Sample records for p53 response elements

  1. Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

    PubMed Central

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

    2014-01-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

  2. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    PubMed

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. p53 genes function to restrain mobile elements

    PubMed Central

    Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  4. A Polymorphic p53 Response Element in KIT Ligand Influences Cancer Risk and Has Undergone Natural Selection

    PubMed Central

    Zeron-Medina, Jorge; Wang, Xuting; Repapi, Emmanouela; Campbell, Michelle R.; Su, Dan; Castro-Giner, Francesc; Davies, Benjamin; Peterse, Elisabeth F.P.; Sacilotto, Natalia; Walker, Graeme J.; Terzian, Tamara; Tomlinson, Ian P.; Box, Neil F.; Meinshausen, Nicolai; De Val, Sarah; Bell, Douglas A.; Bond, Gareth L.

    2014-01-01

    SUMMARY The ability of p53 to regulate transcription is crucial for tumor suppression and implies that inherited polymorphisms in functional p53-binding sites could influence cancer. Here, we identify a polymorphic p53 responsive element and demonstrate its influence on cancer risk using genome-wide data sets of cancer susceptibility loci, genetic variation, p53 occupancy, and p53-binding sites. We uncover a single-nucleotide polymorphism (SNP) in a functional p53-binding site and establish its influence on the ability of p53 to bind to and regulate transcription of the KITLG gene. The SNP resides in KITLG and associates with one of the largest risks identified among cancer genome-wide association studies. We establish that the SNP has undergone positive selection throughout evolution, signifying a selective benefit, but go on to show that similar SNPs are rare in the genome due to negative selection, indicating that polymorphisms in p53-binding sites are primarily detrimental to humans. PMID:24120139

  5. p53 regulates the mevalonate pathway in human glioblastoma multiforme

    PubMed Central

    Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M

    2015-01-01

    The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958

  6. Zac1, an Sp1-like protein, regulates human p21{sup WAF1/Cip1} gene expression in HeLa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Pei-Yao; Hsieh, Tsai-Yuan; Liu, Shu-Ting

    2011-12-10

    Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21{sup WAF1/Cip1} gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity bymore » interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein-protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21{sup WAF1/Cip1} gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.« less

  7. Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage

    PubMed Central

    Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.

    2009-01-01

    Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133

  8. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    PubMed

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Transcriptional and post-transcriptional regulation of the ionizing radiation response by ATM and p53

    PubMed Central

    Venkata Narayanan, Ishwarya; Paulsen, Michelle T.; Bedi, Karan; Berg, Nathan; Ljungman, Emily A.; Francia, Sofia; Veloso, Artur; Magnuson, Brian; di Fagagna, Fabrizio d’Adda; Wilson, Thomas E.; Ljungman, Mats

    2017-01-01

    In response to ionizing radiation (IR), cells activate a DNA damage response (DDR) pathway to re-program gene expression. Previous studies using total cellular RNA analyses have shown that the stress kinase ATM and the transcription factor p53 are integral components required for induction of IR-induced gene expression. These studies did not distinguish between changes in RNA synthesis and RNA turnover and did not address the role of enhancer elements in DDR-mediated transcriptional regulation. To determine the contribution of synthesis and degradation of RNA and monitor the activity of enhancer elements following exposure to IR, we used the recently developed Bru-seq, BruChase-seq and BruUV-seq techniques. Our results show that ATM and p53 regulate both RNA synthesis and stability as well as enhancer element activity following exposure to IR. Importantly, many genes in the p53-signaling pathway were coordinately up-regulated by both increased synthesis and RNA stability while down-regulated genes were suppressed either by reduced synthesis or stability. Our study is the first of its kind that independently assessed the effects of ionizing radiation on transcription and post-transcriptional regulation in normal human cells. PMID:28256581

  10. Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression.

    PubMed

    Cathcart, Jillian M; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

    2016-09-20

    Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype.

  11. Loss of p53-inducible long non-coding RNA LINC01021 increases chemosensitivity

    PubMed Central

    Kaller, Markus; Götz, Ursula; Hermeking, Heiko

    2017-01-01

    We have previously identified the long non-coding RNA LINC01021 as a direct p53 target (Hünten et al. Mol Cell Proteomics. 2015; 14:2609-2629). Here, we show that LINC01021 is up-regulated in colorectal cancer (CRC) cell lines upon various p53-activating treatments. The LINC01021 promoter and the p53 binding site lie within a MER61C LTR, which originated from insertion of endogenous retrovirus 1 (ERV1) sequences. Deletion of this MER61C element by a CRISPR/Cas9 approach, as well as siRNA-mediated knockdown of LINC01021 RNA significantly enhanced the sensitivity of the CRC cell line HCT116 towards the chemotherapeutic drugs doxorubicin and 5-FU, suggesting that LINC01021 is an integral part of the p53-mediated response to DNA damage. Inactivation of LINC01021 and also its ectopic expression did not affect p53 protein expression and transcriptional activity, implying that LINC01021 does not feedback to p53. Furthermore, in CRC patient samples LINC01021 expression positively correlated with a wild-type p53-associated gene expression signature. LINC01021 expression was increased in primary colorectal tumors and displayed a bimodal distribution that was particularly pronounced in the mesenchymal CMS4 consensus molecular subtype of CRCs. CMS4 tumors with low LINC01021 expression were associated with poor patient survival. Our results suggest that the genomic redistribution of ERV1-derived p53 response elements and generation of novel p53-inducible lncRNA-encoding genes was selected for during primate evolution as integral part of the cellular response to various forms of genotoxic stress. PMID:29262524

  12. The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

    PubMed Central

    Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

    2010-01-01

    Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

  13. Development of an adenoviral vector with robust expression driven by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

    2008-02-05

    Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

  14. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  15. The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

    PubMed Central

    Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

    2013-01-01

    The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

  16. Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression

    PubMed Central

    Cathcart, Jillian M.; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

    2016-01-01

    Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype. PMID:27531896

  17. MicroRNA-125b is a novel negative regulator of p53.

    PubMed

    Le, Minh T N; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F; Lim, Bing

    2009-04-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3' untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with gamma-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response.

  18. MicroRNA-125b is a novel negative regulator of p53

    PubMed Central

    Le, Minh T.N.; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F.; Lim, Bing

    2009-01-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3′ untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with γ-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response. PMID:19293287

  19. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage

    PubMed Central

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-01-01

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments. PMID:23235459

  20. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

    PubMed

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-12-13

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

  1. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  2. The expanding universe of p53 targets.

    PubMed

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  3. p53 in survival, death and metabolic health: a lifeguard with a licence to kill.

    PubMed

    Kruiswijk, Flore; Labuschagne, Christiaan F; Vousden, Karen H

    2015-07-01

    The function of p53 as a tumour suppressor has been attributed to its ability to promote cell death or permanently inhibit cell proliferation. However, in recent years, it has become clear that p53 can also contribute to cell survival. p53 regulates various metabolic pathways, helping to balance glycolysis and oxidative phosphorylation, limiting the production of reactive oxygen species, and contributing to the ability of cells to adapt to and survive mild metabolic stresses. Although these activities may be integrated into the tumour suppressive functions of p53, deregulation of some elements of the p53-induced response might also provide tumours with a survival advantage.

  4. p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

    PubMed

    Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

    2015-03-01

    The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

  5. Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding

    NASA Astrophysics Data System (ADS)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-10-01

    The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

  6. Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

    PubMed

    Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

    2003-12-01

    p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

  7. Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.

    PubMed

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective.

  8. Evolution of p53 Transactivation Specificity through the Lens of a Yeast-Based Functional Assay

    PubMed Central

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

  9. Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

    PubMed

    Stępiński, Dariusz

    2016-08-01

    Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

  10. Assessment of the DNA damaging potential of environmental chemicals using a quantitative high-throughput screening approach to measure p53 activation.

    PubMed

    Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R

    2017-08-01

    Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  11. Inverted repeat Alu elements in the human lincRNA-p21 adopt a conserved secondary structure that regulates RNA function

    PubMed Central

    Chillón, Isabel; Pyle, Anna M.

    2016-01-01

    LincRNA-p21 is a long intergenic non-coding RNA (lincRNA) involved in the p53-mediated stress response. We sequenced the human lincRNA-p21 (hLincRNA-p21) and found that it has a single exon that includes inverted repeat Alu elements (IRAlus). Sense and antisense Alu elements fold independently of one another into a secondary structure that is conserved in lincRNA-p21 among primates. Moreover, the structures formed by IRAlus are involved in the localization of hLincRNA-p21 in the nucleus, where hLincRNA-p21 colocalizes with paraspeckles. Our results underscore the importance of IRAlus structures for the function of hLincRNA-p21 during the stress response. PMID:27378782

  12. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    PubMed Central

    2010-01-01

    Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557

  13. Transcriptional repression of epithelial cell adhesion molecule (EpCAM) contributes to p53 control of breast cancer invasion

    PubMed Central

    Sankpal, NV; Willman, MW; Fleming, TP; Mayfield, J; Gillanders, WE

    2014-01-01

    p53 is a tumor suppressor gene with well-characterized roles in cell cycle regulation, apoptosis and the maintenance of genome stability. Recent evidence suggests that p53 may also contribute to the regulation of migration and invasion. Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein that is overexpressed in the majority of human epithelial carcinomas, including breast and colorectal carcinomas. We demonstrate by chromatin immunoprecipitation assays that p53 interacts with a candidate p53 binding site within the EpCAM gene. p53-mediated transcriptional repression of EpCAM was confirmed in gain-of-function, and loss-of-function experimental systems. Induction of wildtype p53 was associated with a significant dose-dependent decrease in EpCAM expression; conversely, specific ablation of p53 was associated with a significant increase in EpCAM expression. At the functional level, specific ablation of p53 expression is associated with increased breast cancer invasion, and this effect is abrogated by concomitant specific ablation of EpCAM expression. Taken together, these biochemical and functional data are the first demonstration that (1) wildtype p53 protein binds to a response element within the EpCAM gene and negatively regulates EpCAM expression, and (2) transcriptional repression of EpCAM contributes to p53 control of breast cancer invasion. PMID:19141643

  14. hCLCA2 is a p53-inducible inhibitor of breast cancer cell proliferation

    PubMed Central

    Walia, Vijay; Ding, Ming; Kumar, Sumit; Nie, Daotai; Premkumar, Louis; Elble, Randolph C.

    2009-01-01

    hCLCA2 is frequently downregulated in breast cancer and is a candidate tumor suppressor gene. We show here that the hCLCA2 gene is strongly induced by p53 in response to DNA damage. Adenoviral expression of p53 induces hCLCA2 in a variety of breast cell lines. Further, we find that p53 binds to consensus elements in the hCLCA2 promoter and mutation of these sites abolishes p53-responsiveness and induction by DNA damage. Adenoviral transduction of hCLCA2 into immortalized cells induces p53, CDK inhibitors p21 and p27, and cell cycle arrest by 24 hours, and caspase induction and apoptosis by 40 hours post-infection. Transduction of the malignant tumor cell line BT549 on the other hand does not induce p53, p21, or p27 but instead induces apoptosis directly and more rapidly. Knockout and knockdown studies indicate that growth inhibition and apoptosis are signaled via multiple pathways. Conversely, suppression of hCLCA2 by RNA interference enhances proliferation of MCF10A and reduces sensitivity to doxorubicin. Gene expression profiles indicate that hCLCA2 levels are strongly predictive of tumor cell sensitivity to doxorubicin and other chemotherapeutics. Because certain Cl- channels are proposed to promote apoptosis by reducing intracellular pH, we tested whether, and established that, hCLCA2 enhances Cl- current in breast cancer cells and reduces pH to ∼6.7. These results reveal hCLCA2 as a novel p53-inducible growth inhibitor, explain how its downregulation confers a survival advantage to tumor cells, and suggest both prognostic and therapeutic applications. PMID:19654313

  15. NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

    PubMed

    Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

    2016-07-19

    The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

  16. p73 coordinates with Δ133p53 to promote DNA double-strand break repair.

    PubMed

    Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun

    2018-03-06

    Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.

  17. The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

    PubMed

    Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

    2009-05-01

    Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

  18. Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

    PubMed Central

    Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

    2012-01-01

    During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

  19. The effect of Zhangfei/CREBZF on cell growth, differentiation, apoptosis, migration, and the unfolded protein response in several canine osteosarcoma cell lines.

    PubMed

    Zhang, Rui; Thamm, Douglas H; Misra, Vikram

    2015-02-07

    We had previously shown that the bLZip domain-containing transcription factor, Zhangfei/CREBZF inhibits the growth and the unfolded protein response (UPR) in cells of the D-17 canine osteosarcoma (OS) line and that the effects of Zhangfei are mediated by it stabilizing the tumour suppressor protein p53. To determine if our observations with D-17 cells applied more universally to canine OS, we examined three other independently isolated canine OS cell lines--Abrams, McKinley and Gracie. Like D-17, the three cell lines expressed p53 proteins that were capable of activating promoters with p53 response elements on their own, and synergistically with Zhangfei. Furthermore, as with D-17 cells, Zhangfei suppressed the growth and UPR-related transcripts in the OS cell lines. Zhangfei also induced the activation of osteocalcin expression, a marker of osteoblast differentiation and triggered programmed cell death. Osteosarcomas are common malignancies in large breeds of dogs. Although there has been dramatic progress in their treatment, these therapies often fail, leading to recurrence of the tumour and metastatic spread. Our results indicate that induction of the expression of Zhangfei in OS, where p53 is functional, may be an effective modality for the treatment of OS.

  20. Structure and Kinetic Stability of the p63 Tetramerization Domain

    PubMed Central

    Natan, Eviatar; Joerger, Andreas C.

    2012-01-01

    The p53 family of transcription factors—comprising p53, p63 and p73—plays an important role in tumor prevention and development. Essential to their function is the formation of tetramers, allowing cooperative binding to their DNA response elements. We solved crystal structures of the human p63 tetramerization domain, showing that p63 forms a dimer of dimers with D2 symmetry composed of highly intertwined monomers. The primary dimers are formed via an intramolecular β-sheet and hydrophobic helix packing (H1), a hallmark of all p53 family members. Like p73, but unlike p53, p63 requires a second helix (H2) to stabilize the architecture of the tetramer. In order to investigate the impact of structural differences on tetramer stability, we measured the subunit exchange reaction of p53 family homotetramers by nanoflow electrospray mass spectrometry. There were differences in both the kinetics and the pattern of the exchange reaction, with the p53 and p63 tetramers exhibiting much faster exchange kinetics than p73. The structural similarity between p63 and p73 rationalizes previous observations that p63 and p73 form mixed tetramers, and the kinetic data reveal the dissociation of the p73 homotetramers as the rate-limiting step for heterotetramer formation. Differential stability of the tetramers may play an important role in the cross talk between different isoforms and regulation of p53, p63 and p73 function in the cell cycle. PMID:22100306

  1. ΔN-P63α and TA-P63α exhibit intrinsic differences in transactivation specificities that depend on distinct features of DNA target sites

    PubMed Central

    Foggetti, Giorgia; Raimondi, Ivan; Campomenosi, Paola; Menichini, Paola

    2014-01-01

    TP63 is a member of the TP53 gene family that encodes for up to ten different TA and ΔN isoforms through alternative promoter usage and alternative splicing. Besides being a master regulator of gene expression for squamous epithelial proliferation, differentiation and maintenance, P63, through differential expression of its isoforms, plays important roles in tumorigenesis. All P63 isoforms share an immunoglobulin-like folded DNA binding domain responsible for binding to sequence-specific response elements (REs), whose overall consensus sequence is similar to that of the canonical p53 RE. Using a defined assay in yeast, where P63 isoforms and RE sequences are the only variables, and gene expression assays in human cell lines, we demonstrated that human TA- and ΔN-P63α proteins exhibited differences in transactivation specificity not observed with the corresponding P73 or P53 protein isoforms. These differences 1) were dependent on specific features of the RE sequence, 2) could be related to intrinsic differences in their oligomeric state and cooperative DNA binding, and 3) appeared to be conserved in evolution. Since genotoxic stress can change relative ratio of TA- and ΔN-P63α protein levels, the different transactivation specificity of each P63 isoform could potentially influence cellular responses to specific stresses. PMID:24926492

  2. A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

    PubMed

    Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

    2002-08-22

    A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

  3. Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

    PubMed Central

    Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

    1998-01-01

    Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

  4. MicroRNA-145 is regulated by DNA methylation and p53 gene mutation in prostate cancer

    PubMed Central

    Suh, Seong O.; Chen, Yi; Zaman, Mohd Saif; Hirata, Hiroshi; Yamamura, Soichiro; Shahryari, Varahram; Liu, Jan; Tabatabai, Z.Laura; Kakar, Sanjay; Deng, Guoren; Tanaka, Yuichiro; Dahiya, Rajvir

    2011-01-01

    MiR-145 is downregulated in various cancers including prostate cancer. However, the underlying mechanisms of miR-145 downregulation are not fully understood. Here, we reported that miR-145 was silenced through DNA hypermethylation and p53 mutation status in laser capture microdissected (LCM) prostate cancer and matched adjacent normal tissues. In 22 of 27 (81%) prostate tissues, miR-145 was significantly downregulated in the cancer compared with the normal tissues. Further studies on miR-145 downregulation mechanism showed that miR-145 is methylated at the promoter region in both prostate cancer tissues and 50 different types of cancer cell lines. In seven cancer cell lines with miR-145 hypermethylation, 5-aza-2′-deoxycytidine treatment dramatically induced miR-145 expression. Interestingly, we also found a significant correlation between miR-145 expression and the status of p53 gene in both LCM prostate tissues and 47 cancer cell lines. In 29 cell lines with mutant p53, miR-145 levels were downregulated in 28 lines (97%), whereas in 18 cell lines with wild-type p53 (WT p53), miR-145 levels were downregulated in only 6 lines (33%, P < 0.001). Electrophoretic mobility shift assay showed that p53 binds to the p53 response element upstream of miR-145, but the binding was inhibited by hypermethylation. To further confirm that p53 binding to miR-145 could regulate miR-145 expression, we transfected WT p53 and MUT p53 into PC-3 cells and found that miR-145 is upregulated by WT p53 but not with MUTp53. The apoptotic cells are increased after WT p53 transfection. In summary, this is the first report documenting that downregulation of miR-145 is through DNA methylation and p53 mutation pathways in prostate cancer. PMID:21349819

  5. Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

    PubMed Central

    Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

    2015-01-01

    ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792

  6. Structure and kinetic stability of the p63 tetramerization domain.

    PubMed

    Natan, Eviatar; Joerger, Andreas C

    2012-01-20

    The p53 family of transcription factors--comprising p53, p63 and p73--plays an important role in tumor prevention and development. Essential to their function is the formation of tetramers, allowing cooperative binding to their DNA response elements. We solved crystal structures of the human p63 tetramerization domain, showing that p63 forms a dimer of dimers with D₂ symmetry composed of highly intertwined monomers. The primary dimers are formed via an intramolecular β-sheet and hydrophobic helix packing (H1), a hallmark of all p53 family members. Like p73, but unlike p53, p63 requires a second helix (H2) to stabilize the architecture of the tetramer. In order to investigate the impact of structural differences on tetramer stability, we measured the subunit exchange reaction of p53 family homotetramers by nanoflow electrospray mass spectrometry. There were differences in both the kinetics and the pattern of the exchange reaction, with the p53 and p63 tetramers exhibiting much faster exchange kinetics than p73. The structural similarity between p63 and p73 rationalizes previous observations that p63 and p73 form mixed tetramers, and the kinetic data reveal the dissociation of the p73 homotetramers as the rate-limiting step for heterotetramer formation. Differential stability of the tetramers may play an important role in the cross talk between different isoforms and regulation of p53, p63 and p73 function in the cell cycle. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. The Human ARF Cell Cycle Regulatory Gene Promoter Is a CpG Island Which Can Be Silenced by DNA Methylation and Down-Regulated by Wild-Type p53

    PubMed Central

    Robertson, Keith D.; Jones, Peter A.

    1998-01-01

    The INK4a/ARF locus encodes two proteins involved in tumor suppression in a manner virtually unique in mammalian cells. Distinct first exons, driven from separate promoters, splice onto a common exon 2 and 3 but utilize different reading frames to produce two completely distinct proteins, both of which play roles in cell cycle control. INK4a, a critical element of the retinoblastoma gene pathway, binds to and inhibits the activities of CDK4 and CDK6, while ARF, a critical element of the p53 pathway, increases the level of functional p53 via interaction with MDM2. Here we clone and characterize the promoter of the human ARF gene and show that it is a CpG island characteristic of a housekeeping gene which contains numerous Sp1 sites. Both ARF and INK4a are coordinately expressed in cells except when their promoter regions become de novo methylated. In one of these situations, ARF transcription could be reactivated by treatment with the DNA methylation inhibitor 5-aza-2′-deoxycytidine, and the reactivation kinetics of ARF and INK4a were found to differ slightly in a cell line in which both genes were silenced by methylation. The ARF promoter was also found to be highly responsive to E2F1 expression, in keeping with previous results at the RNA level. Lastly, transcription from the ARF promoter was down-regulated by wild-type p53 expression, and the magnitude of the effect correlated with the status of the endogenous p53 gene. This finding points to the existence of an autoregulatory feedback loop between p53, MDM2, and ARF, aimed at keeping p53 levels in check. PMID:9774662

  8. Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mohareer, Krishnaveni; Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046; Sahdev, Sudhir

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors,more » which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.« less

  9. Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

    DOE PAGES

    Botcheva, Krassimira; McCorkle, Sean R.

    2014-11-21

    The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less

  10. Down-regulation of MutS homolog 3 by hypoxia in human colorectal cancer

    PubMed Central

    Li, Jie; Koike, Junichi; Kugoh, Hiroyuki; Arita, Michitsune; Ohhira, Takahito; Kikuchi, Yoshinori; Funahashi, Kimihiko; Takamatsu, Ken; Boland, C. Richard; Koi, Minoru; Hemmi, Hiromichi

    2013-01-01

    Down-regulation of hMSH3 is associated with elevated microsatellite alterations at selected tetranucleotide repeats and low levels of microsatellite instability in colorectal cancer (CRC). However, the mechanism that down-regulates hMSH3 in CRC is not known. In this study, a significant association between over-expression of glucose transporter 1, a marker for hypoxia, and down-regulation of hMSH3 in CRC tissues was observed. Therefore, we examined the effect of hypoxia on the expression of hMSH3 in human cell lines. When cells with wild type p53 (wt-p53) were exposed to hypoxia, rapid down-regulation of both hMSH2 and hMSH3 occurred. In contrast, when null or mutated p53 (null/mut-p53) cells were exposed to hypoxia, only hMSH3 was down-regulated, and at slower rate than wt-p53 cells. Using a reporter assay, we found that disruption of the two putative hypoxia response elements (HREs) located within the promoter region of the hMSH3 abrogated the suppressive effect of hypoxia on reporter activity regardless of p53 status. In an EMSA, two different forms of HIF-1α complexes that specifically bind to these HREs were detected. A larger complex containing HIF-1α predominantly bound to the HREs in hypoxic null/mut-p53 cells whereas a smaller complex predominated in wt-p53 cells. Finally, HIF-1α knockdown by siRNA significantly inhibited down-regulation of hMSH3 by hypoxia in both wt-p53 and mut-p53 cells. Taken together, our results suggest that the binding of HIF-1α complexes to HRE sites is necessary for down-regulation of hMSH3 in both wt-p53 and mut-p53 cells. PMID:22343000

  11. Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

    PubMed

    Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

    2018-05-05

    The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Proto-oncogene FBI-1 represses transcription of p21CIP1 by inhibition of transcription activation by p53 and Sp1.

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

    2009-05-08

    Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1-3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target.

  13. Proto-oncogene FBI-1 Represses Transcription of p21CIP1 by Inhibition of Transcription Activation by p53 and Sp1*S⃞

    PubMed Central

    Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

    2009-01-01

    Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1–3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target. PMID:19244234

  14. p53 as the focus of gene therapy: past, present and future.

    PubMed

    Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani

    2018-01-15

    Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  15. Transcriptional analysis of immune-related gene expression in p53-deficient mice with increased susceptibility to influenza A virus infection.

    PubMed

    Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong

    2015-08-18

    p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected in IAV-infected p53KO mice during early IAV infection, reflecting an aberrant inflammatory response. Lack of p53 resulted in the impaired expression of genes involved in IFN signaling and the dysregulated expression of cytokine and chemokine genes in IAV-infected mice, suggesting an essential role of p53 in the regulation of antiviral and inflammatory responses during IAV infection.

  16. UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation

    PubMed Central

    Du, Cheng; Wu, Hong; Leng, Roger P.

    2016-01-01

    Phosphorylation of p53 is a key mechanism responsible for the activation of its tumor suppressor functions in response to various stresses. In unstressed cells, p53 is rapidly turned over and is maintained at a low basal level. After DNA damage or other forms of cellular stress, the p53 level increases, and the protein becomes metabolically stable. However, the mechanism of phosphorylated p53 regulation is unclear. In this study, we studied the kinetics of UBE4B, Hdm2, Pirh2, Cop1 and CHIP induction in response to p53 activation. We show that UBE4B coimmunoprecipitates with phosphorylated p53 at serines 15 and 392. Notably, the affinity between UBE4B and Hdm2 is greatly decreased after DNA damage. Furthermore, we observe that UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to IR. We demonstrate that UBE4B and Hdm2 repress p53S15A, p53S392A, and p53-2A(S15A, S392A) functions, including p53-dependent transactivation and growth inhibition. Overall, our results reveal that UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. PMID:26673821

  17. Split T Cell Tolerance against a Self/Tumor Antigen: Spontaneous CD4+ but Not CD8+ T Cell Responses against p53 in Cancer Patients and Healthy Donors

    PubMed Central

    Tsuji, Takemasa; Matsuzaki, Junko; Ritter, Erika; Miliotto, Anthony; Ritter, Gerd; Odunsi, Kunle; Old, Lloyd J.; Gnjatic, Sacha

    2011-01-01

    Analyses of NY-ESO-1-specific spontaneous immune responses in cancer patients revealed that antibody and both CD4+ and CD8+ T cell responses were induced together in cancer patients. To explore whether such integrated immune responses are also spontaneously induced for other tumor antigens, we have evaluated antibody and T cell responses against self/tumor antigen p53 in ovarian cancer patients and healthy individuals. We found that 21% (64/298) of ovarian cancer patients but no healthy donors showed specific IgG responses against wild-type p53 protein. While none of 12 patients with high titer p53 antibody showed spontaneous p53-specific CD8+ T cell responses following a single in vitro sensitization, significant p53-specific IFN-γ producing CD4+ T cells were detected in 6 patients. Surprisingly, similar levels of p53-specific CD4+ T cells but not CD8+ T cells were also detected in 5/10 seronegative cancer patients and 9/12 healthy donors. Importantly, p53-specific CD4+ T cells in healthy donors originated from a CD45RA− antigen-experienced T cell population and recognized naturally processed wild-type p53 protein. These results raise the possibility that p53-specific CD4+ T cells reflect abnormalities in p53 occurring in normal individuals and that they may play a role in processes of immunosurveillance or immunoregulation of p53-related neoplastic events. PMID:21858191

  18. Induction of MDM2-P2 Transcripts Correlates with Stabilized Wild-Type p53 in Betel- and Tobacco-Related Human Oral Cancer

    PubMed Central

    Ralhan, Ranju; Sandhya, Agarwal; Meera, Mathur; Bohdan, Wasylyk; Nootan, Shukla K.

    2000-01-01

    MDM2, a critical element of cellular homeostasis mechanisms, is involved in complex interactions with important cell-cycle and stress-response regulators including p53. The mdm2-P2 promoter is a transcriptional target of p53. The aim of this study was to determine the association between mdm2-P2 transcripts and the status of the p53 gene in betel- and tobacco-related oral squamous cell carcinomas (SCCs) to understand the mechanism of deregulation of MDM2 and p53 expression and their prognostic implications in oral tumorigenesis. Elevated levels of MDM2 proteins were observed in 11 of 25 (44%) oral hyperplastic lesions, nine of 15 (60%) dysplastic lesions, and 71 of 100 (71%) SCCs. The intriguing feature of the study was the identification and different subcellular localization of three isoforms of MDM2 (ie, 90 kd, 76 kd, and 57 kd) in oral SCCs and their correlation with p53 overexpression in each tumor. The hallmark of the study was the detection of mdm2-P2 transcripts in 12 of 20 oral SCCs overexpressing both MDM2 and p53 proteins while harboring wild-type p53 alleles. Furthermore, mdm2 amplification was an infrequent event in betel- and tobacco-associated oral tumorigenesis. The differential compartmentalization of the three isoforms of MDM2 suggests that each has a distinct function, potentially in the regulation of p53 and other gene products implicated in oral tumorigenesis. In conclusion, we report herein the first evidence suggesting that enhanced translation of mdm2-P2 transcripts (S-mdm2) may represent an important mechanism of overexpression and consequent stabilization and functional inactivation of wild-type p53 serving as an adverse prognosticator in betel- and tobacco-related oral cancer. The clinical significance of the functional inactivation of wild-type p53 by MDM2 is underscored by the significantly shorter median disease-free survival time (16 months) observed in p53/MDM2-positive cases as compared to those which did not show co-expression of these proteins (median time, 26 months; P = 0.02). PMID:10934161

  19. Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santhanam, U.; Ray, A.; Sehgal, P.B.

    1991-09-01

    The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less

  20. Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response

    PubMed Central

    Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

    2014-01-01

    In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

  1. Long-term clinical and immunological effects of p53-SLP® vaccine in patients with ovarian cancer.

    PubMed

    Leffers, Ninke; Vermeij, Renee; Hoogeboom, Baukje-Nynke; Schulze, Ute R; Wolf, Rinze; Hamming, Ineke E; van der Zee, Ate G; Melief, Kees J; van der Burg, Sjoerd H; Daemen, Toos; Nijman, Hans W

    2012-01-01

    Vaccine-induced p53-specific immune responses were previously reported to be associated with improved response to secondary chemotherapy in patients with small cell lung cancer. We investigated long-term clinical and immunological effects of the p53-synthetic long peptide (p53-SLP®) vaccine in patients with recurrent ovarian cancer. Twenty patients were immunized with the p53-SLP® vaccine between July 2006 and August 2007. Follow-up information on patients was obtained. Clinical responses to secondary chemotherapy after p53-SLP® immunizations were determined by computerized tomography and/or tumor marker levels (CA125). Disease-specific survival was compared to a matched historical control group. Immune responses were analyzed by flow cytometry, proliferation assay, interferon gamma (IFN-γ) ELISPOT and/or cytokine bead array. Lymphocytes cultured from skin biopsy were analyzed by flow cytometry and proliferation assay. Of 20 patients treated with the p53-SLP® vaccine, 17 were subsequently treated with chemotherapy. Eight of these patients volunteered another blood sample. No differences in clinical response rates to secondary chemotherapy or disease-specific survival were observed between immunized patients and historical controls (p = 0.925, resp. p = 0.601). p53-specific proliferative responses were observed in 5/8 patients and IFN-γ production in 2/7 patients. Lymphocytes cultured from a prior injection site showing inflammation during chemotherapy did not recognize p53-SLP®. Thus, treatment with the p53-SLP® vaccine does not affect responses to secondary chemotherapy or survival, although p53-specific T-cells do survive chemotherapy. Copyright © 2011 UICC.

  2. Nutlin-3 induces HO-1 expression by activating JNK in a transcription-independent manner of p53.

    PubMed

    Choe, Yun-Jeong; Lee, Sun-Young; Ko, Kyung Won; Shin, Seok Joon; Kim, Ho-Shik

    2014-03-01

    A recent study reported that p53 can induce HO-1 by directly binding to the putative p53 responsive element in the HO-1 promoter. In this study, we report that nutlin-3, a small molecule antagonist of HDM2, induces the transcription of HO-1 in a transcription-independent manner of p53. Nutlin-3 induced HO-1 expression at the level of transcription in human cancer cells such as U2OS and RKO cells. This induction of HO-1 did not occur in SAOS cells in which p53 was mutated and was prevented by knocking down the p53 protein using p53 siRNA transfection, but not by PFT-α, an inhibitor of the transcriptional activity of p53. Accompanying HO-1 expression, nutlin-3 stimulated the accumulation of ROS and the phosphorylation of MAPKs such as JNK, p38 MAPK and ERK1/2. Nutlin-3-induced HO-1 expression was suppressed by TEMPO, a ROS scavenger, and chemical inhibitors of JNK and p38 MAPK but not ERK1/2. In addition, nutlin‑3-induced phosphorylation of JNK but not p38 MAPK was inhibited by TEMPO. Notably, the levels of nutlin-3-induced ROS were correlated with the mitochondrial translocation of p53 and this induction was prevented by PFT-μ, an inhibitor of the mitochondrial translocation of p53. Consistent with the effect of the ROS scavenger and MAPK inhibitors, PFT-μ reduced HO-1 expression and the phosphorylation of JNK induced by nutlin-3. In the experiments of analyzing cell death, the knockdown of HO-1 augmented nutlin-3-induced apoptosis. Collectively, these results suggest that nutlin-3 induces HO-1 expression via the activation of both JNK which is dependent on ROS generated by p53 translocated to the mitochondria and p38 MAPK which appears to be stimulated by a ROS-independent mechanism, and this HO-1 induction may inhibit nutlin-3-induced apoptosis, constituting a negative feedback loop of p53-induced apoptosis.

  3. Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

    PubMed

    Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

    2005-01-20

    Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

  4. Thymidilate synthase and p53 primary tumour expression as predictive factors for advanced colorectal cancer patients.

    PubMed

    Paradiso, A; Simone, G; Petroni, S; Leone, B; Vallejo, C; Lacava, J; Romero, A; Machiavelli, M; De Lena, M; Allegra, C J; Johnston, P G

    2000-02-01

    The purpose of this work was to analyse the ability of p53 and thymidilate synthase (TS) primary tumour expression to retrospectively predict clinical response to chemotherapy and long-term prognosis in patients with advanced colorectal cancers homogeneously treated by methotrexate (MTX)-modulated-5-fluorouracil (5-FU-FA). A total of 108 advanced colorectal cancer patients entered the present retrospective study. Immunohistochemical p53 (pAb 1801 mAb) and TS (TS106 mAb) expression on formalin-fixed paraffin-embedded primary tumour specimens was related to probability of clinical response to chemotherapy, time to progression and overall survival. p53 was expressed in 53/108 (49%) tumours, while 54/108 (50%) showed TS immunostaining. No relationship was demonstrated between p53 positivity and clinical response to chemotherapy (objective response (OR): 20% vs 23%, in p53+ and p53- cases respectively) or overall survival. Percent of OR was significantly higher in TS-negative with respect to TS-positive tumours (30% vs 15% respectively; P < 0.04); simultaneous analysis of TS and p53 indicated 7% OR for p53-positive/TS-positive tumours vs 46% for p53-positive/TS-negative tumours (P < 0.03). Logistic regression analysis confirmed a significant association between TS tumour status and clinical response to chemotherapy (hazard ratio (HR): 2.91; 95% confidence interval (CI) 8.34-1.01; two-sided P < 0.05). A multivariate analysis of overall survival showed that only a small number of metastatic sites was statistically relevant (HR 1.89; 95% CI 2.85-1.26; two-sided P < 0.03). Our study suggests that immunohistochemical expression of p53 and TS could assist the clinician in predicting response of colorectal cancer patients to modulated MTX-5-FU therapy.

  5. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

    PubMed

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-12-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

  6. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

    PubMed Central

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-01-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

  7. p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

    PubMed

    Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

    2007-10-01

    Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

  8. p53 as an Effector or Inhibitor of Therapy Response

    PubMed Central

    Ablain, Julien; Poirot, Brigitte; Esnault, Cécile; Lehmann-Che, Jacqueline; de Thé, Hugues

    2016-01-01

    Although integrity of the p53 signaling pathway in a given tumor was expected to be a critical determinant of response to therapies, most clinical studies failed to link p53 status and treatment outcome. Here, we present two opposite situations: one in which p53 is an essential effector of cure by targeted leukemia therapies and another one in advanced breast cancers in which p53 inactivation is required for the clinical efficacy of dose-dense chemotherapy. If p53 promotes or blocks therapy response, therapies must be tailored on its status in individual tumors. PMID:26637438

  9. ROS-dependent activation of JNK converts p53 into an efficient inhibitor of oncogenes leading to robust apoptosis

    PubMed Central

    Shi, Y; Nikulenkov, F; Zawacka-Pankau, J; Li, H; Gabdoulline, R; Xu, J; Eriksson, S; Hedström, E; Issaeva, N; Kel, A; Arnér, E S J; Selivanova, G

    2014-01-01

    Rescue of the p53 tumor suppressor is an attractive cancer therapy approach. However, pharmacologically activated p53 can induce diverse responses ranging from cell death to growth arrest and DNA repair, which limits the efficient application of p53-reactivating drugs in clinic. Elucidation of the molecular mechanisms defining the biological outcome upon p53 activation remains a grand challenge in the p53 field. Here, we report that concurrent pharmacological activation of p53 and inhibition of thioredoxin reductase followed by generation of reactive oxygen species (ROS), result in the synthetic lethality in cancer cells. ROS promote the activation of c-Jun N-terminal kinase (JNK) and DNA damage response, which establishes a positive feedback loop with p53. This converts the p53-induced growth arrest/senescence to apoptosis. We identified several survival oncogenes inhibited by p53 in JNK-dependent manner, including Mcl1, PI3K, eIF4E, as well as p53 inhibitors Wip1 and MdmX. Further, we show that Wip1 is one of the crucial executors downstream of JNK whose ablation confers the enhanced and sustained p53 transcriptional response contributing to cell death. Our study provides novel insights for manipulating p53 response in a controlled way. Further, our results may enable new pharmacological strategy to exploit abnormally high ROS level, often linked with higher aggressiveness in cancer, to selectively kill cancer cells upon pharmacological reactivation of p53. PMID:24413150

  10. Addition of interferon-α to the p53-SLP® vaccine results in increased production of interferon-γ in vaccinated colorectal cancer patients: a phase I/II clinical trial.

    PubMed

    Zeestraten, Eliane C M; Speetjens, Frank M; Welters, Marij J P; Saadatmand, Sepideh; Stynenbosch, Linda F M; Jongen, Rogier; Kapiteijn, Ellen; Gelderblom, Hans; Nijman, Hans W; Valentijn, A Rob P M; Oostendorp, Jaap; Fathers, Lorraine M; Drijfhout, Jan W; van de Velde, Cornelis J H; Kuppen, Peter J K; van der Burg, Sjoerd H; Melief, Cornelis J M

    2013-04-01

    We previously established safety and immunogenicity of a p53 synthetic long peptides (p53-SLP®) vaccine. In the current trial, we investigated whether combination of interferon-alpha (IFN-α) with p53-SLP® is both safe and able to improve the induced p53-specific IFN-γ response. Eleven colorectal cancer patients successfully treated for metastatic disease were enrolled in this study. Of these, nine patients completed follow-up after two injections with p53-SLP® together with IFN-α. Safety and p53-specific immune responses were determined before and after vaccination. Furthermore, cryopreserved PBMCs were compared head-to-head to cryopreserved PBMCs obtained in our previous trial with p53-SLP® only. Toxicity of p53-SLP® vaccination in combination with IFN-α was limited to Grade 1 or 2, with predominantly small ongoing swellings at the vaccination site. All patients harbored p53-specific T cells after vaccination and most patients showed p53-specific antibodies. Compared to the previous trial, addition of IFN-α significantly improved the frequency of p53-specific T cells in IFN-γ ELISPOT. Moreover, in this trial, p53-specific T cells were detectable in blood samples of all patients in a direct ex vivo multiparameter flowcytometric assay, opposed to only 2 of 10 patients vaccinated with p53-SLP® only. Finally, patients in this trial displayed a broader p53-specific immunoglobulin-G response, indicating an overall better p53-specific T-helper response. Our study shows that p53-SLP® vaccination combined with IFN-α injection is safe and capable of inducing p53-specific immunity. When compared to a similar trial with p53-SLP® vaccination alone the combination was found to induce significantly more IFN-γ producing p53-specific T cells. Copyright © 2012 UICC.

  11. HIPK2 modulates p53 activity towards pro-apoptotic transcription.

    PubMed

    Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella

    2009-10-14

    Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co-recruitment of p300 and p53Lys382 on apoptotic promoters and on the other hand by inhibiting Sirt1 deacetylase activity. We attempted to reactivate p53 apoptotic transcriptional activity by rescuing both Ser46 and Lys382 modification in response to drug. Our data propose combination strategies for the treatment of tumors with dysfunctional p53 and/or HIPK2 that include classical chemotherapy with pharmacological or natural agents such as Sirt1-deacetylase inhibitors or zinc, respectively.

  12. Paradoxical effects of injection stress and nicotine exposure experienced during adolescence on learning in a serial multiple choice (SMC) task in adult female rats.

    PubMed

    Renaud, Samantha M; Pickens, Laura R G; Fountain, Stephen B

    2015-01-01

    Nicotine exposure in adolescent rats has been shown to cause learning impairments that persist into adulthood long after nicotine exposure has ended. This study was designed to assess the extent to which the effects of adolescent nicotine exposure on learning in adulthood can be accounted for by adolescent injection stress experienced concurrently with adolescent nicotine exposure. Female rats received either 0.033 mg/h nicotine (expressed as the weight of the free base) or bacteriostatic water vehicle by osmotic pump infusion on postnatal days 25-53 (P25-53). Half of the nicotine-exposed rats and half of the vehicle rats also received twice-daily injection stress consisting of intraperitoneal saline injections on P26-53. Together these procedures produced 4 groups: No Nicotine/No Stress, Nicotine/No Stress, No Nicotine/Stress, and Nicotine/Stress. On P65-99, rats were trained to perform a structurally complex 24-element serial pattern of responses in the serial multiple choice (SMC) task. Four general results were obtained in the current study. First, learning for within-chunk elements was not affected by either adolescent nicotine exposure, consistent with past work (Pickens, Rowan, Bevins, and Fountain, 2013), or adolescent injection stress. Thus, there were no effects of adolescent nicotine exposure or injection stress on adult within-chunk learning typically attributed to rule learning in the SMC task. Second, adolescent injection stress alone (i.e., without concurrent nicotine exposure) caused transient but significant facilitation of adult learning restricted to a single element of the 24-element pattern, namely, the "violation element," that was the only element of the pattern that was inconsistent with pattern structure. Thus, adolescent injection stress alone facilitated violation element acquisition in adulthood. Third, also consistent with past work (Pickens et al., 2013), adolescent nicotine exposure, in this case both with and without adolescent injection stress, caused a learning impairment in adulthood for the violation element in female rats. Thus, adolescent nicotine impaired adult violation element learning typically attributed to multiple-item learning in the SMC task. Fourth, a paradoxical interaction of injection stress and nicotine exposure in acquisition was observed. In the same female rats in which violation-element learning was impaired by adolescent nicotine exposure, adolescent nicotine experienced without adolescent injection stress produced better learning for chunk-boundary elements in adulthood compared to all other conditions. Thus, adolescent nicotine without concurrent injection stress facilitated adult chunk-boundary element learning typically attributed to concurrent stimulus-response discrimination learning and serial-position learning in the SMC task. To the best of our knowledge, the current study is the first to demonstrate facilitation of adult learning caused by adolescent nicotine exposure. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Paradoxical Effects of Injection Stress and Nicotine Exposure Experienced During Adolescence on Learning in a Serial Multiple Choice (SMC) Task in Adult Female Rats

    PubMed Central

    Renaud, Samantha M.; Pickens, Laura R. G.; Fountain, Stephen B.

    2015-01-01

    Nicotine exposure in adolescent rats has been shown to cause learning impairments that persist into adulthood long after nicotine exposure has ended. This study was designed to assess the extent to which the effects of adolescent nicotine exposure on learning in adulthood can be accounted for by adolescent injection stress experienced concurrently with adolescent nicotine exposure. Female rats received either 0.033 mg/hr nicotine (expressed as the weight of the free base) or bacteriostatic water vehicle by osmotic pump infusion on postnatal days 25-53 (P25-53). Half of the nicotine-exposed rats and half of the vehicle rats also received twice-daily injection stress consisting of intraperitoneal saline injections on P26-53. Together these procedures produced 4 groups: No Nicotine / No Stress, Nicotine / No Stress, No Nicotine / Stress, and Nicotine / Stress. On P65-99, rats were trained to perform a structurally complex 24-element serial pattern of responses in the serial multiple choice (SMC) task. Four general results were obtained in the current study. First, learning for within-chunk elements was not affected by either adolescent nicotine exposure, consistent with past work (Pickens, Rowan, Bevins, & Fountain, 2013), or adolescent injection stress. Thus, there were no effects of adolescent nicotine exposure or injection stress on adult within-chunk learning typically attributed to rule learning in the SMC task. Second, adolescent injection stress alone (i.e., without concurrent nicotine exposure) caused transient but significant facilitation of adult learning restricted to a single element of the 24-element pattern, namely, the “violation element,” that was the only element of the pattern that was inconsistent with pattern structure. Thus, adolescent injection stress alone facilitated violation element acquisition in adulthood. Third, also consistent with past work (Pickens et al., 2013), adolescent nicotine exposure, in this case both with and without adolescent injection stress, caused a learning impairment in adulthood for the violation element in female rats. Thus, adolescent nicotine impaired adult violation element learning typically attributed to multiple-item learning in the SMC task. Fourth, a paradoxical interaction of injection stress and nicotine exposure in acquisition was observed. In the same female rats in which violation-element learning was impaired by adolescent nicotine exposure, adolescent nicotine experienced without adolescent injection stress produced better learning for chunk-boundary elements in adulthood compared to all other conditions. Thus, adolescent nicotine without concurrent injection stress facilitated adult chunk-boundary element learning typically attributed to concurrent stimulus-response discrimination learning and serial-position learning in the SMC task. To the best of our knowledge, the current study is the first to demonstrate facilitation of adult learning caused by adolescent nicotine exposure. PMID:25527003

  14. p53 as an Effector or Inhibitor of Therapy Response.

    PubMed

    Ablain, Julien; Poirot, Brigitte; Esnault, Cécile; Lehmann-Che, Jacqueline; de Thé, Hugues

    2015-12-04

    Although integrity of the p53 signaling pathway in a given tumor was expected to be a critical determinant of response to therapies, most clinical studies failed to link p53 status and treatment outcome. Here, we present two opposite situations: one in which p53 is an essential effector of cure by targeted leukemia therapies and another one in advanced breast cancers in which p53 inactivation is required for the clinical efficacy of dose-dense chemotherapy. If p53 promotes or blocks therapy response, therapies must be tailored on its status in individual tumors. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  15. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    PubMed

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  16. DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

    PubMed Central

    Polato, Federica; Rusconi, Paolo

    2014-01-01

    Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

  17. Thymidilate synthase and p53 primary tumour expression as predictive factors for advanced colorectal cancer patients

    PubMed Central

    Paradiso, A; Simone, G; Petroni, S; Leone, B; Vallejo, C; Lacava, J; Romero, A; Machiavelli, M; Lena, M De; Allegra, C J; Johnston, P G

    2000-01-01

    The purpose of this work was to analyse the ability of p53 and thymidilate synthase (TS) primary tumour expression to retrospectively predict clinical response to chemotherapy and long-term prognosis in patients with advanced colorectal cancers homogeneously treated by methotrexate (MTX)-modulated–5-fluorouracil (5-FU-FA). A total of 108 advanced colorectal cancer patients entered the present retrospective study. Immunohistochemical p53 (pAb 1801 mAb) and TS (TS106 mAb) expression on formalin-fixed paraffin-embedded primary tumour specimens was related to probability of clinical response to chemotherapy, time to progression and overall survival. p53 was expressed in 53/108 (49%) tumours, while 54/108 (50%) showed TS immunostaining. No relationship was demonstrated between p53 positivity and clinical response to chemotherapy (objective response (OR): 20% vs 23%, in p53+ and p53– cases respectively) or overall survival. Percent of OR was significantly higher in TS-negative with respect to TS-positive tumours (30% vs 15% respectively;P< 0.04); simultaneous analysis of TS and p53 indicated 7% OR for p53-positive/TS-positive tumours vs 46% for p53-positive/TS-negative tumours (P< 0.03). Logistic regression analysis confirmed a significant association between TS tumour status and clinical response to chemotherapy (hazard ratio (HR): 2.91; 95% confidence interval (CI) 8.34–1.01; two-sided P< 0.05). A multivariate analysis of overall survival showed that only a small number of metastatic sites was statistically relevant (HR 1.89; 95% CI 2.85–1.26; two-sided P< 0.03). Our study suggests that immunohistochemical expression of p53 and TS could assist the clinician in predicting response of colorectal cancer patients to modulated MTX-5-FU therapy. © 2000 Cancer Research Campaign PMID:10682666

  18. The influence of SV40 immortalization of human fibroblasts on p53-dependent radiation responses

    NASA Technical Reports Server (NTRS)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The simian virus 40 large tumor antigen (SV40 Tag) has been ascribed many functions critical to viral propagation, including binding to the mammalian tumor suppressor p53. Recent studies have demonstrated that SV40-transformed murine cells have functional p53. The status of p53 in SV40-immortalized human cells, however, has not been characterized. We have found that in response to ionizing radiation, p53-dependent p21 transactivation activity is present, albeit reduced, in SV40-immortalized cells and that this activity can be further reduced with either dominant negative p53 expression or higher SV40 Tag expression. Furthermore, overexpression of p53 in SV40-immortalized ataxia-telangiectasia (A-T) cells restores p53-dependent p21 induction to typical A-T levels. All SV40-immortalized cell lines exhibited an absence of G1 arrest. Moreover, all SV40-immortalized cell lines exhibited increased apoptosis relative to primary cells in response to ionizing radiation, suggesting that SV40 immortalization results in a unique phenotype with regard to DNA damage responses. Copyright 1999 Academic Press.

  19. Mapping the Structural and Dynamical Features of Multiple p53 DNA Binding Domains: Insights into Loop 1 Intrinsic Dynamics

    PubMed Central

    Lukman, Suryani; Lane, David P.; Verma, Chandra S.

    2013-01-01

    The transcription factor p53 regulates cellular integrity in response to stress. p53 is mutated in more than half of cancerous cells, with a majority of the mutations localized to the DNA binding domain (DBD). In order to map the structural and dynamical features of the DBD, we carried out multiple copy molecular dynamics simulations (totaling 0.8 μs). Simulations show the loop 1 to be the most dynamic element among the DNA-contacting loops (loops 1-3). Loop 1 occupies two major conformational states: extended and recessed; the former but not the latter displays correlations in atomic fluctuations with those of loop 2 (~24 Å apart). Since loop 1 binds to the major groove whereas loop 2 binds to the minor groove of DNA, our results begin to provide some insight into the possible mechanism underpinning the cooperative nature of DBD binding to DNA. We propose (1) a novel mechanism underlying the dynamics of loop 1 and the possible tread-milling of p53 on DNA and (2) possible mutations on loop 1 residues to restore the transcriptional activity of an oncogenic mutation at a distant site. PMID:24324553

  20. Binding of Amphipathic Cell Penetrating Peptide p28 to Wild Type and Mutated p53 as studied by Raman, Atomic Force and Surface Plasmon Resonance spectroscopies.

    PubMed

    Signorelli, Sara; Santini, Simona; Yamada, Tohru; Bizzarri, Anna Rita; Beattie, Craig W; Cannistraro, Salvatore

    2017-04-01

    Mutations within the DNA binding domain (DBD) of the tumor suppressor p53 are found in >50% of human cancers and may significantly modify p53 secondary structure impairing its function. p28, an amphipathic cell-penetrating peptide, binds to the DBD through hydrophobic interaction and induces a posttranslational increase in wildtype and mutant p53 restoring functionality. We use mutation analyses to explore which elements of secondary structure may be critical to p28 binding. Molecular modeling, Raman spectroscopy, Atomic Force Spectroscopy (AFS) and Surface Plasmon Resonance (SPR) were used to identify which secondary structure of site-directed and naturally occurring mutant DBDs are potentially altered by discrete changes in hydrophobicity and the molecular interaction with p28. We show that specific point mutations that alter hydrophobicity within non-mutable and mutable regions of the p53 DBD alter specific secondary structures. The affinity of p28 was positively correlated with the β-sheet content of a mutant DBD, and reduced by an increase in unstructured or random coil that resulted from a loss in hydrophobicity and redistribution of surface charge. These results help refine our knowledge of how mutations within p53-DBD alter secondary structure and provide insight on how potential structural alterations in p28 or similar molecules improve their ability to restore p53 function. Raman spectroscopy, AFS, SPR and computational modeling are useful approaches to characterize how mutations within the p53DBD potentially affect secondary structure and identify those structural elements prone to influence the binding affinity of agents designed to increase the functionality of p53. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. p53-Mediated Cellular Response to DNA Damage in Cells with Replicative Hepatitis B Virus

    NASA Astrophysics Data System (ADS)

    Puisieux, Alain; Ji, Jingwei; Guillot, Celine; Legros, Yann; Soussi, Thierry; Isselbacher, Kurt; Ozturk, Mehmet

    1995-02-01

    Wild-type p53 acts as a tumor suppressor gene by protecting cells from deleterious effects of genotoxic agents through the induction of a G_1/S arrest or apoptosis as a response to DNA damage. Transforming proteins of several oncogenic DNA viruses inactivate tumor suppressor activity of p53 by blocking this cellular response. To test whether hepatitis B virus displays a similar effect, we studied the p53-mediated cellular response to DNA damage in 2215 hepatoma cells with replicative hepatitis B virus. We demonstrate that hepatitis B virus replication does not interfere with known cellular functions of p53 protein.

  2. mTOR inhibitors blunt the p53 response to nucleolar stress by regulating RPL11 and MDM2 levels

    PubMed Central

    Goudarzi, Kaveh M; Nistér, Monica; Lindström, Mikael S

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a master regulator of cell growth through its ability to stimulate ribosome biogenesis and mRNA translation. In contrast, the p53 tumor suppressor negatively controls cell growth and is activated by a wide range of insults to the cell. The mTOR and p53 signaling pathways are connected by a number of different mechanisms. Chemotherapeutics that inhibit ribosome biogenesis often induce nucleolar stress and activation of p53. Here we have investigated how the p53 response to nucleolar stress is affected by simultaneous mTOR inhibition in osteosarcoma and glioma cell lines. We found that inhibitors of the mTOR pathway including rapamycin, wortmannin, and caffeine blunted the p53 response to nucleolar stress induced by actinomycin D. Synthetic inhibitors of mTOR (temsirolimus, LY294.002 and PP242) also impaired actinomycin D triggered p53 stabilization and induction of p21. Ribosomal protein (RPL11) is known to be required for p53 protein stabilization following nucleolar stress. Treatment of cells with mTOR inhibitors may lead to reduced synthesis of RPL11 and thereby destabilize p53. We found that rapamycin mimicked the effect of RPL11 depletion in terms of blunting the p53 response to nucleolar stress. However, the extent to which the levels of p53 and RPL11 were reduced by rapamycin varied between cell lines. Additional mechanisms whereby rapamycin blunts the p53 response to nucleolar stress are likely to be involved. Indeed, rapamycin increased the levels of endogenous MDM2 despite inhibition of its phosphorylation at Ser-166. Our findings may have implications for the design of combinatorial cancer treatments with mTOR pathway inhibitors. PMID:25482947

  3. MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.

    PubMed

    Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M

    2018-04-17

    The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.

  4. Crosstalk between the IGF-1R/AKT/mTORC1 pathway and the tumor suppressors p53 and p27 determines cisplatin sensitivity and limits the effectiveness of an IGF-1R pathway inhibitor

    PubMed Central

    Davaadelger, Batzaya; Duan, Lei; Perez, Ricardo E.; Gitelis, Steven; Maki, Carl G.

    2016-01-01

    The insulin-like growth factor-1 receptor (IGF-1R) signaling pathway is aberrantly activated in multiple cancers and can promote proliferation and chemotherapy resistance. Multiple IGF-1R inhibitors have been developed as potential therapeutics. However, these inhibitors have failed to increase patient survival when given alone or in combination with chemotherapy agents. The reason(s) for the disappointing clinical effect of these inhibitors is not fully understood. Cisplatin (CP) activated the IGF-1R/AKT/mTORC1 pathway and stabilized p53 in osteosarcoma (OS) cells. p53 knockdown reduced IGF-1R/AKT/mTORC1 activation by CP, and IGF-1R inhibition reduced the accumulation of p53. These data demonstrate positive crosstalk between p53 and the IGF-1R/AKT/mTORC1 pathway in response to CP. Further studies showed the effect of IGF-1R inhibition on CP response is dependent on p53 status. In p53 wild-type cells treated with CP, IGF-1R inhibition increased p53s apoptotic function but reduced p53-dependent senescence, and had no effect on long term survival. In contrast, in p53-null/knockdown cells, IGF-1R inhibition reduced apoptosis in response to CP and increased long term survival. These effects were due to p27 since IGF-1R inhibition stabilized p27 in CP-treated cells, and p27 depletion restored apoptosis and reduced long term survival. Together, the results demonstrate 1) p53 expression determines the effect of IGF-1R inhibition on cancer cell CP response, and 2) crosstalk between the IGF-1R/AKT/mTORC1 pathway and p53 and p27 can reduce cancer cell responsiveness to chemotherapy and may ultimately limit the effectiveness of IGF-1R pathway inhibitors in the clinic. PMID:27050276

  5. Downregulation of VRK1 by p53 in Response to DNA Damage Is Mediated by the Autophagic Pathway

    PubMed Central

    Valbuena, Alberto; Castro-Obregón, Susana; Lazo, Pedro A.

    2011-01-01

    Human VRK1 induces a stabilization and accumulation of p53 by specific phosphorylation in Thr18. This p53 accumulation is reversed by its downregulation mediated by Hdm2, requiring a dephosphorylated p53 and therefore also needs the removal of VRK1 as stabilizer. This process requires export of VRK1 to the cytosol and is inhibited by leptomycin B. We have identified that downregulation of VRK1 protein levels requires DRAM expression, a p53-induced gene. DRAM is located in the endosomal-lysosomal compartment. Induction of DNA damage by UV, IR, etoposide and doxorubicin stabilizes p53 and induces DRAM expression, followed by VRK1 downregulation and a reduction in p53 Thr18 phosphorylation. DRAM expression is induced by wild-type p53, but not by common human p53 mutants, R175H, R248W and R273H. Overexpression of DRAM induces VRK1 downregulation and the opposite effect was observed by its knockdown. LC3 and p62 were also downregulated, like VRK1, in response to UV-induced DNA damage. The implication of the autophagic pathway was confirmed by its requirement for Beclin1. We propose a model with a double regulatory loop in response to DNA damage, the accumulated p53 is removed by induction of Hdm2 and degradation in the proteasome, and the p53-stabilizer VRK1 is eliminated by the induction of DRAM that leads to its lysosomal degradation in the autophagic pathway, and thus permitting p53 degradation by Hdm2. This VRK1 downregulation is necessary to modulate the block in cell cycle progression induced by p53 as part of its DNA damage response. PMID:21386980

  6. Initiation of autoimmunity to the p53 tumor suppressor protein by complexes of p53 and SV40 large T antigen

    PubMed Central

    1994-01-01

    Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have implications for understanding the pathogenesis of ANAs in SLE. In particular, our results imply that autoimmunity can be initiated by a "hit and run" mechanism in which the binding of a viral antigen to a self protein triggers an immune response that subsequently can be perpetuated by self antigen. PMID:8145041

  7. Bifunctional Alkylating Agent-Induced p53 and Nonclassical Nuclear Factor kB Responses and Cell Death are Altered by Caffeic Acid Phenethyl Ester: A Potential Role for Antioxidant/Electrophilic Response-Element Signaling

    DTIC Science & Technology

    2007-01-01

    Methods. To establish the maximal LDH 2,3,7,8-tetrachloro- activity achievable from these cells, untreated control cells were grown dibenzo-p- dioxin to the...to modulated by AhR (Miao et al., 2005). Curcumin has been induce apoptosis. CAPE may be involved in anoikis, that is, shown to compete with dioxin ...the AhR directly binds (Miao et al., 2005). adhesion kinase (Weyant et al., 2000). Also, CAPE-induced Exposure of Hepalclc7 cells to dioxin results in

  8. Crocidolite asbestos causes an induction of p53 and apoptosis in cultured A-549 lung carcinoma cells.

    PubMed

    Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A

    1998-01-01

    A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.

  9. A protein folding molecular imaging biosensor monitors the effects of drugs that restore mutant p53 structure and its downstream function in glioblastoma cells

    PubMed Central

    Paulmurugan, Ramasamy; Afjei, Rayhaneh; Sekar, Thillai V.; Babikir, Husam A.; Massoud, Tarik F.

    2018-01-01

    Misfolding mutations in the DNA-binding domain of p53 alter its conformation, affecting the efficiency with which it binds to chromatin to regulate target gene expression and cell cycle checkpoint functions in many cancers, including glioblastoma. Small molecule drugs that recover misfolded p53 structure and function may improve chemotherapy by activating p53-mediated senescence. We constructed and optimized a split Renilla luciferase (RLUC) complementation molecular biosensor (NRLUC-p53-CRLUC) to determine small molecule-meditated folding changes in p53 protein. After initial evaluation of the biosensor in three different cells lines, we engineered endogenously p53P98L mutant (i.e. not affecting the DNA-binding domain) Ln229 glioblastoma cells, to express the biosensor containing one of four different p53 proteins: p53wt, p53Y220C, p53G245S and p53R282W. We evaluated the consequent phenotypic changes in these four variant cells as well as the parental cells after exposure to PhiKan083 and SCH529074, drugs previously reported to activate mutant p53 folding. Specifically, we measured induced RLUC complementation and consequent therapeutic response. Upon stable transduction with the p53 biosensors, we demonstrated that these originally p53P98L Ln229 cells had acquired p53 cellular phenotypes representative of each p53 protein expressed within the biosensor fusion protein. In these engineered variants we found a differential drug response when treated with doxorubicin and temozolomide, either independently or in combination with PhiKan083 or SCH529074. We thus developed a molecular imaging complementation biosensor that mimics endogenous p53 function for use in future applications to screen novel or repurposed drugs that counter the effects of misfolding mutations responsible for oncogenic structural changes in p53. PMID:29765555

  10. ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53

    PubMed Central

    Sullivan, Kelly D.; Padilla-Just, Nuria; Henry, Ryan E.; Porter, Christopher C.; Kim, Jihye; Tentler, John J.; Eckhardt, S. Gail; Tan, Aik Choon; DeGregori, James; Espinosa, Joaquín M.

    2012-01-01

    The p53 tumor suppressor orchestrates alternative stress responses including cell cycle arrest and apoptosis, but the mechanisms defining cell fate upon p53 activation are poorly understood. Several small molecule activators of p53 have been developed, including Nutlin-3, but their therapeutic potential is limited by the fact that they induce reversible cell cycle arrest in most cancer cell types. We report here the results of a ‘Synthetic Lethal with Nutlin-3’ genome-wide shRNA screen, which revealed that the ATM and MET kinases govern cell fate choice upon p53 activation. Genetic or pharmacological interference with ATM or MET activity converts the cellular response from cell cycle arrest into apoptosis in diverse cancer cell types without affecting expression of key p53 target genes. ATM and MET inhibitors enable Nutlin-3 to kill tumor spheroids. These results identify novel pathways controlling the cellular response to p53 activation and aid in the design of p53-based therapies. PMID:22660439

  11. The tumour suppressor CYLD regulates the p53 DNA damage response

    PubMed Central

    Fernández-Majada, Vanesa; Welz, Patrick-Simon; Ermolaeva, Maria A.; Schell, Michael; Adam, Alexander; Dietlein, Felix; Komander, David; Büttner, Reinhard; Thomas, Roman K.; Schumacher, Björn; Pasparakis, Manolis

    2016-01-01

    The tumour suppressor CYLD is a deubiquitinase previously shown to inhibit NF-κB, MAP kinase and Wnt signalling. However, the tumour suppressing mechanisms of CYLD remain poorly understood. Here we show that loss of CYLD catalytic activity causes impaired DNA damage-induced p53 stabilization and activation in epithelial cells and sensitizes mice to chemical carcinogen-induced intestinal and skin tumorigenesis. Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress. Ubiquitin chain-restriction analysis provides evidence that CYLD removes K48 ubiquitin chains from p53 indirectly by cleaving K63 linkages, suggesting that p53 is decorated with complex K48/K63 chains. Moreover, CYLD deficiency also diminishes CEP-1/p53-dependent DNA damage-induced germ cell apoptosis in the nematode Caenorhabditis elegans. Collectively, our results identify CYLD as a deubiquitinase facilitating DNA damage-induced p53 activation and suggest that regulation of p53 responses to genotoxic stress contributes to the tumour suppressor function of CYLD. PMID:27561390

  12. p53 in breast cancer subtypes and new insights into response to chemotherapy.

    PubMed

    Bertheau, Philippe; Lehmann-Che, Jacqueline; Varna, Mariana; Dumay, Anne; Poirot, Brigitte; Porcher, Raphaël; Turpin, Elisabeth; Plassa, Louis-François; de Roquancourt, Anne; Bourstyn, Edwige; de Cremoux, Patricia; Janin, Anne; Giacchetti, Sylvie; Espié, Marc; de Thé, Hugues

    2013-08-01

    Despite an obvious central role of p53 in the hallmarks of cancer, TP53 status is not yet used for the management of breast cancer. Recent findings may lead to reconsider the role of p53 in breast cancer. TP53 mutations are the most frequent genetic alterations in breast cancer, observed in 30% of breast carcinomas. Their distribution is highly linked to molecular tumor subtypes found in 26% of luminal tumors (17% of luminal A, 41% of luminal B), in 50% of HER2 amplified tumors, in 69% of molecular apocrine breast carcinomas and in 88% of basal-like carcinomas. The type of mutation is linked to the tumor subtype with higher frequency of base-pair substitutions in luminal tumors, whereas molecular apocrine and basal-like tumors present much higher frequency of complex mutations (deletions/insertions). The timing of TP53 mutation also depends on the tumor subtype, being the first important event in luminal tumors but occurring after PTEN loss in basal-like tumors. Regarding response to cytotoxic chemotherapy, the situation is far from the p53-dependent apoptosis paradigm with subsequent clinical response. We reported that TP53 mutated non inflammatory locally advanced breast carcinomas had a high rate of complete pathological response to dose-dense doxorubicin-cyclophosphamide chemotherapy, while TP53 wild-type (WT) tumors never achieved complete response. Using human breast cancer xenograft models, we suggested that this could be due to the induction of senescence in TP53 WT tumor cells. A recent work confirmed these findings in MMTV-Wnt1 mammary tumors, showing that growth arrest and senescent phenotype, not apoptosis, were induced in TP53 WT tumors following doxorubicin treatment, while lack of arrest in mutant tumors resulted in aberrant mitoses, cell death and a superior clinical response. Furthermore, in ER positive (ER(+)) breast tumors, it has been recently reported that ER represses the p53-mediated apoptotic response induced by DNA damage. Taken together, these data can help to better understand p53-mediated response to doxorubicin-based chemotherapy in breast cancer: in ER(+) TP53 WT breast cancers, ER-induced inhibition of p53 apoptotic response would lead preferentially to tumor cell senescence and subsequent resistance to treatment. Conversely, in ER negative (ER(-)) TP53 mutated breast cancers, accumulation of genetic abnormalities would lead to mitotic catastrophe and subsequent better response. In view of these recent results, p53 impact in breast cancer should be reconsidered. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Chk2 mediates RITA-induced apoptosis.

    PubMed

    de Lange, J; Verlaan-de Vries, M; Teunisse, A F A S; Jochemsen, A G

    2012-06-01

    Reactivation of the p53 tumor-suppressor protein by small molecules like Nutlin-3 and RITA (reactivation of p53 and induction of tumor cell apoptosis) is a promising strategy for cancer therapy. The molecular mechanisms involved in the responses to RITA remain enigmatic. Several groups reported the induction of a p53-dependent DNA damage response. Furthermore, the existence of a p53-dependent S-phase checkpoint has been suggested, involving the checkpoint kinase Chk1. We have recently shown synergistic induction of apoptosis by RITA in combination with Nutlin-3, and we observed concomitant Chk2 phosphorylation. Therefore, we investigated whether Chk2 contributes to the cellular responses to RITA. Strikingly, the induction of apoptosis seemed entirely Chk2 dependent. Transcriptional activity of p53 in response to RITA required the presence of Chk2. A partial rescue of apoptosis observed in Noxa knockdown cells emphasized the relevance of p53 transcriptional activity for RITA-induced apoptosis. In addition, we observed an early p53- and Chk2-dependent block of DNA replication upon RITA treatment. Replicating cells seemed more prone to entering RITA-induced apoptosis. Furthermore, the RITA-induced DNA damage response, which was not a secondary effect of apoptosis induction, was strongly attenuated in cells lacking p53 or Chk2. In conclusion, we identified Chk2 as an essential mediator of the cellular responses to RITA.

  14. Chk2 mediates RITA-induced apoptosis

    PubMed Central

    de Lange, J; Verlaan-de Vries, M; Teunisse, A F A S; Jochemsen, A G

    2012-01-01

    Reactivation of the p53 tumor-suppressor protein by small molecules like Nutlin-3 and RITA (reactivation of p53 and induction of tumor cell apoptosis) is a promising strategy for cancer therapy. The molecular mechanisms involved in the responses to RITA remain enigmatic. Several groups reported the induction of a p53-dependent DNA damage response. Furthermore, the existence of a p53-dependent S-phase checkpoint has been suggested, involving the checkpoint kinase Chk1. We have recently shown synergistic induction of apoptosis by RITA in combination with Nutlin-3, and we observed concomitant Chk2 phosphorylation. Therefore, we investigated whether Chk2 contributes to the cellular responses to RITA. Strikingly, the induction of apoptosis seemed entirely Chk2 dependent. Transcriptional activity of p53 in response to RITA required the presence of Chk2. A partial rescue of apoptosis observed in Noxa knockdown cells emphasized the relevance of p53 transcriptional activity for RITA-induced apoptosis. In addition, we observed an early p53- and Chk2-dependent block of DNA replication upon RITA treatment. Replicating cells seemed more prone to entering RITA-induced apoptosis. Furthermore, the RITA-induced DNA damage response, which was not a secondary effect of apoptosis induction, was strongly attenuated in cells lacking p53 or Chk2. In conclusion, we identified Chk2 as an essential mediator of the cellular responses to RITA. PMID:22158418

  15. CDIP, a novel pro-apoptotic gene, regulates TNFalpha-mediated apoptosis in a p53-dependent manner.

    PubMed

    Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

    2007-07-25

    We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-alpha expression tightly correlates with CDIP expression, and that inhibition of TNF-alpha signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-alpha is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-alpha impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 --> CDIP --> TNF-alpha apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy.

  16. Modulation of the poly (ADP-ribose) polymerase inhibitor response and DNA recombination in breast cancer cells by drugs affecting endogenous wild-type p53.

    PubMed

    Ireno, Ivanildce Cristiane; Wiehe, Rahel Stephanie; Stahl, Andreea Iulia; Hampp, Stephanie; Aydin, Sevtap; Troester, Melissa A; Selivanova, Galina; Wiesmüller, Lisa

    2014-10-01

    Synthetic lethal interactions between poly (ADP-ribose) polymerase (PARP) and homologous recombination (HR) repair pathways have been exploited for the development of novel mono- and combination cancer therapies. The tumor suppressor p53 was demonstrated to exhibit indirect and direct regulatory activities in DNA repair, particularly in DNA double-strand break (DSB)-induced and replication-associated HR. In this study, we tested a potential influence of the p53 status on the response to PARP inhibition, which is known to cause replication stress. Silencing endogenous or inducibly expressing p53 we found a protective effect of p53 on PARP inhibitor (PARPi)-mediated cytotoxicities. This effect was specific for wild-type versus mutant p53 and observed in cancer but not in non-transformed cell lines. Enhanced cytotoxicities after treatment with the p53-inhibitory drug Pifithrinα further supported p53-mediated resistance to PARP inhibition. Surprisingly, we equally observed increased PARPi sensitivity in the presence of the p53-activating compound Nutlin-3. As a common denominator, both drug responses correlated with decreased HR activities: Pifithrinα downregulated spontaneous HR resulting in damage accumulation. Nutlin-3 induced a decrease of DSB-induced HR, which was accompanied by a severe drop in RAD51 protein levels. Thus, we revealed a novel link between PARPi responsiveness and p53-controlled HR activities. These data expand the concept of cell and stress type-dependent healer and killer functions of wild-type p53 in response to cancer therapeutic treatment. Our findings have implications for the individualized design of cancer therapies using PARPi and the potentially combined use of p53-modulatory drugs. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. p53-dependent p21-mediated growth arrest pre-empts and protects HCT116 cells from PUMA-mediated apoptosis induced by EGCG

    PubMed Central

    Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L

    2010-01-01

    The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544

  18. TP53 status and response to chemotherapy in breast cancer.

    PubMed

    Bertheau, Philippe; Espié, Marc; Turpin, Elisabeth; Lehmann, Jacqueline; Plassa, Louis-François; Varna, Mariana; Janin, Anne; de Thé, Hugues

    2008-01-01

    Despite its central role in the control of apoptosis, senescence and cell cycle arrest, the tumor suppressor protein p53 remains an enigma for its possible role in predicting response to chemotherapy in cancer patients. Many studies remained inconclusive, others showed a better response for tumors with normal p53, and some recent studies showed adverse effects of normal p53 for response to treatment. p53 is not only a powerful pro-apoptotic factor in response to drug-induced DNA damages but also a potential inducer of cell cycle arrest, protecting tumor cells from further cytotoxic damages. Our review describes the classical as well as the more recent concepts. In order to draw definite conclusions, future works should use more reliable methods to assess the TP53 status and should address more homogeneous tumor subpopulations treated with homogeneous chemotherapy regimens. Copyright 2008 S. Karger AG, Basel.

  19. The Stress-responsive Gene ATF3 Mediates Dichotomous UV Responses by Regulating the Tip60 and p53 Proteins*

    PubMed Central

    Cui, Hongmei; Li, Xingyao; Han, Chunhua; Wang, Qi-En; Wang, Hongbo; Ding, Han-Fei; Zhang, Junran; Yan, Chunhong

    2016-01-01

    The response to UV irradiation is important for a cell to maintain its genetic integrity when challenged by environmental genotoxins. An immediate early response to UV irradiation is the rapid induction of activating transcription factor 3 (ATF3) expression. Although emerging evidence has linked ATF3 to stress pathways regulated by the tumor suppressor p53 and the histone acetyltransferase Tip60, the role of ATF3 in the UV response remains largely unclear. Here, we report that ATF3 mediated dichotomous UV responses. Although UV irradiation enhanced the binding of ATF3 to Tip60, knockdown of ATF3 expression decreased Tip60 stability, thereby impairing Tip60 induction by UV irradiation. In line with the role of Tip60 in mediating UV-induced apoptosis, ATF3 promoted the death of p53-defective cells in response to UV irradiation. However, ATF3 could also activate p53 and promote p53-mediated DNA repair, mainly through altering histone modifications that could facilitate recruitment of DNA repair proteins (such as DDB2) to damaged DNA sites. As a result, ATF3 rather protected the p53 wild-type cells from UV-induced apoptosis. Our results thus indicate that ATF3 regulates cell fates upon UV irradiation in a p53-dependent manner. PMID:26994140

  20. Various stress stimuli rewire the profile of liver secretome in a p53-dependent manner.

    PubMed

    Charni-Natan, Meital; Solomon, Hilla; Molchadsky, Alina; Jacob-Berger, Adi; Goldfinger, Naomi; Rotter, Varda

    2018-05-29

    Liver is an important secretory organ that consistently manages various insults in order to retain whole-body homeostasis. Importantly, it was suggested that the tumor-suppressor p53 plays a role in a variety of liver physiological processes and thus it is being regarded as a systemic homeostasis regulator. Using high-throughput mass spectrometric analysis, we identified various p53-dependent liver secretome profiles. This allowed a global view on the role of p53 in maintaining the harmony of liver and whole-body homeostasis. We found that p53 altered the liver secretome differently under various conditions. Under physiological conditions, p53 controls factors that are related mainly to lipid metabolism and injury response. Upon exposure to various types of cancer therapy agents, the hepatic p53 is activated and induces the secretion of proteins related to additional pathways, such as hemostasis, immune response, and cell adhesion. Interestingly, we identified a possible relationship between p53-dependent liver functions and lung tumors. The latter modify differently liver secretome profile toward the secretion of proteins mainly related to cell migration and immune response. The notion that p53 may rewire the liver secretome profile suggests a new non-cell autonomous role of p53 that affect different liver functions and whole organism homeostasis.

  1. The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

    PubMed

    Hale, T K; Braithwaite, A W

    1999-08-20

    Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

  2. CDIP, a novel pro-apoptotic gene, regulates TNFα-mediated apoptosis in a p53-dependent manner

    PubMed Central

    Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

    2007-01-01

    We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-α expression tightly correlates with CDIP expression, and that inhibition of TNF-α signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-α is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-α impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 → CDIP → TNF-α apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy. PMID:17599062

  3. Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and other stresses

    PubMed Central

    Rubbi, Carlos P.; Milner, Jo

    2003-01-01

    p53 protects against cancer through its capacity to induce cell cycle arrest or apoptosis under a large variety of cellular stresses. It is not known how such diversity of signals can be integrated by a single molecule. However, the literature reveals that a common denominator in all p53-inducing stresses is nucleolar disruption. We thus postulated that the impairment of nucleolar function might stabilize p53 by preventing its degradation. Using micropore irradiation, we demonstrate that large amounts of nuclear DNA damage fail to stabilize p53 unless the nucleolus is also disrupted. Forcing nucleolar disruption by anti-upstream binding factor (UBF) microinjection (in the absence of DNA damage) also causes p53 stabilization. We propose that the nucleolus is a stress sensor responsible for maintenance of low levels of p53, which are automatically elevated as soon as nucleolar function is impaired in response to stress. Our model integrates all known p53-inducing agents and also explains cell cycle-related variations in p53 levels which correlate with established phases of nucleolar assembly/disassembly through the cell cycle. PMID:14609953

  4. Pharmacological activation of a novel p53-dependent S-phase checkpoint involving CHK-1

    PubMed Central

    Ahmed, A; Yang, J; Maya-Mendoza, A; Jackson, D A; Ashcroft, M

    2011-01-01

    We have recently shown that induction of the p53 tumour suppressor protein by the small-molecule RITA (reactivation of p53 and induction of tumour cell apoptosis; 2,5-bis(5-hydroxymethyl-2-thienyl)furan) inhibits hypoxia-inducible factor-1α and vascular endothelial growth factor expression in vivo and induces p53-dependent tumour cell apoptosis in normoxia and hypoxia. Here, we demonstrate that RITA activates the canonical ataxia telangiectasia mutated/ataxia telangiectasia and Rad3-related DNA damage response pathway. Interestingly, phosphorylation of checkpoint kinase (CHK)-1 induced in response to RITA was influenced by p53 status. We found that induction of p53, phosphorylated CHK-1 and γH2AX proteins was significantly increased in S-phase. Furthermore, we found that RITA stalled replication fork elongation, prolonged S-phase progression and induced DNA damage in p53 positive cells. Although CHK-1 knockdown did not significantly affect p53-dependent DNA damage or apoptosis induced by RITA, it did block the ability for DNA integrity to be maintained during the immediate response to RITA. These data reveal the existence of a novel p53-dependent S-phase DNA maintenance checkpoint involving CHK-1. PMID:21593792

  5. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT.

    PubMed

    Leszczynska, Katarzyna B; Foskolou, Iosifina P; Abraham, Aswin G; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N; O'Neill, Eric E; Buffa, Francesca M; Hammond, Ester M

    2015-06-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage-induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain-containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors.

  6. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    PubMed Central

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

  7. Growth factor independence-1 antagonizes a p53-induced DNA damage response pathway in lymphoblastic leukemia

    PubMed Central

    Khandanpour, Cyrus; Phelan, James D.; Vassen, Lothar; Schütte, Judith; Chen, Riyan; Horman, Shane R.; Gaudreau, Marie-Claude; Krongold, Joseph; Zhu, Jinfang; Paul, William E.; Dührsen, Ulrich; Göttgens, Bertie; Grimes, H. Leighton; Möröy, Tarik

    2013-01-01

    Summary Most patients with acute lymphoblastic leukemia (ALL) fail current treatments highlighting the need for better therapies. Since oncogenic signaling activates a p53-dependent DNA-damage response and apoptosis, leukemic cells must devise appropriate countermeasures. We show here that growth factor independence 1 (Gfi1) can serve such a function, since Gfi1 ablation exacerbates p53 responses, and lowers the threshold for p53-induced cell death. Specifically, Gfi1 restricts p53 activity and expression of pro-apoptotic p53 targets such as Bax, Noxa (Pmaip1) and Puma (Bbc3). Subsequently, Gfi1 ablation cures mice from leukemia and limits the expansion of primary human T-ALL xenografts in mice. This suggests that targeting Gfi1 could improve the prognosis of patients with T-ALL or other lymphoid leukemias. PMID:23410974

  8. p53 and PCNA expression in advanced colorectal cancer: response to chemotherapy and long-term prognosis.

    PubMed

    Paradiso, A; Rabinovich, M; Vallejo, C; Machiavelli, M; Romero, A; Perez, J; Lacava, J; Cuevas, M A; Rodriquez, R; Leone, B; Sapia, M G; Simone, G; De Lena, M

    1996-12-20

    In a series of 71 patients with advanced colorectal cancer treated with biochemically modulated 5-fluorouracil (5-FU) and methotrexate (MTX), we investigated the relationship between the proliferating-cell nuclear antigen (PCNA) (PC10) and p53 (Pab1801) primary-tumor immunohistochemical expression with respect to clinical response and long-term prognosis. Nuclear p53 expression was demonstrated in 44% of samples (any number of positive tumor cells) while all tumors showed a certain degree of PCNA immunostaining. PCNA immunostaining was correlated with histopathologic grade and p53 expression, while p53 was not correlated with any of the parameters considered. The probability of clinical response to biochemically modulated 5-FU was independent of p53 and PCNA expression. p53 expression (all cut-off values) was not associated with short- or long-term clinical prognosis, whereas patients with higher PCNA primary-tumor expression showed longer survival from treatment and survival from diagnosis, according to univariate and multivariate analysis, particularly in the sub-set of colon-cancer patients. We conclude that the clinical response of advanced-colorectal-cancer patients to biochemically modulated 5-FU and MTX cannot be predicted by PCNA and p53 primary-tumor expression, but high PCNA expression appears to be independently related to long-term prognosis.

  9. The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

    PubMed

    Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

    2018-03-23

    p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Mechanisms that enhance sustainability of p53 pulses.

    PubMed

    Kim, Jae Kyoung; Jackson, Trachette L

    2013-01-01

    The tumor suppressor p53 protein shows various dynamic responses depending on the types and extent of cellular stresses. In particular, in response to DNA damage induced by γ-irradiation, cells generate a series of p53 pulses. Recent research has shown the importance of sustaining repeated p53 pulses for recovery from DNA damage. However, far too little attention has been paid to understanding how cells can sustain p53 pulses given the complexities of genetic heterogeneity and intrinsic noise. Here, we explore potential molecular mechanisms that enhance the sustainability of p53 pulses by developing a new mathematical model of the p53 regulatory system. This model can reproduce many experimental results that describe the dynamics of p53 pulses. By simulating the model both deterministically and stochastically, we found three potential mechanisms that improve the sustainability of p53 pulses: 1) the recently identified positive feedback loop between p53 and Rorα allows cells to sustain p53 pulses with high amplitude over a wide range of conditions, 2) intrinsic noise can often prevent the dampening of p53 pulses even after mutations, and 3) coupling of p53 pulses in neighboring cells via cytochrome-c significantly reduces the chance of failure in sustaining p53 pulses in the presence of heterogeneity among cells. Finally, in light of these results, we propose testable experiments that can reveal important mechanisms underlying p53 dynamics.

  11. The RNA surveillance protein SMG1 activates p53 in response to DNA double-strand breaks but not exogenously oxidized mRNA

    PubMed Central

    Gewandter, Jennifer S; Bambara, Robert A

    2011-01-01

    DNA damage, stalled replication forks, errors in mRNA splicing and availability of nutrients activate specific phosphatidylinositiol-3-kinase-like kinases (PIKKs) that in turn phosphorylate downstream targets such as p53 on serine 15. While the PIKK proteins ATM and ATR respond to specific DNA lesions, SMG1 responds to errors in mRNA splicing and when cells are exposed to genotoxic stress. Yet, whether genotoxic stress activates SMG1 through specific types of DNA lesions or RNA damage remains poorly understood. Here, we demonstrate that siRNA oligonucleotides targeting the mRNA surveillance proteins SMG1, Upf1, Upf2 or the PIKK protein ATM attenuated p53 (ser15) phosphorylation in cells damaged by high oxygen (hyperoxia), a model of persistent oxidative stress that damages nucleotides. In contrast, loss of SMG1 or ATM, but not Upf1 or Upf2 reduced p53 (ser15) phosphorylation in response to DNA double strand breaks produced by expression of the endonuclease I-PpoI. To determine whether SMG1-dependent activation of p53 was in response to oxidative mRNA damage, mRNA encoding green fluorescence protein (GFP) transcribed in vitro was oxidized by Fenton chemistry and transfected into cells. Although oxidation of GFP mRNA resulted in dose-dependent fragmentation of the mRNA and reduced expression of GFP, it did not stimulate p53 or the p53-target gene p21. These findings establish SMG1 activates p53 in response to DNA double strand breaks independent of the RNA surveillance proteins Upf1 or Upf2; however, these proteins can stimulate p53 in response to oxidative stress but not necessarily oxidized RNA. PMID:21701263

  12. p53 Hypersensitivity Is the Predominant Mechanism of the Unique Responsiveness of Testicular Germ Cell Tumor (TGCT) Cells to Cisplatin

    PubMed Central

    Gutekunst, Matthias; Oren, Moshe; Weilbacher, Andrea; Dengler, Michael A.; Markwardt, Christiane; Thomale, Jürgen; Aulitzky, Walter E.; van der Kuip, Heiko

    2011-01-01

    Consistent with the excellent clinical results in testicular germ cell tumors (TGCT), most cell lines derived from this cancer show an exquisite sensitivity to Cisplatin. It is well accepted that the high susceptibility of TGCT cells to apoptosis plays a central role in this hypersensitive phenotype. The role of the tumor suppressor p53 in this response, however, remains controversial. Here we show that siRNA-mediated silencing of p53 is sufficient to completely abrogate hypersensitivity not only to Cisplatin but also to non-genotoxic inducers of p53 such as the Mdm2 antagonist Nutlin-3 and the proteasome inhibitor Bortezomib. The close relationship between p53 protein levels and induction of apoptosis is lost upon short-term differentiation, indicating that this predominant pro-apoptotic function of p53 is unique in pluripotent embryonal carcinoma (EC) cells. RNA interference experiments as well as microarray analysis demonstrated a central role of the pro-apoptotic p53 target gene NOXA in the p53-dependent apoptotic response of these cells. In conclusion, our data indicate that the hypersensitivity of TGCT cells is a result of their unique sensitivity to p53 activation. Furthermore, in the very specific cellular context of germ cell-derived pluripotent EC cells, p53 function appears to be limited to induction of apoptosis. PMID:21532991

  13. Difference of protein 53 expression based on radiation therapy response in cervical cancer

    NASA Astrophysics Data System (ADS)

    Pasaribu, H. P.; Lubis, L. I.; Dina, S.; Simanjuntak, R. Y.; Siregar, H. S.; Rivany, R.

    2018-03-01

    Cervical cancer is one of most common gynecological cancer in women and the leading cause of death in developing countries. An analytic study with the case-control design was conducted to determine the difference of p53 expression based on radiation therapy response in cervical cancer. The study was performed in Obstetric and Gynecology Department and Pathology Department of Adam Malik General Hospital Medan from January to February 2017. 15 paraffin blocks of acervical cancer patient with incomplete response were obtained as study samples, and 15 paraffin blocks of acervical cancer patient with complete response were obtained as control samples, The samples were collected by consecutive sampling, andan immunohistochemical assessment of p53 expression was done to assessapoptosis count and radiation response. Data were analyzed using Kruskal-Wallis with confidence interval 83.5% and p<0.05 was considered statistically significant. The study found that an increase of p53 expressionin samples with abundant apoptosis (≥5 apoptosis cells/5 HPF), p=0.033, and in incomplete response group, p=0.046. It means that p53 expression before radiation therapy can be used as an early marker for radiation therapy response in cervical cancer.

  14. Release of targeted p53 from the mitochondrion as an early signal during mitochondrial dysfunction

    EPA Science Inventory

    Increased accumulation of p53 tumor suppressor protein is an early response to low-level stressors. To investigate the fate of mitochondrial-sequestered p53, mouse embryonic fibroblast cells (MEFs) on a p53-deficient genetic background were transfected with p53-EGFP fusion protei...

  15. p53 inactivation decreases dependence on estrogen/ERK signalling for proliferation but promotes EMT and susceptility to 3-bromopyruvate in ERα+ breast cancer MCF-7 cells.

    PubMed

    Rieber, Manuel; Strasberg-Rieber, Mary

    2014-03-15

    Most breast cancers express the estrogen receptor alpha (ERα(+)), harbor wt TP53, depend on estrogen/ERK signalling for proliferation, and respond to anti-estrogens. However, concomittant activation of the epidermal growth factor receptor (EGFR)/MEK pathway promotes resistance by decreasing estrogen dependence. Previously, we showed that retroviral transduction of mutant p53 R175H into wt TP53 ERα(+) MCF-7 cells induces epidermal growth factor (EGF)-independent proliferation, activation of the EGF receptor (p-EGFR) and some characteristics of epithelial-mesenchymal transition (EMT). To investigate whether p53 inactivation augments ERα(+) cell proliferation in response to restrictive estradiol, chemical MEK inhibition or metabolic inhibitors. Introduction of mutant p53 R175H lowered expression of p53-dependent PUMA and p21WAF1, decreased E-cadherin and cytokeratin 18 associated with EMT, but increased the % of proliferating ERα(+)/Ki67 cells, diminishing estrogen dependence. These cells also exhibited higher proliferation in the presence of MEK-inhibitor UO126, reciprocally correlating with preferential susceptibility to the pyruvate analog 3-bromopyruvate (3-BrPA) without a comparable response to 2-deoxyglucose. p53 siRNA silencing by electroporation in wt TP53 MCF-7 cells also decreased estrogen dependence and response to MEK inhibition, while also conferring susceptibility to 3-BrPA. (a) ERα(+) breast cancer cells dysfunctional for TP53 which proliferate irrespective of low estrogen and chemical MEK inhibition are likely to increase metabolic consumption becoming increasingly susceptible to 3-BrPA; (b) targeting the pyruvate pathway may improve response to endocrine therapy in ERα(+) breast cancer with p53 dysfunction. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  16. ATM phosphorylation of Mdm2 Ser394 regulates the amplitude and duration of the DNA damage response in mice

    PubMed Central

    Gannon, Hugh S.; Woda, Bruce A.; Jones, Stephen N.

    2012-01-01

    Summary DNA damage induced by ionizing radiation (IR) activates the ATM kinase, which subsequently stabilizes and activates the p53 tumor suppressor protein. Although phosphorylation of p53 by ATM was found previously to modulate p53 levels and transcriptional activities in vivo, it does not appear to be a major regulator of p53 stability. We have utilized mice bearing altered Mdm2 alleles to demonstrate that ATM phosphorylation of Mdm2 serine 394 is required for robust p53 stabilization and activation after DNA damage. In addition, we demonstrate that dephosphorylation of Mdm2 Ser394 regulates attenuation of the p53-mediated response to DNA damage. Therefore, the phosphorylation status of Mdm2 Ser394 governs p53 protein levels and functions in cells undergoing DNA damage. PMID:22624716

  17. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

  18. Family matters: sibling rivalry and bonding between p53 and p63 in cancer.

    PubMed

    Romano, Rose-Anne; Sinha, Satrajit

    2014-04-01

    The p53 family (p53, p63 and p73) is intimately linked with an overwhelming number of cellular processes during normal physiological as well as pathological conditions including cancer. The fact that these proteins are expressed in myriad isoforms, each with unique biochemical properties and distinct effects on tumorigenesis, complicates their study. A case in point is Squamous Cell Carcinoma (SCC) where p53 is often mutated and the ΔNp63 isoform is overexpressed. Given that p53 and p63 can hetero-dimerize, bind to quite similar DNA elements and share common co-factors, any alterations in their individual expression levels, activity and/or mutation can severely disrupt the family equilibrium. The burgeoning genomics data sets and new additions to the experimental toolbox are offering crucial insights into the complex role of the p53 family in SCC, but more mechanistic studies are needed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Plant Nucleolar Stress Response, a New Face in the NAC-Dependent Cellular Stress Responses.

    PubMed

    Ohbayashi, Iwai; Sugiyama, Munetaka

    2017-01-01

    The nucleolus is the most prominent nuclear domain, where the core processes of ribosome biogenesis occur vigorously. All these processes are finely orchestrated by many nucleolar factors to build precisely ribosome particles. In animal cells, perturbations of ribosome biogenesis, mostly accompanied by structural disorders of the nucleolus, cause a kind of cellular stress to induce cell cycle arrest, senescence, or apoptosis, which is called nucleolar stress response. The best-characterized pathway of this stress response involves p53 and MDM2 as key players. p53 is a crucial transcription factor that functions in response to not only nucleolar stress but also other cellular stresses such as DNA damage stress. These cellular stresses release p53 from the inhibition by MDM2, an E3 ubiquitin ligase targeting p53, in various ways, which leads to p53-dependent activation of a set of genes. In plants, genetic impairments of ribosome biogenesis factors or ribosome components have been shown to cause characteristic phenotypes, including a narrow and pointed leaf shape, implying a common signaling pathway connecting ribosomal perturbations and certain aspects of growth and development. Unlike animals, however, plants have neither p53 nor MDM2 family proteins. Then the question arises whether plant cells have a nucleolar stress response pathway. In recent years, it has been reported that several members of the plant-specific transcription factor family NAC play critical roles in the pathways responsive to various cellular stresses. In this mini review, we outline the plant cellular stress response pathways involving NAC transcription factors with reference to the p53-MDM2-dependent pathways of animal cells, and discuss the possible involvement of a plant-unique, NAC-mediated pathway in the nucleolar stress response in plants.

  20. Altered S-nitrosylation of p53 is responsible for impaired antioxidant response in skeletal muscle during aging.

    PubMed

    Baldelli, Sara; Ciriolo, Maria Rosa

    2016-12-20

    p53 transcriptional activity has been proposed to regulate both homeostasis and sarcopenia of skeletal muscle during aging. However, the exact molecular function of p53 remains to be clearly defined. We demonstrated a requirement of nuclear p53 S-nitrosylation in inducing a nitric oxide/PGC-1α-mediated antioxidant pathway in skeletal muscle. Importantly, mutant form of p53-DNA binding domain (C124S) did not undergo nuclear S-nitrosylation and failed in inducing the expression of antioxidant genes (i.e. SOD2 and GCLC). Moreover, we found that during aging the nuclear S-nitrosylation of p53 significantly declines in gastrocnemius/soleus leading to an impairment of redox homeostasis of skeletal muscle. We suggested that decreased level of nuclear neuronal nitric oxide synthase (nNOS)/Syntrophin complex, which we observed during aging, could be responsible for impaired nuclear S-nitrosylation. Taken together, our data indicate that altered S-nitrosylation of p53 during aging could be a contributing factor of sarcopenia condition and of other skeletal muscle pathologies associated with oxidative/nitrosative stress.

  1. Altered S-nitrosylation of p53 is responsible for impaired antioxidant response in skeletal muscle during aging

    PubMed Central

    Baldelli, Sara; Ciriolo, Maria Rosa

    2016-01-01

    p53 transcriptional activity has been proposed to regulate both homeostasis and sarcopenia of skeletal muscle during aging. However, the exact molecular function of p53 remains to be clearly defined. We demonstrated a requirement of nuclear p53 S-nitrosylation in inducing a nitric oxide/PGC-1α-mediated antioxidant pathway in skeletal muscle. Importantly, mutant form of p53-DNA binding domain (C124S) did not undergo nuclear S-nitrosylation and failed in inducing the expression of antioxidant genes (i.e. SOD2 and GCLC). Moreover, we found that during aging the nuclear S-nitrosylation of p53 significantly declines in gastrocnemius/soleus leading to an impairment of redox homeostasis of skeletal muscle. We suggested that decreased level of nuclear neuronal nitric oxide synthase (nNOS)/Syntrophin complex, which we observed during aging, could be responsible for impaired nuclear S-nitrosylation. Taken together, our data indicate that altered S-nitrosylation of p53 during aging could be a contributing factor of sarcopenia condition and of other skeletal muscle pathologies associated with oxidative/nitrosative stress. PMID:28025407

  2. Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

    PubMed

    Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

    2016-04-01

    P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  3. The putative oncotarget CSN5 controls a transcription-uncorrelated p53-mediated autophagy implicated in cancer cell survival under curcumin treatment.

    PubMed

    Zhang, Qing-Yu; Jin, Rui; Zhang, Xian; Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong

    2016-10-25

    Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53-/- cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin.

  4. 53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

    PubMed

    Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

    2016-07-02

    Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

  5. New Insights into the Mechanism of Inhibition of p53 by Simian Virus 40 Large T Antigen

    PubMed Central

    Sheppard, Hilary M.; Corneillie, Siska I.; Espiritu, Christine; Gatti, Andrea; Liu, Xuan

    1999-01-01

    Simian virus 40 (SV40) large tumor antigen (T antigen) has been shown to inhibit p53-dependent transcription by preventing p53 from binding to its cognate cis element. Data presented in this report provide the first direct functional evidence that T antigen, under certain conditions, may also repress p53-dependent transcription by a mechanism in which the transactivation domain of p53 is abrogated while DNA binding is unaffected. Specifically, p53 purified as a complex with T antigen from mouse cells was found to bind DNA as a transcriptionally inactive intact complex, while that purified from human cells was found to bind DNA independently of T antigen and could activate p53-dependent transcription. This difference in activity may be dependent on a different interaction of T antigen with mouse and human p53 and, in addition, on the presence of super T, which is found only in transformed rodent cells. These results suggest that subtle yet important differences exist between the inhibition of p53 by T antigen in mouse and human cells. The implications of this finding with respect to SV40-associated malignancies are discussed. PMID:10082540

  6. Correlation of tumor p53 and PCNA with response and survival of glioblastoma in patients treated with an ECOG protocol of pre-irradiation chemotherapy.

    PubMed

    Grunnet, M L; O'Neill, A; Gilbert, M; Hellman, R

    2000-01-01

    The ability to predict treatment responsiveness and survival of patients with glioblastoma multiforme, the most malignant and most common primary brain tumor, would be a valuable asset. Tumor and proliferation markers such as p53 and PCNA have been immunohistochemically defined and have been useful in other tumors in determining prognosis. Therefore, the authors studied the correlation of responsiveness to treatment, time to progression and survival with p53 and PCNA labeling indices in a pre-irradiation chemotherapy study of the glioblastoma multiforme. Immunohistopathology for labeling indices for p53 and PCNA using formalin-fixed, paraffin-embedded tissue from the glioblastomas of 23 patients entered into a phase II ECOG trial of pre-irradiation chemotherapy were defined using the streptavidin-peroxidase technique with AEC chromogen. The labeling indices were correlated with response to treatment time to progression and overall survival. Most patients received three cycles of BCNU for three days over three months and cisplatin monthly for three days over three months prior to external beam irradiation. There were no significant differences in treatment response, time to progression or overall survival in glioblastoma, patients with positive p53 labeling index (> 5%) versus a negative p53 labeling index (< or = 5%) or positive PCNA labeling (> 10%) versus a negative labeling index (< or = 10%) or any combination of P53 and PCNA labeling indices. Using this protocol of pre-irradiation chemotherapy, p53 and PCNA labeling indices in the glioblastoma multiforme did not predict treatment benefit.

  7. p53 activation by Ni(II) is a HIF-1α independent response causing caspases 9/3-mediated apoptosis in human lung cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, Victor C.; Morse, Jessica L.; Zhitkovich, Anatoly, E-mail: anatoly_zhitkovich@brown.edu

    2013-06-15

    Hypoxia mimic nickel(II) is a human respiratory carcinogen with a suspected epigenetic mode of action. We examined whether Ni(II) elicits a toxicologically significant activation of the tumor suppressor p53, which is typically associated with genotoxic responses. We found that treatments of H460 human lung epithelial cells with NiCl{sub 2} caused activating phosphorylation at p53-Ser15, accumulation of p53 protein and depletion of its inhibitor MDM4 (HDMX). Confirming the activation of p53, its knockdown suppressed the ability of Ni(II) to upregulate MDM2 and p21 (CDKN1A). Unlike DNA damage, induction of GADD45A by Ni(II) was p53-independent. Ni(II) also increased p53-Ser15 phosphorylation and p21more » expression in normal human lung fibroblasts. Although Ni(II)-induced stabilization of HIF-1α occurred earlier, it had no effect on p53 accumulation and Ser15 phosphorylation. Ni(II)-treated H460 cells showed no evidence of necrosis and their apoptosis and clonogenic death were suppressed by p53 knockdown. The apoptotic role of p53 involved a transcription-dependent program triggering the initiator caspase 9 and its downstream executioner caspase 3. Two most prominently upregulated proapoptotic genes by Ni(II) were PUMA and NOXA but only PUMA induction required p53. Knockdown of p53 also led to derepression of antiapoptotic MCL1 in Ni(II)-treated cells. Overall, our results indicate that p53 plays a major role in apoptotic death of human lung cells by Ni(II). Chronic exposure to Ni(II) may promote selection of resistant cells with inactivated p53, providing an explanation for the origin of p53 mutations by this epigenetic carcinogen. - Highlights: • Ni(II) is a strong activator of the transcription factor p53. • Apoptosis is a principal form of death by Ni(II) in human lung epithelial cells. • Ni(II)-activated p53 triggers caspases 9/3-mediated apoptotic program. • NOXA and PUMA are two main proapoptotic genes induced by Ni(II). • HIF-1α and p53 are independent stress responses to hypoxia-mimicking Ni(II)« less

  8. p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

    PubMed

    Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

    1996-09-01

    Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

  9. KDM4B/JMJD2B is a p53 target gene that modulates the amplitude of p53 response after DNA damage

    PubMed Central

    Moon, Eui Jung; Razorenova, Olga V.; Krieg, Adam J.; von Eyben, Rie

    2017-01-01

    Abstract The p53 tumor suppressor protein plays a critical role in orchestrating the genomic response to various stress signals by acting as a master transcriptional regulator. Differential gene activity is controlled by transcription factors but also dependent on the underlying chromatin structure, especially on covalent histone modifications. After screening different histone lysine methyltransferases and demethylases, we identified JMJD2B/KDM4B as a p53-inducible gene in response to DNA damage. p53 directly regulates JMJD2B gene expression by binding to a canonical p53-consensus motif in the JMJD2B promoter. JMJD2B induction attenuates the transcription of key p53 transcriptional targets including p21, PIG3 and PUMA, and this modulation is dependent on the catalytic capacity of JMJD2B. Conversely, JMJD2B silencing led to an enhancement of the DNA-damage driven induction of p21 and PIG3. These findings indicate that JMJD2B acts in an auto-regulatory loop by which p53, through JMJD2B activation, is able to influence its own transcriptional program. Functionally, exogenous expression of JMJD2B enhanced subcutaneous tumor growth of colon cancer cells in a p53-dependent manner, and genetic inhibition of JMJD2B impaired tumor growth in vivo. These studies provide new insights into the regulatory effect exerted by JMJD2B on tumor growth through the modulation of p53 target genes. PMID:28073943

  10. CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

    PubMed

    He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

    2016-01-01

    The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

  11. On p53 revival using system oriented drug dosage design.

    PubMed

    Haseeb, Muhammad; Azam, Shumaila; Bhatti, A I; Azam, Rizwan; Ullah, Mukhtar; Fazal, Sahar

    2017-02-21

    We propose a new paradigm in the drug design for the revival of the p53 pathway in cancer cells. It is shown that the current strategy of using small molecule based Mdm2 inhibitors is not enough to adequately revive p53 in cancerous cells, especially when it comes to the extracting pulsating behavior of p53. This fact has come to notice when a novel method for the drug dosage design is introduced using system oriented concepts. As a test case, small molecule drug Mdm2 repressor Nutlin 3a is considered. The proposed method determines the dose of Nutlin to revive p53 pathway functionality. For this purpose, PBK dynamics of Nutlin have also been integrated with p53 pathway model. The p53 pathway is the focus of researchers for the last thirty years for its pivotal role as a frontline cancer suppressant protein due to its effect on cell cycle checkpoints and cell apoptosis in response to a DNA strand break. That is the reason for finding p53 being absent in more than 50% of tumor cancers. Various drugs have been proposed to revive p53 in cancer cells. Small molecule based drugs are at the foremost and are the subject of advanced clinical trials. The dosage design of these drugs is an important issue. We use control systems concepts to develop the drug dosage so that the cancer cells can be treated in appropriate time. We investigate by using a computational model how p53 protein responds to drug Nutlin 3a, an agent that interferes with the MDM2-mediated p53 regulation. The proposed integrated model describes in some detail the regulation network of p53 including the negative feedback loop mediated by MDM2 and the positive feedback loop mediated by Mdm2 mRNA as well as the reversible represses of MDM2 caused by Nutlin. The reported PBK dynamics of Nutlin 3a are also incorporated to see the full effect. It has been reported that p53 response to stresses in two ways. Either it has a sustained (constant) p53 response, or there are oscillations in p53 concentration. The claimed dosage strategy achieves the p53 response in the first case. However, for the induction of oscillations, it is shown through bifurcation analysis that to achieve oscillating behavior of p53 inhibition of Mdm2 is not enough, rather antirepression of the p53-Mdm2 complex is also needed which leads to the need of a new drug design paradigm. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. p53 sequence analysis predicts treatment response and outcome of patients with esophageal carcinoma.

    PubMed

    Ribeiro, U; Finkelstein, S D; Safatle-Ribeiro, A V; Landreneau, R J; Clarke, M R; Bakker, A; Swalsky, P A; Gooding, W E; Posner, M C

    1998-07-01

    The ability to predict biologic behavior and treatment responsiveness would be a valuable asset in the multimodality approach to esophageal carcinoma. The authors examined whether alterations of the p53 gene correlate with clinicopathologic parameters, response to preoperative chemotherapy/radiotherapy, and outcome in patients with esophageal carcinoma. METHODS. Histopathologic/genetic analysis of p53 was performed on formalin fixed, paraffin embedded tissues. Tissue sections were stained immunohistochemically for p53 protein followed by topographic genotyping comprised of polymerase chain reaction amplification and direct sequencing of p53 exons 5-8. All patients received induction chemotherapy (5-fluorouracil, cisplatin, and alpha-interferon) and concurrent external beam radiotherapy (4500 centigrays) followed by resection. p53 analysis performed on 42 tumors from patients with potentially resectable esophageal carcinoma revealed 25 of the 42 tumors (59.5%) to be p53 immunopositive; however, only 17 of the 42 tumors (40.5%) were proven to contain p53 point mutational damage in exons 8 (n=5), 5 (n=5), 7 (n=4), and 6 (n=3). Eight cases were weakly immunopositive and had no genotype mutation suggesting hyperexpression of normal wild-type p53. Genotyping also identified two immunonegative cases with deletion-type mutations (exons 5 and 6). Tissue samples collected before and after chemotherapy/radiotherapy exhibited fidelity in p53 mutational genotype in all cases. The presence of a p53 point mutation positively correlated with pTNM stage (P=0.003) and residual disease in the resected specimen (P=0.01). Moreover, survival of patients with p53 mutations was significantly lower than that of patients without mutations (overall survival of 21.6 months vs. 40 months; P=0.0038; and disease free survival of 14.1 months vs. 38 months; P=0.0004). Histopathologic/genetic analysis is a better determinant of p53 mutational damage than immunohistochemistry alone and can be used as a prognostic marker for esophageal carcinoma. p53 genotyping may define a subset of patients who respond to chemotherapy/radiotherapy and may predict who potentially benefits from multimodality therapy.

  13. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    PubMed

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  14. The p53 breast cancer tissue biomarker in Indian women

    PubMed Central

    Patil, Vinayak W; Tayade, Mukund B; Pingale, Sangeeta A; Dalvi, Shubhangi M; Rajekar, Rajesh B; Deshmukh, Hemkant M; Patil, Shital D; Singhai, Rajeev

    2011-01-01

    Background Combination chemotherapy is highly effective in locally advanced breast cancer. A negative expression of biomarker p53 indicates a higher chance of responding to this regimen. Patients’ p53 status may be used as a biological cancer marker to identify those who would benefit from more aggressive treatments. Aims The role of p53 in modulating apoptosis has suggested that it may affect the efficacy of anticancer agents. p53 alterations in 80 patients with locally advanced breast cancer IIIB undergoing neoadjuvant chemotherapy were prospectively evaluated. Materials and methods Patients received three cycles of paclitaxel (175 mg/m2) and doxorubicin (60 mg/m2) every 21 days. Tumor sections were analyzed before treatment for altered patterns of p53 expression, using immunohistochemistry and DNA sequencing. Results An overall response rate of 83.5% was obtained, including 15.1% complete pathological responses. The regimen was well tolerated with 17.7% grade 2/3 nausea and 12.8% grade 3/4 leukopenia. There was a statistically significant correlation between response and expression of p53. Of 25 patients who obtained a complete clinical response, only two were classified as p53-positive (P = 0.004, χ2). Of 11 patients who obtained a complete pathological remission, one was positive (P = 0.099, χ2). Conclusion Immunohistochemical (IHC) analysis has been shown to be a prognostic factor for patients with breast cancer in India. Paclitaxel is one of the most promising anticancer agents for the therapy of breast cancer, where it has also shown activity in tumors resistant to doxorubicin. PMID:24367177

  15. The putative oncotarget CSN5 controls a transcription-uncorrelated p53-mediated autophagy implicated in cancer cell survival under curcumin treatment

    PubMed Central

    Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong

    2016-01-01

    Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53−/− cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin. PMID:27626169

  16. ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage

    PubMed Central

    Maya, Ruth; Balass, Moshe; Kim, Seong-Tae; Shkedy, Dganit; Leal, Juan-Fernando Martinez; Shifman, Ohad; Moas, Miri; Buschmann, Thomas; Ronai, Ze'ev; Shiloh, Yosef; Kastan, Michael B.; Katzir, Ephraim; Oren, Moshe

    2001-01-01

    The p53 tumor suppressor protein, a key regulator of cellular responses to genotoxic stress, is stabilized and activated after DNA damage. The rapid activation of p53 by ionizing radiation and radiomimetic agents is largely dependent on the ATM kinase. p53 is phosphorylated by ATM shortly after DNA damage, resulting in enhanced stability and activity of p53. The Mdm2 oncoprotein is a pivotal negative regulator of p53. In response to ionizing radiation and radiomimetic drugs, Mdm2 undergoes rapid ATM-dependent phosphorylation prior to p53 accumulation. This results in a decrease in its reactivity with the 2A10 monoclonal antibody. Phage display analysis identified a consensus 2A10 recognition sequence, possessing the core motif DYS. Unexpectedly, this motif appears twice within the human Mdm2 molecule, at positions corresponding to residues 258–260 and 393–395. Both putative 2A10 epitopes are highly conserved and encompass potential phosphorylation sites. Serine 395, residing within the carboxy-terminal 2A10 epitope, is the major target on Mdm2 for phosphorylation by ATM in vitro. Mutational analysis supports the conclusion that Mdm2 undergoes ATM-dependent phosphorylation on serine 395 in vivo in response to DNA damage. The data further suggests that phosphorylated Mdm2 may be less capable of promoting the nucleo-cytoplasmic shuttling of p53 and its subsequent degradation, thereby enabling p53 accumulation. Our findings imply that activation of p53 by DNA damage is achieved, in part, through attenuation of the p53-inhibitory potential of Mdm2. PMID:11331603

  17. AAVPG: A vigilant vector where transgene expression is induced by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

    2013-12-15

    Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

  18. Bim directly antagonizes Bcl-xl in doxorubicin-induced prostate cancer cell apoptosis independently of p53.

    PubMed

    Yang, Min-Chi; Lin, Ru-Wei; Huang, Shih-Bo; Huang, Shin-Yuan; Chen, Wen-Jie; Wang, Shiaw; Hong, Yi-Ren; Wang, Chihuei

    2016-01-01

    Doxorubicin and other anthracycline compounds exert their anti-cancer effects by causing DNA damage and initiating cell cycle arrest in cancer cells, followed by apoptosis. DNA damage generally activates a p53-mediated pathway to initiate apoptosis by increasing the level of the BH3-only protein, Puma. However, p53-mediated apoptosis in response to DNA damage has not yet been validated in prostate cancers. In the current study, we used LNCaP and PC3 prostate cancer cells, representing wild type p53 and a p53-null model, to determine if DNA damage activates p53-mediated apoptosis in prostate cancers. Our results revealed that PC3 cells were 4 to 8-fold less sensitive than LNCaP cells to doxorubicin-inuced apoptosis. We proved that the differential response of LNCaP and PC3 to doxorubicin was p53-independent by introducing wild-type or dominant negative p53 into PC3 or LNCaP cells, respectively. By comparing several apoptosis-related proteins in both cell lines, we found that Bcl-xl proteins were much more abundant in PC3 cells than in LNCaP cells. We further demonstrated that Bcl-xl protects LNCaP and PC3 cells from doxorubicin-induced apoptosis by using ABT-263, an inhibitor of Bcl-xl, as a single agent or in combination with doxorubicin to treat LNCaP or PC3 cells. Bcl-xl rather than p53, likely contributes to the differential response of LNCaP and PC3 to doxorubicin in apoptosis. Finally, co-immunoprecipitation and siRNA analysis revealed that a BH3-only protein, Bim, is involved in doxorubicin-induced apoptosis by directly counteracting Bcl-xl.

  19. Cell cycle regulation and apoptosis mediated by p53 in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei.

    PubMed

    Nuñez-Hernandez, Dahlia M; Felix-Portillo, Monserrath; Peregrino-Uriarte, Alma B; Yepiz-Plascencia, Gloria

    2018-01-01

    Although hypoxic aquatic environments cause negative effects on shrimp, these animals can withstand somewhat hypoxia, but the cellular mechanisms underlying this capacity are still poorly understood. In humans, mild hypoxia causes the induction of many proteins to allow cell survival. In contrast, apoptosis is induced during severe hypoxia leading to cell death. p53 is a key transcription factor that determines cells fate towards cell cycle arrest or induction of apoptosis in humans. The aim of this work was to study the role of p53 in cell cycle regulation and apoptosis in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei. p53 was silenced by RNAi and afterwards the shrimp were exposed to hypoxia. Cdk-2 was used as indicator of cell cycle progression while caspase-3 expression and caspase activity were analyzed as indicators of apoptosis. p53 levels in hepatopancreas were significantly higher at 48 h after hypoxic treatment. Increased expression levels of Cdk-2 were found in p53-silenced shrimp after 24 and 48 h in the normoxic treatments as well as 48 h after hypoxia, indicating a possible role of p53 in cell cycle regulation. In response to hypoxia, unsilenced shrimp showed an increase in caspase-3 expression levels, however an increase was also observed in caspase activity at 24 h of normoxic conditions in p53-silenced shrimps. Taken together these results indicate the involvement of p53 in regulation of cell cycle and apoptosis in the white shrimp in response to hypoxia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. p53 Mediates Vast Gene Expression Changes That Contribute to Poor Chemotherapeutic Response in a Mouse Model of Breast Cancer.

    PubMed

    Tonnessen-Murray, Crystal; Ungerleider, Nathan A; Rao, Sonia G; Wasylishen, Amanda R; Frey, Wesley D; Jackson, James G

    2018-05-28

    p53 is a transcription factor that regulates expression of genes involved in cell cycle arrest, senescence, and apoptosis. TP53 harbors mutations that inactivate its transcriptional activity in roughly 30% of breast cancers, and these tumors are much more likely to undergo a pathological complete response to chemotherapy. Thus, the gene expression program activated by wild-type p53 contributes to a poor response. We used an in vivo genetic model system to comprehensively define the p53- and p21-dependent genes and pathways modulated in tumors following doxorubicin treatment. We identified genes differentially expressed in spontaneous mammary tumors harvested from treated MMTV-Wnt1 mice that respond poorly (Trp53+/+) or favorably (Trp53-null) and those that lack the critical senescence/arrest p53 target gene Cdkn1a. Trp53 wild-type tumors differentially expressed nearly 10-fold more genes than Trp53-null tumors after treatment. Pathway analyses showed that genes involved in cell cycle, senescence, and inflammation were enriched in treated Trp53 wild-type tumors; however, no genes/pathways were identified that adequately explain the superior cell death/tumor regression observed in Trp53-null tumors. Cdkn1a-null tumors that retained arrest capacity (responded poorly) and those that proliferated (responded well) after treatment had remarkably different gene regulation. For instance, Cdkn1a-null tumors that arrested upregulated Cdkn2a (p16), suggesting an alternative, p21-independent route to arrest. Live animal imaging of longitudinal gene expression of a senescence/inflammation gene reporter in Trp53+/+ tumors showed induction during and after chemotherapy treatment, while tumors were arrested, but expression rapidly diminished immediately upon relapse. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  1. PML is a ROS sensor activating p53 upon oxidative stress

    PubMed Central

    Soilihi, Hassane

    2017-01-01

    Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml−/− cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml−/− embryos survive acute glutathione depletion. Moreover, Pml−/− animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml−/− animals fail to properly activate oxidative stress–responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress–prone background, Pml−/− animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress–induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. PMID:28931625

  2. PML is a ROS sensor activating p53 upon oxidative stress.

    PubMed

    Niwa-Kawakita, Michiko; Ferhi, Omar; Soilihi, Hassane; Le Bras, Morgane; Lallemand-Breitenbach, Valérie; de Thé, Hugues

    2017-11-06

    Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml -/- cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml -/- embryos survive acute glutathione depletion. Moreover, Pml -/- animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml -/- animals fail to properly activate oxidative stress-responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress-prone background, Pml -/- animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress-induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. © 2017 Niwa-Kawakita et al.

  3. Functional characterization of p53 pathway components in the ancient metazoan Trichoplax adhaerens

    NASA Astrophysics Data System (ADS)

    Siau, Jia Wei; Coffill, Cynthia R.; Zhang, Weiyun Villien; Tan, Yaw Sing; Hundt, Juliane; Lane, David; Verma, Chandra; Ghadessy, Farid

    2016-09-01

    The identification of genes encoding a p53 family member and an Mdm2 ortholog in the ancient placozoan Trichoplax adhaerens advocates for the evolutionary conservation of a pivotal stress-response pathway observed in all higher eukaryotes. Here, we recapitulate several key functionalities ascribed to this known interacting protein pair by analysis of the placozoan proteins (Tap53 and TaMdm2) using both in vitro and cellular assays. In addition to interacting with each other, the Tap53 and TaMdm2 proteins are also able to respectively bind human Mdm2 and p53, providing strong evidence for functional conservation. The key p53-degrading function of Mdm2 is also conserved in TaMdm2. Tap53 retained DNA binding associated with p53 transcription activation function. However, it lacked transactivation function in reporter genes assays using a heterologous cell line, suggesting a cofactor incompatibility. Overall, the data supports functional roles for TaMdm2 and Tap53, and further defines the p53 pathway as an evolutionary conserved fulcrum mediating cellular response to stress.

  4. Photodynamic injury of isolated crayfish neuron and surrounding glial cells: the role of p53

    NASA Astrophysics Data System (ADS)

    Sharifulina, S. A.; Uzdensky, A. B.

    2015-03-01

    The pro-apoptotic transcription factor p53 is involved in cell responses to injurious impacts. Using its inhibitor pifithrin- α and activators tenovin-1, RITA and WR-1065, we studied its potential participation in inactivation and death of isolated crayfish mechanoreceptor neuron and satellite glial cells induced by photodynamic treatment, a strong inducer of oxidative stress. In dark, p53 activation by tenovin-1 or WR-1065 shortened activity of isolated neurons. Tenovin-1 and WR-1065 induced apoptosis of glial cells, whereas pifithrin-α was anti-apoptotic. Therefore, p53 mediated glial apoptosis and suppression of neuronal activity after axotomy. Tenovin-1 but not other p53 modulators induced necrosis of axotomized neurons and surrounding glia, possibly, through p53-independent pathway. Under photodynamic treatment, p53 activators tenovin-1 and RITA enhanced glial apoptosis indicating the pro-apoptotic activity of p53. Photoinduced necrosis of neurons and glia was suppressed by tenovin-1 and, paradoxically, by pifithrin-α. Modulation of photoinduced changes in the neuronal activity and necrosis of neurons and glia was possibly p53-independent. The different effects of p53 modulators on neuronal and glial responses to axotomy and photodynamic impact were apparently associated with different signaling pathways in neurons and glial cells.

  5. Loss of P53 regresses cardiac remodeling induced by pressure overload partially through inhibiting HIF1α signaling in mice.

    PubMed

    Li, Jiming; Zeng, Jingjing; Wu, Lianpin; Tao, Luyuan; Liao, Zhiyong; Chu, Maoping; Li, Lei

    2018-06-22

    The tumor suppressor p53 is recognized as the guardian of the genome in cell cycle and cell death. P53 expression increases as cardiac hypertrophy worsens to heart failure, suggesting that p53 may play important role in cardiac remodeling. In the present study, deletion of p53 in the mice heart would ameliorate cardiac hypertrophy induced by pressure overload. The role of p53 on heart was investigated using in vivo models. Cardiac hypertrophy in mice was induced by transverse aortic banding surgery. The extent of cardiac hypertrophy was examined by echocardiography, as well as pathological and molecular analyses of heart tissue. Global knockout of p53 in the mice reduced the hypertrophic response and markedly reduced cardiac apoptosis, and fibrosis. Ejection fraction of heart was also improved in hearts without p53 in response to pressure overload. Protein determination further suggested loss of p53 expression markedly increased Hypoxia-inducible factor 1-alpha (HIF1α) and vascular endothelial growth factor (VEGF) expression. The study indicated p53 deteriorated cardiac functions and cardiac hypertrophy, apoptosis, and fibrosis by partially inhibition of HIF1α and VEGF. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dai, Jiawen; Itahana, Koji, E-mail: koji.itahana@duke-nus.edu.sg; Baskar, Rajamanickam, E-mail: r.baskar@nccs.com.sg

    Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G{sub 1}/S or G{sub 2}/M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G{sub 0}, therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involvedmore » in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its known role in radio-resistance.« less

  7. Androgen Triggers the Pro-Migratory CXCL12/CXCR4 Axis in AR-Positive Breast Cancer Cell Lines: Underlying Mechanism and Possible Implications for the Use of Aromatase Inhibitors in Breast Cancer.

    PubMed

    Azariadis, Kalliopi; Kiagiadaki, Fotini; Pelekanou, Vasiliki; Bempi, Vasiliki; Alexakis, Kostas; Kampa, Marilena; Tsapis, Andreas; Castanas, Elias; Notas, George

    2017-01-01

    Reports regarding the role of androgen in breast cancer (BC) are conflicting. Some studies suggest that androgen could lead to undesirable responses in the presence of certain BC tumor characteristics. We have shown that androgen induces C-X-C motif chemokine 12 (CXCL12) in BC cell lines. Our aim was to identify the mechanisms regulating the phenotypic effects of androgen-induced CXCL12 on Androgen Receptor (AR) positive BC cell lines. We analyzed the expression of CXCL12 and its receptors with qPCR and ELISA and the role of Nuclear Receptor Coactivator 1 (NCOA1) in this effect. AR effects on the CXCL12 promoter was studied via Chromatin-immunoprecipitation. We also analyzed publically available data from The Cancer Genome Atlas to verify AR-CXCL12 interactions and to identify the effect or Aromatase Inhibitors (AI) therapy on CXCL12 expression and disease progression in AR positive cases. CXCL12 induction occurs only in AR-positive BC cell lines, possibly via an Androgen Response Element, upstream of the CXCL12 promoter. The steroid receptor co-regulator NCOA1 is critical for this effect. Androgen only induced the motility of p53-mutant BC cells T47D cells via upregulation of CXCR4 expression while they had no effect on wild-type p53 MCF-7 cells. Loss of CXCR4 expression and depletion of CXCL12 abolished the effect of androgen in T47D cells while inhibition of p53 expression in MCF-7 cells made them responsive to androgen and increased their motility in the presence to androgen. Patients with estrogen receptor positive (ER+)/AR+ BC treated with AIs were at increased risk of disease progression compared to ER+/AR+ non-AI treated and ER+/AR- AI treated cases. AIs may lead to unfavorable responses in some ER/AR positive BC cases, especially in patients with AR+, p53 mutant tumors. © 2017 The Author(s). Published by S. Karger AG, Basel.

  8. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    PubMed Central

    2010-01-01

    Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19Arf and nutlin-3. Conclusions To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53. PMID:20569441

  9. p53 isoform Δ133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming.

    PubMed

    Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun

    2016-11-22

    Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.

  10. Combined radiation and p53 gene therapy of malignant glioma cells.

    PubMed

    Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

    1999-01-01

    More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We conclude that responses to p53 gene therapy are variable among gliomas and most likely depend upon both cellular p53 status and as yet ill-defined downstream pathways involving activation of cell cycle regulatory and apoptotic genes.

  11. Free Radicals Generated by Ionizing Radiation Signal Nuclear Translocation of p53

    NASA Technical Reports Server (NTRS)

    Martinez, J. D.; Pennington, M. E.; Craven, M. T.; Warters, R. L.

    1997-01-01

    The p53 tumor suppressor is a transcription factor that regulates several pathways, which function collectively to maintain the integrity of the genome. Nuclear localization is critical for wild-type function. However, the signals that regulate subcellular localization of p53 have not been identified. Here, we examine the effect of ionizing radiation on the subcellular localization of p53 in two cell lines in which p63 is normally sequestered in the cytoplasm and found that ionizing radiation caused a biphasic translocation response. p53 entered the nucleus 1-2 hours postirradiation (early response), subsequently emerged from the nucleus, and then again entered the nucleus 12-24 hours after the cells had been irradiated (delayed response). These changes in subcellular localization could be completely blocked by the free radical scavenger, WR1065. By comparison, two DNA-damaging agents that do not generate free radicals, mitomycin C and doxorubicin, caused translocation only after 12-24 h of exposure to the drugs, and this effect could not be inhibited by WR1065. Hence, although all three DNA-damaging agents induced relocalization of p53 to the nucleus, only the translocation caused by radiation was sensitive to free radical scavenging. We suggest that the free radicals generated by ionizing radiation can signal p53 translocation to the nucleus.

  12. TRIM65 negatively regulates p53 through ubiquitination

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Yang; Ma, Chengyuan; Zhou, Tong

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediatedmore » degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.« less

  13. The Transcription Factor p53 Influences Microglial Activation Phenotype

    PubMed Central

    Jayadev, Suman; Nesser, Nicole K.; Hopkins, Stephanie; Myers, Scott J.; Case, Amanda; Lee, Rona J.; Seaburg, Luke A.; Uo, Takuma; Murphy, Sean P.; Morrison, Richard S.; Garden, Gwenn A.

    2011-01-01

    Several neurodegenerative diseases are influenced by the innate immune response in the central nervous system (CNS). Microglia, have pro-inflammatory and subsequently neurotoxic actions as well as anti-inflammatory functions that promote recovery and repair. Very little is known about the transcriptional control of these specific microglial behaviors. We have previously shown that in HIV associated neurocognitive disorders (HAND), the transcription factor p53 accumulates in microglia and that microglial p53 expression is required for the in vitro neurotoxicity of the HIV coat glycoprotein gp120. These findings suggested a novel function for p53 in regulating microglial activation. Here we report that in the absence of p53, microglia demonstrate a blunted response to interferon-γ, failing to increase expression of genes associated with classical macrophage activation or secrete pro-inflammatory cytokines. Microarray analysis of global gene expression profiles revealed increased expression of genes associated with anti-inflammatory functions, phagocytosis and tissue repair in p53 knockout (p53−/−) microglia compared with those cultured from strain matched p53 expressing (p53+/+) mice. We further observed that p53−/− microglia demonstrate increased phagocytic activity in vitro and expression of markers for alternative macrophage activation both in vitro and in vivo. In HAND brain tissue, the alternative activation marker CD163 was expressed in a separate subset of microglia than those demonstrating p53 accumulation. These data suggest that p53 influences microglial behavior, supporting the adoption of a pro-inflammatory phenotype, while p53 deficiency promotes phagocytosis and gene expression associated with alternative activation and anti-inflammatory functions. PMID:21598312

  14. Accumulation of p53 in infectious mononucleosis tissues.

    PubMed

    Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L

    2000-11-01

    Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company

  15. Transforming growth factor-beta1 mediates cellular response to DNA damage in situ

    NASA Technical Reports Server (NTRS)

    Ewan, Kenneth B.; Henshall-Powell, Rhonda L.; Ravani, Shraddha A.; Pajares, Maria Jose; Arteaga, Carlos; Warters, Ray; Akhurst, Rosemary J.; Barcellos-Hoff, Mary Helen

    2002-01-01

    Transforming growth factor (TGF)-beta1 is rapidly activated after ionizing radiation, but its specific role in cellular responses to DNA damage is not known. Here we use Tgfbeta1 knockout mice to show that radiation-induced apoptotic response is TGF-beta1 dependent in the mammary epithelium, and that both apoptosis and inhibition of proliferation in response to DNA damage decrease as a function of TGF-beta1 gene dose in embryonic epithelial tissues. Because apoptosis in these tissues has been shown previously to be p53 dependent, we then examined p53 protein activation. TGF-beta1 depletion, by either gene knockout or by using TGF-beta neutralizing antibodies, resulted in decreased p53 Ser-18 phosphorylation in irradiated mammary gland. These data indicate that TGF-beta1 is essential for rapid p53-mediated cellular responses that mediate cell fate decisions in situ.

  16. p53 -Dependent and -Independent Nucleolar Stress Responses

    PubMed Central

    Olausson, Karl Holmberg; Nistér, Monica; Lindström, Mikael S.

    2012-01-01

    The nucleolus has emerged as a cellular stress sensor and key regulator of p53-dependent and -independent stress responses. A variety of abnormal metabolic conditions, cytotoxic compounds, and physical insults induce alterations in nucleolar structure and function, a situation known as nucleolar or ribosomal stress. Ribosomal proteins, including RPL11 and RPL5, become increasingly bound to the p53 regulatory protein MDM2 following nucleolar stress. Ribosomal protein binding to MDM2 blocks its E3 ligase function leading to stabilization and activation of p53. In this review we focus on a number of novel regulators of the RPL5/RPL11-MDM2-p53 complex including PICT1 (GLTSCR2), MYBBP1A, PML and NEDD8. p53-independent pathways mediating the nucleolar stress response are also emerging and in particular the negative control that RPL11 exerts on Myc oncoprotein is of importance, given the role of Myc as a master regulator of ribosome biogenesis. We also briefly discuss the potential of chemotherapeutic drugs that specifically target RNA polymerase I to induce nucleolar stress. PMID:24710530

  17. Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

    PubMed

    Llanos, Susana; Serrano, Manuel

    2010-10-01

    Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

  18. Cyclophosphamide dose intensification may circumvent anthracycline resistance of p53 mutant breast cancers.

    PubMed

    Lehmann-Che, Jacqueline; André, Fabrice; Desmedt, Christine; Mazouni, Chafika; Giacchetti, Sylvie; Turpin, Elisabeth; Espié, Marc; Plassa, Louis-François; Marty, Michel; Bertheau, Philippe; Sotiriou, Christos; Piccart, Martine; Symmans, W Fraser; Pusztai, Lajos; de Thé, Hugues

    2010-01-01

    The predictive value of p53 for the efficacy of front-line anthracycline-based chemotherapy regimens has been a matter of significant controversy. Anthracyclines are usually combined with widely different doses of alkylating agents, which may significantly modulate tumor response to these combinations. We analyzed three series of de novo stage II-III breast cancer patients treated front line with anthracycline-based regimens of various cyclophosphamide dose intensities: 65 patients with estrogen receptor (ER)(-) tumors treated with anthracyclines alone (Institut Jules Bordet, Brussels), 51 unselected breast cancer patients treated with intermediate doses of cyclophosphamide (MD Anderson Cancer Center, Houston, TX), and 128 others treated with a dose-dense anthracycline-cyclophosphamide combination (St. Louis, Paris). After chemotherapy and surgery, pathologic complete response (pCR) was evaluated. p53 status was determined by a yeast functional assay on the pretreatment tumor sample. In a multivariate analysis of the pooled results, a lack of ER expression and high-dose cyclophosphamide administration were associated with a higher likelihood of pCR. A sharp statistical interaction was detected between p53 status and cyclophosphamide dose intensity. Indeed, when restricting our analysis to patients with ER(-) tumors, we confirmed that a mutant p53 status was associated with anthracycline resistance, but found that p53 inactivation was required for response to the dose-intense alkylating regimen. The latter allowed very high levels of pCR in triple-negative tumors. Thus, our data strongly suggest that cyclophosphamide dose intensification in ER(-) p53-mutated breast cancer patients could significantly improve their response.

  19. P53 Immune Responses in Breast Cancer Patients: Assessment of CTL Recognizing the HLA-A2.1 Restricted, Wild-type Sequence p53 (264-272) Epitope; Frequencies of Tetramer+ T Cells Specific for the Wild-Type Sequence P53 (264-272) Peptide in the Circulation of Patients with Head and Neck Cancer; The Ability of Variant Peptides to Reverse the Nonresponsiveness of T Lymphocytes to the Wild-Type Sequence P53 (264-272) Epitope

    DTIC Science & Technology

    2002-10-01

    This document contains three papers focusing on the analysis of anti-p53 cellular immune responses of breast, head, neck, and oral cancer patients...variants were generated by amino acid exchanges at positions 6 (6T) and 7 (7W) of the peptide. The 7W variant peptide has potential for immunotherapy of nonresponsive oral cancer patients.

  20. Modeling gene-environment interactions in oral cavity and esophageal cancers demonstrates a role for the p53 R72P polymorphism in modulating susceptibility.

    PubMed

    Sarkar, Jayanta; Dominguez, Emily; Li, Guojun; Kusewitt, Donna F; Johnson, David G

    2014-08-01

    A large number of epidemiological studies have linked a common single-nucleotide polymorphism (SNP) in the human p53 gene to risk for developing a variety of cancers. This SNP encodes either an arginine or proline at position 72 (R72P) of the p53 protein, which can alter the apoptotic activity of p53 via transcriptional and non-transcriptional mechanisms. This SNP has also been reported to modulate the development of human papilloma virus (HPV)-driven cancers through differential targeting of the p53 variant proteins by the E6 viral oncoprotein. Mouse models for the p53 R72P polymorphism have recently been developed but a role for this SNP in modifying cancer risk in response to viral and chemical carcinogens has yet to be established experimentally. Here, we demonstrate that the p53 R72P polymorphism modulates the hyperprolferative, apoptotic and inflammatory phenotypes caused by expression of the HPV16 E6 and E7 oncoproteins. Moreover, the R72P SNP also modifies the carcinogenic response to the chemical carcinogen 4NQO, in the presence and absence of the HPV16 transgene. Our findings confirm several human epidemiological studies associating the codon 72 proline variant with increased risk for certain cancers but also suggest that there are tissue-specific differences in how the R72P polymorphism influences the response to environmental carcinogens. © 2013 Wiley Periodicals, Inc.

  1. Chk1/2 inhibition overcomes the cisplatin resistance of head and neck cancer cells secondary to the loss of functional p53

    PubMed Central

    Gadhikar, Mayur A.; Sciuto, Maria Rita; Alves, Marcus Vinicius Ortega; Pickering, Curtis R.; Osman, Abdullah A.; Neskey, David M.; Zhao, Mei; Fitzgerald, Alison L.; Myers, Jeffrey N.; Frederick, Mitchell J

    2014-01-01

    Despite the use of multimodality therapy employing cisplatin to treat patients with advanced stage head and neck squamous cell carcinoma (HNSCC), there is an unacceptably high rate of treatment failure. TP53 is the most commonly mutated gene in HNSCC, and the impact of p53 mutation on response to cisplatin treatment is poorly understood. Here we show unambiguously that wild type TP53 (wtp53) is associated with sensitivity of HNSCC cells to cisplatin treatment while mutation or loss of TP53 is associated with cisplatin resistance. We also demonstrate that senescence is the major cellular response to cisplatin in wtp53 HNSCC cells and that cisplatin resistance in p53 null or mutant TP53 cells is due to their lack of senescence. Given the dependence on Chk1/2 kinases to mediate the DNA damage response in p53 deficient cells, there is potential to exploit this to therapeutic advantage through targeted inhibition of the Chk1/2 kinases. Treatment of p53 deficient HNSCC cells with the Chk inhibitor AZD7762 sensitizes them to cisplatin through induction of mitotic cell death. This is the first report demonstrating the ability of a Chk kinase inhibitor to sensitize TP53-deficient HNSCC to cisplatin in a synthetic lethal manner, which has significance given the frequency of TP53 mutations in this disease and because cisplatin has become part of standard therapy for aggressive HNSCC tumors. These pre-clinical data provide evidence that a personalized approach to the treatment of HNSCC based on Chk inhibition in p53 mutant tumors may be feasible. PMID:23839309

  2. P53 oncosuppressor influences selection of genomic imbalances in response to ionizing radiations in human osteosarcoma cell line SAOS-2.

    PubMed

    Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra

    2008-07-01

    To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.

  3. Down-regulation of Wild-type p53-induced Phosphatase 1 (Wip1) Plays a Critical Role in Regulating Several p53-dependent Functions in Premature Senescent Tumor Cells*

    PubMed Central

    Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio

    2013-01-01

    Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976

  4. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    PubMed

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Regulation of p53 by reversible post-transcriptional and post-translational mechanisms in liver and skeletal muscle of an anoxia tolerant turtle, Trachemys scripta elegans.

    PubMed

    Zhang, Jing; Biggar, Kyle K; Storey, Kenneth B

    2013-01-15

    The red-eared slider turtle (Trachemys scripta elegans) exhibits well-developed natural anoxia tolerance that depends on multiple biochemical adaptations, including anoxia-induced hypometabolism. We hypothesized that signaling by the p53 protein could aid in establishing the hypometabolic state by arresting the cell cycle, protecting against DNA damage as well as altering pathways of energy metabolism. Immunoblotting was used to evaluate the regulation and post-transcriptional modifications of p53 in liver and skeletal muscle of red-eared slider turtles subjected to 5h or 20h of anoxic submergence. Tissue specific regulation of p53 was observed with the liver showing a more rapid activation of p53 in response to anoxia as well as differential expression of seven serine phosphorylation and two lysine acetylation sites when compared with skeletal muscle. Protein expression of MDM2, a major p53 inhibitor, was also examined but did not change during anoxia. Reverse-transcriptase PCR was used to assess transcript levels of selected p53 target genes (14-3-3σ, Gadd45α and Pgm) and one microRNA (miR-34a); results showed down-regulation of Pgm and up-regulation of the other three. These findings show an activation of p53 in response to anoxia exposure and suggest an important role for the p53 stress response pathway in regulating natural anoxia tolerance and hypometabolism in a vertebrate facultative anaerobe. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Transcription factor Sox4 is required for PUMA-mediated apoptosis induced by histone deacetylase inhibitor, TSA.

    PubMed

    Jang, Sang-Min; Kang, Eun-Jin; Kim, Jung-Woong; Kim, Chul-Hong; An, Joo-Hee; Choi, Kyung-Hee

    2013-08-23

    PUMA is a crucial regulator of apoptotic cell death mediated by p53-dependent and p53-independent mechanisms. In many cancer cells, PUMA expression is induced in response to DNA-damaging reagent in a p53-dependent manner. However, few studies have investigated transcription factors that lead to the induction of PUMA expression via p53-independent apoptotic signaling. In this study, we found that the transcription factor Sox4 increased PUMA expression in response to trichostatin A (TSA), a histone deacetylase inhibitor in the p53-null human lung cancer cell line H1299. Ectopic expression of Sox4 led to the induction of PUMA expression at the mRNA and protein levels, and TSA-mediated up-regulation of PUMA transcription was repressed by the knockdown of Sox4. Using luciferase assays and chromatin immunoprecipitation, we also determined that Sox4 recruits p300 on the PUMA promoter region and increases PUMA gene expression in response to TSA treatment. Taken together, these results suggest that Sox4 is required for p53-independent apoptotic cell death mediated by PUMA induction via TSA treatment. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.

  7. The critical role of catalase in prooxidant and antioxidant function of p53

    PubMed Central

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

    2013-01-01

    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  8. GmWRKY53, a water- and salt-inducible soybean gene for rapid dissection of regulatory elements in BY-2 cell culture

    PubMed Central

    Tripathi, Prateek; Rabara, Roel C.; Lin, Jun; Rushton, Paul J.

    2013-01-01

    Drought is the major cause of crop losses worldwide. Water stress-inducible promoters are important for understanding the mechanisms of water stress responses in crop plants. Here we utilized tobacco (Nicotiana tabacum L.) Bright Yellow 2 (BY-2) cell system in presence of polyethylene glycol, salt and phytohormones. Extension of the system to 85 mM NaCl led to inducibility of up to 10-fold with the water stress and salt responsive soybean GmWRKY53 promoter. Upon ABA and JA treatment fold inducibility was up to 5-fold and 14-fold, respectively. Thus, we hypothesize that GmWRKY53 could be used as potential model candidate for dissecting drought regulatory elements as well as understanding crosstalk utilizing a rapid heterologous system of BY-2 culture. PMID:23511199

  9. Reactivating p53 and Inducing Tumor Apoptosis (RITA) Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin.

    PubMed

    Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph

    2017-04-01

    Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 <3.0 μmol/l) were identified within established (4/9) and primary patient-derived (2/5) CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC cells within both panels of established CRC cell lines and primary patient-derived CRC cell lines (6/14) that provide a rationale for combining RITA with 5FU or oxaliplatin to enhance the antiproliferative response to both chemotherapeutic agents. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Activation of p53 Transcriptional Activity by SMRT: a Histone Deacetylase 3-Independent Function of a Transcriptional Corepressor

    PubMed Central

    Adikesavan, Anbu Karani; Karmakar, Sudipan; Pardo, Patricia; Wang, Liguo; Liu, Shuang; Li, Wei

    2014-01-01

    The silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) is an established histone deacetylase 3 (HDAC3)-dependent transcriptional corepressor. Microarray analyses of MCF-7 cells transfected with control or SMRT small interfering RNA revealed SMRT regulation of genes involved in DNA damage responses, and the levels of the DNA damage marker γH2AX as well as poly(ADP-ribose) polymerase cleavage were elevated in SMRT-depleted cells treated with doxorubicin. A number of these genes are established p53 targets. SMRT knockdown decreased the activity of two p53-dependent reporter genes as well as the expression of p53 target genes, such as CDKN1A (which encodes p21). SMRT bound directly to p53 and was recruited to p53 binding sites within the p21 promoter. Depletion of GPS2 and TBL1, components of the SMRT corepressor complex, but not histone deacetylase 3 (HDAC3) decreased p21-luciferase activity. p53 bound to the SMRT deacetylase activation domain (DAD), which mediates HDAC3 binding and activation, and HDAC3 could attenuate p53 binding to the DAD region of SMRT. Moreover, an HDAC3 binding-deficient SMRT DAD mutant coactivated p53 transcriptional activity. Collectively, these data highlight a biological role for SMRT in mediating DNA damage responses and suggest a model where p53 binding to the DAD limits HDAC3 interaction with this coregulator, thereby facilitating SMRT coactivation of p53-dependent gene expression. PMID:24449765

  11. p53 suppresses hyper-recombination by modulating BRCA1 function

    PubMed Central

    Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui

    2015-01-01

    Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908

  12. Plant HDAC inhibitor chrysin arrest cell growth and induce p21WAF1 by altering chromatin of STAT response element in A375 cells

    PubMed Central

    2012-01-01

    Background Chrysin and its analogues, belongs to flavonoid family and possess potential anti-tumour activity. The aim of this study is to determine the molecular mechanism by which chrysin controls cell growth and induce apoptosis in A375 cells. Methods Effect of chrysin and its analogues on cell viability and cell cycle analysis was determined by MTT assay and flowcytometry. A series of Western blots was performed to determine the effect of chrysin on important cell cycle regulatory proteins (Cdk2, cyclin D1, p53, p21, p27). The fluorimetry and calorimetry based assays was conducted for characterization of chrysin as HDAC inhibitor. The changes in histone tail modification such as acetylation and methylation was studied after chrysin treatment was estimated by immuno-fluorescence and western blot analysis. The expression of Bcl-xL, survivin and caspase-3 was estimated in chrysin treated cells. The effect of chrysin on p21 promoter activity was studied by luciferase and ChIP assays. Results Chrysin cause G1 cell cycle arrest and found to inhibit HDAC-2 and HDAC-8. Chrysin treated cells have shown increase in the levels of H3acK14, H4acK12, H4acK16 and decrease in H3me2K9 methylation. The p21 induction by chrysin treatment was found to be independent of p53 status. The chromatin remodelling at p21WAF1 promoter induces p21 activity, increased STAT-1 expression and epigenetic modifications that are responsible for ultimate cell cycle arrest and apoptosis. Conclusion Chrysin shows in vitro anti-cancer activity that is correlated with induction of histone hyperacetylation and possible recruitment of STAT-1, 3, 5 proteins at STAT (−692 to −684) region of p21 promoter. Our results also support an unexpected action of chrysin on the chromatin organization of p21WAF1 promoter through histone methylation and hyper-acetylation. It proposes previously unknown sequence specific chromatin modulations in the STAT responsive elements for regulating cell cycle progression negatively via the induction of the CDK inhibitor p21WAF1. PMID:22591439

  13. Battle against cancer: an everlasting saga of p53.

    PubMed

    Hao, Qian; Cho, William C

    2014-12-01

    Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  14. Expression of p53 protein in advanced head and neck squamous cell carcinoma before and after chemotherapy.

    PubMed

    Dunphy, C H; Dunphy, F R; Boyd, J H; Varvares, M A; Kim, H J; Lowe, V; Dunleavy, T L; Rodriguez, J; McDonough, E M; Minster, J

    1997-11-01

    The expression of p53 protein has been reported to be in the range of 35% to 67% in head and neck squamous cell carcinoma (HNSCC). Mutations of the gene for p53 protein have been associated with rapidly proliferating tumors, and p53 protein expression has been shown to be a significant predictor of worse survival in surgically resected HNSCC. To determine whether p53 protein expression in advanced (stages III and IV) HNSCC has any impact on tumor response to 2 to 3 courses of paclitaxel (Taxol) and carboplatin, we prospectively studied prechemotherapy specimens from patients with previously untreated, advanced-stage HNSCC. We also attempted to study residual tumors after chemotherapy to determine if the p53 status of the tumor changed. The expression of p53 protein was evaluated by immunohistochemical analysis (clone BP53-12-1; Bio-Genex, San Ramon, Calif). Tertiary university medical center. Two to 3 courses of chemotherapy with paclitaxel and carboplatin. Pathologic complete remission or residual tumor. The results of p53 immunostaining were positive in 24 (67%) of 36 HNSCC specimens before chemotherapy. After chemotherapy, 8 patients achieved pathologic complete remission. Before chemotherapy, the tumor was p53 negative in 2 patients and positive in 6 patients. No correlation of p53 protein expression with response to chemotherapy was noted. The expression of p53 protein converted from positive to negative in 5 (42%) of 12 specimens from patients with residual tumor after chemotherapy, with no impact on clinical outcome.

  15. p53 targets chromatin structure alteration to repress alpha-fetoprotein gene expression.

    PubMed

    Ogden, S K; Lee, K C; Wernke-Dollries, K; Stratton, S A; Aronow, B; Barton, M C

    2001-11-09

    Many of the functions ascribed to p53 tumor suppressor protein are mediated through transcription regulation. We have shown that p53 represses hepatic-specific alpha-fetoprotein (AFP) gene expression by direct interaction with a composite HNF-3/p53 DNA binding element. Using solid-phase, chromatin-assembled AFP DNA templates and analysis of chromatin structure and transcription in vitro, we find that p53 binds DNA and alters chromatin structure at the AFP core promoter to regulate transcription. Chromatin assembled in the presence of hepatoma extracts is activated for AFP transcription with an open, accessible core promoter structure. Distal (-850) binding of p53 during chromatin assembly, but not post-assembly, reverses transcription activation concomitant with promoter inaccessibility to restriction enzyme digestion. Inhibition of histone deacetylase activity by trichostatin-A (TSA) addition, prior to and during chromatin assembly, activated chromatin transcription in parallel with increased core promoter accessibility. Chromatin immunoprecipitation analyses showed increased H3 and H4 acetylated histones at the core promoter in the presence of TSA, while histone acetylation remained unchanged at the site of distal p53 binding. Our data reveal that p53 targets chromatin structure alteration at the core promoter, independently of effects on histone acetylation, to establish repressed AFP gene expression.

  16. Editor's Highlight: Hydroxyurea Exposure Activates the P53 Signaling Pathway in Murine Organogenesis-Stage Embryos

    PubMed Central

    El Husseini, Nazem; Schlisser, Ava E.; Hales, Barbara F.

    2016-01-01

    Hydroxyurea, an anticancer agent and potent teratogen, induces oxidative stress and activates a DNA damage response pathway in the gestation day (GD) 9 mouse embryo. To delineate the stress response pathways activated by this drug, we investigated the effect of hydroxyurea exposure on the transcriptome of GD 9 embryos. Timed pregnant CD-1 mice were treated with saline or hydroxyurea (400 mg/kg or 600 mg/kg) on GD 9; embryonic gene and protein expression were examined 3 h later. Microarray analysis revealed that the expression of 1346 probe sets changed significantly in embryos exposed to hydroxyurea compared with controls; the P53 signaling pathway was highly affected. In addition, P53 related family members, P63 and P73, were predicted to be activated and had common and unique downstream targets. Western blot analysis revealed that active phospho-P53 was significantly increased in drug-exposed embryos; confocal microscopy showed that the translocation of phospho-P53 to the nucleus was widespread in the embryo. Furthermore, qRT-PCR showed that the expression of P53-regulated genes (Cdkn1A, Fas, and Trp53inp1) was significantly upregulated in hydroxyurea-exposed embryos; the concentration of the redox sensitive P53INP1 protein was also increased in a hydroxyurea dose-dependent fashion. Thus, hydroxyurea elicits a significant effect on the transcriptome of the organogenesis stage murine embryo, activating several key developmental signaling pathways related to DNA damage and oxidative stress. We propose that the P53 pathway plays a central role in the embryonic stress response and the developmental outcome after teratogen exposure. PMID:27208086

  17. Comparison of the protein-protein interfaces in the p53-DNA crystal structures: towards elucidation of the biological interface.

    PubMed

    Ma, Buyong; Pan, Yongping; Gunasekaran, K; Venkataraghavan, R Babu; Levine, Arnold J; Nussinov, Ruth

    2005-03-15

    p53, the tumor suppressor protein, functions as a dimer of dimers. However, how the tetramer binds to the DNA is still an open question. In the crystal structure, three copies of the p53 monomers (containing chains A, B, and C) were crystallized with the DNA-consensus element. Although the structure provides crucial data on the p53-DNA contacts, the active oligomeric state is unclear because the two dimeric (A-B and B-C) interfaces present in the crystal cannot both exist in the tetramer. Here, we address the question of which of these two dimeric interfaces may be more biologically relevant. We analyze the sequence and structural properties of the p53-p53 dimeric interfaces and carry out extensive molecular dynamics simulations of the crystal structures of the human and mouse p53 dimers. We find that the A-B interface residues are more conserved than those of the B-C. Molecular dynamics simulations show that the A-B interface can provide a stable DNA-binding motif in the dimeric state, unlike B-C. Our results indicate that the interface between chains A-B in the p53-DNA complex constitutes a better candidate for a stable biological interface, whereas the B-C interface is more likely to be due to crystal packing. Thus, they have significant implications toward our understanding of DNA binding by p53 as well as p53-mediated interactions with other proteins.

  18. Studies of ATM Kinase Activity Using Engineered ATM Sensitive to ATP Analogues (ATM-AS).

    PubMed

    Enari, Masato; Matsushima-Hibiya, Yuko; Miyazaki, Makoto; Otomo, Ryo

    2017-01-01

    Ataxia-telangiectasia mutated (ATM) protein is a member of the phosphatidylinositol 3-phosphate kinase (PI3-K)-related protein kinase (PIKK) family and is implicated in the initiation of signaling pathways following DNA double strand breaks (DSBs) elicited by exposure to ionizing irradiation (IR) or radiomimetic compounds. Loss of function of the ATM gene product results in the human genetic disorder ataxia-telangiectasia (A-T) characterized by neurodegeneration, immunodeficiency, genomic instability, and cancer predisposition. In response to DSBs, ATM is activated and phosphorylates Ser/Thr-Gln (S/T-Q) sequences on numerous proteins participating in DNA-damage responses. Among these proteins, phosphorylation of the tumor suppressor p53 at Ser15 is known as a target for ATM, which leads to the dissociation of MDM2, an E3 ubiquitin ligase, from p53 to prevent MDM2-dependent p53 degradation. Ser46 on p53 is phosphorylated in response to DSBs and contributes to the preferential transactivation of pro-apoptotic genes, such as p53AIP1, Noxa, and PUMA, to prevent tumor formation. Our group have shown that not only ATM preferentially phosphorylates S/T-Q sequences, but also Ser46, which is a noncanonical site with an S-P sequence for ATM. Ser46 on p53 is directly phosphorylated by ATM in a p53 conformation-dependent manner using the ATP analogue-accepting ATM mutant (ATM-AS) system. This protocol summarizes an approach to identify direct numerous targets for ATM kinase and is used to elucidate ATM signaling pathways in the DNA damage responses.

  19. Vernolide-A, a sesquiterpene lactone from Vernonia cinerea, induces apoptosis in B16F-10 melanoma cells by modulating p53 and caspase-3 gene expressions and regulating NF-κB-mediated bcl-2 activation.

    PubMed

    Pratheeshkumar, Poyil; Kuttan, Girija

    2011-07-01

    In this study, we investigated the effect of vernolide-A on the induction of apoptosis as well as its regulatory effect on the activation of transcription factors in B16F-10 melanoma cells. Treatment of B16F-10 cells with nontoxic concentrations of vernolide-A showed the presence of apoptotic bodies and induced DNA fragmentation in a dose-dependent manner. Cell-cycle analysis and TUNEL assays also confirmed the observation. The proapoptotic genes, p53, Bax, caspase-9, and caspase-3, were upregulated in vernolide-A-treated cells, whereas the antiapoptotic gene, Bcl-2, was downregulated. vernolide-A treatment also showed a downregulation of cyclin D1 expression and upregulated p21 and p27 gene expression in B16F-10 melanoma cells. The study also reveals that vernolide-A treatment could alter the production and expression of proinflammatory cytokines and could inhibit the activation and nuclear translocation of p65, p50, and c-Rel subunits of nuclear factor-κB and other transcription factors, such as c-fos, activated transcription factor-2, and cyclic adenosine monophosphate response-element-binding protein in B16F-10 melanoma cells. These results suggest that vernolide-A induces apoptosis via activation of p53-induced, caspase-3-mediated proapoptotic signaling and suppression of NF-κB-induced, bcl-2-mediated survival signaling.

  20. Inhibition of proliferation and induction of apoptosis in soft tissue sarcoma cells by interferon-α and retinoids

    PubMed Central

    Brodowicz, T; Wiltschke, C; Kandioler-Eckersberger, D; Grunt, T W; Rudas, M; Schneider, S M; Hejna, M; Budinsky, A; Zielinski, C C

    1999-01-01

    Uncontrolled proliferation and a defect of apoptosis constitute crucial elements in the development and progression of tumours. Among many other biological response modifiers known to influence these mechanisms, the efficacy of retinoids and interferons in the treatment of various malignant entities is currently matter of discussion. In the present study, we have investigated the effects of 9-cis-retinoic acid (9cRA), 13-cis-retinoic acid (13cRA), all-trans-retinoic acid (tRA) and interferon-α on proliferation and apoptosis of human soft tissue sarcoma (STS) cell lines HTB-82 (rhabdomyosarcoma), HTB-91 (fibrosarcoma), HTB-92 (liposarcoma), HTB-93 (synovial sarcoma) and HTB-94 (chondrosarcoma) in relation to p53 genotype as well as p53 expression. HTB-91, HTB-92 and HTB-94 STS cells exhibited mutant p53, whereas wild-type p53 was found in HTB-93 STS cells, and a normal p53 status in HTB-82 STS cells, carrying a silent point mutation only. Interferon-α, irrespective of p53 status, inhibited the proliferation of all five cell lines dose- and time-dependently. Similarly, 9cRA, 13cRA and tRA decreased the proliferation of HTB-82 and HTB-93 STS cells, whereas the proliferation of p53-mutated HTB-91, HTB-92 and HTB-94 STS cells remained unchanged. Furthermore, only 9cRA and tRA were capable of inducing apoptosis in HTB-82 and HTB-93 STS cells, whereas HTB-91, HTB-92 and HTB-94 STS cells did not undergo apoptosis under the influence of 9cRA or tRA. Retinoic acid receptor (RAR)-α and RAR-β mRNA were not detectable by Northern blot analysis in the five STS cell lines, whereas mRNA for the universal retinoic acid receptor, RAR-γ, was expressed in all STS cell lines indicating that retinoid resistance was not associated with a lack of RAR expression. Apoptosis was not induced by interferon-α or 13cRA in any of the five STS cell lines tested. Our results indicate that within the panel of tested STS cell lines, inhibition of proliferation and induction of apoptosis result from different mechanisms which differ in their dependence upon the presence of intact p53. © 1999 Cancer Research Campaign PMID:10424735

  1. Inhibition of Mdm2 Sensitizes Human Retinal Pigment Epithelial Cells to Apoptosis

    PubMed Central

    Ray, Ramesh M.; Chaum, Edward; Johnson, Dianna A.; Johnson, Leonard R.

    2011-01-01

    Purpose. Because recent studies indicate that blocking the interaction between p53 and Mdm2 results in the nongenotoxic activation of p53, the authors sought to investigate whether the inhibition of p53-Mdm2 binding activates p53 and sensitizes human retinal epithelial cells to apoptosis. Methods. Apoptosis was evaluated by the activation of caspases and DNA fragmentation assays. The Mdm2 antagonist Nutlin-3 was used to dissociate p53 from Mdm2 and, thus, to increase p53 activity. Knockdown of p53 expression was accomplished by using p53 siRNA. Results. ARPE-19 and primary RPE cells expressed high levels of the antiapoptotic proteins Bcl-2 and Bcl-xL. Exposure of these cells to camptothecin (CPT) or TNF-α/ cycloheximide (CHX) failed to induce apoptosis. In contrast, treatment with the Mdm2 antagonist Nutlin-3 in the absence of CPT or TNF-α/CHX increased apoptosis. Activation of p53 in response to Nutlin-3 also increased levels of Noxa, p53-upregulated modulator of apoptosis (PUMA), and Siva-1, decreased expression of Bcl-2 and Bcl-xL, and simultaneously increased caspases-9 and -3 activities and DNA fragmentation. Knockdown of p53 decreased the basal expression of p21Cip1 and Bcl-2, inhibited the Nutlin-3–induced upregulation of Siva-1 and PUMA expression, and consequently inhibited caspase-3 activation. Conclusions. These results indicate that the normally available pool of intracellular p53 is predominantly engaged in the regulation of cell cycle checkpoints by p21Cip1 and does not trigger apoptosis in response to DNA-damaging agents. However, the blockage of p53 binding to Mdm2 frees a pool of p53 that is sufficient, even in the absence of DNA-damaging agents, to increase the expression of proapoptotic targets and to override the resistance of RPE cells to apoptosis. PMID:21345989

  2. Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway

    PubMed Central

    Llanos, Susana; Serrano, Manuel

    2013-01-01

    Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage. PMID:20935493

  3. Inositol polyphosphate multikinase is a coactivator for serum response factor-dependent induction of immediate early genes

    PubMed Central

    Kim, Eunha; Tyagi, Richa; Lee, Joo-Young; Park, Jina; Kim, Young-ran; Beon, Jiyoon; Chen, Po Yu; Cha, Jiyoung Y.; Snyder, Solomon H.; Kim, Seyun

    2013-01-01

    Inositol polyphosphate multikinase (IPMK) is a notably pleiotropic protein. It displays both inositol phosphate kinase and phosphatidylinositol kinase catalytic activities. Noncatalytically, IPMK stabilizes the mammalian target of rapamycin complex 1 and acts as a transcriptional coactivator for CREB-binding protein/E1A binding protein p300 and tumor suppressor protein p53. Serum response factor (SRF) is a major transcription factor for a wide range of immediate early genes. We report that IPMK, in a noncatalytic role, is a transcriptional coactivator for SRF mediating the transcription of immediate early genes. Stimulation by serum of many immediate early genes is greatly reduced by IPMK deletion. IPMK stimulates expression of these genes, an influence also displayed by catalytically inactive IPMK. IPMK acts by binding directly to SRF and thereby enhancing interactions of SRF with the serum response element of diverse genes. PMID:24248338

  4. Regulation of autophagy by cytoplasmic p53.

    PubMed

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  5. Role of TP53 mutations in triple negative and HER2-positive breast cancer treated with neoadjuvant anthracycline/taxane-based chemotherapy.

    PubMed

    Darb-Esfahani, Silvia; Denkert, Carsten; Stenzinger, Albrecht; Salat, Christoph; Sinn, Bruno; Schem, Christian; Endris, Volker; Klare, Peter; Schmitt, Wolfgang; Blohmer, Jens-Uwe; Weichert, Wilko; Möbs, Markus; Tesch, Hans; Kümmel, Sherko; Sinn, Peter; Jackisch, Christian; Dietel, Manfred; Reimer, Toralf; Loi, Sherene; Untch, Michael; von Minckwitz, Gunter; Nekljudova, Valentina; Loibl, Sibylle

    2016-10-18

    TP53 mutations are frequent in breast cancer, however their clinical relevance in terms of response to chemotherapy is controversial. 450 pre-therapeutic, formalin-fixed, paraffin-embedded core biopsies from the phase II neoadjuvant GeparSixto trial that included HER2-positive and triple negative breast cancer (TNBC) were subjected to Sanger sequencing of exons 5-8 of the TP53 gene. TP53 status was correlated to response to neoadjuvant anthracycline/taxane-based chemotherapy with or without carboplatin and trastuzumab/lapatinib in HER2-positive and bevacizumab in TNBC. p53 protein expression was evaluated by immunohistochemistry in the TNBC subgroup. Of 450 breast cancer samples 297 (66.0%) were TP53 mutant. Mutations were significantly more frequent in TNBC (74.8%) compared to HER2-positive cancers (55.4%, P < 0.0001). Neither mutations nor different mutation types and effects were associated with pCR neither in the whole study group nor in molecular subtypes (P > 0.05 each). Missense mutations tended to be associated with a better survival compared to all other types of mutations in TNBC (P = 0.093) and in HER2-positive cancers (P = 0.071). In TNBC, missense mutations were also linked to higher numbers of tumor-infiltrating lymphocytes (TILs, P = 0.028). p53 protein overexpression was also linked with imporved survival (P = 0.019). Our study confirms high TP53 mutation rates in TNBC and HER2-positive breast cancer. Mutations did not predict the response to an intense neoadjuvant chemotherapy in these two molecular breast cancer subtypes.

  6. Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min

    Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less

  7. TRIM25 has a dual function in the p53/Mdm2 circuit.

    PubMed

    Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C

    2015-11-12

    P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context.

  8. p53 regulates mesenchymal stem cell-mediated tumor suppression in a tumor microenvironment through immune modulation.

    PubMed

    Huang, Y; Yu, P; Li, W; Ren, G; Roberts, A I; Cao, W; Zhang, X; Su, J; Chen, X; Chen, Q; Shou, P; Xu, C; Du, L; Lin, L; Xie, N; Zhang, L; Wang, Y; Shi, Y

    2014-07-17

    p53 is one of the most studied genes in cancer biology, and mutations in this gene may be predictive for the development of many types of cancer in humans and in animals. However, whether p53 mutations in non-tumor stromal cells can affect tumor development has received very little attention. In this study, we show that B16F0 melanoma cells form much larger tumors in p53-deficient mice than in wild-type mice, indicating a potential role of p53 deficiency in non-tumor cells of the microenvironment. As mesenchymal stem cells (MSCs) are attracted to tumors and form a major component of the tumor microenvironment, we examined the potential role of p53 status in MSCs in tumor development. We found that larger tumors resulted when B16F0 melanoma cells were co-injected with bone marrow MSCs derived from p53-deficient mice rather than MSCs from wild-type mice. Interestingly, this tumor-promoting effect by p53-deficient MSCs was not observed in non-obese diabetic/severe combined immunodeficiency mice, indicating the immune response has a critical role. Indeed, in the presence of inflammatory cytokines, p53-deficient MSCs expressed more inducible nitric oxide synthase (iNOS) and exhibited greater immunosuppressive capacity. Importantly, tumor promotion by p53-deficient MSCs was abolished by administration of S-methylisothiourea, an iNOS inhibitor. Therefore, our data demonstrate that p53 status in tumor stromal cells has a key role in tumor development by modulating immune responses.

  9. Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yi Fuming; Saha, Abhik; Murakami, Masanao

    The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less

  10. Hsp70- and p53-reponses after heat treatment and/or X-irradiation mediate the susceptibility of hematopoietic cells to undergo apoptosis.

    PubMed

    Nijhuis, E H A; Poot, A A; Feijen, J; Vermes, I

    2008-02-01

    The effect of heat treatment in combination with X-irradiation was examined with regard to expression of p53, a tumor suppressor gene product, and Hsp70, a heat-shock protein, in association with the occurrence of programmed cell death (apoptosis). Three hematopoietic cell lines (HSB2, HL60 and Kasumi-1), which differ in p53 status, were exposed to 42.5 degrees C during one hour and/or X-radiation (total dose 8 Gy). After exposure, both mRNA and protein expression levels of Hsp70 and p53 were investigated by real-time PCR (polymerase chain reaction) and Western blotting. Apoptosis was simultaneously analyzed by observation of cell morphology as well as flowcytometric determination of Annexin V binding to phosphatidylserine and propidium iodide exclusion. Both HL60 and HSB2 cell lines with a low p53 status and a quick response to heat treatment with Hsp70 over-expression are less susceptible to heat-induced apoptosis compared to Kasumi-1 cells with wild-type p53 protein and no Hsp70 response. The combination of first applying X-irradiation followed by heat treatment resulted in the most effective induction of apoptosis due to impairment of the Hsp70 response in all three cell lines. These results indicate that the Hsp70 response and p53 status mediate the susceptibility of hematopoietic cells to undergo heat-induced apoptosis. Therefore, these parameters can be used as markers to predict the effectiveness of hyperthermia in cancer treatment.

  11. Wt-p53 action in human leukaemia cell lines corresponding to different stages of differentiation.

    PubMed

    Rizzo, M G; Zepparoni, A; Cristofanelli, B; Scardigli, R; Crescenzi, M; Blandino, G; Giuliacci, S; Ferrari, S; Soddu, S; Sacchi, A

    1998-05-01

    Recent studies support the potential application of the wt-p53 gene in cancer therapy. Expression of exogenous wt-p53 suppresses a variety of leukaemia phenotypes by acting on cell survival, proliferation and/or differentiation. As for tumour gene therapy, the final fate of the neoplastic cells is one of the most relevant points. We examined the effects of exogenous wt-p53 gene expression in several leukaemia cell lines to identify p53-responsive leukaemia. The temperature-sensitive p53Val135 mutant or the human wt-p53 cDNA was transduced in leukaemia cell lines representative of different acute leukaemia FAB subtypes, including M1 (KG1), M2 (HL-60), M3 (NB4), M5 (U937) and M6 (HEL 92.1.7), as well as blast crisis of chronic myelogenous leukaemia (BC-CML: K562, BV173) showing diverse differentiation features. By morphological, molecular and biochemical analyses, we have shown that exogenous wt-p53 gene expression induces apoptosis only in cells corresponding to M1, M2 and M3 of the FAB classification and in BC-CML showing morphological and cytochemical features of undifferentiated blast cells. In contrast, it promotes differentiation in the others. Interestingly, cell responsiveness was independent of the vector used and the status of the endogenous p53 gene.

  12. Similarities and differences in the p53-mdm2 and NF-kB feedback loops

    NASA Astrophysics Data System (ADS)

    Krishna, Sandeep

    2008-03-01

    Ultradian oscillations in the p53 and NF-kB signalling systems are produced using similar mechanisms: a negative feedback loop combined with an effective time delay. However, seemingly small differences in the molecular implementation of this mechanism mean that the NF-kB system is in equilibrium in the resting state, while the p53 system is far from equilibrium. I will discuss how this affects the dynamical response of the systems. In particular, I will argue that the nonequilibrium driving makes the p53 system respond much faster to external stimuli than the NF-kB system. The interesting question then is whether this makes sense physiologically, and is consistent with the fact that p53 triggers cell-cycle arrest and apoptosis, while NF-kB triggers the immune response.

  13. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    PubMed

    Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM.

  14. Targeting p53 via JNK Pathway: A Novel Role of RITA for Apoptotic Signaling in Multiple Myeloma

    PubMed Central

    Saha, Manujendra N.; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D.; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM. PMID:22276160

  15. The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line.

    PubMed

    Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen

    2018-06-01

    The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

  16. Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway.

    PubMed

    Namba, Takushi; Chu, Kiki; Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W

    2015-08-21

    Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53.

  17. Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway

    PubMed Central

    Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W.

    2015-01-01

    Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53. PMID:26254280

  18. Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.

    PubMed

    Suppiah, Aravind; Greenman, John

    2013-08-07

    Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.

  19. The c-Abl signaling network in the radioadaptive response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chi-Min, Yuan

    2014-01-28

    The radioadaptive response, or radiation hormesis, i.e. a low dose of radiation can protect cells and organisms from the effects of a subsequent higher dose, is a widely recognized phenomenon. Mechanisms underlying such radiation hormesis, however, remain largely unclear. Preliminary studies indicate an important role of c-Abl signaling in mediating the radioadaptive response. We propose to investigate how c-Abl regulates the crosstalk between p53 and NFκB in response to low doses irradiation. We found in our recent study that low dose IR induces a reciprocal p53 suppression and NFκB activation, which induces HIF-a and subsequently a metabolic reprogramming resulting inmore » a transition from oxidative phosphorylation to glycolysis. Of importance is that this glycolytic switch is essential for the radioadaptive response. This low-dose radiationinduced HIF1α activation was in sharp contrast with the high-dose IR-induced p53 activation and HIF1α inhibition. HIF1α and p53 seem to play distinct roles in mediating the radiation dose-dependent metabolic response. The induction of HIF1α-mediated glycolysis is restricted to a low dose range of radiation, which may have important implications in assessing the level of radiation exposure and its potential health risk. Our results support a dose-dependent metabolic response to IR. When IR doses are below the threshold of causing detectable DNA damage (<0.2Gy) and thus little p53 activation, HIF1α is induced resulting in induction of glycolysis and increased radiation resistance. When the radiation dose reaches levels eliciting DNA damage, p53 is activated and diminishes the activity of HIF1α and glycolysis, leading to the induction of cell death. Our work challenges the LNT model of radiation exposure risk and provides a metabolic mechanism of radioadaptive response. The study supports a need for determining the p53 and HIF1α activity as a potential reliable biological readout of radiation exposure in humans. The exquisite sensitivity of cellular metabolism to low doses of radiation could also serve as a valuable biomarker for estimating the health effects of low-level radiation exposure.« less

  20. Regulation of autophagy by cytoplasmic p53

    PubMed Central

    Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2009-01-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141

  1. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity

    PubMed Central

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363

  2. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    PubMed

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  3. Role of TP53 mutations in triple negative and HER2-positive breast cancer treated with neoadjuvant anthracycline/taxane-based chemotherapy

    PubMed Central

    Darb-Esfahani, Silvia; Denkert, Carsten; Stenzinger, Albrecht; Salat, Christoph; Sinn, Bruno; Schem, Christian; Endris, Volker; Klare, Peter; Schmitt, Wolfgang; Blohmer, Jens-Uwe; Weichert, Wilko; Möbs, Markus; Tesch, Hans; Kümmel, Sherko; Sinn, Peter; Jackisch, Christian; Dietel, Manfred; Reimer, Toralf; Loi, Sherene; Untch, Michael; von Minckwitz, Gunter; Nekljudova, Valentina; Loibl, Sibylle

    2016-01-01

    Background TP53 mutations are frequent in breast cancer, however their clinical relevance in terms of response to chemotherapy is controversial. Methods 450 pre-therapeutic, formalin-fixed, paraffin-embedded core biopsies from the phase II neoadjuvant GeparSixto trial that included HER2-positive and triple negative breast cancer (TNBC) were subjected to Sanger sequencing of exons 5-8 of the TP53 gene. TP53 status was correlated to response to neoadjuvant anthracycline/taxane-based chemotherapy with or without carboplatin and trastuzumab/lapatinib in HER2-positive and bevacizumab in TNBC. p53 protein expression was evaluated by immunohistochemistry in the TNBC subgroup. Results Of 450 breast cancer samples 297 (66.0%) were TP53 mutant. Mutations were significantly more frequent in TNBC (74.8%) compared to HER2-positive cancers (55.4%, P < 0.0001). Neither mutations nor different mutation types and effects were associated with pCR neither in the whole study group nor in molecular subtypes (P > 0.05 each). Missense mutations tended to be associated with a better survival compared to all other types of mutations in TNBC (P = 0.093) and in HER2-positive cancers (P = 0.071). In TNBC, missense mutations were also linked to higher numbers of tumor-infiltrating lymphocytes (TILs, P = 0.028). p53 protein overexpression was also linked with imporved survival (P = 0.019). Conclusions Our study confirms high TP53 mutation rates in TNBC and HER2-positive breast cancer. Mutations did not predict the response to an intense neoadjuvant chemotherapy in these two molecular breast cancer subtypes. PMID:27611952

  4. Global Conformational Selection and Local Induced Fit for the Recognition between Intrinsic Disordered p53 and CBP

    PubMed Central

    Yu, Qingfen; Ye, Wei; Wang, Wei; Chen, Hai-Feng

    2013-01-01

    The transactivation domain (TAD) of tumor suppressor p53 can bind with the nuclear coactivator binding domain (NCBD) of cyclic-AMP response element binding protein (CBP) and activate transcription. NMR experiments demonstrate that both apo-NCBD and TAD are intrinsic disordered and bound NCBD/TAD undergoes a transition to well folded. The recognition mechanism between intrinsic disordered proteins is still hotly debated. Molecular dynamics (MD) simulations in explicit solvent are used to study the recognition mechanism between intrinsic disordered TAD and NCBD. The average RMSD values between bound and corresponding apo states and Kolmogorov-Smirnov P test analysis indicate that TAD and NCBD may follow an induced fit mechanism. Quantitative analysis indicates there is also a global conformational selection. In summary, the recognition of TAD and NCBD might obey a local induced fit and global conformational selection. These conclusions are further supported by high-temperature unbinding kinetics and room temperature landscape analysis. These methods can be used to study the recognition mechanism of other intrinsic disordered proteins. PMID:23555731

  5. Silencing of p53 RNA through transarterial delivery ameliorates renal tubular injury and downregulates GSK-3β expression after ischemia-reperfusion injury.

    PubMed

    Fujino, Takayuki; Muhib, Sharifi; Sato, Nobuyuki; Hasebe, Naoyuki

    2013-12-01

    p53, a pivotal protein in the apoptotic pathway, has been identified as a mediator of transcriptional responses to ischemia-reperfusion (IR) injury. The characteristics and functional significance of the p53 response in vivo are largely unknown in IR-induced kidney injury. Therapeutic opportunities of delivering small interfering RNA (siRNA) via venous injection have gained recognition; however, systemic adverse effects of siRNA therapy should be considered. To prevent IR-induced kidney injury, we tested the efficacy of transarterial administration of siRNA targeting p53 (p53 siRNA). Female C57BL/6 mice underwent unilateral renal artery ischemia for 30 min, followed by reperfusion. siRNA experiments utilized short hairpin (sh) RNA plasmid-based approaches. Transfection of shRNA was performed using cationic polymer transfection reagent. Injection of synthetic p53 shRNA into the left renal artery just after ischemia improved tubular injury, apoptosis, and the swelling of mitochondria in cells of the thick ascending limb of Henle (mTALH) at the outer medullary regions. Staining of upregulated p53 was colocalized with the inducible expression of glycogen synthase kinase-3β (GSK-3β) at mTALH after IR injury. p53 shRNA inhibited GSK-3β expression and restored β-catenin expression at mTALH. For IR-induced kidney injury, transarterial delivery of p53 siRNA is an effective pharmacological intervention. Targeting siRNA to p53 leads to an attenuation of apoptosis and mitochondrial damage through the downregulation of GSK-3β expression and upregulation of β-catenin. Local delivery of vectors such as p53 siRNA through a transaortic catheter is clinically useful in reducing the adverse effect of siRNA-related therapy.

  6. Detection of genotoxic and non-genotoxic carcinogens in Xpc{sup −/−}p53{sup +/−} mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Melis, Joost P.M.; Leiden University Medical Center, Department of Toxicogenetics, Leiden; Speksnijder, Ewoud N.

    2013-01-15

    An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed themore » Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Highlights: ► The Xpc*p53 mouse model is able to identify genotoxic and non-genotoxic carcinogens. ► Time, animals and cost can be significantly reduced compared to the 2-year bioassay. ► Xpc*p53 mice are more advantageous for carcinogen identification than Xpa*p53 mice. ► Xpc*p53 mice exhibit a wild type response upon exposure to genotoxicants.« less

  7. HIPK2 restricts SIRT1 activity upon severe DNA damage by a phosphorylation-controlled mechanism

    PubMed Central

    Conrad, E; Polonio-Vallon, T; Meister, M; Matt, S; Bitomsky, N; Herbel, C; Liebl, M; Greiner, V; Kriznik, B; Schumacher, S; Krieghoff-Henning, E; Hofmann, T G

    2016-01-01

    Upon severe DNA damage a cellular signalling network initiates a cell death response through activating tumour suppressor p53 in association with promyelocytic leukaemia (PML) nuclear bodies. The deacetylase Sirtuin 1 (SIRT1) suppresses cell death after DNA damage by antagonizing p53 acetylation. To facilitate efficient p53 acetylation, SIRT1 function needs to be restricted. How SIRT1 activity is regulated under these conditions remains largely unclear. Here we provide evidence that SIRT1 activity is limited upon severe DNA damage through phosphorylation by the DNA damage-responsive kinase HIPK2. We found that DNA damage provokes interaction of SIRT1 and HIPK2, which phosphorylates SIRT1 at Serine 682 upon lethal damage. Furthermore, upon DNA damage SIRT1 and HIPK2 colocalize at PML nuclear bodies, and PML depletion abrogates DNA damage-induced SIRT1 Ser682 phosphorylation. We show that Ser682 phosphorylation inhibits SIRT1 activity and impacts on p53 acetylation, apoptotic p53 target gene expression and cell death. Mechanistically, we found that DNA damage-induced SIRT1 Ser682 phosphorylation provokes disruption of the complex between SIRT1 and its activator AROS. Our findings indicate that phosphorylation-dependent restriction of SIRT1 activity by HIPK2 shapes the p53 response. PMID:26113041

  8. An adaptive molecular timer in p53-meidated cell fate decision

    NASA Astrophysics Data System (ADS)

    Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

    The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

  9. p53 is a major component of the transcriptional and apoptotic program regulated by PI 3-kinase/Akt/GSK3 signaling.

    PubMed

    Nayak, G; Cooper, G M

    2012-10-11

    The phosphatidylinositol (PI) 3-kinase/Akt signaling pathway has a prominent role in cell survival and proliferation, in part, by regulating gene expression at the transcriptional level. Previous work using global expression profiling identified FOXOs and the E-box-binding transcription factors MITF and USF1 as key targets of PI 3-kinase signaling that lead to the induction of proapoptotic and cell cycle arrest genes in response to inhibition of PI 3-kinase. In this study, we investigated the role of p53 downstream of PI 3-kinase signaling by analyzing the effects of inhibition of PI 3-kinase in Rat-1 cells, which have wild-type p53, compared with Rat-1 cells expressing a dominant-negative p53 mutant. Expression of dominant-negative p53 conferred partial resistance to apoptosis induced by inhibition of PI 3-kinase. Global gene expression profiling combined with computational and experimental analysis of transcription factor binding sites demonstrated that p53, along with FOXO, MITF and USF1, contributed to gene induction in response to PI 3-kinase inhibition. Activation of p53 was mediated by phosphorylation of the histone acetyltransferase Tip60 by glycogen synthase kinase (GSK) 3, leading to activation of p53 by acetylation. Many of the genes targeted by p53 were also targeted by FOXO and E-box-binding transcription factors, indicating that p53 functions coordinately with these factors to regulate gene expression downstream of PI 3-kinase/Akt/GSK3 signaling.

  10. PUMA promotes Bax translocation in FOXO3a-dependent pathway during STS-induced apoptosis

    NASA Astrophysics Data System (ADS)

    Zhang, Yingjie; Chen, Qun

    2009-08-01

    PUMA (p53 up-regulated modulator of apoptosis, also called Bbc3) was first identified as a BH3-only Bcl-2 family protein that is transcriptionally up-regulated by p53 and activated upon p53-dependent apoptotic stimuli, such as treatment with DNA-damaging drugs or UV irradiation. Recently studies have been shown that Puma is also up-regulated in response to certain p53-independent apoptotic stimuli, such as growth factor deprivation or treatment with glucocorticoids or STS (staurosporine). However, the molecular mechanisms of PUMA up-regulation and how PUMA functions in response to p53-independent apoptotic stimuli remain poorly understood. In this study, based on real-time single cell analysis, flow cytometry and western blotting technique, we investigated the function of PUMA in living human lung adenocarcinoma cells (ASTC-a-1) after STS treatment. Our results show that FOXO3a was activated by STS stimulation and then translocated from cytosol to nucleus. The expression of PUMA was up-regulated via a FOXO3a-dependent manner after STS treatment, while p53 had little function in this process. Moreover, cell apoptosis and Bax translocation induced by STS were not blocked by Pifithrin-α (p53 inhibitor), which suggested that p53 was not involved in this signaling pathway. Taken together, these results indicate that PUMA promoted Bax translocation in a FOXO3a-dependment pathway during STS-induced apoptosis, while p53 was dispensable in this process.

  11. Editor's Highlight: Hydroxyurea Exposure Activates the P53 Signaling Pathway in Murine Organogenesis-Stage Embryos.

    PubMed

    El Husseini, Nazem; Schlisser, Ava E; Hales, Barbara F

    2016-08-01

    Hydroxyurea, an anticancer agent and potent teratogen, induces oxidative stress and activates a DNA damage response pathway in the gestation day (GD) 9 mouse embryo. To delineate the stress response pathways activated by this drug, we investigated the effect of hydroxyurea exposure on the transcriptome of GD 9 embryos. Timed pregnant CD-1 mice were treated with saline or hydroxyurea (400 mg/kg or 600 mg/kg) on GD 9; embryonic gene and protein expression were examined 3 h later. Microarray analysis revealed that the expression of 1346 probe sets changed significantly in embryos exposed to hydroxyurea compared with controls; the P53 signaling pathway was highly affected. In addition, P53 related family members, P63 and P73, were predicted to be activated and had common and unique downstream targets. Western blot analysis revealed that active phospho-P53 was significantly increased in drug-exposed embryos; confocal microscopy showed that the translocation of phospho-P53 to the nucleus was widespread in the embryo. Furthermore, qRT-PCR showed that the expression of P53-regulated genes (Cdkn1A, Fas, and Trp53inp1) was significantly upregulated in hydroxyurea-exposed embryos; the concentration of the redox sensitive P53INP1 protein was also increased in a hydroxyurea dose-dependent fashion. Thus, hydroxyurea elicits a significant effect on the transcriptome of the organogenesis stage murine embryo, activating several key developmental signaling pathways related to DNA damage and oxidative stress. We propose that the P53 pathway plays a central role in the embryonic stress response and the developmental outcome after teratogen exposure. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Mutant p53 perturbs DNA replication checkpoint control through TopBP1 and Treslin.

    PubMed

    Liu, Kang; Lin, Fang-Tsyr; Graves, Joshua D; Lee, Yu-Ju; Lin, Weei-Chin

    2017-05-09

    Accumulating evidence supports the gain-of-function of mutant forms of p53 (mutp53s). However, whether mutp53 directly perturbs the DNA replication checkpoint remains unclear. Previously, we have demonstrated that TopBP1 forms a complex with mutp53s and mediates their gain-of-function through NF-Y and p63/p73. Akt phosphorylates TopBP1 and induces its oligomerization, which inhibits its ATR-activating function. Here we show that various contact and conformational mutp53s bypass Akt to induce TopBP1 oligomerization and attenuate ATR checkpoint response during replication stress. The effect on ATR response caused by mutp53 can be exploited in a synthetic lethality strategy, as depletion of another ATR activator, DNA2, in mutp53-R273H-expressing cancer cells renders cells hypersensitive to cisplatin. Expression of mutp53-R273H also makes cancer cells more sensitive to DNA2 depletion or DNA2 inhibitors. In addition to ATR-activating function during replication stress, TopBP1 interacts with Treslin in a Cdk-dependent manner to initiate DNA replication during normal growth. We find that mutp53 also interferes with TopBP1 replication function. Several contact, but not conformational, mutp53s enhance the interaction between TopBP1 and Treslin and promote DNA replication despite the presence of a Cdk2 inhibitor. Together, these data uncover two distinct mechanisms by which mutp53 enhances DNA replication: ( i ) Both contact and conformational mutp53s can bind TopBP1 and attenuate the checkpoint response to replication stress, and ( ii ) during normal growth, contact (but not conformational) mutp53s can override the Cdk2 requirement to promote replication by facilitating the TopBP1/Treslin interaction.

  13. Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

    PubMed

    Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

    2018-03-01

    Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

  14. Pathways connecting telomeres and p53 in senescence, apoptosis, and cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Artandi, Steven E.; Attardi, Laura D.

    2005-06-10

    The ends of eukaryotic chromosomes are protected by specialized structures termed telomeres that serve in part to prevent the chromosome end from activating a DNA damage response. However, this important function for telomeres in chromosome end protection can be lost as telomeres shorten with cell division in culture or in self-renewing tissues with advancing age. Impaired telomere function leads to induction of a DNA damage response and activation of the tumor suppressor protein p53. p53 serves a critical role in enforcing both senescence and apoptotic responses to dysfunctional telomeres. Loss of p53 creates a permissive environment in which critically shortmore » telomeres are inappropriately joined to generate chromosomal end-to-end fusions. These fused chromosomes result in cycles of chromosome fusion-bridge-breakage, which can fuel cancer initiation, especially in epithelial tissues, by facilitating changes in gene copy number.« less

  15. The influence of TRP53 in the dose response of radiation-induced apoptosis, DNA repair and genomic stability in murine haematopoietic cells

    DOE PAGES

    Lemon, Jennifer A.; Taylor, Kristina; Verdecchia, Kyle; ...

    2014-01-01

    Apoptotic and DNA damage endpoints are frequently used as surrogate markers of cancer risk, and have been well-studied in the Trp53+/- mouse model. We report the effect of differing Trp53 gene status on the dose response of ionizing radiation exposures (0.01-2 Gy), with the unique perspective of determining if effects of gene status remain at extended time points. Here we report no difference in the dose response for radiation-induced DNA double-strand breaks in bone marrow and genomic instability (MN-RET levels) in peripheral blood, between wild-type ( Trp53+/+) and heterozygous ( Trp53+/-) mice. The dose response for Trp53+/+ mice showed highermore » initial levels of radiation-induced lymphocyte apoptosis relative to Trp53+/- between 0 and 1 Gy. Although this trend was observed up to 12 hours post-irradiation, both genotypes ultimately reached the same level of apoptosis at 14 hours, suggesting the importance of late-onset p53-independent apoptotic responses in this mouse model. Expected radiation-induced G1 cell cycle delay was observed in Trp53+/+ but not Trp53+/-. Although p53 has an important role in cancer risk, we have shown its influence on radiation dose response can be temporally variable. This research highlights the importance of caution when using haematopoietic endpoints as surrogates to extrapolate radiation-induced cancer risk estimation.« less

  16. Clinical utility of anti-p53 auto-antibody: Systematic review and focus on colorectal cancer

    PubMed Central

    Suppiah, Aravind; Greenman, John

    2013-01-01

    Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance. PMID:23922463

  17. Wnt-Responsive Cancer Stem Cells Are Located Close to Distorted Blood Vessels and Not in Hypoxic Regions in a p53-Null Mouse Model of Human Breast Cancer

    PubMed Central

    Landua, John D.; Bu, Wen; Wei, Wei; Li, Fuhai; Wong, Stephen T.C.; Dickinson, Mary E.; Rosen, Jeffrey M.; Lewis, Michael T.

    2014-01-01

    Cancer stem cells (CSCs, or tumor-initiating cells) may be responsible for tumor formation in many types of cancer, including breast cancer. Using high-resolution imaging techniques, we analyzed the relationship between a Wnt-responsive, CSC-enriched population and the tumor vasculature using p53-null mouse mammary tumors transduced with a lentiviral Wnt signaling reporter. Consistent with their localization in the normal mammary gland, Wnt-responsive cells in tumors were enriched in the basal/myoepithelial population and generally located in close proximity to blood vessels. The Wnt-responsive CSCs did not colocalize with the hypoxia-inducible factor 1α-positive cells in these p53-null basal-like tumors. Average vessel diameter and vessel tortuosity were increased in p53-null mouse tumors, as well as in a human tumor xenograft as compared with the normal mammary gland. The combined strategy of monitoring the fluorescently labeled CSCs and vasculature using high-resolution imaging techniques provides a unique opportunity to study the CSC and its surrounding vasculature. PMID:24797826

  18. Mitomycin C and decarbamoyl mitomycin C induce p53-independent p21WAF1/CIP1 activation

    PubMed Central

    Cheng, Shu-Yuan; Seo, Jiwon; Huang, Bik Tzu; Napolitano, Tanya; Champeil, Elise

    2016-01-01

    Mitomycin C (MC), a commonly used anticancer drug, induces DNA damage via DNA alkylation. Decarbamoyl mitomycin C (DMC), another mitomycin lacking the carbamate at C10, generates similar lesions as MC. Interstrand cross-links (ICLs) are believed to be the lesions primarily responsible for the cytotoxicity of MC and DMC. The major ICL generated by MC (α-ICL) has a trans stereochemistry at the guanine-drug linkage whereas the major ICL from DMC (β-ICL) has the opposite, cis, stereochemistry. In addition, DMC can provoke strong p53-independent cell death. Our hypothesis is that the stereochemistry of the major unique β-ICL generated by DMC is responsible for this p53-independent cell death signaling. p53 gene is inactively mutated in more than half of human cancers. p21WAF1/CIP1 known as a major effector of p53 is involved in p53-dependent and -independent control of cell proliferation and death. This study revealed the role of p21WAF1/CIP1 on MC and DMC triggered cell damage. MCF-7 (p53-proficient) and K562 (p53-deficient) cells were used. Cell cycle distributions were shifted to the G1/S phase in MCF-7 treated with MC and DMC, but were shifted to the S phase in K562. p21WAF1/CIP1 activation was observed in both cells treated with MC and DMC, and DMC triggered more significant activation. Knocking down p53 in MCF-7 did not attenuate MC and DMC induced p21WAF1/CIP1 activation. The α-ICL itself was enough to cause p21WAF1/CIP1 activation. PMID:27666201

  19. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    PubMed

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Substrate phosphorylation and feedback regulation in JFK-promoted p53 destabilization.

    PubMed

    Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

    2011-02-11

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G(1) arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation.

  1. Substrate Phosphorylation and Feedback Regulation in JFK-promoted p53 Destabilization*

    PubMed Central

    Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

    2011-01-01

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G1 arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation. PMID:21127074

  2. Transcriptome profiling identifies p53 as a key player during calreticulin deficiency: Implications in lipid accumulation.

    PubMed

    Vig, Saurabh; Talwar, Puneet; Kaur, Kirandeep; Srivastava, Rohit; Srivastava, Arvind K; Datta, Malabika

    2015-01-01

    Calreticulin (CRT) is an endoplasmic reticulum (ER) resident calcium binding protein that is involved in several cellular activities. Transcriptome analyses in CRT knockdown HepG2 cells revealed 253 altered unique genes and subsequent in silico protein-protein interaction network and MCODE clustering identified 34 significant clusters, of which p53 occupied the central hub node in the highest node-rich cluster. Toward validation, we show that CRT knockdown leads to inhibition of p53 protein levels. Both, CRT and p53 siRNA promote hepatic lipid accumulation and this was accompanied by elevated SREBP-1c and FAS levels. p53 was identified to bind at -219 bp on the SREBP-1c promoter and in the presence of CRT siRNA, there was decreased occupancy of p53 on this binding element. This was associated with increased SREBP-1c promoter activity and both, mutation in this binding site or p53 over-expression antagonised the effects of CRT knockdown. We, therefore, identify a negatively regulating p53 binding site on the SREBP-1c promoter that is critical during hepatic lipid accumulation. These results were validated in mouse primary hepatocytes and toward a physiological relevance, we report that while the levels of CRT and p53 are reduced in the fatty livers of diabetic db/db mice, SREBP-1c levels are significantly elevated. Our results suggest that decreased CRT levels might be involved in the development of a fatty liver by preventing p53 occupancy on the SREBP-1c promoter and thereby facilitating SREBP-1c up-regulation and consequently, lipid accumulation.

  3. Human Cytomegalovirus nuclear egress and secondary envelopment are negatively affected in the absence of cellular p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila

    2016-10-15

    Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, withmore » a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.« less

  4. A Protein Turnover Signaling Motif Controls the Stimulus-Sensitivity of Stress Response Pathways

    PubMed Central

    Loriaux, Paul Michael; Hoffmann, Alexander

    2013-01-01

    Stimulus-induced perturbations from the steady state are a hallmark of signal transduction. In some signaling modules, the steady state is characterized by rapid synthesis and degradation of signaling proteins. Conspicuous among these are the p53 tumor suppressor, its negative regulator Mdm2, and the negative feedback regulator of NFκB, IκBα. We investigated the physiological importance of this turnover, or flux, using a computational method that allows flux to be systematically altered independently of the steady state protein abundances. Applying our method to a prototypical signaling module, we show that flux can precisely control the dynamic response to perturbation. Next, we applied our method to experimentally validated models of p53 and NFκB signaling. We find that high p53 flux is required for oscillations in response to a saturating dose of ionizing radiation (IR). In contrast, high flux of Mdm2 is not required for oscillations but preserves p53 sensitivity to sub-saturating doses of IR. In the NFκB system, degradation of NFκB-bound IκB by the IκB kinase (IKK) is required for activation in response to TNF, while high IKK-independent degradation prevents spurious activation in response to metabolic stress or low doses of TNF. Our work identifies flux pairs with opposing functional effects as a signaling motif that controls the stimulus-sensitivity of the p53 and NFκB stress-response pathways, and may constitute a general design principle in signaling pathways. PMID:23468615

  5. Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

    PubMed

    Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

    2017-10-15

    Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and DNA damage-mediated cellular stresses. This seems to be the first report that p53 activates a viral oncogene; therefore, the discovery would be interesting to a broad readership from the fields of oncology to virology. Copyright © 2017 American Society for Microbiology.

  6. The role of p53 in combination radioimmunotherapy with 64Cu-DOTA-cetuximab and cisplatin in a mouse model of colorectal cancer.

    PubMed

    Guo, Yunjun; Parry, Jesse J; Laforest, Richard; Rogers, Buck E; Anderson, Carolyn J

    2013-09-01

    Radioimmunotherapy has been successfully used in the treatment of lymphoma but thus far has not demonstrated significant efficacy in humans beyond disease stabilization in solid tumors. Radioimmunotherapy with (64)Cu was highly effective in a hamster model of colorectal cancer, but targeted radiotherapies with this radionuclide have since not shown as much success. It is widely known that mutations in key proteins play a role in the success or failure of cancer therapies. For example, the KRAS mutation is predictive of poor response to anti-epidermal growth factor receptor therapies in colorectal cancer, whereas p53 is frequently mutated in tumors, causing resistance to multiple therapeutic regimens. We previously showed that nuclear localization of (64)Cu-labeled DOTA-cetuximab was enhanced in p53 wild-type tumor cells. Here, we examine the role of p53 in the response to radioimmunotherapy with (64)Cu-DOTA-cetuximab in KRAS-mutated HCT116 tumor-bearing mice, with and without cisplatin, which upregulates wild-type p53. Experiments with HCT116 cells that are p53 +/+ (p53 wild-type) and -/- (p53 null) grown in cell culture demonstrated that preincubation with cisplatin increased expression of p53 and subsequently enhanced localization of (64)Cu from (64)Cu-acetate and (64)Cu-DOTA-cetuximab to the tumor cell nuclei. Radioimmunotherapy studies in p53-positive HCT116 tumor-bearing mice, receiving either radioimmunotherapy alone or in combination with cisplatin, showed significantly longer survival in mice receiving unlabeled cetuximab or cisplatin alone or in combination (all, P < 0.01). In contrast, the p53-negative tumor-bearing mice treated with radioimmunotherapy alone or combined with cisplatin showed no survival advantage, compared with control groups (all, P > 0.05). Together, these data suggest that (64)Cu specifically delivered to epidermal growth factor receptor-positive tumors by cetuximab can suppress tumor growth despite the KRAS status and present opportunities for personalized clinical treatment strategies in colorectal cancer.

  7. Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

    PubMed

    Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

    2016-01-01

    Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

  8. Comparisons of IL-8, ROS and p53 responses in human lung epithelial cells exposed to two extracts of PM2.5 collected from an e-waste recycling area, China

    NASA Astrophysics Data System (ADS)

    Yang, Fangxing; Jin, Shiwei; Xu, Ying; Lu, Yuanan

    2011-04-01

    To identify the different effects of organic-soluble and water-soluble pollutants adsorbed on PM2.5 (PM: particulate matter) released from e-waste (electrical/electronic waste) on inflammatory response, oxidative stress and DNA damage, interleukin-8 (IL-8), reactive oxygen species (ROS) and p53 protein levels were determined and compared in human lung epithelial A549 cells exposed to extracts of PM2.5 collected from two sampling sites in an e-waste recycling area in China. It is found that both extracts induced increases of IL-8 release, ROS production and p53 protein expression. The differences between the organic-soluble and water-soluble extracts were determined as of significance for ROS production (p < 0.05) and p53 protein expression (p < 0.01). The ROS production and p53 protein expression induced by the organic-soluble extracts were found to be greater than those induced by the water-soluble extracts, for both sampling sites. The results indicated that PM2.5 collected from the e-waste recycling areas could lead to inflammatory response, oxidative stress and DNA damage, and the organic-soluble extracts had higher potential to induce such adverse effects on human health.

  9. The Origins and Evolution of the p53 Family of Genes

    PubMed Central

    Belyi, Vladimir A.; Ak, Prashanth; Markert, Elke; Wang, Haijian; Hu, Wenwei; Puzio-Kuter, Anna; Levine, Arnold J.

    2010-01-01

    A common ancestor to the three p53 family members of human genes p53, p63, and p73 is first detected in the evolution of modern‐day sea anemones, in which both structurally and functionally it acts to protect the germ line from genomic instabilities in response to stresses. This p63/p73 common ancestor gene is found in almost all invertebrates and first duplicates to produce a p53 gene and a p63/p73 ancestor in cartilaginous fish. Bony fish contain all three genes, p53, p63, and p73, and the functions of these three transcription factors diversify in the higher vertebrates. Thus, this gene family has preserved its structural features and functional activities for over one billion years of evolution. PMID:20516129

  10. Integration of Genomic, Biologic, and Chemical Approaches to Target p53 Loss and Gain-of-Function in Triple Negative Breast Cancer

    DTIC Science & Technology

    2016-09-01

    in this progress report: p53 triple-negative breast cancer subtypes gene expression somatic cell genetics CRISPR /Cas 3. ACCOMPLISHMENTS Major...report, we described the creation of an isogenic p53 mutant TNBC cell line panel using CRISPR /Cas-mediated genome editing8 and the resultant...LOF null state. To validate that mutant p53 is directly responsible for this altered transcription, we will use the same CRISPR -mediated genome

  11. The Isoforms of the p53 Protein

    PubMed Central

    Khoury, Marie P.; Bourdon, Jean-Christophe

    2010-01-01

    p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206

  12. C/EBPbeta represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19(Arf).

    PubMed

    Ewing, S J; Zhu, S; Zhu, F; House, J S; Smart, R C

    2008-11-01

    CCAAT/enhancer-binding protein-beta (C/EBPbeta) is a mediator of cell survival and tumorigenesis. When C/EBPbeta(-/-) mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19(Arf) and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19(Arf) is dramatically elevated in C/EBPbeta(-/-) epidermis and that C/EBPbeta represses a p19(Arf) promoter reporter. To determine whether p19(Arf) is responsible for the proapoptotic phenotype in C/EBPbeta(-/-) mice, C/EBPbeta(-/-);p19(Arf-/-) mice were generated. C/EBPbeta(-/-);p19(Arf-/-) mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19(Arf) is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPbeta(-/-) epidermis, we generated K14-ER:Ras;C/EBPbeta(-/-) mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPbeta(-/-) mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPbeta represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPbeta may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents.

  13. C/EBPβ represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19Arf

    PubMed Central

    Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC

    2013-01-01

    CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078

  14. Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

    PubMed

    Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

    2012-04-01

    Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

  15. Involvement of 53BP1, a p53 Binding Protein, in Chk2 Phosphyorylation of p53 and DNA Damage Cell Cycle Checkpoints

    DTIC Science & Technology

    2006-05-01

    between 53BP1 and the platelet derived growth factor (PDGF) was recently identified in a patient with a myeloproliferative disorder.32 The 53BP1-PDGF...receptor beta in a patient with a t(5;15)(q33;q22) and an imatinib-responsive eosinophilic myeloproliferative disorder. Cancer Res 2004; 64:7216-9

  16. Heterogeneity of p53 dependent genomic responses following ethanol exposure in a developmental mouse model of fetal alcohol spectrum disorder.

    PubMed

    Camargo Moreno, Maria; Mooney, Sandra M; Middleton, Frank A

    2017-01-01

    Prenatal ethanol exposure can produce structural and functional deficits in the brain and result in Fetal Alcohol Spectrum Disorder (FASD). In rodent models acute exposure to a high concentration of alcohol causes increased apoptosis in the developing brain. A single causal molecular switch that signals for this increase in apoptosis has yet to be identified. The protein p53 has been suggested to play a pivotal role in enabling cells to engage in pro-apoptotic processes, and thus figures prominently as a hub molecule in the intracellular cascade of responses elicited by alcohol exposure. In the present study we examined the effect of ethanol-induced cellular and molecular responses in primary somatosensory cortex (SI) and hippocampus of 7-day-old wild-type (WT) and p53-knockout (KO) mice. We quantified apoptosis by active caspase-3 immunohistochemistry and ApopTag™ labeling, then determined total RNA expression levels in laminae of SI and hippocampal subregions. Immunohistochemical results confirmed increased incidence of apoptotic cells in both regions in WT and KO mice following ethanol exposure. The lack of p53 was not protective in these brain regions. Molecular analyses revealed a heterogeneous response to ethanol exposure that varied depending on the subregion, and which may go undetected using a global approach. Gene network analyses suggest that the presence or absence of p53 alters neuronal function and synaptic modifications following ethanol exposure, in addition to playing a classic role in cell cycle signaling. Thus, p53 may function in a way that underlies the intellectual and behavioral deficits observed in FASD.

  17. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    PubMed Central

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  18. Modulation of the cyclin-dependent kinase inhibitor p21(WAF1/Cip1) gene by Zac1 through the antagonistic regulators p53 and histone deacetylase 1 in HeLa Cells.

    PubMed

    Liu, Pei-Yao; Chan, James Yi-Hsin; Lin, Hsiu-Chen; Wang, Sung-Ling; Liu, Shu-Ting; Ho, Ching-Liang; Chang, Li-Chien; Huang, Shih-Ming

    2008-07-01

    Zac1 is a novel seven-zinc finger protein which possesses the ability to bind specifically to GC-rich DNA elements. Zac1 not only promotes apoptosis and cell cycle arrest but also acts as a transcriptional cofactor for p53 and a number of nuclear receptors. Our previous study indicated that the enhancement of p53 activity by Zac1 is much more pronounced in HeLa cells compared with other cell lines tested. This phenomenon might be due to the coactivator effect of Zac1 on p53 and the ability of Zac1 to reverse E6 inhibition of p53. In the present study, we showed that Zac1 acted synergistically with either p53 or a histone deacetylase inhibitor, trichostatin A, to enhance p21(WAF1/Cip1) promoter activity. We showed that Zac1 physically interacted with some nuclear receptor corepressors such as histone deacetylase 1 (HDAC1) and mSin3a, and the induction of p21(WAF1/Cip1) gene and protein by Zac1 was suppressed by either overexpressing HDAC1 or its deacetylase-dead mutant. In addition, our data suggest that trichostatin A-induced p21(WAF1/Cip1) protein expression might be mediated through a p53-independent and HDAC deacetylase-independent pathway. Taken together, our data suggest that Zac1 might be involved in regulating the p21(WAF1/Cip1) gene and protein expression through its protein-protein interaction with p53 and HDAC1 in HeLa cells.

  19. Basal p53 expression is indispensable for mesenchymal stem cell integrity.

    PubMed

    Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G

    2018-03-01

    Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional MSC responses in the pathophysiology of p53-related skeletal disorders.

  20. L'effet de p53 sur la radiosensibilité des cellules humaines normales et cancéreuses

    NASA Astrophysics Data System (ADS)

    Little, J. B.; Li, C. Y.; Nagasawa, H.; Huang, H.

    1998-04-01

    The radiosensitivity of normal human fibroblasts in p53 dependent and associated with the loss of cells from the cycling population as the result of an irreversible G1 arrest; cells lacking normal p53 function show no arrest and are more radioresistant. Under conditions in which the repair potentially lethal radiation damage is facilitated, the fraction of cells arrested in G1 is reduced and survival is enhanced. The response of human tumor cells differs significantly. The radiation-induced G1 arrest is minimal or absent in p53+ tumor cells, and loss of normal p53 function has no consistent effect on their radiosensitivity. These results suggest that p53 status may not be a useful predictive marker for the response of human solid tumors to radiation therapy. La radiosensibilité des fibroblastes diploïdes humains est liée à l'expression de p53, et à la perte de cellules en cycle résultant d'un arrêt irréversible en phase G1 ; dans les cellules n'ayant pas une fonction p53 normale, on ne constate aucun arrêt, et elles sont plus radio-résistantes. Dans des conditions favorables à la réparation de lésions potentiellement léthales dues à l'irradiation, la proportion de cellules bloquées en phase G1 baisse, et les chances de survie sont accrues. Bien différente est la réaction des cellules cancéreuses humaines. Le blocage par irradiation en phase G1 est minime ou inexistant dans les cellules cancéreuses p53^+, et la perte de la fonction normale p53 n'a pas d'effet constant sur leur radiosensibilité. Ces résultats laissent penser que l'expression de p53 n'est pas un indice fiable permettant de prévoir la réaction des tumeurs solides à la radiothérapie.

  1. The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential

    PubMed Central

    Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre

    2015-01-01

    Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205

  2. Tripeptidyl peptidase II plays a role in the radiation response of selected primary cell types but not based on nuclear translocation and p53 stabilization.

    PubMed

    Firat, Elke; Tsurumi, Chizuko; Gaedicke, Simone; Huai, Jisen; Niedermann, Gabriele

    2009-04-15

    The giant cytosolic protease tripeptidyl peptidase II (TPPII) was recently proposed to play a role in the DNA damage response. Shown were nuclear translocation of TPPII after gamma-irradiation, lack of radiation-induced p53 stabilization in TPPII-siRNA-treated cells, and complete tumor regression in mice after gamma-irradiation when combined with TPPII-siRNA silencing or a protease inhibitor reported to inhibit TPPII. This suggested that TPPII could be a novel target for tumor radiosensitization and prompted us to study radiation responses using TPPII-knockout mice. Neither the sensitivity to total body irradiation nor the radiosensitivity of resting lymphoid cells, which both strongly depend on p53, was altered in the absence of TPPII. Functional integrity of p53 in TPPII-knockout cells is further shown by a proper G(1) arrest and by the accumulation of p53 and its transcriptional targets, p21, Bax, and Fas, on gamma-irradiation. Furthermore, we could not confirm radiation-induced nuclear translocation of TPPII. Nevertheless, after gamma-irradiation, we found slightly increased mitotic catastrophe of TPPII-deficient primary fibroblasts and increased apoptosis of TPPII-deficient activated CD8(+) T cells. The latter was accompanied by delayed resolution of the DNA double-strand break marker gammaH2AX. This could, however, be due to increased apoptotic DNA damage rather than reduced DNA damage repair. Our data do not confirm a role for TPPII in the DNA damage response based on nuclear TPPII translocation and p53 stabilization but nevertheless do show increased radiation-induced cell death of selected nontransformed cell types in the absence of the TPPII protease.

  3. Increased Arf/p53 activity in stem cells, aging and cancer.

    PubMed

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

    2017-04-01

    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  4. CRISPR-Cas9-based target validation for p53-reactivating model compounds

    PubMed Central

    Wanzel, Michael; Vischedyk, Jonas B; Gittler, Miriam P; Gremke, Niklas; Seiz, Julia R; Hefter, Mirjam; Noack, Magdalena; Savai, Rajkumar; Mernberger, Marco; Charles, Joël P; Schneikert, Jean; Bretz, Anne Catherine; Nist, Andrea; Stiewe, Thorsten

    2015-01-01

    Inactivation of the p53 tumor suppressor by Mdm2 is one of the most frequent events in cancer, so compounds targeting the p53-Mdm2 interaction are promising for cancer therapy. Mechanisms conferring resistance to p53-reactivating compounds are largely unknown. Here we show using CRISPR-Cas9–based target validation in lung and colorectal cancer that the activity of nutlin, which blocks the p53-binding pocket of Mdm2, strictly depends on functional p53. In contrast, sensitivity to the drug RITA, which binds the Mdm2-interacting N terminus of p53, correlates with induction of DNA damage. Cells with primary or acquired RITA resistance display cross-resistance to DNA crosslinking compounds such as cisplatin and show increased DNA cross-link repair. Inhibition of FancD2 by RNA interference or pharmacological mTOR inhibitors restores RITA sensitivity. The therapeutic response to p53-reactivating compounds is therefore limited by compound-specific resistance mechanisms that can be resolved by CRISPR-Cas9-based target validation and should be considered when allocating patients to p53-reactivating treatments. PMID:26595461

  5. The p53-reactivating small-molecule RITA enhances cisplatin-induced cytotoxicity and apoptosis in head and neck cancer.

    PubMed

    Roh, Jong-Lyel; Ko, Jung Ho; Moon, Soo Jin; Ryu, Chang Hwan; Choi, Jun Young; Koch, Wayne M

    2012-12-01

    We evaluated whether the restoration of p53 function by the p53-reactivating small molecule RITA (reactivation of p53 and induction of tumor cell apoptosis enhances cisplatin-induced cytotoxicity and apoptosis in head-and-neck cancer (HNC). RITA induced prominent accumulation and reactivation of p53 in a wild-type TP53-bearing HNC cell line. RITA showed maximal growth suppression in tumor cells showing MDM2-dependent p53 degradation. RITA promoted apoptosis in association with upregulation of p21, BAX, and cleaved caspase-3; notably, the apoptotic response was blocked by pifithrin-α, demonstrating its p53 dependence. With increasing concentrations, RITA strongly induced apoptosis rather than G2-phase arrest. In combination therapy, RITA enhanced cisplatin-induced growth inhibition and apoptosis of HNC cells invitro and in vivo. Our data suggest that the restoration of p53 tumor-suppressive function by RITA enhances the cytotoxicity and apoptosis of cisplatin, an action that may offer an attractive strategy for treating HNC. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  6. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

    PubMed Central

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-01-01

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984

  7. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    PubMed

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  8. Rb and p53 Liver Functions Are Essential for Xenobiotic Metabolism and Tumor Suppression

    PubMed Central

    Nantasanti, Sathidpak; Toussaint, Mathilda J. M.; Youssef, Sameh A.; Tooten, Peter C. J.; de Bruin, Alain

    2016-01-01

    The tumor suppressors Retinoblastoma (Rb) and p53 are frequently inactivated in liver diseases, such as hepatocellular carcinomas (HCC) or infections with Hepatitis B or C viruses. Here, we discovered a novel role for Rb and p53 in xenobiotic metabolism, which represent a key function of the liver for metabolizing therapeutic drugs or toxins. We demonstrate that Rb and p53 cooperate to metabolize the xenobiotic 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC). DDC is metabolized mainly by cytochrome P450 (Cyp)3a enzymes resulting in inhibition of heme synthesis and accumulation of protoporphyrin, an intermediate of heme pathway. Protoporphyrin accumulation causes bile injury and ductular reaction. We show that loss of Rb and p53 resulted in reduced Cyp3a expression decreased accumulation of protoporphyrin and consequently less ductular reaction in livers of mice fed with DDC for 3 weeks. These findings provide strong evidence that synergistic functions of Rb and p53 are essential for metabolism of DDC. Because Rb and p53 functions are frequently disabled in liver diseases, our results suggest that liver patients might have altered ability to remove toxins or properly metabolize therapeutic drugs. Strikingly the reduced biliary injury towards the oxidative stress inducer DCC was accompanied by enhanced hepatocellular injury and formation of HCCs in Rb and p53 deficient livers. The increase in hepatocellular injury might be related to reduce protoporphyrin accumulation, because protoporphrin is well known for its anti-oxidative activity. Furthermore our results indicate that Rb and p53 not only function as tumor suppressors in response to carcinogenic injury, but also in response to non-carcinogenic injury such as DDC. PMID:26967735

  9. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    PubMed

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  10. Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

    PubMed Central

    Stegh, Alexander H.

    2012-01-01

    Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

  11. Generation of oscillations by the p53-Mdm2 feedback loop: A theoretical and experimental study

    PubMed Central

    Lev Bar-Or, Ruth; Maya, Ruth; Segel, Lee A.; Alon, Uri; Levine, Arnold J.; Oren, Moshe

    2000-01-01

    The intracellular activity of the p53 tumor suppressor protein is regulated through a feedback loop involving its transcriptional target, mdm2. We present a simple mathematical model suggesting that, under certain circumstances, oscillations in p53 and Mdm2 protein levels can emerge in response to a stress signal. A delay in p53-dependent induction of Mdm2 is predicted to be required, albeit not sufficient, for this oscillatory behavior. In line with the predictions of the model, oscillations of both p53 and Mdm2 indeed occur on exposure of various cell types to ionizing radiation. Such oscillations may allow cells to repair their DNA without risking the irreversible consequences of continuous excessive p53 activation. PMID:11016968

  12. Tyrosinase overexpression promotes ATM-dependent p53 phosphorylation by quercetin and sensitizes melanoma cells to dacarbazine.

    PubMed

    Thangasamy, Thilakavathy; Sittadjody, Sivanandane; Limesand, Kirsten H; Burd, Randy

    2008-01-01

    Dacarbazine (DTIC) has been used for the treatment of melanoma for decades. However, monotherapy with this chemotherapeutic agent results only in moderate response rates. To improve tumor response to DTIC current clinical trials in melanoma focus on combining a novel targeted agent with chemotherapy. Here, we demonstrate that tyrosinase which is commonly overexpressed in melanoma activates the bioflavonoid quercetin (Qct) and promotes an ataxia telangiectasia mutated (ATM)-dependent DNA damage response. This response sensitizes melanoma cells that overexpress tyrosinase to DTIC. In DB-1 melanoma cells that overexpress tyrosinase (Tyr(+) cells), the threshold for phosphorylation of ATM and p53 at serine 15 was observed at a low dose of Qct (25 microM) when compared to the mock transfected pcDNA3 cells, which required a higher dose (75 microM). Both pcDNA3 and Tyr(+) DB-1 cells demonstrated similar increases in phosphorylation of p53 at other serine sites, but in the Tyr(+) cells, DNApk expression was found to be reduced compared to control cells, indicating a shift towards an ATM-mediated response. The DB-1 control cells were resistant to DTIC, but were sensitized to apoptosis with high dose Qct, while Tyr(+) cells were sensitized to DTIC with low or high dose Qct. Qct also sensitized SK Mel 5 (p53 wildtype) and 28 (p53 mutant) cells to DTIC. However, when SK Mel 5 cells were transiently transfected with tyrosinase and treated with Qct plus DTIC, SK Mel 5 cells demonstrated a more than additive induction of apoptosis. Therefore, this study demonstrates that tyrosinase overexpression promotes an ATM-dependent p53 phosphorylation by Qct treatment and sensitizes melanoma cells to dacarbazine. In conclusion, these results suggest that Qct or Qct analogues may significantly improve DTIC response rates in tumors that express tyrosinase.

  13. Tyrosinase Overexpression Promotes ATM-Dependent p53 Phosphorylation by Quercetin and Sensitizes Melanoma Cells to Dacarbazine

    PubMed Central

    Thangasamy, Thilakavathy; Sittadjody, Sivanandane; H. Limesand, Kirsten; Burd, Randy

    2008-01-01

    Dacarbazine (DTIC) has been used for the treatment of melanoma for decades. However, monotherapy with this chemotherapeutic agent results only in moderate response rates. To improve tumor response to DTIC current clinical trials in melanoma focus on combining a novel targeted agent with chemotherapy. Here, we demonstrate that tyrosinase which is commonly overexpressed in melanoma activates the bioflavonoid quercetin (Qct) and promotes an ataxia telangiectasia mutated (ATM)-dependent DNA damage response. This response sensitizes melanoma cells that overexpress tyrosinase to DTIC. In DB-1 melanoma cells that overexpress tyrosinase (Tyr cells), the threshold for phosphorylation of ATM and p53 at serine 15 was observed at a low dose of Qct (25 μM) when compared to the mock transfected pcDNA3 cells, which required a higher dose (75 μM). Both pcDNA3 and Tyr DB-1 cells demonstrated similar increases in phosphorylation of p53 at other serine sites, but in the Tyr cells, DNApk expression was found to be reduced compared to control cells, indicating a shift towards an ATM-mediated response. The DB-1 control cells were resistant to DTIC, but were sensitized to apoptosis with high dose Qct, while Tyr cells were sensitized to DTIC with low or high dose Qct. Qct also sensitized SK Mel 5 (p53 wildtype) and 28 (p53 mutant) cells to DTIC. However, when SK Mel 5 cells were transiently transfected with tyrosinase and treated with Qct plus DTIC, SK Mel 5 cells demonstrated a more than additive induction of apoptosis. Therefore, this study demonstrates that tyrosinase overexpression promotes an ATM-dependent p53 phosphorylation by Qct treatment and sensitizes melanoma cells to dacarbazine. In conclusion, these results suggest that Qct or Qct analogues may significantly improve DTIC response rates in tumors that express tyrosinase. PMID:18791269

  14. JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation

    PubMed Central

    Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

    2009-01-01

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types—MDM2, Pirh2, and COP1—and the HECT-domain type—ARF-BP1—have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G1 phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation. PMID:19509332

  15. JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation.

    PubMed

    Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

    2009-06-23

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types--MDM2, Pirh2, and COP1--and the HECT-domain type--ARF-BP1--have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G(1) phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation.

  16. ATM and p53 combined analysis predicts survival in glioblastoma multiforme patients: A clinicopathologic study.

    PubMed

    Romano, Francesco Jacopo; Guadagno, Elia; Solari, Domenico; Borrelli, Giorgio; Pignatiello, Sara; Cappabianca, Paolo; Del Basso De Caro, Marialaura

    2018-06-01

    Glioblastoma is one of the most malignant cancers, with a distinguishing dismal prognosis: surgery followed by chemo- and radiotherapy represents the current standard of care, and chemo- and radioresistance underlie disease recurrence and short overall survival of patients suffering from this malignancy. ATM is a kinase activated by autophosphorylation upon DNA doublestrand breaks arising from errors during replication, byproducts of metabolism, chemotherapy or ionizing radiations; TP53 is one of the most popular tumor suppressor, with a preeminent role in DNA damage response and repair. To study the effects of the immunohistochemical expression of p-ATM and p53 in glioblastoma patients, 21 cases were retrospectively examined. In normal brain tissue, p-ATM was expressed only in neurons; conversely, in tumors cells, the protein showed a variable cytoplasmic expression (score: +,++,+++), with being completely undetectable in three cases. Statistical analysis revealed that high p-ATM score (++/+++) strongly correlated to shorter survival (P = 0.022). No difference in overall survival was registered between p53 normally expressed (NE) and overexpressed (OE) glioblastoma patients (P = 0.669). Survival analysis performed on the results from combined assessment of the two proteins showed that patients with NE p53 /low pATM score had longer overall survival than the NE p53/ high pATM score counterpart. Cox-regression analysis confirmed this finding (HR = 0.025; CI 95% = 0.002-0.284; P = 0.003). Our study outlined the immunohistochemical expression of p-ATM/p53 in glioblastomas and provided data on their possible prognostic/predictive of response role. A "non-oncogene addiction" to ATM for NEp53 glioblastoma could be postulated, strengthening the rationale for development of ATM inhibiting drugs. © 2018 Wiley Periodicals, Inc.

  17. Bimodal regulation of p21waf1 protein as function of DNA damage levels

    PubMed Central

    Buscemi, G; Ricci, C; Zannini, L; Fontanella, E; Plevani, P; Delia, D

    2014-01-01

    Human p21Waf1 protein is well known for being transcriptionally induced by p53 and activating the cell cycle checkpoint arrest in response to DNA breaks. Here we report that p21Waf1 protein undergoes a bimodal regulation, being upregulated in response to low doses of DNA damage but rapidly and transiently degraded in response to high doses of DNA lesions. Responsible for this degradation is the checkpoint kinase Chk1, which phosphorylates p21Waf1 on T145 and S146 residues and induces its proteasome-dependent proteolysis. The initial p21Waf1 degradation is then counteracted by the ATM-Chk2 pathway, which promotes the p53-dependent accumulation of p21Waf1 at any dose of damage. We also found that p21Waf1 ablation favors the activation of an apoptotic program to eliminate otherwise irreparable cells. These findings support a model in which in human cells a balance between ATM-Chk2-p53 and the ATR-Chk1 pathways modulates p21Waf1 protein levels in relation to cytostatic and cytotoxic doses of DNA damage. PMID:25486478

  18. Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.

    PubMed

    Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu

    2016-11-04

    Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. © 2015 Wiley Periodicals, Inc.

  19. The Tumor Suppressor Protein p53 and its Physiological Splicing Variant p53as in a Mouse Mammary Cancer Model

    DTIC Science & Technology

    1997-10-01

    and Biomedical Laboratories. PI - Signature Date TABLE OF CONTENTS Report Documentation Page ii Foreword m Introduction 1-2 Experimental Methods...life studies of P53 or p53as in G1, S, and G2/ M was unsuccessful as reported last year. Long cell cycle times may be responsible for lack of separation...of S-phase 5 cells from G2/ M -phase cells by centrifugal elutriation. Attempts to synchronize cells by density arrest and/or serum starvation resulted

  20. HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.

    PubMed

    Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C

    2006-02-01

    HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.

  1. Gamma rays induce a p53-independent mitochondrial biogenesis that is counter-regulated by HIF1α

    PubMed Central

    Bartoletti-Stella, A; Mariani, E; Kurelac, I; Maresca, A; Caratozzolo, M F; Iommarini, L; Carelli, V; Eusebi, L H; Guido, A; Cenacchi, G; Fuccio, L; Rugolo, M; Tullo, A; Porcelli, A M; Gasparre, G

    2013-01-01

    Mitochondrial biogenesis is an orchestrated process that presides to the regulation of the organelles homeostasis within a cell. We show that γ-rays, at doses commonly used in the radiation therapy for cancer treatment, induce an increase in mitochondrial mass and function, in response to a genotoxic stress that pushes cells into senescence, in the presence of a functional p53. Although the main effector of the response to γ-rays is the p53-p21 axis, we demonstrated that mitochondrial biogenesis is only indirectly regulated by p53, whose activation triggers a murine double minute 2 (MDM2)-mediated hypoxia-inducible factor 1α (HIF1α) degradation, leading to the release of peroxisome-proliferator activated receptor gamma co-activator 1β inhibition by HIF1α, thus promoting mitochondrial biogenesis. Mimicking hypoxia by HIF1α stabilization, in fact, blunts the mitochondrial response to γ-rays as well as the induction of p21-mediated cell senescence, indicating prevalence of the hypoxic over the genotoxic response. Finally, we also show in vivo that post-radiotherapy mitochondrial DNA copy number increase well correlates with lack of HIF1α increase in the tissue, concluding this may be a useful molecular tool to infer the trigger of a hypoxic response during radiotherapy, which may lead to failure of activation of cell senescence. PMID:23764844

  2. Janus face-like effects of Aurora B inhibition: antitumoral mode of action versus induction of aneuploid progeny.

    PubMed

    Wiedemuth, Ralf; Klink, Barbara; Fujiwara, Mamoru; Schröck, Evelin; Tatsuka, Masaaki; Schackert, Gabriele; Temme, Achim

    2016-10-01

    The mitotic Aurora B kinase is overexpressed in tumors and various inhibitors for Aurora B are currently under clinical assessments. However, when considering Aurora B kinase inhibitors as anticancer drugs, their mode of action and the role of p53 status as a possible predictive factor for response still needs to be investigated. In this study, we analyzed the effects of selective Aurora B inhibition using AZD1152-HQPA/Barasertib (AZD1152) on HCT116 cells, U87-MG, corresponding isogenic p53-deficient cells and a primary glioblastoma cell line. AZD1152 treatment caused polyploidy and non-apoptotic cell death in all cell lines irrespective of p53 status and was accompanied by poly-merotelic kinetochore-microtubule attachments and DNA damage. In p53 wild-type cells a DNA damage response induced an inefficient pseudo-G1 cell cycle arrest, which was not able to halt ongoing endoreplication of cells. Of note, release of tumor cells from AZD1152 resulted in recovery of aneuploid progenies bearing numerical and structural chromosomal aberrations. Yet, AZD1152 treatment enhanced death receptor TRAIL-R2 levels in all tumor cell lines investigated. A concomitant increase of the activating natural killer (NK) cell ligand MIC A/B in p53-deficient cells and an induction of FAS/CD95 in cells containing p53 rendered AZD1152-treated cells more susceptible for NK-cell-mediated lysis. Our study mechanistically explains a p53-independent mode of action of a chemical Aurora B inhibitor and suggests a potential triggering of antitumoral immune responses, following polyploidization of tumor cells, which might constrain recovery of aneuploid tumor cells. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    PubMed

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  4. p53, a New Master Regulator of Stem Cell Differentiation | Center for Cancer Research

    Cancer.gov

    When the genome is damaged, a key player in stabilizing and maintaining genomic integrity is a protein called p53.  This protein can activate or shut down gene activity in response to DNA damage.  But how exactly does p53 accomplish its task? This question has yet to be answered completely at the molecular level.   

  5. Heterogeneity of p53 dependent genomic responses following ethanol exposure in a developmental mouse model of fetal alcohol spectrum disorder

    PubMed Central

    Mooney, Sandra M.; Middleton, Frank A.

    2017-01-01

    Prenatal ethanol exposure can produce structural and functional deficits in the brain and result in Fetal Alcohol Spectrum Disorder (FASD). In rodent models acute exposure to a high concentration of alcohol causes increased apoptosis in the developing brain. A single causal molecular switch that signals for this increase in apoptosis has yet to be identified. The protein p53 has been suggested to play a pivotal role in enabling cells to engage in pro-apoptotic processes, and thus figures prominently as a hub molecule in the intracellular cascade of responses elicited by alcohol exposure. In the present study we examined the effect of ethanol-induced cellular and molecular responses in primary somatosensory cortex (SI) and hippocampus of 7-day-old wild-type (WT) and p53-knockout (KO) mice. We quantified apoptosis by active caspase-3 immunohistochemistry and ApopTag™ labeling, then determined total RNA expression levels in laminae of SI and hippocampal subregions. Immunohistochemical results confirmed increased incidence of apoptotic cells in both regions in WT and KO mice following ethanol exposure. The lack of p53 was not protective in these brain regions. Molecular analyses revealed a heterogeneous response to ethanol exposure that varied depending on the subregion, and which may go undetected using a global approach. Gene network analyses suggest that the presence or absence of p53 alters neuronal function and synaptic modifications following ethanol exposure, in addition to playing a classic role in cell cycle signaling. Thus, p53 may function in a way that underlies the intellectual and behavioral deficits observed in FASD. PMID:28723918

  6. Reciprocal inhibition of p53 and nuclear factor-kappaB transcriptional activities determines cell survival or death in neurons.

    PubMed

    Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef

    2003-09-17

    The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.

  7. The Role of p53 in Combination Radioimmunotherapy with 64Cu-DOTA-Cetuximab and Cisplatin in a Mouse Model of Colorectal Cancer

    PubMed Central

    Guo, Yunjun; Parry, Jesse J.; Laforest, Richard; Rogers, Buck E.; Anderson, Carolyn J.

    2014-01-01

    Radioimmunotherapy has been successfully used in the treatment of lymphoma but thus far has not demonstrated significant efficacy in humans beyond disease stabilization in solid tumors. Radioimmunotherapy with 64Cu was highly effective in a hamster model of colorectal cancer, but targeted radiotherapies with this radionuclide have since not shown as much success. It is widely known that mutations in key proteins play a role in the success or failure of cancer therapies. For example, the KRAS mutation is predictive of poor response to anti–epidermal growth factor receptor therapies in colorectal cancer, whereas p53 is frequently mutated in tumors, causing resistance to multiple therapeutic regimens. Methods We previously showed that nuclear localization of 64Cu-labeled DOTA-cetuximab was enhanced in p53 wild-type tumor cells. Here, we examine the role of p53 in the response to radioimmunotherapy with 64Cu-DOTA-cetuximab in KRAS-mutated HCT116 tumor–bearing mice, with and without cisplatin, which upregulates wild-type p53. Results Experiments with HCT116 cells that are p53 +/+ (p53 wild-type) and −/− (p53 null) grown in cell culture demonstrated that preincubation with cisplatin increased expression of p53 and subsequently enhanced localization of 64Cu from 64Cuacetate and 64Cu-DOTA-cetuximab to the tumor cell nuclei. Radioimmunotherapy studies in p53-positive HCT116 tumor–bearing mice, receiving either radioimmunotherapy alone or in combination with cisplatin, showed significantly longer survival in mice receiving unlabeled cetuximab or cisplatin alone or in combination (all, P < 0.01). In contrast, the p53-negative tumor-bearing mice treated with radioimmunotherapy alone or combined with cisplatin showed no survival advantage, compared with control groups (all, P > 0.05). Conclusion Together, these data suggest that 64Cu specifically delivered to epidermal growth factor receptor–positive tumors by cetuximab can suppress tumor growth despite the KRAS status and present opportunities for personalized clinical treatment strategies in colorectal cancer. PMID:23873478

  8. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    PubMed

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  9. Effect of water treatment sludge on growth and elemental composition of tomato (Lycopersicon esculentum) shoots

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elliott, H.A.; Singer, L.M.

    The impact of a water treatment sludge on the fertility of a silt loam soil was assessed by monitoring the yield and elemental composition of tomato (Lycopersicon esculentum) shoots in a greenhouse study. Application of sludge at rates from 2-10% (air dry weight basis) raised the soil pH from 5.3 to 8.0 which enhanced plant growth. A substantial reduction in metal (Cd, Zn, Cu, Ni) uptake was observed with sludge amendments, even at the highest rates. The alkaline nature of this sludge (pH=9.3, calcium carbonate equivalence=53%) suggest its potential use as a liming material for agricultural soils. Overly alkaline conditionsmore » should be avoided however, as high application rates combined with ammonia fertilization had an antagonistic effect on plant growth, possibly from P deficiency induced by struvite (MgNH{sub 4}PO{sub 4}) formation.« less

  10. Phosphorylation of the Mdm2 oncoprotein by the c-Abl tyrosine kinase regulates p53 tumor suppression and the radiosensitivity of mice.

    PubMed

    Carr, Michael I; Roderick, Justine E; Zhang, Hong; Woda, Bruce A; Kelliher, Michelle A; Jones, Stephen N

    2016-12-27

    The p53 tumor suppressor acts as a guardian of the genome by preventing the propagation of DNA damage-induced breaks and mutations to subsequent generations of cells. We have previously shown that phosphorylation of the Mdm2 oncoprotein at Ser394 by the ATM kinase is required for robust p53 stabilization and activation in cells treated with ionizing radiation, and that loss of Mdm2 Ser394 phosphorylation leads to spontaneous tumorigenesis and radioresistance in Mdm2 S394A mice. Previous in vitro data indicate that the c-Abl kinase phosphorylates Mdm2 at the neighboring residue (Tyr393) in response to DNA damage to regulate p53-dependent apoptosis. In this present study, we have generated an Mdm2 mutant mouse (Mdm2 Y393F ) to determine whether c-Abl phosphorylation of Mdm2 regulates the p53-mediated DNA damage response or p53 tumor suppression in vivo. The Mdm2 Y393F mice develop accelerated spontaneous and oncogene-induced tumors, yet display no defects in p53 stabilization and activity following acute genotoxic stress. Although apoptosis is unaltered in these mice, they recover more rapidly from radiation-induced bone marrow ablation and are more resistant to whole-body radiation-induced lethality. These data reveal an in vivo role for c-Abl phosphorylation of Mdm2 in regulation of p53 tumor suppression and bone marrow failure. However, c-Abl phosphorylation of Mdm2 Tyr393 appears to play a lesser role in governing Mdm2-p53 signaling than ATM phosphorylation of Mdm2 Ser394. Furthermore, the effects of these phosphorylation events on p53 regulation are not additive, as Mdm2 Y393F/S394A mice and Mdm2 S394A mice display similar phenotypes.

  11. Phosphorylation of the Mdm2 oncoprotein by the c-Abl tyrosine kinase regulates p53 tumor suppression and the radiosensitivity of mice

    PubMed Central

    Carr, Michael I.; Roderick, Justine E.; Zhang, Hong; Woda, Bruce A.; Kelliher, Michelle A.; Jones, Stephen N.

    2016-01-01

    The p53 tumor suppressor acts as a guardian of the genome by preventing the propagation of DNA damage-induced breaks and mutations to subsequent generations of cells. We have previously shown that phosphorylation of the Mdm2 oncoprotein at Ser394 by the ATM kinase is required for robust p53 stabilization and activation in cells treated with ionizing radiation, and that loss of Mdm2 Ser394 phosphorylation leads to spontaneous tumorigenesis and radioresistance in Mdm2S394A mice. Previous in vitro data indicate that the c-Abl kinase phosphorylates Mdm2 at the neighboring residue (Tyr393) in response to DNA damage to regulate p53-dependent apoptosis. In this present study, we have generated an Mdm2 mutant mouse (Mdm2Y393F) to determine whether c-Abl phosphorylation of Mdm2 regulates the p53-mediated DNA damage response or p53 tumor suppression in vivo. The Mdm2Y393F mice develop accelerated spontaneous and oncogene-induced tumors, yet display no defects in p53 stabilization and activity following acute genotoxic stress. Although apoptosis is unaltered in these mice, they recover more rapidly from radiation-induced bone marrow ablation and are more resistant to whole-body radiation-induced lethality. These data reveal an in vivo role for c-Abl phosphorylation of Mdm2 in regulation of p53 tumor suppression and bone marrow failure. However, c-Abl phosphorylation of Mdm2 Tyr393 appears to play a lesser role in governing Mdm2-p53 signaling than ATM phosphorylation of Mdm2 Ser394. Furthermore, the effects of these phosphorylation events on p53 regulation are not additive, as Mdm2Y393F/S394A mice and Mdm2S394A mice display similar phenotypes. PMID:27956626

  12. Similar mitochondrial signaling responses to a single bout of continuous or small-sided-games-based exercise in sedentary men.

    PubMed

    Mendham, Amy E; Duffield, Rob; Coutts, Aaron J; Marino, Frank E; Boyko, Andriy; McAinch, Andrew J; Bishop, David John

    2016-12-01

    This study assessed the mitochondrial related signaling responses to a single bout of noncontact, modified football (touch rugby), played as small-sided games (SSG), or cycling (CYC) exercise in sedentary, obese, middle-aged men. In a randomized, crossover design, nine middle-aged, sedentary, obese men completed two, 40-min exercise conditions (CYC and SSG) separated by a 21-day recovery period. Heart rate (HR) and ratings of perceived exertion (RPE) were collected during each bout. Needle biopsies from the vastus lateralis muscle were collected at rest and 30 and 240 min postexercise for analysis of protein content and phosphorylation (PGC-1α, SIRT1, p53, p53 Ser15 , AMPK, AMPK Thr172 , CAMKII, CAMKII Thr286 , p38MAPK, and p38MAPK Thr180/Tyr182 ) and mRNA expression (PGC-1α, p53, NRF1, NRF2, Tfam, and cytochrome c). A main effect of time effect for both conditions was evident for HR, RPE, and blood lactate (P < 0.05), with no condition by time interaction (P > 0.05). Both conditions increased PGC1-α protein and mRNA expression at 240 min (P < 0.05). AMPK Thr172 increased 30 min post CYC (P < 0.05), with no change in SSG (P > 0.05). CYC increased p53 protein content at 240 min to a greater extent than SSG (P < 0.05). mRNA expression of NRF2 decreased in both conditions (P < 0.05). No condition by time interactions were evident for mRNA expression of Tfam, NRF1, cytochrome c, and p53. The similar PGC-1α response between intensity-matched conditions suggests both conditions are of similar benefit for stimulating mitochondrial biogenesis. Differences between conditions regarding fluctuation in exercise intensity and type of muscle contraction may explain the increase of p53 and AMPK within CYC and not SSG (noncontact, modified football). Copyright © 2016 the American Physiological Society.

  13. Axonal Degeneration Is Regulated by a Transcriptional Program that Coordinates Expression of Pro- and Anti-degenerative Factors.

    PubMed

    Maor-Nof, Maya; Romi, Erez; Sar Shalom, Hadas; Ulisse, Valeria; Raanan, Calanit; Nof, Aviv; Leshkowitz, Dena; Lang, Roland; Yaron, Avraham

    2016-12-07

    Developmental neuronal cell death and axonal elimination are controlled by transcriptional programs, of which their nature and the function of their components remain elusive. Here, we identified the dual specificity phosphatase Dusp16 as part of trophic deprivation-induced transcriptome in sensory neurons. Ablation of Dusp16 enhanced axonal degeneration in response to trophic withdrawal, suggesting that it has a protective function. Moreover, axonal skin innervation was severely reduced while neuronal elimination was increased in the Dusp16 knockout. Mechanistically, Dusp16 negatively regulates the transcription factor p53 and antagonizes the expression of the pro-degenerative factor, Puma (p53 upregulated modulator of apoptosis). Co-ablation of Puma with Dusp16 protected axons from rapid degeneration and specifically reversed axonal innervation loss early in development with no effect on neuronal deficits. Overall, these results reveal that physiological axonal elimination is regulated by a transcriptional program that integrates regressive and progressive elements and identify Dusp16 as a new axonal preserving factor. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiran, Shashi; Oddi, Vineesha; Ramakrishna, Gayatri, E-mail: gayatrirama1@gmail.com

    2015-02-01

    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose ofmore » doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT7 attenuated p38/JNK activation and also p53 response. • Overall, SIRT7 promoted cellular survival in conditions of genomic stress.« less

  15. p53 Involvement in the Control of Murine Hair Follicle Regression

    PubMed Central

    Botchkarev, Vladimir A.; Komarova, Elena A.; Siebenhaar, Frank; Botchkareva, Natalia V.; Sharov, Andrei A.; Komarov, Pavel G.; Maurer, Marcus; Gudkov, Andrei V.; Gilchrest, Barbara A.

    2001-01-01

    p53 is a transcription factor mediating a variety of biological responses including apoptotic cell death. p53 was recently shown to control apoptosis in the hair follicle induced by ionizing radiation and chemotherapy, but its role in the apoptosis-driven physiological hair follicle regression (catagen) remains to be elucidated. Here, we show that p53 protein is strongly expressed and co-localized with apoptotic markers in the regressing hair follicle compartments during catagen. In contrast to wild-type mice, p53 knockout mice show significant retardation of catagen accompanied by significant decrease in the number of apoptotic cells in the hair matrix. Furthermore, p53 null hair follicles are characterized by alterations in the expression of markers that are encoded by p53 target genes and are implicated in the control of catagen (Bax, Bcl-2, insulin-like growth factor binding protein-3). These data suggest that p53 is involved in the control of apoptosis in the hair follicle during physiological regression and imply that p53 antagonists may be useful for the management of hair growth disorders characterized by premature entry into catagen, such as androgenetic alopecia, alopecia areata, and telogen effluvium. PMID:11395365

  16. Degradation of phosphorylated p53 by viral protein-ECS E3 ligase complex.

    PubMed

    Sato, Yoshitaka; Kamura, Takumi; Shirata, Noriko; Murata, Takayuki; Kudoh, Ayumi; Iwahori, Satoko; Nakayama, Sanae; Isomura, Hiroki; Nishiyama, Yukihiro; Tsurumi, Tatsuya

    2009-07-01

    p53-signaling is modulated by viruses to establish a host cellular environment advantageous for their propagation. The Epstein-Barr virus (EBV) lytic program induces phosphorylation of p53, which prevents interaction with MDM2. Here, we show that induction of EBV lytic program leads to degradation of p53 via an ubiquitin-proteasome pathway independent of MDM2. The BZLF1 protein directly functions as an adaptor component of the ECS (Elongin B/C-Cul2/5-SOCS-box protein) ubiquitin ligase complex targeting p53 for degradation. Intringuingly, C-terminal phosphorylation of p53 resulting from activated DNA damage response by viral lytic replication enhances its binding to BZLF1 protein. Purified BZLF1 protein-associated ECS could be shown to catalyze ubiquitination of phospho-mimetic p53 more efficiently than the wild-type in vitro. The compensation of p53 at middle and late stages of the lytic infection inhibits viral DNA replication and production during lytic infection, suggesting that the degradation of p53 is required for efficient viral propagation. Taken together, these findings demonstrate a role for the BZLF1 protein-associated ECS ligase complex in regulation of p53 phosphorylated by activated DNA damage signaling during viral lytic infection.

  17. Identification of a small molecule that overcomes HdmX-mediated suppression of p53

    PubMed Central

    Chakrabarti, Amit; Karan, Sukanya; Liu, Zhigang; Xia, Zhiqiang; Gundluru, Mahesh; Moreton, Stephen; Saunthararajah, Yogen; Jackson, Mark W; Agarwal, Mukesh K; Wald, David N

    2016-01-01

    Inactivation of the p53 tumor suppressor by mutation or overexpression of negative regulators occurs frequently in cancer. Since p53 plays a key role in regulating proliferation or apoptosis in response to DNA damaging chemotherapies, strategies aimed at reactivating p53 are increasingly being sought. Strategies to reactivate wild-type p53 include the use of small molecules capable of releasing wild-type p53 from key, cellular negative regulators, such as Hdm2 and HdmX. Derivatives of the Hdm2 antagonist Nutlin-3 are in clinical trials. However, Nutlin-3 specifically disrupts Hdm2-p53, leaving tumors harboring high levels of HdmX resistant to Nutlin-3 treatment. Here we identify CTX1, a novel small molecule that overcomes HdmX-mediated p53 repression. CTX1 binds directly to HdmX to prevent p53-HdmX complex formation, resulting in the rapidly induction of p53 in a DNA damage-independent manner. Treatment of a panel of cancer cells with CTX1 induced apoptosis or suppressed proliferation and importantly, CTX1 demonstrates promising activity as a single agent in a mouse model of circulating primary human leukemia. CTX1 is a small molecule HdmX inhibitor that demonstrates promise as a cancer therapeutic candidate. PMID:26883273

  18. Caspase-2-mediated cleavage of Mdm2 creates p53-induced positive feedback loop

    PubMed Central

    Oliver, Trudy G.; Meylan, Etienne; Chang, Gregory P.; Xue, Wen; Burke, James R.; Humpton, Timothy J.; Hubbard, Diana; Bhutkar, Arjun; Jacks, Tyler

    2011-01-01

    SUMMARY Caspase-2 is an evolutionarily conserved caspase, yet its biological function and cleavage targets are poorly understood. Caspase-2 is activated by the p53 target gene product PIDD (also known as LRDD) in a complex called the Caspase-2-PIDDosome. We show that PIDD expression promotes growth arrest and chemotherapy resistance by a mechanism that depends on Caspase-2 and wild-type p53. PIDD-induced Caspase-2 directly cleaves the E3 ubiquitin ligase Mdm2 at Asp 367, leading to loss of the C-terminal RING domain responsible for p53 ubiquitination. As a consequence, N-terminally truncated Mdm2 binds p53 and promotes its stability. Upon DNA damage, p53 induction of the Caspase-2-PIDDosome creates a positive feedback loop that inhibits Mdm2 and reinforces p53 stability and activity, contributing to cell survival and drug resistance. These data establish Mdm2 as a cleavage target of Caspase-2 and provide insight into a mechanism of Mdm2 inhibition that impacts p53 dynamics upon genotoxic stress. PMID:21726810

  19. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    PubMed Central

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  20. Replication of damaged DNA in vitro is blocked by p53

    PubMed Central

    Zhou, Jianmin; Prives, Carol

    2003-01-01

    The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

  1. Sirtuin7 is involved in protecting neurons against oxygen-glucose deprivation and reoxygenation-induced injury through regulation of the p53 signaling pathway.

    PubMed

    Lv, Jianrui; Tian, Junbin; Zheng, Guoxi; Zhao, Jing

    2017-10-01

    Sirtuin7 (SIRT7) is known to regulate apoptosis and stress responses. So far, very little is known about the role of SIRT7 in cerebral ischemia/reperfusion injury. In this study, we aimed to investigate the potential role of SIRT7 in regulating oxygen-glucose deprivation and reoxygenation (OGD/R)-induced injury in neurons. We found a significant increase of SIRT7 expression in neurons in response to OGD/R treatment. Knockdown of SIRT7 aggravated OGD/R-induced injury. Knockdown of SIRT7 augmented the levels of total and acetylated p53 protein. Moreover, knockdown of SIRT7 markedly increased the transcriptional activity of p53 toward apoptosis and activated the p53-mediated proapoptotic signaling pathway. By contrast, overexpression of SIRT7 showed the opposite effects. Taken together, the results of our study suggest that SIRT7 is involved in protecting neurons against OGD/R-induced injury, possibly through regulation of the p53-mediated proapoptotic signaling pathway, indicating a potential therapeutic target for cerebral ischemia/reperfusion injury. © 2017 Wiley Periodicals, Inc.

  2. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms.

    PubMed

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K; Xiong, Yue; Chen, Xian; Wan, Yisong Y

    2016-01-05

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1-cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms.

  3. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms

    PubMed Central

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K.; Xiong, Yue; Chen, Xian; Wan, Yisong Y.

    2016-01-01

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1–cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms. PMID:26728942

  4. A New lncRNA, APTR, Associates with and Represses the CDKN1A/p21 Promoter by Recruiting Polycomb Proteins

    PubMed Central

    Negishi, Masamitsu; Wongpalee, Somsakul P.; Sarkar, Sukumar; Park, Jonghoon; Lee, Kyung Yong; Shibata, Yoshiyuki; Reon, Brian J.; Abounader, Roger; Suzuki, Yutaka; Sugano, Sumio; Dutta, Anindya

    2014-01-01

    Long noncoding RNAs (lncRNAs) have emerged as a major regulator of cell physiology, but many of which have no known function. CDKN1A/p21 is an important inhibitor of the cell-cycle, regulator of the DNA damage response and effector of the tumor suppressor p53, playing a crucial role in tumor development and prevention. In order to identify a regulator for tumor progression, we performed an siRNA screen of human lncRNAs required for cell proliferation, and identified a novel lncRNA, APTR, that acts in trans to repress the CDKN1A/p21 promoter independent of p53 to promote cell proliferation. APTR associates with the promoter of CDKN1A/p21 and this association requires a complementary-Alu sequence encoded in APTR. A different module of APTR associates with and recruits the Polycomb repressive complex 2 (PRC2) to epigenetically repress the p21 promoter. A decrease in APTR is necessary for the induction of p21 after heat stress and DNA damage by doxorubicin, and the levels of APTR and p21 are anti-correlated in human glioblastomas. Our data identify a new regulator of the cell-cycle inhibitor CDKN1A/p21 that acts as a proliferative factor in cancer cell lines and in glioblastomas and demonstrate that Alu elements present in lncRNAs can contribute to targeting regulatory lncRNAs to promoters. PMID:24748121

  5. Human papillomavirus type 16 E6 inhibits p21{sup WAF1} transcription independently of p53 by inactivating p150{sup Sal2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parroche, Peggy; Institut Federatif de Recherche 128 BioSciences Gerland-Lyon Sud; Touka, Majid

    2011-09-01

    HPV16 E6 deregulates G1/S cell cycle progression through p53 degradation preventing transcription of the CDK inhibitor p21{sup WAF1}. However, additional mechanisms independent of p53 inactivation appear to exist. Here, we report that HPV16 E6 targets the cellular factor p150{sup Sal2}, which positively regulates p21{sup WAF1} transcription. HPV16 E6 associates with p150{sup Sal2}, inducing its functional inhibition by preventing its binding to cis elements on the p21{sup WAF1} promoter. A HPV16 E6 mutant, L110Q, which was unable to bind p150{sup Sal2}, did not affect the ability of the cellular protein to bind p21{sup WAF1} promoter, underlining the linkage between these events.more » These data describe a novel mechanism by which HPV16 E6 induces cell cycle deregulation with a p53-independent pathway. The viral oncoprotein targets p150{sup Sal2}, a positive transcription regulator of p21{sup WAF1} gene, preventing G1/S arrest and allowing cellular proliferation and efficient viral DNA replication.« less

  6. Shorter telomere length in peripheral blood lymphocytes of workers exposed to polycyclic aromatic hydrocarbons.

    PubMed

    Pavanello, Sofia; Pesatori, Angela-C; Dioni, Laura; Hoxha, Mirjam; Bollati, Valentina; Siwinska, Ewa; Mielzyńska, Danuta; Bolognesi, Claudia; Bertazzi, Pier-Alberto; Baccarelli, Andrea

    2010-02-01

    Shorter telomere length (TL) in peripheral blood lymphocytes (PBLs) is predictive of lung cancer risk. Polycyclic aromatic hydrocarbons (PAHs) are established lung carcinogens that cause chromosome instability. Whether PAH exposure and its molecular effects are linked with shorter TL has never been evaluated. In the present study, we investigated the effect of chronic exposure to PAHs on TL measured in PBLs of Polish male non-current smoking cokeoven workers and matched controls. PAH exposure and molecular effects were characterized using measures of internal dose (urinary 1-pyrenol), effective dose [anti-benzo[a]pyrene diolepoxide (anti-BPDE)-DNA adduct], genetic instability (micronuclei, MN) and DNA methylation [p53 promoter and Alu and long interspersed nuclear element-1 (LINE-1) repetitive elements, as surrogate measures of global methylation] in PBLs. TL was measured by real-time polymerase chain reaction. Cokeoven workers were heavily exposed to PAHs (79% exceeded the urinary 1-pyrenol biological exposure index) and exhibited lower TL (P = 0.038) than controls, as well as higher levels of genetic and chromosomal alterations [i.e. anti-BPDE-DNA adduct and MN (P < 0.0001)] and epigenetic changes [i.e. p53 gene-specific promoter and global methylation (P

  7. Ionizing Radiation-Induced Responses in Human Cells with Differing TP53 Status

    PubMed Central

    Mirzayans, Razmik; Andrais, Bonnie; Scott, April; Wang, Ying W.; Murray, David

    2013-01-01

    Ionizing radiation triggers diverse responses in human cells encompassing apoptosis, necrosis, stress-induced premature senescence (SIPS), autophagy, and endopolyploidy (e.g., multinucleation). Most of these responses result in loss of colony-forming ability in the clonogenic survival assay. However, not all modes of so-called clonogenic cell “death” are necessarily advantageous for therapeutic outcome in cancer radiotherapy. For example, the crosstalk between SIPS and autophagy is considered to influence the capacity of the tumor cells to maintain a prolonged state of growth inhibition that unfortunately can be succeeded by tumor regrowth and disease recurrence. Likewise, endopolyploid giant cells are able to segregate into near diploid descendants that continue mitotic activities. Herein we review the current knowledge on the roles that the p53 and p21WAF1 tumor suppressors play in determining the fate of human fibroblasts (normal and Li-Fraumeni syndrome) and solid tumor-derived cells after exposure to ionizing radiation. In addition, we discuss the important role of WIP1, a p53-regulated oncogene, in the temporal regulation of the DNA damage response and its contribution to p53 dynamics post-irradiation. This article highlights the complexity of the DNA damage response and provides an impetus for rethinking the nature of cancer cell resistance to therapeutic agents. PMID:24232458

  8. TGFbeta1 (Leu10Pro), p53 (Arg72Pro) can predict for increased risk for breast cancer in south Indian women and TGFbeta1 Pro (Leu10Pro) allele predicts response to neo-adjuvant chemo-radiotherapy.

    PubMed

    Rajkumar, Thangarajan; Samson, Mani; Rama, Ranganathan; Sridevi, Veluswami; Mahji, Urmila; Swaminathan, Rajaraman; Nancy, Nirmala K

    2008-11-01

    The breast cancer incidence has been increasing in the south Indian women. A case (n=250)-control (n=500) study was undertaken to investigate the role of Single Nucleotide Polymorphisms (SNP's) in GSTM1 (Present/Null); GSTP1 (Ile105Val), p53 (Arg72Pro), TGFbeta1 (Leu10Pro), c-erbB2 (Ile655Val), and GSTT1 (Null/Present) in breast cancer. In addition, the value of the SNP's in predicting primary tumor's pathologic response following neo-adjuvant chemo-radiotherapy was assessed. Genotyping was done using PCR (GSTM1, GSTT1), Taqman Allelic discrimination assay (GSTP1, c-erbB2) and PCR-CTPP (p53 and TGFbeta1). None of the gene SNP's studied were associated with a statistically significant increased risk for the breast cancer. However, combined analysis of the SNP's showed that p53 (Arg/Arg and Arg/Pro) with TGFbeta1 (Pro/Pro and Leu/Pro) were associated with greater than 2 fold increased risk for breast cancer in Univariate (P=0.01) and Multivariate (P=0.003) analysis. There was no statistically significant association for the GST family members with the breast cancer risk. TGFbeta1 (Pro/Pro) allele was found to predict complete pathologic response in the primary tumour following neo-adjuvant chemo-radiotherapy (OR=6.53 and 10.53 in Univariate and Multivariate analysis respectively) (P=0.004) and was independent of stage. This study suggests that SNP's can help predict breast cancer risk in south Indian women and that TGFbeta1 (Pro/Pro) allele is associated with a better pCR in the primary tumour.

  9. Poor prognosis in non-villous splenic marginal zone cell lymphoma is associated with p53 mutations.

    PubMed

    Baldini, L; Guffanti, A; Cro, L; Fracchiolla, N S; Colombi, M; Motta, M; Maiolo, A T; Neri, A

    1997-11-01

    We have recently reported a series of 15 non-villous splenic marginal zone lymphoma patients, six of whom showed p53 mutations (40%). This molecular alteration did not correlate with any particular clinico-pathologic feature at diagnosis. After a median follow-up of 56 months, four cases evolved into aggressive fatal non-Hodgkin's lymphoma (NHL) and two had refractory progressive disease; interestingly, p53 mutations were demonstrated in five of these patients at diagnosis. As the patients with wild-type p53 presented responsive or indolent disease, this genetic alteration may be an early marker of aggressive transformation or refractoriness. p53 evaluation at diagnosis could be advisable in this particular subset of NHL.

  10. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  11. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    PubMed

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  12. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    PubMed Central

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  13. Missense mutations located in structural p53 DNA-binding motifs are associated with extremely poor survival in chronic lymphocytic leukemia.

    PubMed

    Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri

    2011-07-01

    There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P < .001). Survival assessed from the time of abnormality detection was significantly reduced in patients with both missense (P < .001) and nonmissense p53 mutations (P = .004). In addition, patients harboring missense mutation located in p53 DNA-binding motifs (DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.

  14. The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

    PubMed

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

  15. A Dbf4p BRCA1 C-Terminal-Like Domain Required for the Response to Replication Fork Arrest in Budding Yeast

    PubMed Central

    Gabrielse, Carrie; Miller, Charles T.; McConnell, Kristopher H.; DeWard, Aaron; Fox, Catherine A.; Weinreich, Michael

    2006-01-01

    Dbf4p is an essential regulatory subunit of the Cdc7p kinase required for the initiation of DNA replication. Cdc7p and Dbf4p orthologs have also been shown to function in the response to DNA damage. A previous Dbf4p multiple sequence alignment identified a conserved ∼40-residue N-terminal region with similarity to the BRCA1 C-terminal (BRCT) motif called “motif N.” BRCT motifs encode ∼100-amino-acid domains involved in the DNA damage response. We have identified an expanded and conserved ∼100-residue N-terminal region of Dbf4p that includes motif N but is capable of encoding a single BRCT-like domain. Dbf4p orthologs diverge from the BRCT motif at the C terminus but may encode a similar secondary structure in this region. We have therefore called this the BRCT and DBF4 similarity (BRDF) motif. The principal role of this Dbf4p motif was in the response to replication fork (RF) arrest; however, it was not required for cell cycle progression, activation of Cdc7p kinase activity, or interaction with the origin recognition complex (ORC) postulated to recruit Cdc7p–Dbf4p to origins. Rad53p likely directly phosphorylated Dbf4p in response to RF arrest and Dbf4p was required for Rad53p abundance. Rad53p and Dbf4p therefore cooperated to coordinate a robust cellular response to RF arrest. PMID:16547092

  16. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    PubMed

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  17. Suppression of p53-inducible gene 3 is significant for glioblastoma progression and predicts poor patient prognosis.

    PubMed

    Quan, Jishu; Li, Yong; Jin, Meihua; Chen, Dunfu; Yin, Xuezhe; Jin, Ming

    2017-03-01

    Glioblastoma is the most malignant and invasive brain tumor with extremely poor prognosis. p53-inducible gene 3, a downstream molecule of the tumor suppressor p53, has been found involved in apoptosis and oxidative stress response. However, the functions of p53-inducible gene 3(PIG3) in cancer are far from clear including glioblastoma. In this study, we found that p53-inducible gene 3 expression was suppressed in glioblastoma tissues compared with normal tissues. And the expression of p53-inducible gene 3 was significantly associated with the World Health Organization grade. Patients with high p53-inducible gene 3 expression have a significantly longer median survival time (15 months) than those with low p53-inducible gene 3 expression (8 months). According to Cox regression analysis, p53-inducible gene 3 was an independent prognostic factor with multivariate hazard ratio of 0.578 (95% confidence interval, 0.352-0.947; p = 0.030) for overall survival. Additionally, gain and loss of function experiments showed that knockdown of p53-inducible gene 3 significantly increased the proliferation and invasion ability of glioblastoma cells while overexpression of p53-inducible gene 3 inhibited the proliferation and invasion ability. The results of in vivo glioblastoma models further confirmed that p53-inducible gene 3 suppression promoted glioblastoma progression. Altogether, our data suggest that high expression of p53-inducible gene 3 is significant for glioblastoma inhibition and p53-inducible gene 3 independently indicates good prognosis in patients, which might be a novel prognostic biomarker or potential therapeutic target in glioblastoma.

  18. Novel Plasmid-Encoded Ceftazidime-Hydrolyzing CTX-M-53 Extended-Spectrum β-Lactamase from Salmonella enterica Serotypes Westhampton and Senftenberg▿

    PubMed Central

    Doublet, Benoît; Granier, Sophie A.; Robin, Frédéric; Bonnet, Richard; Fabre, Laëtitia; Brisabois, Anne; Cloeckaert, Axel; Weill, François-Xavier

    2009-01-01

    We describe the characterization of a novel CTX-M β-lactamase from Salmonella enterica. Four S. enterica isolates (three of serotype Westhampton and one of serotype Senftenberg) resistant to extended-spectrum cephalosporins (cefotaxime and ceftazidime) were recovered in 2004 from living cockles in three supermarkets located in distant geographic areas in France, which got their supplies from the same fishery. The isolates were found to produce a novel extended-spectrum β-lactamase (ESBL) belonging to the CTX-M-1 phylogenetic group and named CTX-M-53. The CTX-M-53 β-lactamase harbored the substitution Asp240Gly, like the CTX-M-15 enzyme, which is specifically implicated in a higher catalytic efficiency against ceftazidime. The blaCTX-M-53 gene was located on a mobilizable 11-kb plasmid, pWES-1. The complete sequence of pWES-1 revealed the presence of a novel insertion sequence, ISSen2, and an IS26 element upstream and downstream of the blaCTX-M-53 gene, respectively; however, transposition assays of the blaCTX-M-53 gene were unsuccessful. IS26 elements may have contributed to the acquisition of the blaCTX-M-53 gene. Interestingly, the mobilization module of the pWES-1 plasmid was similar to that of quinolone resistance plasmids (carrying the qnrS2 gene) from aquatic sources. Although belonging to two serotypes differentiated on the basis of the O-antigen structure (E1 or E4 groups), the isolates were found to be genetically indistinguishable by pulsed-field gel electrophoresis. Multilocus sequence typing showed that the isolates of serotype Westhampton had a sequence type, ST14, common among isolates of serotype Senftenberg. This is the first characterization of the CTX-M-53 ESBL, which represents an additional ceftazidime-hydrolyzing CTX-M enzyme. PMID:19273683

  19. The Role of JMY in p53 Regulation.

    PubMed

    Adighibe, Omanma; Pezzella, Francesco

    2018-05-31

    Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

  20. Peptide immunisation of HLA-DR-transgenic mice permits the identification of a novel HLA-DRbeta1*0101- and HLA-DRbeta1*0401-restricted epitope from p53.

    PubMed

    Rojas, José Manuel; McArdle, Stephanie E B; Horton, Roger B V; Bell, Matthew; Mian, Shahid; Li, Geng; Ali, Selman A; Rees, Robert C

    2005-03-01

    Because of the central role of CD4(+) T cells in antitumour immunity, the identification of the MHC class II-restricted peptides to which CD4(+) T cells respond has become a priority of tumour immunologists. Here, we describe a strategy permitting us to rapidly determine the immunogenicity of candidate HLA-DR-restricted peptides using peptide immunisation of HLA-DR-transgenic mice, followed by assessment of the response in vitro. This strategy was successfully applied to the reported haemaglutinin influenza peptide HA(307-319), and then extended to three candidate HLA-DR-restricted p53 peptides predicted by the evidence-based algorithm SYFPEITHI to bind to HLA-DRbeta1*0101 (HLA-DR1) and HLA-DRbeta1*0401 (HLA-DR4) molecules. One of these peptides, p53(108-122), consistently induced responses in HLA-DR1- and in HLA-DR4-transgenic mice. Moreover, this peptide was naturally processed by dendritic cells (DCs), and induced specific proliferation in the splenocytes of mice immunised with p53 cDNA, demonstrating that immune responses could be naturally mounted to the peptide. Furthermore, p53(108-122) peptide was also immunogenic in HLA-DR1 and HLA-DR4 healthy donors. Thus, the use of this transgenic model permitted the identification of a novel HLA-DR-restricted epitope from p53 and constitutes an attractive approach for the rapid identification of novel immunogenic MHC class II-restricted peptides from tumour antigens, which can ultimately be incorporated in immunotherapeutic protocols.

  1. Gene Expression in Mammalian Cells After Exposure to 95 MeV Argon Ions

    NASA Astrophysics Data System (ADS)

    Arenz, A.; Hellweg, C. E.; Baumstark-Khan, C.

    Cell response to genotoxic agents is complex and involves the participation of different classes of genes (DNA repair, cell cycle control, signal transduction, apoptosis and oncogenesis). The unique feature of the space radiation environment is the dominance of high-energy charged particles (HZE or high LET radiation) which present a significant hazard to space flight crews, and accelerator-based experiments are underway to quantify the health risks due to unavoidable radiation exposure. High linear energy transfer (LET) radiation has an increased relative biological effectiveness (RBE) as compared to X-rays for cell death induction, gene mutation, genomic instability, and carcinogenesis. The tumour suppressor gene p53 plays a crucial role in maintaining the integrity of the genome. The p53 protein acts as a transcription factor that mediates cell cycle arrest and apoptosis by binding to DNA and activating transcription of specific genes. It is also though to be involved in damage repair by transcriptional activation of the newly identified p53 dependent ribonuclease subunit R2 (p53R2) that is directly involved in the p53 cell cycle checkpoint for repair of damaged DNA. In that case it is responsible for nucleotide delivery for DNA repair synthesis. DNA damages of cultured human cells (e.g. MCF-7, AGS, A549) exposed to accelerated argon ions at the French heavy ion facility GANIL were analysed for expression levels of certain damage- and apoptosis-relevant genes. RNA was extracted from cells exposed to different particle fluences after various recovery times. A real-time QRT-PCR assay was applied, which employs both relative and absolute quantification of a candidate mRNA biomarker. The expressions of different DNA damage inducible genes (e.g. p53R2, GADD45, p21) were analysed. A reproducible up-regulation representing a twofold to fourfold change in p53R2 gene expression level was confirmed for X-irradiated and Ar-ion exposed cells dependent on dose. Kinetics of p53R2 gene expression modulations shows a response lasting up to 24 hours after irradiation.

  2. Non-linear feedback control of the p53 protein-mdm2 inhibitor system using the derivative-free non-linear Kalman filter.

    PubMed

    Rigatos, Gerasimos G

    2016-06-01

    It is proven that the model of the p53-mdm2 protein synthesis loop is a differentially flat one and using a diffeomorphism (change of state variables) that is proposed by differential flatness theory it is shown that the protein synthesis model can be transformed into the canonical (Brunovsky) form. This enables the design of a feedback control law that maintains the concentration of the p53 protein at the desirable levels. To estimate the non-measurable elements of the state vector describing the p53-mdm2 system dynamics, the derivative-free non-linear Kalman filter is used. Moreover, to compensate for modelling uncertainties and external disturbances that affect the p53-mdm2 system, the derivative-free non-linear Kalman filter is re-designed as a disturbance observer. The derivative-free non-linear Kalman filter consists of the Kalman filter recursion applied on the linearised equivalent of the protein synthesis model together with an inverse transformation based on differential flatness theory that enables to retrieve estimates for the state variables of the initial non-linear model. The proposed non-linear feedback control and perturbations compensation method for the p53-mdm2 system can result in more efficient chemotherapy schemes where the infusion of medication will be better administered.

  3. p53 is a key regulator for osthole-triggered cancer pathogenesis.

    PubMed

    Huang, Ssu-Ming; Tsai, Cheng-Fang; Chen, Dar-Ren; Wang, Min-Ying; Yeh, Wei-Lan

    2014-01-01

    Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development.

  4. Genus Beta Human Papillomavirus E6 Proteins Vary in Their Effects on the Transactivation of p53 Target Genes

    PubMed Central

    White, Elizabeth A.; Walther, Johanna; Javanbakht, Hassan

    2014-01-01

    ABSTRACT The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. IMPORTANCE This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the potential connection between some beta HPVs and cancer. PMID:24850740

  5. In Vivo Senescence in the Sbds-Deficient Murine Pancreas: Cell-Type Specific Consequences of Translation Insufficiency

    PubMed Central

    Tourlakis, Marina E.; Zhang, Siyi; Ball, Heather L.; Gandhi, Rikesh; Liu, Hongrui; Zhong, Jian; Yuan, Julie S.; Guidos, Cynthia J.; Durie, Peter R.; Rommens, Johanna M.

    2015-01-01

    Genetic models of ribosome dysfunction show selective organ failure, highlighting a gap in our understanding of cell-type specific responses to translation insufficiency. Translation defects underlie a growing list of inherited and acquired cancer-predisposition syndromes referred to as ribosomopathies. We sought to identify molecular mechanisms underlying organ failure in a recessive ribosomopathy, with particular emphasis on the pancreas, an organ with a high and reiterative requirement for protein synthesis. Biallelic loss of function mutations in SBDS are associated with the ribosomopathy Shwachman-Diamond syndrome, which is typified by pancreatic dysfunction, bone marrow failure, skeletal abnormalities and neurological phenotypes. Targeted disruption of Sbds in the murine pancreas resulted in p53 stabilization early in the postnatal period, specifically in acinar cells. Decreased Myc expression was observed and atrophy of the adult SDS pancreas could be explained by the senescence of acinar cells, characterized by induction of Tgfβ, p15Ink4b and components of the senescence-associated secretory program. This is the first report of senescence, a tumour suppression mechanism, in association with SDS or in response to a ribosomopathy. Genetic ablation of p53 largely resolved digestive enzyme synthesis and acinar compartment hypoplasia, but resulted in decreased cell size, a hallmark of decreased translation capacity. Moreover, p53 ablation resulted in expression of acinar dedifferentiation markers and extensive apoptosis. Our findings indicate a protective role for p53 and senescence in response to Sbds ablation in the pancreas. In contrast to the pancreas, the Tgfβ molecular signature was not detected in fetal bone marrow, liver or brain of mouse models with constitutive Sbds ablation. Nevertheless, as observed with the adult pancreas phenotype, disease phenotypes of embryonic tissues, including marked neuronal cell death due to apoptosis, were determined to be p53-dependent. Our findings therefore point to cell/tissue-specific responses to p53-activation that include distinction between apoptosis and senescence pathways, in the context of translation disruption. PMID:26057580

  6. In Vivo Senescence in the Sbds-Deficient Murine Pancreas: Cell-Type Specific Consequences of Translation Insufficiency.

    PubMed

    Tourlakis, Marina E; Zhang, Siyi; Ball, Heather L; Gandhi, Rikesh; Liu, Hongrui; Zhong, Jian; Yuan, Julie S; Guidos, Cynthia J; Durie, Peter R; Rommens, Johanna M

    2015-06-01

    Genetic models of ribosome dysfunction show selective organ failure, highlighting a gap in our understanding of cell-type specific responses to translation insufficiency. Translation defects underlie a growing list of inherited and acquired cancer-predisposition syndromes referred to as ribosomopathies. We sought to identify molecular mechanisms underlying organ failure in a recessive ribosomopathy, with particular emphasis on the pancreas, an organ with a high and reiterative requirement for protein synthesis. Biallelic loss of function mutations in SBDS are associated with the ribosomopathy Shwachman-Diamond syndrome, which is typified by pancreatic dysfunction, bone marrow failure, skeletal abnormalities and neurological phenotypes. Targeted disruption of Sbds in the murine pancreas resulted in p53 stabilization early in the postnatal period, specifically in acinar cells. Decreased Myc expression was observed and atrophy of the adult SDS pancreas could be explained by the senescence of acinar cells, characterized by induction of Tgfβ, p15(Ink4b) and components of the senescence-associated secretory program. This is the first report of senescence, a tumour suppression mechanism, in association with SDS or in response to a ribosomopathy. Genetic ablation of p53 largely resolved digestive enzyme synthesis and acinar compartment hypoplasia, but resulted in decreased cell size, a hallmark of decreased translation capacity. Moreover, p53 ablation resulted in expression of acinar dedifferentiation markers and extensive apoptosis. Our findings indicate a protective role for p53 and senescence in response to Sbds ablation in the pancreas. In contrast to the pancreas, the Tgfβ molecular signature was not detected in fetal bone marrow, liver or brain of mouse models with constitutive Sbds ablation. Nevertheless, as observed with the adult pancreas phenotype, disease phenotypes of embryonic tissues, including marked neuronal cell death due to apoptosis, were determined to be p53-dependent. Our findings therefore point to cell/tissue-specific responses to p53-activation that include distinction between apoptosis and senescence pathways, in the context of translation disruption.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kirsch, David G., E-mail: david.kirsch@duke.ed; Department of Radiation Oncology, Massachusetts General Hospital, Boston, MA; Departments of Radiation Oncology and Pharmacology and Cancer Biology, Duke University Medical Center, Durham, NC

    Purpose: To image a genetically engineered mouse model of non-small-cell lung cancer with micro-computed tomography (micro-CT) to measure tumor response to radiation therapy. Methods and Materials: The Cre-loxP system was used to generate primary lung cancers in mice with mutation in K-ras alone or in combination with p53 mutation. Mice were serially imaged by micro-CT, and tumor volumes were determined. A comparison of tumor volume by micro-CT and tumor histology was performed. Tumor response to radiation therapy (15.5 Gy) was assessed with micro-CT. Results: The tumor volume measured with free-breathing micro-CT scans was greater than the volume calculated by histology.more » Nevertheless, this imaging approach demonstrated that lung cancers with mutant p53 grew more rapidly than lung tumors with wild-type p53 and also showed that radiation therapy increased the doubling time of p53 mutant lung cancers fivefold. Conclusions: Micro-CT is an effective tool to noninvasively measure the growth of primary lung cancers in genetically engineered mice and assess tumor response to radiation therapy. This imaging approach will be useful to study the radiation biology of lung cancer.« less

  8. A Unifying Theory of Prostate Cancer

    DTIC Science & Technology

    2001-09-01

    of cell cycle arrest or apoptosis, may lead to genomic instability and the development of cancer. 10 * One of our goals was to determine whether p53...and cell cycle arrest. Therefore, mechanisms responsible for upregulation and activation of p53 are intact in prostatic epithelial cells. We also...such as y-irradiation (Girinsky et al., 1995). The p53 protein is known to be a key regulator of cell cycle arrest and/or apoptosis (Wiman, 1997

  9. p73 Protein Expression Correlates With Radiation-Induced Apoptosis in the Lack of p53 Response to Radiation Therapy for Cervical Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wakatsuki, Masaru; Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba; Ohno, Tatsuya

    2008-03-15

    Purpose: p73 belongs to the p53 tumor suppressor family of genes and can inhibit cell growth in a p53-like manner by inducing apoptosis or cell cycle arrest. Here, we investigated whether p73 could compensate for impaired p53 function in apoptosis induced by radiation therapy (RT) for cervical cancer. Methods and Materials: Sixty-eight patients with squamous cell carcinoma of the cervix who received definitive RT combined with (n = 37) or without (n = 31) cisplatin were investigated. Biopsy specimens were excised from the cervical tumor before RT and after 9 Gy. Results: Mean apoptosis index (AI) was 0.93% before RTmore » and 1.97% after 9 Gy with a significant increase (p < 0.001). For all patients, there was a significant correlation between p73 expression positivity after 9 Gy and AI ratio (AI after 9 Gy/AI before RT) (p = 0.021). Forty-one patients were regarded as the p53-responding group according to the expression of p53 after 9 Gy, whereas the remaining 27 patients were regarded as the p53-nonresponding group. A significant correlation between p73 expression after 9 Gy and AI ratio was observed in the p53-non-responding group (p < 0.001) but not in the p53-responding group (p = 0.940). Conclusion: Our results suggest that p73 plays an important role in compensating for the lack of p53 function in radiation-induced apoptosis of cervical cancer.« less

  10. CTCF regulates the human p53 gene through direct interaction with its natural antisense transcript, Wrap53

    PubMed Central

    Saldaña-Meyer, Ricardo; González-Buendía, Edgar; Guerrero, Georgina; Narendra, Varun; Bonasio, Roberto; Recillas-Targa, Félix; Reinberg, Danny

    2014-01-01

    The multifunctional CCCTC-binding factor (CTCF) protein exhibits a broad range of functions, including that of insulator and higher-order chromatin organizer. We found that CTCF comprises a previously unrecognized region that is necessary and sufficient to bind RNA (RNA-binding region [RBR]) and is distinct from its DNA-binding domain. Depletion of cellular CTCF led to a decrease in not only levels of p53 mRNA, as expected, but also those of Wrap53 RNA, an antisense transcript originated from the p53 locus. PAR-CLIP-seq (photoactivatable ribonucleoside-enhanced cross-linking and immunoprecipitation [PAR-CLIP] combined with deep sequencing) analyses indicate that CTCF binds a multitude of transcripts genome-wide as well as to Wrap53 RNA. Apart from its established role at the p53 promoter, CTCF regulates p53 expression through its physical interaction with Wrap53 RNA. Cells harboring a CTCF mutant in its RBR exhibit a defective p53 response to DNA damage. Moreover, the RBR facilitates CTCF multimerization in an RNA-dependent manner, which may bear directly on its role in establishing higher-order chromatin structures in vivo. PMID:24696455

  11. The Role of Siah1-Induced Degradation of beta-Catenin in Androgen Receptor Signaling

    DTIC Science & Technology

    2007-11-01

    biological responses to DNA damage: Insights from yeast and p53. Nat. Cell Biol. 3, E277–E286. Winston, J.T., Strack, P., Beer -Romero, P., Chu, C.Y...apoptosis, depending on the cell line tested [3]. The findings suggest that p53-mediated induction of Siah1 expression could play an important role in the...hypothesis that Siah1 is an important mediator of p53’s effects in prostate cancers. If the hypothesis proves to be correct, then the results derived

  12. Genetic inactivation of the transcription factor TIF-IA leads to nucleolar disruption, cell cycle arrest, and p53-mediated apoptosis.

    PubMed

    Yuan, Xuejun; Zhou, Yonggang; Casanova, Emilio; Chai, Minqiang; Kiss, Eva; Gröne, Hermann-Josef; Schütz, Günter; Grummt, Ingrid

    2005-07-01

    Growth-dependent regulation of rRNA synthesis is mediated by TIF-IA, a basal transcription initiation factor for RNA polymerase I. We inactivated the murine TIF-IA gene by homologous recombination in mice and embryonic fibroblasts (MEFs). TIF-IA-/- embryos die before or at embryonic day 9.5 (E9.5), displaying retardation of growth and development. In MEFs, Cre-mediated depletion of TIF-IA leads to disruption of nucleoli, cell cycle arrest, upregulation of p53, and induction of apoptosis. Elevated levels of p53 after TIF-IA depletion are due to increased binding of ribosomal proteins, such as L11, to MDM2 and decreased interaction of MDM2 with p53 and p19(ARF). RNAi-induced loss of p53 overcomes proliferation arrest and apoptosis in response to TIF-IA ablation. The striking correlation between perturbation of nucleolar function, elevated levels of p53, and induction of cell suicide supports the view that the nucleolus is a stress sensor that regulates p53 activity.

  13. Preclinical efficacy of the MDM2 inhibitor RG7112 in MDM2 amplified and TP53 wild-type glioblastomas

    PubMed Central

    Verreault, Maite; Schmitt, Charlotte; Goldwirt, Lauriane; Pelton, Kristine; Haidar, Samer; Levasseur, Camille; Guehennec, Jeremy; Knoff, David; Labussiere, Marianne; Marie, Yannick; Ligon, Azra H.; Mokhtari, Karima; Hoang-Xuan, Khe; Sanson, Marc; Alexander, Brian M; Wen, Patrick Y.; Delattre, Jean-Yves; Ligon, Keith L.; Idbaih, Ahmed

    2016-01-01

    Rationale p53 pathway alterations are key molecular events in glioblastoma (GBM). MDM2 inhibitors increase expression and stability of p53 and are presumed to be most efficacious in patients with TP53 wild-type and MDM2-amplified cancers. However, this biomarker hypothesis has not been tested in patients or patient-derived models for GBM. Methods We performed a preclinical evaluation of RG7112 MDM2 inhibitor, across a panel of 36 patient-derived GBM cell lines (PDCLs), each genetically characterized according to their P53 pathway status. We then performed a pharmacokinetic (PK) profiling of RG7112 distribution in mice and evaluated the therapeutic activity of RG7112 in orthotopic and subcutaneous GBM models. Results MDM2-amplified PDCLs were 44 times more sensitive than TP53 mutated lines that showed complete resistance at therapeutically attainable concentrations (avg. IC50 of 0.52 μM vs 21.9 μM). MDM4 amplified PDCLs were highly sensitive but showed intermediate response (avg. IC50 of 1.2 μM), whereas response was heterogeneous in TP53 wild-type PDCLs with normal MDM2/4 levels (avg. IC50 of 7.7 μM). In MDM2-amplified lines, RG7112 restored p53 activity inducing robust p21 expression and apoptosis. PK profiling of RG7112-treated PDCL intracranial xenografts demonstrated that the compound significantly crosses the blood-brain and the blood-tumor barriers. Most importantly, treatment of MDM2-amplified/TP53 wild-type PDCL-derived model (subcutaneous and orthotopic) reduced tumor growth, was cytotoxic, and significantly increased survival. Conclusion These data strongly support development of MDM2 inhibitors for clinical testing in MDM2-amplified GBM patients. Moreover, significant efficacy in a subset of non-MDM2 amplified models suggests that additional markers of response to MDM2 inhibitors must be identified. PMID:26482041

  14. Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

    PubMed Central

    Eberhart, Charles G; Chaudhry, Aneeka; Daniel, Richard W; Khaki, Leila; Shah, Keerti V; Gravitt, Patti E

    2005-01-01

    Background p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. Methods p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT), and 8 supratentorial primitive neuroectodermal tumors (sPNET) using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. Results p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3) was readily detected. Conclusion Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein. PMID:15717928

  15. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    PubMed

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.

  16. Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

    PubMed

    Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

    2015-10-01

    The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Chronic inflammation and cancer: potential chemoprevention through nuclear factor kappa B and p53 mutual antagonism

    PubMed Central

    2014-01-01

    Activation of nuclear factor-kappa B (NF- κB) as a mechanism of host defense against infection and stress is the central mediator of inflammatory responses. A normal (acute) inflammatory response is activated on urgent basis and is auto-regulated. Chronic inflammation that results due to failure in the regulatory mechanism, however, is largely considered as a critical determinant in the initiation and progression of various forms of cancer. Mechanistically, NF- κB favors this process by inducing various genes responsible for cell survival, proliferation, migration, invasion while at the same time antagonizing growth regulators including tumor suppressor p53. It has been shown by various independent investigations that a down regulation of NF- κB activity directly, or indirectly through the activation of the p53 pathway reduces tumor growth substantially. Therefore, there is a huge effort driven by many laboratories to understand the NF- κB signaling pathways to intervene the function of this crucial player in inflammation and tumorigenesis in order to find an effective inhibitor directly, or through the p53 tumor suppressor. We discuss here on the role of NF- κB in chronic inflammation and cancer, highlighting mutual antagonism between NF- κB and p53 pathways in the process. We also discuss prospective pharmacological modulators of these two pathways, including those that were already tested to affect this mutual antagonism. PMID:25152696

  18. p53 is required for brain growth but is dispensable for resistance to nutrient restriction during Drosophila larval development

    PubMed Central

    Contreras, Esteban G.; Sierralta, Jimena

    2018-01-01

    Background Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called ‘brain sparing’. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Results Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Conclusions Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals. PMID:29621246

  19. p53 is required for brain growth but is dispensable for resistance to nutrient restriction during Drosophila larval development.

    PubMed

    Contreras, Esteban G; Sierralta, Jimena; Glavic, Alvaro

    2018-01-01

    Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called 'brain sparing'. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals.

  20. [Interaction between p53 and MDM2 in human lung cancer cells].

    PubMed

    Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J

    2014-01-01

    The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo  or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) -  mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and MDM2 positive. In 46 (34%) cases, elevation of p53 was combined with MDM2 negative expression. Other tumor samples were either negative for both proteins (71/ 52%), or p53 negative and MDM2 positive in 10 (7%) tumor samples. Absence of p53 staining in most studies indicates absence of p53 mutation, and on the contrary, positive expression of p53 is a sign of p53 mutations with loss of function. In our study, 34% of cases with extensively high level of p53 without increased level of MDM2 were identified. We suppose that these are tumors with inactivating mutations that stabilize p53. On the other hand, tumors with high level of stabilized wildtype p53 protein and simultaneously with increased MDM2 staining (9 samples/7%) represent group with functional p53. In this group of patients, we could expect better prognosis with regard to function of p53 protein.

  1. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

  2. TGF-beta1 modulates focal adhesion kinase expression in rat intestinal epithelial IEC-6 cells via stimulatory and inhibitory Smad binding elements.

    PubMed

    Walsh, Mary F; Ampasala, Dinakar R; Rishi, Arun K; Basson, Marc D

    2009-02-01

    TGF-beta and FAK modulate cell migration, differentiation, proliferation and apoptosis, and TGF-beta promotes FAK transcription in intestinal epithelial cells via Smad-dependent and independent pathways. We utilized a 1320 bp FAK promoter-luciferase construct to characterize basal and TGF-beta-mediated FAK gene transcription in IEC-6 cells. Inhibiting JNK or Akt negated TGF-beta-stimulated promoter activity; ERK inhibition did not block the TGF-beta effect but increased basal activity. Co-transfection with Co-Smad4 enhanced the TGF-beta response while the inhibitory Smad7 abolished it. Serial deletions sequentially removing the four Smad binding elements (SBE) in the 5' untranslated region of the promoter revealed that the two most distal SBE's are positive regulators while SBE3 exerts a negative influence. Mutational deletion of two upstream p53 sites enhanced basal but did not affect TGF-beta-stimulated increases in promoter activity. TGF-beta increased DNA binding of Smad4, phospho-Smad2/3 and Runx1/AML1a to the most distal 435 bp containing 3 SBE and 2 AML1a sites by ChIP assay. However, although point mutation of SBE1 ablated the TGF-beta-mediated rise in SV40-promoter activity, mutation of AML1a sites did not. TGF-beta regulation of FAK transcription reflects a complex interplay between positive and negative non-Smad signals and SBE's, the last independent of p53 or AML1a.

  3. Loss of p21{sup Sdi1} expression in senescent cells after DNA damage accompanied with increase of miR-93 expression and reduced p53 interaction with p21{sup Sdi1} gene promoter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choi, Ok Ran; Lim, In Kyoung, E-mail: iklim@ajou.ac.kr

    2011-04-08

    Highlights: {yields} Reduced p21 expression in senescent cells treated with DNA damaging agents. {yields} Increase of [{sup 3}H]thymidine and BrdU incorporations in DNA damaged-senescent cells. {yields} Upregulation of miR-93 expression in senescent cells in response to DSB. {yields} Failure of p53 binding to p21 promoter in senescent cells in response to DSB. {yields} Molecular mechanism of increased cancer development in aged than young individuals. -- Abstract: To answer what is a critical event for higher incidence of tumor development in old than young individuals, primary culture of human diploid fibroblasts were employed and DNA damage was induced by doxorubicin ormore » X-ray irradiation. Response to the damage was different between young and old cells; loss of p21{sup sdi1} expression in spite of p53{sup S15} activation in old cells along with [{sup 3}H]thymidine and BrdU incorporation, but not in young cells. The phenomenon was confirmed by other tissue fibroblasts obtained from different donor ages. Induction of miR-93 expression and reduced p53 binding to p21 gene promoter account for loss of p21{sup sdi1} expression in senescent cells after DNA damage, suggesting a mechanism of in vivo carcinogenesis in aged tissue without repair arrest.« less

  4. Phytochemical regulation of the tumor suppressive microRNA, miR-34a, by p53-dependent and independent responses in human breast cancer cells

    PubMed Central

    Hargraves, Kris G.; He, Lin; Firestone, Gary L.

    2016-01-01

    The tumor suppressive microRNA miR-34a is transcriptionally regulated by p53 and shown to inhibit breast cancer cell proliferation as well as being a marker of increased disease free survival. Indole-3-carbinol (I3C) derived from cruciferous vegetables, artemisinin, extracted from the sweet wormwood plant, and artesunate, a semi-synthetic derivative of artemisinin, are phytochemicals with anti-tumorigenic properties however, little is known about the role of microRNAs in their mechanism of action. Human breast cancer cells expressing wild-type (MCF-7) or mutant p53 (T47D) were treated with a concentration range and time course of each phytochemical under conditions of cell cycle arrest as detected by flow cytometry to examine the potential connection between miR-34a expression and their anti-proliferative responses. Real-time PCR and western blot analysis of extracted RNA and total protein revealed artemsinin and artesunate increased miR-34a expression in a dose-dependent manner correlating with down-regulation of the miR-34a target gene, CDK4. I3C stimulation of miR-34a expression required functional p53, whereas, both artemisinin and artesunate up-regulated miR-34a expression regardless of p53 mutational status or in the presence of dominant negative p53. Phytochemical treatments inhibited the luciferase activity of a construct containing the wild-type 3′UTR of CDK4, but not those with a mutated miR-34a binding site, whereas, transfection of miR-34a inhibitors ablated the phytochemical mediated down-regulation of CDK4 and induction of cell cycle arrest. Our results suggest that miR-34a is an essential component of the anti-proliferative activities of I3C, artemisinin and artesunate and demonstrate that both wild-type p53 dependent and independent pathways are responsible for miR-34a induction. PMID:25789847

  5. Predominant role of DNA polymerase eta and p53-dependent translesion synthesis in the survival of ultraviolet-irradiated human cells.

    PubMed

    Lerner, Leticia K; Francisco, Guilherme; Soltys, Daniela T; Rocha, Clarissa R R; Quinet, Annabel; Vessoni, Alexandre T; Castro, Ligia P; David, Taynah I P; Bustos, Silvina O; Strauss, Bryan E; Gottifredi, Vanesa; Stary, Anne; Sarasin, Alain; Chammas, Roger; Menck, Carlos F M

    2017-02-17

    Genome lesions trigger biological responses that help cells manage damaged DNA, improving cell survival. Pol eta is a translesion synthesis (TLS) polymerase that bypasses lesions that block replicative polymerases, avoiding continued stalling of replication forks, which could lead to cell death. p53 also plays an important role in preventing cell death after ultraviolet (UV) light exposure. Intriguingly, we show that p53 does so by favoring translesion DNA synthesis by pol eta. In fact, the p53-dependent induction of pol eta in normal and DNA repair-deficient XP-C human cells after UV exposure has a protective effect on cell survival after challenging UV exposures, which was absent in p53- and Pol H-silenced cells. Viability increase was associated with improved elongation of nascent DNA, indicating the protective effect was due to more efficient lesion bypass by pol eta. This protection was observed in cells proficient or deficient in nucleotide excision repair, suggesting that, from a cell survival perspective, proper bypass of DNA damage can be as relevant as removal. These results indicate p53 controls the induction of pol eta in DNA damaged human cells, resulting in improved TLS and enhancing cell tolerance to DNA damage, which parallels SOS responses in bacteria. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Ribosomal protein-Mdm2-p53 pathway coordinates nutrient stress with lipid metabolism by regulating MCD and promoting fatty acid oxidation.

    PubMed

    Liu, Yong; He, Yizhou; Jin, Aiwen; Tikunov, Andrey P; Zhou, Lishi; Tollini, Laura A; Leslie, Patrick; Kim, Tae-Hyung; Li, Lei O; Coleman, Rosalind A; Gu, Zhennan; Chen, Yong Q; Macdonald, Jeffrey M; Graves, Lee M; Zhang, Yanping

    2014-06-10

    The tumor suppressor p53 has recently been shown to regulate energy metabolism through multiple mechanisms. However, the in vivo signaling pathways related to p53-mediated metabolic regulation remain largely uncharacterized. By using mice bearing a single amino acid substitution at cysteine residue 305 of mouse double minute 2 (Mdm2(C305F)), which renders Mdm2 deficient in binding ribosomal proteins (RPs) RPL11 and RPL5, we show that the RP-Mdm2-p53 signaling pathway is critical for sensing nutrient deprivation and maintaining liver lipid homeostasis. Although the Mdm2(C305F) mutation does not significantly affect growth and development in mice, this mutation promotes fat accumulation under normal feeding conditions and hepatosteatosis under acute fasting conditions. We show that nutrient deprivation inhibits rRNA biosynthesis, increases RP-Mdm2 interaction, and induces p53-mediated transactivation of malonyl-CoA decarboxylase (MCD), which catalyzes the degradation of malonyl-CoA to acetyl-CoA, thus modulating lipid partitioning. Fasted Mdm2(C305F) mice demonstrate attenuated MCD induction and enhanced malonyl-CoA accumulation in addition to decreased oxidative respiration and increased fatty acid accumulation in the liver. Thus, the RP-Mdm2-p53 pathway appears to function as an endogenous sensor responsible for stimulating fatty acid oxidation in response to nutrient depletion.

  7. The Role of AKT/mTOR Pathway in Stress Response to UV-Irradiation: Implication in Skin Carcinogenesis by Regulation of Apoptosis, Autophagy and Senescence

    PubMed Central

    Strozyk, Elwira; Kulms, Dagmar

    2013-01-01

    Induction of DNA damage by UVB and UVA radiation may generate mutations and genomic instability leading to carcinogenesis. Therefore, skin cells being repeatedly exposed to ultraviolet (UV) light have acquired multilayered protective mechanisms to avoid malignant transformation. Besides extensive DNA repair mechanisms, the damaged skin cells can be eliminated by induction of apoptosis, which is mediated through the action of tumor suppressor p53. In order to prevent the excessive loss of skin cells and to maintain the skin barrier function, apoptotic pathways are counteracted by anti-apoptotic signaling including the AKT/mTOR pathway. However, AKT/mTOR not only prevents cell death, but is also active in cell cycle transition and hyper-proliferation, thereby also counteracting p53. In turn, AKT/mTOR is tuned down by the negative regulators being controlled by the p53. This inhibition of AKT/mTOR, in combination with transactivation of damage-regulated autophagy modulators, guides the p53-mediated elimination of damaged cellular components by autophagic clearance. Alternatively, p53 irreversibly blocks cell cycle progression to prevent AKT/mTOR-driven proliferation, thereby inducing premature senescence. Conclusively, AKT/mTOR via an extensive cross talk with p53 influences the UV response in the skin with no black and white scenario deciding over death or survival. PMID:23887651

  8. Cytoplasmic sequestration of the tumor suppressor p53 by a heat shock protein 70 family member, mortalin, in human colorectal adenocarcinoma cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gestl, Erin E., E-mail: egestl@wcupa.edu; Anne Boettger, S., E-mail: aboettger@wcupa.edu

    2012-06-29

    Highlights: Black-Right-Pointing-Pointer Eight human colorectal cell lines were evaluated for p53 and mortalin localization. Black-Right-Pointing-Pointer Six cell lines displayed cytoplasmic sequestration of the tumor suppressor p53. Black-Right-Pointing-Pointer Direct interaction between mortalin and p53 was shown in five cell lines. Black-Right-Pointing-Pointer Cell lines positive for p53 sequestration yielded elevated p53 expression levels. Black-Right-Pointing-Pointer This study yields the first evidence of cytoplasmic sequestration p53 by mortalin. -- Abstract: While it is known that cytoplasmic retention of p53 occurs in many solid tumors, the mechanisms responsible for this retention have not been positively identified. Since heatshock proteins like mortalin have been associated withmore » p53 inactivation in other tumors, the current study sought to characterize this potential interaction in never before examined colorectal adenocarcinoma cell lines. Six cell lines, one with 3 different fractions, were examined to determine expression of p53 and mortalin and characterize their cellular localization. Most of these cell lines displayed punctate p53 and mortalin localization in the cell cytoplasm with the exception of HCT-8 and HCT116 379.2 cells, where p53 was not detected. Nuclear p53 was only observed in HCT-116 40-16, LS123, and HT-29 cell lines. Mortalin was only localized in the cytoplasm in all cell lines. Co-immunoprecipitation and immunohistochemistry revealed that p53 and mortalin were bound and co-localized in the cytoplasmic fraction of four cell lines, HCT-116 (40-16 and 386; parental and heterozygous fractions respectively of the same cell line), HT-29, LS123 and LoVo, implying that p53 nuclear function is limited in those cell lines by being restricted to the cytoplasm. Mortalin gene expression levels were higher than gene expression levels of p53 in all cell lines. Cell lines with cytoplasmic sequestration of p53, however, also displayed elevated p53 gene expression levels compared to cell lines without p53 sequestration. Our data reveal the characteristic cytoplasmic sequestration of p53 by the heat shock protein mortalin in human colorectal adenocarcinoma cell lines, as is the case for other cancers, such as glioblastomas and hepatocellular carcinomas.« less

  9. The p53-Reactivating Small Molecule RITA Induces Senescence in Head and Neck Cancer Cells

    PubMed Central

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L.; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N.; Skinner, Heath D.

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC. PMID:25119136

  10. Induction of KLF4 in basal keratinocytes blocks the proliferation-differentiation switch and initiates squamous epithelial dysplasia

    PubMed Central

    Foster, K. Wade; Liu, Zhaoli; Nail, Clinton D.; Li, Xingnan; Fitzgerald, Thomas J.; Bailey, Sarah K.; Frost, Andra R.; Louro, Iuri D.; Townes, Tim M.; Paterson, Andrew J.; Kudlow, Jeffrey E.; Lobo-Ruppert, Susan M.; Ruppert, J. Michael

    2006-01-01

    KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions. PMID:15674344

  11. Induction of KLF4 in basal keratinocytes blocks the proliferation-differentiation switch and initiates squamous epithelial dysplasia.

    PubMed

    Foster, K Wade; Liu, Zhaoli; Nail, Clinton D; Li, Xingnan; Fitzgerald, Thomas J; Bailey, Sarah K; Frost, Andra R; Louro, Iuri D; Townes, Tim M; Paterson, Andrew J; Kudlow, Jeffrey E; Lobo-Ruppert, Susan M; Ruppert, J Michael

    2005-02-24

    KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes, KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions.

  12. A Novel ATM/TP53/p21-Mediated Checkpoint Only Activated by Chronic γ-Irradiation

    PubMed Central

    Sasatani, Megumi; Iizuka, Daisuke; Masuda, Yuji; Inaba, Toshiya; Suzuki, Keiji; Ootsuyama, Akira; Umata, Toshiyuki; Kamiya, Kenji; Suzuki, Fumio

    2014-01-01

    Different levels or types of DNA damage activate distinct signaling pathways that elicit various cellular responses, including cell-cycle arrest, DNA repair, senescence, and apoptosis. Whereas a range of DNA-damage responses have been characterized, mechanisms underlying subsequent cell-fate decision remain elusive. Here we exposed cultured cells and mice to different doses and dose rates of γ-irradiation, which revealed cell-type-specific sensitivities to chronic, but not acute, γ-irradiation. Among tested cell types, human fibroblasts were associated with the highest levels of growth inhibition in response to chronic γ-irradiation. In this context, fibroblasts exhibited a reversible G1 cell-cycle arrest or an irreversible senescence-like growth arrest, depending on the irradiation dose rate or the rate of DNA damage. Remarkably, when the same dose of γ-irradiation was delivered chronically or acutely, chronic delivery induced considerably more cellular senescence. A similar effect was observed with primary cells isolated from irradiated mice. We demonstrate a critical role for the ataxia telangiectasia mutated (ATM)/tumor protein p53 (TP53)/p21 pathway in regulating DNA-damage-associated cell fate. Indeed, blocking the ATM/TP53/p21 pathway deregulated DNA damage responses, leading to micronucleus formation in chronically irradiated cells. Together these results provide insights into the mechanisms governing cell-fate determination in response to different rates of DNA damage. PMID:25093836

  13. YopP-expressing variant of Y. pestis activates a potent innate immune response affording cross-protection against yersiniosis and tularemia [corrected].

    PubMed

    Zauberman, Ayelet; Flashner, Yehuda; Levy, Yinon; Vagima, Yaron; Tidhar, Avital; Cohen, Ofer; Bar-Haim, Erez; Gur, David; Aftalion, Moshe; Halperin, Gideon; Shafferman, Avigdor; Mamroud, Emanuelle

    2013-01-01

    Plague, initiated by Yersinia pestis infection, is a rapidly progressing disease with a high mortality rate if not quickly treated. The existence of antibiotic-resistant Y. pestis strains emphasizes the need for the development of novel countermeasures against plague. We previously reported the generation of a recombinant Y. pestis strain (Kim53ΔJ+P) that over-expresses Y. enterocolitica YopP. When this strain was administered subcutaneously to mice, it elicited a fast and effective protective immune response in models of bubonic, pneumonic and septicemic plague. In the present study, we further characterized the immune response induced by the Kim53ΔJ+P recombinant strain. Using a panel of mouse strains defective in specific immune functions, we observed the induction of a prompt protective innate immune response that was interferon-γ dependent. Moreover, inoculation of mice with Y. pestis Kim53ΔJ+P elicited a rapid protective response against secondary infection by other bacterial pathogens, including the enteropathogen Y. enterocolitica and the respiratory pathogen Francisella tularensis. Thus, the development of new therapies to enhance the innate immune response may provide an initial critical delay in disease progression following the exposure to highly virulent bacterial pathogens, extending the time window for successful treatment.

  14. Tetraploidization or autophagy: The ultimate fate of senescent human endometrial stem cells under ATM or p53 inhibition.

    PubMed

    Borodkina, Aleksandra V; Shatrova, Alla N; Deryabin, Pavel I; Grukova, Anastasiya A; Nikolsky, Nikolay N; Burova, Elena B

    2016-01-01

    Previously we demonstrated that endometrium-derived human mesenchymal stem cells (hMESCs) via activation of the ATM/p53/p21/Rb pathway enter the premature senescence in response to oxidative stress. Down regulation effects of the key components of this signaling pathway, particularly ATM and p53, on a fate of stressed hMESCs have not yet been investigated. In the present study by using the specific inhibitors Ku55933 and Pifithrin-α, we confirmed implication of both ATM and p53 in H(2)O(2)-induced senescence of hMESCs. ATM or p53 down regulation was shown to modulate differently the cellular fate of H(2)O(2)-treated hMESCs. ATM inhibition allowed H(2)O(2)-stimulated hMESCs to escape the permanent cell cycle arrest due to loss of the functional ATM/p53/p21/Rb pathway, and induced bypass of mitosis and re-entry into S phase, resulting in tetraploid cells. On the contrary, suppression of the p53 transcriptional activity caused a pronounced cell death of H(2)O(2)-treated hMESCs via autophagy induction. The obtained data clearly demonstrate that down regulation of ATM or p53 shifts senescence of human endometrial stem cells toward tetraploidization or autophagy.

  15. Characterisation of the p53 pathway in cell lines established from TH-MYCN transgenic mouse tumours.

    PubMed

    Chen, Lindi; Esfandiari, Arman; Reaves, William; Vu, Annette; Hogarty, Michael D; Lunec, John; Tweddle, Deborah A

    2018-03-01

    Cell lines established from the TH-MYCN transgenic murine model of neuroblastoma are a valuable preclinical, immunocompetent, syngeneic model of neuroblastoma, for which knowledge of their p53 pathway status is important. In this study, the Trp53 status and functional response to Nutlin-3 and ionising radiation (IR) were determined in 6 adherent TH-MYCN transgenic cell lines using Sanger sequencing, western blot analysis and flow cytometry. Sensitivity to structurally diverse MDM2 inhibitors (Nutlin-3, MI-63, RG7388 and NDD0005) was determined using XTT proliferation assays. In total, 2/6 cell lines were Trp53 homozygous mutant (NHO2A and 844MYCN+/+) and 1/6 (282MYCN+/-) was Trp53 heterozygous mutant. For 1/6 cell lines (NHO2A), DNA from the corresponding primary tumour was found to be Trp53 wt. In all cases, the presence of a mutation was consistent with aberrant p53 signalling in response to Nutlin-3 and IR. In comparison to TP53 wt human neuroblastoma cells, Trp53 wt murine control and TH-MYCN cell lines were significantly less sensitive to growth inhibition mediated by MI-63 and RG7388. These murine Trp53 wt and mutant TH-MYCN cell lines are useful syngeneic, immunocompetent neuroblastoma models, the former to test p53-dependent therapies in combination with immunotherapies, such as anti-GD2, and the latter as models of chemoresistant relapsed neuroblastoma when aberrations in the p53 pathway are more common. The spontaneous development of Trp53 mutations in 3 cell lines from TH-MYCN mice may have arisen from MYCN oncogenic driven and/or ex vivo selection. The identified species-dependent selectivity of MI-63 and RG7388 should be considered when interpreting in vivo toxicity studies of MDM2 inhibitors.

  16. Relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation in chronic lymphocytic leukemia.

    PubMed

    Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R

    2002-08-15

    Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.

  17. DNA methylation differences in exposed workers and nearby residents of the Ma Ta Phut industrial estate, Rayong, Thailand

    PubMed Central

    Peluso, Marco; Bollati, Valentina; Munnia, Armelle; Srivatanakul, Petcharin; Jedpiyawongse, Adisorn; Sangrajrang, Suleeporn; Piro, Sara; Ceppi, Marcello; Bertazzi, Pier Alberto; Boffetta, Paolo; Baccarelli, Andrea A

    2012-01-01

    Background Adverse biological effects from airborne pollutants are a primary environmental concern in highly industrialized areas. Recent studies linked air pollution exposures with altered blood Deoxyribo-nucleic acid (DNA) methylation, but effects from industrial sources and underlying biological mechanisms are still largely unexplored. Methods The Ma Ta Phut industrial estate (MIE) in Rayong, Thailand hosts one of the largest steel, oil refinery and petrochemical complexes in south-eastern Asia. We measured a panel of blood DNA methylation markers previously associated with air pollution exposures, including repeated elements [long interspersed nuclear element-1 (LINE-1) and Alu] and genes [p53, hypermethylated-in-cancer-1 (HIC1), p16 and interleukin-6 (IL-6)], in 67 MIE workers, 65 Ma Ta Phut residents and 45 rural controls. To evaluate the role of DNA damage and oxidation, we correlated DNA methylation measures with bulky DNA and 3-(2-deoxy-β-D-erythro-pentafuranosyl)pyrimido[1,2-α]purin-10(3H)-one deoxyguanosine (M1dG) adducts. Results In covariate-adjusted models, MIE workers, compared with rural residents, showed lower LINE-1 (74.8% vs 78.0%; P < 0.001), p53 (8.0% vs 15.7%; P < 0.001) and IL-6 methylation (39.2% vs 45.0%; P = 0.027) and higher HIC1 methylation (22.2% vs 15.3%, P < 0.001). For all four markers, Ma Ta Phut residents exhibited methylation levels intermediate between MIE workers and rural controls (LINE-1, 75.7%, P < 0.001; p53, 9.0%, P < 0.001; IL-6, 39.8%, P = 0.041; HIC1, 17.8%, P = 0.05; all P-values vs rural controls). Bulky DNA adducts showed negative correlation with p53 methylation (P = 0.01). M1dG showed negative correlations with LINE-1 (P = 0.003) and IL-6 methylation (P = 0.05). Conclusions Our findings indicate that industrial exposures may induce alterations of DNA methylation patterns detectable in blood leucocyte DNA. Correlation of DNA adducts with DNA hypomethylation suggests potential mediation by DNA damage. PMID:23064502

  18. Selective sensitization to DNA-damaging agents in a human rhabdomyosarcoma cell line with inducible wild-type p53 overexpression.

    PubMed

    Gibson, A A; Harwood, F G; Tillman, D M; Houghton, J A

    1998-01-01

    Drug-induced cytotoxicity or apoptosis may be influenced by the expression of the p53 tumor suppressor gene and by the specific oncogene expressed, which may dictate the threshold at which a cytotoxic response may by induced. The objective of the study was to elucidate how DNA-damaging agents with different mechanisms of action were sensitized in the context of expression of the Pax3/FKHR fusion protein, a transformation event unique to alveolar rhabdomyosarcomas (ARMSs), and wild-type p53 (wtp53). A wtp53 cDNA was subcloned into the pGRE5-2/EBV vector with dexamethasone-inducible overexpression and transfected into Rh30 ARMS cells that express Pax3/FKHR and a mutant p53 phenotype. Following dexamethasone induction of wtp53 overexpression in a derived clone (Cl.#27), growth was slowed, and cells accumulated in G1. Functional wtp53 activity was demonstrated by selective transactivation of p50-2, a wtp53 chloramphenicol acetyltransferase reporter construct, and by up-regulated expression of endogenous p21Waf1. Data demonstrated p53-dependent sensitization (> or = 4-fold) to bleomycin, actinomycin D, and 5-fluorouracil and considerably less p53-dependence (< or = 2-fold) for doxorubicin, topotecan, etoposide, and cisplatin in Cl.#27 compared to an equivalent clone containing the pGRE5-EBV vector alone (VC#3). Data demonstrate that ARMS cells show a selective sensitization to DNA-damaging agents when wtp53 is overexpressed. The cytotoxic activity of agents that are not potentiated substantially must, therefore, depend upon p53-independent factors that relate to the mechanism of drug action.

  19. USP7S-dependent inactivation of Mule regulates DNA damage signalling and repair.

    PubMed

    Khoronenkova, Svetlana V; Dianov, Grigory L

    2013-02-01

    The E3 ubiquitin ligase Mule/ARF-BP1 plays an important role in the cellular DNA damage response by controlling base excision repair and p53 protein levels. However, how the activity of Mule is regulated in response to DNA damage is currently unknown. Here, we report that the Ser18-containing isoform of the USP7 deubiquitylation enzyme (USP7S) controls Mule stability by preventing its self-ubiquitylation and subsequent proteasomal degradation. We find that in response to DNA damage, downregulation of USP7S leads to self-ubiquitylation and proteasomal degradation of Mule, which eventually leads to p53 accumulation. Cells that are unable to downregulate Mule show reduced ability to upregulate p53 levels in response to DNA damage. We also find that, as Mule inactivation is required for stabilization of base excision repair enzymes, the failure of cells to downregulate Mule after DNA damage results in deficient DNA repair. Our data describe a novel mechanism by which Mule is regulated in response to DNA damage and coordinates cellular DNA damage responses and DNA repair.

  20. p53 Is a Key Regulator for Osthole-Triggered Cancer Pathogenesis

    PubMed Central

    Huang, Ssu-Ming; Tsai, Cheng-Fang; Wang, Min-Ying

    2014-01-01

    Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development. PMID:25013761

  1. Pifithrin-α provides neuroprotective effects at the level of mitochondria independently of p53 inhibition.

    PubMed

    Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten

    2014-12-01

    Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.

  2. Effect of age on the sensitivity of the rat thyroid gland to ionizing radiation

    PubMed Central

    Matsuu-Matsuyama, Mutsumi; Shichijo, Kazuko; Okaichi, Kumio; Kurashige, Tomomi; Kondo, Hisayoshi; Miura, Shiro; Nakashima, Masahiro

    2015-01-01

    Exposure to ionizing radiation during childhood is a well-known risk factor for thyroid cancer. Our study evaluated the effect of age on the radiosensitivity of rat thyroid glands. Four-week-old (4W), 7 -week-old (7W), and 8-month-old (8M) male Wistar rats were exposed to 8 Gy of whole-body X-ray irradiation. Thyroids were removed 3–72 h after irradiation, and non-irradiated thyroids served as controls. Ki67-positivity and p53 binding protein 1 (53BP1) focus formation (a DNA damage response) were evaluated via immunohistochemistry. Amounts of proteins involved in DNA damage response (p53, p53 phosphorylated at serine 15, p21), apoptosis (cleaved caspase-3), and autophagy (LC3, p62) were determined via western blotting. mRNA levels of 84 key autophagy-related genes were quantified using polymerase chain reaction arrays. Ki67-positive cells in 4W (with high proliferative activity) and 7W thyroids significantly decreased in number post-irradiation. The number of 53BP1 foci and amount of p53 phosphorylated at serine 15 increased 3 h after irradiation, regardless of age. No increase in apoptosis or in the levels of p53, p21 or cleaved caspase-3 was detected for any ages. Levels of LC3-II and p62 increased in irradiated 4W but not 8M thyroids, whereas expression of several autophagy-related genes was higher in 4W than 8M irradiated thyroids. Irradiation increased the expression of genes encoding pro-apoptotic proteins in both 4W and 8M thyroids. In summary, no apoptosis or p53 accumulation was noted, despite the expression of some pro-apoptotic genes in immature and adult thyroids. Irradiation induced autophagy in immature, but not in adult, rat thyroids. PMID:25691451

  3. Identification of Four Oxidative Stress-Responsive MicroRNAs, miR-34a-5p, miR-1915-3p, miR-638, and miR-150-3p, in Hepatocellular Carcinoma.

    PubMed

    Wan, Yong; Cui, Ruixia; Gu, Jingxian; Zhang, Xing; Xiang, Xiaohong; Liu, Chang; Qu, Kai; Lin, Ting

    2017-01-01

    Increasing evidence suggests that oxidative stress plays an essential role during carcinogenesis. However, the underlying mechanism between oxidative stress and carcinogenesis remains unknown. Recently, microRNAs (miRNAs) are revealed to be involved in oxidative stress response and carcinogenesis. This study aims to identify miRNAs in hepatocellular carcinoma (HCC) cells which might involve in oxidative stress response. An integrated analysis of miRNA expression signature was performed by employing robust rank aggregation (RRA) method, and four miRNAs (miR-34a-5p, miR-1915-3p, miR-638, and miR-150-3p) were identified as the oxidative stress-responsive miRNAs. Pathway enrichment analysis suggested that these four miRNAs played an important role in antiapoptosis process. Our data also revealed miR-34a-5p and miR-1915-3p, but not miR-150-3p and miR-638, were regulated by p53 in HCC cell lines under oxidative stress. In addition, clinical investigation revealed that these four miRNAs might be involved in oxidative stress response by targeting oxidative stress-related genes in HCC tissues. Kaplan-Meier analysis showed that these four miRNAs were associated with patients' overall survival. In conclusion, we identified four oxidative stress-responsive miRNAs, which were regulated by p53-dependent (miR-34a-5p and miR-1915-3p) and p53-independent pathway (miR-150-3p and miR-638). These four miRNAs may offer new strategy for HCC diagnosis and prognosis.

  4. Modeling the Etiology of p53-mutated Cancer Cells*

    PubMed Central

    Perez, Ricardo E.; Shen, Hong; Duan, Lei; Kim, Reuben H.; Kim, Terresa; Park, No-Hee; Maki, Carl G.

    2016-01-01

    p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds. PMID:27022024

  5. Immunohistochemical status of p53, MDM2, bcl2, bax, and ER in invasive ductal breast carcinoma in Tunisian patients.

    PubMed

    Baccouche, Sami; Daoud, Jamel; Frikha, Mounir; Mokdad-Gargouri, Raja; Gargouri, Ali; Jlidi, Rachid

    2003-12-01

    TP53 gene alterations have been associated with sporadic breast cancer. To assess the role of p53 in invasive ductal carcinoma (IDC) of the breast among Tunisian patients, p53 protein status was studied by immuno-histochemical analysis. The p53 protein was expressed in 41 of 70 (58%) tumors. Study of the status of its target gene expression showed that MDM2 was overexpressed in 43 tumors (61%), bcl2 in 29 (41%), and bax in only 9 (12%). Estrogen receptor (ER) was detected in 38 tumor tissues (54%). The accumulated p53 was significantly associated with MDM2-positive, bcl2-negative, and ER-negative tumors (P = 0.024, P = 0.000027, and P = 0.000008, respectively), whereas with bax the correlaton was not significant. Bcl2 immunostaining displayed a positive correlation with ER (P = 0.001). A significantly higher fraction of p53-positive cells was observed in ER-negative SBRII-SBRIII tumors than in ER-positive SBRI-SBRII tumors (P = 0.000066). bcl2-positive tumors were significantly correlated with ER-positive/SBRI-SBRII tumors (P = 0.007), but negatively correlated with p53/bax (P = 0000004). MDM2 immunostaining displayed the same phenotype as p53 in the correlation with bcl2 and ER (P = 0.003), strengthened by significant associations between MDM2-positive/p53-positive and bcl2-negative or ER-negative, respectively (P = 0.00005 and P = 0.000001, respectively). MDM2-positive cells were significantly correlated with the p53-positive/bax-negative phenotype (P = 0.04). These results suggest that p53 accumulated in these tumor tissues is associated with bad prognostic markers (ER-negative, SBRIII) of IDC. MDM2 overexpression might be responsible for the accumulated p53 value in IDC. Regulation of the apoptotic process is involved in IDC; bcl2 is associated with a good prognostic marker (ER-positive and SBRI-II), whereas the regulation of bax is complex and does not necessarily correlate with the overexpression of p53.

  6. Posttranslational Modifications of p53 in Replicative Senescence Overlapping but Distinct from Those Induced by DNA Damage

    PubMed Central

    Webley, Katherine; Bond, Jane A.; Jones, Christopher J.; Blaydes, Jeremy P.; Craig, Ashley; Hupp, Ted; Wynford-Thomas, David

    2000-01-01

    Replicative senescence in human fibroblasts is absolutely dependent on the function of the phosphoprotein p53 and correlates with activation of p53-dependent transcription. However, no evidence for posttranslational modification of p53 in senescence has been presented, raising the possibility that changes in transcriptional activity result from upregulation of a coactivator. Using a series of antibodies with phosphorylation-sensitive epitopes, we now show that senescence is associated with major changes at putative regulatory sites in the N and C termini of p53 consistent with increased phosphorylation at serine-15, threonine-18, and serine-376 and decreased phosphorylation at serine-392. Ionizing and UV radiation generated overlapping but distinct profiles of response, with increased serine-15 phosphorylation being the only common change. These results support a direct role for p53 in signaling replicative senescence and are consistent with the generation by telomere erosion of a signal which shares some but not all of the features of DNA double-strand breaks. PMID:10733583

  7. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    PubMed

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  8. Assessment of apoptosis in oesophageal carcinoma preoperatively treated by chemotherapy and radiotherapy.

    PubMed

    Moreira, L F; Naomoto, Y; Hamada, M; Kamikawa, Y; Orita, K

    1995-01-01

    Apoptosis, programmed cell death, was immunohistochemically determined in 55 samples of oesophageal squamous cell carcinoma using the BM1 Mab. Sections from patients not treated (group 1, n = 12) or preoperatively treated by chemotherapy (group 2, n = 11), radiation (group 3, n = 13) or both (group 4, n = 8), and 11 additional cases of high-grade dysplasia or early cancer were examined. Most of the apoptotic cells were BM1-positive and checked by TUNEL proved to be nick end positive. They accounted for 7 (11%), 19 (29%), 21 (32%) and 26 (38%) cells per field in those 4 groups respectively. Chemotherapy and/or radiation significantly increased the number of apoptotic cells as compared to controls (p = 0.029 and p = 0.029, respectively). To assess the implications of the oncogene expression in the apoptotic pathway, additional section stained with bcl2 and p53 were negative for bcl2 and were positive for p53 in 16 samples (37%). Overall, positive cases for p53 mutation showed a significantly decreased incidence of apoptotic cells (p = 0.03). These results suggest that in situ assessment of apoptotic response better correlates to the apoptosis induced by radiation than that by chemotherapy, that abnormalities of the p53 protein decrease the apoptotic response in oesophageal carcinoma, and that immunohistochemical analysis of p53 protein helps to determine the sensitivity to these anticancer agents.

  9. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    PubMed

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar

    2017-04-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License

  10. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    PubMed Central

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, AI; Ullah, Mukhtar

    2017-01-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. PMID:28547941

  11. Trends in Urology Residents' Exposure to Operative Urotrauma: A Survey of Residency Program Directors.

    PubMed

    Parker, Daniel C; Kocher, Neil; Mydlo, Jack H; Simhan, Jay

    2016-01-01

    To determine longitudinal trends in resident exposure to urotrauma and to assess whether presence of Genitourinary Reconstructive Surgeon (GURS) faculty has impacted exposure and career choice. An identical, 31-question multiple-choice survey was sent to program directors of Accreditation Council for Graduate Medical Education (ACGME)-accredited urology residency programs in 2006 and 2013. The areas of focus included program demographics, extent of urotrauma exposure, program director perceptions regarding educational value of urotrauma, and impact of GURS fellowship trained faculty. Responses were de-identified, compiled, and compared for differences. Response rates were 57% (64/112) and 43% (53/123) for the 2006 and 2013 survey, respectively (P = .03). Trauma Level 1 designation (56/64 [89%] vs 44/53 [88%], P = .84) and presence of GURS faculty (22/64 [34%] vs 22/53 [43%], P = .43) were similar between survey periods. Although survey respondents felt urotrauma volume had remained constant (34/64 [53%] vs 30/53 [56%], P = .71), more recent respondents reported that conservative management strategies negatively impacted resident exposure (14/64 [22%] vs 23/53 [43%], P = .01). Residencies with GURS faculty in 2013 (22/53, 42%) were positively associated with residents publishing urotrauma literature (9/22 [41%] vs 4/31 [13%], P = .02), the presence of multidisciplinary trauma and urology conferences (3/22 [14%] vs 0/31 [0%], P = .03), and residents matriculating to GURS fellowships (15/22 [68%] vs 10/31 [32%], P = .009). Many contemporary urology residencies report poor resident exposure to urotrauma during training. Although presence of GURS faculty may influence resident career choice, additional strategies may be warranted to expose residents to urotrauma during training. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Adenovirus-mediated p53 gene delivery potentiates the radiation-induced growth inhibition of experimental brain tumors.

    PubMed

    Badie, B; Kramar, M H; Lau, R; Boothman, D A; Economou, J S; Black, K L

    1998-05-01

    Patients with malignant gliomas continue to have very poor prognosis even after surgical resection, radiation and chemotherapy. Because these tumors often have alterations in the p53 tumor suppressor gene, which plays a key role in the cellular response to DNA damaging agents, we investigated the role of p53 gene therapy in conjunction with ionizing radiation in a rat brain tumor model. Exposure of cultured rat 9L gliosarcoma cells, which contain a mutant p53 gene, to a recombinant adenovirus-vector bearing the wild-type p53 gene (Adp53), induced apoptosis within 24 hours. Although ionizing radiation had no additional effect on apoptosis within this time frame, it caused G1 arrest in non-apoptotic cells after Adp53 therapy. In contrast, wild-type 9L cells demonstrated little G1 arrest after X-irradiation. When animals bearing brain tumors were irradiated after intratumoral Adp53 injections, more than 85% reduction in tumor size was noted. Moreover, the group of rats receiving both radiation and Adp53 therapy had a significant increase in survival as compared to animals receiving either therapy alone. These results support the use of p53 gene therapy as an adjunct to radiation in treatment of malignant brain tumors.

  13. Uterine deletion of Trp53 compromises antioxidant responses in mouse decidua

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burnum, Kristin E.; Hirota, Yasushi; Baker, Erin Shammel

    2012-09-01

    Preterm birth is a global health issue impacting both mothers and children. However, the etiology of preterm birth is not clearly understood. From our recent finding that premature decidual senescence with terminal differentiation is a cause of preterm birth in mice with uterine Trp53 deletion, encoding p53 protein, led us to explore other potential factors that are related to preterm birth. Utilizing proteomics approaches, here we show that 183 candidate proteins cause significant changes in decidua with Trp53 deletion as compared to normal decidua. Functional categorization of these proteins unveiled new pathways that are influenced by p53. In particular, downregulationmore » of a cluster of antioxidant proteins in p53 deficient decidua suggests that increased oxidative stress could be one cause of preterm birth in mice with uterine deletion of Trp53.« less

  14. Uterine Deletion of Trp53 Compromises Antioxidant Responses in the Mouse Decidua

    PubMed Central

    Burnum, Kristin E.; Hirota, Yasushi; Baker, Erin S.; Yoshie, Mikihiro; Ibrahim, Yehia M.; Monroe, Matthew E.; Anderson, Gordon A.; Smith, Richard D.; Daikoku, Takiko

    2012-01-01

    Preterm birth is a global health issue impacting millions of mothers and babies. However, the etiology of preterm birth is not clearly understood. Our recent finding that premature decidual senescence with terminal differentiation is a cause of preterm birth in mice with uterine Trp53 deletion, encoding p53 protein, led us to explore other potential factors that are related to preterm birth. Using proteomics approaches, here, we show that 183 candidate proteins show significant changes in deciduae with Trp53 deletion as compared with normal deciduae. Functional categorization of these proteins unveiled new pathways that are influenced by p53. In particular, down-regulation of a cluster of antioxidant enzymes in p53-deficient deciduae suggests that increased oxidative stress could be one cause of preterm birth in mice harboring uterine deletion of Trp53. PMID:22759378

  15. CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.

    PubMed

    He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang

    2015-03-01

    Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.

  16. mTORC1 and p53

    PubMed Central

    Hasty, Paul; Sharp, Zelton Dave; Curiel, Tyler J.; Campisi, Judith

    2013-01-01

    A balance must be struck between cell growth and stress responses to ensure that cells proliferate without accumulating damaged DNA. This balance means that optimal cell proliferation requires the integration of pro-growth and stress-response pathways. mTOR (mechanistic target of rapamycin) is a pleiotropic kinase found in complex 1 (mTORC1). The mTORC1 pathway governs a response to mitogenic signals with high energy levels to promote protein synthesis and cell growth. In contrast, the p53 DNA damage response pathway is the arbiter of cell proliferation, restraining mTORC1 under conditions of genotoxic stress. Recent studies suggest a complicated integration of these pathways to ensure successful cell growth and proliferation without compromising genome maintenance. Deciphering this integration could be key to understanding the potential clinical usefulness of mTORC1 inhibitors like rapamycin. Here we discuss how these p53-mTORC1 interactions might play a role in the suppression of cancer and perhaps the development of cellular senescence and organismal aging. PMID:23255104

  17. SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

    2014-06-15

    Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutatedmore » (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.« less

  18. Phosphorylated Hsp27 activates ATM-dependent p53 signaling and mediates the resistance of MCF-7 cells to doxorubicin-induced apoptosis.

    PubMed

    Xu, Yimiao; Diao, Ying; Qi, Shimei; Pan, Xiaolong; Wang, Qi; Xin, Yinqiang; Cao, Xiang; Ruan, Jie; Zhao, Zhihui; Luo, Lan; Liu, Chang; Yin, Zhimin

    2013-05-01

    DNA damage activates p53 and its downstream target genes, which further leads to apoptosis or survival either by the cell cycle arrest or by DNA repair. In many tumors, the heat shock protein 27 (Hsp27) is expressed at high levels to provide protection against anticancer drugs. However, the roles of Hsp27 in p53-mediated cellular responses to DNA damage are controversial. Here, we investigated the interplay between the phosphorylation status of Hsp27 and p53 in kidney 293A (HEK293A) cells and found that over-expressing phosphorylated Hsp27 mimics (Hsp27-3D) activated p53/p21 in an ATM-dependent manner. In addition, incubation with doxorubicin (Dox), an anticancer drug, induced Hsp27 phosphorylation in human adenocarcinoma cells (MCF-7). In contrast, inhibition of Hsp27 phosphorylation retarded both p53 induction and p21 accumulation, and led to cell apoptosis. Furthermore, phosphorylated Hsp27 increased p53 nuclear importing and its downstream target gene expression such as p21 and MDM2, while de-phosphorylated Hsp27 impeded this procession. Taken together, our data suggest that Hsp27, in its phosphorylated or de-phosphorylated status, plays different roles in regulating p53 pathway and cell survival. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Immunohistochemical expression of protein p53 in neoplasms of the mammary gland in bitches.

    PubMed

    Rodo, A; Malicka, E

    2008-01-01

    The aim of the study was to investigate the presence of protein p53 in correlation with other tumor traits: histological type, tumor grade and proliferative activity. Material for the investigation comprised mammary gland tumours collected from dogs, the patients of veterinary clinics, during surgical procedures, and archival samples. Alltogether 21 adenomas, 31 complex carcinomas, 35 simple carcinomas and 12 solid carcinomas were qualified for further investigation. No protein p53 expression was found in adenomas. Cancers show positive reaction in 32.5%. The highest percent of p53 positive neoplasms was observed in solid carcinomas and neoplasms with the highest degree of histological malignancy. The smallest number showing this expression was observed in adenomas and the highest was characteristic for solid carcinomas. Considering the tumour grading, it was found that an increase in neoplasm malignancy was positively correlated with the number of the cells showing the expression of protein p53. The differences were statistically significant. Statistically significant positive correlations were observed between the proliferative activity and protein p53 expression. Higher accumulation of protein p53 in more malignant neoplasms suggests that mutations of protein p53 can be responsible for higher proliferation in neoplasms with advanced progression of malignancy.

  20. Cyclophilin B induces chemoresistance by degrading wild type p53 via interaction with MDM2 in colorectal cancer.

    PubMed

    Choi, Tae Gyu; Nguyen, Minh Nam; Kim, Jieun; Jo, Yong Hwa; Jang, Miran; Nguyen, Ngoc Ngo Yen; Yun, Hyeong Rok; Choe, Wonchae; Kang, Insug; Ha, Joohun; Tang, Dean G; Kim, Sung Soo

    2018-06-06

    Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Chemoresistance is a major problem for effective therapy in CRC. Here, we investigated the mechanism by which peptidylprolyl isomerase B (PPIB; cyclophilin B, CypB) regulates chemoresistance in CRC. We found that CypB is a novel wild type p53 (p53WT)-inducible gene but a negative regulator of p53WT in response to oxaliplatin treatment. Overexpression of CypB shortens the half-life of p53WT and inhibits oxaliplatin-induced apoptosis in CRC cells, whereas knockdown of CypB lengthens the half-life of p53WT and stimulates p53WT dependent apoptosis. CypB interacts directly with MDM2, and enhances MDM2-dependent p53WT ubiquitination and degradation. Furthermore, we firmly validated using bioinformatics analyses that overexpression of CypB is associated with poor prognosis in CRC progression and chemoresistance. Hence, we suggest a novel mechanism of chemoresistance caused by overexpressed CypB, which may help to develop new anti-cancer drugs. We also propose that CypB may be utilized as a predictive biomarker in CRC patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  1. A p53-inducible microRNA-34a downregulates Ras signaling by targeting IMPDH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Hwa-Ryeon; Roe, Jae-Seok; Lee, Ji-Eun

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer p53 downregulates IMPDH. Black-Right-Pointing-Pointer p53-dependent miR-34a transactivation inhibits IMPDH transcription. Black-Right-Pointing-Pointer miR-34a-mediated inhibition of IMPDH downregulates GTP-dependent Ras signal. -- Abstract: p53 is a well-known transcription factor that controls cell cycle arrest and cell death in response to a wide range of stresses. Moreover, p53 regulates glucose metabolism and its mutation results in the metabolic switch to the Warburg effect found in cancer cells. Nucleotide biosynthesis is also critical for cell proliferation and the cell division cycle. Nonetheless, little is known about whether p53 regulates nucleotide biosynthesis. Here we demonstrated that p53-inducible microRNA-34a (miR-34a) repressed inosine 5 Primemore » -monophosphate dehydrogenase (IMPDH), a rate-limiting enzyme of de novo GTP biosynthesis. Treatment with anti-miR-34a inhibitor relieved the expression of IMPDH upon DNA damage. Ultimately, miR-34a-mediated inhibition of IMPDH resulted in repressed activation of the GTP-dependent Ras signaling pathway. In summary, we suggest that p53 has a novel function in regulating purine biosynthesis, aided by miR-34a-dependent IMPDH repression.« less

  2. Synergy between Prkdc and Trp53 regulates stem cell proliferation and GI-ARS after irradiation.

    PubMed

    Gurley, Kay E; Ashley, Amanda K; Moser, Russell D; Kemp, Christopher J

    2017-11-01

    Ionizing radiation (IR) is one of the most widely used treatments for cancer. However, acute damage to the gastrointestinal tract or gastrointestinal acute radiation syndrome (GI-ARS) is a major dose-limiting side effect, and the mechanisms that underlie this remain unclear. Here we use mouse models to explore the relative roles of DNA repair, apoptosis, and cell cycle arrest in radiation response. IR induces DNA double strand breaks and DNA-PK mutant Prkdc scid/scid mice are sensitive to GI-ARS due to an inability to repair these breaks. IR also activates the tumor suppressor p53 to trigger apoptotic cell death within intestinal crypt cells and p53 deficient mice are resistant to apoptosis. To determine if DNA-PK and p53 interact to govern radiosensitivity, we compared the response of single and compound mutant mice to 8 Gy IR. Compound mutant Prkdc scid/scid /Trp53 -/- mice died earliest due to severe GI-ARS. While both Prkdc scid/scid and Prkdc scid/scid /Trp53 -/- mutant mice had higher levels of IR-induced DNA damage, particularly within the stem cell compartment of the intestinal crypt, in Prkdc scid/scid /Trp53 -/- mice these damaged cells abnormally progressed through the cell cycle resulting in mitotic cell death. This led to a loss of Paneth cells and a failure to regenerate the differentiated epithelial cells required for intestinal function. IR-induced apoptosis did not correlate with radiosensitivity. Overall, these data reveal that DNA repair, mediated by DNA-PK, and cell cycle arrest, mediated by p53, cooperate to protect the stem cell niche after DNA damage, suggesting combination approaches to modulate both pathways may be beneficial to reduce GI-ARS. As many cancers harbor p53 mutations, this also suggests targeting DNA-PK may be effective to enhance sensitivity of p53 mutant tumors to radiation.

  3. Transcriptional inhibition of p21{sup WAF1/CIP1} gene (CDKN1) expression by survivin is at least partially p53-dependent: Evidence for survivin acting as a transcription factor or co-factor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang, Lei; Pre-Doctoral Chinese Fellowship Student, Second West China Hospital, Sichuan University, Sichuan; Ling, Xiang

    2012-05-04

    Highlights: Black-Right-Pointing-Pointer Survivin inhibits the expression of p21 protein, mRNA and promoter activity. Black-Right-Pointing-Pointer Survivin neutralizes p53-induced p21 expression and promoter activity. Black-Right-Pointing-Pointer Survivin physically interacts with p53 in cancer cells. Black-Right-Pointing-Pointer Genetic silencing of endogenous survivin upregulates p21 in p53 wild type cancer cells. Black-Right-Pointing-Pointer Both p53 and survivin interacts on the two p53-binding sites in the p21 promoter. -- Abstract: Growing evidence suggests a role for the antiapoptotic protein survivin in promotion of cancer cell G1/S transition and proliferation. However, the underlying mechanism is unclear. Further, although upregulation of p21{sup WAF1/CIP1} by p53 plays an important role inmore » p53-mediated cell G1 arrests in response to various distresses, it is unknown whether survivin plays a role in the regulation of p21{sup WAF1/CIP1} expression. Here, we report that exogenous expression of survivin in p53-wild type MCF-7 breast cancer cells inhibits the expression of p21{sup WAF1/CIP1} protein, mRNA and promoter activity, while the survivin C84A mutant and antisense failed to do so. Cotransfection experiments in the p53 mutant H1650 lung cancer cell line showed that survivin neutralizes p53-induced p21{sup WAF1/CIP1} expression and promoter activity. Importantly, genetically silencing of endogenous survivin using lentiviral survivin shRNA also enhances endogenous p21 in p53 wild type cancer cells, suggesting the physiological relevance of the fining. We further demonstrated that both p53 and survivin interacts on the two p53-binding sites in the p21{sup WAF1/CIP1} promoter (-2313 to -2212; -1452 to -1310), and survivin physically interacts with p53 in cancer cells. Together, we propose that survivin may act as a transcription factor or cofactor to interact with p53 on the p21{sup WAF1/CIP1} promoter leading to the inhibition of p21{sup WAF1/CIP1} expression at least in part by neutralizing p53-mediated transcriptional activation of the p21 gene.« less

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Simoes, Maria L.; Hockley, Sarah L.; Schwerdtle, Tanja

    Aristolochic acid (AA) is the causative agent of urothelial tumours associated with aristolochic acid nephropathy. These tumours contain TP53 mutations and over-express TP53. We compared transcriptional and translational responses of two isogenic HCT116 cell lines, one expressing TP53 (p53-WT) and the other with this gene knocked out (p53-null), to treatment with aristolochic acid I (AAI) (50-100 {mu}M) for 6-48 h. Modulation of 118 genes was observed in p53-WT cells and 123 genes in p53-null cells. Some genes, including INSIG1, EGR1, CAV1, LCN2 and CCNG1, were differentially expressed in the two cell lines. CDKN1A was selectively up-regulated in p53-WT cells, leadingmore » to accumulation of TP53 and CDKN1A. Apoptotic signalling, measured by caspase-3 and -7 activity, was TP53-dependent. Both cell types accumulated in S phase, suggesting that AAI-DNA adducts interfere with DNA replication, independently of TP53 status. The oncogene MYC, frequently over-expressed in urothelial tumours, was up-regulated by AAI, whereas FOS was down-regulated. Observed modulation of genes involved in endocytosis, e.g. RAB5A, may be relevant to the known inhibition of receptor-mediated endocytosis, an early sign of AA-mediated proximal tubule injury. AAI-DNA adduct formation was significantly greater in p53-WT cells than in p53-null cells. Collectively, phenotypic anchoring of the AAI-induced expression profiles to DNA adduct formation, cell-cycle parameters, TP53 expression and apoptosis identified several genes linked to these biological outcomes, some of which are TP53-dependent. These results strengthen the importance of TP53 in AA-induced cancer, and indicate that other alterations, e.g. to MYC oncogenic pathways, may also contribute.« less

  5. Epigenetic inactivation of the p53-induced long noncoding RNA TP53 target 1 in human cancer

    PubMed Central

    Diaz-Lagares, Angel; Crujeiras, Ana B.; Lopez-Serra, Paula; Soler, Marta; Setien, Fernando; Goyal, Ashish; Sandoval, Juan; Hashimoto, Yutaka; Martinez-Cardús, Anna; Gomez, Antonio; Heyn, Holger; Moutinho, Catia; Espada, Jesús; Vidal, August; Paúles, Maria; Galán, Maica; Sala, Núria; Akiyama, Yoshimitsu; Martínez-Iniesta, María; Farré, Lourdes; Villanueva, Alberto; Gross, Matthias; Diederichs, Sven; Guil, Sonia; Esteller, Manel

    2016-01-01

    Long noncoding RNAs (lncRNAs) are important regulators of cellular homeostasis. However, their contribution to the cancer phenotype still needs to be established. Herein, we have identified a p53-induced lncRNA, TP53TG1, that undergoes cancer-specific promoter hypermethylation-associated silencing. In vitro and in vivo assays identify a tumor-suppressor activity for TP53TG1 and a role in the p53 response to DNA damage. Importantly, we show that TP53TG1 binds to the multifaceted DNA/RNA binding protein YBX1 to prevent its nuclear localization and thus the YBX1-mediated activation of oncogenes. TP53TG1 epigenetic inactivation in cancer cells releases the transcriptional repression of YBX1-targeted growth-promoting genes and creates a chemoresistant tumor. TP53TG1 hypermethylation in primary tumors is shown to be associated with poor outcome. The epigenetic loss of TP53TG1 therefore represents an altered event in an lncRNA that is linked to classical tumoral pathways, such as p53 signaling, but is also connected to regulatory networks of the cancer cell. PMID:27821766

  6. Prognostic and predictive value of TP53 mutations in node-positive breast cancer patients treated with anthracycline- or anthracycline/taxane-based adjuvant therapy: results from the BIG 02-98 phase III trial

    PubMed Central

    2012-01-01

    Abstract Introduction Pre-clinical data suggest p53-dependent anthracycline-induced apoptosis and p53-independent taxane activity. However, dedicated clinical research has not defined a predictive role for TP53 gene mutations. The aim of the current study was to retrospectively explore the prognosis and predictive values of TP53 somatic mutations in the BIG 02-98 randomized phase III trial in which women with node-positive breast cancer were treated with adjuvant doxorubicin-based chemotherapy with or without docetaxel. Methods The prognostic and predictive values of TP53 were analyzed in tumor samples by gene sequencing within exons 5 to 8. Patients were classified according to p53 protein status predicted from TP53 gene sequence, as wild-type (no TP53 variation or TP53 variations which are predicted not to modify p53 protein sequence) or mutant (p53 nonsynonymous mutations). Mutations were subcategorized according to missense or truncating mutations. Survival analyses were performed using the Kaplan-Meier method and log-rank test. Cox-regression analysis was used to identify independent predictors of outcome. Results TP53 gene status was determined for 18% (520 of 2887) of the women enrolled in BIG 02-98. TP53 gene variations were found in 17% (90 of 520). Nonsynonymous p53 mutations, found in 16.3% (85 of 520), were associated with older age, ductal morphology, higher grade and hormone-receptor negativity. Of the nonsynonymous mutations, 12.3% (64 of 520) were missense and 3.6% were truncating (19 of 520). Only truncating mutations showed significant independent prognostic value, with an increased recurrence risk compared to patients with non-modified p53 protein (hazard ratio = 3.21, 95% confidence interval = 1.740 to 5.935, P = 0.0002). p53 status had no significant predictive value for response to docetaxel. Conclusions p53 truncating mutations were uncommon but associated with poor prognosis. No significant predictive role for p53 status was detected. Trial registration ClinicalTrials.gov NCT00174655 PMID:22551440

  7. p53 Loss synergizes with estrogen and papillomaviral oncogenes to induce cervical and breast cancers.

    PubMed

    Shai, Anny; Pitot, Henry C; Lambert, Paul F

    2008-04-15

    Whereas the tumor suppressor p53 gene is frequently mutated in most human cancers, this is not the case in human papillomavirus (HPV)-associated cancers, presumably because the viral E6 oncoprotein inactivates the p53 protein. The ability of E6 to transform cells in tissue culture and induce cancers in mice correlates in part with its ability to inactivate p53. In this study, we compared the expression of the HPV16 E6 oncogene to the conditional genetic disruption of p53 in the context of a mouse model for cervical cancer in which estrogen is a critical cofactor. Nearly all of the K14Crep53(f/f) mice treated with estrogen developed cervical cancer, a stark contrast to its complete absence in like-treated K14E6(WT)p53(f/f) mice, indicating that HPV16 E6 must only partially inactivate p53. p53-independent activities of E6 also contributed to carcinogenesis, but in the female reproductive tract, these activities were manifested only in the presence of the HPV16 E7 oncogene. Interestingly, treatment of K14Crep53(f/f) mice with estrogen also resulted in mammary tumors after only a short latency, many of which were positive for estrogen receptor alpha. The majority of these mammary tumors were of mixed cell types, suggestive of their originating from a multipotent progenitor. Furthermore, a subset of mammary tumors arising in the estrogen-treated, p53-deficient mammary glands exhibited evidence of an epithelial to mesenchymal transition. These data show the importance of the synergy between estrogen and p53 insufficiency in determining basic properties of carcinogenesis in hormone-responsive tissues, such as the breast and the reproductive tract.

  8. p53-regulated autophagy is controlled by glycolysis and determines cell fate

    PubMed Central

    Duan, Lei; Perez, Ricardo E.; Davaadelger, Batzaya; Dedkova, Elena N.; Blatter, Lothar A.; Maki, Carl G.

    2015-01-01

    The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis. PMID:26337205

  9. Exercise Activates p53 and Negatively Regulates IGF-1 Pathway in Epidermis within a Skin Cancer Model.

    PubMed

    Yu, Miao; King, Brenee; Ewert, Emily; Su, Xiaoyu; Mardiyati, Nur; Zhao, Zhihui; Wang, Weiqun

    2016-01-01

    Exercise has been previously reported to lower cancer risk through reducing circulating IGF-1 and IGF-1-dependent signaling in a mouse skin cancer model. This study aims to investigate the underlying mechanisms by which exercise may down-regulate the IGF-1 pathway via p53 and p53-related regulators in the skin epidermis. Female SENCAR mice were pair-fed an AIN-93 diet with or without 10-week treadmill exercise at 20 m/min, 60 min/day and 5 days/week. Animals were topically treated with TPA 2 hours before sacrifice and the target proteins in the epidermis were analyzed by both immunohistochemistry and Western blot. Under TPA or vehicle treatment, MDM2 expression was significantly reduced in exercised mice when compared with sedentary control. Meanwhile, p53 was significantly elevated. In addition, p53-transcriptioned proteins, i.e., p21, IGFBP-3, and PTEN, increased in response to exercise. There was a synergy effect between exercise and TPA on the decreased MDM2 and increased p53, but not p53-transcripted proteins. Taken together, exercise appeared to activate p53, resulting in enhanced expression of p21, IGFBP-3, and PTEN that might induce a negative regulation of IGF-1 pathway and thus contribute to the observed cancer prevention by exercise in this skin cancer model.

  10. miR-300 regulates cellular radiosensitivity through targeting p53 and apaf1 in human lung cancer cells.

    PubMed

    He, Jinpeng; Feng, Xiu; Hua, Junrui; Wei, Li; Lu, Zhiwei; Wei, Wenjun; Cai, Hui; Wang, Bing; Shi, Wengui; Ding, Nan; Li, He; Zhang, Yanan; Wang, Jufang

    2017-10-18

    microRNAs (miRNAs) play a crucial role in mediation of the cellular sensitivity to ionizing radiation (IR). Previous studies revealed that miR-300 was involved in the cellular response to IR or chemotherapy drug. However, whether miR-300 could regulate the DNA damage responses induced by extrinsic genotoxic stress in human lung cancer and the underlying mechanism remain unknown. In this study, the expression of miR-300 was examined in lung cancer cells treated with IR, and the effects of miR-300 on DNA damage repair, cell cycle arrest, apoptosis and senescence induced by IR were investigated. It was found that IR induced upregulation of endogenous miR-300, and ectopic expression of miR-300 by transfected with miR-300 mimics not only greatly enhanced the cellular DNA damage repair ability but also substantially abrogated the G2 cell cycle arrest and apoptosis induced by IR. Bioinformatic analysis predicted that p53 and apaf1 were potential targets of miR-300, and the luciferase reporter assay showed that miR-300 significantly suppressed the luciferase activity through binding to the 3'-UTR of p53 or apaf1 mRNA. In addition, overexpression of miR-300 significantly reduced p53/apaf1 and/or IR-induced p53/apaf1 protein expression levels. Flow cytomertry analysis and colony formation assay showed that miR-300 desensitized lung cancer cells to IR by suppressing p53-dependent G2 cell cycle arrest, apoptosis and senescence. These data demonstrate that miR-300 regulates the cellular sensitivity to IR through targeting p53 and apaf1 in lung cancer cells.

  11. Interleukin 6 downregulates p53 expression and activity by stimulating ribosome biogenesis: a new pathway connecting inflammation to cancer

    PubMed Central

    Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M

    2014-01-01

    Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714

  12. Csa-19, a radiation-responsive human gene, identified by an unbiased two-gel cDNA library screening method in human cancer cells

    NASA Technical Reports Server (NTRS)

    Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.

    1997-01-01

    A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.

  13. Influence of P53 on the radiotherapy response of hepatocellular carcinoma

    PubMed Central

    Gomes, Ana R.; Abrantes, Ana M.; Brito, Ana F.; Laranjo, Mafalda; Casalta-Lopes, João E.; Gonçalves, Ana C.; Sarmento-Ribeiro, Ana B.; Tralhão, José G.

    2015-01-01

    Background/Aims Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide, and it has a poor prognosis and few therapeutic options. Radiotherapy is one of the most effective forms of cancer treatment, and P53 protein is one of the key molecules determining how a cell responds to radiotherapy. The aim of this study was to determine the therapeutic efficacy of iodine-131 in three human HCC cell lines. Methods Western blotting was used to measure P53 expression. The effects of radiotherapy with iodine-131 were assessed by using the clonogenic assay to evaluate cell survival. Flow cytometry was carried out to examine the effects of iodine-131 on cell death, oxidative stress, reduced intracellular glutathione expression, the mitochondrial membrane potential, and the cell cycle. Results The P53 protein was not expressed in Hep3B2.1-7 cells, was expressed at normal levels in HepG2 cells, and was overexpressed in HuH7 cells. P53 expression in the HuH7 and HepG2 cell lines increased after internal and external irradiation with iodine-131. Irradiation induced a decrease in cell survival and led to a decrease in cell viability in all of the cell lines studied, accompanied by cell death via late apoptosis/necrosis and necrosis. Irradiation with 131-iodine induced mostly cell-cycle arrest in the G0/G1 phase. Conclusions These results suggest that P53 plays a key role in the radiotherapy response of HCC. PMID:26527121

  14. P53 protein in proliferation, repair and apoptosis of cells.

    PubMed

    Wawryk-Gawda, Ewelina; Chylińska-Wrzos, Patrycja; Lis-Sochocka, Marta; Chłapek, Katarzyna; Bulak, Kamila; Jędrych, Marian; Jodłowska-Jędrych, Barbara

    2014-05-01

    The p53 protein is an important factor of many intra- and extracellular processes. This protein regulates the repair of cellular DNA and induces apoptosis. It is also responsible for the regulation of the senescence and the cell entering the subsequent stages of the cellular cycle. The protein p53 is also involved in inhibiting angiogenesis and the induction of oxidative shock. In our study, we examined the activity of p53 protein in the uterine epithelial cells in rats treated with cladribine. Its action is mainly based on apoptosis induction. We compared the activity of p53 protein in cells with a high apoptosis index and in cells with active repair mechanisms and high proliferation index. We observed stronger p53 protein expression in the epithelial cells of the materials taken 24 h after the last dose of 2-CdA associated with the active process of apoptosis and inhibition of proliferation. After 4 weeks from the last dose of cladribine, the stronger expression of p53 protein was associated with both the existing changes in the cell's genome, the effects of the ongoing repair mechanisms, as well as the high proliferation activity.

  15. Smoking, p53 Mutation, and Lung Cancer

    PubMed Central

    Gibbons, Don L.; Byers, Lauren A.; Kurie, Jonathan M.

    2014-01-01

    This issue marks the 50th Anniversary of the release of the U.S. Surgeon General’s Report on Smoking and Health. Perhaps no other singular event has done more to highlight the effects of smoking on the development of cancer. Tobacco exposure is the leading cause of cancers involving the oral cavity, conductive airways and the lung. Owing to the many carcinogens in tobacco smoke, smoking-related malignancies have a high genome-wide burden of mutations, including in the gene encoding for p53. The p53 protein is the most frequently mutated tumor suppressor in cancer, responsible for a range of critical cellular functions that are compromised by the presence of a mutation. Herein we review the epidemiologic connection between tobacco exposure and cancer, the molecular basis of p53 mutation in lung cancer, and the normal molecular and cellular roles of p53 that are abrogated during lung tumor development and progression as defined by in vitro and in vivo studies. We also consider the therapeutic potential of targeting mutant p53 in a clinical setting based upon the cellular role of mutant p53 and data from genetic murine models. PMID:24442106

  16. Detection of genotoxic and non-genotoxic carcinogens in Xpc(-/-)p53(+/-) mice.

    PubMed

    Melis, Joost P M; Speksnijder, Ewoud N; Kuiper, Raoul V; Salvatori, Daniela C F; Schaap, Mirjam M; Maas, Saskia; Robinson, Joke; Verhoef, Aart; van Benthem, Jan; Luijten, Mirjam; van Steeg, Harry

    2013-01-15

    An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed the Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Enhancing the Effects of Low Dose Doxorubicin Treatment by the Radiation in T47D and SKBR3 Breast Cancer Cells

    PubMed Central

    Aghaee, Fahimeh; Baradaran, Behzad; Mesbahi, Asghar; Mohammadzadeh, Mohammad; Jafarabadi, Mohammad Asghari

    2013-01-01

    Purpose Breast cancer is the most common malignancy of women worldwide. Radiotherapy consists of a vital element in the treatment of breast cancer but relative side effects and different radioactive responses are limiting factors for a successful treatment. Doxorubicin has been used to treat cancers for over 30 years and is considered as the most effective drug in the treatment of breast cancer. There are also many chronic side effects that limit the amount of doxorubicin that can be administered. The combined radio-drug treatment, with low doses, can be an approach for reducing side effects from single modality treatments instead of suitable cure rates. Methods We have studied the effect of 1, 1.5, and 2 Gy doses of 9 MV X-rays along with 1 µM doxorubicin on inducing cell death, apoptosis and also p53 and PTEN gene expression in T47D and SKBR3 breast cancer cells. Results Doxorubicin treatment resulted in upregulation of radiation-induced levels of p53 and downregulation of PTEN at 1 and 1.5 Gy in T47D breast cancer cells, as well as downregulation of p53 mRNA level of expression and upregulation of PTEN mRNA level of expression in SKBR3 breast cancer cell line. In addition, doxorubicin in combination with radiation decreased the viability of breast cancer cell lines in the both cell lines. Conclusion Low doses of doxorubicin, with least cell toxicity, may be an effective treatment for breast cancer when used in conjunction with ionizing radiation. PMID:23843848

  18. The p53-p21WAF1 checkpoint pathway plays a protective role in preventing DNA rereplication induced by abrogation of FOXF1 function

    PubMed Central

    Lo, Pang-Kuo; Lee, Ji Shin; Sukumar, Saraswati

    2011-01-01

    We previously identified FOXF1 as a potential tumor suppressor gene with an essential role in preventing DNA rereplication to maintain genomic stability, which is frequently inactivated in breast cancer through the epigenetic mechanism. Here we further addressed the role of the p53-p21WAF1 checkpoint pathway in DNA rereplication induced by silencing of FOXF1. Knockdown of FOXF1 by small interference RNA (siRNA) rendered colorectal p53-null and p21WAF1-null HCT116 cancer cells more susceptible to rereplication and apoptosis than the wild-type parental cells. In parental HCT116 cells with a functional p53 checkpoint, the p53-p21WAF1 checkpoint pathway was activated upon FOXF1 knockdown, which was concurrent with suppression of the CDK2-Rb cascade and induction of G1 arrest. In contrast, these events were not observed in FOXF1-depleted HCT116-p53−/− and HCT116-p21−/− cells, indicating the p53-dependent checkpoint function is vital for inhibiting CDK2 to induce G1 arrest and protect cells from rereplication. The pharmacologic inhibitor (caffeine) of Ataxia telangiectasia mutated (ATM) and ataxia telangiectasia and Rad3 related (ATR) protein kinases abolished activation of the p53-p21WAF1 pathway upon FOXF1 knockdown, suggesting that suppression of FOXF1 function triggered the ATM/ATR-mediated DNA damage response. Cosilencing of p53 by siRNA synergistically enhanced the effect of FOXF1 depletion on stimulation of DNA rereplication and apoptosis in wild-type HCT116. Finally, we show that FOXF1 expression is predominantly silenced in breast and colorectal cancer cell lines with inactive p53. Our study demonstrated that the p53-p21WAF1 checkpoint pathway is an intrinsically protective mechanism to prevent DNA rereplication induced by silencing of FOXF1. PMID:21964066

  19. Cisplatin-Induced Renal Injury is Independently Mediated by OCT2 and p53

    PubMed Central

    Sprowl, Sprowl; Lancaster, Cynthia S.; Pabla, Navjotsingh; Hermann, Edwin; Kosloske, Ashley M.; Gibson, Alice A.; Li, Lie; Zeeh, Dorothea; Schlatter, Eberhard; Janke, Laura J.; Ciarimboli, Giuliano; Sparreboom, Alex

    2014-01-01

    Purpose Tubular secretion of cisplatin is abolished in mice deficient for the organic cation transporters Oct1 and Oct2 [Oct1/2(−/−) mice], and these animals are protected from severe cisplatin-induced kidney damage. Since tubular necrosis is not completely absent in Oct1/2(−/−) mice, we hypothesized that alternate pathways are involved in the observed injury. Experimental Design Studies were done in wildtype, Oct1/2(−/−), or p53-deficient animals, all on an FVB background, receiving i.p. cisplatin at 15 mg/kg. The cisplatin metabolites were analyzed using mass spectrometry, and gene expression was assessed using Affymetrix microarrays and RT-PCR arrays. Results KEGG pathway analyses on kidneys from mice exposed to cisplatin revealed that most significantly altered genes were associated with the p53 signaling network, including Cdnk1a and Mdm2, in both wildtype (P=2.40×10–11) and Oct1/2(−/−) mice (P=1.92×10-8). This was confirmed by demonstrating that homozygosity for a p53-null allele partially reduced renal tubular damage, while loss of p53 in Oct1/2(−/−) mice [p53(−/−)/Oct1/2(−/−)] completely abolished nephrotoxicity. We found that pifithrin-α, an inhibitor of p53-dependent transcriptional activation, inhibits Oct2 and can mimic the lack of nephrotoxicity observed in p53(−/−)/Oct1/2(−/−) mice. Conclusions These findings indicate that (i) the p53 pathway plays a crucial role in the kidney in response to cisplatin treatment and (ii) clinical exploration of OCT2 inhibitors may not lead to complete nephroprotection unless the p53 pathway is simultaneously antagonized. PMID:24916697

  20. Data for a proteomic analysis of p53-independent induction of apoptosis by bortezomib

    PubMed Central

    Yerlikaya, Azmi; Okur, Emrah; Tarık Baykal, Ahmet; Acılan, Ceyda; Boyacı, İhsan; Ulukaya, Engin

    2014-01-01

    This data article contains data related to the research article entitled, “A proteomic analysis of p53-independent induction of apoptosis by bortezomib in 4T1 breast cancer cell line” by Yerlikaya et al. [1]. The research article presented 2-DE and nLC-MS/MS based proteomic analysis of proteasome inhibitor bortezomib-induced changes in the expression of cellular proteins. The report showed that GRP78 and TCEB2 were over-expressed in response to treatment with bortezomib for 24 h. In addition, the report demonstrated that Hsp70, the 26S proteasome non-ATPase regulatory subunit 14 and sequestosome 1 were increased at least 2 fold in p53-deficient 4T1 cells. The data here show for the first time the increased expressions of Card10, Dffb, Traf3 and Trp53bp2 in response to inhibition of the 26S proteasome. The information presented here also shows that both Traf1 and Xiap (a member of IAPs) are also downregulated simultaneously upon proteasomal inhibition. The increases in the level of Card10 and Trp53bp2 proteins were verified by Western blot analysis in response to varying concentrations of bortezomib for 24 h. PMID:26217687

  1. Local activation of p53 in the tumor microenvironment overcomes immune suppression and enhances antitumor immunity

    PubMed Central

    Guo, Gang; Yu, Miao; Xiao, Wei; Celis, Esteban; Cui, Yan

    2017-01-01

    Mutations in tumor suppressor p53 remain a vital mechanism of tumor escape from apoptosis and senescence. Emerging evidence suggests that p53 dysfunction also fuels inflammation and supports tumor immune evasion, thereby serving as an immunological driver of tumorigenesis. Therefore, targeting p53 in the tumor microenvironment (TME) also represents an immunologically desirable strategy for reversing immunosuppression and enhancing antitumor immunity. Using a pharmacological p53 activator nutlin-3a, we show that local p53 activation in TME comprising overt tumor infiltrating leukocytes (TILeus) induces systemic antitumor immunity and tumor regression, but not in TME with scarce TILeus, such as B16 melanoma. Maneuvers that recruit leukocytes to TME, such as TLR3 ligand in B16 tumors, greatly enhanced nutlin-induced antitumor immunity and tumor control. Mechanistically, nutlin-3a-induced antitumor immunity was contingent on two non-redundant but immunologically synergistic p53-dependent processes: reversal of immunosuppression in TME and induction of tumor immunogenic cell death (ICD), leading to activation and expansion of polyfunctional CD8 CTLs and tumor regression. Our study demonstrates that unlike conventional tumoricidal therapies, which rely on effective p53 targeting in each tumor cell and often associate with systemic toxicity, this immune-based strategy requires only limited local p53 activation to alter the immune landscape of TME and subsequently amplify immune response to systemic antitumor immunity. Hence, targeting the p53 pathway in TME can be exploited to reverse immunosuppression and augment therapeutic benefits beyond tumoricidal effects to harness tumor-specific, durable, and systemic antitumor immunity with minimal toxicity. PMID:28280037

  2. Activation of the miR-34a/SIRT1/p53 Signaling Pathway Contributes to the Progress of Liver Fibrosis via Inducing Apoptosis in Hepatocytes but Not in HSCs.

    PubMed

    Tian, Xiao-Feng; Ji, Fu-Jian; Zang, Hong-Liang; Cao, Hong

    2016-01-01

    Liver fibrosis results from a sustained wound healing response to chronic liver injury, and the activation of nonparenchymal hepatic stellate cells (HSCs) is the pivotal process. MicroRNA-34a (miR-34a) is the direct target gene of p53 and activates p53 through sirtuin 1 (SIRT1) simultaneously. The miR-34a/SIRT1/p53 signaling pathway thus forms a positive feedback loop wherein p53 induces miR-34a and miR-34a activates p53 by inhibiting SIRT1, playing an important role in cell proliferation and apoptosis. miR-34a expression has been found to be increased in animal models or in human patients with different liver diseases, including liver fibrosis. However, the exact role of this classical miR-34a/SIRT1/p53 signaling pathway in liver fibrosis remains unclear. In the present study, using a CCl4-induced rat liver fibrosis model, we found that the miR-34a/SIRT1/p53 signaling pathway was activated and could be inhibited by SIRT1 activator SRT1720. Further studies showed that the miR-34a/SIRT1/p53 signaling pathway was activated in hepatocytes but not in HSCs. The activation of this pathway in hepatocytes resulted in the apoptosis of hepatocytes and thus activated HSCs. Our data indicate that the miR-34a/SIRT1/p53 signaling pathway might be a promising therapeutic target for liver fibrosis.

  3. miR-338-3p confers 5-fluorouracil resistance in p53 mutant colon cancer cells by targeting the mammalian target of rapamycin.

    PubMed

    Han, Jia; Li, Jie; Tang, Kaijie; Zhang, Huahua; Guo, Bo; Hou, Ni; Huang, Chen

    2017-11-15

    Evidence demonstrate that p53 mutations and microRNAs (miRs) are important components of 5-FU resistance in colorectal cancer (CRC). miR-338-3p has been reported associated with cancer prognosis. However whether or not it influences chemotherapy sensitivity and the underlying mechanisms have not been elucidated. Here, three types of human colon cancer cell lines, HT29 (mutant p53), HCT116 (wild-type p53), and HCT116 p53 -/- (deficient p53), were treated with 5-FU. We showed that expression of miR-338-3p was correlated with apoptosis and 5-FU resistance in colon cancer cells. Ectopic expression of miR-338-3p conferred resistance to 5-FU in HCT116 cells. Further experiments indicated that miR-338-3p mediated 5-FU resistance through down-regulation of mTOR expression. Moreover, inhibition of miR-338-3p in HT29 and HCT116 p53 -/- cells increased their sensitivity to 5-FU treatment. Furthermore, we detected autophagy changes in our experiment because mTOR was known prominently regulating autophagy and the competition between autophagy and apoptosis in response to 5-FU was a mechanism influencing 5-FU sensitivity. Our results reveal a critical and novel role of miR-338-3p in the correlation of 5-FU resistance with p53 status. Moreover, the miR-338-3p inhibitor has the potential to overcome 5-FU resistance in p53 mutant colon cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. p53 Loss Synergizes with Estrogen and Papillomaviral Oncogenes to Induce Cervical and Breast Cancers

    PubMed Central

    Shai, Anny; Pitot, Henry C.; Lambert, Paul F.

    2010-01-01

    Whereas the tumor suppressor p53 gene is frequently mutated in most human cancers, this is not the case in human papillomavirus (HPV)-associated cancers, presumably because the viral E6 oncoprotein inactivates the p53 protein. The ability of E6 to transform cells in tissue culture and induce cancers in mice correlates in part with its ability to inactivate p53. In this study, we compared the expression of the HPV16 E6 oncogene to the conditional genetic disruption of p53 in the context of a mouse model for cervical cancer in which estrogen is a critical cofactor. Nearly all of the K14Crep53f/f mice treated with estrogen developed cervical cancer, a stark contrast to its complete absence in like-treated K14E6WTp53f/f mice, indicating that HPV16 E6 must only partially inactivate p53. p53-independent activities of E6 also contributed to carcinogenesis, but in the female reproductive tract, these activities were manifested only in the presence of the HPV16 E7 oncogene. Interestingly, treatment of K14Crep53f/f mice with estrogen also resulted in mammary tumors after only a short latency, many of which were positive for estrogen receptor α. The majority of these mammary tumors were of mixed cell types, suggestive of their originating from a multipotent progenitor. Furthermore, a subset of mammary tumors arising in the estrogen-treated, p53-deficient mammary glands exhibited evidence of an epithelial to mesenchymal transition. These data show the importance of the synergy between estrogen and p53 insufficiency in determining basic properties of carcinogenesis in hormone-responsive tissues, such as the breast and the reproductive tract. PMID:18413729

  5. The E3 ubiquitin ligase Mule acts through the ATM-p53 axis to maintain B lymphocyte homeostasis.

    PubMed

    Hao, Zhenyue; Duncan, Gordon S; Su, Yu-Wen; Li, Wanda Y; Silvester, Jennifer; Hong, Claire; You, Han; Brenner, Dirk; Gorrini, Chiara; Haight, Jillian; Wakeham, Andrew; You-Ten, Annick; McCracken, Susan; Elia, Andrew; Li, Qinxi; Detmar, Jacqui; Jurisicova, Andrea; Hobeika, Elias; Reth, Michael; Sheng, Yi; Lang, Philipp A; Ohashi, Pamela S; Zhong, Qing; Wang, Xiaodong; Mak, Tak W

    2012-01-16

    Cellular homeostasis is controlled by pathways that balance cell death with survival. Mcl-1 ubiquitin ligase E3 (Mule) is an E3 ubiquitin ligase that targets the proapoptotic molecule p53 for polyubiquitination and degradation. To elucidate the role of Mule in B lymphocyte homeostasis, B cell-specific Mule knockout (BMKO) mice were generated using the Cre-LoxP recombination system. Analysis of BMKO mice showed that Mule was essential for B cell development, proliferation, homeostasis, and humoral immune responses. p53 transactivation was increased by two- to fourfold in Mule-deficient B cells at steady state. Genetic ablation of p53 in BMKO mice restored B cell development, proliferation, and homeostasis. p53 protein was increased in resting Mule-deficient mouse embryonic fibroblasts (MEFs) and embryonic stem (ES) cells. Loss of Mule in both MEFs and B cells at steady state resulted in increased levels of phospho-ataxia telangiectasia mutated (ATM) and the ATM substrate p53. Under genotoxic stress, BMKO B cells were resistant to apoptosis, and control MEFs exhibited evidence of a physical interaction between Mule and phospho-ATM. Phospho-ATM, phospho-p53, and Brca1 levels were reduced in Mule-deficient B cells and MEFs subjected to genotoxic stress. Thus, Mule regulates the ATM-p53 axis to maintain B cell homeostasis under both steady-state and stress conditions.

  6. Up-regulation of nucleotide excision repair in mouse lung and liver following chronic exposure to aflatoxin B{sub 1} and its dependence on p53 genotype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mulder, Jeanne E.; Bondy, Genevieve S.; Mehta, Rekha

    Aflatoxin B{sub 1} (AFB{sub 1}) is biotransformed in vivo into an epoxide metabolite that forms DNA adducts that may induce cancer if not repaired. p53 is a tumor suppressor gene implicated in the regulation of global nucleotide excision repair (NER). Male heterozygous p53 knockout (B6.129-Trp53{sup tm1Brd}N5, Taconic) and wild-type mice were exposed to 0, 0.2 or 1.0 ppm AFB{sub 1} for 26 weeks. NER activity was assessed with an in vitro assay, using AFB{sub 1}-epoxide adducted plasmid DNA as a substrate. For wild-type mice, repair of AFB{sub 1}–N7-Gua adducts was 124% and 96% greater in lung extracts from mice exposedmore » to 0.2 ppm and 1.0 ppm AFB{sub 1} respectively, and 224% greater in liver extracts from mice exposed to 0.2 ppm AFB{sub 1} (p < 0.05). In heterozygous p53 knockout mice, repair of AFB{sub 1}–N7-Gua was only 45% greater in lung extracts from mice exposed to 0.2 ppm AFB{sub 1} (p < 0.05), and no effect was observed in lung extracts from mice treated with 1.0 ppm AFB{sub 1} or in liver extracts from mice treated with either AFB{sub 1} concentration. p53 genotype did not affect basal levels of repair. AFB{sub 1} exposure did not alter repair of AFB{sub 1}-derived formamidopyrimidine adducts in lung or liver extracts of either mouse genotype nor did it affect XPA or XPB protein levels. In summary, chronic exposure to AFB{sub 1} increased NER activity in wild-type mice, and this response was diminished in heterozygous p53 knockout mice, indicating that loss of one allele of p53 limits the ability of NER to be up-regulated in response to DNA damage. - Highlights: • Mice are chronically exposed to low doses of the mycotoxin aflatoxin B{sub 1} (AFB{sub 1}). • The effects of AFB{sub 1} and p53 status on nucleotide excision repair are investigated. • AFB{sub 1} increases nucleotide excision repair in wild type mouse lung and liver. • This increase is attenuated in p53 heterozygous mouse lung and liver. • Results portray the role of p53 in nucleotide excision repair after AFB{sub 1} exposure.« less

  7. DNA damage response in nephrotoxic and ischemic kidney injury

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yan, Mingjuan; Tang, Chengyuan

    DNA damage activates specific cell signaling cascades for DNA repair, cell cycle arrest, senescence, and/or cell death. Recent studies have demonstrated DNA damage response (DDR) in experimental models of acute kidney injury (AKI). In cisplatin-induced AKI or nephrotoxicity, the DDR pathway of ATR/Chk2/p53 is activated and contributes to renal tubular cell apoptosis. In ischemic AKI, DDR seems more complex and involves at least the ataxia telangiectasia mutated (ATM), a member of the phosphatidylinositol 3-kinase-related kinase (PIKK) family, and p53; however, while ATM may promote DNA repair, p53 may trigger cell death. Targeting DDR for kidney protection in AKI therefore reliesmore » on a thorough elucidation of the DDR pathways in various forms of AKI.« less

  8. Control of G1 arrest after DNA damage.

    PubMed Central

    Kastan, M B; Kuerbitz, S J

    1993-01-01

    The temporal relationship between DNA damage and DNA replication may be critical in determining whether the genetic changes necessary for cellular transformation occur after DNA damage. Recent characterization of the mechanisms responsible for alterations in cell-cycle progression after DNA damage in our laboratory have implicated the p53 (tumor suppressor) protein in the G1 arrest that occurs after certain types of DNA damage. In particular, we found that levels of p53 protein increased rapidly and transiently after nonlethal doses of gamma irradiation (XRT) in hematopoietic cells with wild-type, but not mutant, p53 genes. These changes in p53 protein levels were temporally linked to a transient G1 arrest in these cells. Hematopoietic cells with mutant or absent p53 genes did not exhibit this G1 arrest, through they continued to demonstrate a G2 arrest. We recently extended these observations of a tight correlation between the status of the endogenous p53 genes and this G1 arrest after XRT and this cell-cycle alteration after XRT was then established by transfecting cells lacking endogenous p53 genes with a wild-type gene and observing acquisition of the G1 arrest and by transfecting cells processing endogenous wild-type p53 genes with a mutant p53 gene and observing loss of the G1 arrest after XRT. These observations and their significance for our understanding of the mechanisms of DNA damage-induced cellular transformation are discussed. PMID:8013425

  9. A novel P53/POMC/Gαs/SASH1 autoregulatory feedback loop activates mutated SASH1 to cause pathologic hyperpigmentation.

    PubMed

    Zhou, Ding'an; Wei, Zhiyun; Kuang, Zhongshu; Luo, Huangchao; Ma, Jiangshu; Zeng, Xing; Wang, Ke; Liu, Beizhong; Gong, Fang; Wang, Jing; Lei, Shanchuan; Wang, Dongsheng; Zeng, Jiawei; Wang, Teng; He, Yong; Yuan, Yongqiang; Dai, Hongying; He, Lin; Xing, Qinghe

    2017-04-01

    p53-Transcriptional-regulated proteins interact with a large number of other signal transduction pathways in the cell, and a number of positive and negative autoregulatory feedback loops act upon the p53 response. P53 directly controls the POMC/α-MSH productions induced by ultraviolet (UV) and is associated with UV-independent pathological pigmentation. When identifying the causative gene of dyschromatosis universalis hereditaria (DUH), we found three mutations encoding amino acid substitutions in the gene SAM and SH3 domain containing 1 (SASH1), and SASH1 was associated with guanine nucleotide-binding protein subunit-alpha isoforms short (Gαs). However, the pathological gene and pathological mechanism of DUH remain unknown for about 90 years. We demonstrate that SASH1 is physiologically induced by p53 upon UV stimulation and SASH and p53 is reciprocally induced at physiological and pathophysiological conditions. SASH1 is regulated by a novel p53/POMC/α-MSH/Gαs/SASH1 cascade to mediate melanogenesis. A novel p53/POMC/Gαs/SASH1 autoregulatory positive feedback loop is regulated by SASH1 mutations to induce pathological hyperpigmentation phenotype. Our study demonstrates that a novel p53/POMC/Gαs/SASH1 autoregulatory positive feedback loop is regulated by SASH1 mutations to induce pathological hyperpigmentation phenotype. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  10. TRIM25 enhances cell growth and cell survival by modulating p53 signals via interaction with G3BP2 in prostate cancer.

    PubMed

    Takayama, Ken-Ichi; Suzuki, Takashi; Tanaka, Tomoaki; Fujimura, Tetsuya; Takahashi, Satoru; Urano, Tomohiko; Ikeda, Kazuhiro; Inoue, Satoshi

    2018-04-01

    Prostate cancer growth is promoted by the gene regulatory action of androgen receptor (AR) and its downstream signals. The aberrant dysfunction of tumor suppressor p53 has an important role in the prognosis of cancer. We previously found that androgen treatments translocate p53 to the cytoplasm. The mechanism of this translocation depends on sumoylation of p53 by complex of SUMO E3 ligase RanBP2 with androgen-induced GTPase-activating protein-binding protein 2 (G3BP2). Here, we identified tripartite motif-containing protein 25 (TRIM25)/estrogen-responsive finger protein (Efp) as a novel interacting partner of G3BP2 protein complex. Then, we demonstrated that TRIM25 knockdown resulted in p53 downstream activation for cell cycle inhibition and apoptosis induction in LNCaP and 22Rv1 cells. In contrast, overexpression of TRIM25 promoted prostate cancer cell proliferation and inhibited apoptosis by docetaxel treatment in LNCaP cells. We observed that p53 activity was reduced by mechanism of G3BP2-mediated nuclear export in TRIM25-overexpressing prostate cancer cells. We also found TRIM25 is important for G3BP2/RanBP2-mediated p53 modification. Clinically, we newly demonstrated that TRIM25 is a prognostic factor for prostate cancer patients. Expression of TRIM25 is significantly associated with cytoplasmic p53 expression and G3BP2. Moreover, TRIM25 knockdown results in reduced tumor growth and increased p53 activity in the mouse xenograft model of prostate cancer. Thus, our findings show that overexpression of TRIM25 promoted prostate cancer cell proliferation and cell survival by modulating p53 nuclear export mechanism with G3BP2 interaction.

  11. Crosstalk between mitochondrial stress signals regulates yeast chronological lifespan.

    PubMed

    Schroeder, Elizabeth A; Shadel, Gerald S

    2014-01-01

    Mitochondrial DNA (mtDNA) exists in multiple copies per cell and is essential for oxidative phosphorylation. Depleted or mutated mtDNA promotes numerous human diseases and may contribute to aging. Reduced TORC1 signaling in the budding yeast, Saccharomyces cerevisiae, extends chronological lifespan (CLS) in part by generating a mitochondrial ROS (mtROS) signal that epigenetically alters nuclear gene expression. To address the potential requirement for mtDNA maintenance in this response, we analyzed strains lacking the mitochondrial base-excision repair enzyme Ntg1p. Extension of CLS by mtROS signaling and reduced TORC1 activity, but not caloric restriction, was abrogated in ntg1Δ strains that exhibited mtDNA depletion without defects in respiration. The DNA damage response (DDR) kinase Rad53p, which transduces pro-longevity mtROS signals, is also activated in ntg1Δ strains. Restoring mtDNA copy number alleviated Rad53p activation and re-established CLS extension following mtROS signaling, indicating that Rad53p senses mtDNA depletion directly. Finally, DDR kinases regulate nucleus-mitochondria localization dynamics of Ntg1p. From these results, we conclude that the DDR pathway senses and may regulate Ntg1p-dependent mtDNA stability. Furthermore, Rad53p senses multiple mitochondrial stresses in a hierarchical manner to elicit specific physiological outcomes, exemplified by mtDNA depletion overriding the ability of Rad53p to transduce an adaptive mtROS longevity signal. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. Phosphorylation and gene expression of p53 are not affected in human cells exposed to 2.1425 GHz band CW or W-CDMA modulated radiation allocated to mobile radio base stations.

    PubMed

    Hirose, H; Sakuma, N; Kaji, N; Suhara, T; Sekijima, M; Nojima, T; Miyakoshi, J

    2006-09-01

    A large-scale in vitro study focusing on low-level radiofrequency (RF) fields from mobile radio base stations employing the International Mobile Telecommunication 2000 (IMT-2000) cellular system was conducted to test the hypothesis that modulated RF fields induce apoptosis or other cellular stress response that activate p53 or the p53-signaling pathway. First, we evaluated the response of human cells to microwave exposure at a specific absorption rate (SAR) of 80 mW/kg, which corresponds to the limit of the average whole-body SAR for general public exposure defined as a basic restriction by the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines. Second, we investigated whether continuous wave (CW) and wideband code division multiple access (W-CDMA) modulated signal RF fields at 2.1425 GHz induced apoptosis or any signs of stress. Human glioblastoma A172 cells were exposed to W-CDMA radiation at SARs of 80, 250, and 800 mW/kg, and CW radiation at 80 mW/kg for 24 or 48 h. Human IMR-90 fibroblasts from fetal lungs were exposed to both W-CDMA and CW radiation at a SAR of 80 mW/kg for 28 h. Under the RF field exposure conditions described above, no significant differences in the percentage of apoptotic cells were observed between the test groups exposed to RF signals and the sham-exposed negative controls, as evaluated by the Annexin V affinity assay. No significant differences in expression levels of phosphorylated p53 at serine 15 or total p53 were observed between the test groups and the negative controls by the bead-based multiplex assay. Moreover, microarray hybridization and real-time RT-PCR analysis showed no noticeable differences in gene expression of the subsequent downstream targets of p53 signaling involved in apoptosis between the test groups and the negative controls. Our results confirm that exposure to low-level RF signals up to 800 mW/kg does not induce p53-dependent apoptosis, DNA damage, or other stress response in human cells.

  13. Suppression of HPV E6 and E7 expression by BAF53 depletion in cervical cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Kiwon; Lee, Ah-Young; Kwon, Yunhee Kim

    Highlights: {yields} Integration of HPV into host genome critical for activation of E6 and E7 oncogenes. {yields} BAF53 is essential for higher-order chromatin structure. {yields} BAF53 knockdown suppresses E6 and E7 from HPV integrants, but not from episomal HPVs. {yields} BAF53 knockdown decreases H3K9Ac and H4K12Ac on P105 promoter of integrated HPV 18. {yields} BAF53 knockdown restores the p53-dependent signaling pathway in HeLa and SiHa cells. -- Abstract: Deregulation of the expression of human papillomavirus (HPV) oncogenes E6 and E7 plays a pivotal role in cervical carcinogenesis because the E6 and E7 proteins neutralize p53 and Rb tumor suppressor pathways,more » respectively. In approximately 90% of all cervical carcinomas, HPVs are found to be integrated into the host genome. Following integration, the core-enhancer element and P105 promoter that control expression of E6 and E7 adopt a chromatin structure that is different from that of episomal HPV, and this has been proposed to contribute to activation of E6 and E7 expression. However, the molecular basis underlying this chromatin structural change remains unknown. Previously, BAF53 has been shown to be essential for the integrity of higher-order chromatin structure and interchromosomal interactions. Here, we examined whether BAF53 is required for activated expression of E6 and E7 genes. We found that BAF53 knockdown led to suppression of expression of E6 and E7 genes from HPV integrants in cervical carcinoma cell lines HeLa and SiHa. Conversely, expression of transiently transfected HPV18-LCR-Luciferase was not suppressed by BAF53 knockdown. The level of the active histone marks H3K9Ac and H4K12Ac on the P105 promoter of integrated HPV 18 was decreased in BAF53 knockdown cells. BAF53 knockdown restored the p53-dependent signaling pathway in HeLa and SiHa cells. These results suggest that activated expression of the E6 and E7 genes of integrated HPV is dependent on BAF53-dependent higher-order chromatin structure or nuclear motor activity.« less

  14. Structure and stability insights into tumour suppressor p53 evolutionary related proteins.

    PubMed

    Pagano, Bruno; Jama, Abdullah; Martinez, Pierre; Akanho, Ester; Bui, Tam T T; Drake, Alex F; Fraternali, Franca; Nikolova, Penka V

    2013-01-01

    The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs) of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.

  15. p53 as Batman: using a movie plot to understand control of the cell cycle.

    PubMed

    Gadi, Nikhita; Foley, Sage E; Nowey, Mark; Plopper, George E

    2013-04-16

    This Teaching Resource provides and describes a two-part classroom exercise to help students understand control of the cell cycle, with a focus on the transcription factor p53, the E3 ubiquitin ligase Mdm2, the Mdm2 inhibitor ARF, the kinases ATM and ATR, the kinase Chk2, and the cell cycle inhibitor p21(Cip1). Students use characters and scenes from the movie The Dark Knight to represent elements of the cell cycle control machinery, then they apply these characters and scenes to translate a primary research article on p53 function into a new movie scene in the "Batman universe." This exercise is appropriate for college-level courses in cell biology and cancer biology and requires students to have a background in introductory cell biology. Explicit learning outcomes and associated assessment methods are provided, as well as slides, student assignments, the primary research article, and an instructor's guide for the exercise.

  16. Mutant human tumor suppressor p53 modulates the activation of mitogen-activated protein kinase and nuclear factor-kappaB, but not c-Jun N-terminal kinase and activated protein-1.

    PubMed

    Gulati, Anthony P; Yang, Yang-Ming; Harter, David; Mukhopadhyay, Asok; Aggarwal, Bharat B; Aggarwal, Bharat A; Benzil, Deborah L; Whysner, John; Albino, Anthony P; Murali, Raj; Jhanwar-Uniyal, Meena

    2006-01-01

    The roles of the mitogen-activated kinase protein (MAPK) pathway, nuclear factor-kappa B (NF-kappaB), and activator protein-1 (AP-1) in cellular responses to growth factors and mitogen are well established. However, the manner by which these proliferative pathways are affected by the tumor suppressor protein p53 is not fully understood. We report here the results of an investigation of the status of p53 on two human melanoma cell lines with wild-type p53 (SK-Mel-186) or mutant p53 (SK-Mel-110). The basal levels of the activated extracellular-signal regulated kinases 1 and 2 (ERK1/2) were high in cells with wild-type p53, but low in cells with mutant p53. The 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced activation of ERK1/2 through the phosphorylation of threonine and tyrosine at 202 and 204, respectively, was demonstrated in both cell lines, however, in a discrete manner. TPA-induced activation of ERK1/2 was sustained in wild-type p53 cells, while only a transient activation was seen in mutant p53 cells. Inhibition of MAPK kinase (MEK), an upstream kinase, by U0126, blocked TPA-induced activation of ERK1/2 in wild-type p53 cells and in mutant p53 cells. Treatment of wild-type p53 (SK-Mel 186) cells with small interfering RNA (siRNA) of p53 displayed a transient induction of activation of ERK1/2 following TPA treatment, indicating that p53 has a role in the regulation of the activation of ERK1/2. NF-kappaB activity decreased significantly in cells with wild-type p53, while enhanced NF-kappaB activity was evident in cells with mutant p53. The expression of either wild-type or mutant p53 had a similar effect on TPA-induced Jun N-terminal kinase (JNK) activation, indicating specificity for the ERK pathway. Similarly, AP-1 binding activity showed a transient variation in both cell lines after TPA treatment but with different kinetics. These observations suggest that both wild-type and mutant p53 can modulate the activation pathways for ERK1/2, and NF-kappaB distinctively, while modulating the pathways of JNK and AP-1 similarly. These differences may influence cellular processes such as proliferation, differentiation, and apoptosis. 2005 Wiley-Liss, Inc.

  17. A p53-dependent response limits the viability of mammalian haploid cells

    PubMed Central

    Olbrich, Teresa; Mayor-Ruiz, Cristina; Vega-Sendino, Maria; Gomez, Carmen; Ortega, Sagrario; Ruiz, Sergio; Fernandez-Capetillo, Oscar

    2017-01-01

    The recent development of haploid cell lines has facilitated forward genetic screenings in mammalian cells. These lines include near-haploid human cell lines isolated from a patient with chronic myelogenous leukemia (KBM7 and HAP1), as well as haploid embryonic stem cells derived from several organisms. In all cases, haploidy was shown to be an unstable state, so that cultures of mammalian haploid cells rapidly become enriched in diploids. Here we show that the observed diploidization is due to a proliferative disadvantage of haploid cells compared with diploid cells. Accordingly, single-cell–sorted haploid mammalian cells maintain the haploid state for prolonged periods, owing to the absence of competing diploids. Although the duration of interphase is similar in haploid and diploid cells, haploid cells spend longer in mitosis, indicative of problems in chromosome segregation. In agreement with this, a substantial proportion of the haploids die at or shortly after the last mitosis through activation of a p53-dependent cytotoxic response. Finally, we show that p53 deletion stabilizes haploidy in human HAP1 cells and haploid mouse embryonic stem cells. We propose that, similar to aneuploidy or tetraploidy, haploidy triggers a p53-dependent response that limits the fitness of mammalian cells. PMID:28808015

  18. Autophagy is induced through the ROS-TP53-DRAM1 pathway in response to mitochondrial protein synthesis inhibition.

    PubMed

    Xie, Xiaolei; Le, Li; Fan, Yanxin; Lv, Lin; Zhang, Junjie

    2012-07-01

    Mitoribosome in mammalian cells is responsible for synthesis of 13 mtDNA-encoded proteins, which are integral parts of four mitochondrial respiratory chain complexes (I, III, IV and V). ERAL1 is a nuclear-encoded GTPase important for the formation of the 28S small mitoribosomal subunit. Here, we demonstrate that knockdown of ERAL1 by RNA interference inhibits mitochondrial protein synthesis and promotes reactive oxygen species (ROS) generation, leading to autophagic vacuolization in HeLa cells. Cells that lack ERAL1 expression showed a significant conversion of LC3-I to LC3-II and an enhanced accumulation of autophagic vacuoles carrying the LC3 marker, all of which were blocked by the autophagy inhibitor 3-MA as well as by the ROS scavenger NAC. Inhibition of mitochondrial protein synthesis either by ERAL1 siRNA or chloramphenicol (CAP), a specific inhibitor of mitoribosomes, induced autophagy in HTC-116 TP53 (+/+) cells, but not in HTC-116 TP53 (-/-) cells, indicating that tumor protein 53 (TP53) is essential for the autophagy induction. The ROS elevation resulting from mitochondrial protein synthesis inhibition induced TP53 expression at transcriptional levels by enhancing TP53 promoter activity, and increased TP53 protein stability by suppressing TP53 ubiquitination through MAPK14/p38 MAPK-mediated TP53 phosphorylation. Upregulation of TP53 and its downstream target gene DRAM1, but not CDKN1A/p21, was required for the autophagy induction in ERAL1 siRNA or CAP-treated cells. Altogether, these data indicate that autophagy is induced through the ROS-TP53-DRAM1 pathway in response to mitochondrial protein synthesis inhibition.

  19. p53 Enables metabolic fitness and self-renewal of nephron progenitor cells.

    PubMed

    Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida

    2015-04-01

    Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre(+);p53(fl/fl)) induces progressive depletion of Cited1(+)/Six2(+) self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre(+);p53(fl/fl) cap has 30% fewer Six2(GFP(+)) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre(+);p53(fl/fl) cells in the S and G2/M phases compared with Six2Cre(+);p53(+/+) cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP(+)) CM cells revealed that the top downregulated genes in Six2Cre(+);p53(fl/fl) CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼ 50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. © 2015. Published by The Company of Biologists Ltd.

  20. Notch1 Signaling Sensitizes Tumor Necrosis Factor-related Apoptosis-inducing Ligand-induced Apoptosis in Human Hepatocellular Carcinoma Cells by Inhibiting Akt/Hdm2-mediated p53 Degradation and Up-regulating p53-dependent DR5 Expression*

    PubMed Central

    Wang, Chunmei; Qi, Runzi; Li, Nan; Wang, Zhengxin; An, Huazhang; Zhang, Qinghua; Yu, Yizhi; Cao, Xuetao

    2009-01-01

    Notch signaling plays a critical role in regulating cell proliferation, differentiation, and apoptosis. Our previous study showed that overexpression of Notch1 could inhibit human hepatocellular carcinoma (HCC) cell growth by arresting the cell cycle and inducing apoptosis. HCC cells are resistant to apoptotic induction by tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), so new therapeutic approaches have been explored to sensitize HCC cells to TRAIL-induced apoptosis. We are wondering whether and how Notch1 signaling can enhance the sensitivity of HCC cells to TRAIL-induced apoptosis. In this study, we found that overexpression of ICN, the constitutive activated form of Notch1, up-regulated p53 protein expression in HCC cells by inhibiting proteasome degradation. p53 up-regulation was further observed in human primary hepatocellular carcinoma cells after activation of Notch signaling. Inhibition of the Akt/Hdm2 pathway by Notch1 signaling was responsible for the suppression of p53 proteasomal degradation, thus contributing to the Notch1 signaling-mediated up-regulation of p53 expression. Accordingly, Notch1 signaling could make HCC cells more sensitive to TRAIL-induced apoptosis, whereas Notch1 signaling lost the synergistic promotion of TRAIL-induced apoptosis in p53-silenced HepG2 HCC cells and p53-defective Hep3B HCC cells. The data suggest that enhancement of TRAIL-induced apoptosis by Notch1 signaling is dependent upon p53 up-regulation. Furthermore, Notch1 signaling could enhance DR5 expression in a p53-dependent manner. Taken together, Notch1 signaling sensitizes TRAIL-induced apoptosis in HCC cells by inhibiting Akt/Hdm2-mediated p53 degradation and up-regulating p53-dependent DR5 expression. Thus, our results suggest that activation of Notch1 signaling may be a promising approach to improve the therapeutic efficacy of TRAIL-resistant HCC. PMID:19376776

  1. Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.

    PubMed

    Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J

    2014-06-01

    Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.

  2. The nucleolus as a fundamental regulator of the p53 response and a new target for cancer therapy.

    PubMed

    Woods, Simone J; Hannan, Katherine M; Pearson, Richard B; Hannan, Ross D

    2015-07-01

    Recent studies have highlighted the fundamental role that key oncogenes such as MYC, RAS and PI3K occupy in driving RNA Polymerase I transcription in the nucleolus. In addition to maintaining essential levels of protein synthesis, hyperactivated ribosome biogenesis and nucleolar function plays a central role in suppressing p53 activation in response to oncogenic stress. Consequently, disruption of ribosome biogenesis by agents such as the small molecule inhibitor of RNA Polymerase I transcription, CX-5461, has shown unexpected, potent, and selective effects in killing tumour cells via disruption of nucleolar function leading to activation of p53, independent of DNA damage. This review will explore the mechanism of DNA damage-independent activation of p53 via the nucleolar surveillance pathway and how this can be utilised to design novel cancer therapies. Non-genotoxic targeting of nucleolar function may provide a new paradigm for treatment of a broad range of oncogene-driven malignancies with improved therapeutic windows. This article is part of a Special Issue entitled: Translation and Cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Etoposide radiosensitizes p53-defective cholangiocarcinoma cell lines independent of their G2 checkpoint efficacies

    PubMed Central

    Hematulin, Arunee; Meethang, Sutiwan; Utapom, Kitsana; Wongkham, Sopit; Sagan, Daniel

    2018-01-01

    Radiotherapy has been accounted as the most comprehensive cancer treatment modality over the past few decades. However, failure of this treatment modality occurs in several malignancies due to the resistance of cancer cells to radiation. It was previously reported by the present authors that defective cell cycle checkpoints could be used as biomarkers for predicting the responsiveness to radiation in individual patients with cholangiocarcinoma (CCA). However, identification of functional defective cell cycle checkpoints from cells from a patient's tissues is cumbersome and not applicable in the clinic. The present study evaluated the radiosensitization potential of etoposide in p53-defective CCA KKU-M055 and KKU-M214 cell lines. Treatment with etoposide enhanced the responsiveness of two p53-defective CCA cell lines to radiation independent of G2 checkpoint function. In addition, etoposide treatment increased radiation-induced cell death without altering the dominant mode of cell death of the two cell lines. These findings indicate that etoposide could be used as a radiation sensitizer for p53-defective tumors, independent of the function of G2 checkpoint. PMID:29541168

  4. Fusaric Acid Induces DNA Damage and Post-Translational Modifications of p53 in Human Hepatocellular Carcinoma (HepG2 ) Cells.

    PubMed

    Ghazi, Terisha; Nagiah, Savania; Tiloke, Charlette; Sheik Abdul, Naeem; Chuturgoon, Anil A

    2017-11-01

    Fusaric acid (FA), a common fungal contaminant of maize, is known to mediate toxicity in plants and animals; however, its mechanism of action is unclear. p53 is a tumor suppressor protein that is activated in response to cellular stress. The function of p53 is regulated by post-translational modifications-ubiquitination, phosphorylation, and acetylation. This study investigated a possible mechanism of FA induced toxicity in the human hepatocellular carcinoma (HepG 2 ) cell line. The effect of FA on DNA integrity and post-translational modifications of p53 were investigated. Methods included: (a) culture and treatment of HepG 2 cells with FA (IC 50 : 580.32 μM, 24 h); (b) comet assay (DNA damage); (c) Western blots (protein expression of p53, MDM2, p-Ser-15-p53, a-K382-p53, a-CBP (K1535)/p300 (K1499), HDAC1 and p-Ser-47-Sirt1); and (d) Hoechst 33342 assay (apoptosis analysis). FA caused DNA damage in HepG 2 cells relative to the control (P < 0.0001). FA decreased the protein expression of p53 (0.24-fold, P = 0.0004) and increased the expression of p-Ser-15-p53 (12.74-fold, P = 0.0126) and a-K382-p53 (2.24-fold, P = 0.0096). This occurred despite the significant decrease in the histone acetyltransferase, a-CBP (K1535)/p300 (K1499) (0.42-fold, P = 0.0023) and increase in the histone deacetylase, p-Ser-47-Sirt1 (1.22-fold, P = 0.0020). The expression of MDM2, a negative regulator of p53, was elevated in the FA treatment compared to the control (1.83-fold, P < 0.0001). FA also inhibited cell proliferation and induced apoptosis in HepG 2 cells as evidenced by the Hoechst assay. Together, these results indicate that FA is genotoxic and post-translationally modified p53 leading to HepG 2 cell death. J. Cell. Biochem. 118: 3866-3874, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  5. Expression of p53 and Bcl-xL as predictive markers for larynx preservation in advanced laryngeal cancer

    PubMed Central

    Kumar, Bhavna; Cordell, Kitrina G.; D’Silva, Nisha; Prince, Mark E.; Adams, Meredith E.; Fisher, Susan G.; Wolf, Gregory T.; Carey, Thomas E.; Bradford, Carol R.

    2012-01-01

    Objective To assess tumor markers in advanced laryngeal cancer. Design Marker expression and clinical outcome. Setting Laboratory. Patients Pretreatment tumor biopsies were analyzed from patients enrolled in the Department of Veterans Affairs laryngeal cancer trial. Main Outcome Measures Expression of p53 and Bcl-xL in pretreatment biopsies was assessed for correlation with chemotherapy response, laryngeal preservation, and survival. Results Higher rates of larynx preservation were observed in patients whose tumors expressed p53 versus those that did not (73% versus 53%, p = 0.0304). Higher rates of larynx preservation were also observed in patients whose tumors expressed low levels of Bcl-xL versus those that expressed high levels (90% versus 60%, p = 0.02). Patients were then categorized into 3 risk groups (low, intermediate and high risk) based on their tumor p53 and Bcl-xL expression status. We observed that patients whose tumors had the high risk biomarker profile (low p53 and high Bcl-xL) were less likely to preserve their larynx than patients whose tumors had the intermediate risk (high p53 and low or high Bcl-xL) or low risk (low p53 and low Bcl-xL) biomarker profile. The larynx preservation rates were 100%, 76% and 54% for the low, intermediate and high risk groups respectively (Fisher exact 0.039). Conclusions Tumor expression of p53 and Bcl-xL is a strong predictor of successful organ preservation in patients treated with induction chemotherapy followed by radiation in responding tumors. PMID:18427001

  6. Mycobacterium bovis BCG promotes tumor cell survival from tumor necrosis factor-α-induced apoptosis.

    PubMed

    Holla, Sahana; Ghorpade, Devram Sampat; Singh, Vikas; Bansal, Kushagra; Balaji, Kithiganahalli Narayanaswamy

    2014-09-11

    Increased incidence of lung cancer among pulmonary tuberculosis patients suggests mycobacteria-induced tumorigenic response in the host. The alveolar epithelial cells, candidate cells that form lung adenocarcinoma, constitute a niche for mycobacterial replication and infection. We thus explored the possible mechanism of M. bovis Bacillus Calmette-Guérin (BCG)-assisted tumorigenicity in type II epithelial cells, human lung adenocarcinoma A549 and other cancer cells. Cancer cell lines originating from lung, colon, bladder, liver, breast, skin and cervix were treated with tumor necrosis factor (TNF)-α in presence or absence of BCG infection. p53, COP1 and sonic hedgehog (SHH) signaling markers were determined by immunoblotting and luciferase assays, and quantitative real time PCR was done for p53-responsive pro-apoptotic genes and SHH signaling markers. MTT assays and Annexin V staining were utilized to study apoptosis. Gain- and loss-of-function approaches were used to investigate the role for SHH and COP1 signaling during apoptosis. A549 xenografted mice were used to validate the contribution of BCG during TNF-α treatment. Here, we show that BCG inhibits TNF-α-mediated apoptosis in A549 cells via downregulation of p53 expression. Substantiating this observation, BCG rescued A549 xenografts from TNF-α-mediated tumor clearance in nude mice. Furthermore, activation of SHH signaling by BCG induced the expression of an E3 ubiquitin ligase, COP1. SHH-driven COP1 targeted p53, thereby facilitating downregulation of p53-responsive pro-apoptotic genes and inhibition of apoptosis. Similar effects of BCG could be shown for HCT116, T24, MNT-1, HepG2 and HELA cells but not for HCT116 p53(-/-) and MDA-MB-231 cells. Our results not only highlight possible explanations for the coexistence of pulmonary tuberculosis and lung cancer but also address probable reasons for failure of BCG immunotherapy of cancers.

  7. Astrocytes Can Adopt Endothelial Cell Fates in a p53-Dependent Manner.

    PubMed

    Brumm, Andrew J; Nunez, Stefanie; Doroudchi, Mehdi M; Kawaguchi, Riki; Duan, Jinhzu; Pellegrini, Matteo; Lam, Larry; Carmichael, S Thomas; Deb, Arjun; Hinman, Jason D

    2017-08-01

    Astrocytes respond to a variety of CNS injuries by cellular enlargement, process outgrowth, and upregulation of extracellular matrix proteins that function to prevent expansion of the injured region. This astrocytic response, though critical to the acute injury response, results in the formation of a glial scar that inhibits neural repair. Scar-forming cells (fibroblasts) in the heart can undergo mesenchymal-endothelial transition into endothelial cell fates following cardiac injury in a process dependent on p53 that can be modulated to augment cardiac repair. Here, we sought to determine whether astrocytes, as the primary scar-forming cell of the CNS, are able to undergo a similar cellular phenotypic transition and adopt endothelial cell fates. Serum deprivation of differentiated astrocytes resulted in a change in cellular morphology and upregulation of endothelial cell marker genes. In a tube formation assay, serum-deprived astrocytes showed a substantial increase in vessel-like morphology that was comparable to human umbilical vein endothelial cells and dependent on p53. RNA sequencing of serum-deprived astrocytes demonstrated an expression profile that mimicked an endothelial rather than astrocyte transcriptome and identified p53 and angiogenic pathways as specifically upregulated. Inhibition of p53 with genetic or pharmacologic strategies inhibited astrocyte-endothelial transition. Astrocyte-endothelial cell transition could also be modulated by miR-194, a microRNA downstream of p53 that affects expression of genes regulating angiogenesis. Together, these studies demonstrate that differentiated astrocytes retain a stimulus-dependent mechanism for cellular transition into an endothelial phenotype that may modulate formation of the glial scar and promote injury-induced angiogenesis.

  8. The interactions of p53 with tau and Aß as potential therapeutic targets for Alzheimer's disease.

    PubMed

    Jazvinšćak Jembrek, Maja; Slade, Neda; Hof, Patrick R; Šimić, Goran

    2018-05-04

    Alzheimer's disease (AD), the most common progressive neurodegenerative disorder, is characterized by severe cognitive decline and personality changes as a result of synaptic and neuronal loss. The defining clinicopathological hallmarks of the disease are deposits of amyloid precursor protein (APP)-derived amyloid-β peptides (Aβ) in the brain parenchyma, and intracellular aggregates of truncated and hyperphosphorylated tau protein in neurofibrillary tangles (NFT). At the cellular and molecular levels, many intertwined pathological mechanisms that relate Aβ and tau pathology with a transcription factor p53 have been revealed. p53 is activated in response to various stressors that threaten genomic stability. Depending on damage severity, it promotes neuronal death or survival, predominantly via transcription-dependent mechanisms that affect expression of apoptosis-related target genes. Levels of p53 are enhanced in the AD brain and maintain sustained tau hyperphosphorylation, whereas intracellular Aβ directly contributes to p53 pool and promotes downstream p53 effects. The review summarizes the role of p53 in neuronal function, discusses the interactions of p53, tau, and Aβ in the normal brain and during the progression of AD pathology, and considers the impact of the most prominent hereditary risk factors of AD on p53/tau/Aβ interactions. A better understanding of this intricate interplay would provide deeper insight into AD pathology and might offer some novel therapeutic targets for the improvement of treatment options. In this regard, drugs and natural compounds targeting the p53 pathway are of growing interest in neuroprotection as they may represent promising therapeutic approaches in the prevention of oxidative stress-dependent pathological processes underlying AD. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. p53 Is a Host Cell Regulator during Herpes Simplex Encephalitis.

    PubMed

    Maruzuru, Yuhei; Koyanagi, Naoto; Takemura, Naoki; Uematsu, Satoshi; Matsubara, Daisuke; Suzuki, Yutaka; Arii, Jun; Kato, Akihisa; Kawaguchi, Yasushi

    2016-08-01

    p53 is a critical host cell factor in the cellular response to a broad range of stress factors. We recently reported that p53 is required for efficient herpes simplex virus 1 (HSV-1) replication in cell culture. However, a defined role for p53 in HSV-1 replication and pathogenesis in vivo remains elusive. In this study, we examined the effects of p53 on HSV-1 infection in vivo using p53-deficient mice. Following intracranial inoculation, p53 knockout reduced viral replication in the brains of mice and led to significantly reduced rates of mortality due to herpes simplex encephalitis. These results suggest that p53 is an important host cell regulator of HSV-1 replication and pathogenesis in the central nervous system (CNS). HSV-1 causes sporadic cases of encephalitis, which, even with antiviral therapy, can result in severe neurological defects and even death. Many host cell factors involved in the regulation of CNS HSV-1 infection have been investigated using genetically modified mice. However, most of these factors are immunological regulators and act via immunological pathways in order to restrict CNS HSV-1 infection. They therefore provide limited information on intrinsic host cell regulators that may be involved in the facilitation of CNS HSV-1 infection. Here we demonstrate that a host cell protein, p53, which has generally been considered a host cell restriction factor for various viral infections, is required for efficient HSV-1 replication and pathogenesis in the CNS of mice. This is the first report showing that p53 positively regulates viral replication and pathogenesis in vivo and provides insights into its molecular mechanism, which may suggest novel clinical treatment options for herpes simplex encephalitis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    PubMed Central

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Wilhelm Doerr, H; Rödel, F; Speidel, D; Cinatl, J

    2012-01-01

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3rRITA10 μM to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells. PMID:22476102

  11. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    PubMed

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  12. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    PubMed

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  13. In Vitro Cytotoxicity and Adaptive Stress Responses to Selected Haloacetic Acid and Halobenzoquinone Water Disinfection Byproducts.

    PubMed

    Procházka, Erik; Escher, Beate I; Plewa, Michael J; Leusch, Frederic D L

    2015-10-19

    The process of disinfecting drinking water inadvertently leads to the formation of numerous disinfection byproducts (DBPs). Some of these are mutagenic, genotoxic, teratogenic, and cytotoxic, as well as potentially carcinogenic both in vivo and in vitro. We investigated the in vitro biological activity of five DBPs: three monohaloacetic acids (monoHAAs) [chloroacetic acid (CAA), bromoacetic acid (BAA), and iodoacetic acid (IAA)] and two novel halobenzoquinones (HBQs) [2,6-dichloro-p-benzoquinone (DCBQ) and 2,6-dibromo-p-benzoquinone]. We focused particularly on cytotoxicity and induction of two adaptive stress response pathways: the oxidative stress responsive Nrf2/ARE and DNA-damage responsive p53 pathways. All five DBPs were cytotoxic to the Caco-2 cell line after a 4 h exposure, and all DBPs induced both of the adaptive stress response pathways, Nrf2/ARE and p53, in the micromolar range, as measured by two β-lactamase-based reporter gene assays. The decreasing order of potency for all three endpoints for the five DBPs was IAA ∼ BAA > DCBQ ∼ DBBQ > CAA. Induction of oxidative stress was previously proposed to be the molecular initiating event (MIE) for both classes of DBPs. However, comparing the levels of activation of the two pathways uncovered that the Nrf2/ARE pathway was the more sensitive endpoint for HAAs, whereas the p53 pathway was more sensitive in the case of HBQs. Therefore, the DNA damage-responsive p53 pathway may be an important piece of information to fill in a gap in the adverse outcome pathway framework for the assessment of HBQs. Finally, we cautiously compared the potential risk of the two novel HBQs using a benchmarking approach to that of the well-studied CAA, which suggested that their relative risk may be lower than that of BAA and IAA.

  14. CITED2 silencing sensitizes cancer cells to cisplatin by inhibiting p53 trans-activation and chromatin relaxation on the ERCC1 DNA repair gene

    PubMed Central

    Liu, Yu-Chin; Chang, Pu-Yuan; Chao, Chuck C.-K.

    2015-01-01

    In this study, we show that silencing of CITED2 using small-hairpin RNA (shCITED2) induced DNA damage and reduction of ERCC1 gene expression in HEK293, HeLa and H1299 cells, even in the absence of cisplatin. In contrast, ectopic expression of ERCC1 significantly reduced intrinsic and induced DNA damage levels, and rescued the effects of CITED2 silencing on cell viability. The effects of CITED2 silencing on DNA repair and cell death were associated with p53 activity. Furthermore, CITED2 silencing caused severe elimination of the p300 protein and markers of relaxed chromatin (acetylated H3 and H4, i.e. H3K9Ac and H3K14Ac) in HEK293 cells. Chromatin immunoprecipitation assays further revealed that DNA damage induced binding of p53 along with H3K9Ac or H3K14Ac at the ERCC1 promoter, an effect which was almost entirely abrogated by silencing of CITED2 or p300. Moreover, lentivirus-based CITED2 silencing sensitized HeLa cell line-derived tumor xenografts to cisplatin in immune-deficient mice. These results demonstrate that CITED2/p300 can be recruited by p53 at the promoter of the repair gene ERCC1 in response to cisplatin-induced DNA damage. The CITED2/p300/p53/ERCC1 pathway is thus involved in the cell response to cisplatin and represents a potential target for cancer therapy. PMID:26384430

  15. Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.

    PubMed

    Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald

    2017-06-01

    p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p < 0.001). The p53 and Bcl-2 immunoreactivity was increased in aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.

  16. p53/CEP-1 Increases or Decreases Lifespan, Depending on Level of Mitochondrial Bioenergetic Stress

    PubMed Central

    Ventura, Natascia; Rea, Shane L.; Schiavi, Alfonso; Torgovnick, Alessandro; Testi, Roberto; Johnson, Thomas E.

    2009-01-01

    SUMMARY Mitochondrial pathologies underlie a number of life-shortening diseases in humans. In the nematode Caenorhabditis elegans, severely reduced expression of mitochondrial proteins involved in electron transport chain-mediated energy production also leads to pathological phenotypes, including arrested development and/or shorter life; in sharp contrast, mild suppression of these same proteins extends lifespan. Here we show that the C. elegans p53 ortholog cep-1 mediates these opposite effects. We find that cep-1 is required to extend longevity in response to mild suppression of several bioenergetically relevant mitochondrial proteins, including frataxin - the protein defective in patients with Friedreich’s Ataxia. Importantly we show that cep-1 also mediates both the developmental arrest and life shortening induced by severe mitochondrial stress. Our findings support an evolutionarily conserved function for p53 in modulating organismal responses to mitochondrial dysfunction and suggest that metabolic checkpoint responses may play a role in longevity control and in human mitochondrial-associated diseases. PMID:19416129

  17. Mutant p53 dictates the oncogenic activity of c-Abl in triple-negative breast cancers

    PubMed Central

    Morrison, Chevaun D; Chang, Jenny C; Keri, Ruth A; Schiemann, William P

    2017-01-01

    We recently established c-Abl as a potent suppressor of triple-negative breast cancer (TNBC) progression through its reactivation of a p53:p21 signaling axis coupled to senescence. Moreover, we observed co-expression of p53 and c-Abl to be essential for normal mammary epithelial cell physiology, as this relationship is lost upon breast cancer progression. Cytoplasmic c-Abl activity is markedly increased in some TNBCs and contributes to disease progression; however, the mechanisms underlying these events remain largely unknown. In addressing this question, we show here that c-Abl is predominantly restricted to the cytoplasm of human MDA-MB-231 TNBC cells, and to the nucleus of human MCF-7 luminal A cells. TTK is a mitotic protein kinase that phosphorylates c-Abl on Thr735, thereby creating a recognition binding motif for 14-3-3 adaptor proteins in response to oxidative stress. By interrogating the METABRIC database, we observed a significant correlation between p53 expression and that of c-Abl and TTK in basal-like breast cancers. Moreover, heterologous expression of TTK in MCF-7 cells significantly stimulated their growth in part via a c-Abl-dependent mechanism. Conversely, depleting TTK expression in MDA-MB-231 cells not only inhibited their organoid growth in 3D-cultures, but also sensitized them to the tumor suppressing activities of c-Abl independent of its subcellular localization. Moreover, we show that mutant p53 forms cytoplasmic complexes with c-Abl, thereby dictating the subcellular localization of c-Abl and the sensitivity of MDA-MB-231 cells to Imatinib. In response to nutrient deprivation, c-Abl:p53 complexes readily accumulate in the nucleus, resulting in the hyperactivation of c-Abl and initiation of its anti-tumor activities. Collectively, we identified a novel mutant p53:c-Abl cytoplasmic signaling complex that promotes MDA-MB-231 cell growth and highlights the contextual cues that confer oncogenic activity to c-Abl in breast cancer. PMID:28661474

  18. Uterine Carcinosarcomas: Clinical, Histopathologic and Immunohistochemical Characteristics.

    PubMed

    Chen, Xiaowei; Arend, Rebecca; Hamele-Bena, Diane; Tergas, Ana I; Hawver, Melanie; Tong, Guo-Xia; Wright, Thomas C; Wright, Jason D

    2017-09-01

    Carcinosarcomas (malignant mixed Müllerian tumors or MMMT) are rare malignant tumors in the female genital tract composed of both malignant epithelial and malignant mesenchymal components. They comprise <5% of all neoplasms in the gynecologic tract and have an aggressive clinical course. The purpose of this study is to evaluate the immunophenotype and possible histogenesis of carcinosarcomas of the uterus. Sixty-two cases of uterine carcinosarcomas diagnosed between 1995 and 2011 were retrieved from the gynecologic pathology files at Columbia University Medical Center. Representative tissue blocks containing both epithelial and mesenchymal components were selected from each case for histologic and immunohistochemical studies. Clinical data from each case were retrieved. The epithelial component was poorly differentiated adenocarcinoma in the majority (80.7%) of cases; in 17.7%, the carcinoma was moderately differentiated, and in only 1.6% the carcinoma was well differentiated. 53% of the tumors had homologous stromal elements and 47% displayed heterologous stromal elements. Immunohistochemical study revealed almost equal staining in both epithelial and mesenchymal components of carcinosarcomas for p16 and p53. PAX8 positivity was noted in 73% of epithelial components, but only 13% of stromal components, and PAX8 stromal positivity was never seen in the absence of PAX8 epithelial positivity. Expression of p16, p53, and PAX8 in both malignant components lends support to the monoclonal theory of uterine carcinosarcoma tumorigenesis. The roles of these tumor markers in the diagnosis and pathogenesis of this tumor and associations between clinical characteristics, tumor pathologic features, and prognosis are discussed.

  19. Concordant p53 and mdm-2 protein expression in vulvar squamous cell carcinoma and adjacent lichen sclerosus.

    PubMed

    Carlson, J A; Amin, S; Malfetano, J; Tien, A T; Selkin, B; Hou, J; Goncharuk, V; Wilson, V L; Rohwedder, A; Ambros, R; Ross, J S

    2001-06-01

    To determine if carcinogenic events in vulvar skin precede the onset of morphologic atypia, the authors investigated for derangements in DNA content, cell proliferation, and cell death in vulvar carcinomas and surrounding skin in 140 samples of tumor and surrounding skin collected from 35 consecutive vulvectomy specimen for squamous cell carcinoma (SCC) or vulvar intraepithelial neoplasia (VIN) 3. Vulvar non-cancer excisions were used as controls. Investigations consisted of histologic classification and measurement of 9 variables--epidermal thickness (acanthosis and rete ridge length), immunolabeling index (LI) for 3 proteins (p53 protein, Ki-67, and mdm-2), pattern of p53 expression (dispersed vs. compact), DNA content index, and presence of aneuploidy by image analysis and apoptotic rate by Apotag labeling. Significant positive correlations were found for all nine variables studied versus increasing histologic severity in two proposed histologic stepwise models of vulvar carcinogenesis (lichen sclerosus (LS) and VIN 3 undifferentiated associated SCC groups). High p53 LI (>25) and the compact pattern of p53 expression (suspected oncoprotein) significantly correlated with LS and its associated vulvar samples compared with samples not associated with LS (P < or = 0.001). Furthermore, p53 LI, mdm-2 LI, and pattern of p53 expression were concordant between patient matched samples of LS and SCC. In addition, mdm-2 LI significantly correlated with dispersed pattern p53 LI suggesting a response to wild-type p53 protein accumulation. These findings support the hypothesis that neoplastic transformation occurs in sequential steps and compromises proteins involved in the cell cycle control. Concordance of p53 and mdm-2 protein expression in LS and adjacent SCC provides evidence that LS can act as a precursor lesion in the absence of morphologic atypia. Overexpression of mdm-2 with stabilization and inactivation of p53 protein may provide an alternate pathway for vulvar carcinogenesis.

  20. Systems biology approach identifies the kinase Csnk1a1 as a regulator of the DNA damage response in embryonic stem cells.

    PubMed

    Carreras Puigvert, Jordi; von Stechow, Louise; Siddappa, Ramakrishnaiah; Pines, Alex; Bahjat, Mahnoush; Haazen, Lizette C J M; Olsen, Jesper V; Vrieling, Harry; Meerman, John H N; Mullenders, Leon H F; van de Water, Bob; Danen, Erik H J

    2013-01-22

    In pluripotent stem cells, DNA damage triggers loss of pluripotency and apoptosis as a safeguard to exclude damaged DNA from the lineage. An intricate DNA damage response (DDR) signaling network ensures that the response is proportional to the severity of the damage. We combined an RNA interference screen targeting all kinases, phosphatases, and transcription factors with global transcriptomics and phosphoproteomics to map the DDR in mouse embryonic stem cells treated with the DNA cross-linker cisplatin. Networks derived from canonical pathways shared in all three data sets were implicated in DNA damage repair, cell cycle and survival, and differentiation. Experimental probing of these networks identified a mode of DNA damage-induced Wnt signaling that limited apoptosis. Silencing or deleting the p53 gene demonstrated that genotoxic stress elicited Wnt signaling in a p53-independent manner. Instead, this response occurred through reduced abundance of Csnk1a1 (CK1α), a kinase that inhibits β-catenin. Together, our findings reveal a balance between p53-mediated elimination of stem cells (through loss of pluripotency and apoptosis) and Wnt signaling that attenuates this response to tune the outcome of the DDR.

  1. Relative biological effectiveness of light ions in human tumoural cell lines: role of protein p53

    NASA Technical Reports Server (NTRS)

    Baggio, L.; Cavinato, M.; Cherubini, R.; Conzato, M.; Cucinotta, F.; Favaretto, S.; Gerardi, S.; Lora, S.; Stoppa, P.; Williams, J. R.

    2002-01-01

    Protons and alpha particles of high linear energy transfer (LET) have shown an increased relative biological effectiveness (RBE) with respect to X/gamma rays for several cellular and molecular endpoints in different in vitro cell systems. To contribute to understanding the biochemical mechanisms involved in the increased effectiveness of high LET radiation, an extensive study has been designed. The present work reports the preliminary result of this study on two human tumoural cell lines, DLD1 and HCT116, (with different p53 status), which indicate that for these cell lines, p53 does not appear to take a part in the response to radiation induced DNA damage, suggesting an alternative p53-independent pathway and a cell biochemical mechanism dependent on the cell type.

  2. HPV positive, wild type TP53, and p16 overexpression correlate with the absence of residual tumors after chemoradiotherapy in anal squamous cell carcinoma.

    PubMed

    Soares, Paulo C; Abdelhay, Eliana S; Thuler, Luiz Claudio S; Soares, Bruno Moreira; Demachki, Samia; Ferro, Gessica Valéria Rocha; Assumpção, Paulo P; Lamarão, Leticia Martins; Ribeiro Pinto, Luis Felipe; Burbano, Rommel Mario Rodríguez

    2018-02-21

    Anal residual tumors are consensually identified within six months of chemoradiotherapy and represent a persistent lesion that may have prognostic value for overall survival. The aim of this study was to evaluate the association of HPV and HIV status, p16 expression level and TP53 mutations with the absence of residual tumors (local response) in Squamous Cell Carcinoma (SCC) of the anal canal after chemoradiotherapy. We performed a study on 78 patients with SCC of the anal canal who submitted to chemoradiotherapy and were followed for a six-month period to identify the absence or presence of residual tumors. HPV DNA was identified by polymerase chain reaction and direct sequencing, HIV RNA was detected by TaqMan amplification, p16 expression was detected by western blotting, and the mutational analysis of TP53 was performed by direct sequencing; additionally, samples carrying mutations underwent fluorescent in sit hybridization. The evaluation of the tumor response to treatment was conducted six months after the conclusion of chemoradiotherapy. The following classifications were used to evaluate the outcomes: a) no response (presence of residual tumor) and b) complete response (absence of residual tumor). The significant variables associated with the absence of residual tumors were HPV positive, p16 overexpressed, wild-type TP53, female gender, and stages I and II. Only the presence of HPV was independently correlated with the clinical response; this variable increased the chances of a response within six months by 31-fold. The presence of HPV in tumor cells was correlated with the absence of a residual tumor. This correlation is valuable and can direct future therapeutic approaches in the anal canal.

  3. Ser46 phosphorylation and prolyl-isomerase Pin1-mediated isomerization of p53 are key events in p53-dependent apoptosis induced by mutant huntingtin.

    PubMed

    Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino

    2011-11-01

    Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.

  4. Ser46 phosphorylation and prolyl-isomerase Pin1-mediated isomerization of p53 are key events in p53-dependent apoptosis induced by mutant huntingtin

    PubMed Central

    Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino

    2011-01-01

    Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment. PMID:22011578

  5. Classification of TP53 Mutations and HPV Predict Survival in Advanced Larynx Cancer

    PubMed Central

    Scheel, Adam; Bellile, Emily; McHugh, Jonathan B.; Walline, Heather M.; Prince, Mark E.; Urba, Susan; Wolf, Gregory T.; Eisbruch, Avraham; Worden, Francis; Carey, Thomas E.; Bradford, Carol

    2016-01-01

    OBJECTIVE Assess TP53 functional mutations in the context of other biomarkers in advanced larynx cancer. STUDY DESIGN Prospective analysis of pretreatment tumor TP53, HPV, Bcl-xL and cyclin D1 status in stage III and IV larynx cancer patients in a clinical trial. METHODS TP53 exons 4-9 from 58 tumors were sequenced. Mutations were grouped using three classifications based on their expected function. Each functional group was analyzed for response to induction chemotherapy, time to surgery, survival, HPV status, p16INK4a, Bcl-xl and cyclin D1 expression. RESULTS TP53 Mutations were found in 22/58 (37.9%) patients with advanced larynx cancer, including missense mutations in 13/58 (22.4%) patients, nonsense mutations in 4/58 (6.9%), and deletions in 5/58 (8.6%). High risk HPV was found in 20/52 (38.5%) tumors. A classification based on crystal Evolutionary Action score of p53 (EAp53) distinguished missense mutations with high risk for decreased survival from low risk mutations (p=0.0315). A model including this TP53 classification, HPV status, cyclin D1 and Bcl-xL staining significantly predicts survival (p=0.0017). CONCLUSION EAp53 functional classification of TP53 mutants and biomarkers predict survival in advanced larynx cancer. PMID:27345657

  6. Investigating DNA Binding and Conformational Variation in Temperature Sensitive p53 Cancer Mutants Using QM-MM Simulations

    PubMed Central

    Koulgi, Shruti; Achalere, Archana; Sonavane, Uddhavesh; Joshi, Rajendra

    2015-01-01

    The tp53 gene is found to be mutated in 50% of all the cancers. The p53 protein, a product of tp53 gene, is a multi-domain protein. It consists of a core DNA binding domain (DBD) which is responsible for its binding and transcription of downstream target genes. The mutations in p53 protein are responsible for creating cancerous conditions and are found to be occurring at a high frequency in the DBD region of p53. Some of these mutations are also known to be temperature sensitive (ts) in nature. They are known to exhibit partial or strong binding with DNA in the temperature range (298–306 K). Whereas, at 310 K and above they show complete loss in binding. We have analyzed the changes in binding and conformational behavior at 300 K and 310 K for three of the ts-mutants viz., V143A, R249S and R175H. QM-MM simulations have been performed on the wild type and the above mentioned ts-mutants for 30 ns each. The optimal estimate of free energy of binding for a particular number of interface hydrogen bonds was calculated using the maximum likelihood method as described by Chodera et. al (2007). This parameter has been observed to be able to mimic the binding affinity of the p53 ts-mutants at 300 K and 310 K. Thus the correlation between MM-GBSA free energy of binding and hydrogen bonds formed by the interface residues between p53 and DNA has revealed the temperature dependent nature of these mutants. The role of main chain dihedrals was obtained by performing dihedral principal component analysis (PCA). This analysis, suggests that the conformational variations in the main chain dihedrals (ϕ and ψ) of the p53 ts-mutants may have caused reduction in the overall stability of the protein. The solvent exposure of the side chains of the interface residues were found to hamper the binding of the p53 to the DNA. Solvent Accessible Surface Area (SASA) also proved to be a crucial property in distinguishing the conformers obtained at 300 K and 310 K for the three ts-mutants from the wild type at 300 K. PMID:26579714

  7. Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53

    PubMed Central

    York, D.; Withers, S. S.; Watson, K. D.; Seo, K. W.; Rebhun, R. B.

    2016-01-01

    Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. PMID:27333821

  8. Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53.

    PubMed

    York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B

    2017-09-01

    Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.

  9. p53 Regulates insulin-like growth factor-I receptor gene expression in uterine serous carcinoma and predicts responsiveness to an insulin-like growth factor-I receptor-directed targeted therapy.

    PubMed

    Attias-Geva, Zohar; Bentov, Itay; Kidron, Dvora; Amichay, Keren; Sarfstein, Rive; Fishman, Ami; Bruchim, Ilan; Werner, Haim

    2012-07-01

    The role of the insulin-like growth factors (IGF) in endometrial cancer has been well established. The IGF-I receptor (IGF-IR), which mediates the biological actions of IGF-I, is usually overexpressed in endometrial tumours. Uterine serous carcinoma (USC) constitutes a defined histological category among endometrial cancers. Mutation of the p53 gene appears early in the course of the disease and is considered a key event in the initiation of USC. The aim of the present study was to evaluate the potential interactions between p53 and the IGF-IR in USC. In addition, we investigated the role of p53 as a biomarker in IGF-IR targeted therapies. Immunohistochemical analysis in a collection of 35 USC specimens revealed that IGF-IR is highly expressed in primary and metastatic USC. Likewise, p53 was expressed in 85.7% of primary tumours and 100% of metastases. A significant negative correlation between p53 expression and survival was noticed. In addition, using USC-derived cell lines we provide evidence that p53 regulates IGF-IR gene expression via a mechanism that involves repression of the IGF-IR promoter. We show that the mechanism of action of p53 involves interaction with zinc finger protein Sp1, a potent transactivator of the IGF-IR gene. Finally, we demonstrate that USC tumours overexpressing p53 are more likely to benefit from anti-IGF-IR therapies. In summary, we provide evidence that p53 regulates IGF-IR gene expression in USC cells via a mechanism that involves repression of the IGF-IR promoter. The interplay between the p53 and IGF-I signalling pathways is of major basic and translational relevance. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. RITA inhibits multiple myeloma cell growth through induction of p53-mediated caspase-dependent apoptosis and synergistically enhances nutlin-induced cytotoxic responses.

    PubMed

    Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong

    2010-11-01

    Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.

  11. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    PubMed Central

    2011-01-01

    Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG) that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses. PMID:21349196

  12. Classification of TP53 mutations and HPV predict survival in advanced larynx cancer.

    PubMed

    Scheel, Adam; Bellile, Emily; McHugh, Jonathan B; Walline, Heather M; Prince, Mark E; Urba, Susan; Wolf, Gregory T; Eisbruch, Avraham; Worden, Francis; Carey, Thomas E; Bradford, Carol

    2016-09-01

    Assess tumor suppressor p53 (TP53) functional mutations in the context of other biomarkers in advanced larynx cancer. Prospective analysis of pretreatment tumor TP53, human papillomavirus (HPV), Bcl-xL, and cyclin D1 status in stage III and IV larynx cancer patients in a clinical trial. TP53 exons 4 through 9 from 58 tumors were sequenced. Mutations were grouped using three classifications based on their expected function. Each functional group was analyzed for response to induction chemotherapy, time to surgery, survival, HPV status, p16INK4a, Bcl-xl, and cyclin D1 expression. TP53 mutations were found in 22 of 58 (37.9%) patients with advanced larynx cancer, including missense mutations in 13 of 58 (22.4%) patients, nonsense mutations in four of 58 (6.9%), and deletions in five of 58 (8.6%). High-risk HPV was found in 20 of 52 (38.5%) tumors. A classification based on Evolutionary Action score of p53 (EAp53) distinguished missense mutations with high risk for decreased survival from low-risk mutations (P = 0.0315). A model including this TP53 classification, HPV status, cyclin D1, and Bcl-xL staining significantly predicts survival (P = 0.0017). EAp53 functional classification of TP53 mutants and biomarkers predict survival in advanced larynx cancer. NA. Laryngoscope, 126:E292-E299, 2016. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

  13. P53 Protein Expression in Dental Follicle, Dentigerous Cyst, Odontogenic Keratocyst, and Inflammatory Subtypes of Cysts: An Immunohistochemical Study

    PubMed Central

    Fatemeh, Mashhadiabbas; Sepideh, Arab; Sara, Bagheri Seyedeh; Nazanin, Mahdavi

    2017-01-01

    Objectives An odontogenic keratocyst (OKC) is a developmental odontogenic cyst with aggressive clinical behavior. This cyst shows a different growth mechanism from the more common dentigerous cyst and now has been renamed as a keratocystic odontogenic tumor (KCOT). Inflammation can assist tumor growth via different mechanisms including dysregulation of the p53 gene. This study aims to assess and compare the expression of tumor suppressor gene p53 in inflamed and non-inflamed types of OKC and dentigerous cyst. Methods Immunohistochemical expression of p53 was assessed in 14 cases of dental follicle, 34 cases of OKC (including 18 inflamed OKCs), and 31 cases of dentigerous cyst (including 16 inflamed cysts). Results The mean percentage of p53 positive cells was 0.7% in dental follicles, 5.4% in non-inflamed OKCs, 17.3% in inflamed OKCs, 1.2% in non-inflamed dentigerous cysts, and 2.2% in inflamed dentigerous cysts. The differences between the groups were statistically significant (p < 0.050) except for the difference between inflamed and non-inflamed dentigerous cysts, and between dental follicle and non-inflamed dentigerous cyst. Conclusions The difference in p53 expression in OKC and dentigerous cyst can explain their different growth mechanism and clinical behavior. Inflammation is responsible for the change in behavior of neoplastic epithelium of OKC via p53 overexpression. PMID:28584604

  14. P53 Protein Expression in Dental Follicle, Dentigerous Cyst, Odontogenic Keratocyst, and Inflammatory Subtypes of Cysts: An Immunohistochemical Study.

    PubMed

    Fatemeh, Mashhadiabbas; Sepideh, Arab; Sara, Bagheri Seyedeh; Nazanin, Mahdavi

    2017-05-01

    An odontogenic keratocyst (OKC) is a developmental odontogenic cyst with aggressive clinical behavior. This cyst shows a different growth mechanism from the more common dentigerous cyst and now has been renamed as a keratocystic odontogenic tumor (KCOT). Inflammation can assist tumor growth via different mechanisms including dysregulation of the p53 gene. This study aims to assess and compare the expression of tumor suppressor gene p53 in inflamed and non-inflamed types of OKC and dentigerous cyst. Immunohistochemical expression of p53 was assessed in 14 cases of dental follicle, 34 cases of OKC (including 18 inflamed OKCs), and 31 cases of dentigerous cyst (including 16 inflamed cysts). The mean percentage of p53 positive cells was 0.7% in dental follicles, 5.4% in non-inflamed OKCs, 17.3% in inflamed OKCs, 1.2% in non-inflamed dentigerous cysts, and 2.2% in inflamed dentigerous cysts. The differences between the groups were statistically significant ( p < 0.050) except for the difference between inflamed and non-inflamed dentigerous cysts, and between dental follicle and non-inflamed dentigerous cyst. The difference in p53 expression in OKC and dentigerous cyst can explain their different growth mechanism and clinical behavior. Inflammation is responsible for the change in behavior of neoplastic epithelium of OKC via p53 overexpression.

  15. The expanding regulatory universe of p53 in gastrointestinal cancer.

    PubMed

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  16. A minimally invasive assay for individual assessment of the ATM/CHEK2/p53 pathway activity.

    PubMed

    Kabacik, Sylwia; Ortega-Molina, Ana; Efeyan, Alejo; Finnon, Paul; Bouffler, Simon; Serrano, Manuel; Badie, Christophe

    2011-04-01

    Ionizing radiation induces DNA Double-Strand Breaks (DSBs) which activate the ATM/CHEK2/p53 pathway leading to cell cycle arrest and apoptosis through transcription of genes including CDKN1A (p21) and BBC3 (PUMA). This pathway prevents genomic instability and tumorigenesis as demonstrated in heritable syndromes [e.g. Ataxia Telangiectasia (AT); Li-Fraumeni syndrome (LFS)]. Here, a simple assay based on gene expression in peripheral blood to measure accurately ATM/CHEK2/p53 pathway activity is described. The expression of p21, Puma and Sesn2 was determined in blood from mice with different gene copy numbers of Atm, Trp53 (p53), Chek2 or Arf and in human blood and mitogen stimulated T-lymphocyte (MSTL) cultures from AT, AT carriers, LFS patients, and controls, both before and after ex vivo ionizing irradiation. Mouse Atm/Chek2/p53 activity was highly dependent on the copy number of each gene except Arf. In human MSTL, an AT case, AT carriers and LFS patients showed responses distinct from healthy donors. The relationship between gene copy number and transcriptional induction upon radiation was linear for p21 and Puma and correlated well with cancer incidence in p53 variant mice. This reliable blood test provides an assay to determine ATM/CHEK2/p53 pathway activity and demonstrates the feasibility of assessing the activity of this essential cancer protection pathway in simple assays. These findings may have implications for the individualized prediction of cancer susceptibility.

  17. Prosurvival long noncoding RNA PINCR regulates a subset of p53 targets in human colorectal cancer cells by binding to Matrin 3

    PubMed Central

    Chaudhary, Ritu; Gryder, Berkley; Woods, Wendy S; Subramanian, Murugan; Jones, Matthew F; Li, Xiao Ling; Jenkins, Lisa M; Shabalina, Svetlana A; Mo, Min; Dasso, Mary; Yang, Yuan; Wakefield, Lalage M; Zhu, Yuelin; Frier, Susan M; Moriarity, Branden S; Prasanth, Kannanganattu V; Perez-Pinera, Pablo; Lal, Ashish

    2017-01-01

    Thousands of long noncoding RNAs (lncRNAs) have been discovered, yet the function of the vast majority remains unclear. Here, we show that a p53-regulated lncRNA which we named PINCR (p53-induced noncoding RNA), is induced ~100-fold after DNA damage and exerts a prosurvival function in human colorectal cancer cells (CRC) in vitro and tumor growth in vivo. Targeted deletion of PINCR in CRC cells significantly impaired G1 arrest and induced hypersensitivity to chemotherapeutic drugs. PINCR regulates the induction of a subset of p53 targets involved in G1 arrest and apoptosis, including BTG2, RRM2B and GPX1. Using a novel RNA pulldown approach that utilized endogenous S1-tagged PINCR, we show that PINCR associates with the enhancer region of these genes by binding to RNA-binding protein Matrin 3 that, in turn, associates with p53. Our findings uncover a critical prosurvival function of a p53/PINCR/Matrin 3 axis in response to DNA damage in CRC cells. DOI: http://dx.doi.org/10.7554/eLife.23244.001 PMID:28580901

  18. ATF4 induction through an atypical integrated stress response to ONC201 triggers p53-independent apoptosis in hematological malignancies

    PubMed Central

    Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O.; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E.; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C.; Orlowski, Robert; Sarbassov, Dos D.; Lorenzi, Philip L.; Huang, Xuelin; Neelapu, Sattva S.; McDonnell, Timothy; Miranda, Roberto N.; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R. Eric.; Andreeff, Michael

    2016-01-01

    The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. PMID:26884599

  19. Attenuation of dexamethasone-induced cell death in multiple myeloma is mediated by miR-125b expression

    PubMed Central

    Murray, Megan Y.; Rushworth, Stuart A.; Zaitseva, Lyubov; Bowles, Kristian M.; MacEwan, David J.

    2013-01-01

    Dexamethasone is a key front-line chemotherapeutic for B-cell malignant multiple myeloma (MM). Dexamethasone modulates MM cell survival signaling but fails to induce marked cytotoxicity when used as a monotherapy. We demonstrate here the mechanism behind this insufficient responsiveness of MM cells toward dexamethasone, revealing in MM a dramatic anti-apoptotic role for microRNA (miRNA)-125b in the insensitivity toward dexamethasone-induced apoptosis. MM cells responding to dexamethasone exhibited enhanced expression of oncogenic miR-125b. Dexamethasone also induced expression of miR-34a, which acts to suppress SIRT1 deacetylase, and thus allows maintained acetylation and inactivation of p53. p53 mRNA is also suppressed by miR-125b targeting. Reporter assays showed that both these dexamethasone-induced miRNAs act downstream of their target genes to prevent p53 tumor suppressor actions and, ultimately, resist cytotoxic responses in MM. Use of antisense miR-125b transcripts enhanced expression of pro-apoptotic p53, repressed expression of anti-apoptotic SIRT1 and, importantly, significantly enhanced dexamethasone-induced cell death responses in MM. Pharmacological manipulations showed that the key regulation enabling complete dexamethasone sensitivity in MM cells lies with miR-125b. In summary, dexamethasone-induced miR-125b induces cell death resistance mechanisms in MM cells via the p53/miR-34a/SIRT1 signaling network and provides these cells with an enhanced level of resistance to cytotoxic chemotherapeutics. Clearly, such anti-apoptotic mechanisms will need to be overcome to more effectively treat nascent, refractory and relapsed MM patients. These mechanisms provide insight into the role of miRNA regulation of apoptosis and their promotion of MM cell proliferative mechanisms. PMID:23759586

  20. Inhibition of autophagy as a treatment strategy for p53 wild-type acute myeloid leukemia

    PubMed Central

    Folkerts, Hendrik; Hilgendorf, Susan; Wierenga, Albertus T J; Jaques, Jennifer; Mulder, André B; Coffer, Paul J; Schuringa, Jan Jacob; Vellenga, Edo

    2017-01-01

    Here we have explored whether inhibition of autophagy can be used as a treatment strategy for acute myeloid leukemia (AML). Steady-state autophagy was measured in leukemic cell lines and primary human CD34+ AML cells with a large variability in basal autophagy between AMLs observed. The autophagy flux was higher in AMLs classified as poor risk, which are frequently associated with TP53 mutations (TP53mut), compared with favorable- and intermediate-risk AMLs. In addition, the higher flux was associated with a higher expression level of several autophagy genes, but was not affected by alterations in p53 expression by knocking down p53 or overexpression of wild-type p53 or p53R273H. AML CD34+ cells were more sensitive to the autophagy inhibitor hydroxychloroquine (HCQ) than normal bone marrow CD34+ cells. Similar, inhibition of autophagy by knockdown of ATG5 or ATG7 triggered apoptosis, which coincided with increased expression of p53. In contrast to wild-type p53 AML (TP53wt), HCQ treatment did not trigger a BAX and PUMA-dependent apoptotic response in AMLs harboring TP53mut. To further characterize autophagy in the leukemic stem cell-enriched cell fraction AML CD34+ cells were separated into ROSlow and ROShigh subfractions. The immature AML CD34+-enriched ROSlow cells maintained higher basal autophagy and showed reduced survival upon HCQ treatment compared with ROShigh cells. Finally, knockdown of ATG5 inhibits in vivo maintenance of AML CD34+ cells in NSG mice. These results indicate that targeting autophagy might provide new therapeutic options for treatment of AML since it affects the immature AML subfraction. PMID:28703806

  1. Adenovirally mediated p53 overexpression diversely influence the cell cycle of HEp-2 and CAL 27 cell lines upon cisplatin and methotrexate treatment.

    PubMed

    Kraljević Pavelić, Sandra; Marjanović, Marko; Poznić, Miroslav; Kralj, Marijeta

    2009-12-01

    p53 gene plays a crucial role in the response to therapy. Since it is inactivated in the majority of human cancers, it is strongly believed that the p53 mutations confer resistance to therapeutics. In this paper we analyzed the influence of two mechanistically diverse antitumor agents--cisplatin and methotrexate on the proliferation and cell cycle of two head and neck squamous cancer cell lines HEp-2 (wild type p53 gene, but HPV 18/E6-inactivated protein) and CAL 27 (mutated p53 gene), along with the influence of adenovirally mediated p53 overexpression in modulation of cisplatin and methoterexate effects, whereby subtoxic vector/compound concentrations were employed. p53 gene was introduced into tumor cells using adenoviral vector (AdCMV-p53). The cell cycle perturbations were measured by two parameter flow cytometry. The expression of p53, p21(WAF1/CIP1) and cyclin B1 proteins was examined using immunocytochemistry and western blot methods. In CAL 27 cells overexpression of p53 completely abrogated high S phase content observed in methotrexate-treated cells into a G1 and slight G2 arrest, while it sustained G2 arrest of the cells treated with cisplatin, along with the reduction of DNA synthesis and cyclin B1 expression. On the other hand, in HEp-2 cell line p53 overexpression slightly slowed down the progression through S phase in cells treated with methotrexate, decreased the cyclin B1 expression only after 24 h, and failed to sustain the G2 arrest after treatment with cisplatin alone. Instead, it increased the population of S phase cells that were not actively synthesizing DNA, sustained cyclin B1 expression and allowed the G2 cells to progress through mitosis. This study demonstrates that adenovirally mediated p53 overexpression at sub-cytotoxic levels enhanced the activity of low doses of cisplatin and methotrexate in HEp-2 and CAL 27 cells through changes in the cell cycle. However, the mechanisms of these effects differ depending on the genetic context and on the chemotherapeutics' modality of action.

  2. AS-2, a novel inhibitor of p53-dependent apoptosis, prevents apoptotic mitochondrial dysfunction in a transcription-independent manner and protects mice from a lethal dose of ionizing radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morita, Akinori, E-mail: morita@tokushima-u.ac.jp; Ariyasu, Shinya; Wang, Bing

    2014-08-08

    Highlights: • A bidentate HQ derivative, AS-2, suppresses p53-dependent apoptosis by DNA damage. • AS-2 does not significantly affect nuclear p53 response. • UV-excited blue emission of AS-2 clearly showed its extranuclear localization. • AS-2 prevents mitochondrial dysfunction despite the increase of mitochondrial p53. • AS-2 protects mice from a radiation dose that causes lethal hematopoietic syndrome. - Abstract: In a previous study, we reported that some tetradentate zinc(II) chelators inhibit p53 through the denaturation of its zinc-requiring structure but a chelator, Bispicen, a potent inhibitor of in vitro apoptosis, failed to show any efficient radioprotective effect against irradiated micemore » because the toxicity of the chelator to mice. The unsuitability of using tetradentate chelators as radioprotectors prompted us to undertake a more extensive search for p53-inhibiting agents that are weaker zinc(II) chelators and therefore less toxic. Here, we show that an 8-hydroxyquinoline (8HQ) derivative, AS-2, suppresses p53-dependent apoptosis through a transcription-independent mechanism. A mechanistic study using cells with different p53 characteristics revealed that the suppressive effect of AS-2 on apoptosis is specifically mediated through p53. In addition, AS-2 was less effective in preventing p53-mediated transcription-dependent events than pifithrin-μ (PFTμ), an inhibitor of transcription-independent apoptosis by p53. Fluorescence visualization of the extranuclear distribution of AS-2 also supports that it is ineffective on the transcription-dependent pathway. Further investigations revealed that AS-2 suppressed mitochondrial apoptotic events, such as the mitochondrial release of intermembrane proteins and the loss of mitochondrial membrane potential, although AS-2 resulted in an increase in the mitochondrial translocation of p53 as opposed to the decrease of cytosolic p53, and did not affect the apoptotic interaction of p53 with Bcl-2. AS-2 also protected mice that had been exposed to a lethal dose of ionizing radiation. Our findings indicate that some types of bidentate 8HQ chelators could serve as radioprotectors with no substantial toxicity in vivo.« less

  3. Identification of a novel TIF-IA-NF-κB nucleolar stress response pathway.

    PubMed

    Chen, Jingyu; Lobb, Ian T; Morin, Pierre; Novo, Sonia M; Simpson, James; Kennerknecht, Kathrin; von Kriegsheim, Alex; Batchelor, Emily E; Oakley, Fiona; Stark, Lesley A

    2018-06-05

    p53 as an effector of nucleolar stress is well defined, but p53 independent mechanisms are largely unknown. Like p53, the NF-κB transcription factor plays a critical role in maintaining cellular homeostasis under stress. Many stresses that stimulate NF-κB also disrupt nucleoli. However, the link between nucleolar function and activation of the NF-κB pathway is as yet unknown. Here we demonstrate that artificial disruption of the PolI complex stimulates NF-κB signalling. Unlike p53 nucleolar stress response, this effect does not appear to be linked to inhibition of rDNA transcription. We show that specific stress stimuli of NF-κB induce degradation of a critical component of the PolI complex, TIF-IA. This degradation precedes activation of NF-κB and is associated with increased nucleolar size. It is mimicked by CDK4 inhibition and is dependent upon a novel pathway involving UBF/p14ARF and S44 of the protein. We show that blocking TIF-IA degradation blocks stress effects on nucleolar size and NF-κB signalling. Finally, using ex vivo culture, we show a strong correlation between degradation of TIF-IA and activation of NF-κB in freshly resected, human colorectal tumours exposed to the chemopreventative agent, aspirin. Together, our study provides compelling evidence for a new, TIF-IA-NF-κB nucleolar stress response pathway that has in vivo relevance and therapeutic implications.

  4. The ubiquitin ligase LIN41/TRIM71 targets p53 to antagonize cell death and differentiation pathways during stem cell differentiation

    PubMed Central

    Nguyen, Duong Thi Thuy; Richter, Daniel; Michel, Geert; Mitschka, Sibylle; Kolanus, Waldemar; Cuevas, Elisa; Gregory Wulczyn, F

    2017-01-01

    Rapidity and specificity are characteristic features of proteolysis mediated by the ubiquitin-proteasome system. Therefore, the UPS is ideally suited for the remodeling of the embryonic stem cell proteome during the transition from pluripotent to differentiated states and its inverse, the generation of inducible pluripotent stem cells. The Trim-NHL family member LIN41 is among the first E3 ubiquitin ligases to be linked to stem cell pluripotency and reprogramming. Initially discovered in C. elegans as a downstream target of the let-7 miRNA, LIN41 is now recognized as a critical regulator of stem cell fates as well as the timing of neurogenesis. Despite being indispensable for embryonic development and neural tube closure in mice, the underlying mechanisms for LIN41 function in these processes are poorly understood. To better understand the specific contributions of the E3 ligase activity for the stem cell functions of LIN41, we characterized global changes in ubiquitin or ubiquitin-like modifications using Lin41-inducible mouse embryonic stem cells. The tumor suppressor protein p53 was among the five most strongly affected proteins in cells undergoing neural differentiation in response to LIN41 induction. We show that LIN41 interacts with p53, controls its abundance by ubiquitination and antagonizes p53-dependent pro-apoptotic and pro-differentiation responses. In vivo, the lack of LIN41 is associated with upregulation of Grhl3 and widespread caspase-3 activation, two downstream effectors of p53 with essential roles in neural tube closure. As Lin41-deficient mice display neural tube closure defects, we conclude that LIN41 is critical for the regulation of p53 functions in cell fate specification and survival during early brain development. PMID:28430184

  5. Exquisite sensitivity of TP53 mutant and basal breast cancers to a dose-dense epirubicin-cyclophosphamide regimen.

    PubMed

    Bertheau, Philippe; Turpin, Elisabeth; Rickman, David S; Espié, Marc; de Reyniès, Aurélien; Feugeas, Jean-Paul; Plassa, Louis-François; Soliman, Hany; Varna, Mariana; de Roquancourt, Anne; Lehmann-Che, Jacqueline; Beuzard, Yves; Marty, Michel; Misset, Jean-Louis; Janin, Anne; de Thé, Hugues

    2007-03-01

    In breast cancers, only a minority of patients fully benefit from the different chemotherapy regimens currently in use. Identification of markers that could predict the response to a particular regimen would thus be critically important for patient care. In cell lines or animal models, tumor protein p53 (TP53) plays a critical role in modulating the response to genotoxic drugs. TP53 is activated in response to DNA damage and triggers either apoptosis or cell-cycle arrest, which have opposite effects on cell fate. Yet, studies linking TP53 status and chemotherapy response have so far failed to unambiguously establish this paradigm in patients. Breast cancers with a TP53 mutation were repeatedly shown to have a poor outcome, but whether this reflects poor response to treatment or greater intrinsic aggressiveness of the tumor is unknown. In this study we analyzed 80 noninflammatory breast cancers treated by frontline (neoadjuvant) chemotherapy. Tumor diagnoses were performed on pretreatment biopsies, and the patients then received six cycles of a dose-dense regimen of 75 mg/m(2) epirubicin and 1,200 mg/m(2) cyclophosphamide, given every 14 days. After completion of chemotherapy, all patients underwent mastectomies, thus allowing for a reliable assessment of chemotherapy response. The pretreatment biopsy samples were used to determine the TP53 status through a highly efficient yeast functional assay and to perform RNA profiling. All 15 complete responses occurred among the 28 TP53-mutant tumors. Furthermore, among the TP53-mutant tumors, nine out of ten of the highly aggressive basal subtypes (defined by basal cytokeratin [KRT] immunohistochemical staining) experienced complete pathological responses, and only TP53 status and basal subtype were independent predictors of a complete response. Expression analysis identified many mutant TP53-associated genes, including CDC20, TTK, CDKN2A, and the stem cell gene PROM1, but failed to identify a transcriptional profile associated with complete responses among TP53 mutant tumors. In patients with unresponsive tumors, mutant TP53 status predicted significantly shorter overall survival. The 15 patients with responsive TP53-mutant tumors, however, had a favorable outcome, suggesting that this chemotherapy regimen can overcome the poor prognosis generally associated with mutant TP53 status. This study demonstrates that, in noninflammatory breast cancers, TP53 status is a key predictive factor for response to this dose-dense epirubicin-cyclophosphamide regimen and further suggests that the basal subtype is exquisitely sensitive to this association. Given the well-established predictive value of complete responses for long-term survival and the poor prognosis of basal and TP53-mutant tumors treated with other regimens, this chemotherapy could be particularly suited for breast cancer patients with a mutant TP53, particularly those with basal features.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bae, Soo Kyung; Gwak, Jungsug; Song, Im-Sook

    Highlights: {yields} TopIn activates p53-dependent transcription in colon cancer cells. {yields} TopIn induces apoptosis in colon cancer cells. {yields} TopIn selectively inhibits topoisomerase I activity. {yields} TopIn does not affect the activity of BCRP and MDR-1. -- Abstract: The tumor suppressor p53 plays an important role in cellular emergency mechanisms through regulating the genes involved in cell cycle arrest and apoptosis. To identify small molecules that can activate p53-responsive transcription, we performed chemical screening using genetically engineered HCT116 reporter cells. We found that TopIn (7-phenyl-6H-[1,2,5]oxadiazolo[3,4-e]indole 3-oxide) efficiently activated p53-mediated transcriptional activity and induced phosphorylation of p53 at Ser15, thereby stabilizingmore » the p53 protein. Furthermore, TopIn upregulated the expression of p21{sup WAF1/CIP1}, a downstream target of p53, and suppressed cellular proliferation in various colon cancer cells. Additionally, TopIn induced DNA fragmentation, caspase-3/7 activation and poly ADP ribose polymerase cleavage, typical biochemical markers of apoptosis, in p53 wild-type and mutated colon cancer cells. Finally, we found that TopIn inhibited topoisomerase I activity, but not topoisomerase II, in vitro and induced the formation of the topoisomerase I-DNA complex in HCT116 colon cancer cells. Unlike camptothecin (CPT) and its derivative SN38, TopIn did not affect the activity of the ATP-binding cassette transporter breast cancer resistance protein (BCRP) or multidrug-resistant protein-1 (MDR-1). These results suggest that TopIn may present a promising new topoisomerase I-targeting anti-tumor therapeutics.« less

  7. New orally active DNA minor groove binding small molecule CT-1 acts against breast cancer by targeting tumor DNA damage leading to p53-dependent apoptosis.

    PubMed

    Saini, Karan Singh; Hamidullah; Ashraf, Raghib; Mandalapu, Dhanaraju; Das, Sharmistha; Siddiqui, Mohd Quadir; Dwivedi, Sonam; Sarkar, Jayanta; Sharma, Vishnu Lal; Konwar, Rituraj

    2017-04-01

    Targeting tumor DNA damage and p53 pathway is a clinically established strategy in the development of cancer chemotherapeutics. Majority of anti-cancer drugs are delivered through parenteral route for reasons like severe toxicity, lack of stability, and poor enteral absorption. Current DNA targeting drugs in clinical like anthracycline suffers from major drawbacks like cardiotoxicity. Here, we report identification of a new orally active small molecule curcumin-triazole conjugate (CT-1) with significant anti-breast cancer activity in vitro and in vivo. CT-1 selectively and significantly inhibits viability of breast cancer cell lines; retards cells cycle progression at S phase and induce mitochondrial-mediated cell apoptosis. CT-1 selectively binds to minor groove of DNA and induces DNA damage leading to increase in p53 along with decrease in its ubiquitination. Inhibition of p53 with pharmacological inhibitor as well as siRNA revealed the necessity of p53 in CT-1-mediated anti-cancer effects in breast cancer cells. Studies using several other intact p53 and deficient p53 cancer cell lines further confirmed necessity of p53 in CT-1-mediated anti-cancer response. Pharmacological inhibition of pan-caspase showed CT-1 induces caspase-dependent cell death in breast cancer cells. Most interestingly, oral administration of CT-1 induces significant inhibition of tumor growth in LA-7 syngeneic orthotropic rat mammary tumor model. CT-1 treated mammary tumor shows enhancement in DNA damage, p53 upregulation, and apoptosis. Collectively, CT-1 exhibits potent anti-cancer effect both in vitro and in vivo and could serve as a safe orally active lead for anti-cancer drug development. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. p53 mediates bcl-2 phosphorylation and apoptosis via activation of the Cdc42/JNK1 pathway.

    PubMed

    Thomas, A; Giesler, T; White, E

    2000-11-02

    A member of the small G protein family, cdc42, was isolated from a screen undertaken to identify p53-inducible genes during apoptosis in primary baby rat kidney (BRK) cells transformed with E1A and a temperature-sensitive mutant p53 using a PCR-based subtractive hybridization method. Cdc42 is a GTPase that belongs to the Rho/Rac subfamily of Ras-like GTPases. In response to external stimuli, Cdc42 is known to transduce signals to regulate the organization of the actin cytoskeleton, induce DNA synthesis in quiescent fibroblasts, and promote apoptosis in neuronal and immune cells. In this study, we have demonstrated that cdc42 mRNA and protein were up-regulated in the presence of wild-type p53 in BRK cells, followed by cytoplasmic to plasma membrane translocation of Cdc42. Overexpression of Cdc42 in the presence of a dominant-negative mutant p53 induced apoptosis rapidly, indicating that Cdc42 functions downstream of p53. Furthermore, stable expression of a dominant-negative mutant of Cdc42 partially inhibited p53-mediated apoptosis. The Bcl-2 family members Bcl-xL, and the adenovirus protein E1B 19K, inhibited Cdc42-mediated apoptosis, whereas Bcl-2 did not. We provide evidence that PAK1 and JNK1 may play a role downstream of Cdc42 to transduce its apoptotic signal. Cdc42/PAK1 activates JNK1-induced phosphorylation of Bcl-2, thereby inactivating its function, and that a phosphorylation resistant mutant (Bcl-2S70,87A,T56,74A) gains the ability to inhibit Cdc42- and p53-mediated apoptosis. Thus, one mechanism by which p53 promotes apoptosis is through activation of Cdc42 and inactivation of Bcl-2.

  9. The Central Sirtuin 1/p53 Pathway Is Essential for the Orexigenic Action of Ghrelin

    PubMed Central

    Velásquez, Douglas A.; Martínez, Gloria; Romero, Amparo; Vázquez, María J.; Boit, Katia D.; Dopeso-Reyes, Iria G.; López, Miguel; Vidal, Anxo; Nogueiras, Ruben; Diéguez, Carlos

    2011-01-01

    OBJECTIVE Ghrelin is a stomach-derived peptide that increases food intake through the activation of hypothalamic AMP-activated protein kinase (AMPK). However, the molecular mechanisms initiated by the activation of the ghrelin receptor, which in turn lead to AMPK activation, remain unclear. Sirtuin 1 (SIRT1) is a deacetylase activated in response to calorie restriction that acts through the tumor suppressor gene p53. We tested the hypothesis that the central SIRT1/p53 pathway might be mediating the orexigenic action of ghrelin. RESEARCH DESIGN AND METHODS SIRT1 inhibitors, such as Ex527 and sirtinol, and AMPK activators, such as AICAR, were administered alongside ghrelin in the brain of rats and mice (wild-type versus p53 knockout [KO]). Their hypothalamic effects on lipid metabolism and changes in transcription factors and neuropeptides were assessed by Western blot and in situ hybridization. RESULTS The central pretreatment with Ex527, a potent SIRT1 inhibitor, blunted the ghrelin-induced food intake in rats. Mice lacking p53, a target of SIRT1 action, failed to respond to ghrelin in feeding behavior. Ghrelin failed to phosphorylate hypothalamic AMPK when rats were pretreated with Ex527, as it did in p53 KO mice. It is noteworthy that the hypothalamic SIRT1/p53 pathway seems to be specific for mediating the orexigenic action of ghrelin, because central administration of AICAR, a potent AMPK activator, increased food intake in p53 KO mice. Finally, blockade of the central SIRT1 pathway did not modify ghrelin-induced growth hormone secretion. CONCLUSIONS Ghrelin specifically triggers a central SIRT1/p53 pathway that is essential for its orexigenic action, but not for the release of growth hormone. PMID:21386086

  10. Genomic Instability Associated with p53 Knockdown in the Generation of Huntington’s Disease Human Induced Pluripotent Stem Cells

    PubMed Central

    Tidball, Andrew M.; Neely, M. Diana; Chamberlin, Reed; Aboud, Asad A.; Kumar, Kevin K.; Han, Bingying; Bryan, Miles R.; Aschner, Michael; Ess, Kevin C.; Bowman, Aaron B.

    2016-01-01

    Alterations in DNA damage response and repair have been observed in Huntington’s disease (HD). We generated induced pluripotent stem cells (iPSC) from primary dermal fibroblasts of 5 patients with HD and 5 control subjects. A significant fraction of the HD iPSC lines had genomic abnormalities as assessed by karyotype analysis, while none of our control lines had detectable genomic abnormalities. We demonstrate a statistically significant increase in genomic instability in HD cells during reprogramming. We also report a significant association with repeat length and severity of this instability. Our karyotypically normal HD iPSCs also have elevated ATM-p53 signaling as shown by elevated levels of phosphorylated p53 and H2AX, indicating either elevated DNA damage or hypersensitive DNA damage signaling in HD iPSCs. Thus, increased DNA damage responses in the HD genotype is coincidental with the observed chromosomal aberrations. We conclude that the disease causing mutation in HD increases the propensity of chromosomal instability relative to control fibroblasts specifically during reprogramming to a pluripotent state by a commonly used episomal-based method that includes p53 knockdown. PMID:26982737

  11. Periodontal Pathogens in the Etiology of Pancreatic Cancer.

    PubMed

    Öğrendik, Mesut

    2017-03-01

    Pancreatic cancer is the fourth leading cause of cancer-related deaths worldwide. Chronic pancreatitis is frequently observed in patients with pancreatic cancer, and a significant relationship between orodigestive cancer-related deaths and chronic periodontitis has been detected. Porphyromonas gingivalis , Tannerella forsythia , and Treponema denticola , collectively called the Red complex, are the major pathogens responsible for chronic periodontitis and secrete peptidylarginine deiminase. Anti- P. gingivalis antibodies titers are higher in pancreatic cancer patients than in healthy subjects. This review examines the association between oral bacteria and the etiology of pancreatic cancer. High rates of tumor suppressor gene p53 mutations, particularly p53 arginine mutations, were detected in pancreatic cancer patients. K-ras arginine mutations were detected in patients with pancreatic cancer. Oral bacteria peptidylarginine deiminases might lead to the p53 and K-ras point mutations by degrading arginine. Oral bacteria are likely to be responsible for the development of pancreatic cancer. If this hypothesis is true, it may reveal the real cause of pancreatic cancer, which is a fatal disease.

  12. Low expression levels of ATM may substitute for CHEK2 /TP53 mutations predicting resistance towards anthracycline and mitomycin chemotherapy in breast cancer.

    PubMed

    Knappskog, Stian; Chrisanthar, Ranjan; Løkkevik, Erik; Anker, Gun; Østenstad, Bjørn; Lundgren, Steinar; Risberg, Terje; Mjaaland, Ingvil; Leirvaag, Beryl; Miletic, Hrvoje; Lønning, Per E

    2012-03-15

    Mutations affecting p53 or its upstream activator Chk2 are associated with resistance to DNA-damaging chemotherapy in breast cancer. ATM (Ataxia Telangiectasia Mutated protein) is the key activator of p53 and Chk2 in response to genotoxic stress. Here, we sought to evaluate ATM's potential role in resistance to chemotherapy. We sequenced ATM and assessed gene expression levels in pre-treatment biopsies from 71 locally advanced breast cancers treated in the neoadjuvant setting with doxorubicin monotherapy or mitomycin combined with 5-fluorouracil. Findings were confirmed in a separate patient cohort treated with epirubicin monotherapy. Each tumor was previously analyzed for CHEK2 and TP53 mutation status. While ATM mutations were not associated with chemo-resistance, low ATM expression levels predicted chemo-resistance among patients with tumors wild-type for TP53 and CHEK2 (P = 0.028). Analyzing the ATM-chk2-p53 cascade, low ATM levels (defined as the lower 5 to 50% percentiles) or mutations inactivating TP53 or CHEK2 robustly predicted anthracycline resistance (P-values varying between 0.001 and 0.027 depending on the percentile used to define "low" ATM levels). These results were confirmed in an independent cohort of 109 patients treated with epirubicin monotherapy. In contrast, ATM-levels were not suppressed in resistant tumors harboring TP53 or CHEK2 mutations (P > 0.5). Our data indicate loss of function of the ATM-Chk2-p53 cascade to be strongly associated with resistance to anthracycline/mitomycin-containing chemotherapy in breast cancer.

  13. Exploratory Analysis of TP53 Mutations in Circulating Tumour DNA as Biomarkers of Treatment Response for Patients with Relapsed High-Grade Serous Ovarian Carcinoma: A Retrospective Study

    PubMed Central

    Piskorz, Anna M.; Biggs, Heather; Addley, Helen; Freeman, Sue; Moyle, Penelope; Sala, Evis; Sayal, Karen; Hosking, Karen; Gounaris, Ioannis; Earl, Helena M.; Rosenfeld, Nitzan; Brenton, James D.

    2016-01-01

    Background Circulating tumour DNA (ctDNA) carrying tumour-specific sequence alterations may provide a minimally invasive means to dynamically assess tumour burden and response to treatment in cancer patients. Somatic TP53 mutations are a defining feature of high-grade serous ovarian carcinoma (HGSOC). We tested whether these mutations could be used as personalised markers to monitor tumour burden and early changes as a predictor of response and time to progression (TTP). Methods and Findings We performed a retrospective analysis of serial plasma samples collected during routine clinical visits from 40 patients with HGSOC undergoing heterogeneous standard of care treatment. Patient-specific TP53 assays were developed for 31 unique mutations identified in formalin-fixed paraffin-embedded tumour DNA from these patients. These assays were used to quantify ctDNA in 318 plasma samples using microfluidic digital PCR. The TP53 mutant allele fraction (TP53MAF) was compared to serum CA-125, the current gold-standard response marker for HGSOC in blood, as well as to disease volume on computed tomography scans by volumetric analysis. Changes after one cycle of treatment were compared with TTP. The median TP53MAF prior to treatment in 51 relapsed treatment courses was 8% (interquartile range [IQR] 1.2%–22%) compared to 0.7% (IQR 0.3%–2.0%) for seven untreated newly diagnosed stage IIIC/IV patients. TP53MAF correlated with volumetric measurements (Pearson r = 0.59, p < 0.001), and this correlation improved when patients with ascites were excluded (r = 0.82). The ratio of TP53MAF to volume of disease was higher in relapsed patients (0.04% per cm3) than in untreated patients (0.0008% per cm3, p = 0.004). In nearly all relapsed patients with disease volume > 32 cm3, ctDNA was detected at ≥20 amplifiable copies per millilitre of plasma. In 49 treatment courses for relapsed disease, pre-treatment TP53MAF concentration, but not CA-125, was associated with TTP. Response to chemotherapy was seen earlier with ctDNA, with a median time to nadir of 37 d (IQR 28–54) compared with a median time to nadir of 84 d (IQR 42–116) for CA-125. In 32 relapsed treatment courses evaluable for response after one cycle of chemotherapy, a decrease in TP53MAF of >60% was an independent predictor of TTP in multivariable analysis (hazard ratio 0.22, 95% CI 0.07–0.67, p = 0.008). Conversely, a decrease in TP53MAF of ≤60% was associated with poor response and identified cases with TTP < 6 mo with 71% sensitivity (95% CI 42%–92%) and 88% specificity (95% CI 64%–99%). Specificity was improved when patients with recent drainage of ascites were excluded. Ascites drainage led to a reduction of TP53MAF concentration. The limitations of this study include retrospective design, small sample size, and heterogeneity of treatment within the cohort. Conclusions In this retrospective study, we demonstrated that ctDNA is correlated with volume of disease at the start of treatment in women with HGSOC and that a decrease of ≤60% in TP53MAF after one cycle of chemotherapy was associated with shorter TTP. These results provide evidence that ctDNA has the potential to be a highly specific early molecular response marker in HGSOC and warrants further investigation in larger cohorts receiving uniform treatment. PMID:27997533

  14. Exploratory Analysis of TP53 Mutations in Circulating Tumour DNA as Biomarkers of Treatment Response for Patients with Relapsed High-Grade Serous Ovarian Carcinoma: A Retrospective Study.

    PubMed

    Parkinson, Christine A; Gale, Davina; Piskorz, Anna M; Biggs, Heather; Hodgkin, Charlotte; Addley, Helen; Freeman, Sue; Moyle, Penelope; Sala, Evis; Sayal, Karen; Hosking, Karen; Gounaris, Ioannis; Jimenez-Linan, Mercedes; Earl, Helena M; Qian, Wendi; Rosenfeld, Nitzan; Brenton, James D

    2016-12-01

    Circulating tumour DNA (ctDNA) carrying tumour-specific sequence alterations may provide a minimally invasive means to dynamically assess tumour burden and response to treatment in cancer patients. Somatic TP53 mutations are a defining feature of high-grade serous ovarian carcinoma (HGSOC). We tested whether these mutations could be used as personalised markers to monitor tumour burden and early changes as a predictor of response and time to progression (TTP). We performed a retrospective analysis of serial plasma samples collected during routine clinical visits from 40 patients with HGSOC undergoing heterogeneous standard of care treatment. Patient-specific TP53 assays were developed for 31 unique mutations identified in formalin-fixed paraffin-embedded tumour DNA from these patients. These assays were used to quantify ctDNA in 318 plasma samples using microfluidic digital PCR. The TP53 mutant allele fraction (TP53MAF) was compared to serum CA-125, the current gold-standard response marker for HGSOC in blood, as well as to disease volume on computed tomography scans by volumetric analysis. Changes after one cycle of treatment were compared with TTP. The median TP53MAF prior to treatment in 51 relapsed treatment courses was 8% (interquartile range [IQR] 1.2%-22%) compared to 0.7% (IQR 0.3%-2.0%) for seven untreated newly diagnosed stage IIIC/IV patients. TP53MAF correlated with volumetric measurements (Pearson r = 0.59, p < 0.001), and this correlation improved when patients with ascites were excluded (r = 0.82). The ratio of TP53MAF to volume of disease was higher in relapsed patients (0.04% per cm3) than in untreated patients (0.0008% per cm3, p = 0.004). In nearly all relapsed patients with disease volume > 32 cm3, ctDNA was detected at ≥20 amplifiable copies per millilitre of plasma. In 49 treatment courses for relapsed disease, pre-treatment TP53MAF concentration, but not CA-125, was associated with TTP. Response to chemotherapy was seen earlier with ctDNA, with a median time to nadir of 37 d (IQR 28-54) compared with a median time to nadir of 84 d (IQR 42-116) for CA-125. In 32 relapsed treatment courses evaluable for response after one cycle of chemotherapy, a decrease in TP53MAF of >60% was an independent predictor of TTP in multivariable analysis (hazard ratio 0.22, 95% CI 0.07-0.67, p = 0.008). Conversely, a decrease in TP53MAF of ≤60% was associated with poor response and identified cases with TTP < 6 mo with 71% sensitivity (95% CI 42%-92%) and 88% specificity (95% CI 64%-99%). Specificity was improved when patients with recent drainage of ascites were excluded. Ascites drainage led to a reduction of TP53MAF concentration. The limitations of this study include retrospective design, small sample size, and heterogeneity of treatment within the cohort. In this retrospective study, we demonstrated that ctDNA is correlated with volume of disease at the start of treatment in women with HGSOC and that a decrease of ≤60% in TP53MAF after one cycle of chemotherapy was associated with shorter TTP. These results provide evidence that ctDNA has the potential to be a highly specific early molecular response marker in HGSOC and warrants further investigation in larger cohorts receiving uniform treatment.

  15. Safety and Efficacy in Advanced Solid Tumors of a Targeted Nanocomplex Carrying the p53 Gene Used in Combination with Docetaxel: A Phase 1b Study

    PubMed Central

    Pirollo, Kathleen F; Nemunaitis, John; Leung, Po Ki; Nunan, Robert; Adams, Jana; Chang, Esther H

    2016-01-01

    Loss of p53 suppressor function, through mutations or inactivation of the p53 pathway, occurs in most human cancers. SGT-53 is a liposomal nanocomplex designed for systemic, tumor-targeting delivery of the wt p53 gene. In this nanodelivery system, an anti-transferrin receptor single-chain antibody fragment serves as the targeting moiety. In an initial phase 1 trial in patients with advanced solid tumors, SGT-53 demonstrated tumor-specific targeting, was shown to be well tolerated, and was associated with an antitumor effect in several patients. Our preclinical studies have also demonstrated enhanced antitumor activity with the combination of SGT-53 and docetaxel. Thus, this dose-escalation trial was undertaken to assess the combination of SGT-53 and docetaxel for safety and potential efficacy in 14 advanced cancer patients. Results reveal that the combination of SGT-53 (maximum dose, 3.6 mg DNA/infusion) and docetaxel (75 mg/m2/infusion) was well tolerated. Moreover, clinical activity involving 12 evaluable patients was observed. Three of these patients achieved RECIST-verified partial responses with tumor reductions of −47%, −51%, and −79%. Two others had stable disease with significant shrinkage (−25% and −16%). These results support phase 2 testing of SGT-53 in combination with docetaxel. PMID:27357628

  16. DNA damage in children with scoliosis following X-ray exposure.

    PubMed

    Himmetoglu, S; Guven, M F; Bilsel, N; Dincer, Y

    2014-10-14

    It has been suggested that cancer incidence is high in subjects with scoliosis who are relatively more often exposed to X--ray for diagnosis and follow--up. X--ray is a kind of ionizing radiation and leads to formation of oxygen free radicals which are capable of damage to DNA, thus altered gen expression and mutation. p53 tumor suppressor gene plays a crucial role in the damage response. It controls the checkpoint of cell cycle and redirects the cell metabolism to either repair of damaged DNA or apoptosis as response to DNA damage. The aim of the present study was to examine serum levels of 8--Hydroxydeoxyguanosine (8--OHdG), a strongly mutagenic product of oxidative DNA damage, p53, superoxide dismutase (SOD) and glutathione peroxidase (G--Px), as antioxidant activity, in children with scoliosis who had got whole spine radiograph two times during the last year. A total of 31 children with adolescent idiopathic scoliosis and age--matched 21 healthy children were included in the study. Serum levels of 8--OHdG and p53 were measured with ELISA kits. SOD and G--Px activities were determined with spectrophotometric assays. Serum levels of 8--OHdG and p53 were found to be higher (P<0.001 and P<0.01, respectively), SOD activity was found to be lower (P<0.001) in the children with scoliosis as compared to age--matched controls. There was no significant difference between the groups for G--Px activity. Our data show that X--ray exposure causes increased 8--OHdG level, and decreased SOD activity, which both may reflect a tumor promoting condition. Increased p53 level may be interpreted as a compensatory effort of cell to X--ray mediated DNA damage.

  17. DNA damage in children with scoliosis following X-ray exposure.

    PubMed

    Himmetoglu, S; Guven, M F; Bilsel, N; Dincer, Y

    2015-06-01

    It has been suggested that cancer incidence is high in subjects with scoliosis who are relatively more often exposed to X-ray for diagnosis and follow-up. X-ray is a kind of ionizing radiation and leads to formation of oxygen free radicals which are capable of damage to DNA, thus altered gen expression and mutation. p53 tumor suppressor gene plays a crucial role in the damage response. It controls the checkpoint of cell cycle and redirects the cell metabolism to either repair of damaged DNA or apoptosis as response to DNA damage. The aim of the present study was to examine serum levels of 8-Hydroxydeoxyguanosine (8-OHdG), a strongly mutagenic product of oxidative DNA damage, p53, superoxide dismutase (SOD) and glutathione peroxidase (G-Px), as antioxidant activity, in children with scoliosis who had got whole spine radiograph two times during the last year. A total of 31 children with adolescent idiopathic scoliosis and 21 age-matched healthy children were included in the study. Serum levels of 8-OHdG and p53 were measured with ELISA kits. SOD and G-Px activities were determined with spectrophotometric assays. Serum levels of 8-OHdG and p53 were found to be higher (P<0.001 and P<0.01, respectively), SOD activity was found to be lower (P<0.001) in the children with scoliosis as compared to age-matched controls. There was no significant difference between the groups for G-Px activity. Our data show that X-ray exposure causes increased 8-OHdG level, and decreased SOD activity, which both may reflect a tumor promoting condition. Increased p53 level may be interpreted as a compensatory effort of cell to X-ray mediated DNA damage.

  18. The anticancer effect of saffron in two p53 isogenic colorectal cancer cell lines

    PubMed Central

    2012-01-01

    Background Saffron extract, a natural product, has been shown to induce apoptosis in several tumor cell lines. Nevertheless, the p53-dependency of saffron’s mechanism of action in colon cancer remains unexplored. Material and methods In order to examine saffron’s anti-proliferative and pro-apoptotic effects in colorectal cancer cells, we treated two p53 isogenic HCT116 cell lines (HCT wildtype and HCT p53−/−) with different doses of the drug and analyzed cell proliferation and apoptosis in a time-dependent manner. MTT viability and crystal violet assays were performed in order to determine the effective dose of saffron on both cell lines. The cell cycle progress was examined by Flow cytometric analysis. Apoptosis was assessed using Annexin-PI-staining and Western Blotting for caspase 3 and PARP cleavage. Autophagy was determined by Western Blotting of the light chain 3 (LC3)-II and Beclin 1 proteins. The protein content of phospho-H2AX (γH2AX), a sensor of DNA double strand breaks, was also analyzed by Western Blotting. Results Saffron extract induced a p53-dependent pattern of cell cycle distribution with a full G2/M stop in HCT116 p53 wildtype cells. However, it induced a remarkable delay in S/G2 phase transit with entry into mitosis in HCT116 p53 −/− cells. The apoptotic Pre-G1 cell fraction as well as Annexin V staining and caspase 3 cleavage showed a more pronounced apoptosis induction in HCT116 p53 wildtype cells. Obviously, the significantly higher DNA-damage, reflected by ɣH2AX protein levels in cells lacking p53, was coped by up-regulation of autophagy. The saffron-induced LC3-II protein level was a remarkable indication of the accumulation of autophagosomes, a response to the cellular stress condition of drug treatment. Conclusions This is the first study showing the effect of saffron in HCT116 colorectal cancer cells with different p53 status. Saffron induced DNA-damage and apoptosis in both cell lines. However, autophagy has delayed the induction of apoptosis in HCT116 p53 −/− cells. Considering the fact that most tumors show a functional p53 inactivation, further research is needed to elucidate the long-term effects of saffron in p53 −/− tumors. PMID:22640402

  19. Pre-clinical efficacy and synergistic potential of the MDM2-p53 antagonists, Nutlin-3 and RG7388, as single agents and in combined treatment with cisplatin in ovarian cancer

    PubMed Central

    Zanjirband, Maryam; Edmondson, Richard J.; Lunec, John

    2016-01-01

    Ovarian cancer is the fifth leading cause of cancer-related female deaths. Due to serious side effects, relapse and resistance to standard chemotherapy, better and more targeted approaches are required. Mutation of the TP53 gene accounts for 50% of all human cancers. In the remaining malignancies, non-genotoxic activation of wild-type p53 by small molecule inhibition of the MDM2-p53 binding interaction is a promising therapeutic strategy. Proof of concept was established with the cis-imidazoline Nutlin-3, leading to the development of RG7388 and other compounds currently in early phase clinical trials. This preclinical study evaluated the effect of Nutlin-3 and RG7388 as single agents and in combination with cisplatin in a panel of ovarian cancer cell lines. Median-drug-effect analysis showed Nutlin-3 or RG7388 combination with cisplatin was additive to, or synergistic in a p53-dependent manner, resulting in increased p53 activation, cell cycle arrest and apoptosis, associated with increased p21WAF1 protein and/or caspase-3/7 activity compared to cisplatin alone. Although MDM2 inhibition activated the expression of p53-dependent DNA repair genes, the growth inhibitory and pro-apoptotic effects of p53 dominated the response. These data indicate that combination treatment with MDM2 inhibitors and cisplatin has synergistic potential for the treatment of ovarian cancer, dependent on cell genotype. PMID:27223080

  20. An in silico algorithm for identifying stabilizing pockets in proteins: test case, the Y220C mutant of the p53 tumor suppressor protein

    PubMed Central

    Bromley, Dennis; Bauer, Matthias R.; Fersht, Alan R.; Daggett, Valerie

    2016-01-01

    The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be ‘rescued’ and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952

  1. Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.

    PubMed

    Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M

    2015-12-01

    Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.

  2. Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer.

    PubMed

    Shen, Youfeng; Xu, Kaixiang; Yuan, Zaimei; Guo, Jianxiong; Zhao, Heng; Zhang, Xuezeng; Zhao, Lu; Qing, Yubo; Li, Honghui; Pan, Weirong; Jia, Baoyu; Zhao, Hong-Ye; Wei, Hong-Jiang

    2017-11-03

    Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Transcription activator-like effector nucleases (TALENs) were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO) cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT) for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19) were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean section after 38 days of gestation for genotyping. Finally, six live piglets and one stillborn piglet were collected from two recipients by caesarean section. Sequencing analyses of the target site confirmed the P53 biallelic knockout in all fetuses and piglets, consistent with the genotype of the donor cells. The qPCR analysis showed that the expression of the P53 mRNA had significant reduction in various tissues of the knockout piglets. Furthermore, confocal microscopy and western blotting analyses demonstrated that the fibroblast cells of Diannan miniature piglets with a P53 biallelic knockout were defective in mediating DNA damage when incubated with doxorubicin. TALENs combined with SCNT was successfully used to generate P53 KO Diannan miniature pigs. Although these genetically engineered Diannan miniature pigs had no tumorigenic signs, the P53 gene was dysfunctional. We believe that these pigs will provide powerful new resources for preclinical oncology and basic cancer research.

  3. Optional elements and variant structures in the productions of bei2 'to give' dative constructions in Cantonese-speaking adults and three-year-old children.

    PubMed

    Wong, Anita M-Y; Chow, Dorcas C-C; McBride-Cheng, Catherine; Stokes, Stephanie F

    2010-01-01

    To express object transfer, Cantonese-speakers use a 'ditransitive' ([V-R-T] or [V-T-R] where V=Verb, T=Theme, R=Recipient), or a more complex prepositional/serial-verb (P/SV) construction. Clausal elements in Cantonese datives can be optional (resulting in 'full' versus 'non-full' forms) or appear in variant orders (full non-canonical and full canonical). We report on usage of dative constructions with the word bei2 'to give' in 86 parents and 53 three-year-old children during conversations. The parents used more P/SV than ditransitive bei2-datives, and vice versa for the children. Both groups showed a similar usage pattern of optional elements and variant structures in their ditransitive and P/SV bei2-datives. The roles of multiple construction types, optional elements and variant structures in children's learning of bei2-dative constructions are described.

  4. Novel action modality of the diterpenoid anisomelic acid causes depletion of E6 and E7 viral oncoproteins in HPV-transformed cervical carcinoma cells.

    PubMed

    Paul, Preethy; Rajendran, Senthil Kumar; Peuhu, Emilia; Alshatwi, Ali A; Akbarsha, Mohammad A; Hietanen, Sakari; Eriksson, John E

    2014-05-15

    Cervical cancer, the second most common malignancy among women, is mainly caused by human papilloma virus (HPV) infection. In HPV-positive cervical cancer cells, the activity of p53 and the induction of p21 are inhibited by the HPV oncoproteins E6 and E7. Therefore, blocking the activity of E6 and E7 would serve as an important therapeutic target in these cancer cells. In this study, anisomelic acid (AA), a natural compound belonging to the same diterpenoid family of bioactive compounds as taxol, was found to deplete the E6 and E7 proteins in HPV-positive cervical cancer cells. Consequently, p53 and the p53-responsive gene, p21, were dramatically induced, leading to G2/M-phase cell cycle arrest. AA-mediated cell cycle arrest and p21 expression were canceled when p53 was down-regulated by p53-shRNA. AA also induced p53-independent intrinsic apoptosis by depletion of the cellular inhibitor of apoptosis protein 2 (cIAP2) whose proteosomal degradation is inhibited by E6. The in ovo chick embryo chorioallantoic membrane (CAM) assay showed that anisomelic acid inhibited the tumor growth of the cervical cancer SiHa cells. AA is revealed to hold a novel action modality based on specific targeting of the HPV oncoproteins, which restores p53-mediated growth arrest and induces apoptosis by terminating E6-mediated cIAP2 stabilization. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Autonomous feedback loop of RUNX1-p53-CBFB in acute myeloid leukemia cells.

    PubMed

    Morita, Ken; Noura, Mina; Tokushige, Chieko; Maeda, Shintaro; Kiyose, Hiroki; Kashiwazaki, Gengo; Taniguchi, Junichi; Bando, Toshikazu; Yoshida, Kenichi; Ozaki, Toshifumi; Matsuo, Hidemasa; Ogawa, Seishi; Liu, Pu Paul; Nakahata, Tatsutoshi; Sugiyama, Hiroshi; Adachi, Souichi; Kamikubo, Yasuhiko

    2017-11-30

    Although runt-related transcription factor 1 (RUNX1) and its associating core binding factor-β (CBFB) play pivotal roles in leukemogenesis, and inhibition of RUNX1 has now been widely recognized as a novel strategy for anti-leukemic therapies, it has been elusive how leukemic cells could acquire the serious resistance against RUNX1-inhibition therapies and also whether CBFB could participate in this process. Here, we show evidence that p53 (TP53) and CBFB are sequentially up-regulated in response to RUNX1 depletion, and their mutual interaction causes the physiological resistance against chemotherapy for acute myeloid leukemia (AML) cells. Mechanistically, p53 induced by RUNX1 gene silencing directly binds to CBFB promoter and stimulates its transcription as well as its translation, which in turn acts as a platform for the stabilization of RUNX1, thereby creating a compensative RUNX1-p53-CBFB feedback loop. Indeed, AML cells derived from relapsed cases exhibited higher CBFB expression levels compared to those from primary AML cells at diagnosis, and these CBFB expressions were positively correlated to those of p53. Our present results underscore the importance of RUNX1-p53-CBFB regulatory loop in the development and/or maintenance of AML cells, which could be targeted at any sides of this triangle in strategizing anti-leukemia therapies.

  6. P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest

    PubMed Central

    Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

    2015-01-01

    Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest. PMID:26512957

  7. P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.

    PubMed

    Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

    2015-10-29

    Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.

  8. SIRT1 activation mediates heat-induced survival of UVB damaged Keratinocytes.

    PubMed

    Calapre, Leslie; Gray, Elin S; Kurdykowski, Sandrine; David, Anthony; Descargues, Pascal; Ziman, Mel

    2017-06-10

    Exposure to heat stress after UVB irradiation induces a reduction of apoptosis, resulting in survival of DNA damaged human keratinocytes. This heat-mediated evasion of apoptosis appears to be mediated by activation of SIRT1 and inactivation of p53 signalling. In this study, we assessed the role of SIRT1 in the inactivation of p53 signalling and impairment of DNA damage response in UVB plus heat exposed keratinocytes. Activation of SIRT1 after multiple UVB plus heat exposures resulted in increased p53 deacetylation at K382, which is known to affect its binding to specific target genes. Accordingly, we noted decreased apoptosis and down regulation of the p53 targeted pro-apoptotic gene BAX and the DNA repair genes ERCC1 and XPC after UVB plus heat treatments. In addition, UVB plus heat induced increased expression of the cell survival gene Survivin and the proliferation marker Ki67. Notably, keratinocytes exposed to UVB plus heat in the presence of the SIRT1 inhibitor, Ex-527, showed a similar phenotype to those exposed to UV alone; i.e. an increase in p53 acetylation, increased apoptosis and low levels of Survivin. This study demonstrate that heat-induced SIRT1 activation mediates survival of DNA damaged keratinocytes through deacetylation of p53 after exposure to UVB plus heat.

  9. Simultaneous Analysis of P53 Protein Expression and Cell Proliferation in Irradiated Human Lymphocytes by Flow Cytometry

    PubMed Central

    de Freitas e Silva, Rafael; Gonçalves dos Santos, Neyliane Frassinetti; Pereira, Valéria Rěgo Alves; Amaral, Ademir

    2014-01-01

    P53 protein has an intrinsic role in modulating the cellular response against DNA radioinduced damages and has been pointed out as an indirect indicator of individual radiosensitivity. The rate of cell proliferation is also a parameter that has been related to tissue sensitivity to radiation. However, this feature is yet understudied. In this context, the aim of this work was to employ Flow Cytometry (FC) for simultaneously assessing of p53 protein expression levels together with cellular proliferation rate of irradiated human lymphocytes. From in vitro irradiated human blood samples, mononuclear cells were isolated and labeled with Carboxylfluorescein Diacetate Succinimidyl Ester (CFSE) prior to phytohaemagglutinin (PHA) stimulation in culture for 96 hours. Cells were also labeled with anti-p53 monoclonal antibody PE-conjugated in order to analyze either proliferation rate or p53 expression levels by FC. It was verified a reduction in the proliferation rate of irradiated lymphocytes and, in parallel, a rise in the p53 expression levels, similar for quiescent and proliferating lymphocytes. The results emphasize the importance of the use of CFSE-stained lymphocytes in assays associated to proliferation rate and the use of this methodology in several studies, such as for evaluating individual radiosensitivity. PMID:24659936

  10. Development of a Fish Cell Biosensor System for Genotoxicity Detection Based on DNA Damage-Induced Trans-Activation of p21 Gene Expression

    PubMed Central

    Geng, Deyu; Zhang, Zhixia; Guo, Huarong

    2012-01-01

    p21CIP1/WAF1 is a p53-target gene in response to cellular DNA damage. Here we report the development of a fish cell biosensor system for high throughput genotoxicity detection of new drugs, by stably integrating two reporter plasmids of pGL3-p21-luc (human p21 promoter linked to firefly luciferase) and pRL-CMV-luc (CMV promoter linked to Renilla luciferase) into marine flatfish flounder gill (FG) cells, referred to as p21FGLuc. Initial validation of this genotoxicity biosensor system showed that p21FGLuc cells had a wild-type p53 signaling pathway and responded positively to the challenge of both directly acting genotoxic agents (bleomycin and mitomycin C) and indirectly acting genotoxic agents (cyclophosphamide with metabolic activation), but negatively to cyclophosphamide without metabolic activation and the non-genotoxic agents ethanol and D-mannitol, thus confirming a high specificity and sensitivity, fast and stable response to genotoxic agents for this easily maintained fish cell biosensor system. This system was especially useful in the genotoxicity detection of Di(2-ethylhexyl) phthalate (DEHP), a rodent carcinogen, but negatively reported in most non-mammalian in vitro mutation assays, by providing a strong indication of genotoxicity for DEHP. A limitation for this biosensor system was that it might give false positive results in response to sodium butyrate and any other agents, which can trans-activate the p21 gene in a p53-independent manner. PMID:25585933

  11. Human papilloma virus type16 E6 deregulates CHK1 and sensitizes human fibroblasts to environmental carcinogens independently of its effect on p53

    PubMed Central

    Chen, Bo; Simpson, Dennis A.; Zhou, Yingchun; Mitra, Amritava; Mitchell, David L.; Cordeiro-Stone, Marila; Kaufmann, William K.

    2015-01-01

    After treatment with ultraviolet radiation (UV), human fibroblasts that express the HPV type 16 E6 oncoprotein display defects in repair of cyclobutane pyrimidine dimers, hypersensitivity to inactivation of clonogenic survival and an inability to sustain DNA replication. To determine whether these effects are specific to depletion of p53 or inactivation of its function, fibroblast lines were constructed with ectopic expression of a dominant-negative p53 allele (p53-H179Q) to inactivate function or a short-hairpin RNA (p53-RNAi) to deplete expression of p53. Only the expression of HPV16E6 sensitized fibroblasts to UV or the chemical carcinogen, benzo[a]pyrene diolepoxide I (BPDE). Carcinogen-treated cells expressing p53-H179Q or p53-RNAi were resistant to inactivation of colony formation and did not suffer replication arrest. CHK1 is a key checkpoint kinase in the response to carcinogen-induced DNA damage. Control and p53-RNAi-expressing fibroblasts displayed phosphorylation of Ser345 on CHK1 45–120 min after carcinogen treatment with a return to near baseline phosphorylation by 6 h after treatment. HPV16E6-expressing fibroblasts displayed enhanced and sustained phosphorylation of CHK1. This was associated with enhanced phosphorylation of Thr68 on CHK2 and Ser139 on H2AX, both markers of severe replication stress and DNA double strand breaks. Incubation with the phosphatase inhibitor okadaic acid produced more phosphorylation of CHK1 in UV-treated HPV16E6-expressing cells than in p53-H179Q-expressing cells suggesting that HPV16E6 may interfere with the recovery of coupled DNA replication at replication forks that are stalled at [6-4]pyrimidine-pyrimidone photoproducts and BPDE-DNA adducts. The results indicate that HPV16E6 targets a protein or proteins other than p53 to deregulate the activity of CHK1 in carcinogen-damaged cells. PMID:19411857

  12. Survivin safeguards chromosome numbers and protects from aneuploidy independently from p53

    PubMed Central

    2014-01-01

    Background Survivin, a member of the inhibitor of apoptosis (IAP) gene family, has a dual role in mitosis and in apoptosis. It is abundantly expressed in every human tumor, compared with normal tissues. During mitosis Survivin assembles with the chromosomal passenger complex and regulates chromosomal segregation. Here, we aim to explore whether interference with the mitotic function of Survivin is linked to p53-mediated G1 cell cycle arrest and affects chromosomal stability. Methods In this study, we used HCT116, SBC-2, and U87-MG and generated corresponding isogenic p53-deficient cells. Retroviral vectors were used to stably knockdown Survivin. The resulting phenotype, in particular the mechanisms of cell cycle arrest and of initiation of aneuploidy, were investigated by Western Blot analysis, confocal laser scan microscopy, proliferation assays, spectral karyotyping and RNAi. Results In all cell lines Survivin-RNAi did not induce instant apoptosis but caused polyplodization irrespective of p53 status. Strikingly, polyploidization after knockdown of Survivin resulted in merotelic kinetochore spindle assemblies, γH2AX-foci, and DNA damage response (DDR), which was accompanied by a transient p53-mediated G1-arrest. That p53 wild type cells specifically arrest due to DNA damage was shown by simultaneous inhibition of ATM and DNA-PK, which abolished induction of p21waf/cip. Cytogenetic analysis revealed chromosomal aberrations indicative for DNA double strand break repair by the mechanism of non-homologous end joining (NHEJ), only in Survivin-depleted cells. Conclusion Our findings suggest that Survivin plays an essential role in proper amphitelic kinetochore-spindle assembly and that constraining Survivin’s mitotic function results in polyploidy and aneuploidy which cannot be controlled by p53. Therefore, Survivin critically safeguards chromosomal stability independently from p53. PMID:24886358

  13. Exquisite Sensitivity of TP53 Mutant and Basal Breast Cancers to a Dose-Dense Epirubicin−Cyclophosphamide Regimen

    PubMed Central

    Espié, Marc; de Reyniès, Aurélien; Feugeas, Jean-Paul; Plassa, Louis-François; Soliman, Hany; Varna, Mariana; de Roquancourt, Anne; Lehmann-Che, Jacqueline; Beuzard, Yves; Marty, Michel; Misset, Jean-Louis; Janin, Anne; de Thé, Hugues

    2007-01-01

    Background In breast cancers, only a minority of patients fully benefit from the different chemotherapy regimens currently in use. Identification of markers that could predict the response to a particular regimen would thus be critically important for patient care. In cell lines or animal models, tumor protein p53 (TP53) plays a critical role in modulating the response to genotoxic drugs. TP53 is activated in response to DNA damage and triggers either apoptosis or cell-cycle arrest, which have opposite effects on cell fate. Yet, studies linking TP53 status and chemotherapy response have so far failed to unambiguously establish this paradigm in patients. Breast cancers with a TP53 mutation were repeatedly shown to have a poor outcome, but whether this reflects poor response to treatment or greater intrinsic aggressiveness of the tumor is unknown. Methods and Findings In this study we analyzed 80 noninflammatory breast cancers treated by frontline (neoadjuvant) chemotherapy. Tumor diagnoses were performed on pretreatment biopsies, and the patients then received six cycles of a dose-dense regimen of 75 mg/m2 epirubicin and 1,200 mg/m2 cyclophosphamide, given every 14 days. After completion of chemotherapy, all patients underwent mastectomies, thus allowing for a reliable assessment of chemotherapy response. The pretreatment biopsy samples were used to determine the TP53 status through a highly efficient yeast functional assay and to perform RNA profiling. All 15 complete responses occurred among the 28 TP53-mutant tumors. Furthermore, among the TP53-mutant tumors, nine out of ten of the highly aggressive basal subtypes (defined by basal cytokeratin [KRT] immunohistochemical staining) experienced complete pathological responses, and only TP53 status and basal subtype were independent predictors of a complete response. Expression analysis identified many mutant TP53-associated genes, including CDC20, TTK, CDKN2A, and the stem cell gene PROM1, but failed to identify a transcriptional profile associated with complete responses among TP53 mutant tumors. In patients with unresponsive tumors, mutant TP53 status predicted significantly shorter overall survival. The 15 patients with responsive TP53-mutant tumors, however, had a favorable outcome, suggesting that this chemotherapy regimen can overcome the poor prognosis generally associated with mutant TP53 status. Conclusions This study demonstrates that, in noninflammatory breast cancers, TP53 status is a key predictive factor for response to this dose-dense epirubicin–cyclophosphamide regimen and further suggests that the basal subtype is exquisitely sensitive to this association. Given the well-established predictive value of complete responses for long-term survival and the poor prognosis of basal and TP53-mutant tumors treated with other regimens, this chemotherapy could be particularly suited for breast cancer patients with a mutant TP53, particularly those with basal features. PMID:17388661

  14. A phase 1/2 study combining gemcitabine, Pegintron and p53 SLP vaccine in patients with platinum-resistant ovarian cancer.

    PubMed

    Dijkgraaf, Eveline M; Santegoets, Saskia J A M; Reyners, An K L; Goedemans, Renske; Nijman, Hans W; van Poelgeest, Mariëtte I E; van Erkel, Arien R; Smit, Vincent T H B M; Daemen, Toos A H H; van der Hoeven, Jacobus J M; Melief, Cornelis J M; Welters, Marij J P; Kroep, Judith R; van der Burg, Sjoerd H

    2015-10-13

    Preclinical tumor models show that chemotherapy has immune modulatory properties which can be exploited in the context of immunotherapy. The purpose of this study was to determine the feasibility and immunogenicity of combinations of such an immunomodulatory chemotherapeutic agent with immunotherapy, p53 synthetic long peptide (SLP) vaccine and Pegintron (IFN-α) in patients with platinum-resistant p53-positive epithelial ovarian cancer (EOC). This is a phase 1/2 trial in which patients sequential 6 cycles of gemcitabine (1000 mg/kg2 iv; n = 3), gemcitabine with Pegintron before and after the first gemcitabine cycle (Pegintron 1 μg/kg sc; n = 6), and gemcitabine and Pegintron combined with p53 SLP vaccine (0.3 mg/peptide, 9 peptides; n = 6). At baseline, 22 days after the 2nd and 6th cycle, blood was collected for immunomonitoring. Toxicity, CA-125, and radiologic response were evaluated after 3 and 6 cycles of chemotherapy. None of the patients enrolled experienced dose-limiting toxicity. Predominant grade 3/4 toxicities were nausea/vomiting and dyspnea. Grade 1/2 toxicities consisted of fatigue (78%) and Pegintron-related flu-like symptoms (72%). Gemcitabine reduced myeloid-derived suppressor cells (p = 0.0005) and increased immune-supportive M1 macrophages (p = 0.04). Combination of gemcitabine and Pegintron stimulated higher frequencies of circulating proliferating CD4+ and CD8+ T-cells but not regulatory T-cells. All vaccinated patients showed strong vaccine-induced p53-specific T-cell responses. Combination of gemcitabine, the immune modulator Pegintron and therapeutic peptide vaccination is a viable approach in the development of combined chemo-immunotherapeutic regimens to treat cancer.

  15. Low expression levels of ATM may substitute for CHEK2 /TP53 mutations predicting resistance towards anthracycline and mitomycin chemotherapy in breast cancer

    PubMed Central

    2012-01-01

    Introduction Mutations affecting p53 or its upstream activator Chk2 are associated with resistance to DNA-damaging chemotherapy in breast cancer. ATM (Ataxia Telangiectasia Mutated protein) is the key activator of p53 and Chk2 in response to genotoxic stress. Here, we sought to evaluate ATM's potential role in resistance to chemotherapy. Methods We sequenced ATM and assessed gene expression levels in pre-treatment biopsies from 71 locally advanced breast cancers treated in the neoadjuvant setting with doxorubicin monotherapy or mitomycin combined with 5-fluorouracil. Findings were confirmed in a separate patient cohort treated with epirubicin monotherapy. Each tumor was previously analyzed for CHEK2 and TP53 mutation status. Results While ATM mutations were not associated with chemo-resistance, low ATM expression levels predicted chemo-resistance among patients with tumors wild-type for TP53 and CHEK2 (P = 0.028). Analyzing the ATM-chk2-p53 cascade, low ATM levels (defined as the lower 5 to 50% percentiles) or mutations inactivating TP53 or CHEK2 robustly predicted anthracycline resistance (P-values varying between 0.001 and 0.027 depending on the percentile used to define "low" ATM levels). These results were confirmed in an independent cohort of 109 patients treated with epirubicin monotherapy. In contrast, ATM-levels were not suppressed in resistant tumors harboring TP53 or CHEK2 mutations (P > 0.5). Conclusions Our data indicate loss of function of the ATM-Chk2-p53 cascade to be strongly associated with resistance to anthracycline/mitomycin-containing chemotherapy in breast cancer. PMID:22420423

  16. A new role of GCN2 in the nucleolus.

    PubMed

    Nakamura, Akito; Kimura, Hiromichi

    2017-04-01

    General control nonderepressible 2 (GCN2) is activated by the accumulation of uncharged tRNA in response to amino acid shortage and regulates amino acid starvation response in the cytosol. Here we report the nucleolar localization of GCN2 and the association between GCN2 and small RNA transcripts. Immunofluorescence analysis revealed that GCN2 was constitutively localized to the nucleolus or recruited to the nucleolus by amino acid starvation stress. The nucleolus is the largest structure in the nucleus, where it primarily serves as the site of ribosome and RNA synthesis in addition to acting as a stress sensor through the regulation of p53 function. We found that siRNA-mediated depletion of GCN2 increases small RNA transcripts such as tRNA and 5S rRNA, and induces the p53 pathway activation. Derepression of these transcripts and p53 pathway activation by GCN2 depletion was restored by depletion of B-related factor 1 (BRF1), a primary subunit of RNA polymerase III (pol III) components. These data suggest that the excess amount of small RNA transcripts following GCN2 depletion was responsible for the p53 activation. Our findings reveal a role of GCN2 in the nucleolus that is involved in the expression of small RNA transcripts and serves as alternative stress-sensing machinery for nutrient deficiency. Thus, GCN2 may play pivotal roles in multiple protein translation checkpoints in both the nucleolus and cytosol. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Shorter telomere length in peripheral blood lymphocytes of workers exposed to polycyclic aromatic hydrocarbons

    PubMed Central

    Pavanello, Sofia; Pesatori, Angela-C.; Dioni, Laura; Hoxha, Mirjam; Bollati, Valentina; Siwinska, Ewa; Mielzyńska, Danuta; Bolognesi, Claudia; Bertazzi, Pier-Alberto; Baccarelli, Andrea

    2010-01-01

    Shorter telomere length (TL) in peripheral blood lymphocytes (PBLs) is predictive of lung cancer risk. Polycyclic aromatic hydrocarbons (PAHs) are established lung carcinogens that cause chromosome instability. Whether PAH exposure and its molecular effects are linked with shorter TL has never been evaluated. In the present study, we investigated the effect of chronic exposure to PAHs on TL measured in PBLs of Polish male non-current smoking cokeoven workers and matched controls. PAH exposure and molecular effects were characterized using measures of internal dose (urinary 1-pyrenol), effective dose [anti-benzo[a]pyrene diolepoxide (anti-BPDE)–DNA adduct], genetic instability (micronuclei, MN) and DNA methylation [p53 promoter and Alu and long interspersed nuclear element-1 (LINE-1) repetitive elements, as surrogate measures of global methylation] in PBLs. TL was measured by real-time polymerase chain reaction. Cokeoven workers were heavily exposed to PAHs (79% exceeded the urinary 1-pyrenol biological exposure index) and exhibited lower TL (P = 0.038) than controls, as well as higher levels of genetic and chromosomal alterations [i.e. anti-BPDE–DNA adduct and MN (P < 0.0001)] and epigenetic changes [i.e. p53 gene-specific promoter and global methylation (P ≤ 0.001)]. TL decreased with longer duration of work as cokeoven worker (P = 0.039) and in all subjects with higher levels of anti-BPDE–DNA adduct (P = 0.042), p53 hypomethylation (P = 0.005) and MN (P = 0.009). In multivariate analysis, years of work in cokery (P = 0.008) and p53 hypomethylation (P = 0.001) were the principal determinants of shorter TL. Our results indicate that shorter TL is associated with chronic PAH exposure. The interrelations with other genetic and epigenetic mechanisms in our data suggest that shorter TL could be a central event in PAH carcinogenesis. PMID:19892797

  18. p53 independent induction of PUMA mediates intestinal apoptosis in response to ischaemia–reperfusion

    PubMed Central

    Wu, Bin; Qiu, Wei; Wang, Peng; Yu, Hui; Cheng, Tao; Zambetti, Gerard P; Zhang, Lin; Yu, Jian

    2007-01-01

    Background The small intestine is highly sensitive to ischaemia–reperfusion (I/R) induced injury which is associated with high morbidity and mortality. Apoptosis, or programmed cell death, is a major mode of cell death occurring during I/R induced injury. However, the mechanisms by which I/R cause apoptosis in the small intestine are poorly understood. p53 upregulated modulator of apoptosis (PUMA) is a p53 downstream target and a member of the BH3‐only group of Bcl‐2 family proteins. It has been shown that PUMA plays an essential role in apoptosis induced by a variety of stimuli in different tissues through a mitochondrial pathway. Aims The role of PUMA in I/R induced injury and apoptosis in the small intestine was investigated. The mechanisms by which PUMA is regulated in I/R induced intestinal apoptosis were also studied. Methods Ischaemia was induced by superior mesenteric artery occlusion in the mouse small intestine. Induction of PUMA in response to ischaemia alone, or ischaemia followed by reperfusion (I/R), was examined. I/R induced intestinal apoptosis and injury were compared between PUMA knockout and wild‐type mice. The mechanisms of I/R induced and PUMA mediated apoptosis were investigated through analysis of caspase activation, cytosolic release of mitochondrial cytochrome c and alterations of the proapoptotic Bcl‐2 family proteins Bax and Bak. To determine whether PUMA is induced by reactive oxygen species and/or reactive nitrogen species generated by I/R, superoxide dismutase (SOD) and N‐nitro‐L‐arginine methyl ester (L‐NAME) were used to treat animals before I/R. To determine whether p53 is involved in regulating PUMA during I/R induced apoptosis, PUMA induction and apoptosis in response to I/R were examined in p53 knockout mice. Results PUMA was markedly induced following I/R in the mucosa of the mouse small intestine. I/R induced intestinal apoptosis was significantly attenuated in PUMA knockout mice compared with that in wild‐type mice. I/R induced caspase 3 activation, cytochrome c release, Bax mitochondrial translocation and Bak multimerisation were also inhibited in PUMA knockout mice. SOD or L‐NAME significantly blunted I/R induced PUMA expression and apoptosis. Furthermore, I/R induced PUMA expression and apoptosis in the small intestine were not affected in the p53 knockout mice. Conclusions Our data demonstrated that PUMA is activated by oxidative stress in response to I/R to promote p53 independent apoptosis in the small intestine through the mitochondrial pathway. Inhibition of PUMA is potentially useful for protecting against I/R induced intestinal injury and apoptosis. PMID:17127703

  19. Comparative Assessment of Vitamin-B12, Folic Acid and Homocysteine Levels in Relation to p53 Expression in Megaloblastic Anemia.

    PubMed

    Yadav, Manish K; Manoli, Nandini M; Madhunapantula, SubbaRao V

    2016-01-01

    Megaloblastic anemia (MBA), also known as macrocytic anemia, is a type of anemia characterized by decreased number of RBCs as well as the presence of unusually large, abnormal and poorly developed erythrocytes (megaloblasts), which fail to enter blood circulation due to their larger size. Lack of vitamin-B12 (VB12) and / or folate (Vitamin-B9, VB9) with elevated homocysteine is the key factor responsible for megaloblastic anemia. Prior studies have demonstrated the induction of apoptosis in these abnormal under-developed erythrocytes. However, it is not clear whether this apoptosis induction is due to elevated p53 level or due to any other mechanism. Furthermore, it is also not fully known whether decreased vitamin-B12 and / or folate are responsible for apoptosis induction mediated by p53 in pre-erythroblasts. Levels of serum VB9, VB12 and homocysteine in 50 patients suffering from MBA were compared with 50 non-megaloblastic anemia control subjects, who were referred by the clinicians for bone marrow examination for medical conditions other than MBA. Next, we have measured the p53 expression in the paraffin embedded blocks prepared from bone marrow biopsy, using immunohistochemistry, and the expression levels correlated with VB9 and VB12 levels. Out of 50 MBA patients 40 (80%) and 44 (88%) subjects had very low VB12 and VB9 levels respectively. In contrast, only 2 (4%) and 12 (24%) non-megaloblastic anemia controls, out of 50 subjects, had low VB12 and VB9 respectively. Correlating with low vitamin B9 and B12, the homocysteine levels were high in 80% cases. But, only 20% non-megaloblastic controls exhibited high homocysteine in plasma. Immunohistochemical analysis for p53 expression showed a significantly high level of expression in MBA cases and no-or very low-expression in control subjects. Our correlation studies comparing the VB12 and VB9 levels with p53 expression concludes unusually high p53 levels in patients suffering from VB12 and VB9 deficiency induced MBA compared to control subjects not suffering from MBA. Tumor protein p53 is the key protein expressed heavily in the bone marrow biopsies of patients suffering from VB12 and VB9 deficiency induced MBA but not in control subjects. Hence, p53 expression could be used as a surrogate marker for confirming the VB9 and VB12 induced MBA.

  20. Comparative Assessment of Vitamin-B12, Folic Acid and Homocysteine Levels in Relation to p53 Expression in Megaloblastic Anemia

    PubMed Central

    Yadav, Manish K.; Manoli, Nandini M.

    2016-01-01

    Background Megaloblastic anemia (MBA), also known as macrocytic anemia, is a type of anemia characterized by decreased number of RBCs as well as the presence of unusually large, abnormal and poorly developed erythrocytes (megaloblasts), which fail to enter blood circulation due to their larger size. Lack of vitamin-B12 (VB12) and / or folate (Vitamin-B9, VB9) with elevated homocysteine is the key factor responsible for megaloblastic anemia. Prior studies have demonstrated the induction of apoptosis in these abnormal under-developed erythrocytes. However, it is not clear whether this apoptosis induction is due to elevated p53 level or due to any other mechanism. Furthermore, it is also not fully known whether decreased vitamin-B12 and / or folate are responsible for apoptosis induction mediated by p53 in pre-erythroblasts. Methods Levels of serum VB9, VB12 and homocysteine in 50 patients suffering from MBA were compared with 50 non-megaloblastic anemia control subjects, who were referred by the clinicians for bone marrow examination for medical conditions other than MBA. Next, we have measured the p53 expression in the paraffin embedded blocks prepared from bone marrow biopsy, using immunohistochemistry, and the expression levels correlated with VB9 and VB12 levels. Results Out of 50 MBA patients 40 (80%) and 44 (88%) subjects had very low VB12 and VB9 levels respectively. In contrast, only 2 (4%) and 12 (24%) non-megaloblastic anemia controls, out of 50 subjects, had low VB12 and VB9 respectively. Correlating with low vitamin B9 and B12, the homocysteine levels were high in 80% cases. But, only 20% non-megaloblastic controls exhibited high homocysteine in plasma. Immunohistochemical analysis for p53 expression showed a significantly high level of expression in MBA cases and no—or very low—expression in control subjects. Our correlation studies comparing the VB12 and VB9 levels with p53 expression concludes unusually high p53 levels in patients suffering from VB12 and VB9 deficiency induced MBA compared to control subjects not suffering from MBA. Conclusion Tumor protein p53 is the key protein expressed heavily in the bone marrow biopsies of patients suffering from VB12 and VB9 deficiency induced MBA but not in control subjects. Hence, p53 expression could be used as a surrogate marker for confirming the VB9 and VB12 induced MBA. PMID:27780269

  1. BTK blocks the inhibitory effects of MDM2 on p53 activity

    PubMed Central

    Rada, Miran; Althubiti, Mohammad; Ekpenyong-Akiba, Akang E.; Lee, Koon-Guan; Lam, Kong Peng; Fedorova, Olga; Barlev, Nickolai A.; Macip, Salvador

    2017-01-01

    p53 is a tumour suppressor that is activated in response to various types of stress. It is regulated by a complex pattern of over 50 different post-translational modifications, including ubiquitination by the E3 ligase MDM2, which leads to its proteasomal degradation. We have previously reported that expression of Bruton’s Tyrosine Kinase (BTK) induces phosphorylation of p53 at the N-terminus, including Serine 15, and increases its protein levels and activity. The mechanisms involved in this process are not completely understood. Here, we show that BTK also increases MDM2 and is necessary for MDM2 upregulation after DNA damage, consistent with what we have shown for other p53 target genes. Moreover, we found that BTK binds to MDM2 on its PH domain and induces its phosphorylation. This suggested a negative regulation of MDM2 functions by BTK, supported by the fact BTK expression rescued the inhibitory effects of MDM2 on p53 transcriptional activity. Indeed, we observed that BTK mediated the loss of the ubiquitination activity of MDM2, a process that was dependent on the phosphorylation functions of BTK. Our data together shows that the kinase activity of BTK plays an important role in disrupting the MDM2-p53 negative feedback loop by acting at different levels, including binding to and inactivation of MDM2. This study provides a potential mechanism to explain how BTK modulates p53 functions. PMID:29290977

  2. Knockdown of hepatoma-derived growth factor-related protein-3 induces apoptosis of H1299 cells via ROS-dependent and p53-independent NF-κB activation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yun, Hong Shik; Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791; Baek, Jeong-Hwa

    2014-07-11

    Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates themore » radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells.« less

  3. Loss of p53 protein during radiation transformation of primary human mammary epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wazer, D.E.; Chu, Qiuming; Liu, Xiao Long

    1994-04-01

    The causative factors leading to breast cancer are largely unknown. Increased incidence of breast cancer following diagnostic or therapeutic radiation suggests that radiation may contribute to mammary oncogenesis. This report describes the in vitro neoplastic transformation of a normal human mammary epithelial cell strain, 76N, by fractionated [gamma]-irradiation at a clinically used dose (30 Gy). The transformed cells (76R-30) were immortal, had reduced growth factor requirements, and produced tumors in nude mice. Remarkably, the 76R-30 cells completely lacked the p53 tumor suppressor protein. Loss of p53 was due to deletion of the gene on one allele and a 26-bp deletionmore » within the third intron on the second allele which resulted in abnormal splicing out of either the third or fourth exon from the mRNA. PCR with a mutation-specific primer showed that intron 3 mutation was present in irradiated cells before selection for immortal phenotype. 76R-30 cells did not exhibit G[sub 1] arrest in response to radiation, indicating a loss of p53-mediated function. Expression of the wild-type p53 gene in 76R-30 cells led to their growth inhibition. Thus, loss of p53 protein appears to have contributed to neoplastic transformation of these cells. This unique model should facilitate analyses of molecular mechanisms of radiation-induced breast cancer and allow identification of p53-regulated cellular genes in breast cells. 44 refs., 8 figs., 1 tab.« less

  4. Infrasound-array-element frequency response: in-situ measurement and modeling

    NASA Astrophysics Data System (ADS)

    Gabrielson, T.

    2011-12-01

    Most array elements at the infrasound stations of the International Monitoring System use some variant of a multiple-inlet pipe system for wind-noise suppression. These pipe systems have a significant impact on the overall frequency response of the element. The spatial distribution of acoustic inlets introduces a response dependence that is a function of frequency and of vertical and horizontal arrival angle; the system of inlets, pipes, and summing junctions further shapes that response as the signal is ducted to the transducer. In-situ measurements, using a co-located reference microphone, can determine the overall frequency response and diagnose problems with the system. As of July 2011, the in-situ frequency responses for 25 individual elements at 6 operational stations (I10, I53, I55, I56, I57, and I99) have been measured. In support of these measurements, a fully thermo-viscous model for the acoustics of these multiple-inlet pipe systems has been developed. In addition to measurements at operational stations, comparative analyses have been done on experimental systems: a multiple-inlet radial-pipe system with varying inlet hole size; a one-quarter scale model of a 70-meter rosette system; and vertical directionality of a small rosette system using aircraft flyovers. [Funded by the US Army Space and Missile Defense Command

  5. Involvement of 53BP1, a p53 Binding Protein, in Chk2 Phosphorylation of p53 and DNA Damage Cell Cycle Checkpoints

    DTIC Science & Technology

    2005-05-01

    NaC1, 1 mM EDTA, 1% NP40 supplemented required for cell survival. Mal. Cell. Biol. 22, 555-566 (2002). with protease inhibitors (Roche) and Benzonase...response is delayed or inhibited by treatment with the PIK this fact. inhibitors caffeine and wortmannin. 53BP1 foci also overlap I1 A fellow of the U...ltr Xbal __BTK_ _ WT 2,6 kB VICTR54 LTR NEO PGK BTK LT 8A 4DSI) inutant 1.5 LII + 13 D A +C +1tr rtrtr Neo 2 kR-’ c +i+ +i+tr tr/tr 2 3 A b

  6. Mitochondrial DNA maintenance is regulated in human hepatoma cells by glycogen synthase kinase 3β and p53 in response to tumor necrosis factor α.

    PubMed

    Vadrot, Nathalie; Ghanem, Sarita; Braut, Françoise; Gavrilescu, Laura; Pilard, Nathalie; Mansouri, Abdellah; Moreau, Richard; Reyl-Desmars, Florence

    2012-01-01

    During chronic liver inflammation, up-regulated Tumor Necrosis Factor alpha (TNF-α) targets hepatocytes and induces abnormal reactive oxygen species (ROS) production responsible for mitochondrial DNA (mtDNA) alterations. The serine/threonine Glycogen Synthase Kinase 3 beta (GSK3β) plays a pivotal role during inflammation but its involvement in the maintenance of mtDNA remains unknown. The aim of this study was to investigate its involvement in TNF-α induced mtDNA depletion and its interrelationship with p53 a protein known to maintain mtDNA copy numbers. Using quantitative polymerase chain reaction (qPCR) we found that at 30 min in human hepatoma HepG2 cells TNF-α induced 0.55±0.10 mtDNA lesions per 10 Kb and a 52.4±2.8% decrease in mtDNA content dependent on TNF-R1 receptor and ROS production. Both lesions and depletion returned to baseline from 1 to 6 h after TNF-α exposure. Luminol-amplified chemiluminescence (LAC) was used to measure the rapid (10 min) and transient TNF-α induced increase in ROS production (168±15%). A transient 8-oxo-dG level of 1.4±0.3 ng/mg DNA and repair of abasic sites were also measured by ELISA assays. Translocation of p53 to mitochondria was observed by Western Blot and co-immunoprecipitations showed that TNF-α induced p53 binding to GSK3β and mitochondrial transcription factor A (TFAM). In addition, mitochondrial D-loop immunoprecipitation (mtDIP) revealed that TNF-α induced p53 binding to the regulatory D-loop region of mtDNA. The knockdown of p53 by siRNAs, inhibition by the phosphoSer(15)p53 antibody or transfection of human mutant active GSK3βS9A pcDNA3 plasmid inhibited recovery of mtDNA content while blockade of GSK3β activity by SB216763 inhibitor or knockdown by siRNAs suppressed mtDNA depletion. This study is the first to report the involvement of GSK3β in TNF-α induced mtDNA depletion. We suggest that p53 binding to GSK3β, TFAM and D-loop could induce recovery of mtDNA content through mtDNA repair.

  7. In vivo and in vitro cloning and phenotype characterization of tellurite resistance determinant conferred by plasmid pTE53 of a clinical isolate of Escherichia coli.

    PubMed

    Burian, J; Tu, N; Kl'ucár, L; Guller, L; Lloyd-Jones, G; Stuchlík, S; Fejdi, P; Siekel, P; Turna, J

    1998-01-01

    A determinant encoding resistance against potassium tellurite (Te(r)) was discovered in a clinical isolate of Escherichia coli strain KL53. The strain formed typical black colonies on solid LB medium with tellurite. The determinant was located on a large conjugative plasmid designated pTE53. Electron-dense particles were observed in cells harboring pTE53 by electron microscopy. X-Ray identification analysis identified these deposits as elemental tellurium and X-ray diffraction analysis showed patterns typical of crystalline structures. Comparison with JCPDS 4-0554 (Joint Committee on Powder Diffraction Standards) reference data confirmed that these crystals were pure tellurium crystals. In common with other characterized Te(r) determinants, accumulation studies with radioactively labeled tellurite showed that reduced uptake of tellurite did not contribute to the resistance mechanism. Tellurite accumulation rates for E. coli strain AB1157 harboring pTE53 were twice higher than for the plasmid-free host strain. In addition, no efflux mechanism was detected. The potassium tellurite resistance determinant of plasmid pTE53 was cloned using both in vitro and in vivo techniques in low-copy-number vectors pACYC184 and mini-Mu derivative pPR46. Cloning of the functional Te(r) determinant into high-copy cloning vectors pTZ19R and mini-Mu derivatives pBEf and pJT2 was not successful. During in vivo cloning experiments, clones with unusual "white colony" phenotypes were found on solid LB with tellurite. All these clones were Mucts62 lysogens. Their tellurite resistance levels were in the same order as the wild type strains. Clones with the "white" phenotype had a 3.6 times lower content of tellurium than the tellurite-reducing strain. Transformation of a "white" mutant with a recombinant pACYC184 based Te(r) plasmid did not change the phenotype. However, when one clone was cured from Mucts62 the "white" phenotype reverted to the wild-type "black" phenotype. It was suggested that the "white" phenotype was the result of an insertional inactivation of an unknown chromosomal gene by Mucts62, which reduced the tellurite uptake.

  8. Oral bacteria in pancreatic cancer: mutagenesis of the p53 tumour suppressor gene

    PubMed Central

    Öğrendik, Mesut

    2015-01-01

    Carcinoma of exocrine pancreas is the fourth leading cause of cancer deaths, worldwide. The prevalence of this disease is very high in patients with chronic pancreatitis. Orodigestive cancers are frequently seen in patients with periodontitis. These findings suggest that this type of cancer may have some bacterial origins. This study hypothesizes that the peptidyl arginine deaminase (PAD) enzymes found in oral bacteria may be responsible for the p53 point mutations that occur in patients with pancreatic cancer. Porphyromonas gingivalis, Prevotella intermedia, Tannerella forsythia, and Treponema denticola possess the PAD enzyme, and p53 arginine mutations have been detected in patients with pancreatic cancer. Moreover, the Pro allele p53Arg72-Pro is a risk factor for the development of this cancer. Anti-P. gingivalis antibody titers have been found to be higher in patients with pancreatic cancer as compared to healthy controls. The hypothesis in question can be tested if the DNA of P. gingivalis or the antibodies against P. gingivalis can be detected in patients with the p53 arginine mutation.If this hypothesis is true, it could reveal the real cause of pancreatic cancer, which is a fatal disease. Further studies are necessary in order to confirm this hypothesis. PMID:26617937

  9. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    PubMed

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression.

  10. Prognostic value of tumor suppressors in osteosarcoma before and after neoadjuvant chemotherapy.

    PubMed

    Robl, Bernhard; Pauli, Chantal; Botter, Sander Martijn; Bode-Lesniewska, Beata; Fuchs, Bruno

    2015-05-09

    Primary bone cancers are among the deadliest cancer types in adolescents, with osteosarcomas being the most prevalent form. Osteosarcomas are commonly treated with multi-drug neoadjuvant chemotherapy and therapy success as well as patient survival is affected by the presence of tumor suppressors. In order to assess the prognostic value of tumor-suppressive biomarkers, primary osteosarcoma tissues were analyzed prior to and after neoadjuvant chemotherapy. We constructed a tissue microarray from high grade osteosarcoma samples, consisting of 48 chemotherapy naïve biopsies (BXs) and 47 tumor resections (RXs) after neoadjuvant chemotherapy. We performed immunohistochemical stainings of P53, P16, maspin, PTEN, BMI1 and Ki67, characterized the subcellular localization and related staining outcome with chemotherapy response and overall survival. Binary logistic regression analysis was used to analyze chemotherapy response and Kaplan-Meier-analysis as well as the Cox proportional hazards model was applied for analysis of patient survival. No significant associations between biomarker expression in BXs and patient survival or chemotherapy response were detected. In univariate analysis, positive immunohistochemistry of P53 (P = 0.008) and P16 (P16; P = 0.033) in RXs was significantly associated with poor survival prognosis. In addition, presence of P16 in RXs was associated with poor survival in multivariate regression analysis (P = 0.003; HR = 0.067) while absence of P16 was associated with good chemotherapy response (P = 0.004; OR = 74.076). Presence of PTEN on tumor RXs was significantly associated with an improved survival prognosis (P = 0.022). Positive immunohistochemistry (IHC) of P16 and P53 in RXs was indicative for poor overall patient survival whereas positive IHC of PTEN was prognostic for good overall patient survival. In addition, we found that P16 might be a marker of osteosarcoma chemotherapy resistance. Therefore, our study supports the use of tumor RXs to assess the prognostic value of biomarkers.

  11. Preliminary report on the effect of brachytherapy on expression of p53, bc1-2 and apoptosis in squamous cell carcinoma of the oesophagus.

    PubMed

    Sur, Monalisa; Sur, Ranjan K; Cooper, Kum; Bizos, Damon

    2003-02-01

    Pre-brachytherapy biopsies and post-brachytherapy oesophagectomy specimens of 10 patients with early squamous cell carcinoma of the middle third of the oesophagus were examined for the expression of p53, bcl-2 and apoptosis using immunohistochemical markers. There was no expression of p53 in one patient in both pre- and post-brachytherapy specimens. In 8 patients, p53 staining was strongly positive (3+) with approximately 50% or more cells, and with diffuse and no specific pattern in the pre-brachytherapy biopsies. The tumour areas of the post-brachytherapy specimens of this group showed strong 3+ positivity with p53 (10-50% positive cell count), with the pattern being focal and peripheral in the tumour islands. The centre of the tumour islands showed necrosis and/or keratinisation. In one patient, the pre-brachytherapy biopsy showed expression of p53 while the post-brachytherapy specimen was negative. bcl-2 expression in both pre- and post-brachytherapy was equivocal and inconclusive in both the pre- and post-brachytherapy specimens. Apoptosis was negative in all the pre- and post-brachytherapy tissue sections in the presence of positive controls. Brachytherapy does not cause cell death by apoptosis but by necrosis and maturation of the cells into better differentiated cells, which is caused by OH free radical, and induction of the keratin gene respectively. It is possible that brachytherapy may cause destruction of cells containing wild-type p53, while mutant p53 in cells located at the tumour periphery escape the effect of brachytherapy. This may be responsible for the high incidence of local recurrence and distant metastasis in oesophageal cancer treated with radiotherapy. There is no effect of brachytherapy on bcl-2 expression in oesophageal cancer.

  12. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  13. Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts

    NASA Technical Reports Server (NTRS)

    Thomas, M. J.; Umayahara, Y.; Shu, H.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

    1996-01-01

    Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal activation of IGF-I gene transcription by cAMP in osteoblasts.

  14. The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR

    PubMed Central

    Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

    2010-01-01

    Summary The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca2+-independent-phospholipase A2 (iPLA2). We previously reported that inhibition of iPLA2 arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA2 induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA2. The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA2-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway. PMID:18032786

  15. The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR.

    PubMed

    Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

    2007-12-01

    The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca(2+)-independent-phospholipase A(2) (iPLA(2)). We previously reported that inhibition of iPLA(2) arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA(2) induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA(2). The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA(2)-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Serk In, E-mail: serkin@korea.edu; The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul; Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while theremore » was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.« less

  17. Alcohol alters hepatic FoxO1, p53, and mitochondrial SIRT5 deacetylation function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lieber, Charles S.; Department of Medicine, Mount Sinai School of Medicine, New York, NY 10029; Leo, Maria Anna

    2008-08-22

    Chronic alcohol consumption affects the gene expression of a NAD-dependent deacetylase Sirtuis 1 (SIRT1) and the peroxisome proliferator-activated receptor-{gamma} coactivator1{alpha} (PGC-1{alpha}). Our aim was to verify that it also alters the forkhead (FoxO1) and p53 transcription factor proteins, critical in the hepatic response to oxidative stress and regulated by SIRT1 through its deacetylating capacity. Accordingly, rats were pair-fed the Lieber-DeCarli alcohol-containing liquid diets for 28 days. Alcohol increased hepatic mRNA expression of FoxO1 (p = 0.003) and p53 (p = 0.001) while corresponding protein levels remained unchanged. However phospho-FoxO1 and phospho-Akt (protein kinase) were both decreased by alcohol consumption (pmore » = 0.04 and p = 0.02, respectively) while hepatic p53 was found hyperacetylated (p = 0.017). Furthermore, mitochondrial SIRT5 was reduced (p = 0.0025), and PGC-1{alpha} hyperacetylated (p = 0.027), establishing their role in protein modification. Thus, alcohol consumption disrupts nuclear-mitochondrial interactions by post-translation protein modifications, which contribute to alteration of mitochondrial biogenesis through the newly discovered reduction of SIRT5.« less

  18. SIAH1-induced p34SEI-1 polyubiquitination/degradation mediates p53 preferential vitamin C cytotoxicity.

    PubMed

    Lee, Soonduck; Kim, Jinsun; Jung, Samil; Li, Chengping; Yang, Young; Kim, Keun Il; Lim, Jong-Seok; Kim, Yonghwan; Cheon, Choong-Il; Lee, Myeong-Sok

    2015-03-01

    Vitamin C is considered as an important anticancer therapeutic agent although this view is debatable. In this study, we introduce a physiological mechanism demonstrating how vitamin C exerts anticancer activity that induces cell cycle arrest and apoptosis. Our previous and current data reveal that p53 tumor suppressor is the prerequisite factor for stronger anticancer effects of vitamin C. In addition, vitamin C-mediated cancer cell cytotoxicity appears to be achieved at least partly through the downregulation of the p34SEI-1 oncoprotein. Our previous study showed that p34SEI-1 increases the survival of various types of cancer cells by inhibiting their apoptosis. Present data suggest that vitamin C treatment decreases the p34SEI-1 expression at the protein level and therefore alleviates its anti-apoptotic activity. Of note, SIAH1, E3 ubiquitin ligase, appears to be responsible for the p34SEI-1 polyubiquitination and its subsequent degradation, which is dependent on p53. In summary, vitamin C increases cancer cell death by inducing SIAH1-mediated polyubiquitination/degradation of the p34SEI-1 oncoprotein in a p53-dependent manner.

  19. Plant growth, nutrients and potentially toxic elements in leaves of yerba mate clones in response to phosphorus in acid soils.

    PubMed

    Barbosa, Julierme Z; Motta, Antonio C V; Consalter, Rangel; Poggere, Giovana C; Santin, Delmar; Wendling, Ivar

    2018-01-01

    Native to subtropical region of South America, yerba mate is responsive to P under some conditions, but the degree of influence of genetic and soil on the growth and composition of the leaf is unknown. The aim of study was to evaluate plant growth, nutrients and potentially toxic elements in leaves of yerba mate clones in response to P application in acid soils. In greenhouse condition, two yerba mate clone seedlings were grown (210 days) in pots, each clone in a completely randomized design in factorial scheme (with and without P; four acid soils). The elemental composition of leaves and the growth of plants were determined. Phosphorus promoted plant growth, but this was not accompanied by increased P in leaf tissue in all conditions tested. The P effect on the elemental composition varied: decrease/null (N, K, Mg, Mn, Cu, Ni, B, Mo, Al, Cd); increase/null (C/N, C, Ca, Fe, V); increase/decrease/null (Zn, Ba, Pb) and; null (Cr). The soils affect the elemental composition of the leaves, especially Mn, with accumulation greater than 1000 mg kg-1. The Ba, Pb, Al and Zn in the leaves varied among clones. Yerba mate response to P was affected by edaphic and plant factors.

  20. Where does allogeneic stem cell transplantation fit in the treatment of chronic lymphocytic leukemia?

    PubMed

    Dreger, Peter; Montserrat, Emili

    2015-03-01

    Allogeneic hematopoietic stem cell transplantation (alloHSCT) has been considered as the treatment of choice for patients with high-risk chronic lymphocytic leukemia (CLL) (i.e., refractory to purine analogs, short response (<24 months) to intensive treatments, and/or presence of 17p/TP53 abnormalities). Currently, new and highly effective therapeutic agents targeting BCR-mediated intracellular signal transduction have been incorporated into the CLL treatment armamentarium. These signal transduction inhibitors (STI) will change the algorithms of high-risk CLL (HR-CLL) management. Despite the limited body of evidence, there is sufficient rationale for withholding alloHSCT in patients with 17p-/TP53mut CLL in first remission. In contrast, the perspectives of patients with relapsed 17p-/TP53mut CLL remain uncertain even if responding to STI. The same accounts for patients with HR-CLL progressing under STI. In both scenarios, it is reasonable to consider alloHSCT, ideally after response to alternative STI regimens.

Top