Sample records for pair creation probability

  1. Sauter-Schwinger pair creation dynamically assisted by a plane wave

    NASA Astrophysics Data System (ADS)

    Torgrimsson, Greger; Schneider, Christian; Schützhold, Ralf

    2018-05-01

    We study electron-positron pair creation by a strong and constant electric field superimposed with a weaker transversal plane wave which is incident perpendicularly (or under some angle). Comparing the fully nonperturbative approach based on the world-line instanton method with a perturbative expansion into powers of the strength of the weaker plane wave, we find good agreement—provided that the latter is carried out to sufficiently high orders. As usual for the dynamically assisted Sauter-Schwinger effect, the additional plane wave induces an exponential enhancement of the pair-creation probability if the combined Keldysh parameter exceeds a certain threshold.

  2. Strangeness suppression of qq creation observed in exclusive reactions.

    PubMed

    Mestayer, M D; Park, K; Adhikari, K P; Aghasyan, M; Pereira, S Anefalos; Ball, J; Battaglieri, M; Batourine, V; Bedlinskiy, I; Biselli, A S; Boiarinov, S; Briscoe, W J; Brooks, W K; Burkert, V D; Carman, D S; Celentano, A; Chandavar, S; Charles, G; Colaneri, L; Cole, P L; Contalbrigo, M; Cortes, O; Crede, V; D'Angelo, A; Dashyan, N; De Vita, R; Deur, A; Djalali, C; Doughty, D; Dupre, R; El Alaoui, A; El Fassi, L; Elouadrhiri, L; Eugenio, P; Fedotov, G; Fleming, J A; Forest, T A; Garillon, B; Garçon, M; Ghandilyan, Y; Gilfoyle, G P; Giovanetti, K L; Girod, F X; Goetz, J T; Golovatch, E; Gothe, R W; Griffioen, K A; Guegan, B; Guidal, M; Hakobyan, H; Hanretty, C; Hattawy, M; Holtrop, M; Hughes, S M; Hyde, C E; Ilieva, Y; Ireland, D G; Jiang, H; Jo, H S; Joo, K; Keller, D; Khandaker, M; Kim, A; Kim, W; Koirala, S; Kubarovsky, V; Kuleshov, S V; Lenisa, P; Levine, W I; Livingston, K; Lu, H Y; MacGregor, I J D; Mayer, M; McKinnon, B; Meyer, C A; Mirazita, M; Mokeev, V; Montgomery, R A; Moody, C I; Moutarde, H; Movsisyan, A; Camacho, C Munoz; Nadel-Turonski, P; Niccolai, S; Niculescu, G; Niculescu, I; Osipenko, M; Ostrovidov, A I; Pappalardo, L L; Paremuzyan, R; Peng, P; Phelps, W; Pisano, S; Pogorelko, O; Pozdniakov, S; Price, J W; Protopopescu, D; Puckett, A J R; Raue, B A; Rimal, D; Ripani, M; Rizzo, A; Rosner, G; Roy, P; Sabatié, F; Saini, M S; Schott, D; Schumacher, R A; Simonyan, A; Sokhan, D; Strauch, S; Sytnik, V; Tang, W; Tian, Ye; Ungaro, M; Vernarsky, B; Vlassov, A V; Voskanyan, H; Voutier, E; Walford, N K; Watts, D P; Wei, X; Weinstein, L B; Wood, M H; Zachariou, N; Zhang, J; Zhao, Z W; Zonta, I

    2014-10-10

    We measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK(+), pπ(0), and nπ(+), with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq creation probabilities for the first time in exclusive two-body production, in which only a single qq pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

  3. Strangeness suppression of q q ¯ creation observed in exclusive reactions

    DOE PAGES

    Mestayer, M. D.; Park, K.; Adhikari, K. P.; ...

    2014-10-10

    In this study, we measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK +, pπ 0, and nπ +, with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq¯ creation probabilities for the first time in exclusive two-body production, in which only a single qq¯ pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

  4. Strangeness Suppression of qq ¯ Creation Observed in Exclusive Reactions

    NASA Astrophysics Data System (ADS)

    Mestayer, M. D.; Park, K.; Adhikari, K. P.; Aghasyan, M.; Pereira, S. Anefalos; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Biselli, A. S.; Boiarinov, S.; Briscoe, W. J.; Brooks, W. K.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Colaneri, L.; Cole, P. L.; Contalbrigo, M.; Cortes, O.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; Deur, A.; Djalali, C.; Doughty, D.; Dupre, R.; Alaoui, A. El; Fassi, L. El; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Fleming, J. A.; Forest, T. A.; Garillon, B.; Garçon, M.; Ghandilyan, Y.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guegan, B.; Guidal, M.; Hakobyan, H.; Hanretty, C.; Hattawy, M.; Holtrop, M.; Hughes, S. M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Jiang, H.; Jo, H. S.; Joo, K.; Keller, D.; Khandaker, M.; Kim, A.; Kim, W.; Koirala, S.; Kubarovsky, V.; Kuleshov, S. V.; Lenisa, P.; Levine, W. I.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; Mayer, M.; McKinnon, B.; Meyer, C. A.; Mirazita, M.; Mokeev, V.; Montgomery, R. A.; Moody, C. I.; Moutarde, H.; Movsisyan, A.; Camacho, C. Munoz; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I.; Pappalardo, L. L.; Paremuzyan, R.; Peng, P.; Phelps, W.; Pisano, S.; Pogorelko, O.; Pozdniakov, S.; Price, J. W.; Protopopescu, D.; Puckett, A. J. R.; Raue, B. A.; Rimal, D.; Ripani, M.; Rizzo, A.; Rosner, G.; Roy, P.; Sabatié, F.; Saini, M. S.; Schott, D.; Schumacher, R. A.; Simonyan, A.; Sokhan, D.; Strauch, S.; Sytnik, V.; Tang, W.; Tian, Ye; Ungaro, M.; Vernarsky, B.; Vlassov, A. V.; Voskanyan, H.; Voutier, E.; Walford, N. K.; Watts, D. P.; Wei, X.; Weinstein, L. B.; Wood, M. H.; Zachariou, N.; Zhang, J.; Zhao, Z. W.; Zonta, I.; CLAS Collaboration

    2014-10-01

    We measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK+, pπ0, and nπ+, with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq ¯ creation probabilities for the first time in exclusive two-body production, in which only a single qq ¯ pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

  5. Strangeness suppression of q q ¯ creation observed in exclusive reactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mestayer, M. D.; Park, K.; Adhikari, K. P.

    In this study, we measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK +, pπ 0, and nπ +, with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq¯ creation probabilities for the first time in exclusive two-body production, in which only a single qq¯ pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

  6. Quasi-stationary states and fermion pair creation from a vacuum in supercritical Coulomb field

    NASA Astrophysics Data System (ADS)

    Khalilov, V. R.

    2017-12-01

    Creation of charged fermion pair from a vacuum in so-called supercritical Coulomb potential is examined for the case when fermions can move only in the same (one) plane. In which case, quantum dynamics of charged massive or massless fermions can be described by the two-dimensional Dirac Hamiltonians with an usual (-a/r) Coulomb potential. These Hamiltonians are singular and require the additional definition in order for them to be treated as self-adjoint quantum-mechanical operators. We construct the self-adjoint two-dimensional Dirac Hamiltonians with a Coulomb potential and determine the quantum-mechanical states for such Hamiltonians in the corresponding Hilbert spaces of square-integrable functions. We determine the scattering amplitude in which the self-adjoint extension parameter is incorporated and then obtain equations implicitly defining possible discrete energy spectra of the self-adjoint Dirac Hamiltonians with a Coulomb potential. It is shown that this quantum system becomes unstable in the presence of a supercritical Coulomb potential which manifests in the appearance of quasi-stationary states in the lower (negative) energy continuum. The energy spectrum of those states is quasi-discrete, consists of broadened levels with widths related to the inverse lifetimes of the quasi-stationary states as well as the probability of creation of charged fermion pair by a supercritical Coulomb field. Explicit analytical expressions for the creation probabilities of charged (massive or massless) fermion pair are obtained in a supercritical Coulomb field.

  7. Asymptotic expansion of pair production probability in a time-dependent electric field

    NASA Astrophysics Data System (ADS)

    Arai, Takashi

    2015-12-01

    We study particle creation in a single pulse of an electric field in scalar quantum electrodynamics. We investigate the parameter condition for the case where the dynamical pair creation and Schwinger mechanism respectively dominate. Then, an asymptotic expansion for the particle distribution in terms of the time interval of the applied electric field is derived. We compare our result with particle creation in a constant electric field with a finite-time interval. These results coincide in an extremely strong field, however they differ in general field strength. We interpret the reason of this difference as a nonperturbative effect of high-frequency photons in external electric fields. Moreover, we find that the next-to-leading-order term in our asymptotic expansion coincides with the derivative expansion of the effective action.

  8. Efficient creation of dipolar coupled nitrogen-vacancy spin qubits in diamond

    NASA Astrophysics Data System (ADS)

    Jakobi, I.; Momenzadeh, S. A.; Fávaro de Oliveira, F.; Michl, J.; Ziem, F.; Schreck, M.; Neumann, P.; Denisenko, A.; Wrachtrup, J.

    2016-09-01

    Coherently coupled pairs or multimers of nitrogen-vacancy defect electron spins in diamond have many promising applications especially in quantum information processing (QIP) but also in nanoscale sensing applications. Scalable registers of spin qubits are essential to the progress of QIP. Ion implantation is the only known technique able to produce defect pairs close enough to allow spin coupling via dipolar interaction. Although several competing methods have been proposed to increase the resulting resolution of ion implantation, the reliable creation of working registers is still to be demonstrated. The current limitation are residual radiation-induced defects, resulting in degraded qubit performance as trade-off for positioning accuracy. Here we present an optimized estimation of nanomask implantation parameters that are most likely to produce interacting qubits under standard conditions. We apply our findings to a well-established technique, namely masks written in electron-beam lithography, to create coupled defect pairs with a reasonable probability. Furthermore, we investigate the scaling behavior and necessary improvements to efficiently engineer interacting spin architectures.

  9. Pair creation of higher dimensional black holes on a de Sitter background

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dias, Oscar J.C.; Lemos, Jose P.S.; CENTRA, Departamento de Fisica, F.C.T., Universidade do Algarve, Campus de Gambelas, 8005-139 Faro

    We study in detail the quantum process in which a pair of black holes is created in a higher D-dimensional de Sitter (dS) background. The energy to materialize and accelerate the pair comes from the positive cosmological constant. The instantons that describe the process are obtained from the Tangherlini black hole solutions. Our pair creation rates reduce to the pair creation rate for Reissner-Nordstroem-dS solutions when D=4. Pair creation of black holes in the dS background becomes less suppressed when the dimension of the spacetime increases. The dS space is the only background in which we can discuss analytically themore » pair creation process of higher dimensional black holes, since the C-metric and the Ernst solutions, which describe, respectively, a pair accelerated by a string and by an electromagnetic field, are not known yet in a higher dimensional spacetime.« less

  10. FAST TRACK COMMUNICATION: Open string pair creation from worldsheet instantons

    NASA Astrophysics Data System (ADS)

    Schubert, Christian; Torrielli, Alessandro

    2010-10-01

    Worldline instantons provide a particularly elegant way to derive Schwinger's well-known formula for the pair creation rate due to a constant electric field in quantum electrodynamics. In this communication, we show how to extend this method to the corresponding problem of open string pair creation.

  11. Semiclassical fermion pair creation in de Sitter spacetime

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stahl, Clément, E-mail: clement.stahl@icranet.org; Eckhard, Strobel, E-mail: eckhard.strobel@irap-phd.eu; Dipartimento di Fisica, Università di Roma “La Sapienza”, Piazzale Aldo Moro 5, 00185 Rome

    2015-12-17

    We present a method to semiclassically compute the pair creation rate of bosons and fermions in de Sitter spacetime. The results in the bosonic case agree with the ones in the literature. We find that for the constant electric field the fermionic and bosonic pair creation rate are the same. This analogy of bosons and fermions in the semiclassical limit is known from several flat spacetime examples.

  12. Phase transition in conservative diffusive contact processes

    NASA Astrophysics Data System (ADS)

    Fiore, Carlos E.; de Oliveira, Mário J.

    2004-10-01

    We determine the phase diagrams of conservative diffusive contact processes by means of numerical simulations. These models are versions of the ordinary diffusive single-creation, pair-creation, and triplet-creation contact processes in which the particle number is conserved. The transition between the frozen and active states was determined by studying the system in the subcritical regime, and the nature of the transition, whether continuous or first order, was determined by looking at the fractal dimension of the critical cluster. For the single-creation model the transition remains continuous for any diffusion rate. For pair- and triplet-creation models, however, the transition becomes first order for high enough diffusion rate. Our results indicate that in the limit of infinite diffusion rate the jump in density equals 2/3 for the pair-creation model and 5/6 for the triplet-creation model.

  13. Technical Report on Modeling for Quasispecies Abundance Inference with Confidence Intervals from Metagenomic Sequence Data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McLoughlin, K.

    2016-01-11

    The overall aim of this project is to develop a software package, called MetaQuant, that can determine the constituents of a complex microbial sample and estimate their relative abundances by analysis of metagenomic sequencing data. The goal for Task 1 is to create a generative model describing the stochastic process underlying the creation of sequence read pairs in the data set. The stages in this generative process include the selection of a source genome sequence for each read pair, with probability dependent on its abundance in the sample. The other stages describe the evolution of the source genome from itsmore » nearest common ancestor with a reference genome, breakage of the source DNA into short fragments, and the errors in sequencing the ends of the fragments to produce read pairs.« less

  14. Optical-vortex pair creation and annihilation and helical astigmatism of a nonplanar ring resonator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Heckenberg, N.R.; Vaupel, M.; Malos, J.T.

    1996-09-01

    The creation and annihilation of pairs of optical vortices have been studied in transitions between patterns produced in a photorefractive oscillator. Smooth metamorphosis between stable patterns occurs through pair creation or annihilation but can be modeled using superposition of modes taking into account lifting of degeneracy of helical modes by helical astigmatism of the resonator. {copyright} {ital 1996 The American Physical Society.}

  15. Quasiparticle pair creation in unstable superflow

    NASA Astrophysics Data System (ADS)

    Elser, Veit

    1995-06-01

    Landau's instability mechanism in superflow is considered with special attention given to the role of nonuniformity in the flow. Linear stability analysis applied to the first in a series of approximate microscopic equations for the superfluid reveals a growth rate for Landau's instability proportional to the shear in the flow. In a quasiparticle description, the shear acts as a source of particle pair creation. The observation of roton-pair creation in experiments with electron bubbles in helium is offered as evidence of this phenomenon.

  16. Pair creation energy and Fano factor of silicon measured at 185 K using 55 F e X-rays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kotov, Ivan V.; Neal, H.; O'Connor, P.

    Here, the pair creation energy, ωω and the Fano factor of silicon were measured using a CCD sensor and X-rays from an 55Fe source. The measurements were performed at a sensor temperature of 185K. The pair creation energy was measured for X-rays in the 1.7–6.5 keV range. The measured pair creation energy is ω=(3.650 ± 0.009) eV at the MnK α line energy. The Fano factor at this energy is F = 0.128±0.001. The agreement with theory and previous measurements is satisfactory. The system gain was obtained from flat field exposures using the Poisson distribution properties. These results and themore » details of our measurement procedure are presented below.« less

  17. Pair creation energy and Fano factor of silicon measured at 185 K using 55 F e X-rays

    DOE PAGES

    Kotov, Ivan V.; Neal, H.; O'Connor, P.

    2018-06-14

    Here, the pair creation energy, ωω and the Fano factor of silicon were measured using a CCD sensor and X-rays from an 55Fe source. The measurements were performed at a sensor temperature of 185K. The pair creation energy was measured for X-rays in the 1.7–6.5 keV range. The measured pair creation energy is ω=(3.650 ± 0.009) eV at the MnK α line energy. The Fano factor at this energy is F = 0.128±0.001. The agreement with theory and previous measurements is satisfactory. The system gain was obtained from flat field exposures using the Poisson distribution properties. These results and themore » details of our measurement procedure are presented below.« less

  18. Radiation creation of cation defects in alkali halide crystals: Review and today's concept (Review Article)

    NASA Astrophysics Data System (ADS)

    Lushchik, A.; Lushchik, Ch.; Vasil'chenko, E.; Popov, A. I.

    2018-04-01

    Irradiation of alkali halide crystals creates pairs of Frenkel defects both in anion and cation sublattices. However, the particular nonimpact creation mechanisms (related to the decay of different electronic excitations) of cation Frenkel pairs are still unclear. At helium temperatures, there is yet no direct evidences of the creation of stable (long-lived) elemental cation defects. On the other hand, a number of complex structural defects containing cation vacancies and/or interstitials, were detected after irradiation of alkali halides at higher temperatures. Besides already proved mechanism related to the association of H and VK centers into trihalide molecules, the following possibilities of cation interstitial-vacancy pair creation are analyzed as well: (i) a direct decay of cation or anion excitons, (ii) the transformation of anion Frenkel pairs, formed at the decay of anion excitons or e-h recombination, into cation ones.

  19. Quantum descriptions of singularities leading to pair creation. [of gravitons

    NASA Technical Reports Server (NTRS)

    Misner, C. W.

    1974-01-01

    A class of cosmological models is analyzed which provide a mathematically convenient (but idealized) description of a cosmological singularity that develops into a pair creation epoch and terminates in an adiabatic expansion with redshifting particle energies. This class of models was obtained by Gowdy (1971, 1974) as a set of exact solutions of the classical empty space Einstein equations describing inhomogeneous universes populated only by gravitational waves. It is shown that these models can be used to exhibit simplified models of quantized gravitational fields, and that a quantum description can be given arbitrarily near a cosmological singularity. Graviton pair creation occurs, and can be seen to convert anisotropic expansion rates into the energy of graviton pairs.

  20. Laser-assisted bremsstrahlung and electron-positron pair creation in relativistic laser fields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Loetstedt, Erik

    2009-07-25

    An electron submitted to a relativistically strong laser field emits Compton harmonics at frequencies satisfying the nonlinear Compton formula. We investigate the scenario when in addition to the laser field, also a nuclear Coulomb field is present to accelerate the electron. In this case we may speak about laser-assisted bremsstrahlung, with radiation resulting from the combined effect of the Coulomb and laser field. The theoretical method employed is fully relativistic quantum electrodynamics, where in particular the laser-dressed Dirac-Volkov propagator requires proper treatment. Electron-positron pair creation is a physical process related to bremsstrahlung by a crossing symmetry of quantum electrodynamics. Wemore » consider pair creation in the combined fields of a laser, a nucleus and a high-frequency photon. We show that the total number of created pairs is not affected by the laser, provided the energy of the high-energy photon exceeds the pair creation threshold, but that the differential cross section is strongly enhanced in a particular direction, making a small angle with the laser beam. The physical picture is that the electron-positron pair is created by the high-energy photon, and subsequently accelerated by the laser field.« less

  1. Magnetic pair creation transparency in gamma-ray pulsars

    NASA Astrophysics Data System (ADS)

    Story, Sarah A.

    Magnetic pair creation, gamma → e+e- , is a key component in polar cap models of gamma-ray pulsars, and has informed assumptions about the still poorly understood radio emission. The Fermi Gamma-Ray Space Telescope has now detected more than 100 gamma-ray pulsars, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Fermi observations have established that the high-energy spectra of most of these pulsars have exponential turnovers in the 1--10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres, so their energy can be used to provide a physically motivated lower bound to the typical altitude of GeV band emission. This work computes pair creation opacities for photon propagation in neutron star magnetospheres. It explores the constraints that can be placed on the emission location of Fermi gamma-rays due to single-photon pair creation transparency below the turnover energy, as well as the limitations of this technique. These altitude bounds are typically in the range of 2--6 neutron star radii for the Fermi pulsar sample, and provide one of the few possible constraints on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles.

  2. Quantum cosmology of a conformal multiverse

    NASA Astrophysics Data System (ADS)

    Robles-Pérez, Salvador J.

    2017-09-01

    This paper studies the cosmology of a homogeneous and isotropic spacetime endorsed with a conformally coupled massless scalar field. We find six different solutions of the Friedmann equation that represent six different types of universes, and all of them are periodically distributed along the complex time axis. From a classical point of view, they are then isolated, separated by Euclidean regions that represent quantum mechanical barriers. Quantum mechanically, however, there is a nonzero probability for the state of the universes to tunnel out through a Euclidean instanton and suffer a sudden transition to another state of the spacetime. We compute the probability of transition for this and other nonlocal processes like the creation of universes in entangled pairs and, generally speaking, in multipartite entangled states. We obtain the quantum state of a single universe within the formalism of the Wheeler-DeWitt equation and give the semiclassical state of the universes that describes the quantum mechanics of a scalar field propagating in a de Sitter background spacetime. We show that the superposition principle of the quantum mechanics of matter fields alone is an emergent feature of the semiclassical description of the universe that is not valid, for instance, in the spacetime foam. We use the third quantization formalism to describe the creation of an entangled pair of universes with opposite signs of the momentum conjugated to the scale factor. Each universe of the entangled pair represents an expanding spacetime in terms of the Wentzel-Kramers-Brillouin (WKB) time experienced by internal observers in their particle physics experiments. We compute the effective value of the Friedmann equation of the background spacetime of the two entangled universes, and thus, the effect that the entanglement would have in their expansion rates. We analyze as well the effects of the interuniversal entanglement in the properties of the scalar fields that propagate in each spacetime of the entangled pair. We find that the largest modes of the scalar field are unaware of the entanglement between the universes, but the effects can be significant for the lowest modes, allowing us to compute, in principle, detailed observational imprints of the multiverse in the properties of a single universe like ours.

  3. Missing energies at pair creation

    NASA Technical Reports Server (NTRS)

    El-Ela, A. A.; Hassan, S.; Bagge, E. R.

    1985-01-01

    Wilson cloud chamber measurements of the separated spectra of positrons and electrons produced by gamma quanta of 6.14 MeV differ considerably from the theoretically predicted spectra by BETHE and HEITLER, but are in good agreement with those of a modified theory of pair creation.

  4. Pair Creation Transparency in Gamma-Ray Pulsars

    NASA Astrophysics Data System (ADS)

    Story, Sarah A.

    Pulsars are rapidly rotating, highly magnetized neutron stars that produce photon pulses in energies from radio to gamma-rays. The population of known gamma-ray pulsars has been increased nearly twenty-fold in the past six years since the launch of the Fermi Gamma-Ray Space Telescope; it now exceeds 145 sources and has defined an important part of Fermi's science legacy. In order to understand the detectability of pulsars in gamma-rays, it is important to consider not only the radiative mechanisms that produce gamma-rays, but the processes that can attenuate photons before they can leave the pulsar magnetosphere. Here I explore two such processes, one-photon magnetic pair creation and two-photon pair creation. Magnetic pair creation has been at the core of radio pulsar paradigms and central to polar cap models of gamma-ray pulsars for over three decades. Among the population characteristics well established for Fermi pulsars is the common occurrence of exponential turnovers in the spectra in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres. By demanding insignificant photon attenuation precipitated by such single-photon pair creation, the energies of these turnovers for Fermi pulsars can be used to compute lower bounds for the typical altitude of GeV band emission. In this thesis, I explore such pair transparency constraints below the turnover energy and update earlier altitude bound determinations that have been deployed in various gamma-ray pulsar papers by the Fermi-LAT collaboration. For low altitude emission locales, general relativistic influences are found to be important, increasing cumulative opacity, shortening the photon attenuation lengths, and also reducing the maximum energy that permits escape of photons from a neutron star magnetosphere. Rotational aberration influences are also explored, and are found to be small at low altitudes, except near the magnetic pole. Our analysis clearly demonstrates that including near-threshold physics in the pair creation rate is essential to deriving accurate attenuation lengths and escape energies. The altitude bounds we compute for Fermi pulsars are typically in the range of 2-7 stellar radii and provide key information on the emission altitude in radio quiet pulsars that do not possess double peaked pulse profiles. The bound for the Crab pulsar is at a much higher altitude, with the detection by the atmospheric Cherenkov telescope MAGIC out to 350-400 GeV implying a lower bound of 310 km to the emission region, i.e., approximately 20% of the light cylinder radius. These results are also extended to the super-critical field domain, where it is found that emission in magnetars originating below around 10 stellar radii will not appear in the Fermi-LAT band. Two-photon pair creation becomes important at high altitudes and for photons produced by curvature radiation from charges flowing downward along magnetic field lines. Because the efficiency of two-photon pair creation does not depend on the local magnetic field strength, it can continue to be active in the weak-field regions far from the neutron star. It is found that two-photon pair creation can strongly attenuate photons emitted from downward-traveling charges except at very high altitudes of emission, but in the absence of rotational aberration, it is unable to produce significant opacity for upward-traveling charges unless unrealistically high neutron star surface temperatures are assumed.

  5. The effect of incremental changes in phonotactic probability and neighborhood density on word learning by preschool children

    PubMed Central

    Storkel, Holly L.; Bontempo, Daniel E.; Aschenbrenner, Andrew J.; Maekawa, Junko; Lee, Su-Yeon

    2013-01-01

    Purpose Phonotactic probability or neighborhood density have predominately been defined using gross distinctions (i.e., low vs. high). The current studies examined the influence of finer changes in probability (Experiment 1) and density (Experiment 2) on word learning. Method The full range of probability or density was examined by sampling five nonwords from each of four quartiles. Three- and 5-year-old children received training on nonword-nonobject pairs. Learning was measured in a picture-naming task immediately following training and 1-week after training. Results were analyzed using multi-level modeling. Results A linear spline model best captured nonlinearities in phonotactic probability. Specifically word learning improved as probability increased in the lowest quartile, worsened as probability increased in the midlow quartile, and then remained stable and poor in the two highest quartiles. An ordinary linear model sufficiently described neighborhood density. Here, word learning improved as density increased across all quartiles. Conclusion Given these different patterns, phonotactic probability and neighborhood density appear to influence different word learning processes. Specifically, phonotactic probability may affect recognition that a sound sequence is an acceptable word in the language and is a novel word for the child, whereas neighborhood density may influence creation of a new representation in long-term memory. PMID:23882005

  6. Current flow and pair creation at low altitude in rotation-powered pulsars' force-free magnetospheres: space charge limited flow

    NASA Astrophysics Data System (ADS)

    Timokhin, A. N.; Arons, J.

    2013-02-01

    We report the results of an investigation of particle acceleration and electron-positron plasma generation at low altitude in the polar magnetic flux tubes of rotation-powered pulsars, when the stellar surface is free to emit whatever charges and currents are demanded by the force-free magnetosphere. We apply a new 1D hybrid plasma simulation code to the dynamical problem, using Particle-in-Cell methods for the dynamics of the charged particles, including a determination of the collective electrostatic fluctuations in the plasma, combined with a Monte Carlo treatment of the high-energy gamma-rays that mediate the formation of the electron-positron pairs. We assume the electric current flowing through the pair creation zone is fixed by the much higher inductance magnetosphere, and adopt the results of force-free magnetosphere models to provide the currents which must be carried by the accelerator. The models are spatially one dimensional, and designed to explore the physics, although of practical relevance to young, high-voltage pulsars. We observe novel behaviour (a) When the current density j is less than the Goldreich-Julian value (0 < j/jGJ < 1), space charge limited acceleration of the current carrying beam is mild, with the full Goldreich-Julian charge density comprising the charge densities of the beam and a cloud of electrically trapped particles with the same sign of charge as the beam. The voltage drops are of the order of mc2/e, and pair creation is absent. (b) When the current density exceeds the Goldreich-Julian value (j/jGJ > 1), the system develops high voltage drops (TV or greater), causing emission of curvature gamma-rays and intense bursts of pair creation. The bursts exhibit limit cycle behaviour, with characteristic time-scales somewhat longer than the relativistic fly-by time over distances comparable to the polar cap diameter (microseconds). (c) In return current regions, where j/jGJ < 0, the system develops similar bursts of pair creation. These discharges are similar to those encountered in previous calculations by Timokhin of pair creation when the surface has a high work function and cannot freely emit charge. In cases (b) and (c), the intermittently generated pairs allow the system to simultaneously carry the magnetospherically prescribed currents and adjust the charge density and average electric field to force-free conditions. We also elucidate the conditions for pair creating beam flow to be steady (stationary with small fluctuations in the rotating frame), finding that such steady flows can occupy only a small fraction of the current density parameter space exhibited by the force-free magnetospheric model. The generic polar flow dynamics and pair creation are strongly time dependent. The model has an essential difference from almost all previous quantitative studies, in that we sought the accelerating voltage (with pair creation, when the voltage drops are sufficiently large; without, when they are small) as a function of the applied current. The 1D results described here characterize the dependence of acceleration and pair creation on the magnitude and sign of current. The dependence on the spatial distribution of the current is a multi-dimensional problem, possibly exhibiting more chaotic behaviour. We briefly outline possible relations of the electric field fluctuations observed in the polar flows (both with and without pair creation discharges) to direct emission of radio waves, as well as revive the possible relation of the observed limit cycle behaviour to microstructure in the radio emission. Actually modelling these effects requires the multi-dimensional treatment, to be reported in a later paper.

  7. Current Flow and Pair Creation at Low Altitude in Rotation-Powered Pulsars' Force-Free Magnetospheres: Space Charge Limited Flow

    NASA Technical Reports Server (NTRS)

    Timokhin, A. N.; Arons, J.

    2013-01-01

    We report the results of an investigation of particle acceleration and electron-positron plasma generation at low altitude in the polar magnetic flux tubes of rotation-powered pulsars, when the stellar surface is free to emit whatever charges and currents are demanded by the force-free magnetosphere. We apply a new 1D hybrid plasma simulation code to the dynamical problem, using Particle-in-Cell methods for the dynamics of the charged particles, including a determination of the collective electrostatic fluctuations in the plasma, combined with a Monte Carlo treatment of the high-energy gamma-rays that mediate the formation of the electron-positron pairs.We assume the electric current flowing through the pair creation zone is fixed by the much higher inductance magnetosphere, and adopt the results of force-free magnetosphere models to provide the currents which must be carried by the accelerator. The models are spatially one dimensional, and designed to explore the physics, although of practical relevance to young, high-voltage pulsars. We observe novel behaviour (a) When the current density j is less than the Goldreich-Julian value (0 < j/j(sub GJ) < 1), space charge limited acceleration of the current carrying beam is mild, with the full Goldreich-Julian charge density comprising the charge densities of the beam and a cloud of electrically trapped particles with the same sign of charge as the beam. The voltage drops are of the order of mc(sup 2)/e, and pair creation is absent. (b) When the current density exceeds the Goldreich-Julian value (j/j(sub GJ) > 1), the system develops high voltage drops (TV or greater), causing emission of curvature gamma-rays and intense bursts of pair creation. The bursts exhibit limit cycle behaviour, with characteristic time-scales somewhat longer than the relativistic fly-by time over distances comparable to the polar cap diameter (microseconds). (c) In return current regions, where j/j(sub GJ) < 0, the system develops similar bursts of pair creation. These discharges are similar to those encountered in previous calculations by Timokhin of pair creation when the surface has a high work function and cannot freely emit charge. In cases (b) and (c), the intermittently generated pairs allow the system to simultaneously carry the magnetospherically prescribed currents and adjust the charge density and average electric field to force-free conditions. We also elucidate the conditions for pair creating beam flow to be steady (stationary with small fluctuations in the rotating frame), finding that such steady flows can occupy only a small fraction of the current density parameter space exhibited by the force-free magnetospheric model. The generic polar flow dynamics and pair creation are strongly time dependent. The model has an essential difference from almost all previous quantitative studies, in that we sought the accelerating voltage (with pair creation, when the voltage drops are sufficiently large; without, when they are small) as a function of the applied current.

  8. Klein tunneling phenomenon with pair creation process

    NASA Astrophysics Data System (ADS)

    Wu, G. Z.; Zhou, C. T.; Fu, L. B.

    2018-01-01

    In this paper, we study the Klein tunneling phenomenon with electron-positron pair creation process. Pairs can be created from the vacuum by a supercritical single-well potential (for electrons). In the time region, the time-dependent growth pattern of the created pairs can be characterized by four distinct regimes which can be considered as four different statuses of the single well. We find that if positrons penetrate the single well by Klein tunneling in different statuses, the total number of the tunneling positrons will be different. If Klein tunneling begins at the initial stage of the first status i.e. when the sing well is empty, the tunneling process and the total number of tunneling positrons are similar to the traditional Klein tunneling case without considering the pair creation process. As the tunneling begins later, the total tunneling positron number increases. The number will finally settle to an asymptotic value when the tunneling begins later than the settling-down time t s of the single well which has been defined in this paper.

  9. A highly coarse-grained model to simulate entangled polymer melts.

    PubMed

    Zhu, You-Liang; Liu, Hong; Lu, Zhong-Yuan

    2012-04-14

    We introduce a highly coarse-grained model to simulate the entangled polymer melts. In this model, a polymer chain is taken as a single coarse-grained particle, and the creation and annihilation of entanglements are regarded as stochastic events in proper time intervals according to certain rules and possibilities. We build the relationship between the probability of appearance of an entanglement between any pair of neighboring chains at a given time interval and the rate of variation of entanglements which describes the concurrence of birth and death of entanglements. The probability of disappearance of entanglements is tuned to keep the total entanglement number around the target value. This useful model can reflect many characteristics of entanglements and macroscopic properties of polymer melts. As an illustration, we apply this model to simulate the polyethylene melt of C(1000)H(2002) at 450 K and further validate this model by comparing to experimental data and other simulation results.

  10. High e+/e– ratio dense pair creation with 10 21W.cm –2 laser irradiating solid targets

    DOE PAGES

    Liang, E.; Clarke, T.; Henderson, A.; ...

    2015-09-14

    In this study, we report results of new pair creation experiments using ~100 Joule pulses of the Texas Petawatt Laser to irradiate solid gold and platinum targets, with intensities up to ~1.9 × 10 21 W.cm –2 and pulse durations as short as ~130 fs. Positron to electron (e+/e–) ratios >15% were observed for many thick disk and rod targets, with the highest e+/e– ratio reaching ~50% for a Pt rod. The inferred pair yield was ~ few ×10 10 with emerging pair density reaching ~10 15/cm 3 so that the pair skin depth becomes < pair jet transverse size.more » These results represent major milestones towards the goal of creating a significant quantity of dense pair-dominated plasmas with e+/e– approaching 100% and pair skin depth << pair plasma size, which will have wide-ranging applications to astrophysics and fundamental physics.« less

  11. Ultra-Intense Short-Pulse Pair Creation Using the Texas Petawatt Laser

    NASA Astrophysics Data System (ADS)

    Liang, Edison; Henderson, Alexander; Clarke, Taylor; Taylor, Devin; Chaguine, Petr; Serratto, Kristina; Riley, Nathan; Dyer, Gilliss; Donovan, Michael; Ditmire, Todd

    2013-10-01

    We report results from the 2012 pair creation experiment using the Texas Petawatt Laser. Up to 1011 positrons per steradian were detected using 100 Joule pulses from the Texas Petawatt Laser to irradiate gold targets, with peak laser intensities up to 1.9 × 1021W/cm2 and pulse durations as short as 130 fs. Positron-to-electron ratios exceeding 20% were measured on some shots. The positron energy, positron yield per unit laser energy, and inferred positron density are significantly higher than those reported in previous experiments. This confirms that, for a given laser energy, higher intensity and shorter pulses irradiating thicker targets are more favorable for pair creation. Narrow-band high-energy positrons up to 23 MeV were observed from thin targets. Supported by DOE Grant DE-SC-0001481 and Rice FIF.

  12. Pulsar extinction. [astrophysics

    NASA Technical Reports Server (NTRS)

    Sturrock, P. A.; Baker, K.; Turk, J. S.

    1975-01-01

    Radio emission from pulsars, attributed to an instability associated with the creation of electron-positron pairs from gamma rays was investigated. The condition for pair creation therefore lead to an extinction condition. The relevant physical processes were analyzed in the context of a mathematical model, according to which radiation originated at the polar caps and magnetic field lines changed from a closed configuration to an open configuration at the force balance or corotation radius.

  13. Magnetic Pair Creation Transparency in Pulsars

    NASA Astrophysics Data System (ADS)

    Story, Sarah; Baring, M. G.

    2013-04-01

    The Fermi gamma-ray pulsar database now exceeds 115 sources and has defined an important part of Fermi's science legacy, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Among the well established population characteristics is the common occurrence of exponential turnovers in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres, so their energy can be used to provide lower bounds to the typical altitude of GeV band emission. We explore such constraints due to single-photon pair creation transparency below the turnover energy. We adopt a semi-analytic approach, spanning both domains when general relativistic influences are important and locales where flat spacetime photon propagation is modified by rotational aberration effects. Our work clearly demonstrates that including near-threshold physics in the pair creation rate is essential to deriving accurate attenuation lengths. The altitude bounds, typically in the range of 2-6 neutron star radii, provide key information on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles. For the Crab pulsar, which emits pulsed radiation up to energies of 120 GeV, we obtain a lower bound of around 15 neutron star radii to its emission altitude.

  14. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

    PubMed Central

    2017-01-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

  15. Neutrino Photoproduction on the Electron of a Hydrogen-Like Atom

    NASA Astrophysics Data System (ADS)

    Skobelev, V. V.

    2017-10-01

    The process of interaction of a photon with the bound electron of a hydrogen-like atom with creation of a neutrino pair γ +{(Ze)}^{\\ast \\ast}\\to \\overline{νν}+{(Ze)}^{\\ast } is considered here for the first time. This process can take place with and without a change in the energy of the pair relative to the energy of the "initial" photon due to atomic transitions. It is shown that in the case when the system of atoms is located in an equilibrium radiation field with temperature T << m e this process can be neglected in comparison with spontaneous emission of the hydrogen-like atom {(Ze)}^{\\ast}\\to (Ze)+ν\\overline{ν} , despite the smaller power of the expansion parameter ( Zα) < < 1, α = e 2/ ℏc ≈ 1/137 in the expressions for the cross sections and probabilities. Calculations have been performed for the first time using the density matrix, introduced in the previous paper, of the electron in the field of the nucleus in the leading approximation in (Zα).

  16. Probability Distributions over Cryptographic Protocols

    DTIC Science & Technology

    2009-06-01

    Artificial Immune Algorithm . . . . . . . . . . . . . . . . . . . 9 3 Design Decisions 11 3.1 Common Ground...creation algorithm for unbounded distribution . . . . . . . 24 4.2 Message creation algorithm for unbounded naive distribution . . . . 24 4.3 Protocol...creation algorithm for intended-run distributions . . . . . . 26 4.4 Protocol and message creation algorithm for realistic distribution . . 32 ix THIS

  17. Counterion effects on the ultrafast dynamics of charge-transfer-to-solvent electrons.

    PubMed

    Rivas, N; Moriena, G; Domenianni, L; Hodak, J H; Marceca, E

    2017-12-06

    We performed femtosecond transient absorption (TA) experiments to monitor the solvation dynamics of charge-transfer-to-solvent (CTTS) electrons originating from UV photoexcitation of ammoniated iodide in close proximity to the counterions. Solutions of KI were prepared in liquid ammonia and TA experiments were carried out at different temperatures and densities, along the liquid-gas coexistence curve of the fluid. The results complement previous femtosecond TA work by P. Vöhringer's group in neat ammonia via multiphoton ionization. The dynamics of CTTS-detached electrons in ammonia was found to be strongly affected by ion pairing. Geminate recombination time constants as well as escape probabilities were determined from the measured temporal profiles and analysed as a function of the medium density. A fast unresolved (τ < 250 fs) increase of absorption related to the creation/thermalization of solvated electron species was followed by two decay components: one with a characteristic time around 10 ps, and a slower one that remains active for hundreds of picoseconds. While the first process is attributed to an early recombination of (I, e - ) pairs, the second decay and its asymptote reflects the effect of the K + counterion on the geminate recombination dynamics, rate and yield. The cation basically acts as an electron anchor that restricts the ejection distance, leading to solvent-separated counterion-electron species. The formation of (K + , NH 3 , e - ) pairs close to the parent iodine atom brings the electron escape probability to very low values. Transient spectra of the electron species have also been estimated as a function of time by probing the temporal profiles at different wavelengths.

  18. Nonlinear Breit–Wheeler pair creation with bremsstrahlung γ rays

    NASA Astrophysics Data System (ADS)

    Blackburn, T. G.; Marklund, M.

    2018-05-01

    Electron–positron pairs are produced through the Breit–Wheeler process when energetic photons traverse electromagnetic fields of sufficient strength. Here we consider a possible experimental geometry for observation of pair creation in the highly nonlinear regime, in which bremsstrahlung of an ultrarelativistic electron beam in a high-Z target is used to produce γ rays that collide with a counter-propagating laser pulse. We show how the target thickness may be chosen to optimize the yield of Breit–Wheeler positrons, and verify our analytical predictions with simulations of the cascade in the material and in the laser pulse. The electron beam energy and laser intensity required are well within the capability of today’s high-intensity laser facilities.

  19. Bell pair creation in current of Kondo-correlated dot

    NASA Astrophysics Data System (ADS)

    Sakano, Rui; Oguri, Akira; Nishikawa, Yunori; Abe, Eisuke

    Recently, local-Fermi-liquid properties in non-linear currents and shot noises through the Kondo dot have been investigated both theoretically and experimentally. We suggest a new entangled-electron-pair generator utilizing mechanism of quasiparticle-pair creation which has been observed as enhancement of shot noise in the quantum dot. Using the renormalized perturbation theory for an orbital-degenerate impurity Anderson model and the full counting statistics, we calculate the Clauser-Horne-Shimony-Holt type Bell's correlator for currents through correlated two different channels of a Kondo correlated dot. It is shown that residual exchange-interactions of the local-Fermi-liquid create spin-entangled quasiparticle-pairs in nonlinear current and this results in violation of the Bell's inequality. This work was partially supported by JSPS KAKENHI Grant Numbers JP26220711, JP26400319, JP15K05181 and JP16K17723.

  20. Dense gamma-ray and pair creation using ultra-intense lasers

    NASA Astrophysics Data System (ADS)

    Liang, Edison; Lo, Willie; Hasson, Hannah; Dyer, Gilliss; Clarke, Taylor; Fasanelli, Fabio; Yao, Kelly; Marchenka, Ilija; Henderson, Alexander; Dashko, Andriy; Zhang, Yuling; Ditmire, Todd

    2016-10-01

    We report recent results of gamma-ray and e +e- pair creation experiments using the Texas Petawatt laser (TPW) in Austin and the Trident laser at LANL irradiating solid high-Z targets. In addition to achieving record high densities of emerging gamma-rays and pairs at TPW, we measured in detail the spectra of hot electrons, positrons, and gamma-rays, and studied their spectral variation with laser and target parameters. A new type of gamma-ray spectrometer, called the scintillator attenuation spectrometer (SAS), was successfully demonstrated in Trident experiments in 2015. We will discuss the design and results of the SAS. Preliminary results of new experiments at TPW carried out in the summer of 2016 will also be presented.

  1. Magnetic pair creation transparency in gamma-ray pulsars

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Story, Sarah A.; Baring, Matthew G., E-mail: ss16@rice.edu, E-mail: baring@rice.edu

    2014-07-20

    Magnetic pair creation, γ → e {sup +} e {sup –}, has been at the core of radio pulsar paradigms and central to polar cap models of gamma-ray pulsars for over three decades. The Fermi gamma-ray pulsar population now exceeds 140 sources and has defined an important part of Fermi's science legacy, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Among the population characteristics well established is the common occurrence of exponential turnovers in their spectra in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in themore » strong magnetic fields of pulsar inner magnetospheres. By demanding insignificant photon attenuation precipitated by such single-photon pair creation, the energies of these turnovers for Fermi pulsars can be used to compute lower bounds for the typical altitude of GeV band emission. This paper explores such pair transparency constraints below the turnover energy and updates earlier altitude bound determinations that have been deployed in various Fermi pulsar papers. For low altitude emission locales, general relativistic influences are found to be important, increasing cumulative opacity, shortening the photon attenuation lengths, and also reducing the maximum energy that permits escape of photons from a neutron star magnetosphere. Rotational aberration influences are also explored, and are found to be small at low altitudes, except near the magnetic pole. The analysis presented in this paper clearly demonstrates that including near-threshold physics in the pair creation rate is essential to deriving accurate attenuation lengths and escape energies. The altitude bounds are typically in the range of 2-7 stellar radii for the young Fermi pulsar population, and provide key information on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles. The bound for the Crab pulsar is at a much higher altitude, with the putative detection by MAGIC out to 350-400 GeV implying a lower bound of 310 km to the emission region, i.e., approximately 20% of the light cylinder radius. These results are also extended to the super-critical field domain, where it is found that emission in neurton stars originating below around 10 stellar radii will not appear in the Fermi-LAT band.« less

  2. Magnetic Pair Creation Transparency in Gamma-Ray Pulsars

    NASA Astrophysics Data System (ADS)

    Story, Sarah A.; Baring, Matthew G.

    2014-07-01

    Magnetic pair creation, γ → e + e -, has been at the core of radio pulsar paradigms and central to polar cap models of gamma-ray pulsars for over three decades. The Fermi gamma-ray pulsar population now exceeds 140 sources and has defined an important part of Fermi's science legacy, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Among the population characteristics well established is the common occurrence of exponential turnovers in their spectra in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres. By demanding insignificant photon attenuation precipitated by such single-photon pair creation, the energies of these turnovers for Fermi pulsars can be used to compute lower bounds for the typical altitude of GeV band emission. This paper explores such pair transparency constraints below the turnover energy and updates earlier altitude bound determinations that have been deployed in various Fermi pulsar papers. For low altitude emission locales, general relativistic influences are found to be important, increasing cumulative opacity, shortening the photon attenuation lengths, and also reducing the maximum energy that permits escape of photons from a neutron star magnetosphere. Rotational aberration influences are also explored, and are found to be small at low altitudes, except near the magnetic pole. The analysis presented in this paper clearly demonstrates that including near-threshold physics in the pair creation rate is essential to deriving accurate attenuation lengths and escape energies. The altitude bounds are typically in the range of 2-7 stellar radii for the young Fermi pulsar population, and provide key information on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles. The bound for the Crab pulsar is at a much higher altitude, with the putative detection by MAGIC out to 350-400 GeV implying a lower bound of 310 km to the emission region, i.e., approximately 20% of the light cylinder radius. These results are also extended to the super-critical field domain, where it is found that emission in magnetars originating below around 10 stellar radii will not appear in the Fermi-LAT band.

  3. Magnetic Pair Creation Attenuation Altitude Constraints in Gamma-Ray Pulsars

    NASA Astrophysics Data System (ADS)

    Baring, Matthew; Story, Sarah

    The Fermi gamma-ray pulsar database now exceeds 150 sources and has defined an important part of Fermi's science legacy, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Among the well established population characteristics is the common occurrence of exponential turnovers in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres, so their energy can be used to provide lower bounds to the typical altitude of GeV band emission. We explore such constraints due to single-photon pair creation transparency at and below the turnover energy. Our updated computations span both domains when general relativistic influences are important and locales where flat spacetime photon propagation is modified by rotational aberration effects. The altitude bounds, typically in the range of 2-5 stellar radii, provide key information on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles. However, the exceptional case of the Crab pulsar provides an altitude bound of around 20% of the light cylinder radius if pair transparency persists out to 350 GeV, the maximum energy detected by MAGIC. This is an impressive new physics-based constraint on the Crab's gamma-ray emission locale.

  4. Universe creation from the third-quantized vacuum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McGuigan, M.

    1989-04-15

    Third quantization leads to a Hilbert space containing a third-quantized vacuum in which no universes are present as well as multiuniverse states. We consider the possibility of universe creation for the special case where the universe emerges in a no-particle state. The probability of such a creation is computed from both the path-integral and operator formalisms.

  5. Universe creation from the third-quantized vacuum

    NASA Astrophysics Data System (ADS)

    McGuigan, Michael

    1989-04-01

    Third quantization leads to a Hilbert space containing a third-quantized vacuum in which no universes are present as well as multiuniverse states. We consider the possibility of universe creation for the special case where the universe emerges in a no-particle state. The probability of such a creation is computed from both the path-integral and operator formalisms.

  6. Creation of electron-positron plasma with superstrong laser field

    NASA Astrophysics Data System (ADS)

    Narozhny, N. B.; Fedotov, A. M.

    2014-05-01

    We present a short review of recent progress in studying QED effects within the interaction of ultra-relativistic laser pulses with vacuum and e - e + plasma. Current development in laser technologies promises very rapid growth of laser intensities in the near future. Two exawatt class facilities (ELI and XCELS, Russia) in Europe are already in the planning stage. Realization of these projects will make available a laser intensity of ˜ 1026 W/cm2 or even higher. Therefore, discussion of nonlinear optical effects in vacuum are becoming compelling for experimentalists and are currently gaining much attention. We show that, in spite of the fact that the expected field strength is still essentially less than E S = m 2 c 3/ eℏ = 1.32 · 1016 V/cm, the nonlinear vacuum effects will be accessible for observation at the ELI and XCELS facilities. The most promissory effect for observation is pair creation by a laser pulse in vacuum. It is shown, that at intensities ˜ 5 · 1025 W/cm2, creation even of a single pair is accompanied by the development of an avalanche QED cascade. There exists a distinctive feature of the laser-induced cascades, as compared with the air showers arising due primarily to cosmic rays entering the atmosphere. In our case the laser field plays not only the role of a target (similar to a nucleus in the case of air showers) but is also responsible for the acceleration of slow particles. It is shown that the effect of pair creation imposes a natural limit for the attainable laser intensity and, apparently, the field strength E ˜ E S is not accessible for a pair-creating electromagnetic field at all.

  7. To Converse with Creation: Saving California Indian Languages.

    ERIC Educational Resources Information Center

    Whittemore, Katharine

    1997-01-01

    Describes the Master-Apprentice Language Learning Program, which seeks to save endangered Native Californian languages by pairing speakers and nonspeakers and providing the pairs with materials, technical support, and personal support. Briefly discusses the history of American Indian genocide and language extinction in California. Includes…

  8. The interactive evolution of human communication systems.

    PubMed

    Fay, Nicolas; Garrod, Simon; Roberts, Leo; Swoboda, Nik

    2010-04-01

    This paper compares two explanations of the process by which human communication systems evolve: iterated learning and social collaboration. It then reports an experiment testing the social collaboration account. Participants engaged in a graphical communication task either as a member of a community, where they interacted with seven different partners drawn from the same pool, or as a member of an isolated pair, where they interacted with the same partner across the same number of games. Participants' horizontal, pair-wise interactions led "bottom up" to the creation of an effective and efficient shared sign system in the community condition. Furthermore, the community-evolved sign systems were as effective and efficient as the local sign systems developed by isolated pairs. Finally, and as predicted by a social collaboration account, and not by an iterated learning account, interaction was critical to the creation of shared sign systems, with different isolated pairs establishing different local sign systems and different communities establishing different global sign systems. Copyright © 2010 Cognitive Science Society, Inc.

  9. Radiation-Damage Resistance in Phyllosilicate Minerals From First Principles and Implications for Radiocesium and Strontium Retention in Soils

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sassi, Michel; Rosso, Kevin M.; Okumura, Masahiko

    Accidental discharges of the hazardous nuclear fission products 137Cs+ and 90Sr2+ into the environment, such as during the Fukushima Dai-ichi nuclear accident, have repeatedly occurred throughout the nuclear age. Numerous studies of their fate and transport in soils and sediments have demonstrated their strong and selective binding to phyllosilicates such as clay minerals, primarily via cation exchange into interlayer sites. The locally concentrated amounts of these radioactive beta-emitters that can be found in these host minerals raises important questions regarding the long-term interplay and durability of radioisotope-clay association, which is not well known. This study goes beyond the usual short-termmore » focus to address the permanence of radioisotope retention in clay minerals, by developing a general theoretical understanding of their resistance to defect creation. We report ab initio molecular dynamics (AIMD) calculations of the threshold displacement energy (TDE) of each symmetry-unique atomic specie comprising the unit cell of model vermiculite. The determined TDE values are material specific and radiation independent. We use them to estimate the probability of Frenkel pair creation via direct electron-ion collision, as could be induced by the passage of a high energy electron emitted during the beta-decay of 137Cs, 90Sr and daughter 90Y. For 137Cs and 90Sr, we found that the probability is about 36%, while for 90Y the probability is much higher with about 89%. The long-term retention picture that emerges is that decay will progressively alter the clay interlayer structure and charge, likely leading to delamination of the clay and re-release of residual parent isotopes. Future work examining the effect of Frenkel defect accumulation on the binding energy of parent and daughter radionuclides in the interlayer is thus justifiable, and potentially important for accurate long-term forecasting of radionuclide transport in the environment.« less

  10. Pair Production Induced by Ultrashort and Ultraintense Laser Pulses in Plasmas

    NASA Astrophysics Data System (ADS)

    Luo, Yue-E.; Wang, Xue-Wen; Wang, Yuan-Sheng; Ji, Shen-Tong; Yu, Hong

    2018-06-01

    The probability of Schwinger pair production is calculated, which is induced by an ultraintense and ultrashort laser pulse propagating in a plasma. The dependence of the probability on the amplitude of the laser pulse and the frequency of plasmas is analyzed. Particularly, the effect of the pulse duration on the probability is discussed, by introducing a pulse-shape function to describe the temporal shape of the laser pulse. The results show that a laser with shorter pulse is more efficient in pair production. The probability of pair production increases when the order of the duration is comparable to the period of a laser.

  11. The pair-production channel in atomic processes

    NASA Astrophysics Data System (ADS)

    Belkacem, Ali; Sørensen, Allan H.

    2006-06-01

    Assisted by the creation of electron-positron pairs, new channels for ionization, excitation, and charge transfer open in atomic collisions when the energy is raised to relativistic values. At extreme energies these pair-production channels usually dominate the "traditional" contributions to cross sections that involve only "positive-energy" electrons. An extensive body of theoretical and experimental work has been performed over the last two decades to investigate charge-changing processes catalyzed by pair production in relativistic heavy ion collisions. We review some of these studies.

  12. Composition effect in luminescence properties of Y(NbxTa1-x)O4 mixed crystals

    NASA Astrophysics Data System (ADS)

    Spassky, D.; Vasil'ev, A.; Vielhauer, S.; Sidletskiy, O.; Voloshyna, O.; Belsky, A.

    2018-06-01

    The luminescence properties of Y(NbxTa1-x)O4 mixed crystals were studied. Local structure modifications arise due to the inhomogeneous distribution of the substitutional ions in the mixed crystal and can be traced using the luminescence spectroscopy. In particular, it is shown that the intensity of exciton emission under interband VUV excitation increases for intermediate values of x with the maximum at x = 0.4 relatively to the intensity observed in the constituents of the mixed crystals - YTaO4 and YNbO4. From the luminescence excitation spectra it follows that the probability of exciton creation from the separated e-h pairs increases for intermediate values of x as well. Using numerical simulation it is shown that the effect is connected with the variation of the thermalization length of hot electrons and holes, which is minimal at x = 0.4.

  13. Worldsheet instantons and the amplitude for string pair production in an external field as a WKB exact functional integral

    NASA Astrophysics Data System (ADS)

    Gordon, James; Semenoff, Gordon W.

    2018-05-01

    We revisit the problem of charged string pair creation in a constant external electric field. The string states are massive and creation of pairs from the vacuum is a tunnelling process, analogous to the Schwinger process where charged particle-anti-particle pairs are created by an electric field. We find the instantons in the worldsheet sigma model which are responsible for the tunnelling events. We evaluate the sigma model partition function in the multi-instanton sector in the WKB approximation which keeps the classical action and integrates the quadratic fluctuations about the solution. We find that the summation of the result over all multi-instanton sectors reproduces the known amplitude. This suggests that corrections to the WKB limit must cancel. To show that they indeed cancel, we identify a fermionic symmetry of the sigma model which occurs in the instanton sectors and which is associated with collective coordinates. We demonstrate that the action is symmetric and that the interaction action is an exact form. These conditions are sufficient for localization of the worldsheet functional integral onto its WKB limit.

  14. Molecular dynamics study of the conformational properties of cyclohexadecane

    NASA Astrophysics Data System (ADS)

    Zhang, Renshi; Mattice, Wayne L.

    1993-06-01

    Molecular dynamics has been used for the first time for the study of the conformational properties of cyclohexadecane, c-C16H32. By analyzing a long molecular dynamics trajectory (14.5 ns) at 450 K, equilibrium statistics such as the relative populations of different isomeric conformers and the probability ratios, p(gt)/p(tt), p(gg)/p(tt), and p(gg)/p(gtg), of different conformational segments, have been studied. The dynamic properties including the transition modes of gauche migration and gauche-pair creation, which have been reported before in n-alkanes, and the auto- and cross-correlations of the bond dihedral angles, have also been obtained. It was possible to make direct comparisons on some of the statistics with theory and experiment. Most of the results extracted from the molecular dynamics trajectory lie in between previously reported experimental and theoretical values. Many previously predicted conformers have been confirmed by our simulations. The results of the population probability of the most populated conformer seems to suggest that an earlier discrepancy between the theoretical works and an experimental work originates from insufficient samplings in earlier theoretical works, rather than from their inaccurate force field.

  15. Massive soliton stars

    NASA Technical Reports Server (NTRS)

    Chiu, Hong-Yee

    1990-01-01

    The structure of nontopological solutions of Einstein field equations as proposed by Friedberg, Lee, and Pang (1987) is examined. This analysis incorporates finite temperature effects and pair creation. Quarks are assumed to be the only species that exist in interior of soliton stars. The possibility of primordial creation of soliton stars in the incomplete decay of the degenerate vacuum in early universe is explored. Because of dominance of pair creation inside soliton stars, the luminosity of soliton stars is not determined by its radiative transfer characteristics, and the surface temperature of soliton stars can be the same as its interior temperature. It is possible that soliton stars are intense X-ray radiators at large distances. Soliton stars are nearly 100 percent efficient energy converters, converting the rest energy of baryons entering the interior into radiation. It is possible that a sizable number of baryons may also be trapped inside soliton stars during early epochs of the universe. In addition, if soliton stars exist they could assume the role played by massive black holes in galactic centers.

  16. Multiplicity evolution of identified particle charge-dependent correlations in Pb-Pb, p-Pb and pp collisions at the LHC with ALICE

    NASA Astrophysics Data System (ADS)

    Pan, Jinjin; Alice Collaboration

    2017-09-01

    The charge pair creation and transport processes in heavy-ion collisions are investigated experimentally by measurements of charge-dependent correlations of identified particle pairs, related to the Balance Function. The produced pair separation in rapidity is expected to be larger for hadrons arising from quark-antiquark pair creation in the early stages of the collision than for hadrons emerging from the later hadronization stage. Correlations are reported for charged-pion pairs in Pb-Pb, p-Pb and pp collisions at √{sNN } = 2.76, 5.02 and 7 TeV, respectively; and for charged-kaon pairs in Pb-Pb collisions at √{sNN } = 2.76 TeV. The correlations are measured as a function of relative rapidity Δy and azimuthal angle Δϕ , and are dominated by a peak centered at Δy = Δϕ = 0. We observe that the peak widths in Δy and Δϕ are narrower in higher multiplicity events in Pb-Pb, p-Pb, and pp collisions, which is consistent with the effects of radial flow, as well as the two-wave quark production mechanism. We investigate the charge transport and system evolution further by studying the Δϕ width of the peak as a function of Δy. Funded by the US Department of Energy.

  17. On Stellar Flash Echoes from Circular Rings

    NASA Astrophysics Data System (ADS)

    Nemiroff, Robert; Mukherjee, Oindabi

    2018-01-01

    A flash -- or any episode of variability -- that occurs in the vicinity of a circular ring might be seen several times later, simultaneously, as echoes on the ring. Effective images of the flash are created and annihilated in pairs, with as many as four flash images visible concurrently. Videos detailing sequences of image pair creation, tandem motion, and subsequent image annihilation are shown, given simple opacity and scattering assumptions. It is proven that, surprisingly, images from a second pair creation event always annihilate with images from the first. Caustic surfaces between flash locations yielding two and four images are computed. Although such ring echos surely occur, their practical detection might be difficult as it could require dedicated observing programs involving sensitive photometry of extended objects. Potential flash sources include planetary and interstellar gas and dust rings near and around variable stars, flare stars, novae, supernovae, and GRBs. Potentially recoverable information includes size, distance, temporal history, and angular isotropy of both the ring and flash.

  18. Scalar pair production in a magnetic field in de Sitter universe

    NASA Astrophysics Data System (ADS)

    Băloi, Mihaela-Andreea; Crucean, Cosmin; Popescu, Diana

    2018-05-01

    The production of scalar particles by the dipole magnetic field in de Sitter expanding universe is analyzed. The amplitude and probability of transition are computed using perturbative methods. A graphical study of the transition probability is performed obtaining that the rate of pair production is important in the early universe. Our results prove that in the process of pair production by the external magnetic field the momentum conservation law is broken. We also found that the probabilities are maximum when the particles are emitted perpendicular to the direction of magnetic dipole momentum. The total probability is computed and is analysed in terms of the angle between particles momenta.

  19. Low-temperature creation of Frenkel defects via hot electron-hole recombination in highly pure NaCl single crystals

    NASA Astrophysics Data System (ADS)

    Lushchik, A.; Lushchik, Ch.; Nagirnyi, V.; Shablonin, E.; Vasil'chenko, E.

    2016-07-01

    The creation spectrum of stable F centres (being part of F-H pairs of Frenkel defects) by synchrotron radiation of 7-40 eV has been measured for highly pure NaCl single crystals at 12 K using a highly sensitive luminescent method. It is shown that the efficiency of F centre creation in a closely packed NaCl is low at the decay of anion or cation excitons (7.8-8.4 and 33.4 eV, respectively) or at the recombination of relaxed conduction electrons and valence holes. Only the recombination of nonrelaxed (hot) electrons with holes provides the energy exceeding threshold value EFD, which is sufficient for the creation of Frenkel defects at low temperature.

  20. Characterization of a quadrant diamond transmission X-ray detector including a precise determination of the mean electron–hole pair creation energy

    DOE PAGES

    Keister, Jeffrey W.; Cibik, Levent; Schreiber, Swenja; ...

    2018-02-20

    Precise monitoring of the incoming photon flux is crucial for many experiments using synchrotron radiation. For photon energies above a few keV, thin semiconductor photodiodes can be operated in transmission for this purpose. Diamond is a particularly attractive material as a result of its low absorption. The responsivity of a state-of-the art diamond quadrant transmission detector has been determined, with relative uncertainties below 1% by direct calibration against an electrical substitution radiometer. From these data and the measured transmittance, the thickness of the involved layers as well as the mean electron–hole pair creation energy were determined, the latter with anmore » unprecedented relative uncertainty of 1%. Lastly, the linearity and X-ray scattering properties of the device are also described.« less

  1. Characterization of a quadrant diamond transmission X-ray detector including a precise determination of the mean electron–hole pair creation energy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keister, Jeffrey W.; Cibik, Levent; Schreiber, Swenja

    Precise monitoring of the incoming photon flux is crucial for many experiments using synchrotron radiation. For photon energies above a few keV, thin semiconductor photodiodes can be operated in transmission for this purpose. Diamond is a particularly attractive material as a result of its low absorption. The responsivity of a state-of-the art diamond quadrant transmission detector has been determined, with relative uncertainties below 1% by direct calibration against an electrical substitution radiometer. From these data and the measured transmittance, the thickness of the involved layers as well as the mean electron–hole pair creation energy were determined, the latter with anmore » unprecedented relative uncertainty of 1%. Lastly, the linearity and X-ray scattering properties of the device are also described.« less

  2. Entanglement by Path Identity.

    PubMed

    Krenn, Mario; Hochrainer, Armin; Lahiri, Mayukh; Zeilinger, Anton

    2017-02-24

    Quantum entanglement is one of the most prominent features of quantum mechanics and forms the basis of quantum information technologies. Here we present a novel method for the creation of quantum entanglement in multipartite and high-dimensional systems. The two ingredients are (i) superposition of photon pairs with different origins and (ii) aligning photons such that their paths are identical. We explain the experimentally feasible creation of various classes of multiphoton entanglement encoded in polarization as well as in high-dimensional Hilbert spaces-starting only from nonentangled photon pairs. For two photons, arbitrary high-dimensional entanglement can be created. The idea of generating entanglement by path identity could also apply to quantum entities other than photons. We discovered the technique by analyzing the output of a computer algorithm. This shows that computer designed quantum experiments can be inspirations for new techniques.

  3. Entanglement by Path Identity

    NASA Astrophysics Data System (ADS)

    Krenn, Mario; Hochrainer, Armin; Lahiri, Mayukh; Zeilinger, Anton

    2017-02-01

    Quantum entanglement is one of the most prominent features of quantum mechanics and forms the basis of quantum information technologies. Here we present a novel method for the creation of quantum entanglement in multipartite and high-dimensional systems. The two ingredients are (i) superposition of photon pairs with different origins and (ii) aligning photons such that their paths are identical. We explain the experimentally feasible creation of various classes of multiphoton entanglement encoded in polarization as well as in high-dimensional Hilbert spaces—starting only from nonentangled photon pairs. For two photons, arbitrary high-dimensional entanglement can be created. The idea of generating entanglement by path identity could also apply to quantum entities other than photons. We discovered the technique by analyzing the output of a computer algorithm. This shows that computer designed quantum experiments can be inspirations for new techniques.

  4. Observation of Bs production at the Y(5S) resonance.

    PubMed

    Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Bornheim, A; Pappas, S P; Weinstein, A J; Asner, D M; Edwards, K W; Briere, R A; Chen, G P; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Crede, V; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Gibbons, L; Gittelman, B; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Phillips, E A; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Shepherd, M R; Stroiney, S; Sun, W M; Urner, D; Wilksen, T; Weaver, K M; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Gollin, G D; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Williams, J; Wiss, J; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Li, S Z; Poling, R; Scott, A W; Smith, A; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Arms, K; Severini, H; Dytman, S A; Love, W; Mehrabyan, S; Mueller, J A; Savinov, V; Li, Z; Lopez, A; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Muramatsu, H; Park, C S; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Maravin, Y; Artuso, M; Boulahouache, C; Blusk, S; Butt, J; Dorjkhaidav, O; Li, J; Menaa, N; Mountain, R; Nandakumar, R; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E

    2006-01-20

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the Bs meson in e+e- annihilation at the Y(5S) resonance. We find 14 candidates consistent with Bs decays into final states with a J/psi or a Ds(*)- . The probability that we have observed a background fluctuation is less than 8 x 10(-10) . We have established that at the energy of the Y(5S) resonance Bs production proceeds predominantly through the creation of Bs*Bs* pairs. We find sigma(e+e- --> Bs*Bs*) = [0.11(-0.03))(+0.04)(stat) +/- 0.02(syst)]nb , and set the following limits: sigma(e+e- --> BsBs)/ sigma(e+ e- --> Bs*Bs*) <0.16 and [sigma(e+e- --> BsBs*) + sigma(e+e- --> Bs*Bs)]/sigma(e+e- -->Bs*Bs*) < 0.16 (90% C.L.). The mass of the Bs* meson is measured to be M(Bs*) = [5.414+/- 0.001(stat) +/- 0.003(syst)] GeV/c2 .

  5. Cosmological perturbations in the entangled inflationary universe

    NASA Astrophysics Data System (ADS)

    Robles-Pérez, Salvador J.

    2018-03-01

    In this paper, the model of a multiverse made up of universes that are created in entangled pairs that conserve the total momentum conjugated to the scale factor is presented. For the background spacetime, assumed is a Friedmann-Robertson-Walker metric with a scalar field with mass m minimally coupled to gravity. For the fields that propagate in the entangled spacetimes, the perturbations of the spacetime and the scalar field, whose quantum states become entangled too, are considered. They turn out to be in a quasithermal state, and the corresponding thermodynamical magnitudes are computed. Three observables are expected to be caused by the creation of the universes in entangled pairs: a modification of the Friedmann equation because of the entanglement of the spacetimes, a modification of the effective value of the potential of the scalar field by the backreaction of the perturbation modes, and a modification of the spectrum of fluctuations because the thermal distribution is induced by the entanglement of the partner universes. The later would be a distinctive feature of the creation of universes in entangled pairs.

  6. Pairs of Asteroids Probably of a Common Origin

    NASA Astrophysics Data System (ADS)

    Vokrouhlický, David; Nesvorný, David

    2008-07-01

    We report the first observational evidence for pairs of main-belt asteroids with bodies in each pair having nearly identical orbits. The existence of ~60 pairs identified here cannot be reconciled with random fluctuations of the asteroid orbit density and rather suggests a common origin of the paired objects. We propose that the identified pairs formed by (i) collisional disruptions of km-sized and larger parent asteroids, (ii) Yarkovsky-O'Keefe-Radzievski-Paddack (YORP)-induced spin-up and rotational fission of fast-rotating objects, and/or (iii) splitting of unstable asteroid binaries. In case (i), the pairs would be parts of compact collisional families with many km- and sub-km-size members that should be found by future asteroid surveys. Our dynamical analysis suggests that most identified pairs formed within the past lsim1 Myr, in several cases even much more recently. For example, paired asteroids (6070) Rheinland and (54827) 2001 NQ8 probably separated from their common ancestor only 16.5-19 kyr ago. Given their putatively very recent formation, the identified objects are prime candidates for astronomical observations. The title paraphrases that of Hirayama's 1918 paper "Groups of asteroids probably of a common origin," where the first evidence was given for groups of asteroid fragments produced by disruptive collisions.

  7. Nonrandom network connectivity comes in pairs.

    PubMed

    Hoffmann, Felix Z; Triesch, Jochen

    2017-01-01

    Overrepresentation of bidirectional connections in local cortical networks has been repeatedly reported and is a focus of the ongoing discussion of nonrandom connectivity. Here we show in a brief mathematical analysis that in a network in which connection probabilities are symmetric in pairs, P ij = P ji , the occurrences of bidirectional connections and nonrandom structures are inherently linked; an overabundance of reciprocally connected pairs emerges necessarily when some pairs of neurons are more likely to be connected than others. Our numerical results imply that such overrepresentation can also be sustained when connection probabilities are only approximately symmetric.

  8. Vacuum instability in Kaluza–Klein manifolds

    NASA Astrophysics Data System (ADS)

    Fucci, Guglielmo

    2018-05-01

    The purpose of this work in to analyze particle creation in spaces with extra dimensions. We consider, in particular, a massive scalar field propagating in a Kaluza–Klein manifold subject to a constant electric field. We compute the rate of particle creation from vacuum by using techniques rooted in the spectral zeta function formalism. The results we obtain show explicitly how the presence of the extra-dimensions and their specific geometric characteristics, influence the rate at which pairs of particles and anti-particles are generated.

  9. Probability of coincidental similarity among the orbits of small bodies - I. Pairing

    NASA Astrophysics Data System (ADS)

    Jopek, Tadeusz Jan; Bronikowska, Małgorzata

    2017-09-01

    Probability of coincidental clustering among orbits of comets, asteroids and meteoroids depends on many factors like: the size of the orbital sample searched for clusters or the size of the identified group, it is different for groups of 2,3,4,… members. Probability of coincidental clustering is assessed by the numerical simulation, therefore, it depends also on the method used for the synthetic orbits generation. We have tested the impact of some of these factors. For a given size of the orbital sample we have assessed probability of random pairing among several orbital populations of different sizes. We have found how these probabilities vary with the size of the orbital samples. Finally, keeping fixed size of the orbital sample we have shown that the probability of random pairing can be significantly different for the orbital samples obtained by different observation techniques. Also for the user convenience we have obtained several formulae which, for given size of the orbital sample can be used to calculate the similarity threshold corresponding to the small value of the probability of coincidental similarity among two orbits.

  10. Recent Progress on Laser Produced Positron Research At LLN

    NASA Astrophysics Data System (ADS)

    Chen, Hui; Hermann, M.; Kalantar, D.; Kemp, A.; Link, A.; Jiang, S.; Martinez, D.; Park, J.; Remington, B.; Sherlock, M.; Williams, Gj; Beg, F.; Edghill, B.; Fedosejevs, R.; Kerr, S.; D'Humieres, E.; Fiuza, F.; Willingale, L.; Fiksel, G.; Nakai, N.; Arikawa, Y.; Morace, A.; Sentoku, Y.

    2017-10-01

    We report the recent results on laser-produced relativistic electron-positron plasma jets. This includes: the prepulse and material dependence of pair generation; time dependent positron acceleration and maximum achieved pair density. We will highlight the results from recent experiments on the Omega EP laser testing nanostructured target to increase pair yield. We will also report on a newly commissioned platform using the NIF ARC lasers which was developed for efficient pair creation using 10 ps laser duration at near relativistic laser intensity. This work was performed under the auspices of the U.S. DOE by LLNL under Contract DE-AC52-07NA27344, and funded by LDRD (#17-ERD-010).

  11. Microscopic description of pair transfer between two superfluid Fermi systems: Combining phase-space averaging and combinatorial techniques

    NASA Astrophysics Data System (ADS)

    Regnier, David; Lacroix, Denis; Scamps, Guillaume; Hashimoto, Yukio

    2018-03-01

    In a mean-field description of superfluidity, particle number and gauge angle are treated as quasiclassical conjugated variables. This level of description was recently used to describe nuclear reactions around the Coulomb barrier. Important effects of the relative gauge angle between two identical superfluid nuclei (symmetric collisions) on transfer probabilities and fusion barrier have been uncovered. A theory making contact with experiments should at least average over different initial relative gauge-angles. In the present work, we propose a new approach to obtain the multiple pair transfer probabilities between superfluid systems. This method, called phase-space combinatorial (PSC) technique, relies both on phase-space averaging and combinatorial arguments to infer the full pair transfer probability distribution at the cost of multiple mean-field calculations only. After benchmarking this approach in a schematic model, we apply it to the collision 20O+20O at various energies below the Coulomb barrier. The predictions for one pair transfer are similar to results obtained with an approximated projection method, whereas significant differences are found for two pairs transfer. Finally, we investigated the applicability of the PSC method to the contact between nonidentical superfluid systems. A generalization of the method is proposed and applied to the schematic model showing that the pair transfer probabilities are reasonably reproduced. The applicability of the PSC method to asymmetric nuclear collisions is investigated for the 14O+20O collision and it turns out that unrealistically small single- and multiple pair transfer probabilities are obtained. This is explained by the fact that relative gauge angle play in this case a minor role in the particle transfer process compared to other mechanisms, such as equilibration of the charge/mass ratio. We conclude that the best ground for probing gauge-angle effects in nuclear reaction and/or for applying the proposed PSC approach on pair transfer is the collisions of identical open-shell spherical nuclei.

  12. Extending or creating a new brand: evidence from a study on event-related potentials.

    PubMed

    Jin, Jia; Wang, Cuicui; Yu, Liping; Ma, Qingguo

    2015-07-08

    Brand strategy is a critical problem in new product promotion. In relation to this, producers typically have two main options, namely, brand extension and new brand creation. The current study investigated the neural basis of evaluating these brand strategies at the brain level by using event-related potentials. The experiment used a word-pair paradigm, in which the first word was either a famous beverage brand name or a newly created brand, and the second word was a product name from one of the two product categories (beverage or household appliance). Therefore, four conditions existed as follows: a famous beverage brand paired with a beverage product (BB) or with a household appliance (BH) and a newly created brand paired with a beverage product (NB) or with a household appliance (NH). Behavioral results showed that brand extension obtained a higher acceptance rate than new brand creation under the beverage product category; however, a lower acceptance rate was observed under the household appliance category. Moreover, at the brain level, BB elicited lower N400 mean amplitude than the new brand product NB, whereas BH led to higher N400 amplitude than the new brand product NH. These results showed that the likelihood of accepting a product depended on the association between the brand name and product name, and that the N400 could serve as an index of brand strategy evaluation. In addition, this study also confirmed that brand extension is not always the best brand strategy; an inappropriate extension sometimes performed worse than the creation of a new brand.

  13. Formation of Isolated Zn Vacancies in ZnO Single Crystals by Absorption of Ultraviolet Radiation: A Combined Study Using Positron Annihilation, Photoluminescence, and Mass Spectroscopy

    NASA Astrophysics Data System (ADS)

    Khan, Enamul H.; Weber, Marc H.; McCluskey, Matthew D.

    2013-07-01

    Positron annihilation spectra reveal isolated zinc vacancy (VZn) creation in single-crystal ZnO exposed to 193-nm radiation at 100mJ/cm2 fluence. The appearance of a photoluminescence excitation peak at 3.18 eV in irradiated ZnO is attributed to an electronic transition from the VZn acceptor level at ˜100meV to the conduction band. The observed VZn density profile and hyperthermal Zn+ ion emission support zinc vacancy-interstitial Frenkel pair creation by exciting a wide 6.34 eV Zn-O antibonding state at 193-nm photon—a novel photoelectronic process for controlled VZn creation in ZnO.

  14. Formation of isolated Zn vacancies in ZnO single crystals by absorption of ultraviolet radiation: a combined study using positron annihilation, photoluminescence, and mass spectroscopy.

    PubMed

    Khan, Enamul H; Weber, Marc H; McCluskey, Matthew D

    2013-07-05

    Positron annihilation spectra reveal isolated zinc vacancy (V(Zn)) creation in single-crystal ZnO exposed to 193-nm radiation at 100 mJ/cm(2) fluence. The appearance of a photoluminescence excitation peak at 3.18 eV in irradiated ZnO is attributed to an electronic transition from the V(Zn) acceptor level at ~100 meV to the conduction band. The observed V(Zn) density profile and hyperthermal Zn(+) ion emission support zinc vacancy-interstitial Frenkel pair creation by exciting a wide 6.34 eV Zn-O antibonding state at 193-nm photon-a novel photoelectronic process for controlled V(Zn) creation in ZnO.

  15. Natal and breeding philopatry in a black brant, Branta bernicla nigricans, metapopulation

    USGS Publications Warehouse

    Lindberg, Mark S.; Sedinger, James S.; Derksen, Dirk V.; Rockwell, Robert F.

    1998-01-01

    We estimated natal and breeding philopatry and dispersal probabilities for a metapopulation of Black Brant (Branta bernicla nigricans) based on observations of marked birds at six breeding colonies in Alaska, 1986–1994. Both adult females and males exhibited high (>0.90) probability of philopatry to breeding colonies. Probability of natal philopatry was significantly higher for females than males. Natal dispersal of males was recorded between every pair of colonies, whereas natal dispersal of females was observed between only half of the colony pairs. We suggest that female-biased philopatry was the result of timing of pair formation and characteristics of the mating system of brant, rather than factors related to inbreeding avoidance or optimal discrepancy. Probability of natal philopatry of females increased with age but declined with year of banding. Age-related increase in natal philopatry was positively related to higher breeding probability of older females. Declines in natal philopatry with year of banding corresponded negatively to a period of increasing population density; therefore, local population density may influence the probability of nonbreeding and gene flow among colonies.

  16. The preference of probability over negative values in action selection.

    PubMed

    Neyedli, Heather F; Welsh, Timothy N

    2015-01-01

    It has previously been found that when participants are presented with a pair of motor prospects, they can select the prospect with the largest maximum expected gain (MEG). Many of those decisions, however, were trivial because of large differences in MEG between the prospects. The purpose of the present study was to explore participants' preferences when making non-trivial decisions between two motor prospects. Participants were presented with pairs of prospects that: 1) differed in MEG with either only the values or only the probabilities differing between the prospects; and 2) had similar MEG with one prospect having a larger probability of hitting the target and a higher penalty value and the other prospect a smaller probability of hitting the target but a lower penalty value. In different experiments, participants either had 400 ms or 2000 ms to decide between the prospects. It was found that participants chose the configuration with the larger MEG more often when the probability varied between prospects than when the value varied. In pairs with similar MEGs, participants preferred a larger probability of hitting the target over a smaller penalty value. These results indicate that participants prefer probability information over negative value information in a motor selection task.

  17. Synthesizing skyrmion bound pairs in Fe-Gd thin films

    DOE PAGES

    Lee, J. C. T.; Chess, J. J.; Montoya, S. A.; ...

    2016-07-11

    Here, we show that properly engineered amorphous Fe-Gd alloy thin films with perpendicular magnetic anisotropy exhibit bound pairs of like-polarity, opposite helicity skyrmions at room temperature. Magnetic mirror symmetry planes present in the stripe phase, instead of chiral exchange, determine the internal skyrmion structure and the net achirality of the skyrmion phase. Our study shows that stripe domain engineering in amorphous alloy thin films may enable the creation of skyrmion phases with technologically desirable properties.

  18. Simple Physics-Based Analytical Formulas for the Potentials of Mean Force of the Interaction of Amino Acid Side Chains in Water. VII. Charged-Hydrophobic/Polar and Polar-Hydrophobic/Polar Side Chains.

    PubMed

    Makowski, Mariusz; Liwo, Adam; Scheraga, Harold A

    2017-01-19

    The physics-based potentials of side-chain-side-chain interactions corresponding to pairs composed of charged and polar, polar and polar, charged and hydrophobic, and hydrophobic and hydrophobic side chains have been determined. A total of 144 four-dimensional potentials of mean force (PMFs) of all possible pairs of molecules modeling these pairs were determined by umbrella-sampling molecular dynamics simulations in explicit water as functions of distance and orientation, and the analytical expressions were then fitted to the PMFs. Depending on the type of interacting sites, the analytical approximation to the PMF is a sum of terms corresponding to van der Waals interactions and cavity-creation involving the nonpolar sections of the side chains and van der Waals, cavity-creation, and electrostatic (charge-dipole or dipole-dipole) interaction energies and polarization energies involving the charged or polar sections of the side chains. The model used in this work reproduces all features of the interacting pairs. The UNited RESidue force field with the new side-chain-side-chain interaction potentials was preliminarily tested with the N-terminal part of the B-domain of staphylococcal protein A (PDBL 1BDD ; a three-α-helix bundle) and UPF0291 protein YnzC from Bacillus subtilis (PDB: 2HEP ; an α-helical hairpin).

  19. A short walk in quantum probability

    NASA Astrophysics Data System (ADS)

    Hudson, Robin

    2018-04-01

    This is a personal survey of aspects of quantum probability related to the Heisenberg commutation relation for canonical pairs. Using the failure, in general, of non-negativity of the Wigner distribution for canonical pairs to motivate a more satisfactory quantum notion of joint distribution, we visit a central limit theorem for such pairs and a resulting family of quantum planar Brownian motions which deform the classical planar Brownian motion, together with a corresponding family of quantum stochastic areas. This article is part of the themed issue `Hilbert's sixth problem'.

  20. ELECTRODYNAMICS OF AXISYMMETRIC PULSAR MAGNETOSPHERE WITH ELECTRON-POSITRON DISCHARGE: A NUMERICAL EXPERIMENT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Alexander Y.; Beloborodov, Andrei M., E-mail: amb@phys.columbia.edu

    2014-11-01

    We present the first self-consistent global simulations of pulsar magnetospheres with operating e {sup ±} discharge. We focus on the simple configuration of an aligned or anti-aligned rotator. The star is spun up from a zero (vacuum) state to a high angular velocity, and we follow the coupled evolution of its external electromagnetic field and plasma particles using the ''particle-in-cell'' method. A plasma magnetosphere begins to form through the extraction of particles from the star; these particles are accelerated by the rotation-induced electric field, producing curvature radiation and igniting e {sup ±} discharge. We follow the system evolution for severalmore » revolution periods, longer than required to reach a quasi-steady state. Our numerical experiment puts to test previous ideas for the plasma flow and gaps in the pulsar magnetosphere. We first consider rotators capable of producing pairs out to the light cylinder through photon-photon collisions. We find that their magnetospheres are similar to the previously obtained force-free solutions with a Y-shaped current sheet. The magnetosphere continually ejects e {sup ±} pairs and ions. Pair creation is sustained by a strong electric field along the current sheet. We observe powerful curvature and synchrotron emission from the current sheet, consistent with Fermi observations of gamma-ray pulsars. We then study pulsars that can only create pairs in the strong-field region near the neutron star, well inside the light cylinder. We find that both aligned and anti-aligned rotators relax to the ''dead'' state with suppressed pair creation and electric currents, regardless of the discharge voltage.« less

  1. Quantifying inbreeding avoidance through extra-pair reproduction

    PubMed Central

    Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin

    2015-01-01

    Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females’ alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females’ within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. PMID:25346331

  2. Experimental purification of two-atom entanglement.

    PubMed

    Reichle, R; Leibfried, D; Knill, E; Britton, J; Blakestad, R B; Jost, J D; Langer, C; Ozeri, R; Seidelin, S; Wineland, D J

    2006-10-19

    Entanglement is a necessary resource for quantum applications--entanglement established between quantum systems at different locations enables private communication and quantum teleportation, and facilitates quantum information processing. Distributed entanglement is established by preparing an entangled pair of quantum particles in one location, and transporting one member of the pair to another location. However, decoherence during transport reduces the quality (fidelity) of the entanglement. A protocol to achieve entanglement 'purification' has been proposed to improve the fidelity after transport. This protocol uses separate quantum operations at each location and classical communication to distil high-fidelity entangled pairs from lower-fidelity pairs. Proof-of-principle experiments distilling entangled photon pairs have been carried out. However, these experiments obtained distilled pairs with a low probability of success and required destruction of the entangled pairs, rendering them unavailable for further processing. Here we report efficient and non-destructive entanglement purification with atomic quantum bits. Two noisy entangled pairs were created and distilled into one higher-fidelity pair available for further use. Success probabilities were above 35 per cent. The many applications of entanglement purification make it one of the most important techniques in quantum information processing.

  3. A short walk in quantum probability.

    PubMed

    Hudson, Robin

    2018-04-28

    This is a personal survey of aspects of quantum probability related to the Heisenberg commutation relation for canonical pairs. Using the failure, in general, of non-negativity of the Wigner distribution for canonical pairs to motivate a more satisfactory quantum notion of joint distribution, we visit a central limit theorem for such pairs and a resulting family of quantum planar Brownian motions which deform the classical planar Brownian motion, together with a corresponding family of quantum stochastic areas.This article is part of the themed issue 'Hilbert's sixth problem'. © 2018 The Author(s).

  4. Classical Wave Model of Quantum-Like Processing in Brain

    NASA Astrophysics Data System (ADS)

    Khrennikov, A.

    2011-01-01

    We discuss the conjecture on quantum-like (QL) processing of information in the brain. It is not based on the physical quantum brain (e.g., Penrose) - quantum physical carriers of information. In our approach the brain created the QL representation (QLR) of information in Hilbert space. It uses quantum information rules in decision making. The existence of such QLR was (at least preliminary) confirmed by experimental data from cognitive psychology. The violation of the law of total probability in these experiments is an important sign of nonclassicality of data. In so called "constructive wave function approach" such data can be represented by complex amplitudes. We presented 1,2 the QL model of decision making. In this paper we speculate on a possible physical realization of QLR in the brain: a classical wave model producing QLR . It is based on variety of time scales in the brain. Each pair of scales (fine - the background fluctuations of electromagnetic field and rough - the cognitive image scale) induces the QL representation. The background field plays the crucial role in creation of "superstrong QL correlations" in the brain.

  5. The entangled accelerating universe

    NASA Astrophysics Data System (ADS)

    González-Díaz, Pedro F.; Robles-Pérez, Salvador

    2009-08-01

    Using the known result that the nucleation of baby universes in correlated pairs is equivalent to spacetime squeezing, we show in this Letter that there exists a T-duality symmetry between two-dimensional warp drives, which are physically expressible as localized de Sitter little universes, and two-dimensional Tolman-Hawking and Gidding-Strominger baby universes respectively correlated in pairs, so that the creation of warp drives is also equivalent to spacetime squeezing. Perhaps more importantly, it has been also seen that the nucleation of warp drives entails a violation of the Bell's inequalities, and hence the phenomena of quantum entanglement, complementarity and wave function collapse. These results are generalized to the case of any dynamically accelerating universe filled with dark or phantom energy whose creation is also physically equivalent to spacetime squeezing and to the violation of the Bell's inequalities, so that the universe we are living in should be governed by essential sharp quantum theory laws and must be a quantum entangled system.

  6. Electron–Positron Pair Creation Close to a Black Hole Horizon: Redshifted Annihilation Line in the Emergent X-Ray Spectra of a Black Hole. I.

    NASA Astrophysics Data System (ADS)

    Laurent, Philippe; Titarchuk, Lev

    2018-06-01

    We consider a Compton cloud (CC) surrounding a black hole (BH) in an accreting BH system, where electrons propagate with thermal and bulk velocities. In that cloud, soft (disk) photons may be upscattered off these energetic electrons and attain energies of several MeV. They could then create pairs due to photon–photon interactions. In this paper, we study the formation of the 511 keV annihilation line due to this photon–photon interaction, which results in the creation of electron–positron pairs, followed by the annihilation of the created positrons with the CC electrons. The appropriate conditions for annihilation-line generation take place very close to a BH horizon within (103–104)m cm from it, where m is the BH hole mass in solar units. As a result, the created annihilation line should be seen by the Earth observer as a blackbody bump, or the so-called reflection bump at energies around (511/20) (20/z) keV, where z ∼ 20 is a typical gravitational redshift experienced by the created annihilation-line photons when they emerge. This transient feature should occur in any accreting BH system, either galactic or extragalactic. Observational evidences for this feature in several galactic BH systems is detailed in an accompanying paper. An extended hard tail of the spectrum up to 1 MeV may also be formed due to X-ray photons upscattering off created pairs.

  7. Creation of Spin-Triplet Cooper Pairs in the Absence of Magnetic Ordering

    NASA Astrophysics Data System (ADS)

    Breunig, Daniel; Burset, Pablo; Trauzettel, Björn

    2018-01-01

    In superconducting spintronics, it is essential to generate spin-triplet Cooper pairs on demand. Up to now, proposals to do so concentrate on hybrid structures in which a superconductor (SC) is combined with a magnetically ordered material (or an external magnetic field). We, instead, identify a novel way to create and isolate spin-triplet Cooper pairs in the absence of any magnetic ordering. This achievement is only possible because we drive a system with strong spin-orbit interaction—the Dirac surface states of a strong topological insulator (TI)-out of equilibrium. In particular, we consider a bipolar TI-SC-TI junction, where the electrochemical potentials in the outer leads differ in their overall sign. As a result, we find that nonlocal singlet pairing across the junction is completely suppressed for any excitation energy. Hence, this junction acts as a perfect spin-triplet filter across the SC, generating equal-spin Cooper pairs via crossed Andreev reflection.

  8. Creation of Spin-Triplet Cooper Pairs in the Absence of Magnetic Ordering.

    PubMed

    Breunig, Daniel; Burset, Pablo; Trauzettel, Björn

    2018-01-19

    In superconducting spintronics, it is essential to generate spin-triplet Cooper pairs on demand. Up to now, proposals to do so concentrate on hybrid structures in which a superconductor (SC) is combined with a magnetically ordered material (or an external magnetic field). We, instead, identify a novel way to create and isolate spin-triplet Cooper pairs in the absence of any magnetic ordering. This achievement is only possible because we drive a system with strong spin-orbit interaction-the Dirac surface states of a strong topological insulator (TI)-out of equilibrium. In particular, we consider a bipolar TI-SC-TI junction, where the electrochemical potentials in the outer leads differ in their overall sign. As a result, we find that nonlocal singlet pairing across the junction is completely suppressed for any excitation energy. Hence, this junction acts as a perfect spin-triplet filter across the SC, generating equal-spin Cooper pairs via crossed Andreev reflection.

  9. Quantifying inbreeding avoidance through extra-pair reproduction.

    PubMed

    Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin

    2015-01-01

    Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females' alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females' within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  10. Topological phases in a Kitaev chain with imbalanced pairing

    NASA Astrophysics Data System (ADS)

    Li, C.; Zhang, X. Z.; Zhang, G.; Song, Z.

    2018-03-01

    We systematically study a Kitaev chain with imbalanced pair creation and annihilation, which is introduced by non-Hermitian pairing terms. An exact phase diagram shows that the topological phase is still robust under the influence of the conditional imbalance. The gapped phases are characterized by a topological invariant, the extended Zak phase, which is defined by the biorthonormal inner product. Such phases are destroyed at the points where the coalescence of ground states occurs, associated with the time-reversal symmetry breaking. We find that the Majorana edge modes also exist in an open chain in the time-reversal symmetry-unbroken region, demonstrating the bulk-edge correspondence in such a non-Hermitian system.

  11. Soliton creation, propagation, and annihilation in aeromechanical arrays of one-way coupled bistable elements

    NASA Astrophysics Data System (ADS)

    Rosenberger, Tessa; Lindner, John F.

    We study the dynamics of mechanical arrays of bistable elements coupled one-way by wind. Unlike earlier hydromechanical unidirectional arrays, our aeromechanical one-way arrays are simpler, easier to study, and exhibit a broader range of phenomena. Soliton-like waves propagate in one direction at speeds proportional to wind speeds. Periodic boundaries enable solitons to annihilate in pairs in even arrays where adjacent elements are attracted to opposite stable states. Solitons propagate indefinitely in odd arrays where pairing is frustrated. Large noise spontaneously creates soliton- antisoliton pairs, as predicted by prior computer simulations. Soliton annihilation times increase quadratically with initial separations, as expected for random walk models of soliton collisions.

  12. Lesser scaup breeding probability and female survival on the yukon flats, Alaska

    USGS Publications Warehouse

    Martin, K.H.; Lindberg, M.S.; Schmutz, J.A.; Bertram, M.R.

    2009-01-01

    Information on the ecology of waterfowl breeding in the boreal forest is lacking, despite the boreal region's importance to continental waterfowl populations and to duck species that are currently declining, such as lesser scaup (Aythya affinis). We estimated breeding probability and breeding season survival of female lesser scaup on the Yukon Flats National Wildlife Refuge, Alaska, USA, in 2005 and 2006. We captured and marked 93 lesser scaup with radiotransmitters during prelaying and nesting periods. Although all marked lesser scaup females were paired throughout prelaying and incubation periods, we estimated breeding probability over both years as 0.12 (SE = 0.05, n = 67) using telemetry. Proportion of lesser scaup females undergoing rapid follicle growth at capture in 2006 was 0.46 (SE = 0.11, n = 37), based on concentration of yolk precursors in blood plasma. By combining methods based on telemetry, yolk precursors, and postovulatory follicles, we estimated maximum breeding probability as 0.68 (SE = 0.08, n = 37) in 2006. Notably, breeding probability was positively related to female body mass. Survival of female lesser scaup during the nesting and brood-rearing periods was 0.92 (SE = 0.05) in 2005 and 0.86 (SE = 0.08) in 2006. Our results suggest that breeding probability is lower than expected for lesser scaup. In addition, the implicit assumption of continental duck-monitoring programs that all paired females attempt to breed should be reevaluated. Recruitment estimates based on annual breeding-pair surveys may overestimate productivity of scaup pairs in the boreal forest. ?? The Wildlife Society.

  13. Review of Quantum Electromagnetic States

    DTIC Science & Technology

    1999-10-01

    product space. 227 The wave functions used in the Jaynes - Cummings ’ model reside in a direct product space Va ɠ> Vf where Va and Vf are the Hubert...Dependent Probability 215 5.1.3 The Relaxation Term 217 5.2 Jaynes - Cummings ’ Model for Matter-Field Interactions 218 5.2.1 The Atomic Hamiltonian 218...5.3 The Interaction Representation for the Jaynes - Cummings ’ Model 224 5.3.1 Atomic Creation and Annihilation Operators 224 5.3.2 The Boson Creation

  14. Sociocultural definitions of risk

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rayner, S.

    1990-10-01

    Public constituencies frequently are criticized by technical experts as being irrational in response to low-probability risks. This presentation argued that most people are concerned with a variety of risk attributes other than probability and that is rather irrational to exclude these from the definition and analysis of technological risk. Risk communication, which is at the heart of the right-to-know concept, is described as the creation of shared meaning rather than the mere transmission of information. A case study of utilities, public utility commissions, and public interest groups illustrates how the diversity of institutional cultures in modern society leads to problemsmore » for the creation of shared meanings in establishing trust, distributing liability, and obtaining consent to risk. This holistic approach to risk analysis is most appropriate under conditions of high uncertainty and/or decision stakes. 1 fig., 5 tabs.« less

  15. Quasi-probabilities in conditioned quantum measurement and a geometric/statistical interpretation of Aharonov's weak value

    NASA Astrophysics Data System (ADS)

    Lee, Jaeha; Tsutsui, Izumi

    2017-05-01

    We show that the joint behavior of an arbitrary pair of (generally noncommuting) quantum observables can be described by quasi-probabilities, which are an extended version of the standard probabilities used for describing the outcome of measurement for a single observable. The physical situations that require these quasi-probabilities arise when one considers quantum measurement of an observable conditioned by some other variable, with the notable example being the weak measurement employed to obtain Aharonov's weak value. Specifically, we present a general prescription for the construction of quasi-joint probability (QJP) distributions associated with a given combination of observables. These QJP distributions are introduced in two complementary approaches: one from a bottom-up, strictly operational construction realized by examining the mathematical framework of the conditioned measurement scheme, and the other from a top-down viewpoint realized by applying the results of the spectral theorem for normal operators and their Fourier transforms. It is then revealed that, for a pair of simultaneously measurable observables, the QJP distribution reduces to the unique standard joint probability distribution of the pair, whereas for a noncommuting pair there exists an inherent indefiniteness in the choice of such QJP distributions, admitting a multitude of candidates that may equally be used for describing the joint behavior of the pair. In the course of our argument, we find that the QJP distributions furnish the space of operators in the underlying Hilbert space with their characteristic geometric structures such that the orthogonal projections and inner products of observables can be given statistical interpretations as, respectively, “conditionings” and “correlations”. The weak value Aw for an observable A is then given a geometric/statistical interpretation as either the orthogonal projection of A onto the subspace generated by another observable B, or equivalently, as the conditioning of A given B with respect to the QJP distribution under consideration.

  16. Relativistic thermal plasmas - Effects of magnetic fields

    NASA Technical Reports Server (NTRS)

    Araki, S.; Lightman, A. P.

    1983-01-01

    Processes and equilibria in finite, relativistic, thermal plasmas are investigated, taking into account electron-positron creation and annihilation, photon production by internal processes, and photon production by a magnetic field. Inclusion of the latter extends previous work on such plasmas. The basic relations for thermal, Comptonized synchrotron emission are analyzed, including emission and absorption without Comptonization, Comptonized thermal synchrotron emission, and the Comptonized synchrotron and bremsstrahlung luminosities. Pair equilibria are calculated, including approximations and dimensionless parameters, the pair balance equation, maximum temperatures and field strengths, and individual models and cooling curves.

  17. Detecting Planet Pairs in Mean Motion Resonances via the Astrometry Method

    NASA Astrophysics Data System (ADS)

    Wu, Dong-Hong; Liu, Hui-Gen; Yu, Zhou-Yi; Zhang, Hui; Zhou, Ji-Lin

    2016-07-01

    Gaia is leading us into a new era with a high astrometry precision of ˜10 μas. Under such precision, astrometry can play an important role in detecting and characterizing exoplanets. In particular, we can identify planet pairs in mean motion resonances (MMRs), which constrain the formation and evolution of planetary systems. In accordance with observations, we consider two-Jupiter or two-super-Earth systems in 1:2, 2:3, and 3:4 MMRs. Our simulations show that the false alarm probabilities (FAPs) of a third planet are extremely small, while the two real planets can be fitted well with a signal-to-noise ratio (S/N) \\gt 3. The probability of reconstructing a resonant system is related to the eccentricities and the resonance intensity. Generally, when the S/N ≥slant 10, if the eccentricities of both planets are larger than 0.01 and the resonance is quite strong, the probability of reconstructing the planet pair in MMRs is ≥slant 80 % . Jupiter pairs in MMRs are reconstructed more easily than super-Earth pairs with similar S/N when we consider dynamical stability. FAPs are also calculated when we detect planet pairs in or near MMRs. The FAPs for 1:2 MMRs are the largest, I.e., FAP \\gt 15 % when S/N ≤slant 10. Extrapolating from the Kepler planet pairs near MMRs and assuming a S/N ˜ 3, we discover and reconstruct a few tens of Jupiter pairs and hundreds of super-Earth pairs in 2:3 and 1:2 MMRs within 30 pc. We also compare the differences between even and uneven data cadence and find that planets are better measured with more uniform phase coverage.

  18. Estimation of occupancy, breeding success, and predicted abundance of golden eagles (Aquila chrysaetos) in the Diablo Range, California, 2014

    USGS Publications Warehouse

    Wiens, J. David; Kolar, Patrick S.; Fuller, Mark R.; Hunt, W. Grainger; Hunt, Teresa

    2015-01-01

    We used a multistate occupancy sampling design to estimate occupancy, breeding success, and abundance of territorial pairs of golden eagles (Aquila chrysaetos) in the Diablo Range, California, in 2014. This method uses the spatial pattern of detections and non-detections over repeated visits to survey sites to estimate probabilities of occupancy and successful reproduction while accounting for imperfect detection of golden eagles and their young during surveys. The estimated probability of detecting territorial pairs of golden eagles and their young was less than 1 and varied with time of the breeding season, as did the probability of correctly classifying a pair’s breeding status. Imperfect detection and breeding classification led to a sizeable difference between the uncorrected, naïve estimate of the proportion of occupied sites where successful reproduction was observed (0.20) and the model-based estimate (0.30). The analysis further indicated a relatively high overall probability of landscape occupancy by pairs of golden eagles (0.67, standard error = 0.06), but that areas with the greatest occupancy and reproductive potential were patchily distributed. We documented a total of 138 territorial pairs of golden eagles during surveys completed in the 2014 breeding season, which represented about one-half of the 280 pairs we estimated to occur in the broader 5,169-square kilometer region sampled. The study results emphasize the importance of accounting for imperfect detection and spatial heterogeneity in studies of site occupancy, breeding success, and abundance of golden eagles.

  19. Enhancing Poetry Writing through Technology: The Yin and the Yang.

    ERIC Educational Resources Information Center

    Roberts, Sherron Killingsworth; Schmidt, Denise

    2002-01-01

    Describes the outcome of an innovative mentoring program that paired technology faculty and methods faculty in order to form partnerships to facilitate the modeling of technology for preservice teachers. Discusses the creation of useful applications for enhancing poetry writing through technology for elementary school students. (SG)

  20. On Electron-Positron Pair Production by a Spatially Inhomogeneous Electric Field

    NASA Astrophysics Data System (ADS)

    Chervyakov, A.; Kleinert, H.

    2018-05-01

    A detailed analysis of electron-positron pair creation induced by a spatially non-uniform and static electric field from vacuum is presented. A typical example is provided by the Sauter potential. For this potential, we derive the analytic expressions for vacuum decay and pair production rate accounted for the entire range of spatial variations. In the limit of a sharp step, we recover the divergent result due to the singular electric field at the origin. The limit of a constant field reproduces the classical result of Euler, Heisenberg and Schwinger, if the latter is properly averaged over the width of a spatial variation. The pair production by the Sauter potential is described for different regimes from weak to strong fields. For all these regimes, the locally constant-field rate is shown to be the upper limit.

  1. Labeling of Chromosomes in Cell Development and the Appearance of Monozygotic Twins.

    PubMed

    Jim, Carol; Berkovich, Simon

    2015-01-01

    Understanding the mechanism behind the structure of the internal cellular clock can lead to advances in the knowledge of origins of pairs of monozygotic twins and higher order multiples as well as other biological phenomena. To gain insight into this mechanism, we analyze possible cell labeling schemes that model an organism's development. Our findings lead us to predict that monozygotic quadruplets are not quadruplets in the traditional sense but rather two pairs of monozygotic twins where the pairs slightly differ-a situation we coin quadruplet twins. From the considered model, the probability of monozygotic twins is found to be (1/2) (K) , and we discover that the probability of monozygotic quadruplets, or triplets as in the case of the death of an embryo, is (1/8) (K) , where K is a species-specific integer representing the number of pairs of homologous chromosomes. The parameter K may determine cancerization with a probability threshold that is approximately inversely proportional to the Hayflick limit. Exposure to some cancerization factors such as small levels of ionizing radiation and chemical pollution may not produce cancer.

  2. Labeling of Chromosomes in Cell Development and the Appearance of Monozygotic Twins

    PubMed Central

    Berkovich, Simon

    2015-01-01

    Understanding the mechanism behind the structure of the internal cellular clock can lead to advances in the knowledge of origins of pairs of monozygotic twins and higher order multiples as well as other biological phenomena. To gain insight into this mechanism, we analyze possible cell labeling schemes that model an organism's development. Our findings lead us to predict that monozygotic quadruplets are not quadruplets in the traditional sense but rather two pairs of monozygotic twins where the pairs slightly differ—a situation we coin quadruplet twins. From the considered model, the probability of monozygotic twins is found to be (1/2)K, and we discover that the probability of monozygotic quadruplets, or triplets as in the case of the death of an embryo, is (1/8)K, where K is a species-specific integer representing the number of pairs of homologous chromosomes. The parameter K may determine cancerization with a probability threshold that is approximately inversely proportional to the Hayflick limit. Exposure to some cancerization factors such as small levels of ionizing radiation and chemical pollution may not produce cancer. PMID:26185760

  3. Entangle Accelerating Universe

    NASA Astrophysics Data System (ADS)

    González-Díaz, Pedro F.; Robles-Pérez, Salvador a. i. e.

    We show that there exists a T-duality symmetry between two-dimensional warp drives and two dimensional Tolman-Hawking and Gidding-Strominger baby universes respectively correlated in pairs, so that the creation of warp drives is also equivalent to space-time squeezing. It has been also seen that the nucleation of warp drives entails a violation of the Bell's inequalities. These results are generalized to the case of any dynamically accelerating universe whose creation is also physically equivalent to spacetime squeezing and to the violation of the Bell's inequalities, so that the universe we are living in should be governed by essential sharp quantum theory laws and must be a quantum entangled system.

  4. Creating a medical English-Swedish dictionary using interactive word alignment.

    PubMed

    Nyström, Mikael; Merkel, Magnus; Ahrenberg, Lars; Zweigenbaum, Pierre; Petersson, Håkan; Ahlfeldt, Hans

    2006-10-12

    This paper reports on a parallel collection of rubrics from the medical terminology systems ICD-10, ICF, MeSH, NCSP and KSH97-P and its use for semi-automatic creation of an English-Swedish dictionary of medical terminology. The methods presented are relevant for many other West European language pairs than English-Swedish. The medical terminology systems were collected in electronic format in both English and Swedish and the rubrics were extracted in parallel language pairs. Initially, interactive word alignment was used to create training data from a sample. Then the training data were utilised in automatic word alignment in order to generate candidate term pairs. The last step was manual verification of the term pair candidates. A dictionary of 31,000 verified entries has been created in less than three man weeks, thus with considerably less time and effort needed compared to a manual approach, and without compromising quality. As a side effect of our work we found 40 different translation problems in the terminology systems and these results indicate the power of the method for finding inconsistencies in terminology translations. We also report on some factors that may contribute to making the process of dictionary creation with similar tools even more expedient. Finally, the contribution is discussed in relation to other ongoing efforts in constructing medical lexicons for non-English languages. In three man weeks we were able to produce a medical English-Swedish dictionary consisting of 31,000 entries and also found hidden translation errors in the utilized medical terminology systems.

  5. Creating a medical English-Swedish dictionary using interactive word alignment

    PubMed Central

    Nyström, Mikael; Merkel, Magnus; Ahrenberg, Lars; Zweigenbaum, Pierre; Petersson, Håkan; Åhlfeldt, Hans

    2006-01-01

    Background This paper reports on a parallel collection of rubrics from the medical terminology systems ICD-10, ICF, MeSH, NCSP and KSH97-P and its use for semi-automatic creation of an English-Swedish dictionary of medical terminology. The methods presented are relevant for many other West European language pairs than English-Swedish. Methods The medical terminology systems were collected in electronic format in both English and Swedish and the rubrics were extracted in parallel language pairs. Initially, interactive word alignment was used to create training data from a sample. Then the training data were utilised in automatic word alignment in order to generate candidate term pairs. The last step was manual verification of the term pair candidates. Results A dictionary of 31,000 verified entries has been created in less than three man weeks, thus with considerably less time and effort needed compared to a manual approach, and without compromising quality. As a side effect of our work we found 40 different translation problems in the terminology systems and these results indicate the power of the method for finding inconsistencies in terminology translations. We also report on some factors that may contribute to making the process of dictionary creation with similar tools even more expedient. Finally, the contribution is discussed in relation to other ongoing efforts in constructing medical lexicons for non-English languages. Conclusion In three man weeks we were able to produce a medical English-Swedish dictionary consisting of 31,000 entries and also found hidden translation errors in the utilized medical terminology systems. PMID:17034649

  6. Iconicity can ground the creation of vocal symbols

    PubMed Central

    Perlman, Marcus; Dale, Rick; Lupyan, Gary

    2015-01-01

    Studies of gestural communication systems find that they originate from spontaneously created iconic gestures. Yet, we know little about how people create vocal communication systems, and many have suggested that vocalizations do not afford iconicity beyond trivial instances of onomatopoeia. It is unknown whether people can generate vocal communication systems through a process of iconic creation similar to gestural systems. Here, we examine the creation and development of a rudimentary vocal symbol system in a laboratory setting. Pairs of participants generated novel vocalizations for 18 different meanings in an iterative ‘vocal’ charades communication game. The communicators quickly converged on stable vocalizations, and naive listeners could correctly infer their meanings in subsequent playback experiments. People's ability to guess the meanings of these novel vocalizations was predicted by how close the vocalization was to an iconic ‘meaning template’ we derived from the production data. These results strongly suggest that the meaningfulness of these vocalizations derived from iconicity. Our findings illuminate a mechanism by which iconicity can ground the creation of vocal symbols, analogous to the function of iconicity in gestural communication systems. PMID:26361547

  7. Iconicity can ground the creation of vocal symbols.

    PubMed

    Perlman, Marcus; Dale, Rick; Lupyan, Gary

    2015-08-01

    Studies of gestural communication systems find that they originate from spontaneously created iconic gestures. Yet, we know little about how people create vocal communication systems, and many have suggested that vocalizations do not afford iconicity beyond trivial instances of onomatopoeia. It is unknown whether people can generate vocal communication systems through a process of iconic creation similar to gestural systems. Here, we examine the creation and development of a rudimentary vocal symbol system in a laboratory setting. Pairs of participants generated novel vocalizations for 18 different meanings in an iterative 'vocal' charades communication game. The communicators quickly converged on stable vocalizations, and naive listeners could correctly infer their meanings in subsequent playback experiments. People's ability to guess the meanings of these novel vocalizations was predicted by how close the vocalization was to an iconic 'meaning template' we derived from the production data. These results strongly suggest that the meaningfulness of these vocalizations derived from iconicity. Our findings illuminate a mechanism by which iconicity can ground the creation of vocal symbols, analogous to the function of iconicity in gestural communication systems.

  8. Substantiation of International Nanomaterials Security Group Creation

    NASA Astrophysics Data System (ADS)

    Sosnov, A.; Sadovnikov, S.; Panfilov, S.; Magarshak, Yu.

    Nanotechnology has achieved the status as one of the critical R&D area. Scientists use the unique properties of atomic and molecular assemblages built at the nanometer scale. The ability to manipulate the physical, chemical, and biological properties of molecules and particles affords to design agents with set up properties. But the technology allows creating not only useful agents. Possible accidental or deliberate creation of new nanoparticles (NPs) with dangerous properties is highly probable minor product of progress in the new area. The article briefly describes some pathways in development and implementation of NPs for medicinal and the similar purposes. Some of NPs can effective facilitate and mask transport of various agents in various environments. Possible creation of new dangerous NPs (e.g. conjugates based on combination of extensively use NPs and chemical, biological and radioactive agents) as well as creation of brand new NPs and nanodevices with unique properties needs creation of international multidiscipline community for security evaluation of nanomaterials and technologies. The community will forecast possible dangerous unexpectedness in the field of nanoscale materials and devices and suggests rational pathways for prevention of the threats.

  9. Imaginary Worlds in Middle Childhood: A Qualitative Study of Two Pairs of Coordinated Paracosms

    ERIC Educational Resources Information Center

    Taylor, Marjorie; Mottweiler, Candice M.; Naylor, Emilee R.; Levernier, Jacob G.

    2015-01-01

    Imagining alternatives to actual experiences is an important part of everyday life that can take many forms. One manifestation in middle childhood is the creation of elaborate imaginary worlds, called "paracosms." Retrospective reports of adults indicate that having a childhood paracosm is more commonly reported in individuals…

  10. New Common Proper-Motion Pairs with R.A. Between 00h and 01h

    NASA Astrophysics Data System (ADS)

    Caballero, Rafael

    2015-07-01

    This paper presents 37 new common proper-motion pairs. The new pairs have been obtained employing a semi-automatic procedure based on the inspection of images using the tool Aladin, completed with information obtained from the catalogs available at VizieR. All the pairs fulfill the Halbwachs criteria, employed to increase the probability of a physical bond between the two components.

  11. Maintaining the NA atmosphere of Mercury

    NASA Astrophysics Data System (ADS)

    Killen, R. M.; Morgan, T. H.

    1993-02-01

    The possible sources of the Na atmosphere of Mercury are calculatively studied. The likely structure, composition, and temperature of the planet's upper crust is examined along with the probable flux of Na from depth by grain boundary diffusion and by Knudsen flow. The creation of fresh regolith is considered along with mechanisms for supplying Na from the surface to the exosphere. The implications of the calculations for the probable abundances in the regolith are discussed.

  12. Effect of the temporal laser pulse asymmetry on pair production processes during intense laser-electron scattering

    NASA Astrophysics Data System (ADS)

    Hojbota, C. I.; Kim, Hyung Taek; Kim, Chul Min; Pathak, V. B.; Nam, Chang Hee

    2018-06-01

    We investigate the effects of laser pulse shape on strong-field quantum electrodynamics (QED) processes during the collision between a relativistic electron beam and an intense laser pulse. The interplay between high-energy photon emission and two pair production processes, i.e. nonlinear Breit–Wheeler (BW) and Trident, was investigated using particle-in-cell simulations. We found that the temporal evolution of these two processes could be controlled by using laser pulses with different degrees of asymmetry. The temporal envelope of the laser pulse can significantly affect the number of pairs coming from the Trident process, while the nonlinear BW process is less sensitive to it. This study shows that the two QED processes can be examined with state-of-the-art petawatt lasers and the discrimination of the two pair creation processes is feasible by adjusting the temporal asymmetry of the colliding laser pulse.

  13. Approved Methods and Algorithms for DoD Risk-Based Explosives Siting

    DTIC Science & Technology

    2007-02-02

    glass. Pgha Probability of a person being in the glass hazard area Phit Probability of hit Phit (f) Probability of hit for fatality Phit (maji...Probability of hit for major injury Phit (mini) Probability of hit for minor injury Pi Debris probability densities at the ES PMaj (pair) Individual...combined high-angle and combined low-angle tables. A unique probability of hit is calculated for the three consequences of fatality, Phit (f), major injury

  14. Dense GeV electron–positron pairs generated by lasers in near-critical-density plasmas

    PubMed Central

    Zhu, Xing-Long; Yu, Tong-Pu; Sheng, Zheng-Ming; Yin, Yan; Turcu, Ion Cristian Edmond; Pukhov, Alexander

    2016-01-01

    Pair production can be triggered by high-intensity lasers via the Breit–Wheeler process. However, the straightforward laser–laser colliding for copious numbers of pair creation requires light intensities several orders of magnitude higher than possible with the ongoing laser facilities. Despite the numerous proposed approaches, creating high-energy-density pair plasmas in laboratories is still challenging. Here we present an all-optical scheme for overdense pair production by two counter-propagating lasers irradiating near-critical-density plasmas at only ∼1022 W cm−2. In this scheme, bright γ-rays are generated by radiation-trapped electrons oscillating in the laser fields. The dense γ-photons then collide with the focused counter-propagating lasers to initiate the multi-photon Breit–Wheeler process. Particle-in-cell simulations indicate that one may generate a high-yield (1.05 × 1011) overdense (4 × 1022 cm−3) GeV positron beam using 10 PW scale lasers. Such a bright pair source has many practical applications and could be basis for future compact high-luminosity electron–positron colliders. PMID:27966530

  15. Generating polarization-entangled photon pairs using cross-spliced birefringent fibers.

    PubMed

    Meyer-Scott, Evan; Roy, Vincent; Bourgoin, Jean-Philippe; Higgins, Brendon L; Shalm, Lynden K; Jennewein, Thomas

    2013-03-11

    We demonstrate a novel polarization-entangled photon-pair source based on standard birefringent polarization-maintaining optical fiber. The source consists of two stretches of fiber spliced together with perpendicular polarization axes, and has the potential to be fully fiber-based, with all bulk optics replaced with in-fiber equivalents. By modelling the temporal walk-off in the fibers, we implement compensation necessary for the photon creation processes in the two stretches of fiber to be indistinguishable. Our source subsequently produces a high quality entangled state having (92.2 ± 0.2) % fidelity with a maximally entangled Bell state.

  16. Hard choices in assessing survival past dams — a comparison of single- and paired-release strategies

    USGS Publications Warehouse

    Zydlewski, Joseph D.; Stich, Daniel S.; Sigourney, Douglas B.

    2017-01-01

    Mark–recapture models are widely used to estimate survival of salmon smolts migrating past dams. Paired releases have been used to improve estimate accuracy by removing components of mortality not attributable to the dam. This method is accompanied by reduced precision because (i) sample size is reduced relative to a single, large release; and (ii) variance calculations inflate error. We modeled an idealized system with a single dam to assess trade-offs between accuracy and precision and compared methods using root mean squared error (RMSE). Simulations were run under predefined conditions (dam mortality, background mortality, detection probability, and sample size) to determine scenarios when the paired release was preferable to a single release. We demonstrate that a paired-release design provides a theoretical advantage over a single-release design only at large sample sizes and high probabilities of detection. At release numbers typical of many survival studies, paired release can result in overestimation of dam survival. Failures to meet model assumptions of a paired release may result in further overestimation of dam-related survival. Under most conditions, a single-release strategy was preferable.

  17. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  18. Analysis of HIV-1 intersubtype recombination breakpoints suggests region with high pairing probability may be a more fundamental factor than sequence similarity affecting HIV-1 recombination.

    PubMed

    Jia, Lei; Li, Lin; Gui, Tao; Liu, Siyang; Li, Hanping; Han, Jingwan; Guo, Wei; Liu, Yongjian; Li, Jingyun

    2016-09-21

    With increasing data on HIV-1, a more relevant molecular model describing mechanism details of HIV-1 genetic recombination usually requires upgrades. Currently an incomplete structural understanding of the copy choice mechanism along with several other issues in the field that lack elucidation led us to perform an analysis of the correlation between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarity to further explore structural mechanisms. Near full length sequences of URFs from Asia, Europe, and Africa (one sequence/patient), and representative sequences of worldwide CRFs were retrieved from the Los Alamos HIV database. Their recombination patterns were analyzed by jpHMM in detail. Then the relationships between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarities were investigated. Pearson correlation test showed that all URF groups and the CRF group exhibit the same breakpoint distribution pattern. Additionally, the Wilcoxon two-sample test indicated a significant and inexplicable limitation of recombination in regions with high pairing probability. These regions have been found to be strongly conserved across distinct biological states (i.e., strong intersubtype similarity), and genetic similarity has been determined to be a very important factor promoting recombination. Thus, the results revealed an unexpected disagreement between intersubtype similarity and breakpoint distribution, which were further confirmed by genetic similarity analysis. Our analysis reveals a critical conflict between results from natural HIV-1 isolates and those from HIV-1-based assay vectors in which genetic similarity has been shown to be a very critical factor promoting recombination. These results indicate the region with high-pairing probabilities may be a more fundamental factor affecting HIV-1 recombination than sequence similarity in natural HIV-1 infections. Our findings will be relevant in furthering the understanding of HIV-1 recombination mechanisms.

  19. Radiative Processes in Graphene and Similar Nanostructures in Strong Electric Fields

    NASA Astrophysics Data System (ADS)

    Gavrilov, S. P.; Gitman, D. M.

    2017-03-01

    Low-energy single-electron dynamics in graphene monolayers and similar nanostructures is described by the Dirac model, being a 2+1 dimensional version of massless QED with the speed of light replaced by the Fermi velocity vF ≃ c/300. Methods of strong-field QFT are relevant for the Dirac model, since any low-frequency electric field requires a nonperturbative treatment of massless carriers in the case it remains unchanged for a sufficiently long time interval. In this case, the effects of creation and annihilation of electron-hole pairs produced from vacuum by a slowly varying and small-gradient electric field are relevant, thereby substantially affecting the radiation pattern. For this reason, the standard QED text-book theory of photon emission cannot be of help. We construct the Fock-space representation of the Dirac model, which takes exact accounts of the effects of vacuum instability caused by external electric fields, and in which the interaction between electrons and photons is taken into account perturbatively, following the general theory (the generalized Furry representation). We consider the effective theory of photon emission in the first-order approximation and construct the corresponding total probabilities, taking into account the unitarity relation.

  20. Reconstruction method for data protection in telemedicine systems

    NASA Astrophysics Data System (ADS)

    Buldakova, T. I.; Suyatinov, S. I.

    2015-03-01

    In the report the approach to protection of transmitted data by creation of pair symmetric keys for the sensor and the receiver is offered. Since biosignals are unique for each person, their corresponding processing allows to receive necessary information for creation of cryptographic keys. Processing is based on reconstruction of the mathematical model generating time series that are diagnostically equivalent to initial biosignals. Information about the model is transmitted to the receiver, where the restoration of physiological time series is performed using the reconstructed model. Thus, information about structure and parameters of biosystem model received in the reconstruction process can be used not only for its diagnostics, but also for protection of transmitted data in telemedicine complexes.

  1. The effects of anterior arcuate and dorsomedial frontal cortex lesions on visually guided eye movements: 2. Paired and multiple targets.

    PubMed

    Schiller, P H; Chou, I

    2000-01-01

    This study examined the effects of anterior arcuate and dorsomedial frontal cortex lesions on the execution of saccadic eye movements made to paired and multiple targets in rhesus monkeys. Identical paired targets were presented with various temporal asynchronies to determine the temporal offset required to yield equal probability choices to either target. In the intact animal equal probability choices were typically obtained when the targets appeared simultaneously. After unilateral anterior arcuate lesions a major shift arose in the temporal offset required to obtain equal probability choices for paired targets that necessitated presenting the target in the hemifield contralateral to the lesion more than 100 ms prior to the target in the ipsilateral hemifield. This deficit was still pronounced 1 year after the lesion. Dorsomedial frontal cortex lesions produced much smaller but significant shifts in target selection that recovered more rapidly. Paired lesions produced deficits similar to those observed with anterior arcuate lesions alone. Major deficits were also observed on a multiple target temporal discrimination task after anterior arcuate but not after dorsomedial frontal cortex lesions. These results suggest that the frontal eye fields that reside in anterior bank of the arcuate sulcus play an important role in temporal processing and in target selection. Dorsomedial frontal cortex, that contains the medial eye fields, plays a much less important role in the execution of these tasks.

  2. Conflict Probability Estimation for Free Flight

    NASA Technical Reports Server (NTRS)

    Paielli, Russell A.; Erzberger, Heinz

    1996-01-01

    The safety and efficiency of free flight will benefit from automated conflict prediction and resolution advisories. Conflict prediction is based on trajectory prediction and is less certain the farther in advance the prediction, however. An estimate is therefore needed of the probability that a conflict will occur, given a pair of predicted trajectories and their levels of uncertainty. A method is developed in this paper to estimate that conflict probability. The trajectory prediction errors are modeled as normally distributed, and the two error covariances for an aircraft pair are combined into a single equivalent covariance of the relative position. A coordinate transformation is then used to derive an analytical solution. Numerical examples and Monte Carlo validation are presented.

  3. A Computer Program To Increase Comprehension of the Cartesian Rectangular Coordinate System in High School Pre-Algebra Students.

    ERIC Educational Resources Information Center

    Exley, I. Sheck

    The high percentage of high school pre-algebra students having difficulty learning the abstract concept of graphing ordered pairs on the Cartesian rectangular coordinate system was addressed by the creation and implementation of a computer-managed instructional program. Modules consisted of a pretest, instruction, two practice sessions, and a…

  4. Exact calculation of loop formation probability identifies folding motifs in RNA secondary structures

    PubMed Central

    Sloma, Michael F.; Mathews, David H.

    2016-01-01

    RNA secondary structure prediction is widely used to analyze RNA sequences. In an RNA partition function calculation, free energy nearest neighbor parameters are used in a dynamic programming algorithm to estimate statistical properties of the secondary structure ensemble. Previously, partition functions have largely been used to estimate the probability that a given pair of nucleotides form a base pair, the conditional stacking probability, the accessibility to binding of a continuous stretch of nucleotides, or a representative sample of RNA structures. Here it is demonstrated that an RNA partition function can also be used to calculate the exact probability of formation of hairpin loops, internal loops, bulge loops, or multibranch loops at a given position. This calculation can also be used to estimate the probability of formation of specific helices. Benchmarking on a set of RNA sequences with known secondary structures indicated that loops that were calculated to be more probable were more likely to be present in the known structure than less probable loops. Furthermore, highly probable loops are more likely to be in the known structure than the set of loops predicted in the lowest free energy structures. PMID:27852924

  5. Efficiency of Synchrotron Radiation from Rotation-powered Pulsars

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kisaka, Shota; Tanaka, Shuta J., E-mail: kisaka@phys.aoyama.ac.jp, E-mail: sjtanaka@center.konan-u.ac.jp

    2017-03-01

    Synchrotron radiation is widely considered to be the origin of the pulsed non-thermal emissions from rotation-powered pulsars in optical and X-ray bands. In this paper, we study the synchrotron radiation emitted by the created electron and positron pairs in the pulsar magnetosphere to constrain the energy conversion efficiency from the Poynting flux to the particle energy flux. We model two pair creation processes, two-photon collision, which efficiently works in young γ -ray pulsars (≲10{sup 6} year), and magnetic pair creation, which is the dominant process to supply pairs in old pulsars (≳10{sup 6} year). Using the analytical model, we derivemore » the maximum synchrotron luminosity as a function of the energy conversion efficiency. From the comparison with observations, we find that the energy conversion efficiency to the accelerated particles should be an order of unity in the magnetosphere, even though we make a number of the optimistic assumptions to enlarge the synchrotron luminosity. In order to explain the luminosity of the non-thermal X-ray/optical emission from pulsars with low spin-down luminosity L {sub sd} ≲ 10{sup 34} erg s{sup −1}, non-dipole magnetic field components should be dominant at the emission region. For the γ -ray pulsars with L {sub sd} ≲ 10{sup 35} erg s{sup −1}, observed γ -ray to X-ray and optical flux ratios are much higher than the flux ratio between curvature and the synchrotron radiations. We discuss some possibilities such as the coexistence of multiple accelerators in the magnetosphere as suggested from the recent numerical simulation results. The obtained maximum luminosity would be useful to select observational targets in X-ray and optical bands.« less

  6. Dual origin of pairing in nuclei

    NASA Astrophysics Data System (ADS)

    Idini, A.; Potel, G.; Barranco, F.; Vigezzi, E.; Broglia, R. A.

    2016-11-01

    The pairing correlations of the nucleus 120Sn are calculated by solving the Nambu-Gor'kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong 1 S 0 short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- ( v p bare) and long-range ( v p ind) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

  7. Combined-probability space and certainty or uncertainty relations for a finite-level quantum system

    NASA Astrophysics Data System (ADS)

    Sehrawat, Arun

    2017-08-01

    The Born rule provides a probability vector (distribution) with a quantum state for a measurement setting. For two settings, we have a pair of vectors from the same quantum state. Each pair forms a combined-probability vector that obeys certain quantum constraints, which are triangle inequalities in our case. Such a restricted set of combined vectors, called the combined-probability space, is presented here for a d -level quantum system (qudit). The combined space is a compact convex subset of a Euclidean space, and all its extreme points come from a family of parametric curves. Considering a suitable concave function on the combined space to estimate the uncertainty, we deliver an uncertainty relation by finding its global minimum on the curves for a qudit. If one chooses an appropriate concave (or convex) function, then there is no need to search for the absolute minimum (maximum) over the whole space; it will be on the parametric curves. So these curves are quite useful for establishing an uncertainty (or a certainty) relation for a general pair of settings. We also demonstrate that many known tight certainty or uncertainty relations for a qubit can be obtained with the triangle inequalities.

  8. The creation of racks and nanopores creation in various allotropes of boron due to the mechanical loads

    NASA Astrophysics Data System (ADS)

    Sadeghzadeh, S.

    2017-11-01

    Two-dimensional (2D) materials have recently attracted a great attraction. This paper provides a detailed discussion on the rupture mechanisms of different allotropes of boron. As a new 2D material by using a reactive molecular dynamics model, probable types of rupture for borophene sheets were studied, among which two dominant mechanisms were observed: creation of the cracks and formation of nanopores. The results obtained are compared to those for graphene and h-BN nano sheets, although the rupture mechanism was completely different from the graphene and h-BN sheets. The simulations suggested that borophene might remain more stable against external mechanical loads than graphene and BN sheets. Cracking leads to larger strain along the loading direction, whereas the creation of local pores spends the imposed energy for breaking the internal bonds and so flowing the external energy into the various bonds increases the number of pores. For the armchair-types, cracking is a dominant mechanism while for the zigzag-type the common mechanism is the creation of nanopores. These interesting results may help to design a new class of semiconductors that remain stable even when are sustaining uncontrollable external stresses.

  9. Multipacting on the trailing edge of proton beam bunches in the PSR and SNS

    NASA Astrophysics Data System (ADS)

    Danilov, V.; Aleksandrov, A.; Galambos, J.; Jeon, D.; Holmes, J.; Olsen, D.

    1999-12-01

    The Proton Storage Ring (PSR) in Los Alamos has a fast intensity-limiting instability, which may result from an electron cloud interaction with the circulating proton beam leading to a transverse mode coupling instability. The most probable mechanism of the electron creation is multipacting. Though the effect depends on many parameters, a model is presented which predicts a large electron creation in the vacuum chamber. A comparison of this effect between the PSR in Los Alamos and the Spallation Neutron Source (SNS) in Oak Ridge is given. In addition, several possibilities to reduce multipactor are discussed.

  10. Simultaneous production of lepton pairs in ultraperipheral relativistic heavy ion collisions

    NASA Astrophysics Data System (ADS)

    Kurban, E.; Güçlü, M. C.

    2017-10-01

    We calculate the total cross sections and probabilities of electromagnetic productions of electron, muon, and tauon pairs simultaneously. At the CERN Large Hadron Collider (LHC), the available electromagnetic energy is sufficient to produce all kinds of leptons coherently. The masses of muons and tauons are large, so their Compton wavelengths are small enough to interact with the colliding nuclei. Therefore, the realistic nuclear form factors are included in the calculations of electromagnetic pair productions. The cross section calculations show that, at LHC energies, the probabilities of simultaneous productions of all kinds of leptons are increased significantly compared to energies available at the BNL Relativistic Heavy Ion Collider (RHIC) . Experimentally, observing this simultaneous production can give us important information about strong QED.

  11. Wear of enamel and veneering ceramics after laboratory and chairside finishing procedures.

    PubMed

    Magne, P; Oh, W S; Pintado, M R; DeLong, R

    1999-12-01

    This in vitro study compared the wear of enamel against 3 types of ceramics with high esthetic potential (designed for layering techniques): feldspathic porcelain (Creation), aluminous porcelain (Vitadur alpha), and low-fusing glass (Duceram-LFC). Laboratory finishing (glazing/polishing) and chairside polishing with a Dialite kit were simulated to compare their respective effects on wear. Tooth-material specimen pairs were placed in an artificial mouth using closed-loop servohydraulics. Constant masticatory parameters (13.5 N occlusal force, 0.62 mm lateral excursion; 0.23 second cuspal contact time) were maintained for 300, 000 cycles at a rate of 4 Hz. The occlusal surface of each pair was mapped and digitally recorded before and after each masticatory test. Quantitative changes were measured in terms of depth and volume of wear. Quantitative wear characteristics were assessed by SEM. Significant differences were observed (2-factor ANOVA, P <.05). Duceram-LFC generated increased volume loss of enamel (0.197 mm(3)) compared with Creation (0.135 mm(3)) and Vitadur alpha (0.153 mm(3)). Creation exhibited the lowest ceramic wear and lowest combined volume loss (0.260 mm(3); the sum of the data for enamel and the opposing material) compared with Duceram-LFC (0.363 mm(3)) and Vitadur alpha (0.333 mm(3)). The most significant differences among materials were observed in volume loss, not in depth of wear. For all 3 ceramic systems, qualitative SEM evaluation revealed an abrasive type of wear. Wear characteristics of chairside polished specimens were similar to those of laboratory finished specimens (glazed and polished). Duceram-LFC was the most abrasive ceramic for the antagonistic tooth. Creation ceramic was the least abrasive material and most resistant to wear. Defects, brittleness, and the possibly insufficient toughness of LFC may explain its increased abrasiveness. Laboratory and chairside finishing procedures generated similar results.

  12. Causal inference, probability theory, and graphical insights.

    PubMed

    Baker, Stuart G

    2013-11-10

    Causal inference from observational studies is a fundamental topic in biostatistics. The causal graph literature typically views probability theory as insufficient to express causal concepts in observational studies. In contrast, the view here is that probability theory is a desirable and sufficient basis for many topics in causal inference for the following two reasons. First, probability theory is generally more flexible than causal graphs: Besides explaining such causal graph topics as M-bias (adjusting for a collider) and bias amplification and attenuation (when adjusting for instrumental variable), probability theory is also the foundation of the paired availability design for historical controls, which does not fit into a causal graph framework. Second, probability theory is the basis for insightful graphical displays including the BK-Plot for understanding Simpson's paradox with a binary confounder, the BK2-Plot for understanding bias amplification and attenuation in the presence of an unobserved binary confounder, and the PAD-Plot for understanding the principal stratification component of the paired availability design. Published 2013. This article is a US Government work and is in the public domain in the USA.

  13. A French national research project to the creation of an auscultation's school: the ASAP project.

    PubMed

    Andrès, Emmanuel; Reichert, Sandra; Gass, Raymond; Brandt, Christian

    2009-05-01

    Auscultation of pulmonary sounds provides valuable clinical information but has been regarded as a tool of low diagnostic value due to the inherent subjectivity in the evaluation of these sounds. This paper describes an ambitious study of in the so-called ASAP project or "Analyse de Sons Auscultatoires et Pathologiques". ASAP is a 3-year-long French collaborative project developed in the context of the News Technologies of Information and Communication. ASAP aims at making evolve the auscultation technics: by 1) the development objective tools for the analyse of auscultation sounds: electronic stethoscopes paired with computing device; 2) the creation of an auscultation sounds' database in order to compare and identify the acoustical and visual signatures of the pathologies; and 3) the capitalisation of these new auscultation techniques around the creation of a teaching unit: "Ecole de l'Auscultation". This auscultation's school will be destined to the initial and continuous formation of the medical attendants.

  14. LLE Review 116 (July-September 2008)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marozas, J.A., editor

    2010-03-12

    This issue has the following articles: (1) Optimizing Electron-Positron Pair Production on kJ-Class High-Intensity Lasers for the Purpose of Pair-Plasma Creation; (2) Neutron Yield Study of Direct-Drive, Low-Adiabat Cryogenic D2 Implosions on OMEGA; (3) Al 1s-2p Absorption Spectroscopy of Shock-Wave Heating and Compression in Laser-Driven Planar Foil; (4) A Measurable Lawson Criterion and Hydro-Equivalent Curves for Inertial Confinement Fusion; (5) Pulsed-THz Characterization of Hg-Based, High-Temperature Superconductors; (6) LLE's Summer High School Research Program; (7) FY08 Laser Facility Report; and (8) National Laser Users Facility and External Users Programs.

  15. Comparison of Fingerprint and Iris Biometric Authentication for Control of Digital Signatures

    PubMed Central

    Zuckerman, Alan E.; Moon, Kenneth A.; Eaddy, Kenneth

    2002-01-01

    Biometric authentication systems can be used to control digital signature of medical documents. This pilot study evaluated the use of two different fingerprint technologies and one iris technology to control creation of digital signatures on a central server using public private key pairs stored on the server. Documents and signatures were stored in XML for portability. Key pairs and authentication certificates were generated during biometric enrollment. Usability and user acceptance were guarded and limitations of biometric systems prevented use of the system with all test subjects. The system detected alternations in the data content and provided future signer re-authentication for non-repudiation.

  16. Time- and Space-Order Effects in Timed Discrimination of Brightness and Size of Paired Visual Stimuli

    ERIC Educational Resources Information Center

    Patching, Geoffrey R.; Englund, Mats P.; Hellstrom, Ake

    2012-01-01

    Despite the importance of both response probability and response time for testing models of choice, there is a dearth of chronometric studies examining systematic asymmetries that occur over time- and space-orders in the method of paired comparisons. In this study, systematic asymmetries in discriminating the magnitude of paired visual stimuli are…

  17. Distribution of Base Pair Alternations in a Periodic DNA Chain: Application of Pólya Counting to a Physical System

    NASA Astrophysics Data System (ADS)

    Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos

    2018-03-01

    In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.

  18. Application of Monte Carlo cross-validation to identify pathway cross-talk in neonatal sepsis.

    PubMed

    Zhang, Yuxia; Liu, Cui; Wang, Jingna; Li, Xingxia

    2018-03-01

    To explore genetic pathway cross-talk in neonates with sepsis, an integrated approach was used in this paper. To explore the potential relationships between differently expressed genes between normal uninfected neonates and neonates with sepsis and pathways, genetic profiling and biologic signaling pathway were first integrated. For different pathways, the score was obtained based upon the genetic expression by quantitatively analyzing the pathway cross-talk. The paired pathways with high cross-talk were identified by random forest classification. The purpose of the work was to find the best pairs of pathways able to discriminate sepsis samples versus normal samples. The results found 10 pairs of pathways, which were probably able to discriminate neonates with sepsis versus normal uninfected neonates. Among them, the best two paired pathways were identified according to analysis of extensive literature. Impact statement To find the best pairs of pathways able to discriminate sepsis samples versus normal samples, an RF classifier, the DS obtained by DEGs of paired pathways significantly associated, and Monte Carlo cross-validation were applied in this paper. Ten pairs of pathways were probably able to discriminate neonates with sepsis versus normal uninfected neonates. Among them, the best two paired pathways ((7) IL-6 Signaling and Phospholipase C Signaling (PLC); (8) Glucocorticoid Receptor (GR) Signaling and Dendritic Cell Maturation) were identified according to analysis of extensive literature.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Băloi, Mihaela-Andreea, E-mail: mihaela.baloi88@e-uvt.ro; Crucean, Cosmin

    The production of fermions in dipolar electric fields on de Sitter universe is studied. The amplitude and probability of pair production are computed using the exact solution of the Dirac equation in de Sitter spacetime. The form of the dipolar fields is established using the conformal invariance of the Maxwell equations. We obtain that the momentum conservation law is broken in the process of pair production in dipolar electric fields. Also we establish that there are nonvanishing probabilities for processes in which the helicity is conserved/nonconserved. The Minkowski limit is recovered when the expansion factor becomes zero.

  20. Answer to Question {number_sign}30 [{open_quote}{open_quote}How are positrons moderated?,{close_quote}{close_quote} Thomas D. Rossing, Am. J. Phys. {bold 63}(12), 1065 (1995)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weber, M.; Lynn, K.G.

    1996-07-01

    The positrons from {beta}{sup +} decaying sources loss energyat a much faster rate than they annihilate. As the energy of the positrons drops, core excitations, plasmon excitation, electron/hole pair creation, and phonon scattering are the dominant processes of further energy loss.

  1. Characterization of the Amplificatory Effect of Norepinephrine in the Acquisition of Pavlovian Threat Associations

    ERIC Educational Resources Information Center

    Díaz-Mataix, Lorenzo; Piper, Walter T.; Schiff, Hillary C.; Roberts, Clark H.; Campese, Vincent D.; Sears, Robert M.; LeDoux, Joseph E.

    2017-01-01

    The creation of auditory threat Pavlovian memory requires an initial learning stage in which a neutral conditioned stimulus (CS), such as a tone, is paired with an aversive one (US), such as a shock. In this phase, the CS acquires the capacity of predicting the occurrence of the US and therefore elicits conditioned defense responses.…

  2. Distinct dissociation kinetics between ion pairs: Solvent-coordinate free-energy landscape analysis.

    PubMed

    Yonetani, Yoshiteru

    2015-07-28

    Different ion pairs exhibit different dissociation kinetics; however, while the nature of this process is vital for understanding various molecular systems, the underlying mechanism remains unclear. In this study, to examine the origin of different kinetic rate constants for this process, molecular dynamics simulations were conducted for LiCl, NaCl, KCl, and CsCl in water. The results showed substantial differences in dissociation rate constant, following the trend kLiCl < kNaCl < kKCl < kCsCl. Analysis of the free-energy landscape with a solvent reaction coordinate and subsequent rate component analysis showed that the differences in these rate constants arose predominantly from the variation in solvent-state distribution between the ion pairs. The formation of a water-bridging configuration, in which the water molecule binds to an anion and a cation simultaneously, was identified as a key step in this process: water-bridge formation lowers the related dissociation free-energy barrier, thereby increasing the probability of ion-pair dissociation. Consequently, a higher probability of water-bridge formation leads to a higher ion-pair dissociation rate.

  3. Antimatter Production at a Potential Boundary

    NASA Technical Reports Server (NTRS)

    LaPointe, Michael R.; Reddy, Dhanireddy (Technical Monitor)

    2001-01-01

    Current antiproton production techniques rely on high-energy collisions between beam particles and target nuclei to produce particle and antiparticle pairs, but inherently low production and capture efficiencies render these techniques impractical for the cost-effective production of antimatter for space propulsion and other commercial applications. Based on Dirac's theory of the vacuum field, a new antimatter production concept is proposed in which particle-antiparticle pairs are created at the boundary of a steep potential step formed by the suppression of the local vacuum fields. Current antimatter production techniques are reviewed, followed by a description of Dirac's relativistic quantum theory of the vacuum state and corresponding solutions for particle tunneling and reflection from a potential barrier. The use of the Casimir effect to suppress local vacuum fields is presented as a possible technique for generating the sharp potential gradients required for particle-antiparticle pair creation.

  4. Pair creation, motion, and annihilation of topological defects in two-dimensional nematic liquid crystals

    NASA Astrophysics Data System (ADS)

    Cortese, Dario; Eggers, Jens; Liverpool, Tanniemola B.

    2018-02-01

    We present a framework for the study of disclinations in two-dimensional active nematic liquid crystals and topological defects in general. The order tensor formalism is used to calculate exact multiparticle solutions of the linearized static equations inside a planar uniformly aligned state so that the total charge has to vanish. Topological charge conservation then requires that there is always an equal number of q =1 /2 and q =-1 /2 charges. Starting from a set of hydrodynamic equations, we derive a low-dimensional dynamical system for the parameters of the static solutions, which describes the motion of a half-disclination pair or of several pairs. Within this formalism, we model defect production and annihilation, as observed in experiments. Our dynamics also provide an estimate for the critical density at which production and annihilation rates are balanced.

  5. Gamma beams generation with high intensity lasers for two photon Breit-Wheeler pair production

    NASA Astrophysics Data System (ADS)

    D'Humieres, Emmanuel; Ribeyre, Xavier; Jansen, Oliver; Esnault, Leo; Jequier, Sophie; Dubois, Jean-Luc; Hulin, Sebastien; Tikhonchuk, Vladimir; Arefiev, Alex; Toncian, Toma; Sentoku, Yasuhiko

    2017-10-01

    Linear Breit-Wheeler pair creation is the lowest threshold process in photon-photon interaction, controlling the energy release in Gamma Ray Bursts and Active Galactic Nuclei, but it has never been directly observed in the laboratory. Using numerical simulations, we demonstrate the possibility to produce collimated gamma beams with high energy conversion efficiency using high intensity lasers and innovative targets. When two of these beams collide at particular angles, our analytical calculations demonstrate a beaming effect easing the detection of the pairs in the laboratory. This effect has been confirmed in photon collision simulations using a recently developed innovative algorithm. An alternative scheme using Bremsstrahlung radiation produced by next generation high repetition rate laser systems is also being explored and the results of first optimization campaigns in this regime will be presented.

  6. Exact calculation of loop formation probability identifies folding motifs in RNA secondary structures.

    PubMed

    Sloma, Michael F; Mathews, David H

    2016-12-01

    RNA secondary structure prediction is widely used to analyze RNA sequences. In an RNA partition function calculation, free energy nearest neighbor parameters are used in a dynamic programming algorithm to estimate statistical properties of the secondary structure ensemble. Previously, partition functions have largely been used to estimate the probability that a given pair of nucleotides form a base pair, the conditional stacking probability, the accessibility to binding of a continuous stretch of nucleotides, or a representative sample of RNA structures. Here it is demonstrated that an RNA partition function can also be used to calculate the exact probability of formation of hairpin loops, internal loops, bulge loops, or multibranch loops at a given position. This calculation can also be used to estimate the probability of formation of specific helices. Benchmarking on a set of RNA sequences with known secondary structures indicated that loops that were calculated to be more probable were more likely to be present in the known structure than less probable loops. Furthermore, highly probable loops are more likely to be in the known structure than the set of loops predicted in the lowest free energy structures. © 2016 Sloma and Mathews; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  7. Does prediction error drive one-shot declarative learning?

    PubMed

    Greve, Andrea; Cooper, Elisa; Kaula, Alexander; Anderson, Michael C; Henson, Richard

    2017-06-01

    The role of prediction error (PE) in driving learning is well-established in fields such as classical and instrumental conditioning, reward learning and procedural memory; however, its role in human one-shot declarative encoding is less clear. According to one recent hypothesis, PE reflects the divergence between two probability distributions: one reflecting the prior probability (from previous experiences) and the other reflecting the sensory evidence (from the current experience). Assuming unimodal probability distributions, PE can be manipulated in three ways: (1) the distance between the mode of the prior and evidence, (2) the precision of the prior, and (3) the precision of the evidence. We tested these three manipulations across five experiments, in terms of peoples' ability to encode a single presentation of a scene-item pairing as a function of previous exposures to that scene and/or item. Memory was probed by presenting the scene together with three choices for the previously paired item, in which the two foil items were from other pairings within the same condition as the target item. In Experiment 1, we manipulated the evidence to be either consistent or inconsistent with prior expectations, predicting PE to be larger, and hence memory better, when the new pairing was inconsistent. In Experiments 2a-c, we manipulated the precision of the priors, predicting better memory for a new pairing when the (inconsistent) priors were more precise. In Experiment 3, we manipulated both visual noise and prior exposure for unfamiliar faces, before pairing them with scenes, predicting better memory when the sensory evidence was more precise. In all experiments, the PE hypotheses were supported. We discuss alternative explanations of individual experiments, and conclude the Predictive Interactive Multiple Memory Signals (PIMMS) framework provides the most parsimonious account of the full pattern of results.

  8. The origins of music in auditory scene analysis and the roles of evolution and culture in musical creation

    PubMed Central

    Trainor, Laurel J.

    2015-01-01

    Whether music was an evolutionary adaptation that conferred survival advantages or a cultural creation has generated much debate. Consistent with an evolutionary hypothesis, music is unique to humans, emerges early in development and is universal across societies. However, the adaptive benefit of music is far from obvious. Music is highly flexible, generative and changes rapidly over time, consistent with a cultural creation hypothesis. In this paper, it is proposed that much of musical pitch and timing structure adapted to preexisting features of auditory processing that evolved for auditory scene analysis (ASA). Thus, music may have emerged initially as a cultural creation made possible by preexisting adaptations for ASA. However, some aspects of music, such as its emotional and social power, may have subsequently proved beneficial for survival and led to adaptations that enhanced musical behaviour. Ontogenetic and phylogenetic evidence is considered in this regard. In particular, enhanced auditory–motor pathways in humans that enable movement entrainment to music and consequent increases in social cohesion, and pathways enabling music to affect reward centres in the brain should be investigated as possible musical adaptations. It is concluded that the origins of music are complex and probably involved exaptation, cultural creation and evolutionary adaptation. PMID:25646512

  9. The origins of music in auditory scene analysis and the roles of evolution and culture in musical creation.

    PubMed

    Trainor, Laurel J

    2015-03-19

    Whether music was an evolutionary adaptation that conferred survival advantages or a cultural creation has generated much debate. Consistent with an evolutionary hypothesis, music is unique to humans, emerges early in development and is universal across societies. However, the adaptive benefit of music is far from obvious. Music is highly flexible, generative and changes rapidly over time, consistent with a cultural creation hypothesis. In this paper, it is proposed that much of musical pitch and timing structure adapted to preexisting features of auditory processing that evolved for auditory scene analysis (ASA). Thus, music may have emerged initially as a cultural creation made possible by preexisting adaptations for ASA. However, some aspects of music, such as its emotional and social power, may have subsequently proved beneficial for survival and led to adaptations that enhanced musical behaviour. Ontogenetic and phylogenetic evidence is considered in this regard. In particular, enhanced auditory-motor pathways in humans that enable movement entrainment to music and consequent increases in social cohesion, and pathways enabling music to affect reward centres in the brain should be investigated as possible musical adaptations. It is concluded that the origins of music are complex and probably involved exaptation, cultural creation and evolutionary adaptation.

  10. Creation of dialysis vascular access with normal flow increases brain natriuretic peptide levels.

    PubMed

    Malík, Jan; Tuka, Vladimir; Krupickova, Zdislava; Chytilova, Eva; Holaj, Robert; Slavikova, Marcela

    2009-12-01

    Chronic heart failure is very common in hemodialyzed patients due to several factors such as intermittent volume overload, anemia, and hypertension. Dialysis access flow is usually considered to have a minor effect. We hypothesized that creation of dialysis access with "normal" flow would lead to elevation of B-type natriuretic peptide (BNP), which is a sensitive marker of heart failure. We included subjects with a newly created, well-functioning vascular access and normal left ventricular ejection fraction. They were examined before access creation (baseline), then again 6 weeks and 6 months after the surgery. Only subjects with access flow (Qa) < 1500 ml/min were included. Changes of BNP levels and their relation to access flow were studied. We examined 35 subjects aged 60.6 +/- 13.5 years. Qa was 789 +/- 361 and 823 +/- 313 ml/min at 6 weeks and 6 months after the surgery, respectively. Within 6 weeks after access creation, BNP rose from 217 (294) to 267 (550) ng/l (median (quartile range)) with P = 0.003. Qa was significantly related to BNP levels 6 weeks after access creation (r = 0.37, P = 0.036). Six months after access creation, there was only a trend of BNP decrease (235 (308) ng/l, P = 0.44). Creatinine, blood urea nitrogen and hemoglobin levels as well as patients' weight did not change significantly. Creation of dialysis access with "normal" flow volume leads to significant increase of BNP, which is related to the value of access flow. The increase of BNP probably mirrors worsening of clinically silent heart failure.

  11. Innovations: Scientific, Technological, and Social.

    ERIC Educational Resources Information Center

    Gabor, Dennis

    Dr. Gabor, the inventor of holography (lenseless photography), defines "innovation" as a methodical creation of the human spirit, a novelty that once created can be usefully and repeatedly applied. He describes and evaluates 100 important technological and biological inventions that can probably be expected within the next 50 years. He also…

  12. Radiation Effects on the Electrical Properties of Hafnium Oxide Based MOS Capacitors

    DTIC Science & Technology

    2011-03-01

    Figures Figure Page 1. Conceptual illustration of the creation of electron-hole pairs and displacement damage in a n -type silicon metal-oxide-silicon...Illustration of the effect, in a CV plot, of oxide trapped charge for a hypothetical n -type device...8 5. Illustration of the effect, in a CV plot, of interface trapped charge for a hypothetical n -type device

  13. Repeated count surveys help standardize multi-agency estimates of American Oystercatcher (Haematopus palliatus) abundance

    USGS Publications Warehouse

    Hostetter, Nathan J.; Gardner, Beth; Schweitzer, Sara H.; Boettcher, Ruth; Wilke, Alexandra L.; Addison, Lindsay; Swilling, William R.; Pollock, Kenneth H.; Simons, Theodore R.

    2015-01-01

    The extensive breeding range of many shorebird species can make integration of survey data problematic at regional spatial scales. We evaluated the effectiveness of standardized repeated count surveys coordinated across 8 agencies to estimate the abundance of American Oystercatcher (Haematopus palliatus) breeding pairs in the southeastern United States. Breeding season surveys were conducted across coastal North Carolina (90 plots) and the Eastern Shore of Virginia (3 plots). Plots were visited on 1–5 occasions during April–June 2013. N-mixture models were used to estimate abundance and detection probability in relation to survey date, tide stage, plot size, and plot location (coastal bay vs. barrier island). The estimated abundance of oystercatchers in the surveyed area was 1,048 individuals (95% credible interval: 851–1,408) and 470 pairs (384–637), substantially higher than estimates that did not account for detection probability (maximum counts of 674 individuals and 316 pairs). Detection probability was influenced by a quadratic function of survey date, and increased from mid-April (~0.60) to mid-May (~0.80), then remained relatively constant through June. Detection probability was also higher during high tide than during low, rising, or falling tides. Abundance estimates from N-mixture models were validated at 13 plots by exhaustive productivity studies (2–5 surveys wk−1). Intensive productivity studies identified 78 breeding pairs across 13 productivity plots while the N-mixture model abundance estimate was 74 pairs (62–119) using only 1–5 replicated surveys season−1. Our results indicate that standardized replicated count surveys coordinated across multiple agencies and conducted during a relatively short time window (closure assumption) provide tremendous potential to meet both agency-level (e.g., state) and regional-level (e.g., flyway) objectives in large-scale shorebird monitoring programs.

  14. Transmission events revealed in tuberculosis contact investigations in London.

    PubMed

    Cavany, Sean M; Vynnycky, Emilia; Sumner, Tom; Macdonald, Neil; Thomas, H Lucy; White, Jacqui; White, Richard G; Maguire, Helen; Anderson, Charlotte

    2018-04-27

    Contact tracing is a key part of tuberculosis prevention and care, aiming to hasten diagnosis and prevent transmission. The proportion of case-contact pairs for which recent transmission occurred and the typical timespans between the index case and their contact accessing care are not known; we aimed to calculate these. We analysed individual-level TB contact tracing data, collected in London from 20/01/2011-31/12/2015, linked to tuberculosis surveillance and MIRU-VNTR 24-locus strain-typing information. Of pairs of index cases and contacts diagnosed with active tuberculosis, 85/314 (27%) had strain typing data available for both. Of these pairs, 79% (67/85) shared indistinguishable isolates, implying probable recent transmission. Of pairs in which both contact and the index case had a social risk factor, 11/11 (100%) shared indistinguishable isolates, compared to 55/75 (75%) of pairs in which neither had a social risk factor (P = 0.06). The median time interval between the index case and their contact accessing care was 42 days (IQR: 16, 96). As over 20% of pairs did probably not involve recent transmission between index case and contact, the effectiveness of contact tracing is not necessarily limited to those circumstances where the index case has transmitted disease to their close contacts.

  15. Higher-dimensional attractors with absolutely continuous invariant probability

    NASA Astrophysics Data System (ADS)

    Bocker, Carlos; Bortolotti, Ricardo

    2018-05-01

    Consider a dynamical system given by , where E is a linear expanding map of , C is a linear contracting map of and f is in . We provide sufficient conditions for E that imply the existence of an open set of pairs for which the corresponding dynamic T admits a unique absolutely continuous invariant probability. A geometrical characteristic of transversality between self-intersections of images of is present in the dynamic of the maps in . In addition, we give a condition between E and C under which it is possible to perturb f to obtain a pair in .

  16. What is preexisting strength? Predicting free association probabilities, similarity ratings, and cued recall probabilities.

    PubMed

    Nelson, Douglas L; Dyrdal, Gunvor M; Goodmon, Leilani B

    2005-08-01

    Measuring lexical knowledge poses a challenge to the study of the influence of preexisting knowledge on the retrieval of new memories. Many tasks focus on word pairs, but words are embedded in associative networks, so how should preexisting pair strength be measured? It has been measured by free association, similarity ratings, and co-occurrence statistics. Researchers interpret free association response probabilities as unbiased estimates of forward cue-to-target strength. In Study 1, analyses of large free association and extralist cued recall databases indicate that this interpretation is incorrect. Competitor and backward strengths bias free association probabilities, and as with other recall tasks, preexisting strength is described by a ratio rule. In Study 2, associative similarity ratings are predicted by forward and backward, but not by competitor, strength. Preexisting strength is not a unitary construct, because its measurement varies with method. Furthermore, free association probabilities predict extralist cued recall better than do ratings and co-occurrence statistics. The measure that most closely matches the criterion task may provide the best estimate of the identity of preexisting strength.

  17. Pair luminescence in Cr3+ -doped Ba2Mg(BO3)2

    NASA Astrophysics Data System (ADS)

    Bondzior, Bartosz; Miniajluk, Natalia; Dereń, Przemysław J.

    2018-05-01

    Cr3+ ions were introduced to the Ba2Mg(BO3)2 host to provide information about the site occupation, crystal field strength, and the site symmetry. The samples were synthesized by solid-state reaction. Emission observed under 440 nm excitation was characteristic for Cr3+ ions in strong octahedral ligand field with Dq/B parameter ratio 2.74 and sharp R line at 698 nm. The charge mismatch between Cr3+ dopant and Mg2+ host ion is compensated by the creation of Cr3+ pair in the vicinity of Ba or Mg vacancy. The emission decay curve is bi-exponential with decay times 1.2 and 13.3 ms.

  18. Dual origin of pairing in nuclei

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Idini, A.; Potel, G.; Barranco, F.

    The pairing correlations of the nucleus {sup 120}Sn are calculated by solving the Nambu–Gor’kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairingmore » interaction. The first is the strong {sup 1}S{sub 0} short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- (v{sub p}{sup bare}) and long-range (v{sub p}{sup ind}) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.« less

  19. Levitation Performance of Two Opposed Permanent Magnet Pole-Pair Separated Conical Bearingless Motors

    NASA Technical Reports Server (NTRS)

    Kascak, Peter; Jansen, Ralph; Dever, Timothy; Nagorny, Aleksandr; Loparo, Kenneth

    2013-01-01

    In standard motor applications, rotor suspension with traditional mechanical bearings represents the most economical solution. However, in certain high performance applications, rotor suspension without contacting bearings is either required or highly beneficial. Examples include applications requiring very high speed or extreme environment operation, or with limited access for maintenance. This paper expands upon a novel bearingless motor concept, in which two motors with opposing conical air-gaps are used to achieve full five-axis levitation and rotation of the rotor. Force in this motor is created by deliberately leaving the motor s pole-pairs unconnected, which allows the creation of different d-axis flux in each pole pair. This flux imbalance is used to create lateral force. This approach is different than previous bearingless motor designs, which require separate windings for levitation and rotation. This paper examines the predicted and achieved suspension performance of a fully levitated prototype bearingless system.

  20. The instrumental genesis process in future primary teachers using Dynamic Geometry Software

    NASA Astrophysics Data System (ADS)

    Ruiz-López, Natalia

    2018-05-01

    This paper, which describes a study undertaken with pairs of future primary teachers using GeoGebra software to solve geometry problems, includes a brief literature review, the theoretical framework and methodology used. An analysis of the instrumental genesis process for a pair participating in the case study is also provided. This analysis addresses the techniques and types of dragging used, the obstacles to learning encountered, a description of the interaction between the pair and their interaction with the teacher, and the type of language used. Based on this analysis, possibilities and limitations of the instrumental genesis process are identified for the development of geometric competencies such as conjecture creation, property checking and problem researching. It is also suggested that the methodology used in the analysis of the problem solving process may be useful for those teachers and researchers who want to integrate Dynamic Geometry Software (DGS) in their classrooms.

  1. Behavior of visual field index in advanced glaucoma.

    PubMed

    Rao, Harsha L; Senthil, Sirisha; Choudhari, Nikhil S; Mandal, Anil K; Garudadri, Chandra S

    2013-01-14

    To evaluate the magnitude of Visual Field Index (VFI) change attributable to change in the estimation algorithm from the pattern deviation probability plot (PDPP) to the total deviation probability plot (TDPP) when the mean deviation (MD) crosses -20 decibels (dB). In a retrospective study, 37 stable glaucoma eyes in which MD of the VFs crossed -20 dB were identified. For each eye, a pair of VFs was selected so that one VF of the pair had a MD better than but close to -20 dB and the other had a MD worse than but again close to -20 dB. The change in VFI in the VF pairs and its associations with the number of points in probability plots with normal threshold sensitivities were evaluated. Similar pairs of VFs from 28 stable glaucoma eyes where the MD crossed -10 dB were chosen as controls. The change in VFI in VF pairs when the MD crossed 20 dB ranged from 3% to 33% (median: 15%), while the change when MD crossed -10 dB ranged from 1% to 8% (median: 4%). Difference in the number of points with normal threshold sensitivities in PDPP when MD was better than -20 dB compared to those in TDPP when MD crossed -20 dB significantly influenced the VFI change (R(2) = 0.65). Considering the eccentricity of these points further explained the VFI change (R(2) = 0.81). The decrease in VFI when MD crosses -20 dB can be highly variable. This has to be considered with the use of VFI in clinical and research settings.

  2. Performance measurement of HARPO: A time projection chamber as a gamma-ray telescope and polarimeter

    NASA Astrophysics Data System (ADS)

    Gros, P.; Amano, S.; Attié, D.; Baron, P.; Baudin, D.; Bernard, D.; Bruel, P.; Calvet, D.; Colas, P.; Daté, S.; Delbart, A.; Frotin, M.; Geerebaert, Y.; Giebels, B.; Götz, D.; Hashimoto, S.; Horan, D.; Kotaka, T.; Louzir, M.; Magniette, F.; Minamiyama, Y.; Miyamoto, S.; Ohkuma, H.; Poilleux, P.; Semeniouk, I.; Sizun, P.; Takemoto, A.; Yamaguchi, M.; Yonamine, R.; Wang, S.

    2018-01-01

    We analyse the performance of a gas time projection chamber (TPC) as a high-performance gamma-ray telescope and polarimeter in the e+e- pair-creation regime. We use data collected at a gamma-ray beam of known polarisation. The TPC provides two orthogonal projections (x, z) and (y, z) of the tracks induced by each conversion in the gas volume. We use a simple vertex finder in which vertices and pseudo-tracks exiting from them are identified. We study the various contributions to the single-photon angular resolution using Monte Carlo simulations, compare them with the experimental data and find that they are in excellent agreement. The distribution of the azimuthal angle of pair conversions shows a bias due to the non-cylindrical-symmetric structure of the detector. This bias would average out for a long duration exposure on a space mission, but for this pencil-beam characterisation we have ensured its accurate simulation by a double systematics-control scheme, data taking with the detector rotated at several angles with respect to the beam polarisation direction and systematics control with a non-polarised beam. We measure, for the first time, the polarisation asymmetry of a linearly polarised gamma-ray beam in the low energy pair-creation regime. This sub-GeV energy range is critical for cosmic sources as their spectra are power laws which fall quickly as a function of increasing energy. This work could pave the way to extending polarised gamma-ray astronomy beyond the MeV energy regime.

  3. Comparison of Different Risk Perception Measures in Predicting Seasonal Influenza Vaccination among Healthy Chinese Adults in Hong Kong: A Prospective Longitudinal Study

    PubMed Central

    Liao, Qiuyan; Wong, Wing Sze; Fielding, Richard

    2013-01-01

    Background Risk perception is a reported predictor of vaccination uptake, but which measures of risk perception best predict influenza vaccination uptake remain unclear. Methodology During the main influenza seasons (between January and March) of 2009 (Wave 1) and 2010 (Wave 2),505 Chinese students and employees from a Hong Kong university completed an online survey. Multivariate logistic regression models were conducted to assess how well different risk perceptions measures in Wave 1 predicted vaccination uptake against seasonal influenza in Wave 2. Principal Findings The results of the multivariate logistic regression models showed that feeling at risk (β = 0.25, p = 0.021) was the better predictor compared with probability judgment while probability judgment (β = 0.25, p = 0.029 ) was better than beliefs about risk in predicting subsequent influenza vaccination uptake. Beliefs about risk and feeling at risk seemed to predict the same aspect of subsequent vaccination uptake because their associations with vaccination uptake became insignificant when paired into the logistic regression model. Similarly, to compare the four scales for assessing probability judgment in predicting vaccination uptake, the 7-point verbal scale remained a significant and stronger predictor for vaccination uptake when paired with other three scales; the 6-point verbal scale was a significant and stronger predictor when paired with the percentage scale or the 2-point verbal scale; and the percentage scale was a significant and stronger predictor only when paired with the 2-point verbal scale. Conclusions/Significance Beliefs about risk and feeling at risk are not well differentiated by Hong Kong Chinese people. Feeling at risk, an affective-cognitive dimension of risk perception predicts subsequent vaccination uptake better than do probability judgments. Among the four scales for assessing risk probability judgment, the 7-point verbal scale offered the best predictive power for subsequent vaccination uptake. PMID:23894292

  4. Comparison of different risk perception measures in predicting seasonal influenza vaccination among healthy Chinese adults in Hong Kong: a prospective longitudinal study.

    PubMed

    Liao, Qiuyan; Wong, Wing Sze; Fielding, Richard

    2013-01-01

    Risk perception is a reported predictor of vaccination uptake, but which measures of risk perception best predict influenza vaccination uptake remain unclear. During the main influenza seasons (between January and March) of 2009 (Wave 1) and 2010 (Wave 2),505 Chinese students and employees from a Hong Kong university completed an online survey. Multivariate logistic regression models were conducted to assess how well different risk perceptions measures in Wave 1 predicted vaccination uptake against seasonal influenza in Wave 2. The results of the multivariate logistic regression models showed that feeling at risk (β = 0.25, p = 0.021) was the better predictor compared with probability judgment while probability judgment (β = 0.25, p = 0.029 ) was better than beliefs about risk in predicting subsequent influenza vaccination uptake. Beliefs about risk and feeling at risk seemed to predict the same aspect of subsequent vaccination uptake because their associations with vaccination uptake became insignificant when paired into the logistic regression model. Similarly, to compare the four scales for assessing probability judgment in predicting vaccination uptake, the 7-point verbal scale remained a significant and stronger predictor for vaccination uptake when paired with other three scales; the 6-point verbal scale was a significant and stronger predictor when paired with the percentage scale or the 2-point verbal scale; and the percentage scale was a significant and stronger predictor only when paired with the 2-point verbal scale. Beliefs about risk and feeling at risk are not well differentiated by Hong Kong Chinese people. Feeling at risk, an affective-cognitive dimension of risk perception predicts subsequent vaccination uptake better than do probability judgments. Among the four scales for assessing risk probability judgment, the 7-point verbal scale offered the best predictive power for subsequent vaccination uptake.

  5. ANTIPARTICLES IN SPACE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hones, E.W. Jr.

    1959-06-15

    Hoyle obtained a steady-state model for an expanding universe by introducing continuous creation of matter into the field equations of general relativity. Morrison has speculated that the creation of matter throughout the universe may take place by formation of particle--antiparticle pairs which subsequently are segregated by a repulsive force between matter and anti-matter. Burbidge and Hall have estimated that the ratio of antimatter to matter in our galaxy can not exceed -- 10/sup -7/ This investigation points out that a slightly more stringent limit for this ratio is sugge sted by cosmic ray measurements. More precise information concerning the densitymore » of antiparticles in the galaxy can be obtained by carrying a simple scintillation gamma spectrometer some distance from the earth in a satelite or space probe. (A.C.)« less

  6. Two-dimensional quantum repeaters

    NASA Astrophysics Data System (ADS)

    Wallnöfer, J.; Zwerger, M.; Muschik, C.; Sangouard, N.; Dür, W.

    2016-11-01

    The endeavor to develop quantum networks gave rise to a rapidly developing field with far-reaching applications such as secure communication and the realization of distributed computing tasks. This ultimately calls for the creation of flexible multiuser structures that allow for quantum communication between arbitrary pairs of parties in the network and facilitate also multiuser applications. To address this challenge, we propose a two-dimensional quantum repeater architecture to establish long-distance entanglement shared between multiple communication partners in the presence of channel noise and imperfect local control operations. The scheme is based on the creation of self-similar multiqubit entanglement structures at growing scale, where variants of entanglement swapping and multiparty entanglement purification are combined to create high-fidelity entangled states. We show how such networks can be implemented using trapped ions in cavities.

  7. A phosphodiesterase 4-controlled switch between memory extinction and strengthening in the hippocampus

    PubMed Central

    Roesler, Rafael; Reolon, Gustavo K.; Maurmann, Natasha; Schwartsmann, Gilberto; Schröder, Nadja; Amaral, Olavo B.; Valvassori, Samira; Quevedo, João

    2014-01-01

    Established fear-related memories can undergo phenomena such as extinction or reconsolidation when recalled. Extinction probably involves the creation of a new, competing memory trace that decreases fear expression, whereas reconsolidation can mediate memory maintenance, updating, or strengthening. The factors determining whether retrieval will initiate extinction, reconsolidation, or neither of these two processes include training intensity, duration of the retrieval session, and age of the memory. However, previous studies have not shown that the same behavioral protocol can be used to induce either extinction or reconsolidation and strengthening, depending on the pharmacological intervention used. Here we show that, within an experiment that leads to extinction in control rats, memory can be strengthened if rolipram, a selective inhibitor of phosphodiesterase type 4 (PDE4), is administered into the dorsal hippocampus immediately after retrieval. The memory-enhancing effect of rolipram lasted for at least 1 week, was blocked by the protein synthesis inhibitor anisomycin, and did not occur when drug administration was not paired with retrieval. These findings indicate that the behavioral outcome of memory retrieval can be pharmacologically switched from extinction to strengthening. The cAMP/protein kinase A (PKA) signaling pathway might be a crucial mechanism determining the fate of memories after recall. PMID:24672454

  8. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  9. Spatial Multiplexing of Atom-Photon Entanglement Sources using Feedforward Control and Switching Networks.

    PubMed

    Tian, Long; Xu, Zhongxiao; Chen, Lirong; Ge, Wei; Yuan, Haoxiang; Wen, Yafei; Wang, Shengzhi; Li, Shujing; Wang, Hai

    2017-09-29

    The light-matter quantum interface that can create quantum correlations or entanglement between a photon and one atomic collective excitation is a fundamental building block for a quantum repeater. The intrinsic limit is that the probability of preparing such nonclassical atom-photon correlations has to be kept low in order to suppress multiexcitation. To enhance this probability without introducing multiexcitation errors, a promising scheme is to apply multimode memories to the interface. Significant progress has been made in temporal, spectral, and spatial multiplexing memories, but the enhanced probability for generating the entangled atom-photon pair has not been experimentally realized. Here, by using six spin-wave-photon entanglement sources, a switching network, and feedforward control, we build a multiplexed light-matter interface and then demonstrate a ∼sixfold (∼fourfold) probability increase in generating entangled atom-photon (photon-photon) pairs. The measured compositive Bell parameter for the multiplexed interface is 2.49±0.03 combined with a memory lifetime of up to ∼51  μs.

  10. Camera trap placement and the potential for bias due to trails and other features

    PubMed Central

    Forrester, Tavis D.

    2017-01-01

    Camera trapping has become an increasingly widespread tool for wildlife ecologists, with large numbers of studies relying on photo capture rates or presence/absence information. It is increasingly clear that camera placement can directly impact this kind of data, yet these biases are poorly understood. We used a paired camera design to investigate the effect of small-scale habitat features on species richness estimates, and capture rate and detection probability of several mammal species in the Shenandoah Valley of Virginia, USA. Cameras were deployed at either log features or on game trails with a paired camera at a nearby random location. Overall capture rates were significantly higher at trail and log cameras compared to their paired random cameras, and some species showed capture rates as much as 9.7 times greater at feature-based cameras. We recorded more species at both log (17) and trail features (15) than at their paired control cameras (13 and 12 species, respectively), yet richness estimates were indistinguishable after 659 and 385 camera nights of survey effort, respectively. We detected significant increases (ranging from 11–33%) in detection probability for five species resulting from the presence of game trails. For six species detection probability was also influenced by the presence of a log feature. This bias was most pronounced for the three rodents investigated, where in all cases detection probability was substantially higher (24.9–38.2%) at log cameras. Our results indicate that small-scale factors, including the presence of game trails and other features, can have significant impacts on species detection when camera traps are employed. Significant biases may result if the presence and quality of these features are not documented and either incorporated into analytical procedures, or controlled for in study design. PMID:29045478

  11. Camera trap placement and the potential for bias due to trails and other features.

    PubMed

    Kolowski, Joseph M; Forrester, Tavis D

    2017-01-01

    Camera trapping has become an increasingly widespread tool for wildlife ecologists, with large numbers of studies relying on photo capture rates or presence/absence information. It is increasingly clear that camera placement can directly impact this kind of data, yet these biases are poorly understood. We used a paired camera design to investigate the effect of small-scale habitat features on species richness estimates, and capture rate and detection probability of several mammal species in the Shenandoah Valley of Virginia, USA. Cameras were deployed at either log features or on game trails with a paired camera at a nearby random location. Overall capture rates were significantly higher at trail and log cameras compared to their paired random cameras, and some species showed capture rates as much as 9.7 times greater at feature-based cameras. We recorded more species at both log (17) and trail features (15) than at their paired control cameras (13 and 12 species, respectively), yet richness estimates were indistinguishable after 659 and 385 camera nights of survey effort, respectively. We detected significant increases (ranging from 11-33%) in detection probability for five species resulting from the presence of game trails. For six species detection probability was also influenced by the presence of a log feature. This bias was most pronounced for the three rodents investigated, where in all cases detection probability was substantially higher (24.9-38.2%) at log cameras. Our results indicate that small-scale factors, including the presence of game trails and other features, can have significant impacts on species detection when camera traps are employed. Significant biases may result if the presence and quality of these features are not documented and either incorporated into analytical procedures, or controlled for in study design.

  12. The effect of unresolved contaminant stars on the cross-matching of photometric catalogues

    NASA Astrophysics Data System (ADS)

    Wilson, Tom J.; Naylor, Tim

    2017-07-01

    A fundamental process in astrophysics is the matching of two photometric catalogues. It is crucial that the correct objects be paired, and that their photometry does not suffer from any spurious additional flux. We compare the positions of sources in Wide-field Infrared Survey Explorer (WISE), INT Photometric H α Survey, Two Micron All Sky Survey and AAVSO Photometric All Sky Survey with Gaia Data Release 1 astrometric positions. We find that the separations are described by a combination of a Gaussian distribution, wider than naively assumed based on their quoted uncertainties, and a large wing, which some authors ascribe to proper motions. We show that this is caused by flux contamination from blended stars not treated separately. We provide linear fits between the quoted Gaussian uncertainty and the core fit to the separation distributions. We show that at least one in three of the stars in the faint half of a given catalogue will suffer from flux contamination above the 1 per cent level when the density of catalogue objects per point spread function area is above approximately 0.005. This has important implications for the creation of composite catalogues. It is important for any closest neighbour matches as there will be a given fraction of matches that are flux contaminated, while some matches will be missed due to significant astrometric perturbation by faint contaminants. In the case of probability-based matching, this contamination affects the probability density function of matches as a function of distance. This effect results in up to 50 per cent fewer counterparts being returned as matches, assuming Gaussian astrometric uncertainties for WISE-Gaia matching in crowded Galactic plane regions, compared with a closest neighbour match.

  13. Rapid creation of distant entanglement by multiphoton resonant fluorescence

    NASA Astrophysics Data System (ADS)

    Cohen, Guy Z.; Sham, L. J.

    2013-12-01

    We study a simple, effective, and robust method for entangling two separate stationary quantum dot spin qubits with high fidelity using multiphoton Gaussian state. The fluorescence signals from the two dots interfere at a beam splitter. The bosonic nature of photons leads, in analogy with the Hong-Ou-Mandel effect, to selective pairing of photon holes (photon absences in the fluorescent signals). As a result, two odd photon number detections at the outgoing beams herald trion entanglement creation, and subsequent reduction of the trions to the spin ground states leads to spin-spin entanglement. The robustness of the Gaussian states is evidenced by the ability to compensate for photon absorption and noise by a moderate increase in the number of photons at the input. We calculate the entanglement generation rate in the ideal, nonideal, and near-ideal detector regimes and find substantial improvement over single-photon schemes in all three regimes. Fast and efficient spin-spin entanglement creation can form the basis for a scalable quantum dot quantum computing network. Our predictions can be tested using current experimental capabilities.

  14. Facebook dethroned: Revealing the more likely social media destinations for college students’ depictions of underage drinking

    PubMed Central

    Boyle, Sarah C.; Earle, Andrew M.; LaBrie, Joseph W.; Ballou, Kayla

    2016-01-01

    Studies examining representations of college drinking on social media have almost exclusively focused on Facebook. However, recent research suggests college students may be more influenced by peers’ alcohol-related posts on Instagram and Snapchat, two image-based platforms popular among this demographic. One potential explanation for this differential influence is that qualitative distinctions in the types of alcohol-related content posted by students on these three platforms may exist. Informed by undergraduate focus groups, this study examined the hypothesis that, of the three platforms, students tend to use Instagram most often for photos glamourizing drinking and Snapchat for incriminating photos of alcohol misuse and negative consequences. Undergraduate research assistants aided investigators in developing hypothetical vignettes and photographic examples of posts both glamorizing and depicting negative consequences associated with college drinking. In an online survey, vignette and photo stimuli were followed by counterbalanced paired comparisons that presented each possible pair of social media platforms. Undergraduates (N=196) selected the platform from each pair on which they would be more likely to see each post. Generalized Bradley-Terry models examined the probabilities of platform selections. As predicted, Instagram was seen as the most probable destination (and Facebook least probable) for photos depicting alcohol use as attractive and glamorous. Conversely, Snapchat was selected as the most probable destination (and Facebook least probable) for items depicting negative consequences associated with heavy drinking. Results suggest researchers aiming to mitigate the potential influences associated with college students’ glamorous and consequential alcohol-related photos posted social media posts should shift their focus from Facebook to Instagram and Snapchat. PMID:27776267

  15. Ultra-intense Pair Creation using the Texas Petawatt Laser and Applications

    NASA Astrophysics Data System (ADS)

    Liang, Edison; Henderson, Alexander; Clarke, Taylor; Lo, Willie; Chaguine, Petr; Dyer, Gilliss; Riley, Nathan; Serratto, Kristina; Donovan, Michael; Ditmire, Todd

    2014-10-01

    Pair plasmas and intense gamma-ray sources are ubiquitous in the high-energy universe, from pulser winds to gamma-ray bursts (GRB). Their study can be greatly enhanced if such sources can be recreated in the laboratory under controlled conditions. In 2012 and 2013, a joint Rice-University of Texas team performed over 130 laser shots on thick gold and platinum targets using the 100 Joule Texas Petawatt Laser in Austin. The laser intensity of many shots exceeded 1021 W.cm-2 with pulses as short as 130 fs. These experiments probe a new extreme regime of ultra-intense laser - high-Z solid target interactions never achieved before. In addition to creating copious pairs with the highest density (>1015/cc) and emergent e +/e- ratio exceeding 20% in many shots, these experiments also created the highest density multi-MeV gamma-rays, comparable in absolute numbers to those found inside a gamma-ray burst (GRB). Potential applications of such intense pair and gamma-ray sources to laboratory astrophysics and innovative technologies will be discussed. Work supported by DOE HEDLP program.

  16. Analyzing survival curves at a fixed point in time for paired and clustered right-censored data

    PubMed Central

    Su, Pei-Fang; Chi, Yunchan; Lee, Chun-Yi; Shyr, Yu; Liao, Yi-De

    2018-01-01

    In clinical trials, information about certain time points may be of interest in making decisions about treatment effectiveness. Rather than comparing entire survival curves, researchers can focus on the comparison at fixed time points that may have a clinical utility for patients. For two independent samples of right-censored data, Klein et al. (2007) compared survival probabilities at a fixed time point by studying a number of tests based on some transformations of the Kaplan-Meier estimators of the survival function. However, to compare the survival probabilities at a fixed time point for paired right-censored data or clustered right-censored data, their approach would need to be modified. In this paper, we extend the statistics to accommodate the possible within-paired correlation and within-clustered correlation, respectively. We use simulation studies to present comparative results. Finally, we illustrate the implementation of these methods using two real data sets. PMID:29456280

  17. Entropy of finite random binary sequences with weak long-range correlations.

    PubMed

    Melnik, S S; Usatenko, O V

    2014-11-01

    We study the N-step binary stationary ergodic Markov chain and analyze its differential entropy. Supposing that the correlations are weak we express the conditional probability function of the chain through the pair correlation function and represent the entropy as a functional of the pair correlator. Since the model uses the two-point correlators instead of the block probability, it makes it possible to calculate the entropy of strings at much longer distances than using standard methods. A fluctuation contribution to the entropy due to finiteness of random chains is examined. This contribution can be of the same order as its regular part even at the relatively short lengths of subsequences. A self-similar structure of entropy with respect to the decimation transformations is revealed for some specific forms of the pair correlation function. Application of the theory to the DNA sequence of the R3 chromosome of Drosophila melanogaster is presented.

  18. Entropy of finite random binary sequences with weak long-range correlations

    NASA Astrophysics Data System (ADS)

    Melnik, S. S.; Usatenko, O. V.

    2014-11-01

    We study the N -step binary stationary ergodic Markov chain and analyze its differential entropy. Supposing that the correlations are weak we express the conditional probability function of the chain through the pair correlation function and represent the entropy as a functional of the pair correlator. Since the model uses the two-point correlators instead of the block probability, it makes it possible to calculate the entropy of strings at much longer distances than using standard methods. A fluctuation contribution to the entropy due to finiteness of random chains is examined. This contribution can be of the same order as its regular part even at the relatively short lengths of subsequences. A self-similar structure of entropy with respect to the decimation transformations is revealed for some specific forms of the pair correlation function. Application of the theory to the DNA sequence of the R3 chromosome of Drosophila melanogaster is presented.

  19. Acrocentric chromosome associations in man.

    PubMed Central

    Jacobs, P A; Mayer, M; Morton, N E

    1976-01-01

    Heterogeneity among chromosomes was found to be a highly significant source of variation for association proportions, while culture, slide, and observer were negligible sources of variation for association proportions although important for numbers of associations. The consequences of these results for tests of group differences are discussed. It seems evident that each pair of acrocentric chromosomes has its own characteristic probability of entering into association. This is presumably a combination of the probability for each individual member of the pair, a proposition easily tested utilizing acrocentric chromosomes carrying polymorphisms which allow each member of the pair to be individually recognized. A mathematical theory for pairwise satellite association was developed and shown to fit observations on banded chromosomes. While we found very significant heterogeneity among individuals in the frequency with which different chromosomes entered into associations, there was no significant evidence for preferential association between any particular chromosomes, either heterologous or homologous. This finding in our material of apparently random associations between different chromosomes is contrary to claims made by other investigators and should be tested on other material. No correlation was found between the phenotype of the chromosome, as judged by cytogenetic polymorphisms, and its probability of association. PMID:795295

  20. Effect of chronic stress on short and long-term plasticity in dentate gyrus; study of recovery and adaptation.

    PubMed

    Radahmadi, M; Hosseini, N; Nasimi, A

    2014-11-07

    Stress dramatically affects synaptic plasticity of the hippocampus, disrupts paired-pulse facilitation and impairs long-term potentiation (LTP). This study was performed to find the effects of chronic restraint stress and recovery period on excitability, paired-pulse response, LTP and to find probable adaptation to very long stress in the dentate gyrus. Thirty-eight male Wistar rats were randomly divided into four groups of Control, Rest-Stress (21 days stress), Stress-Rest (recovery) and Stress-Stress (42 days stress: adaptation). Chronic restraint stress was applied 6-h/day. Input-output functions, paired-pulse responses and LTP were recorded from the dentate gyrus while stimulating the perforant pathway. We found that chronic stress attenuated the responsiveness, paired-pulse response and LTP in the dentate gyrus. A 21-day recovery period, after the stress, improved all the three responses toward normal, indicating reversibility of these stress-related hippocampal changes. There was no significant adaptation to very long stress, probably due to severity of stress. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  1. Study of a New CPM Pair 2Mass 14515781-1619034

    NASA Astrophysics Data System (ADS)

    Falcon, Israel Tejera

    2013-04-01

    In this paper I present the results of a study of 2Mass 14515781-1619034 as components of a common proper motion pair. Because PPMXL catalog's proper motion data not provide any information about secondary star, I deduced it independently, obtaining similar proper motions for both components. Halbwalchs' criteria indicates that this is a CPM ystem. The criterion of Francisco Rica, which is based on the compatibility of the kinematic function of the equatorial coordinates, indicates that this pair has a 99% probability of being a physical one (Rica, 2007). Also other important criteria (Dommanget, 1956, Peter Van De Kamp, 1961, Sinachopoulus, 1992, Close, 2003), indicate a physical system. With the absolute visual magnitude of both components, I obtained distance modulus 7.29 and 7.59, which put the components of the system at a distance of 287.1 and 329.6 parsecs. Taking into account errors in determining the magnitudes, this means that the probability that both components are situated at the same distance is 96%. I suggest that this pair be included in the WDS catalog.

  2. Information Theoretic Studies and Assessment of Space Object Identification

    DTIC Science & Technology

    2014-03-24

    localization are contained in Ref. [5]. 1.7.1 A Bayesian MPE Based Analysis of 2D Point-Source-Pair Superresolution In a second recently submitted paper [6], a...related problem of the optical superresolution (OSR) of a pair of equal-brightness point sources separated spatially by a distance (or angle) smaller...1403.4897 [physics.optics] (19 March 2014). 6. S. Prasad, “Asymptotics of Bayesian error probability and 2D pair superresolution ,” submitted to Opt. Express

  3. Accelerating calculations of RNA secondary structure partition functions using GPUs

    PubMed Central

    2013-01-01

    Background RNA performs many diverse functions in the cell in addition to its role as a messenger of genetic information. These functions depend on its ability to fold to a unique three-dimensional structure determined by the sequence. The conformation of RNA is in part determined by its secondary structure, or the particular set of contacts between pairs of complementary bases. Prediction of the secondary structure of RNA from its sequence is therefore of great interest, but can be computationally expensive. In this work we accelerate computations of base-pair probababilities using parallel graphics processing units (GPUs). Results Calculation of the probabilities of base pairs in RNA secondary structures using nearest-neighbor standard free energy change parameters has been implemented using CUDA to run on hardware with multiprocessor GPUs. A modified set of recursions was introduced, which reduces memory usage by about 25%. GPUs are fastest in single precision, and for some hardware, restricted to single precision. This may introduce significant roundoff error. However, deviations in base-pair probabilities calculated using single precision were found to be negligible compared to those resulting from shifting the nearest-neighbor parameters by a random amount of magnitude similar to their experimental uncertainties. For large sequences running on our particular hardware, the GPU implementation reduces execution time by a factor of close to 60 compared with an optimized serial implementation, and by a factor of 116 compared with the original code. Conclusions Using GPUs can greatly accelerate computation of RNA secondary structure partition functions, allowing calculation of base-pair probabilities for large sequences in a reasonable amount of time, with a negligible compromise in accuracy due to working in single precision. The source code is integrated into the RNAstructure software package and available for download at http://rna.urmc.rochester.edu. PMID:24180434

  4. METHODOLOGICAL NOTES: The Einstein-Podolsky-Rosen paradox for energy-time variables

    NASA Astrophysics Data System (ADS)

    Klyshko, D. N.

    1989-06-01

    A new variant of the Einstein-Podolsky-Rosen experiment is discussed which illustrates the complementarity principle and the indeterminancy relations for the energy and the time of creation of photons emitted as correlated pairs in the decay of a metastable state of an atom or in parametric scattering of light. It is shown that it is not possible a priori to ascribe to such photons a definite temporal structure; it acquires an operational meaning only after one of the photons of the pair is recorded by a detector with a definite frequency characteristic. A simple interpretation of the effect is possible by means of an advanced wave emitted by one of the detectors at the instant of the photon being recorded.

  5. Charge instabilities due to local charge conjugation symmetry in /2+1 dimensions

    NASA Astrophysics Data System (ADS)

    Bais, F. A.; Striet, J.

    2003-08-01

    Alice electrodynamics (AED) is a theory of electrodynamics in which charge conjugation is a local gauge symmetry. In this paper we investigate a charge instability in alice electrodynamics in 2+1 dimensions due to this local charge conjugation. The instability manifests itself through the creation of a pair of alice fluxes. The final state is one in which the charge is completely delocalized, i.e., it is carried as cheshire charge by the flux pair that gets infinitely separated. We determine the decay rate in terms of the parameters of the model. The relation of this phenomenon with other salient features of 2-dimensional compact QED, such as linear confinement due to instantons/monopoles, is discussed.

  6. Factors related to the joint probability of flooding on paired streams

    USGS Publications Warehouse

    Koltun, G.F.; Sherwood, J.M.

    1998-01-01

    The factors related to the joint probabilty of flooding on paired streams were investigated and quantified to provide information to aid in the design of hydraulic structures where the joint probabilty of flooding is an element of the design criteria. Stream pairs were considered to have flooded jointly at the design-year flood threshold (corresponding to the 2-, 10-, 25-, or 50-year instantaneous peak streamflow) if peak streamflows at both streams in the pair were observed or predicted to have equaled or exceeded the threshold on a given calendar day. Daily mean streamflow data were used as a substitute for instantaneous peak streamflow data to determine which flood thresholds were equaled or exceeded on any given day. Instantaneous peak streamflow data, when available, were used preferentially to assess flood-threshold exceedance. Daily mean streamflow data for each stream were paired with concurrent daily mean streamflow data at the other streams. Observed probabilities of joint flooding, determined for the 2-, 10-, 25-, and 50-year flood thresholds, were computed as the ratios of the total number of days when streamflows at both streams concurrently equaled or exceeded their flood thresholds (events) to the total number of days where streamflows at either stream equaled or exceeded its flood threshold (trials). A combination of correlation analyses, graphical analyses, and logistic-regression analyses were used to identify and quantify factors associated with the observed probabilities of joint flooding (event-trial ratios). The analyses indicated that the distance between drainage area centroids, the ratio of the smaller to larger drainage area, the mean drainage area, and the centroid angle adjusted 30 degrees were the basin characteristics most closely associated with the joint probabilty of flooding on paired streams in Ohio. In general, the analyses indicated that the joint probabilty of flooding decreases with an increase in centroid distance and increases with increases in drainage area ratio, mean drainage area, and centroid angle adjusted 30 degrees. Logistic-regression equations were developed, which can be used to estimate the probability that streamflows at two streams jointly equal or exceed the 2-year flood threshold given that the streamflow at one of the two streams equals or exceeds the 2-year flood threshold. The logistic-regression equations are applicable to stream pairs in Ohio (and border areas of adjacent states) that are unregulated, free of significant urban influences, and have characteristics similar to those of the 304 gaged stream pairs used in the logistic-regression analyses. Contingency tables were constructed and analyzed to provide information about the bivariate distribution of floods on paired streams. The contingency tables showed that the percentage of trials in which both streams in the pair concurrently flood at identical recurrence-interval ranges generally increased as centroid distances decreased and was greatest for stream pairs with adjusted centroid angles greater than or equal to 60 degrees and drainage area ratios greater than or equal to 0.01. Also, as centroid distance increased, streamflow at one stream in the pair was more likely to be in a less than 2-year recurrence-interval range when streamflow at the second stream was in a 2-year or greater recurrence-interval range.

  7. Statefinder diagnostic for modified Chaplygin gas cosmology in f(R,T) gravity with particle creation

    NASA Astrophysics Data System (ADS)

    Singh, J. K.; Nagpal, Ritika; Pacif, S. K. J.

    In this paper, we have studied flat Friedmann-Lemaître-Robertson-Walker (FLRW) model with modified Chaplygin gas (MCG) having equation of state pm = Aρ ‑ B ργ, where 0 ≤ A ≤ 1, 0 ≤ γ ≤ 1 and B is any positive constant in f(R,T) gravity with particle creation. We have considered a simple parametrization of the Hubble parameter H in order to solve the field equations and discussed the time evolution of different cosmological parameters for some obtained models showing unique behavior of scale factor. We have also discussed the statefinder diagnostic pair {r,s} that characterizes the evolution of obtained models and explore their stability. The physical consequences of the models and their kinematic behaviors have also been scrutinized here in some detail.

  8. Vortex creation during magnetic trap manipulations of spinor Bose-Einstein condensates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Itin, A. P.; Space Research Institute, RAS, Moscow; Morishita, T.

    2006-06-15

    We investigate several mechanisms of vortex creation during splitting of a spinor Bose-Einstein condensate (BEC) in a magnetic double-well trap controlled by a pair of current carrying wires and bias magnetic fields. Our study is motivated by a recent MIT experiment on splitting BECs with a similar trap [Y. Shin et al., Phys. Rev. A 72, 021604 (2005)], where an unexpected fork-like structure appeared in the interference fringes indicating the presence of a singly quantized vortex in one of the interfering condensates. It is well known that in a spin-1 BEC in a quadrupole trap, a doubly quantized vortex ismore » topologically produced by a 'slow' reversal of bias magnetic field B{sub z}. Since in the experiment a doubly quantized vortex had never been seen, Shin et al. ruled out the topological mechanism and concentrated on the nonadiabatic mechanical mechanism for explanation of the vortex creation. We find, however, that in the magnetic trap considered both mechanisms are possible: singly quantized vortices can be formed in a spin-1 BEC topologically (for example, during the magnetic field switching-off process). We therefore provide a possible alternative explanation for the interference patterns observed in the experiment. We also present a numerical example of creation of singly quantized vortices due to 'fast' splitting; i.e., by a dynamical (nonadiabatic) mechanism.« less

  9. Sonic analog of gravitational black holes in bose-einstein condensates

    PubMed

    Garay; Anglin; Cirac; Zoller

    2000-11-27

    It is shown that, in dilute-gas Bose-Einstein condensates, there exist both dynamically stable and unstable configurations which, in the hydrodynamic limit, exhibit a behavior resembling that of gravitational black holes. The dynamical instabilities involve creation of quasiparticle pairs in positive and negative energy states, as in the well-known suggested mechanism for black-hole evaporation. We propose a scheme to generate a stable sonic black hole in a ring trap.

  10. Quantum teleportation and entanglement swapping of electron spins in superconducting hybrid structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bubanja, Vladimir, E-mail: vladimir.bubanja@callaghaninnovation.govt.nz

    2015-06-15

    We present schemes for quantum teleportation and entanglement swapping of electronic spin states in hybrid superconductor–normal-metal systems. The proposed schemes employ subgap transport whereby the lowest order processes involve Cooper pair-electron and double Cooper-pair cotunneling in quantum teleportation and entanglement swapping protocols, respectively. The competition between elastic cotunneling and Cooper-pair splitting results in the success probability of 25% in both cases. Described implementations of these protocols are within reach of present-day experimental techniques.

  11. Feedback-Driven Trial-by-Trial Learning in Autism Spectrum Disorders

    PubMed Central

    Solomon, Marjorie; Frank, Michael J.; Ragland, J. Daniel; Smith, Anne C.; Niendam, Tara A.; Lesh, Tyler A.; Grayson, David S.; Beck, Jonathan S.; Matter, John C.; Carter, Cameron S.

    2017-01-01

    Objective Impairments in learning are central to autism spectrum disorders. The authors investigated the cognitive and neural basis of these deficits in young adults with autism spectrum disorders using a well-characterized probabilistic reinforcement learning paradigm. Method The probabilistic selection task was implemented among matched participants with autism spectrum disorders (N=22) and with typical development (N=25), aged 18–40 years, using rapid event-related functional MRI. Participants were trained to choose the correct stimulus in high-probability (AB), medium-probability (CD), and low-probability (EF) pairs, presented with valid feedback 80%, 70%, and 60% of the time, respectively. Whole-brain voxel-wise and parametric modulator analyses examined early and late learning during the stimulus and feedback epochs of the task. Results The groups exhibited comparable performance on medium- and low-probability pairs. Typically developing persons showed higher accuracy on the high-probability pair, better win-stay performance (selection of the previously rewarded stimulus on the next trial of that type), and more robust recruitment of the anterior and medial prefrontal cortex during the stimulus epoch, suggesting development of an intact reward-based working memory for recent stimulus values. Throughout the feedback epoch, individuals with autism spectrum disorders exhibited greater recruitment of the anterior cingulate and orbito-frontal cortices compared with individuals with typical development, indicating continuing trial-by-trial activity related to feedback processing. Conclusions Individuals with autism spectrum disorders exhibit learning deficits reflecting impaired ability to develop an effective reward-based working memory to guide stimulus selection. Instead, they continue to rely on trial-by-trial feedback processing to support learning dependent upon engagement of the anterior cingulate and orbito-frontal cortices. PMID:25158242

  12. Facebook dethroned: Revealing the more likely social media destinations for college students' depictions of underage drinking.

    PubMed

    Boyle, Sarah C; Earle, Andrew M; LaBrie, Joseph W; Ballou, Kayla

    2017-02-01

    Studies examining representations of college drinking on social media have almost exclusively focused on Facebook. However, recent research suggests college students may be more influenced by peers' alcohol-related posts on Instagram and Snapchat, two image-based platforms popular among this demographic. One potential explanation for this differential influence is that qualitative distinctions in the types of alcohol-related content posted by students on these three platforms may exist. Informed by undergraduate focus groups, this study examined the hypothesis that, of the three platforms, students tend to use Instagram most often for photos glamourizing drinking and Snapchat for incriminating photos of alcohol misuse and negative consequences. Undergraduate research assistants aided investigators in developing hypothetical vignettes and photographic examples of posts both glamorizing and depicting negative consequences associated with college drinking. In an online survey, vignette and photo stimuli were followed by counterbalanced paired comparisons that presented each possible pair of social media platforms. Undergraduates (N=196) selected the platform from each pair on which they would be more likely to see each post. Generalized Bradley-Terry models examined the probabilities of platform selections. As predicted, Instagram was seen as the most probable destination (and Facebook least probable) for photos depicting alcohol use as attractive and glamorous. Conversely, Snapchat was selected as the most probable destination (and Facebook least probable) for items depicting negative consequences associated with heavy drinking. Results suggest researchers aiming to mitigate the potential influences associated with college students' glamorous and consequential alcohol-related photos posted social media posts should shift their focus from Facebook to Instagram and Snapchat. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Exact transition probabilities in a 6-state Landau–Zener system with path interference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sinitsyn, Nikolai A.

    2015-04-23

    In this paper, we identify a nontrivial multistate Landau–Zener (LZ) model for which transition probabilities between any pair of diabatic states can be determined analytically and exactly. In the semiclassical picture, this model features the possibility of interference of different trajectories that connect the same initial and final states. Hence, transition probabilities are generally not described by the incoherent successive application of the LZ formula. Finally, we discuss reasons for integrability of this system and provide numerical tests of the suggested expression for the transition probability matrix.

  14. Evidence of scaling of void probability in nucleus-nucleus interactions at few GeV energy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghosh, Dipak; Biswas, Biswanath; Deb, Argha

    1997-11-01

    The rapidity gap probability in the {sup 24}Mg-AgBr interaction at 4.5GeV/c/nucleon has been studied in detail. The data reveal scaling behavior of the void probability in the central rapidity domain which confirms the validity of the linked-pair approximation for the N-particle cumulant correlation functions. This scaling behavior appears to be similar to the void probability in the Perseus-Pisces supercluster region of galaxies. {copyright} {ital 1997} {ital The American Physical Society}

  15. Rewritable ferroelectric vortex pairs in BiFeO3

    NASA Astrophysics Data System (ADS)

    Li, Yang; Jin, Yaming; Lu, Xiaomei; Yang, Jan-Chi; Chu, Ying-Hao; Huang, Fengzhen; Zhu, Jinsong; Cheong, Sang-Wook

    2017-08-01

    Ferroelectric vortex in multiferroic materials has been considered as a promising alternative to current memory cells for the merit of high storage density. However, the formation of regular natural ferroelectric vortex is difficult, restricting the achievement of vortex memory device. Here, we demonstrated the creation of ferroelectric vortex-antivortex pairs in BiFeO3 thin films by using local electric field. The evolution of the polar vortex structure is studied by piezoresponse force microscopy at nanoscale. The results reveal that the patterns and stability of vortex structures are sensitive to the poling position. Consecutive writing and erasing processes cause no influence on the original domain configuration. The Z4 proper coloring vortex-antivortex network is then analyzed by graph theory, which verifies the rationality of artificial vortex-antivortex pairs. This study paves a foundation for artificial regulation of vortex, which provides a possible pathway for the design and realization of non-volatile vortex memory devices and logical devices.

  16. Incoherent pair generation in a beam-beam interaction simulation

    NASA Astrophysics Data System (ADS)

    Rimbault, C.; Bambade, P.; Mönig, K.; Schulte, D.

    2006-03-01

    This paper deals with two topics: the generation of incoherent pairs in two beam-beam simulation programs, GUINEA-PIG and CAIN, and the influence of the International Linear Collider (ILC) beam parameter choices on the background in the micro vertex detector (VD) induced by direct hits. One of the processes involved in incoherent pair creation (IPC) is equivalent to a four fermions interaction and its cross section can be calculated exactly with a dedicated generator, BDK. A comparison of GUINEA-PIG and CAIN results with BDK allows to identify and quantify the uncertainties on IPC background predictions and to benchmark the GUINEA-PIG calculation. Based on this simulation and different VD designs, the five currently suggested ILC beam parameter sets have been compared regarding IPC background induced in the VD by direct IPC hits. We emphasize that the high luminosity set, as it is currently defined, would constrain both the choices of magnetic field and VD inner layer radius.

  17. Osmosis and Diffusion Conceptual Assessment

    PubMed Central

    Fisher, Kathleen M.; Williams, Kathy S.; Lineback, Jennifer Evarts

    2011-01-01

    Biology student mastery regarding the mechanisms of diffusion and osmosis is difficult to achieve. To monitor comprehension of these processes among students at a large public university, we developed and validated an 18-item Osmosis and Diffusion Conceptual Assessment (ODCA). This assessment includes two-tiered items, some adopted or modified from the previously published Diffusion and Osmosis Diagnostic Test (DODT) and some newly developed items. The ODCA, a validated instrument containing fewer items than the DODT and emphasizing different content areas within the realm of osmosis and diffusion, better aligns with our curriculum. Creation of the ODCA involved removal of six DODT item pairs, modification of another six DODT item pairs, and development of three new item pairs addressing basic osmosis and diffusion concepts. Responses to ODCA items testing the same concepts as the DODT were remarkably similar to responses to the DODT collected from students 15 yr earlier, suggesting that student mastery regarding the mechanisms of diffusion and osmosis remains elusive. PMID:22135375

  18. Functionally segregated neural substrates for arbitrary audiovisual paired-association learning.

    PubMed

    Tanabe, Hiroki C; Honda, Manabu; Sadato, Norihiro

    2005-07-06

    To clarify the neural substrates and their dynamics during crossmodal association learning, we conducted functional magnetic resonance imaging (MRI) during audiovisual paired-association learning of delayed matching-to-sample tasks. Thirty subjects were involved in the study; 15 performed an audiovisual paired-association learning task, and the remainder completed a control visuo-visual task. Each trial consisted of the successive presentation of a pair of stimuli. Subjects were asked to identify predefined audiovisual or visuo-visual pairs by trial and error. Feedback for each trial was given regardless of whether the response was correct or incorrect. During the delay period, several areas showed an increase in the MRI signal as learning proceeded: crossmodal activity increased in unimodal areas corresponding to visual or auditory areas, and polymodal responses increased in the occipitotemporal junction and parahippocampal gyrus. This pattern was not observed in the visuo-visual intramodal paired-association learning task, suggesting that crossmodal associations might be formed by binding unimodal sensory areas via polymodal regions. In both the audiovisual and visuo-visual tasks, the MRI signal in the superior temporal sulcus (STS) in response to the second stimulus and feedback peaked during the early phase of learning and then decreased, indicating that the STS might be key to the creation of paired associations, regardless of stimulus type. In contrast to the activity changes in the regions discussed above, there was constant activity in the frontoparietal circuit during the delay period in both tasks, implying that the neural substrates for the formation and storage of paired associates are distinct from working memory circuits.

  19. Heterogeneous Defensive Naval Weapon Assignment To Swarming Threats In Real Time

    DTIC Science & Technology

    2016-03-01

    threat Damage potential of target t if it hits the ship [integer from 0 to 3] _ ttarget phit Probability that target t hits the ship [probability...secondary weapon systems on target t [integer] _ tsec phit Probability that secondary weapon systems launched from target t hit the ship...pairing. These parameters are calculated as follows: 310 _ _t t tpriority target threat target phit = × × (3.1) 3_ 10 _ _t t tsec priority sec

  20. Discrete-time moment closure models for epidemic spreading in populations of interacting individuals.

    PubMed

    Frasca, Mattia; Sharkey, Kieran J

    2016-06-21

    Understanding the dynamics of spread of infectious diseases between individuals is essential for forecasting the evolution of an epidemic outbreak or for defining intervention policies. The problem is addressed by many approaches including stochastic and deterministic models formulated at diverse scales (individuals, populations) and different levels of detail. Here we consider discrete-time SIR (susceptible-infectious-removed) dynamics propagated on contact networks. We derive a novel set of 'discrete-time moment equations' for the probability of the system states at the level of individual nodes and pairs of nodes. These equations form a set which we close by introducing appropriate approximations of the joint probabilities appearing in them. For the example case of SIR processes, we formulate two types of model, one assuming statistical independence at the level of individuals and one at the level of pairs. From the pair-based model we then derive a model at the level of the population which captures the behavior of epidemics on homogeneous random networks. With respect to their continuous-time counterparts, the models include a larger number of possible transitions from one state to another and joint probabilities with a larger number of individuals. The approach is validated through numerical simulation over different network topologies. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. PSE-HMM: genome-wide CNV detection from NGS data using an HMM with Position-Specific Emission probabilities.

    PubMed

    Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi

    2016-11-03

    Copy Number Variation (CNV) is envisaged to be a major source of large structural variations in the human genome. In recent years, many studies apply Next Generation Sequencing (NGS) data for the CNV detection. However, still there is a necessity to invent more accurate computational tools. In this study, mate pair NGS data are used for the CNV detection in a Hidden Markov Model (HMM). The proposed HMM has position specific emission probabilities, i.e. a Gaussian mixture distribution. Each component in the Gaussian mixture distribution captures a different type of aberration that is observed in the mate pairs, after being mapped to the reference genome. These aberrations may include any increase (decrease) in the insertion size or change in the direction of mate pairs that are mapped to the reference genome. This HMM with Position-Specific Emission probabilities (PSE-HMM) is utilized for the genome-wide detection of deletions and tandem duplications. The performance of PSE-HMM is evaluated on a simulated dataset and also on a real data of a Yoruban HapMap individual, NA18507. PSE-HMM is effective in taking observation dependencies into account and reaches a high accuracy in detecting genome-wide CNVs. MATLAB programs are available at http://bs.ipm.ir/softwares/PSE-HMM/ .

  2. Carry-over effects of the social environment on future divorce probability in a wild bird population

    PubMed Central

    Culina, Antica; Hinde, Camilla A.; Sheldon, Ben C.

    2015-01-01

    Initial mate choice and re-mating strategies (infidelity and divorce) influence individual fitness. Both of these should be influenced by the social environment, which determines the number and availability of potential partners. While most studies looking at this relationship take a population-level approach, individual-level responses to variation in the social environment remain largely unstudied. Here, we explore carry-over effects on future mating decisions of the social environment in which the initial mating decision occurred. Using detailed data on the winter social networks of great tits, we tested whether the probability of subsequent divorce, a year later, could be predicted by measures of the social environment at the time of pairing. We found that males that had a lower proportion of female associates, and whose partner ranked lower among these, as well as inexperienced breeders, were more likely to divorce after breeding. We found no evidence that a female's social environment influenced the probability of divorce. Our findings highlight the importance of the social environment that individuals experience during initial pair formation on later pairing outcomes, and demonstrate that such effects can be delayed. Exploring these extended effects of the social environment can yield valuable insights into processes and selective pressures acting upon the mating strategies that individuals adopt. PMID:26468239

  3. Significance of stress transfer in time-dependent earthquake probability calculations

    USGS Publications Warehouse

    Parsons, T.

    2005-01-01

    A sudden change in stress is seen to modify earthquake rates, but should it also revise earthquake probability? Data used to derive input parameters permits an array of forecasts; so how large a static stress change is require to cause a statistically significant earthquake probability change? To answer that question, effects of parameter and philosophical choices are examined through all phases of sample calculations, Drawing at random from distributions of recurrence-aperiodicity pairs identifies many that recreate long paleoseismic and historic earthquake catalogs. Probability density funtions built from the recurrence-aperiodicity pairs give the range of possible earthquake forecasts under a point process renewal model. Consequences of choices made in stress transfer calculations, such as different slip models, fault rake, dip, and friction are, tracked. For interactions among large faults, calculated peak stress changes may be localized, with most of the receiving fault area changed less than the mean. Thus, to avoid overstating probability change on segments, stress change values should be drawn from a distribution reflecting the spatial pattern rather than using the segment mean. Disparity resulting from interaction probability methodology is also examined. For a fault with a well-understood earthquake history, a minimum stress change to stressing rate ratio of 10:1 to 20:1 is required to significantly skew probabilities with >80-85% confidence. That ratio must be closer to 50:1 to exceed 90-95% confidence levels. Thus revision to earthquake probability is achievable when a perturbing event is very close to the fault in question or the tectonic stressing rate is low.

  4. Trinucleotide's quadruplet symmetries and natural symmetry law of DNA creation ensuing Chargaff's second parity rule.

    PubMed

    Rosandić, Marija; Vlahović, Ines; Glunčić, Matko; Paar, Vladimir

    2016-07-01

    For almost 50 years the conclusive explanation of Chargaff's second parity rule (CSPR), the equality of frequencies of nucleotides A=T and C=G or the equality of direct and reverse complement trinucleotides in the same DNA strand, has not been determined yet. Here, we relate CSPR to the interstrand mirror symmetry in 20 symbolic quadruplets of trinucleotides (direct, reverse complement, complement, and reverse) mapped to double-stranded genome. The symmetries of Q-box corresponding to quadruplets can be obtained as a consequence of Watson-Crick base pairing and CSPR together. Alternatively, assuming Natural symmetry law for DNA creation that each trinucleotide in one strand of DNA must simultaneously appear also in the opposite strand automatically leads to Q-box direct-reverse mirror symmetry which in conjunction with Watson-Crick base pairing generates CSPR. We demonstrate quadruplet's symmetries in chromosomes of wide range of organisms, from Escherichia coli to Neanderthal and human genomes, introducing novel quadruplet-frequency histograms and 3D-diagrams with combined interstrand frequencies. These "landscapes" are mutually similar in all mammals, including extinct Neanderthals, and somewhat different in most of older species. In human chromosomes 1-12, and X, Y the "landscapes" are almost identical and slightly different in the remaining smaller and telocentric chromosomes. Quadruplet frequencies could provide a new robust tool for characterization and classification of genomes and their evolutionary trajectories.

  5. Corona emission thresholds for three types of hydrometeor interaction in thunderclouds

    NASA Astrophysics Data System (ADS)

    Blyth, A. M.; Christian, H. J.; Latham, J.

    1998-06-01

    Laboratory studies have been conducted of the conditions under which glancing collisions, at relative velocities V characteristic of those occurring in thunderstorms, of three types of hydrometeor pairs of precipitation dimension (such as (1) warm drop pairs, (2) supercooled drop pairs, and (3) a supercooled drop and a graupel pellet) produce a corona discharge in an electric field E. In each case, the observed corona is emitted at the tip of an ephemeral liquid filament, of length greater than the dimensions of the interacting hydrometeors, drawn out during each interaction. For each type of hydrometeor pair, the probability f that corona was produced during an interaction increased steadily from zero for increasing values of E above about 150 kV/m, and was significantly in excess of 50% for values of E = 400 kV/m, which is probably about the maximum ambient value occurring in a thunderstorm. We conclude that if the associated hydrometeors are present in strongly electrified regions of thunderstorms (unlikely for interaction type 1 but manifestly possible for types 2 and 3, corona initiation leading to the production of lightning could result from each of the three types of interaction studied.

  6. On the chemical reaction of matter with antimatter.

    PubMed

    Lodi Rizzini, Evandro; Venturelli, Luca; Zurlo, Nicola

    2007-06-04

    A chemical reaction between the building block antiatomic nucleus, the antiproton (p or H- in chemical notation), and the hydrogen molecular ion (H2+) has been observed by the ATHENA collaboration at CERN. The charged pair interact via the long-range Coulomb force in the environment of a Penning trap which is purpose-built to observe antiproton interactions. The net result of the very low energy collision of the pair is the creation of an antiproton-proton bound state, known as protonium (Pn), together with the liberation of a hydrogen atom. The Pn is formed in a highly excited, metastable, state with a lifetime against annihilation of around 1 micros. Effects are observed related to the temperature of the H2+ prior to the interaction, and this is discussed herein.

  7. Simulations On Pair Creation In Collision Of γ-Beams Produced With High Intensity Lasers

    NASA Astrophysics Data System (ADS)

    Jansen, Oliver; Ribeyre, Xavier; D'Humieres, Emmanuel; Lobet, Mathieu; Jequier, Sophie; Tikhonchuk, Vladimir

    2016-10-01

    Direct production of electron-positron pairs in two photon collisions, the Breit-Wheeler process, is one of the most basic processes in the universe. However, this process has never been directly observed in the laboratory due to the lack of high intensity γ sources. For a feasibility study and for the optimisation of experimental set-ups we developed a high-performance tree-code. Different possible set-ups with MeV photon sources were discussed and compared using collision detection for huge number of particles in a quantum-electrodynamic regime. The authors acknowledge the financial support from the French National Research Agency (ANR) in the framework of ''The Investments for the Future'' programme IdEx Bordeaux - LAPHIA (ANR-10IDEX-03-02)-Project TULIMA.

  8. The Conjunction Fallacy: A Misunderstanding about Conjunction?

    ERIC Educational Resources Information Center

    Tentori, Katya; Bonini, Nicolao; Osherson, Daniel

    2004-01-01

    It is easy to construct pairs of sentences X, Y that lead many people to ascribe higher probability to the conjunction X-and-Y than to the conjuncts X, Y. Whether an error is thereby committed depends on reasoners' interpretation of the expressions "probability" and "and." We report two experiments designed to clarify the normative status of…

  9. Why firewalls need not exist

    DOE PAGES

    Nomura, Yasunori; Salzetta, Nico

    2016-08-04

    The firewall paradox for black holes is often viewed as indicating a conflict between unitarity and the equivalence principle. We elucidate how the paradox manifests as a limitation of semiclassical theory, rather than presents a conflict between fundamental principles. Two principal features of the fundamental and semiclassical theories address two versions of the paradox: the entanglement and typicality arguments. First, the physical Hilbert space describing excitations on a fixed black hole background in the semiclassical theory is exponentially smaller than the number of physical states in the fundamental theory of quantum gravity. Second, in addition to the Hilbert space formore » physical excitations, the semiclassical theory possesses an unphysically large Fock space built by creation and annihilation operators on the fixed black hole background. Understanding these features not only eliminates the necessity of firewalls but also leads to a new picture of Hawking emission contrasting pair creation at the horizon.« less

  10. A mutli-technique search for the most primitive CO chondrites

    NASA Astrophysics Data System (ADS)

    Alexander, C. M. O'D.; Greenwood, R. C.; Bowden, R.; Gibson, J. M.; Howard, K. T.; Franchi, I. A.

    2018-01-01

    As part of a study to identify the most primitive COs and to look for weakly altered CMs amongst the COs, we have conducted a multi-technique study of 16 Antarctic meteorites that had been classified as primitive COs. For this study, we have determined: (1) the bulk H, C and N abundances and isotopes, (2) bulk O isotopic compositions, (3) bulk modal mineralogies, and (4) for some selected samples the abundances and compositions of their insoluble organic matter (IOM). Two of the 16 meteorites do appear to be CMs - BUC 10943 seems to be a fairly typical CM, while MIL 090073 has probably been heated. Of the COs, DOM 08006 appears to be the most primitive CO identified to date and is quite distinct from the other members of its pairing group. The other COs fall into two groups that are less primitive than DOM 08006 and ALH 77307, the previously most primitive CO. The first group is composed of members of the DOM 08004 pairing group, except DOM 08006. The second group is composed of meteorites belonging to the MIL 03377 and MIL 07099 pairing groups. These two pairing groups should probably be combined. There is a dichotomy in the bulk O isotopes between the primitive (all Antarctic finds) and the more metamorphosed COs (mostly falls). This dichotomy can only partly be explained by the terrestrial weathering experienced by the primitive Antarctic samples. It seems that the more equilibrated samples interacted to a greater extent with 16O-poor material, probably water, than the more primitive meteorites.

  11. Breeding ecology of the Puaiohi (Myadestes palmeri)

    USGS Publications Warehouse

    Snetsinger, T.J.; Herrmann, C.M.; Holmes, D.E.; Hayward, C.D.; Fancy, S.G.

    2005-01-01

    We studied the breeding ecology of the critically endangered Puaiohi (Myadestes palmeri), a poorly known Hawaiian thrush endemic to the island of Kauai. From 1996 through 1998, we monitored 96 active nests over the course of three breeding seasons. Mean clutch size was 2.0, and pairs produced an average of 1.5 fledglings/successful nest. Pairs renested after failure and some raised multiple broods. The mean annual reproductive effort was 2.1 nesting attempts/territory, and pairs produced a mean 1.1 fledglings/attempt. Large differences in nesting effort and productivity occurred among years, with mean number of fledglings/territory ranging from 0.4 to 4.9. Predation by owls (probably Short-eared Owls, Asia flammeus) and introduced rats (probably black rats, Rattus rattus) accounted for most nest failures. The presence of non-breeding floaters in the population and their largely unsuccessful attempts to gain territories in the study area suggest that the population is near carrying capacity. The high reproductive potential of the Puaiohi may help explain its persistence despite the species' historical rarity.

  12. Survival estimation and the effects of dependency among animals

    USGS Publications Warehouse

    Schmutz, Joel A.; Ward, David H.; Sedinger, James S.; Rexstad, Eric A.

    1995-01-01

    Survival models assume that fates of individuals are independent, yet the robustness of this assumption has been poorly quantified. We examine how empirically derived estimates of the variance of survival rates are affected by dependency in survival probability among individuals. We used Monte Carlo simulations to generate known amounts of dependency among pairs of individuals and analyzed these data with Kaplan-Meier and Cormack-Jolly-Seber models. Dependency significantly increased these empirical variances as compared to theoretically derived estimates of variance from the same populations. Using resighting data from 168 pairs of black brant, we used a resampling procedure and program RELEASE to estimate empirical and mean theoretical variances. We estimated that the relationship between paired individuals caused the empirical variance of the survival rate to be 155% larger than the empirical variance for unpaired individuals. Monte Carlo simulations and use of this resampling strategy can provide investigators with information on how robust their data are to this common assumption of independent survival probabilities.

  13. Maximizing detection probability of Wetland-dependent birds during point-count surveys in northwestern Florida

    USGS Publications Warehouse

    Nadeau, C.P.; Conway, C.J.; Smith, B.S.; Lewis, T.E.

    2008-01-01

    We conducted 262 call-broadcast point-count surveys (1-6 replicate surveys on each of 62 points) using standardized North American Marsh Bird Monitoring Protocols between 31 May and 7 July 2006 on St. Vincent National Wildlife Refuge, an island off the northwest coast of Florida. We conducted double-blind multiple-observer surveys, paired morning and evening surveys, and paired morning and night surveys to examine the influence of call-broadcast and time of day on detection probability. Observer detection probability for all species pooled was 75% and was similar between passive (69%) and call-broadcast (65%) periods. Detection probability was higher on morning than evening (t = 3.0, P = 0.030) or night (t = 3.4, P = 0.042) surveys when we pooled all species. Detection probability was higher (but not significant for all species) on morning compared to evening or night surveys for all five focal species detected on surveys: Least Bittern (Ixobrychus exilis), Clapper Rail (Rallus longirostris), Purple Gallinule (Porphyrula martinica), Common Moorhen (Gallinula chloropus), and American Coot (Fulica americana). We detected more Least Bitterns (t = 2.4, P = 0.064) and Common Moorhens (t = 2.8, P = 0.026) on morning than evening surveys, and more Clapper Rails (t = 5.1, P = 0.014) on morning than night surveys.

  14. X-ray flares from runaway pair production in active galactic nuclei

    NASA Technical Reports Server (NTRS)

    Kirk, J. G.; Mastichiadis, A.

    1992-01-01

    The hard X-ray spectrum of AGNs is nonthermal, probably arising from an electron-positron pair cascade, with some emission reflected off relatively cold matter. There has been interest in models on which protons are accelerated and create relativistic electrons on interaction with a local radiation field. It is shown here that a sufficient column density of protons can lead to runaway pair production: photons generated by the relativistic pairs are the targets for the protons to produce more pairs. This can produce X-ray fluxes with the characteristics observed in AGN. The model predicts the maximum ratio of luminosity to source size as well as their spectrum in the early phases. The same mechanism may also be able to create the knots of synchrotron-radiating pair plasma seen in sources such as 3C273.

  15. A dynamical study of the multiple system 17 Cygni ABFG

    NASA Astrophysics Data System (ADS)

    Romanenko, L. G.

    2017-03-01

    Adynamical study of the relative motions of the components of the inner pairs AB (ADS 12913) and FG (ADS 12889) of the quadruple heirarchical system 17 Cygni (WDS 19464+3344) is presented, as well as analysis of themotions of the outer pair AB-FG. The study is based on CCD observations obtained on the 26-inch refractor of the Pulkovo Observatory (2003-2013), position observations from the WDS catalog, Hipparcos parallaxes, and radial velocities of the components from literature data. A family of orbits for 17 Cyg AB is obtained for the first time, and has a most probable period of 6200 yrs. The apparent motion parameters (AMP) method is used, since the entire visible arc of the orbit over 1832-2013 is only 4°. The AMP method is also used to calculate the orbit of the 17 Cyg FG pair, which has a period of 238 yrs, yielding results in good agreement with the orbits derived in other studies. The ephemerides of the obtained AMP orbits, the position data for the AF pair from the WDS catalog (11 positions during 1893-2002), and Pulkovo CCD observations for 2007-2013 are used to calculate the apparent motion parameters of AB-FG outer pair, as well as a family of close-to-parabolic orbits with periods of 3.7 million years ormore. All the orbits (for both the inner and the outer pairs) are steeply inclined to theGalactic plane. Monte Carlo simulations are used to compute the probability that the outer pair is gravitationally bound, which is 47%. The similarity of the proper motions and radial velocities of all the components provides evidence that they all belong to a single stellar stream. Data from the CNS3 catalog are used to compose a list of candidate members of this stream.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aaltonen, T.; Brucken, E.; Devoto, F.

    We search for resonant production of tt pairs in 4.8 fb{sup -1} integrated luminosity of pp collision data at {radical}(s)=1.96 TeV in the lepton+jets decay channel, where one top quark decays leptonically and the other hadronically. A matrix-element reconstruction technique is used; for each event a probability density function of the tt candidate invariant mass is sampled. These probability density functions are used to construct a likelihood function, whereby the cross section for resonant tt production is estimated, given a hypothetical resonance mass and width. The data indicate no evidence of resonant production of tt pairs. A benchmark model ofmore » leptophobic Z{sup '}{yields}tt is excluded with m{sub Z}{sup '}<900 GeV/c{sup 2} at 95% confidence level.« less

  17. Microsatellites for Carpotroche brasiliensis (Flacourtiaceae), a useful species for agroforestry and ecosystem conservation.

    PubMed

    Bittencourt, Flora; Alves, Jackeline S; Gaiotto, Fernanda A

    2015-12-01

    We developed microsatellite markers for Carpotroche brasiliensis (Flacourtiaceae), a dioecious tree that is used as a food resource by midsize animals of the Brazilian fauna. We designed 30 primer pairs using next-generation sequencing and classified 25 pairs as polymorphic. Observed heterozygosity ranged from 0.5 to 1.0, and expected heterozygosity ranged from 0.418 to 0.907. The combined probability of exclusion was greater than 0.999 and the combined probability of identity was less than 0.001, indicating that these microsatellites are appropriate for investigations of genetic structure, individual identification, and paternity testing. The developed molecular tools may contribute to future studies of population genetics, answering ecological and evolutionary questions regarding efficient conservation strategies for C. brasiliensis.

  18. Tunneling method for Hawking radiation in the Nariai case

    NASA Astrophysics Data System (ADS)

    Belgiorno, F.; Cacciatori, S. L.; Dalla Piazza, F.

    2017-08-01

    We revisit the tunneling picture for the Hawking effect in light of the charged Nariai manifold, because this general relativistic solution, which displays two horizons, provides the bonus to allow the knowledge of exact solutions of the field equations. We first perform a revisitation of the tunneling ansatz in the framework of particle creation in external fields à la Nikishov, which corroborates the interpretation of the semiclassical emission rate Γ_{emission} as the conditional probability rate for the creation of a couple of particles from the vacuum. Then, particle creation associated with the Hawking effect on the Nariai manifold is calculated in two ways. On the one hand, we apply the Hamilton-Jacobi formalism for tunneling, in the case of a charged scalar field on the given background. On the other hand, the knowledge of the exact solutions for the Klein-Gordon equations on Nariai manifold, and their analytic properties on the extended manifold, allow us a direct computation of the flux of particles leaving the horizon, and, as a consequence, we obtain a further corroboration of the semiclassical tunneling picture from the side of S-matrix formalism.

  19. Influence of e-e+ creation on the radiative trapping in ultraintense fields of colliding laser pulses

    NASA Astrophysics Data System (ADS)

    Baumann, C.; Pukhov, A.

    2016-12-01

    The behavior of a thin plasma target irradiated by two counterpropagating laser pulses of ultrahigh intensity is studied in the framework of one- and two-dimensional particle-in-cell simulations. It is found that above an intensity threshold, radiative trapping can focus electrons in the peaks of the electromagnetic field. At even higher intensities, the trapping effect cannot be maintained according to the increasing influence of electron-positron pair production on the laser-plasma dynamics.

  20. A Java software for creation of image mosaics.

    PubMed

    Bossert, Oliver

    2004-08-01

    Besides the dimensions of the selected image field width, the resolution of the individual objects is also of major importance for automatic reconstruction and other sophisticated histological work. The software solution presented here allows the user to create image mosaics by using a combination of several photographs. Optimum control is achieved by combining two procedures and several control mechanisms. In sample tests involving 50 image pairs, all images were mosaiced without giving rise to error. The program is ready for public download.

  1. Creation of Emergent Sandbar Habitat (ESH) in the Headwaters of Lewis and Clark Lake and the Impacts on Water Quality

    DTIC Science & Technology

    2009-04-01

    probably tich in decayed vegetative matter (i.e., humus ) and seed stock. The richness of the matetial is indicated by its ctru·ker color as shown in...iron and manganese), humus and peat materials, plankton, weeds, and industrial wastes (APHA, 1998). “True color” is the color of water from which

  2. Ultra-Dense Optical Mass Storage

    DTIC Science & Technology

    1991-02-11

    Technologies develops equipment for telephone company central offices which allows users within a local area to have personal mailboxes for voicemail and FAX...externally applied stress field can alter the energy level of a molecule by slightly dis- torting the local environment surrounding the photochemical...permit us to raise the temperature even further during part of the channel creation process. It is probably reasonable to assume that local heating

  3. [Changes in the activity of an epileptogenic focus in the rat hippocampus under the influence of bemitil].

    PubMed

    Mikhaĭlov, I B; Sharf, M Ia; Guzeva, V I

    1995-01-01

    Experiments performed on male rats with chronically implanted electrochemotrodes showed bemitil (12.5 and 25.0 mg/kg, intra-abdominally, 24 h prior to the locus creation) suppresses he pathological activity of (100 ED) epileptogenic locus induced by he sodium salt of penicillin in the hippocampus of the animals. Probable mechanisms of antiepileptic action of bemitil are considered.

  4. Statistics on continuous IBD data: Exact distribution evaluation for a pair of full(half)-sibs and a pair of a (great-) grandchild with a (great-) grandparent

    PubMed Central

    Stefanov, Valeri T

    2002-01-01

    Background Pairs of related individuals are widely used in linkage analysis. Most of the tests for linkage analysis are based on statistics associated with identity by descent (IBD) data. The current biotechnology provides data on very densely packed loci, and therefore, it may provide almost continuous IBD data for pairs of closely related individuals. Therefore, the distribution theory for statistics on continuous IBD data is of interest. In particular, distributional results which allow the evaluation of p-values for relevant tests are of importance. Results A technology is provided for numerical evaluation, with any given accuracy, of the cumulative probabilities of some statistics on continuous genome data for pairs of closely related individuals. In the case of a pair of full-sibs, the following statistics are considered: (i) the proportion of genome with 2 (at least 1) haplotypes shared identical-by-descent (IBD) on a chromosomal segment, (ii) the number of distinct pieces (subsegments) of a chromosomal segment, on each of which exactly 2 (at least 1) haplotypes are shared IBD. The natural counterparts of these statistics for the other relationships are also considered. Relevant Maple codes are provided for a rapid evaluation of the cumulative probabilities of such statistics. The genomic continuum model, with Haldane's model for the crossover process, is assumed. Conclusions A technology, together with relevant software codes for its automated implementation, are provided for exact evaluation of the distributions of relevant statistics associated with continuous genome data on closely related individuals. PMID:11996673

  5. Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

    PubMed

    Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

    2014-08-15

    We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.

  6. Analysis and inundation mapping of the April-May 2011 flood at selected locations in northern and eastern Arkansas and southern Missouri

    USGS Publications Warehouse

    Westerman, Drew A.; Merriman, Katherine R.; De Lanois, Jeanne L.; Berenbrock, Charles

    2013-01-01

    Precipitation that fell from April 19 through May 3, 2011, resulted in widespread flooding across northern and eastern Arkansas and southern Missouri. The first storm produced a total of approximately 16 inches of precipitation over an 8-day period, and the following storms produced as much as 12 inches of precipitation over a 2-day period. Moderate to major flooding occurred quickly along many streams within Arkansas and Missouri (including the Black, Cache, Illinois, St. Francis, and White Rivers) at levels that had not been seen since the historic 1927 floods. The 2011 flood claimed an estimated 21 lives in Arkansas and Missouri, and damage caused by the flooding resulted in a Federal Disaster Declaration for 59 Arkansas counties that received Federal or State assistance. To further the goal of documenting and understanding floods, the U.S. Geological Survey, in cooperation with the Federal Emergency Management Agency, the U.S. Army Corps of Engineers–Little Rock and Memphis Districts, and Arkansas Natural Resources Commission, conducted a study to summarize meteorological and hydrological conditions before the flood; computed flood-peak magnitudes for 39 streamgages; estimated annual exceedance probabilities for 37 of those streamgages; determined the joint probabilities for 11 streamgages paired to the Mississippi River at Helena, Arkansas, which refers to the probability that locations on two paired streams simultaneously experience floods of a magnitude greater than or equal to a given annual exceedance probability; collected high-water marks; constructed flood-peak inundation maps showing maximum flood extent and water depths; and summarized flood damages and effects. For the period of record used in this report, peak-of-record stage occurred at 24 of the 39 streamgages, and peak-of-record streamflow occurred at 13 of the 30 streamgages where streamflow was determined. Annual exceedance probabilities were estimated to be less than 0.5 percent at three streamgages. The joint probability values for streamgages paired with the Mississippi River at Helena, Ark., streamgage indicate a low probability of concurrent flooding with the paired streamgages. The inundation maps show the flood-peak extent and water depth of flooding for two stream reaches on the White River and two on the Black River; the vicinities of the communities of Holly Grove and Cotton Plant, Ark.; a reach of the White River that includes the crossing of Interstate 40 north of De Valls Bluff, Ark.; and the Tailwaters of Beaver Dam near Eureka Springs, Ark., Table Rock Dam near Branson, Mo., and Bull Shoals Dam near Flippin, Ark. The data and inundation maps can be used for flood response, recovery, and planning efforts by Federal, State, and local agencies.

  7. The rise and fall of a challenger: the Bullet Cluster in Λ cold dark matter simulations

    NASA Astrophysics Data System (ADS)

    Thompson, Robert; Davé, Romeel; Nagamine, Kentaro

    2015-09-01

    The Bullet Cluster has provided some of the best evidence for the Λ cold dark matter (ΛCDM) model via direct empirical proof of the existence of collisionless dark matter, while posing a serious challenge owing to the unusually high inferred pairwise velocities of its progenitor clusters. Here, we investigate the probability of finding such a high-velocity pair in large-volume N-body simulations, particularly focusing on differences between halo-finding algorithms. We find that algorithms that do not account for the kinematics of infalling groups yield vastly different statistics and probabilities. When employing the ROCKSTAR halo finder that considers particle velocities, we find numerous Bullet-like pair candidates that closely match not only the high pairwise velocity, but also the mass, mass ratio, separation distance, and collision angle of the initial conditions that have been shown to produce the Bullet Cluster in non-cosmological hydrodynamic simulations. The probability of finding a high pairwise velocity pair among haloes with Mhalo ≥ 1014 M⊙ is 4.6 × 10-4 using ROCKSTAR, while it is ≈34 × lower using a friends-of-friends (FoF)-based approach as in previous studies. This is because the typical spatial extent of Bullet progenitors is such that FoF tends to group them into a single halo despite clearly distinct kinematics. Further requiring an appropriately high average mass among the two progenitors, we find the comoving number density of potential Bullet-like candidates to be of the order of ≈10-10 Mpc-3. Our findings suggest that ΛCDM straightforwardly produces massive, high relative velocity halo pairs analogous to Bullet Cluster progenitors, and hence the Bullet Cluster does not present a challenge to the ΛCDM model.

  8. Application of Archimedean copulas to the impact assessment of hydro-climatic variables in semi-arid aquifers of western India

    NASA Astrophysics Data System (ADS)

    Wable, Pawan S.; Jha, Madan K.

    2018-02-01

    The effects of rainfall and the El Niño Southern Oscillation (ENSO) on groundwater in a semi-arid basin of India were analyzed using Archimedean copulas considering 17 years of data for monsoon rainfall, post-monsoon groundwater level (PMGL) and ENSO Index. The evaluated dependence among these hydro-climatic variables revealed that PMGL-Rainfall and PMGL-ENSO Index pairs have significant dependence. Hence, these pairs were used for modeling dependence by employing four types of Archimedean copulas: Ali-Mikhail-Haq, Clayton, Gumbel-Hougaard, and Frank. For the copula modeling, the results of probability distributions fitting to these hydro-climatic variables indicated that the PMGL and rainfall time series are best represented by Weibull and lognormal distributions, respectively, while the non-parametric kernel-based normal distribution is the most suitable for the ENSO Index. Further, the PMGL-Rainfall pair is best modeled by the Clayton copula, and the PMGL-ENSO Index pair is best modeled by the Frank copula. The Clayton copula-based conditional probability of PMGL being less than or equal to its average value at a given mean rainfall is above 70% for 33% of the study area. In contrast, the spatial variation of the Frank copula-based probability of PMGL being less than or equal to its average value is 35-40% in 23% of the study area during El Niño phase, while it is below 15% in 35% of the area during the La Niña phase. This copula-based methodology can be applied under data-scarce conditions for exploring the impacts of rainfall and ENSO on groundwater at basin scales.

  9. Robust prediction of consensus secondary structures using averaged base pairing probability matrices.

    PubMed

    Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi

    2007-02-15

    Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.

  10. Solving the Quantum Many-Body Problem via Correlations Measured with a Momentum Microscope

    NASA Astrophysics Data System (ADS)

    Hodgman, S. S.; Khakimov, R. I.; Lewis-Swan, R. J.; Truscott, A. G.; Kheruntsyan, K. V.

    2017-06-01

    In quantum many-body theory, all physical observables are described in terms of correlation functions between particle creation or annihilation operators. Measurement of such correlation functions can therefore be regarded as an operational solution to the quantum many-body problem. Here, we demonstrate this paradigm by measuring multiparticle momentum correlations up to third order between ultracold helium atoms in an s -wave scattering halo of colliding Bose-Einstein condensates, using a quantum many-body momentum microscope. Our measurements allow us to extract a key building block of all higher-order correlations in this system—the pairing field amplitude. In addition, we demonstrate a record violation of the classical Cauchy-Schwarz inequality for correlated atom pairs and triples. Measuring multiparticle momentum correlations could provide new insights into effects such as unconventional superconductivity and many-body localization.

  11. Recursive model for the fragmentation of polarized quarks

    NASA Astrophysics Data System (ADS)

    Kerbizi, A.; Artru, X.; Belghobsi, Z.; Bradamante, F.; Martin, A.

    2018-04-01

    We present a model for Monte Carlo simulation of the fragmentation of a polarized quark. The model is based on string dynamics and the 3P0 mechanism of quark pair creation at string breaking. The fragmentation is treated as a recursive process, where the splitting function of the subprocess q →h +q' depends on the spin density matrix of the quark q . The 3P0 mechanism is parametrized by a complex mass parameter μ , the imaginary part of which is responsible for single spin asymmetries. The model has been implemented in a Monte Carlo program to simulate jets made of pseudoscalar mesons. Results for single hadron and hadron pair transverse-spin asymmetries are found to be in agreement with experimental data from SIDIS and e+e- annihilation. The model predictions on the jet-handedness are also discussed.

  12. Confinement with Perturbation Theory, After All?

    NASA Astrophysics Data System (ADS)

    Hoyer, Paul

    2015-09-01

    I call attention to the possibility that QCD bound states (hadrons) could be derived using rigorous Hamiltonian, perturbative methods. Solving Gauss' law for A 0 with a non-vanishing boundary condition at spatial infinity gives an linear potential for color singlet and qqq states. These states are Poincaré and gauge covariant and thus can serve as initial states of a perturbative expansion, replacing the conventional free in and out states. The coupling freezes at , allowing reasonable convergence. The bound states have a sea of pairs, while transverse gluons contribute only at . Pair creation in the linear A 0 potential leads to string breaking and hadron loop corrections. These corrections give finite widths to excited states, as required by unitarity. Several of these features have been verified analytically in D = 1 + 1 dimensions, and some in D = 3 + 1.

  13. Field signature for apparently superluminal particle motion

    NASA Astrophysics Data System (ADS)

    Land, Martin

    2015-05-01

    In the context of Stueckelberg's covariant symplectic mechanics, Horwitz and Aharonovich [1] have proposed a simple mechanism by which a particle traveling below light speed almost everywhere may exhibit a transit time that suggests superluminal motion. This mechanism, which requires precise measurement of the particle velocity, involves a subtle perturbation affecting the particle's recorded time coordinate caused by virtual pair processes. The Stueckelberg framework is particularly well suited to such problems, because it permits pair creation/annihilation at the classical level. In this paper, we study a trajectory of the type proposed by Horwitz and Aharonovich, and derive the Maxwell 4-vector potential associated with the motion. We show that the resulting fields carry a signature associated with the apparent superluminal motion, providing an independent test for the mechanism that does not require direct observation of the trajectory, except at the detector.

  14. Colour assortative pairing in a colour polymorphic lizard is independent of population morph diversity

    NASA Astrophysics Data System (ADS)

    Pérez i de Lanuza, Guillem; Font, Enrique; Carretero, Miguel Ángel

    2016-10-01

    Previous work with a colour polymorphic population of Podarcis muralis (Lacertidae) revealed that lizards pair by ventral colour, favouring the same colour (i.e. homomorphic) pairs. Such assortative pairing, which probably results in colour assortative mating, can have consequences for the genetic structure of the population and potentially promote speciation. The population previously studied, located in the Pyrenees, encompasses white, yellow and orange animals, as well as intermediate white-orange and yellow-orange morphs. However, other Pyrenean populations of P. muralis have less ventral colour morphs. Our aim in this study is to test the generality of the assortative colour pairing system, extending our previous analyses to populations with different morph compositions and frequencies. The results show that the assortative pattern of pairing is similar in all the populations analysed and, hence, independent of morph composition and not restricted to pentamorphic populations. This suggests that assortative pairing by colour is a general phenomenon for colour polymorphic populations of P. muralis.

  15. High-Speed Quantum Key Distribution Using Photonic Integrated Circuits

    DTIC Science & Technology

    2013-01-01

    protocol [14] that uses energy-time entanglement of pairs of photons. We are employing the QPIC architecture to implement a novel high-dimensional disper...continuous Hilbert spaces using measures of the covariance matrix. Although we focus the discussion on a scheme employing entangled photon pairs...is the probability that parameter estimation fails [20]. The parameter ε̄ accounts for the accuracy of estimating the smooth min- entropy , which

  16. Stimulated emission of Cooper pairs in a high-temperature cuprate superconductor

    DOE PAGES

    Zhang, Wentao; Miller, Tristan; Smallwood, Christopher L.; ...

    2016-07-01

    The concept of stimulated emission of bosons has played an important role in modern science and technology, and constitutes the working principle for lasers. In a stimulated emission process, an incoming photon enhances the probability that an excited atomic state will transition to a lower energy state and generate a second photon of the same energy. It is expected, but not experimentally shown, that stimulated emission contributes significantly to the zero resistance current in a superconductor by enhancing the probability that scattered Cooper pairs will return to the macroscopically occupied condensate instead of entering any other state. Here, we usemore » time- and angle-resolved photoemission spectroscopy to study the initial rise of the non-equilibrium quasiparticle population in a Bi 2 Sr 2 CaCu 2 O 8+δ cuprate superconductor induced by an ultrashort laser pulse. Our finding reveals significantly slower buildup of quasiparticles in the superconducting state than in the normal state. The slower buildup only occurs when the pump pulse is too weak to deplete the superconducting condensate, and for cuts inside the Fermi arc region. We propose this is a manifestation of stimulated recombination of broken Cooper pairs, and signals an important momentum space dichotomy in the formation of Cooper pairs inside and outside the Fermi arc region.« less

  17. Resonance of an unshared electron pair between two atoms connected by a single bond

    PubMed Central

    Pauling, Linus

    1983-01-01

    The reported structure of the dimer of a compound of bicovalent tin indicates that the tin-tin bond is of a new type. It can be described as involving resonance between two structures in which there is transfer of an electron pair from one tin atom to the other. The tin atoms are connected by a single covalent bond (each also forms two covalent bonds with carbon atoms), and an unshared electron pair resonates between the fourth sp3 orbitals of the two atoms. Similar structures probably occur in digermene and distannene. PMID:16593329

  18. Prostate Cancer Probability Prediction By Machine Learning Technique.

    PubMed

    Jović, Srđan; Miljković, Milica; Ivanović, Miljan; Šaranović, Milena; Arsić, Milena

    2017-11-26

    The main goal of the study was to explore possibility of prostate cancer prediction by machine learning techniques. In order to improve the survival probability of the prostate cancer patients it is essential to make suitable prediction models of the prostate cancer. If one make relevant prediction of the prostate cancer it is easy to create suitable treatment based on the prediction results. Machine learning techniques are the most common techniques for the creation of the predictive models. Therefore in this study several machine techniques were applied and compared. The obtained results were analyzed and discussed. It was concluded that the machine learning techniques could be used for the relevant prediction of prostate cancer.

  19. Star formation rates in isolated galaxies selected from the Two-Micron All-Sky Survey

    NASA Astrophysics Data System (ADS)

    Melnyk, O.; Karachentseva, V.; Karachentsev, I.

    2015-08-01

    We have considered the star formation properties of 1616 isolated galaxies from the 2MASS XSC (Extended Source Catalog) selected sample (2MIG) with the far-ultraviolet GALEX magnitudes. This sample was then compared with corresponding properties of isolated galaxies from the Local Orphan Galaxies (LOG) catalogue and paired galaxies. We found that different selection algorithms define different populations of isolated galaxies. The population of the LOG catalogue, selected from non-clustered galaxies in the Local Supercluster volume, mostly consists of low-mass spiral and late-type galaxies. The specific star formation rate (SSFR) upper limit in isolated and paired galaxies does not exceed the value of ˜dex(-9.4). This is probably common for galaxies of differing activity and environment (at least at z < 0.06). The fractions of quenched galaxies are nearly twice as high in the paired galaxy sample as in the 2MIG isolated galaxy sample. From the behaviour of (S)SFR versus M* relations we deduced that the characteristic value influencing evolutionary processes is the galaxy mass. However, the environmental influence is notable: paired massive galaxies with logM* > 11.5 have higher (S)SFR than isolated galaxies. Our results suggest that the environment helps to trigger the star formation in the highest mass galaxies. We found that the fraction of AGN in the paired sample is only a little higher than in our isolated galaxy sample. We assume that AGN phenomenon is probably defined by secular galaxy evolution.

  20. A selection of giant radio sources from NVSS

    DOE PAGES

    Proctor, D. D.

    2016-06-01

    Results of the application of pattern-recognition techniques to the problem of identifying giant radio sources (GRSs) from the data in the NVSS catalog are presented, and issues affecting the process are explored. Decision-tree pattern-recognition software was applied to training-set source pairs developed from known NVSS large-angular-size radio galaxies. The full training set consisted of 51,195 source pairs, 48 of which were known GRSs for which each lobe was primarily represented by a single catalog component. The source pairs had a maximum separation ofmore » $$20^{\\prime} $$ and a minimum component area of 1.87 square arcmin at the 1.4 mJy level. The importance of comparing the resulting probability distributions of the training and application sets for cases of unknown class ratio is demonstrated. The probability of correctly ranking a randomly selected (GRS, non-GRS) pair from the best of the tested classifiers was determined to be 97.8 ± 1.5%. The best classifiers were applied to the over 870,000 candidate pairs from the entire catalog. Images of higher-ranked sources were visually screened, and a table of over 1600 candidates, including morphological annotation, is presented. These systems include doubles and triples, wide-angle tail and narrow-angle tail, S- or Z-shaped systems, and core-jets and resolved cores. In conclusion, while some resolved-lobe systems are recovered with this technique, generally it is expected that such systems would require a different approach.« less

  1. Statistical deprojection of galaxy pairs

    NASA Astrophysics Data System (ADS)

    Nottale, Laurent; Chamaraux, Pierre

    2018-06-01

    Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

  2. Inferring relationships between pairs of individuals from locus heterozygosities

    PubMed Central

    Presciuttini, Silvano; Toni, Chiara; Tempestini, Elena; Verdiani, Simonetta; Casarino, Lucia; Spinetti, Isabella; Stefano, Francesco De; Domenici, Ranieri; Bailey-Wilson, Joan E

    2002-01-01

    Background The traditional exact method for inferring relationships between individuals from genetic data is not easily applicable in all situations that may be encountered in several fields of applied genetics. This study describes an approach that gives affordable results and is easily applicable; it is based on the probabilities that two individuals share 0, 1 or both alleles at a locus identical by state. Results We show that these probabilities (zi) depend on locus heterozygosity (H), and are scarcely affected by variation of the distribution of allele frequencies. This allows us to obtain empirical curves relating zi's to H for a series of common relationships, so that the likelihood ratio of a pair of relationships between any two individuals, given their genotypes at a locus, is a function of a single parameter, H. Application to large samples of mother-child and full-sib pairs shows that the statistical power of this method to infer the correct relationship is not much lower than the exact method. Analysis of a large database of STR data proves that locus heterozygosity does not vary significantly among Caucasian populations, apart from special cases, so that the likelihood ratio of the more common relationships between pairs of individuals may be obtained by looking at tabulated zi values. Conclusions A simple method is provided, which may be used by any scientist with the help of a calculator or a spreadsheet to compute the likelihood ratios of common alternative relationships between pairs of individuals. PMID:12441003

  3. Covariance Based Pre-Filters and Screening Criteria for Conjunction Analysis

    NASA Astrophysics Data System (ADS)

    George, E., Chan, K.

    2012-09-01

    Several relationships are developed relating object size, initial covariance and range at closest approach to probability of collision. These relationships address the following questions: - Given the objects' initial covariance and combined hard body size, what is the maximum possible value of the probability of collision (Pc)? - Given the objects' initial covariance, what is the maximum combined hard body radius for which the probability of collision does not exceed the tolerance limit? - Given the objects' initial covariance and the combined hard body radius, what is the minimum miss distance for which the probability of collision does not exceed the tolerance limit? - Given the objects' initial covariance and the miss distance, what is the maximum combined hard body radius for which the probability of collision does not exceed the tolerance limit? The first relationship above allows the elimination of object pairs from conjunction analysis (CA) on the basis of the initial covariance and hard-body sizes of the objects. The application of this pre-filter to present day catalogs with estimated covariance results in the elimination of approximately 35% of object pairs as unable to ever conjunct with a probability of collision exceeding 1x10-6. Because Pc is directly proportional to object size and inversely proportional to covariance size, this pre-filter will have a significantly larger impact on future catalogs, which are expected to contain a much larger fraction of small debris tracked only by a limited subset of available sensors. This relationship also provides a mathematically rigorous basis for eliminating objects from analysis entirely based on element set age or quality - a practice commonly done by rough rules of thumb today. Further, these relations can be used to determine the required geometric screening radius for all objects. This analysis reveals the screening volumes for small objects are much larger than needed, while the screening volumes for pairs of large objects may be inadequate. These relationships may also form the basis of an important metric for catalog maintenance by defining the maximum allowable covariance size for effective conjunction analysis. The application of these techniques promises to greatly improve the efficiency and completeness of conjunction analysis.

  4. Photon pair source via two coupling single quantum emitters

    NASA Astrophysics Data System (ADS)

    Peng, Yong-Gang; Zheng, Yu-Jun

    2015-10-01

    We study the two coupling two-level single molecules driven by an external field as a photon pair source. The probability of emitting two photons, P2, is employed to describe the photon pair source quality in a short time, and the correlation coefficient RAB is employed to describe the photon pair source quality in a long time limit. The results demonstrate that the coupling single quantum emitters can be considered as a stable photon pair source. Project supported by the National Natural Science Foundation of China (Grand Nos. 91021009, 21073110, and 11374191), the Natural Science Foundation of Shandong Province, China (Grant No. ZR2013AQ020), the Postdoctoral Science Foundation of China (Grant No. 2013M531584), the Doctoral Program of Higher Education of China (Grant Nos. 20130131110005 and 20130131120006), and the Taishan Scholarship Project of Shandong Province, China.

  5. Coherence of beam arrays propagating in the turbulent atmosphere

    NASA Astrophysics Data System (ADS)

    Charnotskii, Mikhail

    2010-04-01

    We analyze some recent publications addressing propagation of the partially coherent polarized beams and beam arrays in the turbulent atmosphere. We show that the published results are limited to the scalar propagation model, and are not particular to the beam polarization. Therefore these results are equally relevant for the scalar beam pairs and arrays discriminated by some parameters such as small frequency shift, time delay or geometry, but not necessary the polarization. We use the virtual incoherent source model to derive the general form of the mutual coherence function of the two Schell-type beams. We discuss some physical stochastic models that result in the creation of the Schell-type beams and beam arrays. New classes of the uniformly, nonuniformly and nonlocally coherent beam pairs emerge naturally from this analysis. Rigorous, Markov approximation-based, propagation model provides relatively simple analytic results for the second-order moments of the optical field of the partially-coherent individual beams and beam pairs. We examine the changes of the beam mutual coherence in the process of the free-space propagation and propagation through the turbulent atmosphere.

  6. English semantic word-pair norms and a searchable Web portal for experimental stimulus creation.

    PubMed

    Buchanan, Erin M; Holmes, Jessica L; Teasley, Marilee L; Hutchison, Keith A

    2013-09-01

    As researchers explore the complexity of memory and language hierarchies, the need to expand normed stimulus databases is growing. Therefore, we present 1,808 words, paired with their features and concept-concept information, that were collected using previously established norming methods (McRae, Cree, Seidenberg, & McNorgan Behavior Research Methods 37:547-559, 2005). This database supplements existing stimuli and complements the Semantic Priming Project (Hutchison, Balota, Cortese, Neely, Niemeyer, Bengson, & Cohen-Shikora 2010). The data set includes many types of words (including nouns, verbs, adjectives, etc.), expanding on previous collections of nouns and verbs (Vinson & Vigliocco Journal of Neurolinguistics 15:317-351, 2008). We describe the relation between our and other semantic norms, as well as giving a short review of word-pair norms. The stimuli are provided in conjunction with a searchable Web portal that allows researchers to create a set of experimental stimuli without prior programming knowledge. When researchers use this new database in tandem with previous norming efforts, precise stimuli sets can be created for future research endeavors.

  7. PARTS: Probabilistic Alignment for RNA joinT Secondary structure prediction

    PubMed Central

    Harmanci, Arif Ozgun; Sharma, Gaurav; Mathews, David H.

    2008-01-01

    A novel method is presented for joint prediction of alignment and common secondary structures of two RNA sequences. The joint consideration of common secondary structures and alignment is accomplished by structural alignment over a search space defined by the newly introduced motif called matched helical regions. The matched helical region formulation generalizes previously employed constraints for structural alignment and thereby better accommodates the structural variability within RNA families. A probabilistic model based on pseudo free energies obtained from precomputed base pairing and alignment probabilities is utilized for scoring structural alignments. Maximum a posteriori (MAP) common secondary structures, sequence alignment and joint posterior probabilities of base pairing are obtained from the model via a dynamic programming algorithm called PARTS. The advantage of the more general structural alignment of PARTS is seen in secondary structure predictions for the RNase P family. For this family, the PARTS MAP predictions of secondary structures and alignment perform significantly better than prior methods that utilize a more restrictive structural alignment model. For the tRNA and 5S rRNA families, the richer structural alignment model of PARTS does not offer a benefit and the method therefore performs comparably with existing alternatives. For all RNA families studied, the posterior probability estimates obtained from PARTS offer an improvement over posterior probability estimates from a single sequence prediction. When considering the base pairings predicted over a threshold value of confidence, the combination of sensitivity and positive predictive value is superior for PARTS than for the single sequence prediction. PARTS source code is available for download under the GNU public license at http://rna.urmc.rochester.edu. PMID:18304945

  8. A probabilistic analysis of the implications of instrument failures on ESA's Swarm mission for its individual satellite orbit deployments

    NASA Astrophysics Data System (ADS)

    Jackson, Andrew

    2015-07-01

    On launch, one of Swarm's absolute scalar magnetometers (ASMs) failed to function, leaving an asymmetrical arrangement of redundant spares on different spacecrafts. A decision was required concerning the deployment of individual satellites into the low-orbit pair or the higher "lonely" orbit. I analyse the probabilities for successful operation of two of the science components of the Swarm mission in terms of a classical probabilistic failure analysis, with a view to concluding a favourable assignment for the satellite with the single working ASM. I concentrate on the following two science aspects: the east-west gradiometer aspect of the lower pair of satellites and the constellation aspect, which requires a working ASM in each of the two orbital planes. I use the so-called "expert solicitation" probabilities for instrument failure solicited from Mission Advisory Group (MAG) members. My conclusion from the analysis is that it is better to have redundancy of ASMs in the lonely satellite orbit. Although the opposite scenario, having redundancy (and thus four ASMs) in the lower orbit, increases the chance of a working gradiometer late in the mission; it does so at the expense of a likely constellation. Although the results are presented based on actual MAG members' probabilities, the results are rather generic, excepting the case when the probability of individual ASM failure is very small; in this case, any arrangement will ensure a successful mission since there is essentially no failure expected at all. Since the very design of the lower pair is to enable common mode rejection of external signals, it is likely that its work can be successfully achieved during the first 5 years of the mission.

  9. The Finite-Size Scaling Relation for the Order-Parameter Probability Distribution of the Six-Dimensional Ising Model

    NASA Astrophysics Data System (ADS)

    Merdan, Ziya; Karakuş, Özlem

    2016-11-01

    The six dimensional Ising model with nearest-neighbor pair interactions has been simulated and verified numerically on the Creutz Cellular Automaton by using five bit demons near the infinite-lattice critical temperature with the linear dimensions L=4,6,8,10. The order parameter probability distribution for six dimensional Ising model has been calculated at the critical temperature. The constants of the analytical function have been estimated by fitting to probability function obtained numerically at the finite size critical point.

  10. Influence of complex impurity centres on radiation damage in wide-gap metal oxides

    NASA Astrophysics Data System (ADS)

    Lushchik, A.; Lushchik, Ch.; Popov, A. I.; Schwartz, K.; Shablonin, E.; Vasil'chenko, E.

    2016-05-01

    Different mechanisms of radiation damage of wide-gap metal oxides as well as a dual influence of impurity ions on the efficiency of radiation damage have been considered on the example of binary ionic MgO and complex ionic-covalent Lu3Al5O12 single crystals. Particular emphasis has been placed on irradiation with ∼2 GeV heavy ions (197Au, 209Bi, 238U, fluence of 1012 ions/cm2) providing extremely high density of electronic excitations within ion tracks. Besides knock-out mechanism for Frenkel pair formation, the additional mechanism through the collapse of mobile discrete breathers at certain lattice places (e.g., complex impurity centres) leads to the creation of complex defects that involve a large number of host atoms. The experimental manifestations of the radiation creation of intrinsic and impurity antisite defects (Lu|Al or Ce|Al - a heavy ion in a wrong cation site) have been detected in LuAG and LuAG:Ce3+ single crystals. Light doping of LuAG causes a small enhancement of radiation resistance, while pair impurity centres (for instance, Ce|Lu-Ce|Al or Cr3+-Cr3+ in MgO) are formed with a rise of impurity concentration. These complex impurity centres as well as radiation-induced intrinsic antisite defects (Lu|Al strongly interacting with Lu in a regular site) tentatively serve as the places for breathers collapse, thus decreasing the material resistance against dense irradiation.

  11. Integrating Nanostructured Artificial Receptors with Whispering Gallery Mode Optical Microresonators via Inorganic Molecular Imprinting Techniques

    PubMed Central

    Hammond, G. Denise; Vojta, Adam L.; Grant, Sheila A.; Hunt, Heather K.

    2016-01-01

    The creation of label-free biosensors capable of accurately detecting trace contaminants, particularly small organic molecules, is of significant interest for applications in environmental monitoring. This is achieved by pairing a high-sensitivity signal transducer with a biorecognition element that imparts selectivity towards the compound of interest. However, many environmental pollutants do not have corresponding biorecognition elements. Fortunately, biomimetic chemistries, such as molecular imprinting, allow for the design of artificial receptors with very high selectivity for the target. Here, we perform a proof-of-concept study to show how artificial receptors may be created from inorganic silanes using the molecular imprinting technique and paired with high-sensitivity transducers without loss of device performance. Silica microsphere Whispering Gallery Mode optical microresonators are coated with a silica thin film templated by a small fluorescent dye, fluorescein isothiocyanate, which serves as our model target. Oxygen plasma degradation and solvent extraction of the template are compared. Extracted optical devices are interacted with the template molecule to confirm successful sorption of the template. Surface characterization is accomplished via fluorescence and optical microscopy, ellipsometry, optical profilometry, and contact angle measurements. The quality factors of the devices are measured to evaluate the impact of the coating on device sensitivity. The resulting devices show uniform surface coating with no microstructural damage with Q factors above 106. This is the first report demonstrating the integration of these devices with molecular imprinting techniques, and could lead to new routes to biosensor creation for environmental monitoring. PMID:27314397

  12. Changes in Keratocyte Density and Visual Function Five Years After Laser In Situ Keratomileusis: Femtosecond Laser Versus Mechanical Microkeratome.

    PubMed

    McLaren, Jay W; Bourne, William M; Maguire, Leo J; Patel, Sanjay V

    2015-07-01

    To determine the effects of keratocyte loss on optical properties and vision after laser in situ keratomileusis (LASIK) with the flap created with a femtosecond laser or a mechanical microkeratome. Randomized clinical paired-eye study. Both eyes of 21 patients received LASIK for myopia or myopic astigmatism. One eye of each patient was randomized by ocular dominance to flap creation with a femtosecond laser and the other eye to flap creation with a mechanical microkeratome. Before LASIK and at 1, 3, and 6 months and 1, 3, and 5 years after LASIK, keratocyte density was measured using confocal microscopy, and high-contrast visual acuity and anterior corneal wavefront aberrations were measured by standard methods. At each visit, all variables were compared between methods of creating the flap and to the same variable before treatment using paired tests with Bonferroni correction for multiple comparisons. Keratocyte density in the flap decreased by 20% during the first year after LASIK and remained low through 5 years (P < .001). High-order wavefront aberrations increased and uncorrected visual acuity improved immediately after surgery, but these variables did not change further to 5 years. There were no differences in any variables between treatments. A sustained reduction in keratocyte density does not affect vision or optical properties of the cornea through 5 years after LASIK. The method of creating a LASIK flap does not influence the changes in keratocyte density in the flap. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Religion in SETI Communications

    NASA Astrophysics Data System (ADS)

    Pay, R.

    The prospect of millions of civilizations in the Galaxy raises the probability of receiving communications in the Search for Extraterrestrial Intelligence (SETI). However, much depends on the average lifetime of planetary civilizations. For a lifetime of 500 years, an optimistic forecast would predict about 65 civilizations in the Galaxy at any one time, separated by 5,000 light years. No prospect of communication. For a lifetime of 10 million years, over a million civilizations would be spaced 180 light years apart. Communication among them is feasible. This indicates that extraterrestrial communications depend on civilizations achieving long term stability, probably by evolving a global religion that removes sources of religious strife. Stability also requires an ethic supporting universal rights, nonviolence, empathy and cooperation. As this ethic will be expressed in the planet-wide religion, it will lead to offers of support to other civilizations struggling to gain stability. As stable civilizations will be much advanced scientifically, understanding the religious concepts that appear in their communications will depend on how quantum mechanics, biological evolution, and the creation of the universe at a point in time are incorporated into their religion. Such a religion will view creation as intentional rather than accidental (the atheistic alternative) and will find the basis for its natural theology in the intention revealed by the physical laws of the universe.

  14. Attractive interaction between Mn atoms on the GaAs(110) surface observed by scanning tunneling microscopy.

    PubMed

    Taninaka, Atsushi; Yoshida, Shoji; Kanazawa, Ken; Hayaki, Eiko; Takeuchi, Osamu; Shigekawa, Hidemi

    2016-06-16

    Scanning tunneling microscopy/spectroscopy (STM/STS) was carried out to investigate the structures of Mn atoms deposited on a GaAs(110) surface at room temperature to directly observe the characteristics of interactions between Mn atoms in GaAs. Mn atoms were paired with a probability higher than the random distribution, indicating an attractive interaction between them. In fact, re-pairing of unpaired Mn atoms was observed during STS measurement. The pair initially had a new structure, which was transformed during STS measurement into one of those formed by atom manipulation at 4 K. Mn atoms in pairs and trimers were aligned in the <110> direction, which is theoretically predicted to produce a high Curie temperature.

  15. Urban green space and obesity in older adults: Evidence from Ireland.

    PubMed

    Dempsey, Seraphim; Lyons, Seán; Nolan, Anne

    2018-04-01

    We examine the association between living in an urban area with more or less green space and the probability of being obese. This work involves the creation of a new dataset which combines geo-coded data at the individual level from the Irish Longitudinal Study on Ageing with green space data from the European Urban Atlas 2012. We find evidence suggestive of a u-shaped relationship between green space in urban areas and obesity; those living in areas with the lowest and highest shares of green space within a 1.6 km buffer zone have a higher probability of being classified as obese (BMI [Formula: see text]). The unexpected result that persons in areas with both the lowest and highest shares of green space have a higher probability of being obese than those in areas with intermediate shares, suggests that other characteristics of urban areas may be mediating this relationship.

  16. Shot-noise evidence of fractional quasiparticle creation in a local fractional quantum Hall state.

    PubMed

    Hashisaka, Masayuki; Ota, Tomoaki; Muraki, Koji; Fujisawa, Toshimasa

    2015-02-06

    We experimentally identify fractional quasiparticle creation in a tunneling process through a local fractional quantum Hall (FQH) state. The local FQH state is prepared in a low-density region near a quantum point contact in an integer quantum Hall (IQH) system. Shot-noise measurements reveal a clear transition from elementary-charge tunneling at low bias to fractional-charge tunneling at high bias. The fractional shot noise is proportional to T(1)(1-T(1)) over a wide range of T(1), where T(1) is the transmission probability of the IQH edge channel. This binomial distribution indicates that fractional quasiparticles emerge from the IQH state to be transmitted through the local FQH state. The study of this tunneling process enables us to elucidate the dynamics of Laughlin quasiparticles in FQH systems.

  17. In Situ Biotreatment of TBA with Recirculation/Oxygenation

    PubMed Central

    North, Katharine P.; Mackay, Douglas M.; Kayne, Julian S.; Petersen, Daniel; Rasa, Ehsan; Rastegarzadeh, Laleh; Holland, Reef B.; Scow, Kate M.

    2012-01-01

    The potential for in situ biodegradation of tert-butyl alcohol (TBA) by creation of aerobic conditions in the subsurface with recirculating well pairs was investigated in two field studies conducted at Vandenberg Air Force Base (VAFB). In the first experiment, a single recirculating well pair with bromide tracer and oxygen amendment successfully delivered oxygen to the subsurface for 42 days. TBA concentrations were reduced from approximately 500 μg/L to below the detection limit within the treatment zone and the treated water was detected in a monitoring transect several meters downgradient. In the second experiment, a site-calibrated model was used to design a double recirculating well pair with oxygen amendment, which successfully delivered oxygen to the subsurface for 291 days and also decreased TBA concentrations to below the detection limit. Methylibium petroleiphilum strain PM1, a known TBA-degrading bacterium, was detectable at the study site but addition of oxygen had little impact on the already low baseline population densities, suggesting that there was not enough carbon within the groundwater plume to support significant new growth in the PM1 population. Given favorable hydrogeologic and geochemical conditions, the use of recirculating well pairs to introduce dissolved oxygen into the subsurface is a viable method to stimulate in situ biodegradation of TBA or other aerobically-degradable aquifer contaminants. PMID:23358537

  18. Universality-class crossover by a nonorder field introduced to the pair contact process with diffusion

    NASA Astrophysics Data System (ADS)

    Park, Su-Chan

    2017-09-01

    The one-dimensional pair contact process with diffusion (PCPD), an interacting particle system with diffusion, pair annihilation, and creation by pairs, has defied consensus about the universality class to which it belongs. An argument by Hinrichsen [Physica A 361, 457 (2006), 10.1016/j.physa.2005.06.101] claims that freely diffusing particles in the PCPD should play the same role as frozen particles when it comes to the critical behavior. Therefore, the PCPD is claimed to have the same critical phenomena as a model with infinitely many absorbing states that belongs to the directed percolation (DP) universality class. To investigate if diffusing particles are really indistinguishable from frozen particles in the sense of the renormalization group, we study numerically a variation of the PCPD by introducing a nonorder field associated with infinitely many absorbing states. We find that a crossover from the PCPD to DP occurs due to the nonorder field. By studying a similar model, we exclude the possibility that the mere introduction of a nonorder field to one model can entail a nontrivial crossover to another model in the same universality class, thus we attribute the observed crossover to the difference of the universality class of the PCPD from the DP class.

  19. In Situ Biotreatment of TBA with Recirculation/Oxygenation.

    PubMed

    North, Katharine P; Mackay, Douglas M; Kayne, Julian S; Petersen, Daniel; Rasa, Ehsan; Rastegarzadeh, Laleh; Holland, Reef B; Scow, Kate M

    2012-01-01

    The potential for in situ biodegradation of tert-butyl alcohol (TBA) by creation of aerobic conditions in the subsurface with recirculating well pairs was investigated in two field studies conducted at Vandenberg Air Force Base (VAFB). In the first experiment, a single recirculating well pair with bromide tracer and oxygen amendment successfully delivered oxygen to the subsurface for 42 days. TBA concentrations were reduced from approximately 500 μg/L to below the detection limit within the treatment zone and the treated water was detected in a monitoring transect several meters downgradient. In the second experiment, a site-calibrated model was used to design a double recirculating well pair with oxygen amendment, which successfully delivered oxygen to the subsurface for 291 days and also decreased TBA concentrations to below the detection limit. Methylibium petroleiphilum strain PM1, a known TBA-degrading bacterium, was detectable at the study site but addition of oxygen had little impact on the already low baseline population densities, suggesting that there was not enough carbon within the groundwater plume to support significant new growth in the PM1 population. Given favorable hydrogeologic and geochemical conditions, the use of recirculating well pairs to introduce dissolved oxygen into the subsurface is a viable method to stimulate in situ biodegradation of TBA or other aerobically-degradable aquifer contaminants.

  20. Pairing call-response surveys and distance sampling for a mammalian carnivore

    USGS Publications Warehouse

    Hansen, Sara J. K.; Frair, Jacqueline L.; Underwood, Harold B.; Gibbs, James P.

    2015-01-01

    Density estimates accounting for differential animal detectability are difficult to acquire for wide-ranging and elusive species such as mammalian carnivores. Pairing distance sampling with call-response surveys may provide an efficient means of tracking changes in populations of coyotes (Canis latrans), a species of particular interest in the eastern United States. Blind field trials in rural New York State indicated 119-m linear error for triangulated coyote calls, and a 1.8-km distance threshold for call detectability, which was sufficient to estimate a detection function with precision using distance sampling. We conducted statewide road-based surveys with sampling locations spaced ≥6 km apart from June to August 2010. Each detected call (be it a single or group) counted as a single object, representing 1 territorial pair, because of uncertainty in the number of vocalizing animals. From 524 survey points and 75 detections, we estimated the probability of detecting a calling coyote to be 0.17 ± 0.02 SE, yielding a detection-corrected index of 0.75 pairs/10 km2 (95% CI: 0.52–1.1, 18.5% CV) for a minimum of 8,133 pairs across rural New York State. Importantly, we consider this an index rather than true estimate of abundance given the unknown probability of coyote availability for detection during our surveys. Even so, pairing distance sampling with call-response surveys provided a novel, efficient, and noninvasive means of monitoring populations of wide-ranging and elusive, albeit reliably vocal, mammalian carnivores. Our approach offers an effective new means of tracking species like coyotes, one that is readily extendable to other species and geographic extents, provided key assumptions of distance sampling are met.

  1. Assessing relative abundance and reproductive success of shrubsteppe raptors

    USGS Publications Warehouse

    Lehman, Robert N.; Carpenter, L.B.; Steenhof, Karen; Kochert, Michael N.

    1998-01-01

    From 1991-1994, we quantified relative abundance and reproductive success of the Ferruginous Hawk (Buteo regalis), Northern Harrier (Circus cyaneus), Burrowing Owl (Speotytoc unicularia), and Short-eared Owl (Asio flammeus) on the shrubsteppe plateaus (benchlands) in and near the Snake River Birds of Prey National Conservation Area in southwestern Idaho. To assess relative abundance, we searched randomly selected plots using four sampling methods: point counts, line transects, and quadrats of two sizes. On a persampling-effort basis, transects were slightly more effective than point counts and quadrats for locating raptor nests (3.4 pairs detected/100 h of effort vs. 2.2-3.1 pairs). Random sampling using quadrats failed to detect a Short-eared Owl population increase from 1993 to 1994. To evaluate nesting success, we tried to determine reproductive outcome for all nesting attempts located during random, historical, and incidental nest searches. We compared nesting success estimates based on all nesting attempts, on attempts found during incubation, and the Mayfield model. Most pairs used to evaluate success were pairs found incidentally. Visits to historical nesting areas yielded the highest number of pairs per sampling effort (14.6/100 h), but reoccupancy rates for most species decreased through time. Estimates based on all attempts had the highest sample sizes but probably overestimated success for all species except the Ferruginous Hawk. Estimates of success based on nesting attempts found during incubation had the lowest sample sizes. All three methods yielded biased nesting snccess estimates for the Northern Harrier and Short-eared Owl. The estimate based on pairs found during incubation probably provided the least biased estimate for the Burrowing Owl. Assessments of nesting success were hindered by difficulties in confirming egg laying and nesting success for all species except the Ferruginous hawk.

  2. Discrete Torsion, (Anti) de Sitter D4-Brane and Tunneling

    NASA Astrophysics Data System (ADS)

    Singh, Abhishek K.; Pandey, P. K.; Singh, Sunita; Kar, Supriya

    2014-06-01

    We obtain quantum geometries on a vacuum created pair of a (DDbar)3-brane, at a Big Bang singularity, by a local two form on a D4-brane. In fact our analysis is provoked by an established phenomenon leading to a pair creation by a gauge field at a black hole horizon by Stephen Hawking in 1975. Importantly, the five dimensional microscopic black holes are described by an effective non-perturbative curvature underlying a discrete torsion in a second order formalism. In the case for a non-propagating torsion, the effective curvature reduces to Riemannian, which in a low energy limit may describe Einstein vacuum in the formalism. In particular, our analysis suggests that a non-trivial space begin with a hot de Sitter brane-Universe underlying a nucleation of a vacuum pair of (DDbar)-instanton at a Big Bang. A pair of instanton nucleats a D-particle which in turn combines with an anti D-particle to describe a D-string and so on. The nucleation of a pair of higher dimensional pair of brane/anti-brane from a lower dimensional pair may be viewed via an expansion of the brane-Universe upon time. It is in conformity with the conjecture of a branes within a brane presumably in presence of the non-zero modes of two form. Interestingly, we perform a thermal analysis underlying various emergent quantum de Sitter vacua on a D4-brane and argue for the plausible tunneling geometries underlying a thermal equilibrium. It is argued that a de Sitter Schwarzschild undergoes quantum tunneling to an AdS-brane Schwarzschild via Nariai and de Sitter topological black hole.

  3. Matrix Concentration Inequalities via the Method of Exchangeable Pairs

    DTIC Science & Technology

    2012-01-27

    viewed as an exchangeable pairs version of the Burkholder –Davis–Gundy (BDG) inequality from classical martingale theory [Bur73]. Matrix extensions of...non-commutative probability. Math. Ann., 319:1–16, 2001. [Bur73] D. L. Burkholder . Distribution function inequalities for martingales. Ann. Probab., 1...Statist. Assoc., 58(301):13–30, 1963. [JX03] M. Junge and Q. Xu. Noncommutative Burkholder /Rosenthal inequalities. Ann. Probab., 31(2):948–995, 2003

  4. Radiation-mediated Shocks in Gamma-Ray Bursts: Pair Creation

    NASA Astrophysics Data System (ADS)

    Lundman, Christoffer; Beloborodov, Andrei M.; Vurm, Indrek

    2018-05-01

    Relativistic sub-photospheric shocks are a possible mechanism for producing prompt gamma-ray burst (GRB) emission. Such shocks are mediated by scattering of radiation. We introduce a time-dependent, special relativistic code which dynamically couples Monte Carlo radiative transfer to the flow hydrodynamics. The code also self-consistently follows electron–positron pair production in photon–photon collisions. We use the code to simulate shocks with properties relevant to GRBs. We focus on plane-parallel solutions, which are accurate deep below the photosphere. The shock generates a power-law photon spectrum through the first-order Fermi mechanism, extending upward from the typical upstream photon energy. Strong (high Mach number) shocks produce rising νF ν spectra. We observe that in non-relativistic shocks the spectrum extends to {E}\\max ∼ {m}e{v}2, where v is the speed difference between the upstream and downstream. In relativistic shocks the spectrum extends to energies E> 0.1 {m}e{c}2 where its slope softens due to Klein–Nishina effects. Shocks with Lorentz factors γ > 1.5 are prolific producers of electron–positron pairs, yielding hundreds of pairs per proton. The main effect of pairs is to reduce the shock width by a factor of ∼ {Z}+/- -1. Most pairs annihilate far downstream of the shock, and the radiation spectrum relaxes to a Wien distribution, reaching equilibrium with the plasma at a temperature determined by the shock jump conditions and the photon number per proton. We discuss the implications of our results for observations of radiation generated by sub-photospheric shocks.

  5. A Framework for Final Drive Simultaneous Failure Diagnosis Based on Fuzzy Entropy and Sparse Bayesian Extreme Learning Machine

    PubMed Central

    Ye, Qing; Pan, Hao; Liu, Changhua

    2015-01-01

    This research proposes a novel framework of final drive simultaneous failure diagnosis containing feature extraction, training paired diagnostic models, generating decision threshold, and recognizing simultaneous failure modes. In feature extraction module, adopt wavelet package transform and fuzzy entropy to reduce noise interference and extract representative features of failure mode. Use single failure sample to construct probability classifiers based on paired sparse Bayesian extreme learning machine which is trained only by single failure modes and have high generalization and sparsity of sparse Bayesian learning approach. To generate optimal decision threshold which can convert probability output obtained from classifiers into final simultaneous failure modes, this research proposes using samples containing both single and simultaneous failure modes and Grid search method which is superior to traditional techniques in global optimization. Compared with other frequently used diagnostic approaches based on support vector machine and probability neural networks, experiment results based on F 1-measure value verify that the diagnostic accuracy and efficiency of the proposed framework which are crucial for simultaneous failure diagnosis are superior to the existing approach. PMID:25722717

  6. Teaching science in light of world view: The effect of contextualized instruction on the scientific compatibility of religious college students' world views

    NASA Astrophysics Data System (ADS)

    Gossard, Paula Rae

    Authors of recent science reform documents promote the goal of scientific literacy for all Americans (American Association for the Advancement of Science, 1989, 1993). Some students, however, feel apprehensive about learning science due to perceptions that science is antagonistic to their world views (Alters, 2005; Esbenshade, 1993). This study investigated the effect of an introductory science course taught in the context of a Christian, theistic world view on the scientific compatibility of religious college students' world views. For the purposes of this study, students' understanding of the nature of science, affective attitudes toward science, and beliefs regarding creation were used as indicators of the scientific compatibility of their world views. One hundred and seventy-one students enrolled in a core curriculum, introductory science course at a Christian university participated in this study by completing pre-instruction and post-instruction survey packets that included demographic information, the Student Understanding of Science and Scientific Inquiry questionnaire (Liang et al., 2006), the Affective Attitude toward Science Scale (Francis & Greer, 1999), and the Origins Survey (Tenneson & Badger, personal communication, June, 2008). Two-tailed paired samples t tests were used to test for significant mean differences in the indicator variables at a .05 level before and after instruction. Pearson correlation coefficients were calculated to determine if relationships were present among the indicator variables at a .05 level before and after instruction. Students' self-identified positions regarding creation were analyzed using a chi-square contingency table. Results indicated that there were statistically significant changes in all indicator variables after instruction of the contextualized course. The direction of these changes and shifts in students' self-identified positions regarding creation supported the conclusion that students developed a more scentifically compatible world view after contextualized instruction based on the indicators used in this study. Weak positive correlations were found between nature of science understanding and young earth creation before and after instruction; weak negative correlations were found between nature of science understanding and old earth creation and evolutionary creation before, but not after, instruction. Conclusions, implications for practice, and recommendations for future research are included.

  7. Bird-community responses to habitat creation in a long-term, large-scale natural experiment.

    PubMed

    Whytock, Robin C; Fuentes-Montemayor, Elisa; Watts, Kevin; Barbosa De Andrade, Patanjaly; Whytock, Rory T; French, Paul; Macgregor, Nicholas A; Park, Kirsty J

    2018-04-01

    Ecosystem function and resilience are compromised when habitats become fragmented due to land-use change. This has led to national and international conservation strategies aimed at restoring habitat extent and improving functional connectivity (i.e., maintaining dispersal processes). However, biodiversity responses to landscape-scale habitat creation and the relative importance of spatial and temporal scales are poorly understood, and there is disagreement over which conservation strategies should be prioritized. We used 160 years of historic post-agricultural woodland creation as a natural experiment to evaluate biodiversity responses to habitat creation in a landscape context. Birds were surveyed in 101 secondary, broadleaf woodlands aged 10-160 years with ≥80% canopy cover and in landscapes with 0-17% broadleaf woodland cover within 3000 m. We used piecewise structural equation modeling to examine the direct and indirect relationships between bird abundance and diversity, ecological continuity, patch characteristics, and landscape structure and quantified the relative conservation value of local and landscape scales for bird communities. Ecological continuity indirectly affected overall bird abundance and species richness through its effects on stand structure, but had a weaker influence (effect size near 0) on the abundance and diversity of species most closely associated with woodland habitats. This was probably because woodlands were rapidly colonized by woodland generalists in ≤10 years (minimum patch age) but were on average too young (median 50 years) to be colonized by woodland specialists. Local patch characteristics were relatively more important than landscape characteristics for bird communities. Based on our results, biodiversity responses to habitat creation depended on local- and landscape-scale factors that interacted across time and space. We suggest that there is a need for further studies that focus on habitat creation in a landscape context and that knowledge gained from studies of habitat fragmentation and loss should be used to inform habitat creation with caution because the outcomes are not necessarily reciprocal. © 2017 The Authors. Conservation Biology published by Wiley Periodicals, Inc. on behalf of Society for Conservation Biology.

  8. Qubit Manipulations Techniques for Trapped-Ion Quantum Information Processing

    NASA Astrophysics Data System (ADS)

    Gaebler, John; Tan, Ting; Lin, Yiheng; Bowler, Ryan; Jost, John; Meier, Adam; Knill, Emanuel; Leibfried, Dietrich; Wineland, David; Ion Storage Team

    2013-05-01

    We report recent results on qubit manipulation techniques for trapped-ions towards scalable quantum information processing (QIP). We demonstrate a platform-independent benchmarking protocol for evaluating the performance of Clifford gates, which form a basis for fault-tolerant QIP. We report a demonstration of an entangling gate scheme proposed by Bermudez et al. [Phys. Rev. A. 85, 040302 (2012)] and achieve a fidelity of 0.974(4). This scheme takes advantage of dynamic decoupling which protects the qubit against dephasing errors. It can be applied directly on magnetic-field-insensitive states, and provides a number of simplifications in experimental implementation compared to some other entangling gates with trapped ions. We also report preliminary results on dissipative creation of entanglement with trapped-ions. Creation of an entangled pair does not require discrete logic gates and thus could reduce the level of quantum-coherent control needed for large-scale QIP. Supported by IARPA, ARO contract No. EAO139840, ONR, and the NIST Quantum Information Program.

  9. Integrable dissipative exclusion process: Correlation functions and physical properties

    NASA Astrophysics Data System (ADS)

    Crampe, N.; Ragoucy, E.; Rittenberg, V.; Vanicat, M.

    2016-09-01

    We study a one-parameter generalization of the symmetric simple exclusion process on a one-dimensional lattice. In addition to the usual dynamics (where particles can hop with equal rates to the left or to the right with an exclusion constraint), annihilation and creation of pairs can occur. The system is driven out of equilibrium by two reservoirs at the boundaries. In this setting the model is still integrable: it is related to the open XXZ spin chain through a gauge transformation. This allows us to compute the full spectrum of the Markov matrix using Bethe equations. We also show that the stationary state can be expressed in a matrix product form permitting to compute the multipoints correlation functions as well as the mean value of the lattice and the creation-annihilation currents. Finally, the variance of the lattice current is computed for a finite-size system. In the thermodynamic limit, it matches the value obtained from the associated macroscopic fluctuation theory.

  10. Reflectance of topologically disordered photonic-crystal films

    NASA Astrophysics Data System (ADS)

    Vigneron, Jean-Pol; Lousse, Virginie M.; Biro, Laszlo P.; Vertesy, Zofia; Balint, Zolt

    2005-04-01

    Periodicity implies the creation of discretely diffracted beams while various departures from periodicity lead to broadened scattering angles. This effect is investigated for disturbed lattices exhibiting randomly varying periods. In the Born approximation, the diffused reflection is shown to be related to a pair correlation function constructed from the distribution of the film scattering power. The technique is first applied to a natural photonic crystal found on the ventral side of the wings of the butterfly Cyanophrys remus, where scanning electron microscopy reveals the formation of polycrystalline photonic structures. Second, the disorder in the distribution of the cross-ribs on the scales another butterfly, Lycaena virgaureae, is investigated. The irregular arrangement of scatterers found in chitin structure of this insect produces light reflection in the long-wavelength part of the visible range, with a quite unusual broad directionality. The use of the pair correlation function allows to propose estimates of the diffusive spreading in these very different systems.

  11. Simulations of "tunnelling of the 3rd kind"

    NASA Astrophysics Data System (ADS)

    Mou, Zong-Gang; Saffin, Paul M.; Tognarelli, Paul; Tranberg, Anders

    2017-07-01

    We consider the phenomenon of "tunnelling of the 3rd kind" [1], whereby a magnetic field may traverse a classically impenetrable barrier by pair creation of unimpeded quantum fermions. These propagate through the barrier and generate a magnetic field on the other side. We study this numerically using quantum fermions coupled to a classical Higgs-gauge system, where we set up a magnetic field outside a box shielded by two superconducting barriers. We examine the magnitude of the internal magnetic field, and find agreement with existing perturbative results within a factor of two.

  12. Preferential Nucleosome Assembly at DNA Triplet Repeats from the Myotonic Dystrophy Gene

    NASA Astrophysics Data System (ADS)

    Wang, Yuh-Hwa; Amirhaeri, Sorour; Kang, Seongman; Wells, Robert D.; Griffith, Jack D.

    1994-07-01

    The expansion of CTG repeats in DNA occurs in or near genes involved in several human diseases, including myotonic dystrophy and Huntington's disease. Nucleosomes, the basic structural element of chromosomes, consist of 146 base pairs of DNA coiled about an octamer of histone proteins and mediate general transcriptional repression. Electron microscopy was used to examine in vitro the nucleosome assembly of DNA containing repeating CTG triplets. The efficiency of nucleosome formation increased with expanded triplet blocks, suggesting that such blocks may repress transcription through the creation of stable nucleosomes.

  13. A model of the normal and null states of pulsars

    NASA Astrophysics Data System (ADS)

    Jones, P. B.

    1981-12-01

    A solvable three-dimensional polar cap model of pair creation and charged particle acceleration has been derived. There are no free parameters of significance apart from the polar surface magnetic flux density. The parameter determining the acceleration potential difference has been obtained by calculation of elementary nuclear and electromagnetic processes. Solutions of the model exist for both normal and null states of a pulsar, and the instability in the normal state leading to the normal to null transition has been identified. The predicted necessary condition for the transition is entirely consistent with observation.

  14. A model of the normal and null states of pulsars

    NASA Astrophysics Data System (ADS)

    Jones, P. B.

    A solvable three dimensional polar cap model of pair creation and charged particle acceleration is derived. There are no free parameters of significance apart from the polar surface magnetic flux density. The parameter CO determining the acceleration potential difference was obtained by calculation of elementary nuclear and electromagnetic processes. Solutions of the model exist for both normal and null states of a pulsar, and the instability in the normal state leading to the normal to null transition is identified. The predicted necessary condition for the transition is entirely consistent with observation.

  15. Pair production in low-energy collisions of uranium nuclei beyond the monopole approximation

    NASA Astrophysics Data System (ADS)

    Maltsev, I. A.; Shabaev, V. M.; Tupitsyn, I. I.; Kozhedub, Y. S.; Plunien, G.; Stöhlker, Th.

    2017-10-01

    A method for calculation of electron-positron pair production in low-energy heavy-ion collisions beyond the monopole approximation is presented. The method is based on the numerical solving of the time-dependent Dirac equation with the full two-center potential. The one-electron wave functions are expanded in the finite basis set constructed on the two-dimensional spatial grid. Employing the developed approach the probabilities of bound-free pair production are calculated for collisions of bare uranium nuclei at the energy near the Coulomb barrier. The obtained results are compared with the corresponding values calculated in the monopole approximation.

  16. Changes in flexibility upon binding: Application of the self-consistent pair contact probability method to protein-protein interactions

    NASA Astrophysics Data System (ADS)

    Canino, Lawrence S.; Shen, Tongye; McCammon, J. Andrew

    2002-12-01

    We extend the self-consistent pair contact probability method to the evaluation of the partition function for a protein complex at thermodynamic equilibrium. Specifically, we adapt the method for multichain models and introduce a parametrization for amino acid-specific pairwise interactions. This method is similar to the Gaussian network model but allows for the adjusting of the strengths of native state contacts. The method is first validated on a high resolution x-ray crystal structure of bovine Pancreatic Phospholipase A2 by comparing calculated B-factors with reported values. We then examine binding-induced changes in flexibility in protein-protein complexes, comparing computed results with those obtained from x-ray crystal structures and molecular dynamics simulations. In particular, we focus on the mouse acetylcholinesterase:fasciculin II and the human α-thrombin:thrombomodulin complexes.

  17. Universal fingerprinting chip server.

    PubMed

    Casique-Almazán, Janet; Larios-Serrato, Violeta; Olguín-Ruíz, Gabriela Edith; Sánchez-Vallejo, Carlos Javier; Maldonado-Rodríguez, Rogelio; Méndez-Tenorio, Alfonso

    2012-01-01

    The Virtual Hybridization approach predicts the most probable hybridization sites across a target nucleic acid of known sequence, including both perfect and mismatched pairings. Potential hybridization sites, having a user-defined minimum number of bases that are paired with the oligonucleotide probe, are first identified. Then free energy values are evaluated for each potential hybridization site, and if it has a calculated free energy of equal or higher negative value than a user-defined free energy cut-off value, it is considered as a site of high probability of hybridization. The Universal Fingerprinting Chip Applications Server contains the software for visualizing predicted hybridization patterns, which yields a simulated hybridization fingerprint that can be compared with experimentally derived fingerprints or with a virtual fingerprint arising from a different sample. The database is available for free at http://bioinformatica.homelinux.org/UFCVH/

  18. Surface code quantum communication.

    PubMed

    Fowler, Austin G; Wang, David S; Hill, Charles D; Ladd, Thaddeus D; Van Meter, Rodney; Hollenberg, Lloyd C L

    2010-05-07

    Quantum communication typically involves a linear chain of repeater stations, each capable of reliable local quantum computation and connected to their nearest neighbors by unreliable communication links. The communication rate of existing protocols is low as two-way classical communication is used. By using a surface code across the repeater chain and generating Bell pairs between neighboring stations with probability of heralded success greater than 0.65 and fidelity greater than 0.96, we show that two-way communication can be avoided and quantum information can be sent over arbitrary distances with arbitrarily low error at a rate limited only by the local gate speed. This is achieved by using the unreliable Bell pairs to measure nonlocal stabilizers and feeding heralded failure information into post-transmission error correction. Our scheme also applies when the probability of heralded success is arbitrarily low.

  19. On the correlations between the polyhedron eccentricity parameters and the bond-valence sums for the cations with one lone electron pair.

    PubMed

    Sidey, Vasyl

    2008-08-01

    Applicability of the Wang-Liebau polyhedron eccentricity parameter in the bond-valence model [Wang & Liebau (2007). Acta Cryst. B63, 216-228] has been found to be doubtful: the correlations between the values of the polyhedron eccentricity parameters and the bond-valence sums calculated for the cations with one lone electron pair are probably an artifact of the poorly determined bond-valence parameters.

  20. Compensatory Evolution of Intrinsic Transcription Terminators in Bacillus Cereus

    PubMed Central

    Safina, Ksenia R.; Mironov, Andrey A.

    2017-01-01

    Many RNA molecules possess complicated secondary structure critical to their function. Mutations in double-helical regions of RNA may disrupt Watson–Crick (WC) interactions causing structure destabilization or even complete loss of function. Such disruption can be compensated by another mutation restoring base pairing, as has been shown for mRNA, rRNA and tRNA. Here, we investigate the evolution of intrinsic transcription terminators between closely related strains of Bacillus cereus. While the terminator structure is maintained by strong natural selection, as evidenced by the low frequency of disrupting mutations, we observe multiple instances of pairs of disrupting-compensating mutations in RNA structure stems. Such two-step switches between different WC pairs occur very fast, consistent with the low fitness conferred by the intermediate non-WC variant. Still, they are not instantaneous, and probably involve transient fixation of the intermediate variant. The GU wobble pair is the most frequent intermediate, and remains fixed longer than other intermediates, consistent with its less disruptive effect on the RNA structure. Double switches involving non-GU intermediates are more frequent at the ends of RNA stems, probably because they are associated with smaller fitness loss. Together, these results show that the fitness landscape of bacterial transcription terminators is rather rugged, but that the fitness valleys associated with unpaired stem nucleotides are rather shallow, facilitating evolution. PMID:28201729

  1. Chirality Characterization of Dispersed Single Wall Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Namkung, Min; Williams, Phillip A.; Mayweather, Candis D.; Wincheski, Buzz; Park, Cheol; Namkung, Juock S.

    2005-01-01

    Raman scattering and optical absorption spectroscopy are used for the chirality characterization of HiPco single wall carbon nanotubes (SWNTs) dispersed in aqueous solution with the surfactant sodium dodecylbenzene sulfonate. Radial breathing mode (RBM) Raman peaks for semiconducting and metallic SWNTs are identified by directly comparing the Raman spectra with the Kataura plot. The SWNT diameters are calculated from these resonant peak positions. Next, a list of (n, m) pairs, yielding the SWNT diameters within a few percent of that obtained from each resonant peak position, is established. The interband transition energies for the list of SWNT (n, m) pairs are calculated based on the tight binding energy expression for each list of the (n, m) pairs, and the pairs yielding the closest values to the corresponding experimental optical absorption peaks are selected. The results reveal that (1, 11), (4, 11), and (0, 11) as the most probable chiralities of the semiconducting nanotubes. The results also reveal that (4, 16), (6, 12) and (8, 8) are the most probable chiralities for the metallic nanotubes. Directly relating the Raman scattering data to the optical absorption spectra, the present method is considered the simplest technique currently available. Another advantage of this technique is the use of the E(sup 8)(sub 11) peaks in the optical absorption spectrum in the analysis to enhance the accuracy in the results.

  2. Effects of fire on golden eagle territory occupancy and reproductive success

    USGS Publications Warehouse

    Kochert, Michael N.; Steenhof, Karen; Marzluff, J.M.; Carpenter, L.B.

    1999-01-01

    We examined effects of fire on golden eagle (Aquila chrysaetos) territory occupancy and reproductive success in southwestern Idaho because wildfires since 1980 have resulted in large-scale losses of shrub habitat in the Snake River Plain. Success (percentage of pairs that raised young) at burned territories declined after major fires (P = 0.004). Pairs in burned areas that could expand into adjacent vacant territories were as successful as pairs in unburned territories and more successful than pairs in burned territories that could not expand. Success at extensively burned territories was lowest 4-6 years after burning but increased 4-5 years later. The incidence and extent of fires did not help predict territories that would have low occupancy and success rates in postburn years. The presence of a vacant neighboring territory and the amount of agriculture and proportion of shrubs within 3 km of the nesting centroid best predicted probability of territory occupancy. Nesting success during preburn years best predicted the probability of a territory being successful in postburn years. Burned territories with high success rates during preburn years continued to have high success rates during postburn years, and those with low success in preburn years continued to be less successful after burning. In areas where much shrub habitat has been lost to fire, management for golden eagles should include active fire suppression and rehabilitation of burned areas.

  3. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

    PubMed

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

    2005-03-10

    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  4. Subthalamic nucleus long-range synchronization—an independent hallmark of human Parkinson's disease

    PubMed Central

    Moshel, Shay; Shamir, Reuben R.; Raz, Aeyal; de Noriega, Fernando R.; Eitan, Renana; Bergman, Hagai; Israel, Zvi

    2013-01-01

    Beta-band synchronous oscillations in the dorsolateral region of the subthalamic nucleus (STN) of human patients with Parkinson's disease (PD) have been frequently reported. However, the correlation between STN oscillations and synchronization has not been thoroughly explored. The simultaneous recordings of 2390 multi-unit pairs recorded by two parallel microelectrodes (separated by fixed distance of 2 mm, n = 72 trajectories with two electrode tracks >4 mm STN span) in 57 PD patients undergoing STN deep brain stimulation surgery were analyzed. Automatic procedures were utilized to divide the STN into dorsolateral oscillatory and ventromedial non-oscillatory regions, and to quantify the intensity of STN oscillations and synchronicity. Finally, the synchronicity of simultaneously vs. non-simultaneously recorded pairs were compared using a shuffling procedure. Synchronization was observed predominately in the beta range and only between multi-unit pairs in the dorsolateral oscillatory region (n = 615). In paired recordings between sites in the dorsolateral and ventromedial (n = 548) and ventromedial-ventromedial region pairs (n = 1227), no synchronization was observed. Oscillation and synchronicity intensity decline along the STN dorsolateral-ventromedial axis suggesting a fuzzy border between the STN regions. Synchronization strength was significantly correlated to the oscillation power, but synchronization was no longer observed following shuffling. We conclude that STN long-range beta oscillatory synchronization is due to increased neuronal coupling in the Parkinsonian brain and does not merely reflect the outcome of oscillations at similar frequency. The neural synchronization in the dorsolateral (probably the motor domain) STN probably augments the pathological changes in firing rate and patterns of subthalamic neurons in PD patients. PMID:24312018

  5. Facial recognition from volume-rendered magnetic resonance imaging data.

    PubMed

    Prior, Fred W; Brunsden, Barry; Hildebolt, Charles; Nolan, Tracy S; Pringle, Michael; Vaishnavi, S Neil; Larson-Prior, Linda J

    2009-01-01

    Three-dimensional (3-D) reconstructions of computed tomography (CT) and magnetic resonance (MR) brain imaging studies are a routine component of both clinical practice and clinical and translational research. A side effect of such reconstructions is the creation of a potentially recognizable face. The Health Insurance Portability and Accountability Act of 1996 (HIPAA) Privacy Rule requires that individually identifiable health information may not be used for research unless identifiers that may be associated with the health information including "Full face photographic images and other comparable images ..." are removed (de-identification). Thus, a key question is: Are reconstructed facial images comparable to full-face photographs for the purpose of identification? To address this question, MR images were selected from existing research repositories and subjects were asked to pair an MR reconstruction with one of 40 photographs. The chance probability that an observer could match a photograph with its 3-D MR image was 1 in 40 (0.025), and we considered 4 successes out of 40 (4/40, 0.1) to indicate that a subject could identify persons' faces from their 3-D MR images. Forty percent of the subjects were able to successfully match photographs with MR images with success rates higher than the null hypothesis success rate. The Blyth-Still-Casella 95% confidence interval for the 40% success rate was 29%-52%, and the 40% success rate was significantly higher ( P < 0.001) than our null hypothesis success rate of 1 in 10 (0.10).

  6. From Waves to Particle Tracks and Quantum Probabilities

    NASA Astrophysics Data System (ADS)

    Falkenburg, Brigitte

    Here, the measurement methods for identifying massive charged particles are investigated. They have been used from early cosmic ray studies up to the present day. Laws such as the classical Lorentz force and Einstein's relativistic kinematics were established before the rise of quantum mechanics. Later, it became crucial to measure the energy loss of charged particles in matter. In 1930, Bethe developed a semi-classical model based on the quantum mechanics of scattering. In the early 1930s, he and others calculated the passage of charged particles through matter including pair creation and bremsstrahlung. Due to missing trust in quantum electrodynamics, however, only semi-empirical methods were employed in order to estimate the mass and charge from the features of particle tracks. In 1932, Anderson inserted a lead plate into the cloud chamber in order to determine the flight direction and charge of the `positive electron'. In the 1940s, nuclear emulsions helped to resolve puzzles about particle identification and quantum electrodynamics. Later, the measurement theory was extended in a cumulative process by adding conservation laws for dynamic properties, probabilistic quantum formulas for resonances, scattering cross sections, etc. The measurement method was taken over from cosmic ray studies to the era of particle accelerators, and finally taken back from there to astroparticle physics. The measurement methods remained the same, but in the transition from particle to astroparticle physics the focus of interest shifted. Indeed, the experimental methods of both fields explore the grounds of `new physics' in complementary ways.

  7. The Bellagio Report: Cardiovascular risks of spaceflight: implications for the future of space travel.

    PubMed

    Sides, Marian B; Vernikos, Joan; Convertino, Victor A; Stepanek, Jan; Tripp, Lloyd D; Draeger, Jorg; Hargens, Alan R; Kourtidou-Papadeli, Chrysoula; Pavy-LeTraon, Anne; Russomano, Thais; Wong, Julielynn Y; Buccello, Regina R; Lee, Peter H; Nangalia, Vishal; Saary, M Joan

    2005-09-01

    Long-duration space missions, as well as emerging civilian tourist space travel activities, prompted review and assessment of data available to date focusing on cardiovascular risk and available risk mitigation strategies. The goal was the creation of tools for risk priority assessments taking into account the probability of the occurrence of an adverse cardiovascular event and available and published literature from spaceflight data as well as available risk mitigation strategies. An international group of scientists convened in Bellagio, Italy, in 2004 under the auspices of the Aerospace Medical Association to review available literature for cardiac risks identified in the Bioastronautics Critical Path Roadmap (versions 2000, 2004). This effort led to the creation of a priority assessment framework to allow for an objective assessment of the hazard, probability of its occurrence, mission impact, and available risk mitigation measures. Spaceflight data are presented regarding evidence/ no evidence of cardiac dysrhythmias, cardiovascular disease, and cardiac function as well as orthostatic intolerance, exercise capacity, and peripheral resistance in presyncopal astronauts compared to non-presyncopal astronauts. Assessment of the priority of different countermeasures was achieved with a tabular framework with focus on probability of occurrence, mission impact, compliance, practicality, and effectiveness of countermeasures. Special operational settings and circumstances related to sensitive portions of any mission and the impact of environmental influences on mission effectiveness are addressed. The need for development of diagnostic tools, techniques, and countermeasure devices, food preparation, preservation technologies and medication, as well as an infrastructure to support these operations are stressed. Selected countermeasure options, including artificial gravity and pharmacological countermeasures need to be systematically evaluated and validated in flight, especially after long-duration exposures. Data need to be collected regarding the emerging field of suborbital and orbital civilian space travel, to allow for sound risk assessment.

  8. Phase transitions in Nowak Sznajd opinion dynamics

    NASA Astrophysics Data System (ADS)

    Wołoszyn, Maciej; Stauffer, Dietrich; Kułakowski, Krzysztof

    2007-05-01

    The Nowak modification of the Sznajd opinion dynamics model on the square lattice assumes that with probability β the opinions flip due to mass-media advertising from down to up, and vice versa. Besides, with probability α the Sznajd rule applies that a neighbour pair agreeing in its two opinions convinces all its six neighbours of that opinion. Our Monte Carlo simulations and mean-field theory find sharp phase transitions in the parameter space.

  9. Noise thresholds for optical quantum computers.

    PubMed

    Dawson, Christopher M; Haselgrove, Henry L; Nielsen, Michael A

    2006-01-20

    In this Letter we numerically investigate the fault-tolerant threshold for optical cluster-state quantum computing. We allow both photon loss noise and depolarizing noise (as a general proxy for all local noise), and obtain a threshold region of allowed pairs of values for the two types of noise. Roughly speaking, our results show that scalable optical quantum computing is possible for photon loss probabilities <3 x 10(-3), and for depolarization probabilities <10(-4).

  10. A formal framework of scenario creation and analysis of extreme hydrological events

    NASA Astrophysics Data System (ADS)

    Lohmann, D.

    2007-12-01

    We are presenting a formal framework for a hydrological risk analysis. Different measures of risk will be introduced, such as average annual loss or occurrence exceedance probability. These are important measures for e.g. insurance companies to determine the cost of insurance. One key aspect of investigating the potential consequences of extreme hydrological events (floods and draughts) is the creation of meteorological scenarios that reflect realistic spatial and temporal patterns of precipitation that also have correct local statistics. 100,000 years of these meteorological scenarios are used in a calibrated rainfall-runoff-flood-loss-risk model to produce flood and draught events that have never been observed. The results of this hazard model are statistically analyzed and linked to socio-economic data and vulnerability functions to show the impact of severe flood events. We are showing results from the Risk Management Solutions (RMS) Europe Flood Model to introduce this formal framework.

  11. The implications of the discovery of extra-terrestrial life for religion.

    PubMed

    Peters, Ted

    2011-02-13

    This paper asks about the future of religion: (i) Will confirmation of extra-terrestrial intelligence (ETI) cause terrestrial religion to collapse? 'No' is the answer based upon a summary of the 'Peters ETI Religious Crisis Survey'. Then the paper examines four specific challenges to traditional doctrinal belief likely to be raised at the detection of ETI: (ii) What is the scope of God's creation? (iii) What can we expect regarding the moral character of ETI? (iv) Is one earthly incarnation in Jesus Christ enough for the entire cosmos, or should we expect multiple incarnations on multiple planets? (v) Will contact with more advanced ETI diminish human dignity? More than probable contact with extra-terrestrial intelligence will expand the Bible's vision so that all of creation--including the 13.7 billion year history of the universe replete with all of God's creatures--will be seen as the gift of a loving and gracious God.

  12. Creating and Selling Embryos for “Donation”: Ethical Challenges

    PubMed Central

    Klitzman, Robert; Sauer, Mark V.

    2015-01-01

    The commercial creation and sale of embryos has begun, posing a series of ethical questions that have received little scholarly attention. Some of the concerns that arise are similar to those posed by the sale of gametes, while other issues differ markedly. Questions emerge, firstly, regarding the rights of the unborn children – their ability to know their biological parents. Companies that create human embryos de novo may wish to keep gamete providers anonymous. Many of these offspring will thus never learn that their parents are not their biological parents. Yet, such disclosures – regarding not only one, but both of these biological parents – may be important for these individuals; and lack of this knowledge may impede their physical and psychological health. Secondly, questions surface regarding the fees that providers should charge for embryos, and whether these amounts should vary based on the traits of one or both of the gamete donors. Some prospective parents may seek specific traits in a baby (e.g., height or eye/hair coloring), prompting creation of embryos from two gamete donors who possess these characteristics. Thirdly, ownership of embryos created without an advanced directive by patients poses dilemmas – e.g., disposition of any remaining embryos. Fourthly, guidelines do not yet exist to limit the number of embryos sold from each pair of gamete donors. Hence, unbeknownst to each other, full siblings could potentially meet, get married and procreate. This discussion has several critical implications for future practice, and professional education and policy. Patients with diseases associated with genetic tests may well ask obstetricians, gynecologists and other physicians about these techniques and practices. Clinicians can refer such patients to Assisted Reproductive Technology specialists, but familiarity with the basic aspects of the issues and complexities involved could aid themselves and their patients Several of these issues can be relatively easily addressed through guidelines from professional associations (e.g., limiting the number of embryos sold from each pair of gamete donors). As creation and sales of embryos will likely spread, consideration of appropriate responses is critical in order to establish standards of care to help the future offspring, and ensure ongoing public trust. PMID:25448512

  13. Creating and selling embryos for "donation": ethical challenges.

    PubMed

    Klitzman, Robert; Sauer, Mark V

    2015-02-01

    The commercial creation and sale of embryos has begun, which poses a series of ethical questions that have received little scholarly attention. Some of the concerns that arise are similar to those posed by the sale of gametes, while other issues differ markedly. Questions emerge, first, regarding the rights of the unborn children and their ability to know their biological parents. Companies that create human embryos de novo may wish to keep gamete providers anonymous. Many of these offspring thus will never learn that their parents are not their biologic parents. Yet, such disclosures, regarding not only one but both of these biologic parents, may be important for these individuals; and a lack of this knowledge may impede their physical and psychological health. Second, questions surface regarding the fees that providers should charge for embryos and whether these amounts should vary based on the traits of 1 or both of the gamete donors. Some prospective parents may seek specific traits in a baby (eg, height or eye/hair coloring), which prompts the creation of embryos from 2 gamete donors who possess these characteristics. Third, ownership of embryos created without an advanced directive by patients poses dilemmas (eg, disposition of any remaining embryos). Fourth, guidelines do not yet exist to limit the number of embryos sold from each pair of gamete donors. Hence, unbeknownst to each other, full siblings could potentially meet, get married, and procreate. This discussion has several critical implications for future practice and professional education and policy. Patients with diseases associated with genetic tests may well ask obstetricians, gynecologists, and other physicians about these techniques and practices. Clinicians can refer such patients to assisted reproductive technology specialists; however, familiarity with the basic aspects of the issues and complexities involved could aid these providers and their patients Several of these issues can be addressed relatively easily through guidelines from professional associations (eg, limiting the number of embryos sold from each pair of gamete donors). Because creation and sales of embryos will likely spread, consideration of appropriate responses is critical to establish standards of care to help the future offspring, and ensure ongoing public trust. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Fitness consequences of nest desertion in an endangered host, the least Bell's vireo

    USGS Publications Warehouse

    Kus, Barbara E.

    2002-01-01

    Recent analyses of the impact of cowbird parasitism on host productivity suggest that while parasitism reduces productivity on a per-nest basis, the ability of pairs to desert parasitized nests and renest allows them to achieve productivity comparable to that of unparasitized pairs. This has implications for the management of several endangered species that are highly vulnerable to parasitism and consequently the target of cowbird control programs. I calculated seasonal nesting effort (number of nests per pair) and productivity of 568 pairs of Least Bell's Vireos (Vireo bellii pusillus) monitored over 11 years at the San Luis Rey River in San Diego County, California (where cowbird trapping has reduced, but not eliminated, parasitism), assigning pairs to one of three groups: (1) deserters, (2) rescued (parasitized pairs with nests “rescued” from probable failure by the removal of cowbird eggs), and (3) unparasitized. Parasitized pairs attempted significantly more nests per season than did unparasitized pairs, with deserters producing more nests than rescued pairs. However, productivity of deserting pairs was significantly lower than that of both rescued and unparasitized pairs, largely because subsequent nests of deserting pairs were also parasitized. Seasonal productivity of rescued and unparasitized pairs was comparable, indicating that in this species, reduction of cowbird impacts through nest manipulation to remove cowbird eggs is effective. Desertion by Least Bell's Vireos does not appear to be an adequate natural defense against parasitism, suggesting the need for continued cowbird control while vireo populations are re-established.

  15. Rapid creation of distant entanglement by multi-photon resonant fluorescence

    NASA Astrophysics Data System (ADS)

    Cohen, Guy Z.; Sham, L. J.

    2014-03-01

    We study a simple, effective and robust method for entangling two separate stationary quantum dot spin qubits with high fidelity using multi-photon Gaussian state. The fluorescence signals from the two dots interfere at a beam splitter. The bosonic nature of photons leads, in analogy with the Hong-Ou-Mandel (HOM) effect, to selective pairing of photon holes (photon absences in the fluorescent signals). By the HOM effect, two photon holes with the same polarization end up at the same beam splitter output. As a result, two odd photon number detections at the outgoing beams, which must correspond to two photon holes with different polarizations, herald entanglement creation. The robustness of the Gaussian states is evidenced by the ability to compensate for photon absorption and noise by a moderate increase in the number of photons at the input. We calculate the entanglement generation rate in the ideal, non-ideal and near-ideal detector regimes and find substantial improvement over single-photon schemes in all three regimes. Fast and efficient spin-spin entanglement creation can form the basis for a scalable quantum dot quantum computing network. Our predictions can be tested using current experimental capabilities. This research was supported by the U.S. Army Research Office MURI award W911NF0910406, by NSF grant PHY-1104446 and by ARO (IARPA, W911NF-08-1-0487). The authors thank D. G. Steel for useful discussions.

  16. Financial obligations and economic barriers to antiretroviral therapy experienced by HIV positive women who participated in a job-creation programme in northern Uganda

    PubMed Central

    Dovel, Kathryn; Thompson, Kallie

    2016-01-01

    Economic costs are commonly cited as barriers to women’s use of antiretroviral therapy (ART) in sub-Saharan Africa; however, little is known about how changes in women’s income influence economic barriers to care. We analysed in-depth interviews with 17 HIV positive women who participated in a job-creation programme in northern Uganda and two key informant interviews with programme staff to examine lingering economic barriers to care experienced after programme enrolment. We found that participants continued to experience economic barriers even after receiving steady a income and improving their economic status. Two themes emerged: first, limited resources in health facilities (e.g., drug and staff shortages) led participants to view ART utilisation as a primarily economic endeavour where clients made informal payments for prompter services or sought treatment in private facilities where ART was readily available; second, increased economic status also increased expectations of economic reciprocity among participants’ social networks. Financial obligations often manifested in the form of caring for additional dependents, limiting the resources women could allocate toward their HIV treatment. When paired with limited resources in health facilities, increased financial obligations perpetuated the economic barriers to care experienced by participants. Job-creation programmes should consider how health institutions interact with participants’ financial obligations to influence women’s access to HIV services. PMID:26652011

  17. Financial obligations and economic barriers to antiretroviral therapy experienced by HIV-positive women who participated in a job-creation programme in northern Uganda.

    PubMed

    Dovel, Kathryn; Thomson, Kallie

    2016-01-01

    Economic costs are commonly cited as barriers to women's use of antiretroviral therapy (ART) in sub-Saharan Africa; however, little is known about how changes in women's income influence economic barriers to care. We analysed in-depth interviews with 17 HIV-positive women who participated in a job-creation programme in northern Uganda and two key informant interviews with programme staff to examine lingering economic barriers to care experienced after programme enrollment. We found that participants continued to experience economic barriers even after receiving a steady income and improving their economic status. Two themes emerged: first, limited resources in health facilities (e.g. drug and staff shortages) led participants to view ART utilisation as a primarily economic endeavour where clients made informal payments for prompter service or sought treatment in private facilities where ART was readily available; second, increased economic status among participants increased expectations of economic reciprocity among participants' social networks. Financial obligations often manifested themselves in the form of caring for additional dependents, limiting the resources women could allocate toward their HIV treatment. When paired with limited resources in health facilities, increased financial obligations perpetuated the economic barriers experienced by participants. Job-creation programmes should consider how health institutions interact with participants' financial obligations to influence women's access to HIV services.

  18. Changes in Keratocyte Density and Visual Function Five Years after Laser in situ Keratomileusis: Femtosecond Laser vs Mechanical Microkeratome

    PubMed Central

    McLaren, Jay W.; Bourne, William M.; Maguire, Leo J.; Patel, Sanjay V.

    2015-01-01

    Purpose To determine the effects of keratocyte loss on optical properties and vision after laser in situ keratomileusis (LASIK) with the flap created with a femtosecond laser or a mechanical microkeratome. Design Randomized clinical paired-eye study. Methods Both eyes of 21 patients received LASIK for myopia or myopic astigmatism. One eye of each patient was randomized by ocular dominance to flap creation with a femtosecond laser and the other eye to flap creation with a mechanical microkeratome. Before LASIK and at 1, 3, 6 months and 1, 3, and 5 years after LASIK, keratocyte density was measured by using confocal microscopy, and high-contrast visual acuity and anterior corneal wavefront aberrations were measured by standard methods. At each visit, all variables were compared between methods of creating the flap and to the same variable before treatment by using paired tests with Bonferroni correction for multiple comparisons. Results Keratocyte density in the flap decreased by 20% during the first year after LASIK and remained low through 5 years (p<0.001). High-order wavefront aberrations increased and uncorrected visual acuity improved immediately after surgery but these variables did not change further to five years. There were no differences in any variables between treatments. Conclusions A sustained reduction in keratocyte density does not affect vision or optical properties of the cornea through 5 years after LASIK. The method of creating a LASIK flap does not influence the changes in keratocyte density in the flap. PMID:25868758

  19. Decay of the de Sitter vacuum

    NASA Astrophysics Data System (ADS)

    Anderson, Paul R.; Mottola, Emil; Sanders, Dillon H.

    2018-03-01

    The decay rate of the Bunch-Davies state of a massive scalar field in the expanding flat spatial sections of de Sitter space is determined by an analysis of the particle pair creation process in real time. The Feynman definition of particle and antiparticle Fourier mode solutions of the scalar wave equation and their adiabatic phase analytically continued to the complexified time domain show conclusively that the Bunch-Davies state is not the vacuum state at late times. The closely analogous creation of charged particle pairs in a uniform electric field is reviewed and Schwinger's result for the vacuum decay rate is recovered by this same real time analysis. The vacuum decay rate in each case is also calculated by switching the background field on adiabatically, allowing it to act for a very long time, and then adiabatically switching it off again. In both the uniform electric field and de Sitter cases, the particles created while the field is switched on are verified to be real, in the sense that they persist in the final asymptotic flat zero-field region. In the de Sitter case, there is an interesting residual dependence of the rate on how the de Sitter phase is ended, indicating a greater sensitivity to spatial boundary conditions. The electric current of the created particles in the E -field case and their energy density and pressure in the de Sitter case are also computed, and the magnitude of their backreaction effects on the background field estimated. Possible consequences of the Hubble scale instability of the de Sitter vacuum for cosmology, vacuum dark energy, and the cosmological "constant" problem are discussed.

  20. Changes in beta-actin mRNA expression in remodeling canine myocardium.

    PubMed

    Carlyle, W C; Toher, C A; Vandervelde, J R; McDonald, K M; Homans, D C; Cohn, J N

    1996-01-01

    Beta-actin, a cytoskeletal protein important in the maintenance of cytoarchitecture, has long been thought to be expressed constitutively in myocardial tissue. As such, beta-actin mRNA has been used as a control gene in a wide range of experiments. However, we have uncovered consistent changes in beta-actin mRNA expression in canine myocardium remodeling as a result of insult to the left ventricle. The experimental canine models used were either DC shock damage to the left ventricle or volume overload resulting from severe mitral regurgitation. The remodeling process in both canine models is characterized by an increase in left ventricular mass. PCR amplification using primers designed to selectively amplify the 3' end and a portion of the 3' untranslated region of beta-actin mRNA resulted in the generation of a 297 base pair product predominant only in normal canine myocardium and a 472 base pair product that became increasingly prominent from 1 to 30 days after DC shock damage to the left ventricle and from 10 to 90 days after creation of mitral regurgitation. Northern analysis showed a three-fold increase in beta-actin mRNA after either DC shock or creation of mitral regurgitation. Western analysis revealed an early increase in beta-actin protein followed by an apparent decrease to below baseline levels. These observations suggest that changes in beta-actin mRNA expression accompany the structural alterations that occur in response to myocardial damage. Whether or not the changes in beta-actin mRNA expression play a role in mediating these structural alterations remains to be determined.

  1. Physical constraints of cultural evolution of dialects in killer whales.

    PubMed

    Filatova, Olga A; Samarra, Filipa I P; Barrett-Lennard, Lance G; Miller, Patrick J O; Ford, John K B; Yurk, Harald; Matkin, Craig O; Hoyt, Erich

    2016-11-01

    Odontocete sounds are produced by two pairs of phonic lips situated in soft nares below the blowhole; the right pair is larger and is more likely to produce clicks, while the left pair is more likely to produce whistles. This has important implications for the cultural evolution of delphinid sounds: the greater the physical constraints, the greater the probability of random convergence. In this paper the authors examine the call structure of eight killer whale populations to identify structural constraints and to determine if they are consistent among all populations. Constraints were especially pronounced in two-voiced calls. In the calls of all eight populations, the lower component of two-voiced (biphonic) calls was typically centered below 4 kHz, while the upper component was typically above that value. The lower component of two-voiced calls had a narrower frequency range than single-voiced calls in all populations. This may be because some single-voiced calls are homologous to the lower component, while others are homologous to the higher component of two-voiced calls. Physical constraints on the call structure reduce the possible variation and increase the probability of random convergence, producing similar calls in different populations.

  2. Looking and listening for learning in arts- and humanities-based creations.

    PubMed

    Varpio, Lara; Grassau, Pamela; Hall, Pippa

    2017-02-01

    The arts and humanities are gradually gaining a foothold in health professions education as a means of supporting the development of future clinicians who are compassionate, critical and reflexive thinkers, while also strengthening clinical skills and practices that emphasise patient-centredness, collaboration and interprofessional practices. Assignments that tap into trainee creativity are increasingly used both to prepare learners for the demands of clinical work and to understand the personal and professional challenges learners face in these contexts. Health professions educators need methods for interpreting these creations in order to understand each learner's expressions. This paper describes two theoretical frameworks that can be used to understand trainees' unique learning experiences as they are expressed in arts- and humanities-based creations. The authors introduce the philosophical underpinnings and interpretation procedures of two theoretical frameworks that enable educators to 'hear' and 'see' the multilayered expressions embedded within arts- and humanities-based student creations: Gilligan's Listening Guide and Kress and van Leeuwen's approach to visual rhetoric. To illustrate how these frameworks can be used, the authors apply them to two creative summaries that learners made as part of a humanities-informed, interprofessional education intervention that took place in a non-acute-care teaching hospital. The interpretations of two creative summaries, a poem and a pair of paintings, highlight how applying these theoretical frameworks can offer important insights into learners' experiences. This cross-cutting edge paper describes how the Listening Guide and visual rhetoric can help health professions educators listen to and read the arts- and humanities-based creative expressions made by learners. Insights gained from these interpretations can advance the understanding of students' personal experiences in different learning environments and can inform curriculum development. © 2016 John Wiley & Sons Ltd and The Association for the Study of Medical Education.

  3. Exploring the cross-level impact of market orientation on nursing innovation in hospitals.

    PubMed

    Weng, Rhay-Hung; Huang, Ching-Yuan; Lin, Tzu-En

    2013-01-01

    Recently, many hospitals have been enthusiastically encouraging nurses to pursue nursing innovation to improve health care quality and increase nursing productivity by proposing innovative training methods, products, services, care skills, and care methods. This study tried to explore the cross-level impact of market orientation on nursing innovation. In our study, 3 to 7 nurses and 1 manager were selected from each nursing team to act as respondents. The questionnaire survey began after the managers of each nursing team and the nurses had been anonymously coded and paired up in Taiwan in 2009-2010. A total of 808 valid questionnaires were collected, including 172 valid teams. Hierarchical linear modeling was used for the analysis. Nursing innovation is the sum of knowledge creation, innovation behavior, and innovation diffusion displayed by the nurses during nursing care. The level of knowledge creation, as perceived by the nurses, was the highest, whereas the level of innovation diffusion was the lowest. Results of hierarchical linear modeling showed that only competitor orientation yielded a significant positive influence on knowledge creation, innovation behavior, or innovation diffusion. The r values were 0.53, 0.49, and 0.61, respectively. Customer orientation and interfunctional coordination did not have significant effects on nursing innovation. Hospital nurses exhibited better performance in knowledge creation than in innovation behavior and diffusion. Only competitor orientation had a significantly positive and cross-level influence on nursing innovation. However, competitor orientation was observed to be the lowest dimension of market orientation, which indicates that this factor should be the focus when improving nursing innovations in the future. Therefore, managers should continually understand the strategies, advantages, and methods of their competitors.

  4. Studies of Positron Generation from Ultraintense Laser-Matter Interactions

    NASA Astrophysics Data System (ADS)

    Williams, Gerald Jackson

    Laser-produced pair jets possess unique characteristics that offer great potential for their use in laboratory-astrophysics experiments to study energetic phenomenon such as relativistic shock accelerations. High-flux, high-energy positron sources may also be used to study relativistic pair plasmas and useful as novel diagnostic tools for high energy density conditions. Copious amounts of positrons are produced with MeV energies from directly irradiating targets with ultraintense lasers where relativistic electrons, accelerated by the laser field, drive positron-electron pair production. Alternatively, laser wakefield accelerated electrons can produce pairs by the same mechanisms inside a secondary converter target. This dissertation describes a series of novel experiments that investigate the characteristics and scaling of pair production from ultraintense lasers, which are designed to establish a robust platform for laboratory-based relativistic pair plasmas. Results include a simple power-law scaling to estimate the effective positron yield for elemental targets for any Maxwellian electron source, typical of direct laser-target interactions. To facilitate these measurements, a solenoid electromagnetic coil was constructed to focus emitted particles, increasing the effective collection angle of the detector and enabling the investigation of pair production from thin targets and low-Z materials. Laser wakefield electron sources were also explored as a compact, high repetition rate platform for the production of high energy pairs with potential applications to the creation of charge-neutral relativistic pair plasmas. Plasma accelerators can produce low-divergence electron beams with energies approaching a GeV at Hz frequencies. It was found that, even for high-energy positrons, energy loss and scattering mechanisms in the target create a fundamental limit to the divergence and energy spectrum of the emitted positrons. The potential future application of laser-generated pairs was considered by exploring the feasibility of radiographing an imploding inertial confinement fusion capsule at ignition- relevant conditions. For an in-flight areal density of 0.02-0.2 g/cm2, currently available positron sources can make density and spatial measurements of deuterium-tritium fuel cores where additional complications of full-scale experiments are expected to reduce the measurement sensitivity.

  5. Modeling of site occupancy dynamics for northern spotted owls, with emphasis on the effects of barred owls

    USGS Publications Warehouse

    Olson, Gail S.; Anthony, Robert G.; Forsman, Eric D.; Ackers, Steven H.; Loschl, Peter J.; Reid, Janice A.; Dugger, Katie M.; Glenn, Elizabeth M.; Ripple, William J.

    2005-01-01

    Northern spotted owls (Strix occidentalis caurina) have been studied intensively since their listing as a threatened species by the U.S. Fish and Wildlife Service in 1990. Studies of spotted owl site occupancy have used various binary response measures, but most of these studies have made the assumption that detectability is perfect, or at least high and not variable. Further, previous studies did not consider temporal variation in site occupancy. We used relatively new methods for open population modeling of site occupancy that incorporated imperfect and variable detectability of spotted owls and allowed modeling of temporal variation in site occupancy, extinction, and colonization probabilities. We also examined the effects of barred owl (S. varia) presence on these parameters. We used spotted owl survey data from 1990 to 2002 for 3 study areas in Oregon, USA, and we used program MARK to develop and analyze site occupancy models. We found per visit detection probabilities averaged <0.70 and were highly variable among study years and study areas. Site occupancy probabilities for owl pairs declined greatly on 1 study area and slightly on the other 2 areas. For all owls, including singles and pairs, site occupancy was mostly stable through time. Barred owl presence had a negative effect on spotted owl detection probabilities, and it had either a positive effect on local-extinction probabilities or a negative effect on colonization probabilities. We conclude that further analyses of spotted owls must account for imperfect and variable detectability and barred owl presence to properly interpret results. Further, because barred owl presence is increasing within the range of northern spotted owls, we expect to see further declines in the proportion of sites occupied by spotted owls.

  6. The Origin of Complex Quantum Amplitudes

    NASA Astrophysics Data System (ADS)

    Goyal, Philip; Knuth, Kevin H.; Skilling, John

    2009-12-01

    Physics is real. Measurement produces real numbers. Yet quantum mechanics uses complex arithmetic, in which √-1 is necessary but mysteriously relates to nothing else. By applying the same sort of symmetry arguments that Cox [1, 2] used to justify probability calculus, we are now able to explain this puzzle. The dual device/object nature of observation requires us to describe the world in terms of pairs of real numbers about which we never have full knowledge. These pairs combine according to complex arithmetic, using Feynman's rules.

  7. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs

    PubMed Central

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-01-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network. PMID:28763014

  8. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

    PubMed

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-08-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

  9. Secondary structure of the 3'-noncoding region of flavivirus genomes: comparative analysis of base pairing probabilities.

    PubMed

    Rauscher, S; Flamm, C; Mandl, C W; Heinz, F X; Stadler, P F

    1997-07-01

    The prediction of the complete matrix of base pairing probabilities was applied to the 3' noncoding region (NCR) of flavivirus genomes. This approach identifies not only well-defined secondary structure elements, but also regions of high structural flexibility. Flaviviruses, many of which are important human pathogens, have a common genomic organization, but exhibit a significant degree of RNA sequence diversity in the functionally important 3'-NCR. We demonstrate the presence of secondary structures shared by all flaviviruses, as well as structural features that are characteristic for groups of viruses within the genus reflecting the established classification scheme. The significance of most of the predicted structures is corroborated by compensatory mutations. The availability of infectious clones for several flaviviruses will allow the assessment of these structural elements in processes of the viral life cycle, such as replication and assembly.

  10. The ambivalent effect of lattice structure on a spatial game

    NASA Astrophysics Data System (ADS)

    Zhang, Hui; Gao, Meng; Li, Zizhen; Maa, Zhihui; Wang, Hailong

    2011-06-01

    The evolution of cooperation is studied in lattice-structured populations, in which each individual who adopts one of the following strategies ‘always defect' (ALLD), ‘tit-for-tat' (TFT), and ‘always cooperate' (ALLC) plays the repeated Prisoner's Dilemma game with its neighbors according to an asynchronous update rule. Computer simulations are applied to analyse the dynamics depending on major parameters. Mathematical analyses based on invasion probability analysis, mean-field approximation, as well as pair approximation are also used. We find that the lattice structure promotes the evolution of cooperation compared with a non-spatial population, this is also confirmed by invasion probability analysis in one dimension. Meanwhile, it also inhibits the evolution of cooperation due to the advantage of being spiteful, which indicates the key role of specific life-history assumptions. Mean-field approximation fails to predict the outcome of computer simulations. Pair approximation is accurate in two dimensions but fails in one dimension.

  11. Modelling human mobility patterns using photographic data shared online.

    PubMed

    Barchiesi, Daniele; Preis, Tobias; Bishop, Steven; Moat, Helen Susannah

    2015-08-01

    Humans are inherently mobile creatures. The way we move around our environment has consequences for a wide range of problems, including the design of efficient transportation systems and the planning of urban areas. Here, we gather data about the position in space and time of about 16 000 individuals who uploaded geo-tagged images from locations within the UK to the Flickr photo-sharing website. Inspired by the theory of Lévy flights, which has previously been used to describe the statistical properties of human mobility, we design a machine learning algorithm to infer the probability of finding people in geographical locations and the probability of movement between pairs of locations. Our findings are in general agreement with official figures in the UK and on travel flows between pairs of major cities, suggesting that online data sources may be used to quantify and model large-scale human mobility patterns.

  12. Modelling human mobility patterns using photographic data shared online

    PubMed Central

    Barchiesi, Daniele; Preis, Tobias; Bishop, Steven; Moat, Helen Susannah

    2015-01-01

    Humans are inherently mobile creatures. The way we move around our environment has consequences for a wide range of problems, including the design of efficient transportation systems and the planning of urban areas. Here, we gather data about the position in space and time of about 16 000 individuals who uploaded geo-tagged images from locations within the UK to the Flickr photo-sharing website. Inspired by the theory of Lévy flights, which has previously been used to describe the statistical properties of human mobility, we design a machine learning algorithm to infer the probability of finding people in geographical locations and the probability of movement between pairs of locations. Our findings are in general agreement with official figures in the UK and on travel flows between pairs of major cities, suggesting that online data sources may be used to quantify and model large-scale human mobility patterns. PMID:26361545

  13. Upper bounds on the error probabilities and asymptotic error exponents in quantum multiple state discrimination

    NASA Astrophysics Data System (ADS)

    Audenaert, Koenraad M. R.; Mosonyi, Milán

    2014-10-01

    We consider the multiple hypothesis testing problem for symmetric quantum state discrimination between r given states σ1, …, σr. By splitting up the overall test into multiple binary tests in various ways we obtain a number of upper bounds on the optimal error probability in terms of the binary error probabilities. These upper bounds allow us to deduce various bounds on the asymptotic error rate, for which it has been hypothesized that it is given by the multi-hypothesis quantum Chernoff bound (or Chernoff divergence) C(σ1, …, σr), as recently introduced by Nussbaum and Szkoła in analogy with Salikhov's classical multi-hypothesis Chernoff bound. This quantity is defined as the minimum of the pairwise binary Chernoff divergences min _{j

  14. Cooling a quantum oscillator: A useful analogy to understand laser cooling as a thermodynamical process

    NASA Astrophysics Data System (ADS)

    Freitas, Nahuel; Paz, Juan Pablo

    2018-03-01

    We analyze the lowest achievable temperature for a mechanical oscillator coupled with a quantum refrigerator composed of a parametrically driven system that is in contact with a bosonic reservoir where the energy is dumped. We show that the cooling of the oscillator (achieved by the resonant transport of its phonon excitations into the environment) is always stopped by a fundamental heating process that is dominant at sufficiently low temperatures. This process can be described as the nonresonant production of excitation pairs. This result is in close analogy with the recent study that showed that pair production is responsible for enforcing the validity of the dynamical version of the third law of thermodynamics [Phys. Rev. E 95, 012146 (2017), 10.1103/PhysRevE.95.012146]. Interestingly, we relate our model to the ones used to describe laser cooling of a single trapped ion reobtaining the correct limiting temperatures for the regimes of resolved and nonresolved sidebands. We show that the limiting temperature for laser cooling is achieved when the cooling transitions induced by the resonant transport of excitations from the motion into the electromagnetic environment is compensated by the heating transitions induced by the creation of phonon-photon pairs.

  15. Pair Production Constraints on Superluminal Neutrinos Revisited

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brodsky, Stanley J.; /SLAC; Gardner, Susan

    2012-02-16

    We revisit the pair creation constraint on superluminal neutrinos considered by Cohen and Glashow in order to clarify which types of superluminal models are constrained. We show that a model in which the superluminal neutrino is effectively light-like can evade the Cohen-Glashow constraint. In summary, any model for which the CG pair production process operates is excluded because such timelike neutrinos would not be detected by OPERA or other experiments. However, a superluminal neutrino which is effectively lightlike with fixed p{sup 2} can evade the Cohen-Glashow constraint because of energy-momentum conservation. The coincidence involved in explaining the SN1987A constraint certainlymore » makes such a picture improbable - but it is still intrinsically possible. The lightlike model is appealing in that it does not violate Lorentz symmetry in particle interactions, although one would expect Hughes-Drever tests to turn up a violation eventually. Other evasions of the CG constraints are also possible; perhaps, e.g., the neutrino takes a 'short cut' through extra dimensions or suffers anomalous acceleration in matter. Irrespective of the OPERA result, Lorentz-violating interactions remain possible, and ongoing experimental investigation of such possibilities should continue.« less

  16. Individualized Levels System and Systematic Stimulus Pairing to Reduce Multiply Controlled Aggression of a Child With Autism Spectrum Disorder.

    PubMed

    Randall, Kayla R; Lambert, Joseph M; Matthews, Mary P; Houchins-Juarez, Nealetta J

    2018-05-01

    Research has shown that physical aggression is common in individuals with autism spectrum disorder (ASD). Interventions for multiply controlled aggression may be complex and difficult to implement with fidelity. As a result, the probability of treatment efficacy for this class of behavior may suffer. We designed an individualized levels system to reduce the physical aggression of an 11-year-old female with ASD. We then employed a systematic stimulus pairing procedure to facilitate generalization. Results suggest individualized levels systems can suppress multiply controlled aggression and that systematic stimulus pairing is an effective way to transfer treatment effects from trained therapists to caregivers.

  17. Pair production in classical Stueckelberg-Horwitz-Piron electrodynamics

    NASA Astrophysics Data System (ADS)

    Land, Martin

    2015-05-01

    We calculate pair production from bremsstrahlung as a classical effect in Stueckelberg-Horwitz electrodynamics. In this framework, worldlines are traced out dynamically through the evolution of events xμ(τ) parameterized by a chronological time τ that is independent of the spacetime coordinates. These events, defined in an unconstrained 8D phase space, interact through five τ-dependent gauge fields induced by the event evolution. The resulting theory differs in its underlying mechanics from conventional electromagnetism, but coincides with Maxwell theory in an equilibrium limit. In particular, the total mass-energy-momentum of particles and fields is conserved, but the mass-shell constraint is lifted from individual interacting events, so that the Feynman-Stueckelberg interpretation of pair creation/annihilation is implemented in classical mechanics. We consider a three-stage interaction which when parameterized by the laboratory clock x0 appears as (1) particle-1 scatters on a heavy nucleus to produce bremsstrahlung, (2) the radiation field produces a particle/antiparticle pair, (3) the antiparticle is annihilated with particle-2 in the presence of a second heavy nucleus. When parameterized in chronological time τ, the underlying process develops as (1) particle-2 scatters on the second nucleus and begins evolving backward in time with negative energy, (2) particle-1 scatters on the first nucleus and releases bremsstrahlung, (3) particle-2 absorbs radiation which returns it to forward time evolution with positive energy.

  18. Academic achievement of twins and singletons in early adulthood: Taiwanese cohort study.

    PubMed

    Tsou, Meng-Ting; Tsou, Meng-Wen; Wu, Ming-Ping; Liu, Jin-Tan

    2008-07-21

    To examine the long term effects of low birth weight on academic achievements in twins and singletons and to determine whether the academic achievement of twins in early adulthood is inferior to that of singletons. Cohort study. Taiwanese nationwide register of academic outcome. A cohort of 218 972 singletons and 1687 twins born in Taiwan, 1983-5. College attendance and test scores in the college joint entrance examinations. After adjustment for birth weight, gestational age, birth order, and sex and the sociodemographic characteristics of the parents, twins were found to have significantly lower mean test scores than singletons in Chinese, mathematics, and natural science, as well as a 2.2% lower probability of attending college. Low birthweight twins had an 8.5% lower probability of college attendance than normal weight twins, while low birthweight singletons had only a 3.2% lower probability. The negative effects of low birth weight on the test scores in English and mathematics were substantially greater for twins than for singletons. The twin pair analysis showed that the association between birth weight and academic achievement scores, which existed for opposite sex twin pairs, was not discernible for same sex twin pairs, indicating that birth weight might partly reflect other underlying genetic variations. These data support the proposition that twins perform less well academically than singletons. Low birth weight has a negative association with subsequent academic achievement in early adulthood, with the effect being stronger for twins than for singletons. The association between birth weight and academic performance might be partly attributable to genetic factors.

  19. A three-state kinetic agent-based model to analyze tax evasion dynamics

    NASA Astrophysics Data System (ADS)

    Crokidakis, Nuno

    2014-11-01

    In this work we study the problem of tax evasion on a fully-connected population. For this purpose, we consider that the agents may be in three different states, namely honest tax payers, tax evaders and undecided, that are individuals in an intermediate class among honests and evaders. Every individual can change his/her state following a kinetic exchange opinion dynamics, where the agents interact by pairs with competitive negative (with probability q) and positive (with probability 1-q) couplings, representing agreement/disagreement between pairs of agents. In addition, we consider the punishment rules of the Zaklan econophysics model, for which there is a probability pa of an audit each agent is subject to in every period and a length of time k detected tax evaders remain honest. Our results suggest that below the critical point qc=1/4 of the opinion dynamics the compliance is high, and the punishment rules have a small effect in the population. On the other hand, for q>qc the tax evasion can be considerably reduced by the enforcement mechanism. We also discuss the impact of the presence of the undecided agents in the evolution of the system.

  20. Nuclear p ⊥-broadening of an energetic parton pair

    NASA Astrophysics Data System (ADS)

    Cougoulic, Florian; Peigné, Stéphane

    2018-05-01

    We revisit the transverse momentum broadening of a fast parton pair crossing a nuclear medium, putting emphasis on the pair global color state, for any number of colors N and within the eikonal limit for parton propagation and the Gaussian approximation for the gluon field of the target. The pair transverse momentum probability distribution is derived in a kinetic equation approach, and is determined by an operator ℬ describing the possible transitions between the pair color states when crossing the medium. The exponential of ℬ encompasses the 4-point correlators of Wilson lines in the saturation formalism. We emphasize the relation of ℬ with the anomalous dimension matrices appearing in the study of soft gluon radiation associated to hard 2 → 2 partonic processes. In a well-chosen, orthonormal basis of the pair color states, we rederive ℬ for any type of parton pair, making maximal use of SU( N) invariants and using `birdtrack' color pictorial notations, providing a quite economical derivation of all previously known 4-point correlators (or equivalently, anomalous dimension matrices for 2 → 2 parton scattering). We discuss some general features of the pair transverse momentum distribution. The latter simplifies in the `compact pair expansion' which singles out the global charges (Casimirs) of the pair color states. This study should provide the necessary tools to address nuclear broadening of n-parton systems in phenomenology while highlighting the color structure of the process.

  1. The interval between cancer diagnosis among mothers and offspring in a population-based cohort.

    PubMed

    Paltiel, Ora; Friedlander, Yehiel; Deutsch, Lisa; Yanetz, Rebecca; Calderon-Margalit, Ronit; Tiram, Efrat; Hochner, Hagit; Barchana, Micha; Harlap, Susan; Manor, Orly

    2007-01-01

    Familial cancers may be due to shared genes or environment, or chance aggregation. We explored the possibility that ascertainment bias influences cancer detection in families, bearing upon the time interval between diagnosis of affected mothers and offspring. The Jerusalem Perinatal Study (JPS) comprises all mothers (n = 39,734) from Western Jerusalem who gave birth 1964 -1976 and their offspring (n = 88,829). After linking identification numbers with Israel's Cancer Registry we measured the absolute time interval between initial cancer diagnoses in affected mother-offspring pairs. We tested the probability of obtaining intervals as short as those observed by chance alone, using a permutation test on the median interval. By June 2003 cancer had developed in 105 mother-offspring pairs within the cohort. Common sites among mothers were breast (47%), colorectal (9%), non-Hodgkin lymphoma (NHL) (8%) and cervix (7%), while for offspring in affected pairs common cancers were leukemia (12.4%), thyroid (13.3%), NHL (10.5%), breast (10.5%) and melanoma (7.6%). The median interval between diagnoses was 5.9 years, but for 33% of affected pairs the interval was < or =3 years. The probability of this occurring by chance alone was 0.03. This held true whether the offspring's or mother's diagnosis was first (P < 0.01). In a population-based cohort followed for three decades, the absolute interval between the diagnosis of cancer in mothers and their offspring is shorter than expected by chance. Explanations include shared environmental exposures or the possibility that cancer ascertainment in one pair member affects health behaviors in the other resulting in early diagnosis. The latter may bias the estimation of anticipation and survival in familial cancers.

  2. Informing disease models with temporal and spatial contact structure among GPS-collared individuals in wild populations.

    PubMed

    Williams, David M; Dechen Quinn, Amy C; Porter, William F

    2014-01-01

    Contacts between hosts are essential for transmission of many infectious agents. Understanding how contacts, and thus transmission rates, occur in space and time is critical to effectively responding to disease outbreaks in free-ranging animal populations. Contacts between animals in the wild are often difficult to observe or measure directly. Instead, one must infer contacts from metrics such as proximity in space and time. Our objective was to examine how contacts between white-tailed deer (Odocoileus virginianus) vary in space and among seasons. We used GPS movement data from 71 deer in central New York State to quantify potential direct contacts between deer and indirect overlap in space use across time and space. Daily probabilities of direct contact decreased from winter (0.05-0.14), to low levels post-parturition through summer (0.00-0.02), and increased during the rut to winter levels. The cumulative distribution for the spatial structure of direct and indirect contact probabilities around a hypothetical point of occurrence increased rapidly with distance for deer pairs separated by 1,000 m-7,000 m. Ninety-five percent of the probabilities of direct contact occurred among deer pairs within 8,500 m of one another, and 99% within 10,900 m. Probabilities of indirect contact accumulated across greater spatial extents: 95% at 11,900 m and 99% at 49,000 m. Contacts were spatially consistent across seasons, indicating that although contact rates differ seasonally, they occur proportionally across similar landscape extents. Distributions of contact probabilities across space can inform management decisions for assessing risk and allocating resources in response.

  3. Creation of the BMA ensemble for SST using a parallel processing technique

    NASA Astrophysics Data System (ADS)

    Kim, Kwangjin; Lee, Yang Won

    2013-10-01

    Despite the same purpose, each satellite product has different value because of its inescapable uncertainty. Also the satellite products have been calculated for a long time, and the kinds of the products are various and enormous. So the efforts for reducing the uncertainty and dealing with enormous data will be necessary. In this paper, we create an ensemble Sea Surface Temperature (SST) using MODIS Aqua, MODIS Terra and COMS (Communication Ocean and Meteorological Satellite). We used Bayesian Model Averaging (BMA) as ensemble method. The principle of the BMA is synthesizing the conditional probability density function (PDF) using posterior probability as weight. The posterior probability is estimated using EM algorithm. The BMA PDF is obtained by weighted average. As the result, the ensemble SST showed the lowest RMSE and MAE, which proves the applicability of BMA for satellite data ensemble. As future work, parallel processing techniques using Hadoop framework will be adopted for more efficient computation of very big satellite data.

  4. Isoscalar neutron-proton pairing and SU(4)-symmetry breaking in Gamow-Teller transitions

    NASA Astrophysics Data System (ADS)

    Kaneko, K.; Sun, Y.; Mizusaki, T.

    2018-05-01

    The isoscalar neutron-proton pairing is thought to be important for nuclei with equal number of protons and neutrons but its manifestation in structure properties remains to be understood. We investigate the Gamow-Teller (GT) transitions for the f7 /2-shell nuclei in large-scale shell-model calculations with the realistic Hamiltonian. We show that the isoscalar T =0 ,Jπ=1+ neutron-proton pairing interaction plays a decisive role for the concentration of GT strengths at the first-excited 11+ state in 42Sc, and that the suppression of these strengths in 46V, 50Mn, and 54Co is mainly caused by the spin-orbit force supplemented by the quadrupole-quadrupole interaction. Based on the good reproduction of the charge-exchange reaction data, we further analyze the interplay between the isoscalar and isovector pairing correlations. We conclude that even for the most promising A =42 nuclei where the SU(4) isoscalar-isovector-pairing symmetry is less broken, the probability of forming an isoscalar neutron-proton pairing condensation is less than 60% as compared to the expectation at the SU(4)-symmetry limit.

  5. Pairing preferences of the model mono-valence mono-atomic ions investigated by molecular simulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Qiang; Department of Chemistry, Bohai University, Jinzhou 121000; Zhang, Ruiting

    2014-05-14

    We carried out a series of potential of mean force calculations to study the pairing preferences of a series of model mono-atomic 1:1 ions with evenly varied sizes. The probabilities of forming the contact ion pair (CIP) and the single water separate ion pair (SIP) were presented in the two-dimensional plots with respect to the ion sizes. The pairing preferences reflected in these plots largely agree with the empirical rule of matching ion sizes in the small and big size regions. In the region that the ion sizes are close to the size of the water molecule; however, a significantmore » deviation from this conventional rule is observed. Our further analysis indicated that this deviation originates from the competition between CIP and the water bridging SIP state. The competition is mainly an enthalpy modulated phenomenon in which the existing of the water bridging plays a significant role.« less

  6. A hybrid double-observer sightability model for aerial surveys

    USGS Publications Warehouse

    Griffin, Paul C.; Lubow, Bruce C.; Jenkins, Kurt J.; Vales, David J.; Moeller, Barbara J.; Reid, Mason; Happe, Patricia J.; Mccorquodale, Scott M.; Tirhi, Michelle J.; Schaberi, Jim P.; Beirne, Katherine

    2013-01-01

    Raw counts from aerial surveys make no correction for undetected animals and provide no estimate of precision with which to judge the utility of the counts. Sightability modeling and double-observer (DO) modeling are 2 commonly used approaches to account for detection bias and to estimate precision in aerial surveys. We developed a hybrid DO sightability model (model MH) that uses the strength of each approach to overcome the weakness in the other, for aerial surveys of elk (Cervus elaphus). The hybrid approach uses detection patterns of 2 independent observer pairs in a helicopter and telemetry-based detections of collared elk groups. Candidate MH models reflected hypotheses about effects of recorded covariates and unmodeled heterogeneity on the separate front-seat observer pair and back-seat observer pair detection probabilities. Group size and concealing vegetation cover strongly influenced detection probabilities. The pilot's previous experience participating in aerial surveys influenced detection by the front pair of observers if the elk group was on the pilot's side of the helicopter flight path. In 9 surveys in Mount Rainier National Park, the raw number of elk counted was approximately 80–93% of the abundance estimated by model MH. Uncorrected ratios of bulls per 100 cows generally were low compared to estimates adjusted for detection bias, but ratios of calves per 100 cows were comparable whether based on raw survey counts or adjusted estimates. The hybrid method was an improvement over commonly used alternatives, with improved precision compared to sightability modeling and reduced bias compared to DO modeling.

  7. Improving strand pairing prediction through exploring folding cooperativity

    PubMed Central

    Jeong, Jieun; Berman, Piotr; Przytycka, Teresa M.

    2008-01-01

    The topology of β-sheets is defined by the pattern of hydrogen-bonded strand pairing. Therefore, predicting hydrogen bonded strand partners is a fundamental step towards predicting β-sheet topology. At the same time, finding the correct partners is very difficult due to long range interactions involved in strand pairing. Additionally, patterns of aminoacids observed in β-sheet formations are very general and therefore difficult to use for computational recognition of specific contacts between strands. In this work, we report a new strand pairing algorithm. To address above mentioned difficulties, our algorithm attempts to mimic elements of the folding process. Namely, in addition to ensuring that the predicted hydrogen bonded strand pairs satisfy basic global consistency constraints, it takes into account hypothetical folding pathways. Consistently with this view, introducing hydrogen bonds between a pair of strands changes the probabilities of forming hydrogen bonds between other pairs of strand. We demonstrate that this approach provides an improvement over previously proposed algorithms. We also compare the performance of this method to that of a global optimization algorithm that poses the problem as integer linear programming optimization problem and solves it using ILOG CPLEX™ package. PMID:18989036

  8. Selfish DNA in protein-coding genes of Rickettsia.

    PubMed

    Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

    2000-10-13

    Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

  9. Microgravity

    NASA Image and Video Library

    2002-08-07

    Members from all four teams were mixed into pairs to work on a Lego (TM) Challenge device to operate in the portable drop tower demonstrator (background). These two team members are about to try out their LEGO (TM) creation. This was part of the second Dropping in a Microgravity Environment (DIME) competition held April 23-25, 2002, at NASA's Glenn Research Center. Competitors included two teams from Sycamore High School, Cincinnati, OH, and one each from Bay High School, Bay Village, OH, and COSI Academy, Columbus, OH. DIME is part of NASA's education and outreach activities. Details are on line at http://microgravity.grc.nasa.gov/DIME_2002.html.

  10. Phenomenological study of the isovector tensor meson family

    NASA Astrophysics Data System (ADS)

    Pang, Cheng-Qun; He, Li-Ping; Liu, Xiang; Matsuki, Takayuki

    2014-07-01

    In this work, we study all the observed a2 states and group them into the a2 meson family, where their total and two-body Okubo-Zweig-Iizuka allowed strong decay partial widths are calculated via the quark pair creation model. Taking into account the present experimental data, we further give the corresponding phenomenological analysis, which is valuable to test whether each a2 state can be assigned into the a2 meson family. What is more important is that the prediction of their decay behaviors will be helpful for future experimental study of the a2 states.

  11. Particle-in-Cell Simulations of the Twisted Magnetospheres of Magnetars. I.

    NASA Astrophysics Data System (ADS)

    Chen, Alexander Y.; Beloborodov, Andrei M.

    2017-08-01

    The magnetospheres of magnetars are believed to be filled with electron-positron plasma generated by electric discharge. We present a first numerical experiment demonstrating this process in an axisymmetric magnetosphere with a simple threshold prescription for pair creation, which is applicable to the inner magnetosphere with an ultrastrong field. The {e}+/- discharge occurs in response to the twisting of the closed magnetic field lines by a shear deformation of the magnetar surface, which launches electric currents into the magnetosphere. The simulation shows the formation of an electric “gap” with an unscreened electric field ({\\boldsymbol{E}}\\cdot {\\boldsymbol{B}}\

  12. Phase-Space Transport of Stochastic Chaos in Population Dynamics of Virus Spread

    NASA Astrophysics Data System (ADS)

    Billings, Lora; Bollt, Erik M.; Schwartz, Ira B.

    2002-06-01

    A general way to classify stochastic chaos is presented and applied to population dynamics models. A stochastic dynamical theory is used to develop an algorithmic tool to measure the transport across basin boundaries and predict the most probable regions of transport created by noise. The results of this tool are illustrated on a model of virus spread in a large population, where transport regions reveal how noise completes the necessary manifold intersections for the creation of emerging stochastic chaos.

  13. An Exactly Soluble Model for Hopping Particles Moving with Correlations Between States due to Exchange Sites

    NASA Astrophysics Data System (ADS)

    Zhao, Xian-Geng; Jia, Sue-Tang

    1992-09-01

    The motion of hopping particles on an infinite chain is investigated. The model is characterized by the correlations between states due to exchange sites. The analytic solutions for this system are discussed in general case. For some special cases, exact results are obtained with the help of explicit calculations of propagators and mean square displacement deviation. Both probability propagators for the creation and annihilation of two particles or for the deformation and formation of Frenkel excitons are indicated.

  14. Exact one-sided confidence limits for the difference between two correlated proportions.

    PubMed

    Lloyd, Chris J; Moldovan, Max V

    2007-08-15

    We construct exact and optimal one-sided upper and lower confidence bounds for the difference between two probabilities based on matched binary pairs using well-established optimality theory of Buehler. Starting with five different approximate lower and upper limits, we adjust them to have coverage probability exactly equal to the desired nominal level and then compare the resulting exact limits by their mean size. Exact limits based on the signed root likelihood ratio statistic are preferred and recommended for practical use.

  15. De-identification Methods for Open Health Data: The Case of the Heritage Health Prize Claims Dataset

    PubMed Central

    Arbuckle, Luk; Koru, Gunes; Eze, Benjamin; Gaudette, Lisa; Neri, Emilio; Rose, Sean; Howard, Jeremy; Gluck, Jonathan

    2012-01-01

    Background There are many benefits to open datasets. However, privacy concerns have hampered the widespread creation of open health data. There is a dearth of documented methods and case studies for the creation of public-use health data. We describe a new methodology for creating a longitudinal public health dataset in the context of the Heritage Health Prize (HHP). The HHP is a global data mining competition to predict, by using claims data, the number of days patients will be hospitalized in a subsequent year. The winner will be the team or individual with the most accurate model past a threshold accuracy, and will receive a US $3 million cash prize. HHP began on April 4, 2011, and ends on April 3, 2013. Objective To de-identify the claims data used in the HHP competition and ensure that it meets the requirements in the US Health Insurance Portability and Accountability Act (HIPAA) Privacy Rule. Methods We defined a threshold risk consistent with the HIPAA Privacy Rule Safe Harbor standard for disclosing the competition dataset. Three plausible re-identification attacks that can be executed on these data were identified. For each attack the re-identification probability was evaluated. If it was deemed too high then a new de-identification algorithm was applied to reduce the risk to an acceptable level. We performed an actual evaluation of re-identification risk using simulated attacks and matching experiments to confirm the results of the de-identification and to test sensitivity to assumptions. The main metric used to evaluate re-identification risk was the probability that a record in the HHP data can be re-identified given an attempted attack. Results An evaluation of the de-identified dataset estimated that the probability of re-identifying an individual was .0084, below the .05 probability threshold specified for the competition. The risk was robust to violations of our initial assumptions. Conclusions It was possible to ensure that the probability of re-identification for a large longitudinal dataset was acceptably low when it was released for a global user community in support of an analytics competition. This is an example of, and methodology for, achieving open data principles for longitudinal health data. PMID:22370452

  16. The non-parametric Parzen's window in stereo vision matching.

    PubMed

    Pajares, G; de la Cruz, J

    2002-01-01

    This paper presents an approach to the local stereovision matching problem using edge segments as features with four attributes. From these attributes we compute a matching probability between pairs of features of the stereo images. A correspondence is said true when such a probability is maximum. We introduce a nonparametric strategy based on Parzen's window (1962) to estimate a probability density function (PDF) which is used to obtain the matching probability. This is the main finding of the paper. A comparative analysis of other recent matching methods is included to show that this finding can be justified theoretically. A generalization of the proposed method is made in order to give guidelines about its use with the similarity constraint and also in different environments where other features and attributes are more suitable.

  17. Synchrotron cooling and annihilation of an e/+/-e/-/ plasma - The radiation mechanism for the 5 March, 1979 transient

    NASA Technical Reports Server (NTRS)

    Ramaty, R.; Bussard, R. W.; Lingenfelter, R. E.

    1981-01-01

    Positron-electron pair radiation is examined as a mechanism that could be responsible for the impulsive phase emission of the 5 March, 1979 transient. Synchrotron cooling and subsequent annihilation of the pairs can account for the energy spectrum, the very high brightness, and the 0.4 MeV feature observed from this transient, whose source is likely to be a neutron star in the supernova remnant N49 in the Large Magellanic Cloud. In this model, the observed radiation is produced in the skin layer of a hot, radiation-dominated pair atmosphere, probably confined to the vicinity of the neutron star by a strong magnetic field. In this layer, about 10 to the 12th generations of pairs are formed (by photon-photon collisions), cooled and annihilated during the 0.15 s duration of the impulsive phase.

  18. Connections between the dynamical symmetries in the microscopic shell model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Georgieva, A. I., E-mail: anageorg@issp.bas.bg; Drumev, K. P.

    2016-03-25

    The dynamical symmetries of the microscopic shell model appear as the limiting cases of a symmetry adapted Pairing-Plus-Quadrupole Model /PQM/, with a Hamiltonian containing isoscalar and isovector pairing and quadrupole interactions. We establish a correspondence between each of the three types of pairing bases and Elliott’s SU(3) basis, that describes collective rotation of nuclear systems with quadrupole deformation. It is derived from their complementarity to the same LS coupling chain of the shell model number conserving algebra. The probability distribution of the S U(3) basis states within the pairing eigenstates is also obtained through a numerical diagonalization of the PQMmore » Hamiltonian in each limit. We introduce control parameters, which define the phase diagram of the model and determine the role of each term of the Hamiltonian in the correct reproduction of the experimental data for the considered nuclei.« less

  19. Relativistically strong electromagnetic radiation in a plasma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bulanov, S. V., E-mail: svbulanov@gmail.com, E-mail: bulanov.sergei@jaea.go.jp; Esirkepov, T. Zh.; Kando, M.

    Physical processes in a plasma under the action of relativistically strong electromagnetic waves generated by high-power lasers have been briefly reviewed. These processes are of interest in view of the development of new methods for acceleration of charged particles, creation of sources of bright hard electromagnetic radiation, and investigation of macroscopic quantum-electrodynamical processes. Attention is focused on nonlinear waves in a laser plasma for the creation of compact electron accelerators. The acceleration of plasma bunches by the radiation pressure of light is the most efficient regime of ion acceleration. Coherent hard electromagnetic radiation in the relativistic plasma is generated inmore » the form of higher harmonics and/or electromagnetic pulses, which are compressed and intensified after reflection from relativistic mirrors created by nonlinear waves. In the limit of extremely strong electromagnetic waves, radiation friction, which accompanies the conversion of radiation from the optical range to the gamma range, fundamentally changes the behavior of the plasma. This process is accompanied by the production of electron–positron pairs, which is described within quantum electrodynamics theory.« less

  20. Long-life partners or sex friends? Impact of parental pair bond on offspring personality.

    PubMed

    Le Bot, Océane; Lumineau, Sophie; de Margerie, Emmanuel; Pittet, Florent; Trabalon, Marie; Houdelier, Cécilia

    2014-12-01

    Previous investigations reported that some traits of parental relationships, including pair-bond duration or mate behavioural compatibility, influence subsequent offspring fitness by acting on their behaviour and growth and thus their early survival. We hypothesized that the development of a pair bond between sexual partners would have a prenatal influence. This study investigated the impact of two pairing managements on the egg characteristics and development of offspring of Japanese quail (Coturnix c. japonica). Thirty males and 30 females were paired either continuously (C; mates together all the time) or non-continuously (NC; pairs met only three times a week for 5 min). Separation-reunion tests evaluated parental pair bond. Egg yolk testosterone and androstenedione levels were evaluated, and the somatic and behavioural development of C and NC chicks was assessed. Our results revealed that members of C pairs were attached to their mates and, although no significant differences in androgen levels could be evidenced between egg sets, a higher proportion of C pairs' eggs were fertilized and their chicks appeared less emotive and more social. Our results revealed that the parental relationship can modulate the behavioural development of their offspring, probably via non-genetic effects, and this could play a major role in the emergence of inter-individual variability. © 2014. Published by The Company of Biologists Ltd.

  1. A Longitudinal Examination of Middle School Science Learners' Use of Scaffolding In and Around a Dynamic Modeling Tool

    NASA Astrophysics Data System (ADS)

    Fretz, Eric Bruce

    Scaffolding is a term rooted in multiple research communities over decades of development. Customized, contingent support can be provided to learners to enable performances beyond what they can do alone. This dissertation seeks to examine how effectively scaffolds designed to promote articulation (written expressions of learner understanding) actually work, and if this effectiveness and/or the quality of the resulting models changes over time. It longitudinally examines the use of scaffolds designed into a dynamic modeling tool, as it is used by middle school science learners to create, test, and revise models of complex science phenomena like stream ecosystems. This dissertation also reviews the origins of the scaffolding construct, and summarizes conceptions of scaffolding from various lines of research. Scaffolding can be provided by both human and non-human agents, such as computers, which require specialized interface design to ensure maximum effectiveness. In the study, learners created models in four curriculum units over the seventh and eighth grade school years. Additionally, this dissertation examines the nature of the discussion learners have while using these scaffolds and the frequency and types of interpersonal scaffolds employed during the creation of models. Model quality is also examined using a rubric developed through review of prior research on assessing models and concept maps. Learner pairs' model creation sessions on a computer are captured with screen video and learner audio, and then distilled to transcripts for subsequent coding and analysis, supported by qualitative analysis software. Articulation scaffolds were found to succeed in promoting articulations and the quality of those articulations improved over time. Learner dialog associated with these written articulations is of reasonable quality but did not improve over time. Quality of model artifacts did improve over time. The overall use of scaffolding by each learner pair was contrasted with that pairs model quality, but no relationship was found. Software design and classroom implementation implications of these findings are discussed. The frequency of interpersonal scaffolding provided by teachers highlights the need to consider scaffolding holistically and synergistically, with design decisions for software tools made in light of careful analysis as to what human and non-human agents can and should each provide.

  2. Orbits of 15 visual binaries

    NASA Astrophysics Data System (ADS)

    Heintz, W. D.

    1981-04-01

    Micrometer observations in 1979-1980 permitted the computation of substantially revised or new orbital elements for 15 visual pairs. They include the bright stars 52 Ari and 78 UMa (in the UMa cluster), four faint dK pairs, and the probable triple ADS 16185. Ephemerides for equator of data are listed in a table along with the orbital elements of the binaries. The measured positions and their residuals are listed in a second table. The considered binaries include ADS 896, 2336, 6315, 7054, 7629, 8092, 8555, 8739, 13987, 16185, Rst 1658, 3906, 3972, 4529, and Jsp 691.

  3. Jonckheere Double Star Photometry - Part XI: Lepus & Vulpecula

    NASA Astrophysics Data System (ADS)

    Knapp, Wilfried; Nanson, John

    2018-07-01

    If any double star discoverer is in urgent need of photometry then it is Jonckheere. There are over 3000 Jonckheere objects listed in the WDS catalog and a good part of them with magnitudes obviously far too bright. This report covers the Jonckheere objects in the constellations Lep and Vul. At least one image per object was taken with V-filter to allow for visual magnitude measurement by differential photometry. All objects were additionally checked for common proper motion. Five qualify indeed as most probably CPM pairs with an additional five as potential CPM pairs.

  4. Multiclass Posterior Probability Twin SVM for Motor Imagery EEG Classification.

    PubMed

    She, Qingshan; Ma, Yuliang; Meng, Ming; Luo, Zhizeng

    2015-01-01

    Motor imagery electroencephalography is widely used in the brain-computer interface systems. Due to inherent characteristics of electroencephalography signals, accurate and real-time multiclass classification is always challenging. In order to solve this problem, a multiclass posterior probability solution for twin SVM is proposed by the ranking continuous output and pairwise coupling in this paper. First, two-class posterior probability model is constructed to approximate the posterior probability by the ranking continuous output techniques and Platt's estimating method. Secondly, a solution of multiclass probabilistic outputs for twin SVM is provided by combining every pair of class probabilities according to the method of pairwise coupling. Finally, the proposed method is compared with multiclass SVM and twin SVM via voting, and multiclass posterior probability SVM using different coupling approaches. The efficacy on the classification accuracy and time complexity of the proposed method has been demonstrated by both the UCI benchmark datasets and real world EEG data from BCI Competition IV Dataset 2a, respectively.

  5. The suppression of pulsar and gamma-ray burst annihilation lines by magnetic photon splitting

    NASA Technical Reports Server (NTRS)

    Baring, Matthew G.

    1993-01-01

    Neutron stars, relativistic and compact by nature, show great potential for the copious creation of electron-positron pairs in the magnetospheres; these rapidly cool, thermalize, and then annihilate. It is therefore expected that many neutron sources might display evidence of pair annihilation lines in the 400-500 keV range. It is shown that magnetic photon splitting, which operates effectively at these energies and in the enormous neutron star magnetic fields, can destroy an annihilation feature by absorbing line photons and reprocessing them to lower energies. In so doing, photon splitting creates a soft gamma-ray bump and a broad quasi-power-law contribution to the X-ray continuum, which is too flat to conflict with the observed X-ray paucity in gamma-ray bursts. The destruction of the line occurs in neutron stars with surface fields of 5 x 10 exp 12 G or maybe even less, depending on the size of the emission region.

  6. Organochlorine pesticides, PCBs, and mercury in Osprey (Pandion haliaetus) eggs from the Upper Volga River, Russia

    USGS Publications Warehouse

    Henny, Charles J.; Galushin, V.M.; Kuznetsov, A.V.; Meyburg, B.-U.; Chancellor, R.D.; Ferrero, J.J.

    1998-01-01

    The Osprey population associated with Darwin Nature Reserve and the Rybinsk Reservoir increased from only a few pairs prior to the creation of the reservoir in the late 1940s , to about 45-50 pairs in 1994. Productivity rates were excellent in 1988 and 1989 (1.38 young/occupied nest), but extremely low in 1987 (0.47 young/occupied nest). A chemical spill into the Volga River in early 1987 resulted in a massive fish kill, which was believed responsible for low production that year. With the exception of the year of the chemical spill and 1992 (the year an egg was collected from 10 of 11 nests studied), production was comparable to rates observed in stable or increasing populations in Byelorussia, Finland, and Sweden. The p.p'-DDE (DDE), polychlorinated biphenyl (PCB), and mercury concentrations from eggs collected in 1992 were below known effect levels and eggshell thickness showed only 6.3 % thinning - an amount not associated with reproductive problems.

  7. Long-Lived Correlated Triplet Pairs in a π-Stacked Crystalline Pentacene Derivative.

    PubMed

    Folie, Brendan D; Haber, Jonah B; Refaely-Abramson, Sivan; Neaton, Jeffrey B; Ginsberg, Naomi S

    2018-02-14

    Singlet fission is the spin-conserving process by which a singlet exciton splits into two triplet excitons. Singlet fission occurs via a correlated triplet pair intermediate, but direct evidence of this state has been scant, and in films of TIPS-pentacene, a small molecule organic semiconductor, even the rate of fission has been unclear. We use polarization-resolved transient absorption microscopy on individual crystalline domains of TIPS-pentacene to establish the fission rate and demonstrate that the initially created triplets remain bound for a surprisingly long time, hundreds of picoseconds, before separating. Furthermore, using a broadband probe, we show that it is possible to determine absorbance spectra of individual excited species in a crystalline solid. We find that triplet interactions perturb the absorbance, and provide evidence that triplet interaction and binding could be caused by the π-stacked geometry. Elucidating the relationship between the lattice structure and the electronic structure and dynamics has important implications for the creation of photovoltaic devices that aim to boost efficiency via singlet fission.

  8. Properties of the Intergalactic Magnetic Field Constrained by Gamma-Ray Observations of Gamma-Ray Bursts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Veres, P.; Dermer, C. D.; Dhuga, K. S.

    The magnetic field in intergalactic space gives important information about magnetogenesis in the early universe. The properties of this field can be probed by searching for radiation of secondary e {sup +} e {sup −} pairs created by TeV photons that produce GeV range radiation by Compton-scattering cosmic microwave background photons. The arrival times of the GeV “echo” photons depend strongly on the magnetic field strength and coherence length. A Monte Carlo code that accurately treats pair creation is developed to simulate the spectrum and time-dependence of the echo radiation. The extrapolation of the spectrum of powerful gamma-ray bursts (GRBs)more » like GRB 130427A to TeV energies is used to demonstrate how the intergalactic magnetic field can be constrained if it falls in the 10{sup −21}–10{sup −17} G range for a 1 Mpc coherence length.« less

  9. The neural correlates of subjective utility of monetary outcome and probability weight in economic and in motor decision under risk

    PubMed Central

    Wu, Shih-Wei; Delgado, Mauricio R.; Maloney, Laurence T.

    2011-01-01

    In decision under risk, people choose between lotteries that contain a list of potential outcomes paired with their probabilities of occurrence. We previously developed a method for translating such lotteries to mathematically equivalent motor lotteries. The probability of each outcome in a motor lottery is determined by the subject’s noise in executing a movement. In this study, we used functional magnetic resonance imaging in humans to compare the neural correlates of monetary outcome and probability in classical lottery tasks where information about probability was explicitly communicated to the subjects and in mathematically equivalent motor lottery tasks where probability was implicit in the subjects’ own motor noise. We found that activity in the medial prefrontal cortex (mPFC) and the posterior cingulate cortex (PCC) quantitatively represent the subjective utility of monetary outcome in both tasks. For probability, we found that the mPFC significantly tracked the distortion of such information in both tasks. Specifically, activity in mPFC represents probability information but not the physical properties of the stimuli correlated with this information. Together, the results demonstrate that mPFC represents probability from two distinct forms of decision under risk. PMID:21677166

  10. The neural correlates of subjective utility of monetary outcome and probability weight in economic and in motor decision under risk.

    PubMed

    Wu, Shih-Wei; Delgado, Mauricio R; Maloney, Laurence T

    2011-06-15

    In decision under risk, people choose between lotteries that contain a list of potential outcomes paired with their probabilities of occurrence. We previously developed a method for translating such lotteries to mathematically equivalent "motor lotteries." The probability of each outcome in a motor lottery is determined by the subject's noise in executing a movement. In this study, we used functional magnetic resonance imaging in humans to compare the neural correlates of monetary outcome and probability in classical lottery tasks in which information about probability was explicitly communicated to the subjects and in mathematically equivalent motor lottery tasks in which probability was implicit in the subjects' own motor noise. We found that activity in the medial prefrontal cortex (mPFC) and the posterior cingulate cortex quantitatively represent the subjective utility of monetary outcome in both tasks. For probability, we found that the mPFC significantly tracked the distortion of such information in both tasks. Specifically, activity in mPFC represents probability information but not the physical properties of the stimuli correlated with this information. Together, the results demonstrate that mPFC represents probability from two distinct forms of decision under risk.

  11. A System-Level Throughput Model for Quantum Key Distribution

    DTIC Science & Technology

    2015-09-17

    object. In quantum entanglement , the physical properties of particle pairs or groups of particles are correlated – the quantum state of each particle...One-Time Pad Algorithm ............................................................................. 8 Figure 2. Photon Polarization [19...64 Poisson distribution for multi- photon probability (29

  12. Revealing charge carrier dynamics in squaraine:[6, 6]-phenyl-C 71-butyric acid methyl ester based organic solar cells

    NASA Astrophysics Data System (ADS)

    Rana, Aniket; Sharma, Chhavi; Prabhu, Deepak D.; Kumar, Mahesh; Karuvath, Yoosaf; Das, Suresh; Chand, Suresh; Singh, Rajiv K.

    2018-04-01

    Ultrafast charge carrier dynamics as well as the generation of polaron pair in squaraine (SQ) and squaraine:[6,6]-phenyl-C 71-butyric acid methyl ester (SQ:PCBM71) have been studied using ultrafast transient absorption spectroscopy (UTAS). The current study reveals that the pure SQ exhibits the creation of singlet and triplet states; however, incorporation of PCBM71 in SQ results in the formation of polaron pairs with ˜550ps lifetime, which in turn leads to the creation of free electrons in the device. We show that the considerable increment in monomolecular and bimolecular recombination in SQ:PCBM71 compared to pure SQ which describes the interfacial compatibility of SQ and PCBMC71 molecules. The present work not only provides the information about the carrier generation in SQ and SQ:PCBM71 but also gives the facts relating to the effect of PCBM71 mixing into the SQ which is very significant because the SQ has donor-acceptor-donor (D-A-D) structure and mixing one more acceptor can introduce more complex recombinations in the blend. These findings have been complimented by the charge transport study in the device using impedance spectroscopy. The various important transport parameters are transit time (τt), diffusion constant (Dn), global mobility (μ) and carrier lifetime (τr). The values of these parameters are 26.38 μs, 4.64x10-6 cm2s-1, 6.12x10-6 cm2V-1s-1 and 399 μs, respectively. To the best of our knowledge such study related to SQ is not present in the literature comprehensively.

  13. Lordosis Re-Creation in TLIF and PLIF: A Cadaveric Study of the Influence of Surgical Bone Resection and Cage Angle.

    PubMed

    Robertson, Peter A; Armstrong, William A; Woods, Daniel L; Rawlinson, Jeremy J

    2018-04-24

    Controlled cadaveric study of surgical technique in Transforaminal and Posterior Lumbar Interbody Fusion (TLIF & PLIF) OBJECTIVE.: To evaluate the contribution of surgical techniques and cage variables in lordosis re-creation in posterior interbody fusion (TLIF/PLIF). The major contributors to lumbar lordosis are the lordotic lower lumbar discs. The pathologies requiring treatment with segmental fusion are frequently hypolordotic or kyphotic. Current posterior based interbody techniques have a poor track record for recreating lordosis, although re-creation of lordosis with optimum anatomical alignment is associated with better outcomes and reduced adjacent segment change needing revision. It is unclear whether surgical techniques or cage parameters contribute significantly to lordosis re-creation. Eight instrumented cadaveric motion segments were evaluated with pre and post experimental radiological assessment of lordosis. Each motion segment was instrumented with pedicle screw fixation to allow segmental stabilization. The surgical procedures were unilateral TLIF with an 18° lordotic and 27 mm length cage, unilateral TLIF (18°, 27 mm) with bilateral facetectomy, unilateral TLIF (18°, 27 mm) with posterior column osteotomy, PLIF with bilateral cages (18°, 22 mm), and PLIF with bilateral cages (24°, 22 mm). Cage insertion used and 'insert and rotate' technique. Pooled results demonstrated a mean increase in lordosis of 2.2° with each procedural step (Lordosis increase was serially 1.8°, 3.5°, 1.6°, 2.5° & 1.6° through the procedures). TLIF and PLIF with posterior column osteotomy increased lordosis significantly compared with Unilateral TLIF and TLIF with bilateral facetectomy. The major contributors to lordosis re-creation were posterior column osteotomy, and PLIF with paired shorter cages rather than TLIF. This study demonstrates that the surgical approach to posterior interbody surgery influences lordosis gain and posterior column osteotomy optimizes lordosis gain in TLIF. The bilateral cages used in PLIF are shorter and associated with further gain in lordosis. This information has the potential to aid surgical planning when attempting to recreate lordosis to optimize outcomes. N/A.

  14. Probability of identity by descent in metapopulations.

    PubMed Central

    Kaj, I; Lascoux, M

    1999-01-01

    Equilibrium probabilities of identity by descent (IBD), for pairs of genes within individuals, for genes between individuals within subpopulations, and for genes between subpopulations are calculated in metapopulation models with fixed or varying colony sizes. A continuous-time analog to the Moran model was used in either case. For fixed-colony size both propagule and migrant pool models were considered. The varying population size model is based on a birth-death-immigration (BDI) process, to which migration between colonies is added. Wright's F statistics are calculated and compared to previous results. Adding between-island migration to the BDI model can have an important effect on the equilibrium probabilities of IBD and on Wright's index. PMID:10388835

  15. Phene Plate (PhP) biochemical fingerprinting. A screening method for epidemiological typing of enterococcal isolates.

    PubMed

    Saeedi, B; Tärnberg, M; Gill, H; Hällgren, A; Jonasson, J; Nilsson, L E; Isaksson, B; Kühn, I; Hanberger, H

    2005-09-01

    Pulsed-field gel electrophoresis (PFGE) is currently considered the gold standard for genotyping of enterococci. However, PFGE is both expensive and time-consuming. The purpose of this study was to investigate whether the PhP system can be used as a reliable clinical screening method for detection of genetically related isolates of enterococci. If so, it should be possible to minimize the number of isolates subjected to PFGE typing, which would save time and money. Ninety-nine clinical enterococcal isolates were analysed by PhP (similarity levels 0.90-0.975) and PFGE (similarity levels < or =3 and < or =6 bands) and all possible pairs of isolates were cross-classified as matched or mismatched. We found that the probability that a pair of isolates (A and B) belonging to the same type according to PhP also belong to the same cluster according to PFGE, i.e. p(A(PFGE)=B(PFGE) * A(PhP)=B(PhP)), and the probability that a pair of isolates of different types according to PhP also belong to different clusters according to PFGE, i.e. p(A(PFGE) not equalB(PFGE) * A(PhP) not equalB(PhP)), was relatively high for E. faecalis (0.86 and 0.96, respectively), but was lower for E. faecium (0.51 and 0.77, respectively). The concordance which shows the probability that PhP and PFGE agree on match or mismatch was 86%-93% for E. faecalis and 54%-66% for E. faecium, which indicates that the PhP method may be useful for epidemiological typing of E. faecalis in the current settings but not for E. faecium.

  16. Shade tree spatial structure and pod production explain frosty pod rot intensity in cacao agroforests, Costa Rica.

    PubMed

    Gidoin, Cynthia; Avelino, Jacques; Deheuvels, Olivier; Cilas, Christian; Bieng, Marie Ange Ngo

    2014-03-01

    Vegetation composition and plant spatial structure affect disease intensity through resource and microclimatic variation effects. The aim of this study was to evaluate the independent effect and relative importance of host composition and plant spatial structure variables in explaining disease intensity at the plot scale. For that purpose, frosty pod rot intensity, a disease caused by Moniliophthora roreri on cacao pods, was monitored in 36 cacao agroforests in Costa Rica in order to assess the vegetation composition and spatial structure variables conducive to the disease. Hierarchical partitioning was used to identify the most causal factors. Firstly, pod production, cacao tree density and shade tree spatial structure had significant independent effects on disease intensity. In our case study, the amount of susceptible tissue was the most relevant host composition variable for explaining disease intensity by resource dilution. Indeed, cacao tree density probably affected disease intensity more by the creation of self-shading rather than by host dilution. Lastly, only regularly distributed forest trees, and not aggregated or randomly distributed forest trees, reduced disease intensity in comparison to plots with a low forest tree density. A regular spatial structure is probably crucial to the creation of moderate and uniform shade as recommended for frosty pod rot management. As pod production is an important service expected from these agroforests, shade tree spatial structure may be a lever for integrated management of frosty pod rot in cacao agroforests.

  17. Fingerprint Recognition with Identical Twin Fingerprints

    PubMed Central

    Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar. PMID:22558204

  18. Generating intrinsically disordered protein conformational ensembles from a Markov chain

    NASA Astrophysics Data System (ADS)

    Cukier, Robert I.

    2018-03-01

    Intrinsically disordered proteins (IDPs) sample a diverse conformational space. They are important to signaling and regulatory pathways in cells. An entropy penalty must be payed when an IDP becomes ordered upon interaction with another protein or a ligand. Thus, the degree of conformational disorder of an IDP is of interest. We create a dichotomic Markov model that can explore entropic features of an IDP. The Markov condition introduces local (neighbor residues in a protein sequence) rotamer dependences that arise from van der Waals and other chemical constraints. A protein sequence of length N is characterized by its (information) entropy and mutual information, MIMC, the latter providing a measure of the dependence among the random variables describing the rotamer probabilities of the residues that comprise the sequence. For a Markov chain, the MIMC is proportional to the pair mutual information MI which depends on the singlet and pair probabilities of neighbor residue rotamer sampling. All 2N sequence states are generated, along with their probabilities, and contrasted with the probabilities under the assumption of independent residues. An efficient method to generate realizations of the chain is also provided. The chain entropy, MIMC, and state probabilities provide the ingredients to distinguish different scenarios using the terminologies: MoRF (molecular recognition feature), not-MoRF, and not-IDP. A MoRF corresponds to large entropy and large MIMC (strong dependence among the residues' rotamer sampling), a not-MoRF corresponds to large entropy but small MIMC, and not-IDP corresponds to low entropy irrespective of the MIMC. We show that MorFs are most appropriate as descriptors of IDPs. They provide a reasonable number of high-population states that reflect the dependences between neighbor residues, thus classifying them as IDPs, yet without very large entropy that might lead to a too high entropy penalty.

  19. Informing Disease Models with Temporal and Spatial Contact Structure among GPS-Collared Individuals in Wild Populations

    PubMed Central

    Williams, David M.; Dechen Quinn, Amy C.; Porter, William F.

    2014-01-01

    Contacts between hosts are essential for transmission of many infectious agents. Understanding how contacts, and thus transmission rates, occur in space and time is critical to effectively responding to disease outbreaks in free-ranging animal populations. Contacts between animals in the wild are often difficult to observe or measure directly. Instead, one must infer contacts from metrics such as proximity in space and time. Our objective was to examine how contacts between white-tailed deer (Odocoileus virginianus) vary in space and among seasons. We used GPS movement data from 71 deer in central New York State to quantify potential direct contacts between deer and indirect overlap in space use across time and space. Daily probabilities of direct contact decreased from winter (0.05–0.14), to low levels post-parturition through summer (0.00–0.02), and increased during the rut to winter levels. The cumulative distribution for the spatial structure of direct and indirect contact probabilities around a hypothetical point of occurrence increased rapidly with distance for deer pairs separated by 1,000 m – 7,000 m. Ninety-five percent of the probabilities of direct contact occurred among deer pairs within 8,500 m of one another, and 99% within 10,900 m. Probabilities of indirect contact accumulated across greater spatial extents: 95% at 11,900 m and 99% at 49,000 m. Contacts were spatially consistent across seasons, indicating that although contact rates differ seasonally, they occur proportionally across similar landscape extents. Distributions of contact probabilities across space can inform management decisions for assessing risk and allocating resources in response. PMID:24409293

  20. Fingerprint recognition with identical twin fingerprints.

    PubMed

    Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

  1. Magnetic Photon Splitting: The S-Matrix Formulation in the Landau Representation

    NASA Technical Reports Server (NTRS)

    Baring, Matthew G.

    1999-01-01

    Calculations of reaction rates for the third-order QED process of photon splitting gamma yields gamma.gamma in strong magnetic fields traditionally have employed either the effective Lagrangian method or variants of Schwinger's proper-time technique. Recently, Mentzel, Berg and Wunner [1] presented an alternative derivation via an S-matrix formulation in the Landau representation. Advantages of such a formulation include the ability to compute rates near pair resonances above pair threshold. This paper presents new developments of the Landau representation formalism as applied to photon splitting, providing significant, advances beyond the work of [1] by summing over the spin quantum numbers of the electron propagators, and analytically integrating over the component of momentum of the intermediate states that is parallel to field. The ensuing tractable expressions for the scattering amplitudes are satisfyingly compact, and of an appearance familiar to S-matrix theory applications. Such developments can facilitate numerical computations of splitting considerably both below and above pair threshold. Specializations to two regimes of interest are obtained, namely the limit of highly supercritical fields and the domain where photon energies are far inferior to that for the threshold of single-photon pair creation. In particular, for the first time the low-frequency amplitudes are simply expressed in terms of the Gamma function, its integral and its derivatives. In addition, the equivalence of the asymptotic forms in these two domains to extant results from effective Lagrangian/proper- time formulations is demonstrated.

  2. [History of the medical indication of induced abortion. A historical contribution to the discussion of a current problem].

    PubMed

    Gottlieb, J

    1974-10-01

    Of all the religious injunctions against abortion, the most effective one over time has been the belief that God is the giver of life and that therefore abortion constitutes an attack on Divine Will. The question of when the soul enters the embryo is, under that view, of secondary importance. 2 schools of thought, each with a large body of supporting literature, have developed on the subject, however; 1 is that life is created complete and by Divine impulse, and the other that the soul enters the body after its creation as a continuing act of Divine creation. Writers supporting the latter view tend to agree that only God knows or can know the moment of the soul's entrance, and furthermore that it probably occurs quite soon after conception. In any case, a doctor can respect his own religious principles with regard to abortion but does not have the right to condemn those of his colleagues who hold different views.

  3. IA-Regional-Radio - Social Network for Radio Recommendation

    NASA Astrophysics Data System (ADS)

    Dziczkowski, Grzegorz; Bougueroua, Lamine; Wegrzyn-Wolska, Katarzyna

    This chapter describes the functions of a system proposed for the music hit recommendation from social network data base. This system carries out the automatic collection, evaluation and rating of music reviewers and the possibility for listeners to rate musical hits and recommendations deduced from auditor's profiles in the form of regional Internet radio. First, the system searches and retrieves probable music reviews from the Internet. Subsequently, the system carries out an evaluation and rating of those reviews. From this list of music hits, the system directly allows notation from our application. Finally, the system automatically creates the record list diffused each day depending on the region, the year season, the day hours and the age of listeners. Our system uses linguistics and statistic methods for classifying music opinions and data mining techniques for recommendation part needed for recorded list creation. The principal task is the creation of popular intelligent radio adaptive on auditor's age and region - IA-Regional-Radio.

  4. Spatiotemporal configuration dependent pairing of nerve events in dark-adapted human vision

    NASA Astrophysics Data System (ADS)

    Bouman, Maarten A.

    2002-02-01

    In the model presented here, in the dark any single quantum absorption in a rod or cone produces a subliminal excitation. Subliminal excitations from both halves of a twin unit pair in the retina for the perception of light from the stimulus. A twin unit contains either two red or two green cones. The twin units are intertwined in triples of two red units and one green unit in a hexagon called a trion. P satellite rods surround each cone, P being approximately proportional to the square of eccentricity. A successful pairing for light perception represents-through the points of time and locations of the creation of its partners in the retina-a direction event with two possible polarities and with the orientation of the elongated shape of the twin unit. The polarity of the event depends on which of the two partners arrives first at the twin's pairing facility. Simultaneous events and successive events with the same polarity in adjacent units that are aligned along one of the three orientations of the hexagonal retinal mosaic pair in the cortex for the perception of edge and of movement. Inter-twin pairing products of the three differently oriented sets of aligned twins are independent of each other and sum vectorially in the cortex. This system of three sub-retinas is called the retrinet. Two one-quantum excitations in any of a twin's receptors make the percept colored. The odd blue cone produces already a blue signal for a single one-quantum excitation. Intra-receptor pairing in a rod, a red cone and a green cone is for white, red, and green respectively. Red and green cone products of a trion cross-pair in the retina and produce a yellow signal. Red and green cone products of a hexagon of adjacent trions cross-pair in the cortex and produce a white signal. This large hexagon with a total of seven trions is called a persepton. After subliminal excitations in a twin have paired successfully, further subliminal receptor excitations in neighboring and aligned twins are expressed to a certain extent in the percept's area, duration and color. Earlier experiments on absolute and color thresholds are the basis for this theory, which is developed in this paper.

  5. Validation of an automated fluorescein method for determining bromide in water

    USGS Publications Warehouse

    Fishman, M. J.; Schroder, L.J.; Friedman, L.C.

    1985-01-01

    Surface, atmospheric precipitation and deionized water samples were spiked with ??g l-1 concentrations of bromide, and the solutions stored in polyethylene and polytetrafluoroethylene bottles. Bromide was determined periodically for 30 days. Automated fluorescein and ion chromatography methods were used to determine bromide in these prepared samples. Analysis of the data by the paired t-test indicates that the two methods are not significantly different at a probability of 95% for samples containing from 0.015 to 0.5 mg l-1 of bromide. The correlation coefficient for the same sets of paired data is 0.9987. Recovery data, except for the surface water samples to which 0.005 mg l-1 of bromide was added, range from 89 to 112%. There appears to be no loss of bromide from solution in either type of container.Surface, atmospheric precipitation and deionized water samples were spiked with mu g l** minus **1 concentrations of bromide, and the solutions stored in polyethylene and polytetrafluoroethylene bottles. Bromide was determined periodically for 30 days. Automated fluorescein and ion chromatography methods were used to determine bromide in these prepared samples. Analysis of the data by the paired t-test indicates that the two methods are not significantly different at a probability of 95% for samples containing from 0. 015 to 0. 5 mg l** minus **1 of bromide. The correlation coefficient for the same sets of paired data is 0. 9987. Recovery data, except for the surface water samples to which 0. 005 mg l** minus **1 of bromide was added, range from 89 to 112%. Refs.

  6. We are not the 99 percent: quantifying asphericity in the distribution of Local Group satellites

    NASA Astrophysics Data System (ADS)

    Forero-Romero, Jaime E.; Arias, Verónica

    2018-05-01

    We use simulations to build an analytic probability distribution for the asphericity in the satellite distribution around Local Group (LG) type galaxies in the Lambda Cold Dark Matter (LCDM) paradigm. We use this distribution to estimate the atypicality of the satellite distributions in the LG even when the underlying simulations do not have enough systems fully resembling the LG in terms of its typical masses, separation and kinematics. We demonstrate the method using three different simulations (Illustris-1, Illustris-1-Dark and ELVIS) and a number of satellites ranging from 11 to 15. Detailed results differ greatly among the simulations suggesting a strong influence of the typical DM halo mass, the number of satellites and the simulated baryonic effects. However, there are three common trends. First, at most 2% of the pairs are expected to have satellite distributions with the same asphericity as the LG; second, at most 80% of the pairs have a halo with a satellite distribution as aspherical as in M31; and third, at most 4% of the pairs have a halo with satellite distribution as planar as in the MW. These quantitative results place the LG at the level of a 3σ outlier in the LCDM paradigm. We suggest that understanding the reasons for this atypicality requires quantifying the asphericity probability distribution as a function of halo mass and large scale environment. The approach presented here can facilitate that kind of study and other comparisons between different numerical setups and choices to study satellites around LG pairs in simulations.

  7. Environmental correlates of breeding in the Crested Caracara (Caracara cheriway)

    USGS Publications Warehouse

    Morrison, J.L.; Pias, Kyle E.; Cohen, J.B.; Catlin, D.H.

    2009-01-01

    We evaluated the influence of weather on reproduction of the Crested Caracara (Caracara cheriway) in an agricultural landscape in south-central Florida. We used a mixed logistic-regression modeling approach within an information-theoretic framework to examine the influence of total rainfall, rainfall frequency, and temperature on the number of breeding pairs, timing of breeding, nest success, and productivity of Crested Caracaras during 1994–2000. The best models indicated an influence of rainfall frequency and laying period on reproduction. More individuals nested and more pairs nested earlier during years with more frequent rainfall in late summer and early fall. Pairs that nested later in each breeding season had smaller clutches, lower nest success and productivity, and higher probability of nest failure. More frequent rainfall during early spring months that are usually characterized by water deficit (March–May), more frequent rainfall during the fall drawdown period (September–November), and a shorter winter dry period showed some association with higher probability of brood reduction and lower nest success. The proportion of nests that failed was higher in “wet” years, when total rainfall during the breeding season (September–April) was >10% above the 20-year average. Rainfall may influence reproduction in Crested Caracaras indirectly through food resources. As total rainfall increased during February–April, when most pairs are feeding nestlings or dependent fledglings, the proportion of drawdown-dependent species (those that become available as rainfall decreases and wetlands become isolated and shallow) in the diet of Crested Caracaras declined, which may indicate reduced availability of foraging habitat for this primarily terrestrial raptor.

  8. Fluctuation theorem for entropy production during effusion of a relativistic ideal gas.

    PubMed

    Cleuren, B; Willaert, K; Engel, A; Van den Broeck, C

    2008-02-01

    The probability distribution of the entropy production for the effusion of a relativistic ideal gas is calculated explicitly. This result is then extended to include particle and antiparticle pair production and annihilation. In both cases, the fluctuation theorem is verified.

  9. On the joint spectral density of bivariate random sequences. Thesis Technical Report No. 21

    NASA Technical Reports Server (NTRS)

    Aalfs, David D.

    1995-01-01

    For univariate random sequences, the power spectral density acts like a probability density function of the frequencies present in the sequence. This dissertation extends that concept to bivariate random sequences. For this purpose, a function called the joint spectral density is defined that represents a joint probability weighing of the frequency content of pairs of random sequences. Given a pair of random sequences, the joint spectral density is not uniquely determined in the absence of any constraints. Two approaches to constraining the sequences are suggested: (1) assume the sequences are the margins of some stationary random field, (2) assume the sequences conform to a particular model that is linked to the joint spectral density. For both approaches, the properties of the resulting sequences are investigated in some detail, and simulation is used to corroborate theoretical results. It is concluded that under either of these two constraints, the joint spectral density can be computed from the non-stationary cross-correlation.

  10. Probability, not linear summation, mediates the detection of concentric orientation-defined textures.

    PubMed

    Schmidtmann, Gunnar; Jennings, Ben J; Bell, Jason; Kingdom, Frederick A A

    2015-01-01

    Previous studies investigating signal integration in circular Glass patterns have concluded that the information in these patterns is linearly summed across the entire display for detection. Here we test whether an alternative form of summation, probability summation (PS), modeled under the assumptions of Signal Detection Theory (SDT), can be rejected as a model of Glass pattern detection. PS under SDT alone predicts that the exponent β of the Quick- (or Weibull-) fitted psychometric function should decrease with increasing signal area. We measured spatial integration in circular, radial, spiral, and parallel Glass patterns, as well as comparable patterns composed of Gabors instead of dot pairs. We measured the signal-to-noise ratio required for detection as a function of the size of the area containing signal, with the remaining area containing dot-pair or Gabor-orientation noise. Contrary to some previous studies, we found that the strength of summation never reached values close to linear summation for any stimuli. More importantly, the exponent β systematically decreased with signal area, as predicted by PS under SDT. We applied a model for PS under SDT and found that it gave a good account of the data. We conclude that probability summation is the most likely basis for the detection of circular, radial, spiral, and parallel orientation-defined textures.

  11. Concentration of vorticity due to selective decay in doubly periodic vortices and a vortex pair

    NASA Astrophysics Data System (ADS)

    Hattori, Yuji

    2018-01-01

    Strong vortices like tornadoes, typhoons, and tropical cyclones are often created in geophysical flows. It is important to understand the mechanism for the creation of these strong vortices. Recently, we found a purely hydrodynamic mechanism for the concentration of vorticity: it is due to selective decay in which circulation decays faster than angular momentum and energy. In this paper, two problems are investigated by direct numerical simulation to seek universality of this mechanism: doubly periodic vortices disturbed by an unstable eigenmode and a vortex pair disturbed by localized disturbances. In the former case, concentration of vorticity occurs when the wavenumber of the eigenmode is large, while it does not occur for small wavenumbers. For small wavenumbers the disturbances grow to a large amplitude eventually destroying the base flow. For large wavenumber, on the other hand, the growth of the disturbances saturates before destroying the base flow. Selective decay of inviscid invariants is shown to be responsible for the concentration of vorticity as in the previous study. In the case of a vortex pair disturbed by localized disturbances concentration of vorticity occurs twice: the first concentration is not related to selective decay; however, the second weak concentration is most likely due to selective decay.

  12. Maser mechanism of optical pulsations from anomalous X-ray pulsar 4U 0142+61

    NASA Astrophysics Data System (ADS)

    Lu, Y.; Zhang, S. N.

    2004-11-01

    Based on the work of Luo & Melrose from the early 1990s, a maser curvature emission mechanism in the presence of curvature drift is used to explain the optical pulsations from anomalous X-ray pulsars (AXPs). The model comprises a rotating neutron star with a strong surface magnetic field, i.e. a magnetar. Assuming the space-charge-limited flow acceleration mechanism, in which the strongly magnetized neutron star induces strong electric fields that pull the charges from its surface and flow along the open field lines, the neutron star generates a dense flow of electrons and positrons (relativistic pair plasma) by either two-photon pair production or one-photon pair creation resulting from inverse Compton scattering of the thermal photons above the pulsar polar cap (PC). The motion of the pair plasma is essentially one-dimensional along the field lines. We propose that optical pulsations from AXPs are generated by a curvature-drift-induced maser developing in the PC of magnetars. Pair plasma is considered as an active medium that can amplify its normal modes. The curvature drift, which is energy-dependent, is another essential ingredient in allowing negative absorption (maser action) to occur. For the source AXP 4U 0142+61, we find that the optical pulsation triggered by curvature-drift maser radiation occurs at the radial distance R(νM) ~ 4.75 × 109 cm to the neutron star. The corresponding curvature maser frequency is about νM~ 1.39 × 1014 Hz, and the pulse component from the maser amplification is about 27 per cent. The result is consistent with the observation of the optical pulsations from AXP 4U 0142+61.

  13. Towards building a disease-phenotype knowledge base: extracting disease-manifestation relationship from literature

    PubMed Central

    Xu, Rong; Li, Li; Wang, QuanQiu

    2013-01-01

    Motivation: Systems approaches to studying phenotypic relationships among diseases are emerging as an active area of research for both novel disease gene discovery and drug repurposing. Currently, systematic study of disease phenotypic relationships on a phenome-wide scale is limited because large-scale machine-understandable disease–phenotype relationship knowledge bases are often unavailable. Here, we present an automatic approach to extract disease–manifestation (D-M) pairs (one specific type of disease–phenotype relationship) from the wide body of published biomedical literature. Data and Methods: Our method leverages external knowledge and limits the amount of human effort required. For the text corpus, we used 119 085 682 MEDLINE sentences (21 354 075 citations). First, we used D-M pairs from existing biomedical ontologies as prior knowledge to automatically discover D-M–specific syntactic patterns. We then extracted additional pairs from MEDLINE using the learned patterns. Finally, we analysed correlations between disease manifestations and disease-associated genes and drugs to demonstrate the potential of this newly created knowledge base in disease gene discovery and drug repurposing. Results: In total, we extracted 121 359 unique D-M pairs with a high precision of 0.924. Among the extracted pairs, 120 419 (99.2%) have not been captured in existing structured knowledge sources. We have shown that disease manifestations correlate positively with both disease-associated genes and drug treatments. Conclusions: The main contribution of our study is the creation of a large-scale and accurate D-M phenotype relationship knowledge base. This unique knowledge base, when combined with existing phenotypic, genetic and proteomic datasets, can have profound implications in our deeper understanding of disease etiology and in rapid drug repurposing. Availability: http://nlp.case.edu/public/data/DMPatternUMLS/ Contact: rxx@case.edu PMID:23828786

  14. Comparison of different "along the track" high resolution satellite stereo-pair for DSM extraction

    NASA Astrophysics Data System (ADS)

    Nikolakopoulos, Konstantinos G.

    2013-10-01

    The possibility to create DEM from stereo pairs is based on the Pythagoras theorem and on the principles of photogrammetry that are applied to aerial photographs stereo pairs for the last seventy years. The application of these principles to digital satellite stereo data was inherent in the first satellite missions. During the last decades the satellite stereo-pairs were acquired across the track in different days (SPOT, ERS etc.). More recently the same-date along the track stereo-data acquisition seems to prevail (Terra ASTER, SPOT5 HRS, Cartosat, ALOS Prism) as it reduces the radiometric image variations (refractive effects, sun illumination, temporal changes) and thus increases the correlation success rate in any image matching.Two of the newest satellite sensors with stereo collection capability is Cartosat and ALOS Prism. Both of them acquire stereopairs along the track with a 2,5m spatial resolution covering areas of 30X30km. In this study we compare two different satellite stereo-pair collected along the track for DSM creation. The first one is created from a Cartosat stereopair and the second one from an ALOS PRISM triplet. The area of study is situated in Chalkidiki Peninsula, Greece. Both DEMs were created using the same ground control points collected with a Differential GPS. After a first control for random or systematic errors a statistical analysis was done. Points of certified elevation have been used to estimate the accuracy of these two DSMs. The elevation difference between the different DEMs was calculated. 2D RMSE, correlation and the percentile value were also computed and the results are presented.

  15. Think Pair Share with Formative Assessment for Junior High School Student

    NASA Astrophysics Data System (ADS)

    Pradana, O. R. Y.; Sujadi, I.; Pramudya, I.

    2017-09-01

    Geometry is a science related to abstract thinking ability so that not many students are able to understand this material well. In this case, the learning model plays a crucial role in improving student achievement. This means that a less precise learning model will cause difficulties for students. Therefore, this study provides a quantitative explanation of the Think Pair Share learning model combined with the formative assessment. This study aims to test the Think Pair Share with the formative assessment on junior high school students. This research uses a quantitative approach of Pretest-Posttest in control group and experiment group. ANOVA test and Scheffe test used to analyse the effectiveness this learning. Findings in this study are student achievement on the material geometry with Think Pair Share using formative assessment has increased significantly. This happens probably because this learning makes students become more active during learning. Hope in the future, Think Pair Share with formative assessment be a useful learning for teachers and this learning applied by the teacher around the world especially on the material geometry.

  16. Computer simulation on the collision-sticking dynamics of two colloidal particles in an optical trap.

    PubMed

    Xu, Shenghua; Sun, Zhiwei

    2007-04-14

    Collisions of a particle pair induced by optical tweezers have been employed to study colloidal stability. In order to deepen insights regarding the collision-sticking dynamics of a particle pair in the optical trap that were observed in experimental approaches at the particle level, the authors carry out a Brownian dynamics simulation. In the simulation, various contributing factors, including the Derjaguin-Landau-Verwey-Overbeek interaction of particles, hydrodynamic interactions, optical trapping forces on the two particles, and the Brownian motion, were all taken into account. The simulation reproduces the tendencies of the accumulated sticking probability during the trapping duration for the trapped particle pair described in our previous study and provides an explanation for why the two entangled particles in the trap experience two different statuses.

  17. Quadratic RK shooting solution for a environmental parameter prediction boundary value problem

    NASA Astrophysics Data System (ADS)

    Famelis, Ioannis Th.; Tsitouras, Ch.

    2014-10-01

    Using tools of Information Geometry, the minimum distance between two elements of a statistical manifold is defined by the corresponding geodesic, e.g. the minimum length curve that connects them. Such a curve, where the probability distribution functions in the case of our meteorological data are two parameter Weibull distributions, satisfies a 2nd order Boundary Value (BV) system. We study the numerical treatment of the resulting special quadratic form system using Shooting method. We compare the solutions of the problem when we employ a classical Singly Diagonally Implicit Runge Kutta (SDIRK) 4(3) pair of methods and a quadratic SDIRK 5(3) pair . Both pairs have the same computational costs whereas the second one attains higher order as it is specially constructed for quadratic problems.

  18. Is employer-based health insurance a barrier to entrepreneurship?

    PubMed

    Fairlie, Robert W; Kapur, Kanika; Gates, Susan

    2011-01-01

    The focus on employer-provided health insurance in the United States may restrict business creation. We address the limited research on the topic of "entrepreneurship lock" by using recent panel data from matched Current Population Surveys. We use difference-in-difference models to estimate the interaction between having a spouse with employer-based health insurance and potential demand for health care. We find evidence of a larger negative effect of health insurance demand on business creation for those without spousal coverage than for those with spousal coverage. We also take a new approach in the literature to examine the question of whether employer-based health insurance discourages business creation by exploiting the discontinuity created at age 65 through the qualification for Medicare. Using a novel procedure of identifying age in months from matched monthly CPS data, we compare the probability of business ownership among male workers in the months just before turning age 65 and in the months just after turning age 65. We find that business ownership rates increase from just under age 65 to just over age 65, whereas we find no change in business ownership rates from just before to just after for other ages 55-75. We also do not find evidence from the previous literature and additional estimates that other confounding factors such as retirement, partial retirement, social security and pension eligibility are responsible for the increase in business ownership in the month individuals turn 65. Our estimates provide some evidence that "entrepreneurship lock" exists, which raises concerns that the bundling of health insurance and employment may create an inefficient level of business creation. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. Relative commutativity degree of some dihedral groups

    NASA Astrophysics Data System (ADS)

    Abdul Hamid, Muhanizah; Mohd Ali, Nor Muhainiah; Sarmin, Nor Haniza; Abd Manaf, Fadila Normahia

    2013-04-01

    The commutativity degree of a finite group G was introduced by Erdos and Turan for symmetric groups, finite groups and finite rings in 1968. The commutativity degree, P(G), is defined as the probability that a random pair of elements in a group commute. The relative commutativity degree of a group G is defined as the probability for an element of subgroup, H and an element of G to commute with one another and denoted by P(H,G). In this research the relative commutativity degree of some dihedral groups are determined.

  20. From decay to complete breaking: pulling the strings in SU(2) Yang-Mills theory.

    PubMed

    Pepe, M; Wiese, U-J

    2009-05-15

    We study {2Q+1} strings connecting two static charges Q in (2+1)D SU(2) Yang-Mills theory. While the fundamental {2} string between two charges Q=1/2 is unbreakable, the adjoint {3} string connecting two charges Q=1 can break. When a {4} string is stretched beyond a critical length, it decays into a {2} string by gluon pair creation. When a {5} string is stretched, it first decays into a {3} string, which eventually breaks completely. The energy of the screened charges at the ends of a string is well described by a phenomenological constituent gluon model.

  1. Creating unconventional geometric beams with large depth of field using double freeform-surface optics.

    PubMed

    Feng, Zexin; Froese, Brittany D; Huang, Chih-Yu; Ma, Donglin; Liang, Rongguang

    2015-07-10

    We consider here creation of an unconventional flattop beam with a large depth of field by employing double freeform optical surfaces. The output beam is designed with continuous variations from the flattop to almost zero near the edges to resist the influence of diffraction on its propagation. We solve this challenging problem by naturally incorporating an optimal transport map computation scheme for unconventional boundary conditions with a simultaneous point-by-point double surface construction procedure. We demonstrate experimentally the generation of a long-range propagated triangular beam through a plano-freeform lens pair fabricated by a diamond-tuning machine.

  2. Ultrafast laser control of backward superfluorescence towards standoff sensing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ariunbold, Gombojav O.; National University of Mongolia, Ulaanbaatar 210646; Baylor University, Waco, Texas 76798

    2014-01-13

    We study infrared backward cooperative emission in a rubidium vapor induced by ultrafast two-photon optical excitations. The laser coherent control of the backward emission is demonstrated by using a pair of 100 fs pulses with a variable time delay. The temporal variation (quantum beat) of the backward beam intensity due to interference of atomic transitions in the rubidium atomic level system 5S-5P-5D is produced and controlled. Based on the obtained experimental results, we discuss possible applications of the developed approach for creation of an effective “guide star” in the sodium atomic layer in the upper atmosphere (mesosphere)

  3. DIME Participants Working on a Legos(TM) Challenge

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Members from all four teams were mixed into pairs to work on a Lego (TM) Challenge device to operate in the portable drop tower demonstrator (background). These two team members are about to try out their LEGO (TM) creation. This was part of the second Dropping in a Microgravity Environment (DIME) competition held April 23-25, 2002, at NASA's Glenn Research Center. Competitors included two teams from Sycamore High School, Cincinnati, OH, and one each from Bay High School, Bay Village, OH, and COSI Academy, Columbus, OH. DIME is part of NASA's education and outreach activities. Details are on line at http://microgravity.grc.nasa.gov/DIME_2002.html.

  4. Unifying distribution functions: some lesser known distributions.

    PubMed

    Moya-Cessa, J R; Moya-Cessa, H; Berriel-Valdos, L R; Aguilar-Loreto, O; Barberis-Blostein, P

    2008-08-01

    We show that there is a way to unify distribution functions that describe simultaneously a classical signal in space and (spatial) frequency and position and momentum for a quantum system. Probably the most well known of them is the Wigner distribution function. We show how to unify functions of the Cohen class, Rihaczek's complex energy function, and Husimi and Glauber-Sudarshan distribution functions. We do this by showing how they may be obtained from ordered forms of creation and annihilation operators and by obtaining them in terms of expectation values in different eigenbases.

  5. A Discrete Probability Function Method for the Equation of Radiative Transfer

    NASA Technical Reports Server (NTRS)

    Sivathanu, Y. R.; Gore, J. P.

    1993-01-01

    A discrete probability function (DPF) method for the equation of radiative transfer is derived. The DPF is defined as the integral of the probability density function (PDF) over a discrete interval. The derivation allows the evaluation of the PDF of intensities leaving desired radiation paths including turbulence-radiation interactions without the use of computer intensive stochastic methods. The DPF method has a distinct advantage over conventional PDF methods since the creation of a partial differential equation from the equation of transfer is avoided. Further, convergence of all moments of intensity is guaranteed at the basic level of simulation unlike the stochastic method where the number of realizations for convergence of higher order moments increases rapidly. The DPF method is described for a representative path with approximately integral-length scale-sized spatial discretization. The results show good agreement with measurements in a propylene/air flame except for the effects of intermittency resulting from highly correlated realizations. The method can be extended to the treatment of spatial correlations as described in the Appendix. However, information regarding spatial correlations in turbulent flames is needed prior to the execution of this extension.

  6. Virial Coefficients for the Liquid Argon

    NASA Astrophysics Data System (ADS)

    Korth, Micheal; Kim, Saesun

    2014-03-01

    We begin with a geometric model of hard colliding spheres and calculate probability densities in an iterative sequence of calculations that lead to the pair correlation function. The model is based on a kinetic theory approach developed by Shinomoto, to which we added an interatomic potential for argon based on the model from Aziz. From values of the pair correlation function at various values of density, we were able to find viral coefficients of liquid argon. The low order coefficients are in good agreement with theoretical hard sphere coefficients, but appropriate data for argon to which these results might be compared is difficult to find.

  7. Unitary limit in crossed Andreev transport

    DOE PAGES

    Sadovskyy, I. A.; Lesovik, G. B.; Vinokur, V. M.

    2015-10-08

    One of the most promising approaches for generating spin- and energy-entangled electron pairs is splitting a Cooper pair into the metal through spatially separated terminals. Utilizing hybrid systems with the energy-dependent barriers at the superconductor/normal metal (NS) interfaces, one can achieve a practically 100% efficiency outcome of entangled electrons. We investigate a minimalistic one-dimensional model comprising a superconductor and two metallic leads and derive an expression for an electron-to-hole transmission probability as a measure of splitting efficiency. We find the conditions for achieving 100% efficiency and present analytical results for the differential conductance and differential noise.

  8. Initiation at closely spaced replication origins in a yeast chromosome.

    PubMed

    Brewer, B J; Fangman, W L

    1993-12-10

    Replication of eukaryotic chromosomes involves initiation at origins spaced an average of 50 to 100 kilobase pairs. In yeast, potential origins can be recognized as autonomous replication sequences (ARSs) that allow maintenance of plasmids. However, there are more ARS elements than active chromosomal origins. The possibility was examined that close spacing of ARSs can lead to inactive origins. Two ARSs located 6.5 kilobase pairs apart can indeed interfere with each other. Replication is initiated from one or the other ARS with equal probability, but rarely (< 5%) from both ARSs on the same DNA molecule.

  9. New England Faculty and College Students Differ in Their Views About Evolution, Creationism, Intelligent Design, and Religiosity

    PubMed Central

    Paz-y-Miño C, Guillermo

    2016-01-01

    Public acceptance of evolution in Northeastern U.S. is the highest nationwide, only 59%. Here, we compare perspectives about evolution, creationism, intelligent design (ID), and religiosity between highly educated New England faculty (n=244; 90% Ph.D. holders in 40 disciplines at 35 colleges/universities) and college students from public secular (n=161), private secular (n=298), and religious (n=185) institutions: 94/3% of the faculty vs. 64/14% of the students admitted to accepting evolution openly and/or privately, and 82/18% of the faculty vs. 58/42% of the students thought that evolution is definitely true or probably true, respectively. Only 3% of the faculty vs. 23% of the students thought that evolution and creationism are in harmony. Although 92% of faculty and students thought that evolution relies on common ancestry, one in every four faculty and one in every three students did not know that humans are apes; 15% of the faculty vs. 34% of the students believed, incorrectly, that the origin of the human mind cannot be explained by evolution, and 30% of the faculty vs. 72% of the students was Lamarckian (believed in inheritance of acquired traits). Notably, 91% of the faculty was very concerned (64%) or somehow concerned (27%) about the controversy evolution vs creationism vs ID and its implications for science education: 96% of the faculty vs. 72% of the students supported the exclusive teaching of evolution while 4% of the faculty vs. 28% of the students favored equal time to evolution, creationism and ID; 92% of the faculty vs. 52% of the students perceived ID as not scientific and proposed to counter evolution or as doctrine consistent with creationism. Although ≈30% of both faculty and students considered religion to be very important in their lives, and ≈20% admitted to praying daily, the faculty was less religious (Religiosity Index faculty=0.5 and students=0.75) and, as expected, more knowledgeable about science (Science Index faculty=2.27 and students=1.60) and evolution (Evolution Index faculty=2.48 and students=1.65) than the students. Because attitudes toward evolution correlate (1) positively with understanding of science/evolution and (2) negatively with religiosity/political ideology, we conclude that science education combined with vigorous public debate should suffice to increase acceptance of naturalistic rationalism and decrease the negative impact of creationism and ID on society’s evolution literacy. PMID:26962385

  10. New England Faculty and College Students Differ in Their Views About Evolution, Creationism, Intelligent Design, and Religiosity.

    PubMed

    Paz-Y-Miño C, Guillermo; Espinosa, Avelina

    2011-06-01

    Public acceptance of evolution in Northeastern U.S. is the highest nationwide, only 59%. Here, we compare perspectives about evolution, creationism, intelligent design (ID), and religiosity between highly educated New England faculty ( n =244; 90% Ph.D. holders in 40 disciplines at 35 colleges/universities) and college students from public secular ( n =161), private secular ( n =298), and religious ( n =185) institutions: 94/3% of the faculty vs. 64/14% of the students admitted to accepting evolution openly and/or privately, and 82/18% of the faculty vs. 58/42% of the students thought that evolution is definitely true or probably true, respectively. Only 3% of the faculty vs. 23% of the students thought that evolution and creationism are in harmony. Although 92% of faculty and students thought that evolution relies on common ancestry, one in every four faculty and one in every three students did not know that humans are apes; 15% of the faculty vs. 34% of the students believed, incorrectly, that the origin of the human mind cannot be explained by evolution, and 30% of the faculty vs. 72% of the students was Lamarckian (believed in inheritance of acquired traits). Notably, 91% of the faculty was very concerned (64%) or somehow concerned (27%) about the controversy evolution vs creationism vs ID and its implications for science education: 96% of the faculty vs. 72% of the students supported the exclusive teaching of evolution while 4% of the faculty vs. 28% of the students favored equal time to evolution, creationism and ID; 92% of the faculty vs. 52% of the students perceived ID as not scientific and proposed to counter evolution or as doctrine consistent with creationism. Although ≈30% of both faculty and students considered religion to be very important in their lives, and ≈20% admitted to praying daily, the faculty was less religious ( Religiosity Index faculty=0.5 and students=0.75) and, as expected, more knowledgeable about science ( Science Index faculty=2.27 and students=1.60) and evolution ( Evolution Index faculty=2.48 and students=1.65) than the students. Because attitudes toward evolution correlate (1) positively with understanding of science/evolution and (2) negatively with religiosity/political ideology, we conclude that science education combined with vigorous public debate should suffice to increase acceptance of naturalistic rationalism and decrease the negative impact of creationism and ID on society's evolution literacy.

  11. Bivariate extreme value distributions

    NASA Technical Reports Server (NTRS)

    Elshamy, M.

    1992-01-01

    In certain engineering applications, such as those occurring in the analyses of ascent structural loads for the Space Transportation System (STS), some of the load variables have a lower bound of zero. Thus, the need for practical models of bivariate extreme value probability distribution functions with lower limits was identified. We discuss the Gumbel models and present practical forms of bivariate extreme probability distributions of Weibull and Frechet types with two parameters. Bivariate extreme value probability distribution functions can be expressed in terms of the marginal extremel distributions and a 'dependence' function subject to certain analytical conditions. Properties of such bivariate extreme distributions, sums and differences of paired extremals, as well as the corresponding forms of conditional distributions, are discussed. Practical estimation techniques are also given.

  12. Study of recreational land and open space using Skylab imagery

    NASA Technical Reports Server (NTRS)

    Sattinger, I. J. (Principal Investigator)

    1975-01-01

    The author has identified the following significant results. An analysis of the statistical uniqueness of each of the signatures of the Gratiot-Saginaw State Game Area was made by computing a matrix of probabilities of misclassification for all possible signature pairs. Within each data set, the 35 signatures were then aggregated into a smaller set of composite signatures by combining groups of signatures having high probabilities of misclassification. Computer separation of forest denisty classes was poor with multispectral scanner data collected on 5 August 1973. Signatures from the scanner data were further analyzed to determine the ranking of spectral channels for computer separation of the scene classes. Probabilities of misclassification were computed for composite signatures using four separate combinations of data source and channel selection.

  13. Freezing transition of the random bond RNA model: Statistical properties of the pairing weights

    NASA Astrophysics Data System (ADS)

    Monthus, Cécile; Garel, Thomas

    2007-03-01

    To characterize the pairing specificity of RNA secondary structures as a function of temperature, we analyze the statistics of the pairing weights as follows: for each base (i) of the sequence of length N , we consider the (N-1) pairing weights wi(j) with the other bases (j≠i) of the sequence. We numerically compute the probability distributions P1(w) of the maximal weight wimax=maxj[wi(j)] , the probability distribution Π(Y2) of the parameter Y2(i)=∑jwi2(j) , as well as the average values of the moments Yk(i)=∑jwik(j) . We find that there are two important temperatures TcTgap , the distribution P1(w) vanishes at some value w0(T)<1 , and accordingly the moments Yk(i)¯ decay exponentially as [w0(T)]k in k . For T

  14. Bonding in Heavier Group 14 Zero-Valent Complexes-A Combined Maximum Probability Domain and Valence Bond Theory Approach.

    PubMed

    Turek, Jan; Braïda, Benoît; De Proft, Frank

    2017-10-17

    The bonding in heavier Group 14 zero-valent complexes of a general formula L 2 E (E=Si-Pb; L=phosphine, N-heterocyclic and acyclic carbene, cyclic tetrylene and carbon monoxide) is probed by combining valence bond (VB) theory and maximum probability domain (MPD) approaches. All studied complexes are initially evaluated on the basis of the structural parameters and the shape of frontier orbitals revealing a bent structural motif and the presence of two lone pairs at the central E atom. For the VB calculations three resonance structures are suggested, representing the "ylidone", "ylidene" and "bent allene" structures, respectively. The influence of both ligands and central atoms on the bonding situation is clearly expressed in different weights of the resonance structures for the particular complexes. In general, the bonding in the studied E 0 compounds, the tetrylones, is best described as a resonating combination of "ylidone" and "ylidene" structures with a minor contribution of the "bent allene" structure. Moreover, the VB calculations allow for a straightforward assessment of the π-backbonding (E→L) stabilization energy. The validity of the suggested resonance model is further confirmed by the complementary MPD calculations focusing on the E lone pair region as well as the E-L bonding region. Likewise, the MPD method reveals a strong influence of the σ-donating and π-accepting properties of the ligand. In particular, either one single domain or two symmetrical domains are found in the lone pair region of the central atom, supporting the predominance of either the "ylidene" or "ylidone" structures having one or two lone pairs at the central atom, respectively. Furthermore, the calculated average populations in the lone pair MPDs correlate very well with the natural bond orbital (NBO) populations, and can be related to the average number of electrons that is backdonated to the ligands. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Kappa statistic for clustered matched-pair data.

    PubMed

    Yang, Zhao; Zhou, Ming

    2014-07-10

    Kappa statistic is widely used to assess the agreement between two procedures in the independent matched-pair data. For matched-pair data collected in clusters, on the basis of the delta method and sampling techniques, we propose a nonparametric variance estimator for the kappa statistic without within-cluster correlation structure or distributional assumptions. The results of an extensive Monte Carlo simulation study demonstrate that the proposed kappa statistic provides consistent estimation and the proposed variance estimator behaves reasonably well for at least a moderately large number of clusters (e.g., K ≥50). Compared with the variance estimator ignoring dependence within a cluster, the proposed variance estimator performs better in maintaining the nominal coverage probability when the intra-cluster correlation is fair (ρ ≥0.3), with more pronounced improvement when ρ is further increased. To illustrate the practical application of the proposed estimator, we analyze two real data examples of clustered matched-pair data. Copyright © 2014 John Wiley & Sons, Ltd.

  16. Selfish routing equilibrium in stochastic traffic network: A probability-dominant description.

    PubMed

    Zhang, Wenyi; He, Zhengbing; Guan, Wei; Ma, Rui

    2017-01-01

    This paper suggests a probability-dominant user equilibrium (PdUE) model to describe the selfish routing equilibrium in a stochastic traffic network. At PdUE, travel demands are only assigned to the most dominant routes in the same origin-destination pair. A probability-dominant rerouting dynamic model is proposed to explain the behavioral mechanism of PdUE. To facilitate applications, the logit formula of PdUE is developed, of which a well-designed route set is not indispensable and the equivalent varitional inequality formation is simple. Two routing strategies, i.e., the probability-dominant strategy (PDS) and the dominant probability strategy (DPS), are discussed through a hypothetical experiment. It is found that, whether out of insurance or striving for perfection, PDS is a better choice than DPS. For more general cases, the conducted numerical tests lead to the same conclusion. These imply that PdUE (rather than the conventional stochastic user equilibrium) is a desirable selfish routing equilibrium for a stochastic network, given that the probability distributions of travel time are available to travelers.

  17. Selfish routing equilibrium in stochastic traffic network: A probability-dominant description

    PubMed Central

    Zhang, Wenyi; Guan, Wei; Ma, Rui

    2017-01-01

    This paper suggests a probability-dominant user equilibrium (PdUE) model to describe the selfish routing equilibrium in a stochastic traffic network. At PdUE, travel demands are only assigned to the most dominant routes in the same origin-destination pair. A probability-dominant rerouting dynamic model is proposed to explain the behavioral mechanism of PdUE. To facilitate applications, the logit formula of PdUE is developed, of which a well-designed route set is not indispensable and the equivalent varitional inequality formation is simple. Two routing strategies, i.e., the probability-dominant strategy (PDS) and the dominant probability strategy (DPS), are discussed through a hypothetical experiment. It is found that, whether out of insurance or striving for perfection, PDS is a better choice than DPS. For more general cases, the conducted numerical tests lead to the same conclusion. These imply that PdUE (rather than the conventional stochastic user equilibrium) is a desirable selfish routing equilibrium for a stochastic network, given that the probability distributions of travel time are available to travelers. PMID:28829834

  18. Force Density Function Relationships in 2-D Granular Media

    NASA Technical Reports Server (NTRS)

    Youngquist, Robert C.; Metzger, Philip T.; Kilts, Kelly N.

    2004-01-01

    An integral transform relationship is developed to convert between two important probability density functions (distributions) used in the study of contact forces in granular physics. Developing this transform has now made it possible to compare and relate various theoretical approaches with one another and with the experimental data despite the fact that one may predict the Cartesian probability density and another the force magnitude probability density. Also, the transforms identify which functional forms are relevant to describe the probability density observed in nature, and so the modified Bessel function of the second kind has been identified as the relevant form for the Cartesian probability density corresponding to exponential forms in the force magnitude distribution. Furthermore, it is shown that this transform pair supplies a sufficient mathematical framework to describe the evolution of the force magnitude distribution under shearing. Apart from the choice of several coefficients, whose evolution of values must be explained in the physics, this framework successfully reproduces the features of the distribution that are taken to be an indicator of jamming and unjamming in a granular packing. Key words. Granular Physics, Probability Density Functions, Fourier Transforms

  19. Design of an activity landscape view taking compound-based feature probabilities into account.

    PubMed

    Zhang, Bijun; Vogt, Martin; Bajorath, Jürgen

    2014-09-01

    Activity landscapes (ALs) of compound data sets are rationalized as graphical representations that integrate similarity and potency relationships between active compounds. ALs enable the visualization of structure-activity relationship (SAR) information and are thus computational tools of interest for medicinal chemistry. For AL generation, similarity and potency relationships are typically evaluated in a pairwise manner and major AL features are assessed at the level of compound pairs. In this study, we add a conditional probability formalism to AL design that makes it possible to quantify the probability of individual compounds to contribute to characteristic AL features. Making this information graphically accessible in a molecular network-based AL representation is shown to further increase AL information content and helps to quickly focus on SAR-informative compound subsets. This feature probability-based AL variant extends the current spectrum of AL representations for medicinal chemistry applications.

  20. A new probable stem lineage crustacean with three-dimensionally preserved soft parts from the Herefordshire (Silurian) Lagerstätte, UK

    PubMed Central

    Siveter, Derek J; Sutton, Mark D; Briggs, Derek E.G; Siveter, David J

    2007-01-01

    A new arthropod with three-dimensionally preserved soft parts, Tanazios dokeron, is described from the Wenlock Series (Silurian) of Herefordshire, England, UK. Serial grinding, digital photographic and computer rendering techniques yielded ‘virtual fossils’ in the round for study. The body tagmata of T. dokeron comprise a head shield and a long trunk. The head shield bears six pairs of horn-like spines and the head bears five pairs of appendages. The antennule, antenna and mandible are all uniramous, and the mandible includes a gnathobasic coxa. Appendages four and five are biramous and similar to those of the trunk: each comprises a limb base with an endite, an enditic membrane, and two epipodites, plus an endopod and exopod. The hypostome bears a large cone-like projection centrally, and there may be a short labrum. The trunk has some 64 segments and at least 60 appendage pairs. A very small telson has the anus sited ventrally in its posterior part and also bears a caudal furca. Comparative morphological and cladistic analyses of T. dokeron indicate a crustacean affinity, with a probable position in the eucrustacean stem group. As such the epipodites in T. dokeron are the first recorded in a eucrustacean stem taxon. The new species is interpreted as a benthic or nektobenthic scavenger. PMID:17609185

  1. Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

    PubMed Central

    2018-01-01

    Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424

  2. On the no-boundary proposal for ekpyrotic and cyclic cosmologies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Battarra, Lorenzo; Lehners, Jean-Luc, E-mail: lorenzo.battarra@aei.mpg.de, E-mail: jlehners@aei.mpg.de

    2014-12-01

    The no-boundary proposal provides a compelling theory for the initial conditions of our universe. We study the implications of such initial conditions for ekpyrotic and cyclic cosmologies. These cosmologies allow for the existence of a new type of ''ekpyrotic instanton'', which describes the creation of a universe in the ekpyrotic contraction phase. Remarkably, we find that the ekpyrotic attractor can explain how the universe became classical. In a cyclic context, in addition to the ekpyrotic instantons there exist de Sitter-like instantons describing the emergence of the universe in the dark energy phase. Our results show that typically the ekpyrotic instantonsmore » yield a higher probability. In fact, in a potential energy landscape allowing both inflationary and cyclic cosmologies, the no-boundary proposal implies that the probability for ekpyrotic and cyclic initial conditions is vastly higher than that for inflationary ones.« less

  3. Using new edges for anomaly detection in computer networks

    DOEpatents

    Neil, Joshua Charles

    2017-07-04

    Creation of new edges in a network may be used as an indication of a potential attack on the network. Historical data of a frequency with which nodes in a network create and receive new edges may be analyzed. Baseline models of behavior among the edges in the network may be established based on the analysis of the historical data. A new edge that deviates from a respective baseline model by more than a predetermined threshold during a time window may be detected. The new edge may be flagged as potentially anomalous when the deviation from the respective baseline model is detected. Probabilities for both new and existing edges may be obtained for all edges in a path or other subgraph. The probabilities may then be combined to obtain a score for the path or other subgraph. A threshold may be obtained by calculating an empirical distribution of the scores under historical conditions.

  4. Using new edges for anomaly detection in computer networks

    DOEpatents

    Neil, Joshua Charles

    2015-05-19

    Creation of new edges in a network may be used as an indication of a potential attack on the network. Historical data of a frequency with which nodes in a network create and receive new edges may be analyzed. Baseline models of behavior among the edges in the network may be established based on the analysis of the historical data. A new edge that deviates from a respective baseline model by more than a predetermined threshold during a time window may be detected. The new edge may be flagged as potentially anomalous when the deviation from the respective baseline model is detected. Probabilities for both new and existing edges may be obtained for all edges in a path or other subgraph. The probabilities may then be combined to obtain a score for the path or other subgraph. A threshold may be obtained by calculating an empirical distribution of the scores under historical conditions.

  5. Creation of a synthetic indicator of quality of care as a clinical management standard in primary care.

    PubMed

    Coma, Ermengol; Ferran, Manel; Méndez, Leonardo; Iglesias, Begoña; Fina, Francesc; Medina, Manuel

    2013-12-01

    The development of electronic medical records has allowed the creation of new quality indicators in healthcare. Among them, synthetic indicators facilitate global interpretation of results and comparisons between professionals. A healthcare quality standard (EQA, the Catalan acronym for Estàndard de Qualitat Assistencial) was constructed to serve as a synthetic indicator to measure the quality of care provided by primary care professionals in Catalonia (Spain). The project phases were to establish the reference population; select health problems to be included; define, select and deliberate about subindicators; and construct and publish the EQA. Construction of the EQA involved 107 healthcare professionals, and 91 health problems were included. In addition, 133 experts were consulted, who proposed a total of 339 indicators. After systematic paired comparison, 61 indicators were selected to create the synthetic indicator. The EQA is now calculated on a monthly basis for more than 8000 healthcare professionals using an automated process that extracts data from electronic medical records; results are published on a follow-up website. Along with the use of the online EQA results tool, there has been an ongoing improvement in most of the quality of care indicators. Creation of the EQA has proven to be useful for the measurement of the quality of care of primary care services. Also an improvement trend over 5 years is shown across most of the measured indicators. The online version of this article (doi:10.1186/2193-1801-2-51) contains supplementary material, which is available to authorized users.

  6. Cowbird removals unexpectedly increase productivity of a brood parasite and the songbird host.

    PubMed

    Kosciuch, Karl L; Sandercock, Brett K

    2008-03-01

    Generalist brood parasites reduce productivity and population growth of avian hosts and have been implicated in population declines of several songbirds of conservation concern. To estimate the demographic effects of brood parasitism on Bell's Vireos (Vireo bellii), we removed Brown-headed Cowbirds (Molothrus ater) in a replicated switchback experimental design. Cowbird removals decreased parasitism frequency from 77% and 85% at unmanipulated plots to 58% and 47% at removal plots in 2004 and 2005, respectively. Vireo productivity per pair was higher at cowbird removal plots when years were pooled (mean = 2.6 +/- 0.2 [SE] young per pair) compared to unmanipulated plots (1.2 +/- 0.1). Nest desertion frequency was lower at cowbird removal plots (35% of parasitized nests) compared to unmanipulated plots (69%) because removal of host eggs was the proximate cue for nest desertion, and vireos experienced lower rates of egg loss at cowbird removal plots. Nest success was higher among unparasitized than parasitized nests, and parasitized nests at cowbird removal plots had a higher probability of success than parasitized nests at unmanipulated plots. Unexpectedly, cowbird productivity from vireo pairs was higher at cowbird removal plots (mean = 0.3 +/- 0.06 young per pair) than at unmanipulated plots (0.1 +/- 0.03) because fewer parasitized nests were deserted and the probability of nest success was higher. Our study provides the first evidence that increases in cowbird productivity may be an unintended consequence of cowbird control programs, especially during the initial years of trapping when parasitism may only be moderately reduced. Thus, understanding the demographic impacts of cowbird removals requires an informed understanding of the behavioral ecology of host-parasite interactions.

  7. A portable pattern-based design technology co-optimization flow to reduce optical proximity correction run-time

    NASA Astrophysics Data System (ADS)

    Chen, Yi-Chieh; Li, Tsung-Han; Lin, Hung-Yu; Chen, Kao-Tun; Wu, Chun-Sheng; Lai, Ya-Chieh; Hurat, Philippe

    2018-03-01

    Along with process improvement and integrated circuit (IC) design complexity increased, failure rate caused by optical getting higher in the semiconductor manufacture. In order to enhance chip quality, optical proximity correction (OPC) plays an indispensable rule in the manufacture industry. However, OPC, includes model creation, correction, simulation and verification, is a bottleneck from design to manufacture due to the multiple iterations and advanced physical behavior description in math. Thus, this paper presented a pattern-based design technology co-optimization (PB-DTCO) flow in cooperation with OPC to find out patterns which will negatively affect the yield and fixed it automatically in advance to reduce the run-time in OPC operation. PB-DTCO flow can generate plenty of test patterns for model creation and yield gaining, classify candidate patterns systematically and furthermore build up bank includes pairs of match and optimization patterns quickly. Those banks can be used for hotspot fixing, layout optimization and also be referenced for the next technology node. Therefore, the combination of PB-DTCO flow with OPC not only benefits for reducing the time-to-market but also flexible and can be easily adapted to diversity OPC flow.

  8. Nonequilibrium excitations and transport of Dirac electrons in electric-field-driven graphene

    NASA Astrophysics Data System (ADS)

    Li, Jiajun; Han, Jong E.

    2018-05-01

    We investigate nonequilibrium excitations and charge transport in charge-neutral graphene driven with dc electric field by using the nonequilibrium Green's-function technique. Due to the vanishing Fermi surface, electrons are subject to nontrivial nonequilibrium excitations such as highly anisotropic momentum distribution of electron-hole pairs, an analog of the Schwinger effect. We show that the electron-hole excitations, initiated by the Landau-Zener tunneling with a superlinear I V relation I ∝E3 /2 , reaches a steady state dominated by the dissipation due to optical phonons, resulting in a marginally sublinear I V with I ∝E , in agreement with recent experiments. The linear I V starts to show the sign of current saturation as the graphene is doped away from the Dirac point, and recovers the semiclassical relation for the saturated velocity. We give a detailed discussion on the nonequilibrium charge creation and the relation between the electron-phonon scattering rate and the electric field in the steady-state limit. We explain how the apparent Ohmic I V is recovered near the Dirac point. We propose a mechanism where the peculiar nonequilibrium electron-hole creation can be utilized in a infrared device.

  9. Competition in saccade target selection reveals attentional guidance by simultaneously active working memory representations.

    PubMed

    Beck, Valerie M; Hollingworth, Andrew

    2017-02-01

    The content of visual working memory (VWM) guides attention, but whether this interaction is limited to a single VWM representation or functional for multiple VWM representations is under debate. To test this issue, we developed a gaze-contingent search paradigm to directly manipulate selection history and examine the competition between multiple cue-matching saccade target objects. Participants first saw a dual-color cue followed by two pairs of colored objects presented sequentially. For each pair, participants selectively fixated an object that matched one of the cued colors. Critically, for the second pair, the cued color from the first pair was presented either with a new distractor color or with the second cued color. In the latter case, if two cued colors in VWM interact with selection simultaneously, we expected the second cued color object to generate substantial competition for selection, even though the first cued color was used to guide attention in the immediately previous pair. Indeed, in the second pair, selection probability of the first cued color was substantially reduced in the presence of the second cued color. This competition between cue-matching objects provides strong evidence that both VWM representations interacted simultaneously with selection. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  10. Creation of short microwave ablation zones: in vivo characterization of single and paired modified triaxial antennas.

    PubMed

    Lubner, Meghan G; Ziemlewicz, Tim J; Hinshaw, J Louis; Lee, Fred T; Sampson, Lisa A; Brace, Christopher L

    2014-10-01

    To characterize modified triaxial microwave antennas configured to produce short ablation zones. Fifty single-antenna and 27 paired-antenna hepatic ablations were performed in domestic swine (N = 11) with 17-gauge gas-cooled modified triaxial antennas powered at 65 W from a 2.45-GHz generator. Single-antenna ablations were performed at 2 (n = 16), 5 (n = 21), and 10 (n = 13) minutes. Paired-antenna ablations were performed at 1-cm and 2-cm spacing for 5 (n = 7 and n = 8, respectively) and 10 minutes (n = 7 and n = 5, respectively). Mean transverse width, length, and aspect ratio of sectioned ablation zones were measured and compared. For single antennas, mean ablation zone lengths were 2.9 cm ± 0.45, 3.5 cm ± 0.55, and 4.2 cm ± 0.40 at 2, 5, and 10 minutes, respectively. Mean widths were 1.8 cm ± 0.3, 2.0 cm ± 0.32, and 2.5 cm ± 0.25 at 2, 5, and 10 minutes, respectively. For paired antennas, mean length at 5 minutes with 1-cm and 2-cm spacing and 10 minutes with 1-cm and 2-cm spacing was 4.2 cm ± 0.9, 4.9 cm ± 1.0, 4.8 cm ± 0.5, and 4.8 cm ± 1.3, respectively. Mean width was 3.1 cm ± 1.0, 4.4 cm ± 0.7, 3.8 cm ± 0.4, and 4.5 cm ± 0.7, respectively. Paired-antenna ablations were more spherical (aspect ratios, 0.72-0.79 for 5-10 min) than single-antenna ablations (aspect ratios, 0.57-0.59). For paired-antenna ablations, 1-cm spacing appeared optimal, with improved circularity and decreased clefting compared with 2-cm spacing (circularity, 0.85 at 1 cm, 0.78 at 2 cm). Modified triaxial antennas can generate relatively short, spherical ablation zones. Paired-antenna ablations were rounder and larger in transverse dimension than single antenna ablations, with 1-cm spacing optimal for confluence of the ablation zone. Copyright © 2014 SIR. Published by Elsevier Inc. All rights reserved.

  11. Creation of short microwave ablation zones: In Vivo Characterization of single and paired Modified Triaxial Antennas Laboratory Investigation

    PubMed Central

    Lubner, Meghan G.; Ziemlewicz, Tim J; Hinshaw, J. Louis; Lee, Fred T.; Sampson, Lisa J.; Brace, Chris L.

    2014-01-01

    Purpose To characterize modified triaxial microwave antennas configured to produce short ablation zones. Materials and Methods 50 single- and 27 paired-antenna hepatic ablations were performed in domestic swine (n=11) with 17-gauge, gas-cooled modified triaxial antennas powered at 65W from a 2.45 GHz generator. Single-antenna ablations were performed at 2 (n=16), 5 (n=21), and 10 (n=13) minutes. Paired-antenna ablations were performed at 1-cm and 2-cm spacing for 5 (n=7, n=8) and 10 minutes (n=7, n=5). Mean transverse width, length and aspect ratio of sectioned ablation zones were measured and compared. Results For single antennas, mean ablation zone length was 2.9±0.45, 3.5±0.55 and 4.2±0.40 cm at 2, 5, and 10 minutes respectively. Mean width was 1.8±0.3, 2.0±0.32, 2.5±0.25 cm at 2, 5, and 10 minutes. For paired antennas, mean length at 5 min 1 and 2 cm and 10 min 1 and 2 cm spacing was 4.2±0.9, 4.4±0.9, 4.8±0.5 and 4.3±0.9 cm respectively. Mean width was 3.1±1.0, 4.0±0.8 and 3.8±0.4, 4.2±0.6 cm respectively. Paired-antenna ablations were more spherical (aspect ratios 0.72-0.79 for 5-10 min) than single-antenna ablations (0.57-0.59). For paired-antenna ablations, 1 cm spacing appeared optimal, with improved circularity and decreased clefting compared to 2 cm spacing (circ 1 cm 0.85, 2 cm 0.78). Conclusion Modified triaxial antennas can generate relatively short, spherical ablation zones. Paired-antenna ablations were rounder and larger in transverse dimension compared to single antenna ablations, with 1 cm spacing optimal for confluence of the ablation zone. PMID:25156644

  12. Community structure of age-0 fishes in paired mainstem and created shallow-water habitats in the Lower Missouri River

    USGS Publications Warehouse

    Starks, Trevor A.; Long, James M.; Dzialowski, Andrew R.

    2016-01-01

    Anthropogenic alterations to aquatic ecosystems have greatly reduced and homogenized riverine habitat, especially those used by larval and juvenile fishes. Creation of shallow-water habitats is used as a restoration technique in response to altered conditions in several studies globally, but only recently in the USA. In the summer of 2012, the U.S. Army Corps of Engineers sampled larval and juvenile fishes at six paired sites (mainstem and constructed chute shallow-water habitats) along a section of the Missouri River between Rulo, NE and St. Louis, MO, USA. From those samples, we enumerated and identified a total of 7622 fishes representing 12 families. Community responses of fishes to created shallow-water habitats were assessed by comparisons of species richness and diversity measures between paired sites and among sampling events. Shannon entropy measures were transformed, and gamma diversity (total diversity) was partitioned into two components, alpha (within community) and beta (between community) diversity using a multiplicative decomposition method. Mantel test results suggest site location, time of sampling event and habitat type were drivers of larval and juvenile community structure. Paired t-test results indicated little to no differences in beta diversity between habitat types; however, chute habitats had significantly higher alpha and gamma diversity as well as increased abundances of Asian carp larvae when compared with mainstem shallow-water habitat. Our results not only show the importance of created shallow-water habitat in promoting stream fish diversity but also highlight the role space and time may play in future restoration and management efforts. 

  13. Why do some women prefer submissive men? Hierarchically disparate couples reach higher reproductive success in European urban humans.

    PubMed

    Jozifkova, Eva; Konvicka, Martin; Flegr, Jaroslav

    2014-01-01

    Equality between partners is considering a feature of the functional partnerships in westernized societies. However, the evolutionary consequences of how in-pair hierarchy influences reproduction are less known. Attraction of some high-ranking women towards low-ranking men represents a puzzle. Young urban adults (120 men, 171 women) filled out a questionnaire focused on their sexual preference for higher or lower ranking partners, their future in-pair hierarchy, and hierarchy between their parents. Human pairs with a hierarchic disparity between partners conceive more offspring than pairs of equally-ranking individuals, who, in turn, conceive more offspring than pairs of two dominating partners. Importantly, the higher reproductive success of hierarchically disparate pairs holds, regardless of which sex, male or female, is the dominant one. In addition, the subjects preferring hierarchy disparity in partnerships were with greater probability sexually aroused by such disparity, suggesting that both the partnership preference and the triggers of sexual arousal may reflect a mating strategy. These results challenge the frequently held belief in within-pair equality as a trademark of functional partnerships. It rather appears that existence of some disparity improves within-pair cohesion, facilitating both cooperation between partners and improving the pairs' ability to face societal challenges. The parallel existence of submissivity-dominance hierarchies within human sexes allows for the parallel existence of alternative reproductive strategies, and may form a background for the diversity of mating systems observed in human societies. Arousal of overemphasized dominance/submissiveness may explain sadomasochistic sex, still little understood from the evolutionary psychology point of view.

  14. Infants' statistical learning: 2- and 5-month-olds' segmentation of continuous visual sequences.

    PubMed

    Slone, Lauren Krogh; Johnson, Scott P

    2015-05-01

    Past research suggests that infants have powerful statistical learning abilities; however, studies of infants' visual statistical learning offer differing accounts of the developmental trajectory of and constraints on this learning. To elucidate this issue, the current study tested the hypothesis that young infants' segmentation of visual sequences depends on redundant statistical cues to segmentation. A sample of 20 2-month-olds and 20 5-month-olds observed a continuous sequence of looming shapes in which unit boundaries were defined by both transitional probability and co-occurrence frequency. Following habituation, only 5-month-olds showed evidence of statistically segmenting the sequence, looking longer to a statistically improbable shape pair than to a probable pair. These results reaffirm the power of statistical learning in infants as young as 5 months but also suggest considerable development of statistical segmentation ability between 2 and 5 months of age. Moreover, the results do not support the idea that infants' ability to segment visual sequences based on transitional probabilities and/or co-occurrence frequencies is functional at the onset of visual experience, as has been suggested previously. Rather, this type of statistical segmentation appears to be constrained by the developmental state of the learner. Factors contributing to the development of statistical segmentation ability during early infancy, including memory and attention, are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Operation of the PAVE PAWS Radar System at Beale Air Force Base, California. Part 2. Public Comment & AF Response.

    DTIC Science & Technology

    1980-07-01

    trip next month to Europe , and when I come back. It’s for this reason that I was not able to have it all typed and prepared, and the Air Force was...millimeter of culture medium. A mutational event such as a change in a single base pair in the bacterial DNA, which is impossible to detect by standard...100) bacteria, a rare single mutation event with a probability of say I in 100,000,000, the probability of 10-8, will thus be amplified by a factor of

  16. Dynamics of vortices in polariton quantum fluids : From full vortices, to half vortices and vortex pairs

    NASA Astrophysics Data System (ADS)

    Deveaud-Plédran, Benoit

    2012-02-01

    Polariton quantum fluids may be created both spontaneously through a standard phase transition towards a Bose Einstein condensate, or may be resonantly driven with a well-defined speed. Thanks to the photonic component of polaritons, the properties of the quantum fluid may be accessed rather directly with in particular the possibility of detained interferometric studies. Here, I will detail the dynamics of vortices, obtained with a picosecond time resolution, in different configurations, with in particular their phase dynamics. I will show in particular the dynamics the dynamics of spontaneous creation of a vortex, the dissociation of a full vortex into two half vortices as well as the dynamics of the dissociation of a dark soliton line into a street of pairs of vortices. Work done at EPFL by a dream team of Postdocs PhD students and collaborators: K. Lagoudakis, G. Nardin, T. Paraiso, G. Grosso, F. Manni, Y L'eger, M. Portella Oberli, F. Morier-Genoud and the help of our friend theorists V, Savona, M. Vouters and T. Liew.

  17. Domain topology and domain switching kinetics in a hybrid improper ferroelectric

    PubMed Central

    Huang, F. -T.; Xue, F.; Gao, B.; Wang, L. H.; Luo, X.; Cai, W.; Lu, X. -Z.; Rondinelli, J. M.; Chen, L. Q.; Cheong, S. -W.

    2016-01-01

    Charged polar interfaces such as charged ferroelectric walls or heterostructured interfaces of ZnO/(Zn,Mg)O and LaAlO3/SrTiO3, across which the normal component of electric polarization changes suddenly, can host large two-dimensional conduction. Charged ferroelectric walls, which are energetically unfavourable in general, were found to be mysteriously abundant in hybrid improper ferroelectric (Ca,Sr)3Ti2O7 crystals. From the exploration of antiphase boundaries in bilayer-perovskites, here we discover that each of four polarization-direction states is degenerate with two antiphase domains, and these eight structural variants form a Z4 × Z2 domain structure with Z3 vortices and five distinct types of domain walls, whose topology is directly relevant to the presence of abundant charged walls. We also discover a zipper-like nature of antiphase boundaries, which are the reversible creation/annihilation centres of pairs of two types of ferroelectric walls (and also Z3-vortex pairs) in 90° and 180° polarization switching. Our results demonstrate the unexpectedly rich nature of hybrid improper ferroelectricity. PMID:27215944

  18. Measuring Charge Collection Efficiency in Diamond Vertex Detectors

    NASA Astrophysics Data System (ADS)

    Josey, Brian; Seidel, Sally; Hoeferkamp, Martin

    2011-10-01

    As currently used at the Large Hadron Collider, vertex detectors are composed primarily of silicon sensors that image particle tracks by detecting the creation of electron-hole pairs caused by the excitation of the silicon atoms. We are investigating replacing these silicon detectors with detectors made out of diamond. Diamond is advantageous due to its radiation hardness. We are measuring the charge collection efficiency of diamond as a function of fluence. We are building a characterization station. Diamond samples will be placed into the characterization station and exposed to a strontium-90 beta source, before and after I irradiate them with 800 MeV protons at LANL. The radiation from the Sr-90 source will create electron-hole pairs. These will be read out by applying an electric field across the sample. The system is triggered by a scintillator-photomultiplier tube assembly. The goal of this measurement is to record collected charge as a function of bias voltage. The diamond charge collection data will be compared to silicon and predictions about detector operation at the LHC will be made.

  19. Triple helical DNA in a duplex context and base pair opening

    PubMed Central

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  20. The separation distance distribution in electron-donor-acceptor systems and the wavelength dependence of free ion yields

    NASA Astrophysics Data System (ADS)

    Zhou, Jinwei; Findley, Bret R.; Braun, Charles L.; Sutin, Norman

    2001-06-01

    We recently reported that free radical ion quantum yields for electron-donor-acceptor (EDA) systems of alkylbenzenes-tetracyanoethylene (TCNE) exhibit a remarkable wavelength dependence in dichloromethane, a medium polarity solvent. We proposed that weak absorption by long-distance, unassociated or "random" D⋯A pairs is mainly responsible for the free radical ion yield. Here a model for the wavelength dependence of the free ion yield is developed for four systems in which differing degrees of EDA complex formation are present: 1,3,5-tri-tert-butylbenzene-TCNE in which only random pairs exist due to the bulky groups on the electron donor, and toluene—TCNE, 1,3,5-triethylbenzene-TCNE and 1,3,5-trimethylbenzene-TCNE. Mulliken-Hush theory is used to determine the excitation distance distribution of unassociated, random pairs at different wavelengths. For each absorption distribution, free radical ion yields at different wavelengths are then calculated using Onsager's result for the ion separation probability. Encouraging agreement between the calculated yields and our experimental results is obtained. As far as we are aware, this is the first time that photoexcitation of unassociated donor/acceptor pairs has been invoked as the source of separated radical ion pairs.

  1. An Effective Big Data Supervised Imbalanced Classification Approach for Ortholog Detection in Related Yeast Species

    PubMed Central

    Galpert, Deborah; del Río, Sara; Herrera, Francisco; Ancede-Gallardo, Evys; Antunes, Agostinho; Agüero-Chapin, Guillermin

    2015-01-01

    Orthology detection requires more effective scaling algorithms. In this paper, a set of gene pair features based on similarity measures (alignment scores, sequence length, gene membership to conserved regions, and physicochemical profiles) are combined in a supervised pairwise ortholog detection approach to improve effectiveness considering low ortholog ratios in relation to the possible pairwise comparison between two genomes. In this scenario, big data supervised classifiers managing imbalance between ortholog and nonortholog pair classes allow for an effective scaling solution built from two genomes and extended to other genome pairs. The supervised approach was compared with RBH, RSD, and OMA algorithms by using the following yeast genome pairs: Saccharomyces cerevisiae-Kluyveromyces lactis, Saccharomyces cerevisiae-Candida glabrata, and Saccharomyces cerevisiae-Schizosaccharomyces pombe as benchmark datasets. Because of the large amount of imbalanced data, the building and testing of the supervised model were only possible by using big data supervised classifiers managing imbalance. Evaluation metrics taking low ortholog ratios into account were applied. From the effectiveness perspective, MapReduce Random Oversampling combined with Spark SVM outperformed RBH, RSD, and OMA, probably because of the consideration of gene pair features beyond alignment similarities combined with the advances in big data supervised classification. PMID:26605337

  2. Pair and triplet approximation of a spatial lattice population model with multiscale dispersal using Markov chains for estimating spatial autocorrelation.

    PubMed

    Hiebeler, David E; Millett, Nicholas E

    2011-06-21

    We investigate a spatial lattice model of a population employing dispersal to nearest and second-nearest neighbors, as well as long-distance dispersal across the landscape. The model is studied via stochastic spatial simulations, ordinary pair approximation, and triplet approximation. The latter method, which uses the probabilities of state configurations of contiguous blocks of three sites as its state variables, is demonstrated to be greatly superior to pair approximations for estimating spatial correlation information at various scales. Correlations between pairs of sites separated by arbitrary distances are estimated by constructing spatial Markov processes using the information from both approximations. These correlations demonstrate why pair approximation misses basic qualitative features of the model, such as decreasing population density as a large proportion of offspring are dropped on second-nearest neighbors, and why triplet approximation is able to include them. Analytical and numerical results show that, excluding long-distance dispersal, the initial growth rate of an invading population is maximized and the equilibrium population density is also roughly maximized when the population spreads its offspring evenly over nearest and second-nearest neighboring sites. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. An Effective Big Data Supervised Imbalanced Classification Approach for Ortholog Detection in Related Yeast Species.

    PubMed

    Galpert, Deborah; Del Río, Sara; Herrera, Francisco; Ancede-Gallardo, Evys; Antunes, Agostinho; Agüero-Chapin, Guillermin

    2015-01-01

    Orthology detection requires more effective scaling algorithms. In this paper, a set of gene pair features based on similarity measures (alignment scores, sequence length, gene membership to conserved regions, and physicochemical profiles) are combined in a supervised pairwise ortholog detection approach to improve effectiveness considering low ortholog ratios in relation to the possible pairwise comparison between two genomes. In this scenario, big data supervised classifiers managing imbalance between ortholog and nonortholog pair classes allow for an effective scaling solution built from two genomes and extended to other genome pairs. The supervised approach was compared with RBH, RSD, and OMA algorithms by using the following yeast genome pairs: Saccharomyces cerevisiae-Kluyveromyces lactis, Saccharomyces cerevisiae-Candida glabrata, and Saccharomyces cerevisiae-Schizosaccharomyces pombe as benchmark datasets. Because of the large amount of imbalanced data, the building and testing of the supervised model were only possible by using big data supervised classifiers managing imbalance. Evaluation metrics taking low ortholog ratios into account were applied. From the effectiveness perspective, MapReduce Random Oversampling combined with Spark SVM outperformed RBH, RSD, and OMA, probably because of the consideration of gene pair features beyond alignment similarities combined with the advances in big data supervised classification.

  4. Survival probability of a truncated radial oscillator subject to periodic kicks

    NASA Astrophysics Data System (ADS)

    Tanabe, Seiichi; Watanabe, Shinichi; Saif, Farhan; Matsuzawa, Michio

    2002-03-01

    Classical and quantum survival probabilities are compared for a truncated radial oscillator undergoing impulsive interactions with periodic laser pulses represented here as kicks. The system is truncated in the sense that the harmonic potential is made valid only within a finite range; the rest of the space is treated as a perfect absorber. Exploring extended values of the parameters of this model [Phys. Rev. A 63, 052721 (2001)], we supplement discussions on classical and quantum features near resonances. The classical system proves to be quasi-integrable and preserves phase-space area despite the momentum transfered by the kicks, exhibiting simple yet rich phase-space features. A geometrical argument reveals quantum-classical correspondence in the locations of minima in the paired survival probabilities while the ``ionization'' rates differ due to quantum tunneling.

  5. Recovering a Probabilistic Knowledge Structure by Constraining Its Parameter Space

    ERIC Educational Resources Information Center

    Stefanutti, Luca; Robusto, Egidio

    2009-01-01

    In the Basic Local Independence Model (BLIM) of Doignon and Falmagne ("Knowledge Spaces," Springer, Berlin, 1999), the probabilistic relationship between the latent knowledge states and the observable response patterns is established by the introduction of a pair of parameters for each of the problems: a lucky guess probability and a careless…

  6. New Center Applies Cost-Benefit Analysis to Education Policies

    ERIC Educational Resources Information Center

    Viadero, Debra

    2008-01-01

    This article describes the Center for Benefit-Cost Studies of Education, at Teachers College, Columbia University. Launched last year by a pair of economists, the center specializes in calculating and comparing the long- and short-term costs--and probable payoffs--of different educational strategies that promise to improve students' lives. Studies…

  7. Across Space and Time: Infants Learn from Backward and Forward Visual Statistics

    ERIC Educational Resources Information Center

    Tummeltshammer, Kristen; Amso, Dima; French, Robert M.; Kirkham, Natasha Z.

    2017-01-01

    This study investigates whether infants are sensitive to backward and forward transitional probabilities within temporal and spatial visual streams. Two groups of 8-month-old infants were familiarized with an artificial grammar of shapes, comprising backward and forward base pairs (i.e. two shapes linked by strong backward or forward transitional…

  8. Probabilistic biological network alignment.

    PubMed

    Todor, Andrei; Dobra, Alin; Kahveci, Tamer

    2013-01-01

    Interactions between molecules are probabilistic events. An interaction may or may not happen with some probability, depending on a variety of factors such as the size, abundance, or proximity of the interacting molecules. In this paper, we consider the problem of aligning two biological networks. Unlike existing methods, we allow one of the two networks to contain probabilistic interactions. Allowing interaction probabilities makes the alignment more biologically relevant at the expense of explosive growth in the number of alternative topologies that may arise from different subsets of interactions that take place. We develop a novel method that efficiently and precisely characterizes this massive search space. We represent the topological similarity between pairs of aligned molecules (i.e., proteins) with the help of random variables and compute their expected values. We validate our method showing that, without sacrificing the running time performance, it can produce novel alignments. Our results also demonstrate that our method identifies biologically meaningful mappings under a comprehensive set of criteria used in the literature as well as the statistical coherence measure that we developed to analyze the statistical significance of the similarity of the functions of the aligned protein pairs.

  9. Medium effects in λK+ pair production by 2.83 GeV protons on nuclei

    NASA Astrophysics Data System (ADS)

    Paryev, E. Ya.; Hartmann, M.; Kiselev, Yu. T.

    2017-12-01

    We study ΛK+ pair production in the interaction of protons of 2.83 GeV kinetic energy with C, Cu, Ag, and Au target nuclei in the framework of the nuclear spectral function approach for incoherent primary proton-nucleon and secondary pion-nucleon production processes, and processes associated with the creation of intermediate Σ0K+ pairs. The approach accounts for the initial proton and final Λ hyperon absorption, final K+ meson distortion in nuclei, target nucleon binding, and Fermi motion, as well as nuclear mean-field potential effects on these processes. We calculate the Λ momentum dependence of the absolute ΛK+ yield from the target nuclei considered, in the kinematical conditions of the ANKE experiment, performed at COSY, within the different scenarios for the Λ-nucleus effective scalar potential. We show that the above observable is appreciably sensitive to this potential in the low-momentum region. Therefore, direct comparison of the results of our calculations with the data from the ANKE-at-COSY experiment can help to determine the above potential at finite momenta. We also demonstrate that the two-step pion-nucleon production channels dominate in the low-momentum ΛK+ production in the chosen kinematics and, therefore, they have to be taken into account in the analysis of these data. Supported by the Ministry of Education and Science of the Russian Federation

  10. Anomalous maximum and minimum for the dissociation of a geminate pair in energetically disordered media

    NASA Astrophysics Data System (ADS)

    Govatski, J. A.; da Luz, M. G. E.; Koehler, M.

    2015-01-01

    We study the geminated pair dissociation probability φ as function of applied electric field and temperature in energetically disordered nD media. Regardless nD, for certain parameters regions φ versus the disorder degree (σ) displays anomalous minimum (maximum) at low (moderate) fields. This behavior is compatible with a transport energy which reaches a maximum and then decreases to negative values as σ increases. Our results explain the temperature dependence of the persistent photoconductivity in C60 single crystals going through order-disorder transitions. They also indicate how an energetic disorder spatial variation may contribute to higher exciton dissociation in multicomponent donor/acceptor systems.

  11. Search for first generation leptoquark pair production in the electron + missing energy + jets final state

    DOE PAGES

    Abazov, Victor Mukhamedovich

    2011-10-11

    We present a search for the pair production of first generation scalar leptoquarks (LQ) in data corresponding to an integrated luminosity of 5.4 fb -1 collected with the D0 detector at the Fermilab Tevatron Collider in pp collisions at √s = 1.96 TeV. In the channel LQLQ → eqν eq, where q,q are u or d quarks, no significant excess of data over background is observed, and we set a 95% C.L. lower limit of 326 GeV on the leptoquark mass, assuming equal probabilities of leptoquark decays to eq and ν eq.

  12. A new exact and more powerful unconditional test of no treatment effect from binary matched pairs.

    PubMed

    Lloyd, Chris J

    2008-09-01

    We consider the problem of testing for a difference in the probability of success from matched binary pairs. Starting with three standard inexact tests, the nuisance parameter is first estimated and then the residual dependence is eliminated by maximization, producing what I call an E+M P-value. The E+M P-value based on McNemar's statistic is shown numerically to dominate previous suggestions, including partially maximized P-values as described in Berger and Sidik (2003, Statistical Methods in Medical Research 12, 91-108). The latter method, however, may have computational advantages for large samples.

  13. The genetics of early telencephalon patterning: some assembly required

    PubMed Central

    Hébert, Jean M.; Fishell, Gord

    2009-01-01

    The immense range of human behaviours is rooted in the complex neural networks of the cerebrum. The creation of these networks depends on the precise integration of specific neuronal subtypes that are born in different regions of the telencephalon. Here, using the mouse as a model system, we review how these proliferative zones are established. Moreover, we discuss how these regions can be traced back in development to the function of a few key genes, including those that encode fibroblast growth factors (FGFs), sonic hedgehog (SHH), bone morphogenetic proteins (BMPs), forkhead box G1 (FoxG1), paired box 6 (PAX6) and LIM homeobox protein 2 (LHX2), that pattern the early telencephalon. PMID:19143049

  14. Is nucleon spin structure inconsistent with the constituent quark model?

    NASA Astrophysics Data System (ADS)

    Qing, Di; Chen, Xiang-Song; Wang, Fan

    1998-12-01

    Proton spin structure discovered in polarized deep inelastic scattering is shown to be consistent with the valence-sea quark mixing constituent quark model. The relativistic correction and quark-antiquark pair creation (annihilation) terms inherently involved in the quark axial vector current suppress the quark spin contribution to the proton spin. The relativistic quark orbital angular momentum provides compensative terms to keep the proton spin 12 untouched. The tensor charge of the proton is predicted to have a similar but smaller suppression. An explanation on why baryon magnetic moments can be parametrized by the naive quark model spin content as well as the spin structure discovered in polarized deep inelastic scattering is given.

  15. Crack Tip Dislocation Nucleation in FCC Solids

    NASA Astrophysics Data System (ADS)

    Knap, J.; Sieradzki, K.

    1999-02-01

    We present results of molecular dynamic simulations aimed at examining crack tip dislocation emission in fcc solids. The results are analyzed in terms of recent continuum formulations of this problem. In mode II, Au, Pd, and Pt displayed a new unanticipated mechanism of crack tip dislocation emission involving the creation of a pair of Shockley partials on a slip plane one plane below the crack plane. In mode I, for all the materials examined, Rice's continuum formulation [J. Mech. Phys. Solids 40, 239 (1992)] underestimated the stress intensity for dislocation emission by almost a factor of 2. Surface stress corrections to the emission criterion brought the agreement between continuum predictions and simulations to within 20%.

  16. Clonidine versus nitroglycerin infusion in laparoscopic cholecystectomy.

    PubMed

    Mishra, Manjaree; Mishra, Shashi Prakash; Mathur, Sharad Kumar

    2014-01-01

    Laparoscopic surgery offers the advantages of minimally invasive surgery; however, pneumoperitoneum and the patient's position induce pathophysiological changes that may complicate anesthetic management. We studied the effect of clonidine and nitroglycerin on heart rate and blood pressure, if any, in association with these drugs or the procedure, as well as the effect of these drugs, if any, on end-tidal carbon dioxide pressure and intraocular pressure. Sixty patients (minimum age of 20 years and maximum age of 65 years, American Society of Anesthesiologists class I or II) undergoing laparoscopic cholecystectomy were randomized into 3 groups and given an infusion of clonidine (group I), nitroglycerin (group II), or normal saline solution (group III) after induction and before creation of pneumoperitoneum. We observed and recorded the following parameters: heart rate, mean arterial blood pressure, end-tidal carbon dioxide pressure, and intraocular pressure. The mean and standard deviation of the parameters studied during the observation period were calculated for the 3 treatment groups and compared by use of analysis of variance tests. Intragroup comparison was performed with the paired t test. The critical value of P, indicating the probability of a significant difference, was taken as < .05 for comparisons. Statistically significant differences in heart rate were observed among the various groups, whereas comparisons of mean arterial pressure, intraocular pressure, and end-tidal carbon dioxide pressure showed statistically significant differences only between groups I and III and between groups II and III. We found clonidine to be more effective than nitroglycerin at preventing changes in hemodynamic parameters and intraocular pressure induced by carbon dioxide insufflation during laparoscopic cholecystectomy. It was also found not to cause hypotension severe enough to stop the infusion and warrant treatment.

  17. Clonidine Versus Nitroglycerin Infusion in Laparoscopic Cholecystectomy

    PubMed Central

    Mishra, Manjaree; Mishra, Shashi Prakash

    2014-01-01

    Background and Objectives: Laparoscopic surgery offers the advantages of minimally invasive surgery; however, pneumoperitoneum and the patient's position induce pathophysiological changes that may complicate anesthetic management. We studied the effect of clonidine and nitroglycerin on heart rate and blood pressure, if any, in association with these drugs or the procedure, as well as the effect of these drugs, if any, on end-tidal carbon dioxide pressure and intraocular pressure. Methods: Sixty patients (minimum age of 20 years and maximum age of 65 years, American Society of Anesthesiologists class I or II) undergoing laparoscopic cholecystectomy were randomized into 3 groups and given an infusion of clonidine (group I), nitroglycerin (group II), or normal saline solution (group III) after induction and before creation of pneumoperitoneum. We observed and recorded the following parameters: heart rate, mean arterial blood pressure, end-tidal carbon dioxide pressure, and intraocular pressure. The mean and standard deviation of the parameters studied during the observation period were calculated for the 3 treatment groups and compared by use of analysis of variance tests. Intragroup comparison was performed with the paired t test. The critical value of P, indicating the probability of a significant difference, was taken as < .05 for comparisons. Results: Statistically significant differences in heart rate were observed among the various groups, whereas comparisons of mean arterial pressure, intraocular pressure, and end-tidal carbon dioxide pressure showed statistically significant differences only between groups I and III and between groups II and III. Conclusion: We found clonidine to be more effective than nitroglycerin at preventing changes in hemodynamic parameters and intraocular pressure induced by carbon dioxide insufflation during laparoscopic cholecystectomy. It was also found not to cause hypotension severe enough to stop the infusion and warrant treatment. PMID:25392635

  18. Bioinformatics algorithm based on a parallel implementation of a machine learning approach using transducers

    NASA Astrophysics Data System (ADS)

    Roche-Lima, Abiel; Thulasiram, Ruppa K.

    2012-02-01

    Finite automata, in which each transition is augmented with an output label in addition to the familiar input label, are considered finite-state transducers. Transducers have been used to analyze some fundamental issues in bioinformatics. Weighted finite-state transducers have been proposed to pairwise alignments of DNA and protein sequences; as well as to develop kernels for computational biology. Machine learning algorithms for conditional transducers have been implemented and used for DNA sequence analysis. Transducer learning algorithms are based on conditional probability computation. It is calculated by using techniques, such as pair-database creation, normalization (with Maximum-Likelihood normalization) and parameters optimization (with Expectation-Maximization - EM). These techniques are intrinsically costly for computation, even worse when are applied to bioinformatics, because the databases sizes are large. In this work, we describe a parallel implementation of an algorithm to learn conditional transducers using these techniques. The algorithm is oriented to bioinformatics applications, such as alignments, phylogenetic trees, and other genome evolution studies. Indeed, several experiences were developed using the parallel and sequential algorithm on Westgrid (specifically, on the Breeze cluster). As results, we obtain that our parallel algorithm is scalable, because execution times are reduced considerably when the data size parameter is increased. Another experience is developed by changing precision parameter. In this case, we obtain smaller execution times using the parallel algorithm. Finally, number of threads used to execute the parallel algorithm on the Breezy cluster is changed. In this last experience, we obtain as result that speedup is considerably increased when more threads are used; however there is a convergence for number of threads equal to or greater than 16.

  19. A master equation and moment approach for biochemical systems with creation-time-dependent bimolecular rate functions

    PubMed Central

    Chevalier, Michael W.; El-Samad, Hana

    2014-01-01

    Noise and stochasticity are fundamental to biology and derive from the very nature of biochemical reactions where thermal motion of molecules translates into randomness in the sequence and timing of reactions. This randomness leads to cell-to-cell variability even in clonal populations. Stochastic biochemical networks have been traditionally modeled as continuous-time discrete-state Markov processes whose probability density functions evolve according to a chemical master equation (CME). In diffusion reaction systems on membranes, the Markov formalism, which assumes constant reaction propensities is not directly appropriate. This is because the instantaneous propensity for a diffusion reaction to occur depends on the creation times of the molecules involved. In this work, we develop a chemical master equation for systems of this type. While this new CME is computationally intractable, we make rational dimensional reductions to form an approximate equation, whose moments are also derived and are shown to yield efficient, accurate results. This new framework forms a more general approach than the Markov CME and expands upon the realm of possible stochastic biochemical systems that can be efficiently modeled. PMID:25481130

  20. Strong metal-support interactions

    NASA Technical Reports Server (NTRS)

    Vannice, M. Albert

    1987-01-01

    It has been demonstrated that synergistic metal-support effects can occur which markedly enhance specific activity and alter selectivity in certain reactions. Because of the presence of such effects in certain reactions conducted under reducing conditions (that is, under H2 pressure), but not others, the creation of unique sites at the metal-support interface seems to be the best model at the present time to explain this behavior. The postulation of these sites, which are specific for a certain reactant such as CO, provides an effective explanation for the higher methanation rates that have been reported over some catalysts. The creation of these sites in the adlineation zone is facilitated by hydrogen spillover from the metal surface, and this same process can also enhance the reduction of many oxide supports. Although oxygen spillover is much less probable due to its higher heat of adsorption, it is much less well understood and the possibility of rate enhancements in CO oxidation caused by special interface sites cannot be discounted at the present time. Consequently, this seems to be an important area of future research.

  1. A master equation and moment approach for biochemical systems with creation-time-dependent bimolecular rate functions

    NASA Astrophysics Data System (ADS)

    Chevalier, Michael W.; El-Samad, Hana

    2014-12-01

    Noise and stochasticity are fundamental to biology and derive from the very nature of biochemical reactions where thermal motion of molecules translates into randomness in the sequence and timing of reactions. This randomness leads to cell-to-cell variability even in clonal populations. Stochastic biochemical networks have been traditionally modeled as continuous-time discrete-state Markov processes whose probability density functions evolve according to a chemical master equation (CME). In diffusion reaction systems on membranes, the Markov formalism, which assumes constant reaction propensities is not directly appropriate. This is because the instantaneous propensity for a diffusion reaction to occur depends on the creation times of the molecules involved. In this work, we develop a chemical master equation for systems of this type. While this new CME is computationally intractable, we make rational dimensional reductions to form an approximate equation, whose moments are also derived and are shown to yield efficient, accurate results. This new framework forms a more general approach than the Markov CME and expands upon the realm of possible stochastic biochemical systems that can be efficiently modeled.

  2. Linkage of Viral Sequences among HIV-Infected Village Residents in Botswana: Estimation of Linkage Rates in the Presence of Missing Data

    PubMed Central

    Carnegie, Nicole Bohme; Wang, Rui; Novitsky, Vladimir; De Gruttola, Victor

    2014-01-01

    Linkage analysis is useful in investigating disease transmission dynamics and the effect of interventions on them, but estimates of probabilities of linkage between infected people from observed data can be biased downward when missingness is informative. We investigate variation in the rates at which subjects' viral genotypes link across groups defined by viral load (low/high) and antiretroviral treatment (ART) status using blood samples from household surveys in the Northeast sector of Mochudi, Botswana. The probability of obtaining a sequence from a sample varies with viral load; samples with low viral load are harder to amplify. Pairwise genetic distances were estimated from aligned nucleotide sequences of HIV-1C env gp120. It is first shown that the probability that randomly selected sequences are linked can be estimated consistently from observed data. This is then used to develop estimates of the probability that a sequence from one group links to at least one sequence from another group under the assumption of independence across pairs. Furthermore, a resampling approach is developed that accounts for the presence of correlation across pairs, with diagnostics for assessing the reliability of the method. Sequences were obtained for 65% of subjects with high viral load (HVL, n = 117), 54% of subjects with low viral load but not on ART (LVL, n = 180), and 45% of subjects on ART (ART, n = 126). The probability of linkage between two individuals is highest if both have HVL, and lowest if one has LVL and the other has LVL or is on ART. Linkage across groups is high for HVL and lower for LVL and ART. Adjustment for missing data increases the group-wise linkage rates by 40–100%, and changes the relative rates between groups. Bias in inferences regarding HIV viral linkage that arise from differential ability to genotype samples can be reduced by appropriate methods for accommodating missing data. PMID:24415932

  3. Linkage of viral sequences among HIV-infected village residents in Botswana: estimation of linkage rates in the presence of missing data.

    PubMed

    Carnegie, Nicole Bohme; Wang, Rui; Novitsky, Vladimir; De Gruttola, Victor

    2014-01-01

    Linkage analysis is useful in investigating disease transmission dynamics and the effect of interventions on them, but estimates of probabilities of linkage between infected people from observed data can be biased downward when missingness is informative. We investigate variation in the rates at which subjects' viral genotypes link across groups defined by viral load (low/high) and antiretroviral treatment (ART) status using blood samples from household surveys in the Northeast sector of Mochudi, Botswana. The probability of obtaining a sequence from a sample varies with viral load; samples with low viral load are harder to amplify. Pairwise genetic distances were estimated from aligned nucleotide sequences of HIV-1C env gp120. It is first shown that the probability that randomly selected sequences are linked can be estimated consistently from observed data. This is then used to develop estimates of the probability that a sequence from one group links to at least one sequence from another group under the assumption of independence across pairs. Furthermore, a resampling approach is developed that accounts for the presence of correlation across pairs, with diagnostics for assessing the reliability of the method. Sequences were obtained for 65% of subjects with high viral load (HVL, n = 117), 54% of subjects with low viral load but not on ART (LVL, n = 180), and 45% of subjects on ART (ART, n = 126). The probability of linkage between two individuals is highest if both have HVL, and lowest if one has LVL and the other has LVL or is on ART. Linkage across groups is high for HVL and lower for LVL and ART. Adjustment for missing data increases the group-wise linkage rates by 40-100%, and changes the relative rates between groups. Bias in inferences regarding HIV viral linkage that arise from differential ability to genotype samples can be reduced by appropriate methods for accommodating missing data.

  4. Efficient pairwise RNA structure prediction using probabilistic alignment constraints in Dynalign

    PubMed Central

    2007-01-01

    Background Joint alignment and secondary structure prediction of two RNA sequences can significantly improve the accuracy of the structural predictions. Methods addressing this problem, however, are forced to employ constraints that reduce computation by restricting the alignments and/or structures (i.e. folds) that are permissible. In this paper, a new methodology is presented for the purpose of establishing alignment constraints based on nucleotide alignment and insertion posterior probabilities. Using a hidden Markov model, posterior probabilities of alignment and insertion are computed for all possible pairings of nucleotide positions from the two sequences. These alignment and insertion posterior probabilities are additively combined to obtain probabilities of co-incidence for nucleotide position pairs. A suitable alignment constraint is obtained by thresholding the co-incidence probabilities. The constraint is integrated with Dynalign, a free energy minimization algorithm for joint alignment and secondary structure prediction. The resulting method is benchmarked against the previous version of Dynalign and against other programs for pairwise RNA structure prediction. Results The proposed technique eliminates manual parameter selection in Dynalign and provides significant computational time savings in comparison to prior constraints in Dynalign while simultaneously providing a small improvement in the structural prediction accuracy. Savings are also realized in memory. In experiments over a 5S RNA dataset with average sequence length of approximately 120 nucleotides, the method reduces computation by a factor of 2. The method performs favorably in comparison to other programs for pairwise RNA structure prediction: yielding better accuracy, on average, and requiring significantly lesser computational resources. Conclusion Probabilistic analysis can be utilized in order to automate the determination of alignment constraints for pairwise RNA structure prediction methods in a principled fashion. These constraints can reduce the computational and memory requirements of these methods while maintaining or improving their accuracy of structural prediction. This extends the practical reach of these methods to longer length sequences. The revised Dynalign code is freely available for download. PMID:17445273

  5. Morphometric analyses of hominoid crania, probabilities of conspecificity and an approximation of a biological species constant.

    PubMed

    Thackeray, J F; Dykes, S

    2016-02-01

    Thackeray has previously explored the possibility of using a morphometric approach to quantify the "amount" of variation within species and to assess probabilities of conspecificity when two fossil specimens are compared, instead of "pigeon-holing" them into discrete species. In an attempt to obtain a statistical (probabilistic) definition of a species, Thackeray has recognized an approximation of a biological species constant (T=-1.61) based on the log-transformed standard error of the coefficient m (log sem) in regression analysis of cranial and other data from pairs of specimens of conspecific extant species, associated with regression equations of the form y=mx+c where m is the slope and c is the intercept, using measurements of any specimen A (x axis), and any specimen B of the same species (y axis). The log-transformed standard error of the co-efficient m (log sem) is a measure of the degree of similarity between pairs of specimens, and in this study shows central tendency around a mean value of -1.61 and standard deviation 0.10 for modern conspecific specimens. In this paper we focus attention on the need to take into account the range of difference in log sem values (Δlog sem or "delta log sem") obtained from comparisons when specimen A (x axis) is compared to B (y axis), and secondly when specimen A (y axis) is compared to B (x axis). Thackeray's approach can be refined to focus on high probabilities of conspecificity for pairs of specimens for which log sem is less than -1.61 and for which Δlog sem is less than 0.03. We appeal for the adoption of a concept here called "sigma taxonomy" (as opposed to "alpha taxonomy"), recognizing that boundaries between species are not always well defined. Copyright © 2015 Elsevier GmbH. All rights reserved.

  6. Heavy Quark Correlations and J / Φ Production in Heavy Ion Collisions

    NASA Astrophysics Data System (ADS)

    Niazi, Reza; Liu, Yunpeng; Ko, Che-Ming

    2014-09-01

    Quark Gluon Plasma (QGP), a phase of QCD matter, was the temporary state that all matter had in the universe microseconds after its creation, which has been produced in high energy nucleus-nucleus collisions at the Relativistic Heavy Ion Collider (RHIC) and the Large Hadron Collider (LHC). Normally being bound inside a proton or neutron, due to the strong nuclear force, the QGP is a hot ``soup'' of quarks and gluons that move relatively freely. QGP is still a very enigmatic state of matter; therefore, active work is being done in trying to understand what is left behind after this short-lived state of matter disintegrates. This includes the abundance of the charmonium meson that consists of a pair of heavy charm and anticharm quarks. In this study, a QGP simulation called the Parton Cascade Model is used with two different initial conditions to see if charm and anticharm quarks can create a charmonium meson in the expanding QGP. In the simulation, the charm quark pair is initially either correlated, with opposite momenta but same position, or uncorrelated, with random momenta and positions, within the QGP. Understanding the difference of the amount of charmonium mesons produced in these two conditions will be helpful in developing theoretical models for charmonium production in heavy ion collisions and thus determining the properties of QGP from experimental measurements. Quark Gluon Plasma (QGP), a phase of QCD matter, was the temporary state that all matter had in the universe microseconds after its creation, which has been produced in high energy nucleus-nucleus collisions at the Relativistic Heavy Ion Collider (RHIC) and the Large Hadron Collider (LHC). Normally being bound inside a proton or neutron, due to the strong nuclear force, the QGP is a hot ``soup'' of quarks and gluons that move relatively freely. QGP is still a very enigmatic state of matter; therefore, active work is being done in trying to understand what is left behind after this short-lived state of matter disintegrates. This includes the abundance of the charmonium meson that consists of a pair of heavy charm and anticharm quarks. In this study, a QGP simulation called the Parton Cascade Model is used with two different initial conditions to see if charm and anticharm quarks can create a charmonium meson in the expanding QGP. In the simulation, the charm quark pair is initially either correlated, with opposite momenta but same position, or uncorrelated, with random momenta and positions, within the QGP. Understanding the difference of the amount of charmonium mesons produced in these two conditions will be helpful in developing theoretical models for charmonium production in heavy ion collisions and thus determining the properties of QGP from experimental measurements. Funded by DOE and NSF-REU Program.

  7. End-to-end distance and contour length distribution functions of DNA helices

    NASA Astrophysics Data System (ADS)

    Zoli, Marco

    2018-06-01

    I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

  8. Cross-contact chain

    NASA Technical Reports Server (NTRS)

    Lieneweg, Udo (Inventor)

    1988-01-01

    A system is provided for use with wafers that include multiple integrated circuits that include two conductive layers in contact at multiple interfaces. Contact chains are formed beside the integrated circuits, each contact chain formed of the same two layers as the circuits, in the form of conductive segments alternating between the upper and lower layers and with the ends of the segments connected in series through interfaces. A current source passes a current through the series-connected segments, by way of a pair of current tabs connected to opposite ends of the series of segments. While the current flows, voltage measurements are taken between each of a plurality of pairs of voltage tabs, the two tabs of each pair connected to opposite ends of an interface that lies along the series-connected segments. A plot of interface conductances on a normal probability chart, enables prediction of the yield of good integrated circuits from the wafer.

  9. Cross-contact chain

    NASA Technical Reports Server (NTRS)

    Lieneweg, U. (Inventor)

    1986-01-01

    A system is provided for use with wafers that include multiple integrated circuits that include two conductive layers in contact at multiple interfaces. Contact chains are formed beside the integrated circuits, each contact chain formed of the same two layers as the circuits, in the form of conductive segments alternating between the upper and lower layers and with the ends of the segments connected in series through interfaces. A current source passes a current through the series-connected segments, by way of a pair of current tabs connected to opposite ends of the series of segments. While the current flows, voltage measurements are taken between each of a plurality of pairs of voltage tabs, the two tabs of each pair connected to opposite ends of an interface that lies along the series-connected segments. A plot of interface conductances on normal probability chart enables prediction of the yield of good integrated circuits from the wafer.

  10. Reliability evaluation of a multistate network subject to time constraint under routing policy

    NASA Astrophysics Data System (ADS)

    Lin, Yi-Kuei

    2013-08-01

    A multistate network is a stochastic network composed of multistate arcs in which each arc has several possible capacities and may fail due to failure, maintenance, etc. The quality of a multistate network depends on how to meet the customer's requirements and how to provide the service in time. The system reliability, the probability that a given amount of data can be transmitted through a pair of minimal paths (MPs) simultaneously under the time constraint, is a proper index to evaluate the quality of a multistate network. An efficient solution procedure is first proposed to calculate it. In order to further enhance the system reliability, the network administrator decides the routing policy in advance to indicate the first and the second priority pairs of MPs. The second priority pair of MPs takes charge of the transmission duty if the first fails. The system reliability under the routing policy can be subsequently evaluated.

  11. General theory of the multistage geminate reactions of the isolated pairs of reactants. II. Detailed balance and universal asymptotes of kinetics.

    PubMed

    Kipriyanov, Alexey A; Doktorov, Alexander B

    2014-10-14

    The analysis of general (matrix) kinetic equations for the mean survival probabilities of any of the species in a sample (or mean concentrations) has been made for a wide class of the multistage geminate reactions of the isolated pairs. These kinetic equations (obtained in the frame of the kinetic approach based on the concept of "effective" particles in Paper I) take into account various possible elementary reactions (stages of a multistage reaction) excluding monomolecular, but including physical and chemical processes of the change in internal quantum states carried out with the isolated pairs of reactants (or isolated reactants). The general basic principles of total and detailed balance have been established. The behavior of the reacting system has been considered on macroscopic time scales, and the universal long-term kinetics has been determined.

  12. Conformation of viroids.

    PubMed Central

    Henco, K; Riesner, D; Sanger, H L

    1977-01-01

    Viroids are uncoated infectious RNA molecules (MW 107 000-127 000) known as pathogens of certain higher plants. Thermodynamic and kinetic studies were carried out on highly purified viroid preparations by applying UV-absorption melting analysis and temperature jump methods. The thermal denaturation of viroids is characterized by high thermal stability, high cooperativity and a high degree of base pairing. Two relaxation processes could be resolved; a process in the sec range could be evaluated as an independent all-or-none-transition with the following properties: reaction enthalpy= 550 kcal/mol, activation enthalpy of the dissociation = 470 kcal/mol; G : C content = 72 %. These data indicate the existence of an uninterrupted double helix of 52 base pairs. A process in the msec range involves 15 - 25 base pairs which are most probably distributed over several short double helical stretches. A tentative model for the secondary structure of viroids isproposed and the possible functional implications of their physicochemical properties are discussed. PMID:866174

  13. Generalized quantum interference of correlated photon pairs.

    PubMed

    Kim, Heonoh; Lee, Sang Min; Moon, Han Seb

    2015-05-07

    Superposition and indistinguishablility between probability amplitudes have played an essential role in observing quantum interference effects of correlated photons. The Hong-Ou-Mandel interference and interferences of the path-entangled photon number state are of special interest in the field of quantum information technologies. However, a fully generalized two-photon quantum interferometric scheme accounting for the Hong-Ou-Mandel scheme and path-entangled photon number states has not yet been proposed. Here we report the experimental demonstrations of the generalized two-photon interferometry with both the interferometric properties of the Hong-Ou-Mandel effect and the fully unfolded version of the path-entangled photon number state using photon-pair sources, which are independently generated by spontaneous parametric down-conversion. Our experimental scheme explains two-photon interference fringes revealing single- and two-photon coherence properties in a single interferometer setup. Using the proposed interferometric measurement, it is possible to directly estimate the joint spectral intensity of a photon pair source.

  14. Experiment and modeling of paired effect on evacuation from a three-dimensional space

    NASA Astrophysics Data System (ADS)

    Jun, Hu; Huijun, Sun; Juan, Wei; Xiaodan, Chen; Lei, You; Musong, Gu

    2014-10-01

    A novel three-dimensional cellular automata evacuation model was proposed based on stairs factor for paired effect and variety velocities in pedestrian evacuation. In the model pedestrians' moving probability of target position at the next moment was defined based on distance profit and repulsive force profit, and evacuation strategy was elaborated in detail through analyzing variety velocities and repulsive phenomenon in moving process. At last, experiments with the simulation platform were conducted to study the relationships of evacuation time, average velocity and pedestrian velocity. The results showed that when the ratio of single pedestrian was higher in the system, the shortest route strategy was good for improving evacuation efficiency; in turn, if ratio of paired pedestrians was higher, it is good for improving evacuation efficiency to adopt strategy that avoided conflicts, and priority should be given to scattered evacuation.

  15. The place of the Local Group in the cosmic web

    NASA Astrophysics Data System (ADS)

    Forero-Romero, Jaime E.; González, Roberto

    2016-10-01

    We use the Bolshoi Simulation to find the most probable location of the Local Group (LG) in the cosmic web. Our LG simulacra are pairs of halos with isolation and kinematic properties consistent with observations. The cosmic web is defined using a tidal tensor approach. We find that the LG's preferred location is regions with a dark matter overdensity close to the cosmic average. This makes filaments and sheets the preferred environment. We also find a strong alignment between the LG and the cosmic web. The orbital angular momentum is preferentially perpendicular to the smallest tidal eigenvector, while the vector connecting the two halos is strongly aligned along the the smallest tidal eigenvector and perpendicular to the largest tidal eigenvector; the pair lies and moves along filaments and sheets. We do not find any evidence for an alignment between the spin of each halo in the pair and the cosmic web.

  16. Quantum control on entangled bipartite qubits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delgado, Francisco

    2010-04-15

    Ising interactions between qubits can produce distortion on entangled pairs generated for engineering purposes (e.g., for quantum computation or quantum cryptography). The presence of parasite magnetic fields destroys or alters the expected behavior for which it was intended. In addition, these pairs are generated with some dispersion in their original configuration, so their discrimination is necessary for applications. Nevertheless, discrimination should be made after Ising distortion. Quantum control helps in both problems; making some projective measurements upon the pair to decide the original state to replace it, or just trying to reconstruct it using some procedures which do not altermore » their quantum nature. Results about the performance of these procedures are reported. First, we will work with pure systems studying restrictions and advantages. Then, we will extend these operations for mixed states generated with uncertainty in the time of distortion, correcting them by assuming the control prescriptions for the most probable one.« less

  17. Statistical models for predicting pair dispersion and particle clustering in isotropic turbulence and their applications

    NASA Astrophysics Data System (ADS)

    Zaichik, Leonid I.; Alipchenkov, Vladimir M.

    2009-10-01

    The purpose of this paper is twofold: (i) to advance and extend the statistical two-point models of pair dispersion and particle clustering in isotropic turbulence that were previously proposed by Zaichik and Alipchenkov (2003 Phys. Fluids15 1776-87 2007 Phys. Fluids 19, 113308) and (ii) to present some applications of these models. The models developed are based on a kinetic equation for the two-point probability density function of the relative velocity distribution of two particles. These models predict the pair relative velocity statistics and the preferential accumulation of heavy particles in stationary and decaying homogeneous isotropic turbulent flows. Moreover, the models are applied to predict the effect of particle clustering on turbulent collisions, sedimentation and intensity of microwave radiation as well as to calculate the mean filtered subgrid stress of the particulate phase. Model predictions are compared with direct numerical simulations and experimental measurements.

  18. General theory of multistage geminate reactions of isolated pairs of reactants. I. Kinetic equations.

    PubMed

    Doktorov, Alexander B; Kipriyanov, Alexey A

    2014-05-14

    General matrix approach to the consideration of multistage geminate reactions of isolated pairs of reactants depending on reactant mobility is formulated on the basis of the concept of "effective" particles. Various elementary reactions (stages of multistage reaction including physicochemical processes of internal quantum state changes) proceeding with the participation of isolated pairs of reactants (or isolated reactants) are taken into account. Investigation has been made in terms of kinetic approach implying the derivation of general (matrix) kinetic equations for local and mean probabilities of finding any of the reaction species in the sample under study (or for local and mean concentrations). The recipes for the calculation of kinetic coefficients of the equations for mean quantities in terms of relative coordinates of reactants have been formulated in the general case of inhomogeneous reacting systems. Important specific case of homogeneous reacting systems is considered.

  19. Longitudinal Study of Hepatitis A Infection by Saliva Sampling: The Kinetics of HAV Markers in Saliva Revealed the Application of Saliva Tests for Hepatitis A Study.

    PubMed

    Amado Leon, Luciane Almeida; de Almeida, Adilson José; de Paula, Vanessa Salete; Tourinho, Renata Santos; Villela, Daniel Antunes Maciel; Gaspar, Ana Maria Coimbra; Lewis-Ximenez, Lia Laura; Pinto, Marcelo Alves

    2015-01-01

    Despite the increasing numbers of studies investigating hepatitis A diagnostic through saliva, the frequency and the pattern of hepatitis A virus (HAV) markers in this fluid still remains unknown. To address this issue, we carried on a longitudinal study to examine the kinetics of HAV markers in saliva, in comparison with serum samples. The present study followed-up ten patients with acute hepatitis A infection during 180 days post diagnosis (dpd). Total anti-HAV was detected in paired serum and saliva samples until the end of the follow-up, showing a peak titer at 90th. However, total anti-HAV level was higher in serum than in saliva samples. This HAV marker showed a probability of 100% to be detected in both serum and saliva during 180 dpd. The IgM anti-HAV could be detected in saliva up to 150 dpd, showing the highest frequency at 30th, when it was detected in all individuals. During the first month of HAV infection, this acute HAV marker showed a detection probability of 100% in paired samples. The detection of IgM anti-HAV in saliva was not dependent on its level in serum, HAV-RNA detection and/or viral load, since no association was found between IgM anti-HAV positivity in saliva and any of these parameter (p>0.05). Most of the patients (80%) were found to contain HAV-RNA in saliva, mainly at early acute phase (30th day). However, it was possible to demonstrate the HAV RNA presence in paired samples for more than 90 days, even after seroconversion. No significant relationship was observed between salivary HAV-RNA positivity and serum viral load, demonstrating that serum viral load is not predictive of HAV-RNA detection in saliva. Similar viral load was seen in paired samples (on average 104 copies/mL). These data demonstrate that the best diagnostic coverage can be achieved by salivary anti-HAV antibodies and HAV-RNA tests during 30-90 dpd. The long detection and high probability of specific-HAV antibodies positivity in saliva samples make the assessment of salivary antibodies a useful tool for diagnosis and epidemiological studies. The high frequency of HAV-RNA in saliva and the probability of detection of about 50%, during the first 30 dpd, demonstrate that saliva is also useful for molecular investigation of hepatitis A cases, mainly during the early course of infection. Therefore, the collection of saliva may provide a simple, cheap and non-invasive means of diagnosis, epidemiological surveys and monitoring of hepatitis A infection purposes.

  20. Longitudinal Study of Hepatitis A Infection by Saliva Sampling: The Kinetics of HAV Markers in Saliva Revealed the Application of Saliva Tests for Hepatitis A Study

    PubMed Central

    Amado Leon, Luciane Almeida; de Almeida, Adilson José; de Paula, Vanessa Salete; Tourinho, Renata Santos; Villela, Daniel Antunes Maciel; Gaspar, Ana Maria Coimbra; Lewis-Ximenez, Lia Laura; Pinto, Marcelo Alves

    2015-01-01

    Despite the increasing numbers of studies investigating hepatitis A diagnostic through saliva, the frequency and the pattern of hepatitis A virus (HAV) markers in this fluid still remains unknown. To address this issue, we carried on a longitudinal study to examine the kinetics of HAV markers in saliva, in comparison with serum samples. The present study followed-up ten patients with acute hepatitis A infection during 180 days post diagnosis (dpd). Total anti-HAV was detected in paired serum and saliva samples until the end of the follow-up, showing a peak titer at 90th. However, total anti-HAV level was higher in serum than in saliva samples. This HAV marker showed a probability of 100% to be detected in both serum and saliva during 180 dpd. The IgM anti-HAV could be detected in saliva up to 150 dpd, showing the highest frequency at 30th, when it was detected in all individuals. During the first month of HAV infection, this acute HAV marker showed a detection probability of 100% in paired samples. The detection of IgM anti-HAV in saliva was not dependent on its level in serum, HAV-RNA detection and/or viral load, since no association was found between IgM anti-HAV positivity in saliva and any of these parameter (p>0.05). Most of the patients (80%) were found to contain HAV-RNA in saliva, mainly at early acute phase (30th day). However, it was possible to demonstrate the HAV RNA presence in paired samples for more than 90 days, even after seroconversion. No significant relationship was observed between salivary HAV-RNA positivity and serum viral load, demonstrating that serum viral load is not predictive of HAV-RNA detection in saliva. Similar viral load was seen in paired samples (on average 104 copies/mL). These data demonstrate that the best diagnostic coverage can be achieved by salivary anti-HAV antibodies and HAV-RNA tests during 30–90 dpd. The long detection and high probability of specific-HAV antibodies positivity in saliva samples make the assessment of salivary antibodies a useful tool for diagnosis and epidemiological studies. The high frequency of HAV-RNA in saliva and the probability of detection of about 50%, during the first 30 dpd, demonstrate that saliva is also useful for molecular investigation of hepatitis A cases, mainly during the early course of infection. Therefore, the collection of saliva may provide a simple, cheap and non-invasive means of diagnosis, epidemiological surveys and monitoring of hepatitis A infection purposes. PMID:26690904

  1. Phonotactic Probability Effects in Children Who Stutter

    PubMed Central

    Anderson, Julie D.; Byrd, Courtney T.

    2008-01-01

    Purpose The purpose of this study was to examine the influence of phonotactic probability, the frequency of different sound segments and segment sequences, on the overall fluency with which words are produced by preschool children who stutter (CWS), as well as to determine whether it has an effect on the type of stuttered disfluency produced. Method A 500+ word language sample was obtained from 19 CWS. Each stuttered word was randomly paired with a fluently produced word that closely matched it in grammatical class, word length, familiarity, word and neighborhood frequency, and neighborhood density. Phonotactic probability values were obtained for the stuttered and fluent words from an online database. Results Phonotactic probability did not have a significant influence on the overall susceptibility of words to stuttering, but it did impact the type of stuttered disfluency produced. In specific, single-syllable word repetitions were significantly lower in phonotactic probability than fluently produced words, as well as part-word repetitions and sound prolongations. Conclusions In general, the differential impact of phonotactic probability on the type of stuttering-like disfluency produced by young CWS provides some support for the notion that different disfluency types may originate in the disruption of different levels of processing. PMID:18658056

  2. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    PubMed Central

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  3. Predicted sequence of cortical tau and amyloid-β deposition in Alzheimer disease spectrum.

    PubMed

    Cho, Hanna; Lee, Hye Sun; Choi, Jae Yong; Lee, Jae Hoon; Ryu, Young Hoon; Lee, Myung Sik; Lyoo, Chul Hyoung

    2018-04-17

    We investigated sequential order between tau and amyloid-β (Aβ) deposition in Alzheimer disease spectrum using a conditional probability method. Two hundred twenty participants underwent 18 F-flortaucipir and 18 F-florbetaben positron emission tomography scans and neuropsychological tests. The presence of tau and Aβ in each region and impairment in each cognitive domain were determined by Z-score cutoffs. By comparing pairs of conditional probabilities, the sequential order of tau and Aβ deposition were determined. Probability for the presence of tau in the entorhinal cortex was higher than that of Aβ in all cortical regions, and in the medial temporal cortices, probability for the presence of tau was higher than that of Aβ. Conversely, in the remaining neocortex above the inferior temporal cortex, probability for the presence of Aβ was always higher than that of tau. Tau pathology in the entorhinal cortex may appear earlier than neocortical Aβ and may spread in the absence of Aβ within the neighboring medial temporal regions. However, Aβ may be required for massive tau deposition in the distant cortical areas. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Interaction of paired cortical and peripheral nerve stimulation on human motor neurons.

    PubMed

    Poon, David E; Roy, Francois D; Gorassini, Monica A; Stein, Richard B

    2008-06-01

    This paper contrasts responses in the soleus muscle of normal human subjects to two major inputs: the tibial nerve (TN) and the corticospinal tract. Paired transcranial magnetic stimulation (TMS) of the motor cortex at intervals of 10-25 ms strongly facilitated the motor evoked potential (MEP) produced by the second stimulus. In contrast, paired TN stimulation produced a depression of the reflex response to the second stimulus. Direct activation of the pyramidal tract did not facilitate a second response, suggesting that the MEP facilitation observed using paired TMS occurred in the cortex. A TN stimulus also depressed a subsequent MEP. Since the TN stimulus depressed both inputs, the mechanism is probably post-synaptic, such as afterhyperpolarization of motor neurons. Presynaptic mechanisms, such as homosynaptic depression, would only affect the pathway used as a conditioning stimulus. When TN and TMS pulses were paired, the largest facilitation occurred when TMS preceded TN by about 5 ms, which is optimal for summation of the two pathways at the level of the spinal motor neurons. A later, smaller facilitation occurred when a single TN stimulus preceded TMS by 50-60 ms, an interval that allows enough time for the sensory afferent input to reach the sensory cortex and be relayed to the motor cortex. Other work indicates that repetitively pairing nerve stimuli and TMS at these intervals, known as paired associative stimulation, produces long-term increases in the MEP and may be useful in strengthening residual pathways after damage to the central nervous system.

  5. Using sightability-adjusted brood-pair ratios to estimate waterfowl productivity

    USGS Publications Warehouse

    Pagano, Anthony M.; Amundson, Courtney L.; Pieron, Matthew R.; Arnold, Todd W.; Kimmel, Timothy C.

    2014-01-01

    Historically, biologists used brood-pair ratios (BPRs) as an index to waterfowl productivity to help guide management decisions and evaluate conservation practices. However, BPRs are biased by imperfect detection probabilities, especially for broods. We conducted roadside surveys for breeding waterfowl pairs on 7–8 study sites in the springs of 2006–2008 in northeastern North Dakota, USA. Later each year, we conducted replicate counts of broods on the same wetlands and used mark–recapture methods to estimate sightability-adjusted BPRs (SA-BPRs). Traditional roadside brood surveys detected only 30–45% of the available broods, depending on species. We explored the potential for using SA-BPRs to measure hen success (i.e., the probability a female hatches ≥1 egg across all nesting attempts) for mallards (Anas platyrhynchos) and other upland-nesting dabbling ducks (Anas spp.). We found that SA-BPRs explained 40% of the variation in hen success over 5 species of dabbling ducks, and we were able to detect an effect of predator reduction on hen success in combined dabblers, but not in mallards alone. However, we found no relationship between SA-BPRs and mallard fledging rates (hen success × initial brood size × duckling survival). Our results suggest that SA-BPRs can provide a cost-effective alternative to traditional measures of productivity such as nesting success, but not to measures of duckling survival. Nevertheless, SA-BPRs may be useful in areas where traditional measures of waterfowl productivity are logistically or financially challenging.

  6. Performance of six diagnostic tests to screen for Chagas disease in blood banks andprevalence of Trypanosoma cruzi infection among donors with inconclusive serologyscreening based on the analysis of epidemiological variables.

    PubMed

    Pereira, Gilberto de Araujo; Louzada-Neto, Francisco; Barbosa, Valdirene de Fátima; Ferreira-Silva, Márcia Maria; de Moraes-Souza, Helio

    2012-01-01

    The frequent occurrence of inconclusive serology in blood banks and the absence of a gold standard test for Chagas'disease led us to examine the efficacy of the blood culture test and five commercial tests (ELISA, IIF, HAI, c-ELISA, rec-ELISA) used in screening blood donors for Chagas disease, as well as to investigate the prevalence of Trypanosoma cruzi infection among donors with inconclusive serology screening in respect to some epidemiological variables. To obtain estimates of interest we considered a Bayesian latent class model with inclusion of covariates from the logit link. A better performance was observed with some categories of epidemiological variables. In addition, all pairs of tests (excluding the blood culture test) presented as good alternatives for both screening (sensitivity > 99.96% in parallel testing) and for confirmation (specificity > 99.93% in serial testing) of Chagas disease. The prevalence of 13.30% observed in the stratum of donors with inconclusive serology, means that probably most of these are non-reactive serology. In addition, depending on the level of specific epidemiological variables, the absence of infection can be predicted with a probability of 100% in this group from the pairs of tests using parallel testing. The epidemiological variables can lead to improved test results and thus assist in the clarification of inconclusive serology screening results. Moreover, all combinations of pairs using the five commercial tests are good alternatives to confirm results.

  7. Interactions between similar and dissimilar charged interfaces in the presence of multivalent anions.

    PubMed

    Moazzami-Gudarzi, Mohsen; Adam, Pavel; Smith, Alexander M; Trefalt, Gregor; Szilágyi, István; Maroni, Plinio; Borkovec, Michal

    2018-04-04

    Direct force measurements involving amidine latex (AL) and sulfate latex (SL) particles in aqueous solutions containing multivalent ferrocyanide anions are presented. These measurements feature three different pairs of particles, namely SL-SL, AL-SL, and AL-AL. The force profiles are quantitatively interpreted in terms of the theory by Derjaguin, Landau, Verwey, and Overbeek (DLVO) that is combined with a short-ranged exponential attraction. In monovalent salt solutions, the AL particles are positively charged, while the SL particles are negatively charged. In solutions containing ferrocyanide, the charge of the AL particles is reversed as the concentration is increased. The longer-ranged component of all force profiles is fully compatible with DLVO theory, provided effects of charge regulation are included. At shorter distances, an additional exponential attraction must be introduced, whereby the respective decay length is about 2 nm for the AL-AL pair, and below 1 nm for the SL-SL pair. This non-DLVO force is intermediate for the asymmetric AL-SL pair. These additional forces are probably related to charge fluctuations, patch-charged interactions, or hydrophobic forces.

  8. Algorithmic information theory and the hidden variable question

    NASA Technical Reports Server (NTRS)

    Fuchs, Christopher

    1992-01-01

    The admissibility of certain nonlocal hidden-variable theories are explained via information theory. Consider a pair of Stern-Gerlach devices with fixed nonparallel orientations that periodically perform spin measurements on identically prepared pairs of electrons in the singlet spin state. Suppose the outcomes are recorded as binary strings l and r (with l sub n and r sub n denoting their n-length prefixes). The hidden-variable theories considered here require that there exists a recursive function which may be used to transform l sub n into r sub n for any n. This note demonstrates that such a theory cannot reproduce all the statistical predictions of quantum mechanics. Specifically, consider an ensemble of outcome pairs (l,r). From the associated probability measure, the Shannon entropies H sub n and H bar sub n for strings l sub n and pairs (l sub n, r sub n) may be formed. It is shown that such a theory requires that the absolute value of H bar sub n - H sub n be bounded - contrasting the quantum mechanical prediction that it grow with n.

  9. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    PubMed Central

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  10. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    PubMed

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  11. Magnetic photon splitting and gamma ray burst spectra

    NASA Technical Reports Server (NTRS)

    Baring, Matthew G.

    1992-01-01

    The splitting of photons into two photons becomes both possible and significant in magnetic fields in excess of 10(exp 12) Gauss. Below the threshold energy, 2m sub e c(exp 2) for single photon pair production, splitting can be an astronomically observable phenomenon evident in gamma ray burst spectra. In such circumstances, it was found that magnetic photon splitting reprocesses the gamma ray burst continuum by degrading the photon energy, with a net effect that is quite similar to pair cascade reprocessing of the spectrum. Results are presented for the spectral modifications due to splitting, taking into account the different probabilities for splitting for different polarization modes. Unpolarized and polarized pair cascade photon spectra form the input spectra for the model, which calculates the resulting splitting reprocessed spectra numerically by solving the photon kinetic equations for each polarization mode. This inclusion of photon polarizations is found to not alter previous predictions that splitting produce a significant flattening of the hard X ray continuum and a bump at MeV energies below a pair production turnover. The spectrum near the bump is always strongly polarized.

  12. Unbiased clustering estimation in the presence of missing observations

    NASA Astrophysics Data System (ADS)

    Bianchi, Davide; Percival, Will J.

    2017-11-01

    In order to be efficient, spectroscopic galaxy redshift surveys do not obtain redshifts for all galaxies in the population targeted. The missing galaxies are often clustered, commonly leading to a lower proportion of successful observations in dense regions. One example is the close-pair issue for SDSS spectroscopic galaxy surveys, which have a deficit of pairs of observed galaxies with angular separation closer than the hardware limit on placing neighbouring fibres. Spatially clustered missing observations will exist in the next generations of surveys. Various schemes have previously been suggested to mitigate these effects, but none works for all situations. We argue that the solution is to link the missing galaxies to those observed with statistically equivalent clustering properties, and that the best way to do this is to rerun the targeting algorithm, varying the angular position of the observations. Provided that every pair has a non-zero probability of being observed in one realization of the algorithm, then a pair-upweighting scheme linking targets to successful observations, can correct these issues. We present such a scheme, and demonstrate its validity using realizations of an idealized simple survey strategy.

  13. Seismic risk assessment and application in the central United States

    USGS Publications Warehouse

    Wang, Z.

    2011-01-01

    Seismic risk is a somewhat subjective, but important, concept in earthquake engineering and other related decision-making. Another important concept that is closely related to seismic risk is seismic hazard. Although seismic hazard and seismic risk have often been used interchangeably, they are fundamentally different: seismic hazard describes the natural phenomenon or physical property of an earthquake, whereas seismic risk describes the probability of loss or damage that could be caused by a seismic hazard. The distinction between seismic hazard and seismic risk is of practical significance because measures for seismic hazard mitigation may differ from those for seismic risk reduction. Seismic risk assessment is a complicated process and starts with seismic hazard assessment. Although probabilistic seismic hazard analysis (PSHA) is the most widely used method for seismic hazard assessment, recent studies have found that PSHA is not scientifically valid. Use of PSHA will lead to (1) artifact estimates of seismic risk, (2) misleading use of the annual probability of exccedance (i.e., the probability of exceedance in one year) as a frequency (per year), and (3) numerical creation of extremely high ground motion. An alternative approach, which is similar to those used for flood and wind hazard assessments, has been proposed. ?? 2011 ASCE.

  14. The Movable Type Method Applied to Protein-Ligand Binding.

    PubMed

    Zheng, Zheng; Ucisik, Melek N; Merz, Kenneth M

    2013-12-10

    Accurately computing the free energy for biological processes like protein folding or protein-ligand association remains a challenging problem. Both describing the complex intermolecular forces involved and sampling the requisite configuration space make understanding these processes innately difficult. Herein, we address the sampling problem using a novel methodology we term "movable type". Conceptually it can be understood by analogy with the evolution of printing and, hence, the name movable type. For example, a common approach to the study of protein-ligand complexation involves taking a database of intact drug-like molecules and exhaustively docking them into a binding pocket. This is reminiscent of early woodblock printing where each page had to be laboriously created prior to printing a book. However, printing evolved to an approach where a database of symbols (letters, numerals, etc.) was created and then assembled using a movable type system, which allowed for the creation of all possible combinations of symbols on a given page, thereby, revolutionizing the dissemination of knowledge. Our movable type (MT) method involves the identification of all atom pairs seen in protein-ligand complexes and then creating two databases: one with their associated pairwise distant dependent energies and another associated with the probability of how these pairs can combine in terms of bonds, angles, dihedrals and non-bonded interactions. Combining these two databases coupled with the principles of statistical mechanics allows us to accurately estimate binding free energies as well as the pose of a ligand in a receptor. This method, by its mathematical construction, samples all of configuration space of a selected region (the protein active site here) in one shot without resorting to brute force sampling schemes involving Monte Carlo, genetic algorithms or molecular dynamics simulations making the methodology extremely efficient. Importantly, this method explores the free energy surface eliminating the need to estimate the enthalpy and entropy components individually. Finally, low free energy structures can be obtained via a free energy minimization procedure yielding all low free energy poses on a given free energy surface. Besides revolutionizing the protein-ligand docking and scoring problem this approach can be utilized in a wide range of applications in computational biology which involve the computation of free energies for systems with extensive phase spaces including protein folding, protein-protein docking and protein design.

  15. N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

    PubMed Central

    Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

    2013-01-01

    We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

  16. Ultrafast Coulomb explosion of a diiodomethane molecule induced by an X-ray free-electron laser pulse.

    PubMed

    Takanashi, Tsukasa; Nakamura, Kosuke; Kukk, Edwin; Motomura, Koji; Fukuzawa, Hironobu; Nagaya, Kiyonobu; Wada, Shin-Ichi; Kumagai, Yoshiaki; Iablonskyi, Denys; Ito, Yuta; Sakakibara, Yuta; You, Daehyun; Nishiyama, Toshiyuki; Asa, Kazuki; Sato, Yuhiro; Umemoto, Takayuki; Kariyazono, Kango; Ochiai, Kohei; Kanno, Manabu; Yamazaki, Kaoru; Kooser, Kuno; Nicolas, Christophe; Miron, Catalin; Asavei, Theodor; Neagu, Liviu; Schöffler, Markus; Kastirke, Gregor; Liu, Xiao-Jing; Rudenko, Artem; Owada, Shigeki; Katayama, Tetsuo; Togashi, Tadashi; Tono, Kensuke; Yabashi, Makina; Kono, Hirohiko; Ueda, Kiyoshi

    2017-08-02

    Coulomb explosion of diiodomethane CH 2 I 2 molecules irradiated by ultrashort and intense X-ray pulses from SACLA, the Japanese X-ray free electron laser facility, was investigated by multi-ion coincidence measurements and self-consistent charge density-functional-based tight-binding (SCC-DFTB) simulations. The diiodomethane molecule, containing two heavy-atom X-ray absorbing sites, exhibits a rather different charge generation and nuclear motion dynamics compared to iodomethane CH 3 I with only a single heavy atom, as studied earlier. We focus on charge creation and distribution in CH 2 I 2 in comparison to CH 3 I. The release of kinetic energy into atomic ion fragments is also studied by comparing SCC-DFTB simulations with the experiment. Compared to earlier simulations, several key enhancements are made, such as the introduction of a bond axis recoil model, where vibrational energy generated during charge creation processes induces only bond stretching or shrinking. We also propose an analytical Coulomb energy partition model to extract the essential mechanism of Coulomb explosion of molecules from the computed and the experimentally measured kinetic energies of fragment atomic ions by partitioning each pair Coulomb interaction energy into two ions of the pair under the constraint of momentum conservation. Effective internuclear distances assigned to individual fragment ions at the critical moment of the Coulomb explosion are then estimated from the average kinetic energies of the ions. We demonstrate, with good agreement between the experiment and the SCC-DFTB simulation, how the more heavily charged iodine fragments and their interplay define the characteristic features of the Coulomb explosion of CH 2 I 2 . The present study also confirms earlier findings concerning the magnitude of bond elongation in the ultrashort X-ray pulse duration, showing that structural damage to all but C-H bonds does not develop to a noticeable degree in the pulse length of ∼10 fs.

  17. Attentional Regulation in Young Twins with Probable Stuttering, High Nonfluency, and Typical Fluency

    ERIC Educational Resources Information Center

    Felsenfeld, Susan; van Beljsterveldt, Catharina Eugenie Maria; Boomsma, Dorret Irene

    2010-01-01

    Purpose: Using a sample of 20,445 Dutch twins, this study examined the relationship between speech fluency and attentional regulation in children. A secondary objective was to identify etiological overlap between nonfluency and poor attention using fluency-discordant twin pairs. Method: Three fluency groups were created at age 5 using a parent…

  18. Assessing risk to birds from industrial wind energy development via paired resource selection nodels

    Treesearch

    Tricia A. Miller; Robert P. Brooks; Michael Lanzone; David Brandes; Jeff Cooper; Kieran O' malley; Charles Maisonneuve; Junior Tremblay; Adam Duerr; Todd Katzner

    2014-01-01

    When wildlife habitat overlaps with industrial development animals may be harmed. Because wildlife and people select resources to maximize biological fitness and economic return, respectively, we estimated risk, the probability of eagles encountering and being affected by turbines, by overlaying models of resource selection for each entity. This conceptual framework...

  19. Coherent exciton transport in dendrimers and continuous-time quantum walks

    NASA Astrophysics Data System (ADS)

    Mülken, Oliver; Bierbaum, Veronika; Blumen, Alexander

    2006-03-01

    We model coherent exciton transport in dendrimers by continuous-time quantum walks. For dendrimers up to the second generation the coherent transport shows perfect recurrences when the initial excitation starts at the central node. For larger dendrimers, the recurrence ceases to be perfect, a fact which resembles results for discrete quantum carpets. Moreover, depending on the initial excitation site, we find that the coherent transport to certain nodes of the dendrimer has a very low probability. When the initial excitation starts from the central node, the problem can be mapped onto a line which simplifies the computational effort. Furthermore, the long time average of the quantum mechanical transition probabilities between pairs of nodes shows characteristic patterns and allows us to classify the nodes into clusters with identical limiting probabilities. For the (space) average of the quantum mechanical probability to be still or to be again at the initial site, we obtain, based on the Cauchy-Schwarz inequality, a simple lower bound which depends only on the eigenvalue spectrum of the Hamiltonian.

  20. Bond-length distributions for ions bonded to oxygen: results for the non-metals and discussion of lone-pair stereoactivity and the polymerization of PO4

    PubMed Central

    Gagné, Olivier Charles

    2018-01-01

    Bond-length distributions are examined for three configurations of the H+ ion, 16 configurations of the group 14–16 non-metal ions and seven configurations of the group 17 ions bonded to oxygen, for 223 coordination polyhedra and 452 bond distances for the H+ ion, 5957 coordination polyhedra and 22 784 bond distances for the group 14–16 non-metal ions, and 248 coordination polyhedra and 1394 bond distances for the group 17 non-metal ions. H⋯O and O—H + H⋯O distances correlate with O⋯O distance (R 2 = 0.94 and 0.96): H⋯O = 1.273 × O⋯O – 1.717 Å; O—H + H⋯O = 1.068 × O⋯O – 0.170 Å. These equations may be used to locate the hydrogen atom more accurately in a structure refined by X-ray diffraction. For non-metal elements that occur with lone-pair electrons, the most observed state between the n versus n+2 oxidation state is that of highest oxidation state for period 3 cations, and lowest oxidation state for period 4 and 5 cations when bonded to O2−. Observed O—X—O bond angles indicate that the period 3 non-metal ions P3+, S4+, Cl3+ and Cl5+ are lone-pair seteroactive when bonded to O2−, even though they do not form secondary bonds. There is no strong correlation between the degree of lone-pair stereoactivity and coordination number when including secondary bonds. There is no correlation between lone-pair stereoactivity and bond-valence sum at the central cation. In synthetic compounds, PO4 polymerizes via one or two bridging oxygen atoms, but not by three. Partitioning our PO4 dataset shows that multi-modality in the distribution of bond lengths is caused by the different bond-valence constraints that arise for Obr = 0, 1 and 2. For strongly bonded cations, i.e. oxyanions, the most probable cause of mean bond length variation is the effect of structure type, i.e. stress induced by the inability of a structure to follow its a priori bond lengths. For ions with stereoactive lone-pair electrons, the most probable cause of variation is bond-length distortion.

  1. Conformation of the Phosphate D-alanine Zwitterion in Bacterial Teichoic Acid from Nuclear Magnetic Resonance Spectroscopy

    PubMed Central

    Garimella, Ravindranath; Halye, Jeffrey L.; Harrison, William; Klebba, Phillip E.; Rice, Charles V.

    2009-01-01

    The conformation of D-alanine (D-Ala) groups of bacterial teichoic acid is a central, yet untested, paradigm of microbiology. The D-Ala binds via the C-terminus, thereby allowing the amine to exist as a free cationic NH3+ group with the ability to form a contact-ion-pair with the nearby anionic phosphate group. This conformation hinders metal chelation by the phosphate because the zwitterion pair is charge neutral. To the contrary, the repulsion of cationic antimicrobial peptides (CAMPs) is attributed to the presence of the D-Ala cation; thus the ion-pair does not form in this model. Solid-state nuclear magnetic resonance (NMR) spectroscopy has been used to measure the distance between amine and phosphate groups within cell wall fragments of Bacillus subtilis. The bacteria were grown on media containing 15N D-Ala and β-chloroalanine racemase inhibitor. The rotational-echo double-resonance (REDOR) pulse sequence was used to measure the internuclear dipolar coupling and the results demonstrate: 1) the metal-free amine-to-phosphate distance is 4.4 Å and 2) the amine-to-phosphate distance increases to 5.4 Å in the presence of Mg2+ ions. As a result, the zwitterion exists in a nitrogen-oxygen ion-pair configuration providing teichoic acid with a positive charge to repel CAMPs. Additionally, the amine of D-Ala does not prevent magnesium chelation in contradiction to the prevailing view of teichoic acids in metal binding. Thus, the NMR-based description of teichoic acid structure resolves the contradictory models, advances the basic understanding of cell wall biochemistry, and provides possible insight into the creation of new antibiotic therapies. PMID:19746945

  2. The origin of polynucleotide-directed protein synthesis

    NASA Technical Reports Server (NTRS)

    Orgel, Leslie E.

    1989-01-01

    If protein synthesis evolved in an RNA world it was probably preceded by simpler processes by means of which interaction with amino acids conferred selective advantage on replicating RNA molecules. It is suggested that at first the simple attachment of amino acids to the 2'(3') termini of RNA templates favored initiation of replication at the end of the template rather than at internal positions. The second stage in the evolution of protein synthesis would probably have been the association of pairs of charged RNA adaptors in such a way as to favor noncoded formation of peptides. Only after this process had become efficient could coded synthesis have begun.

  3. Modeling the Offensive-Defensive Interaction and Resulting Outcomes in Basketball.

    PubMed

    Lamas, Leonardo; Santana, Felipe; Heiner, Matthew; Ugrinowitsch, Carlos; Fellingham, Gilbert

    2015-01-01

    We analyzed the interaction between offensive (i.e. space creation dynamics--SCDs) and defensive (i.e. space protection dynamics--SPDs) actions in six play outcomes (free shot, contested shot, new SCD, reset, foul, and turnover) in Spanish professional basketball games. Data consisted of 1548 SCD-SPD-outcome triples obtained from six play-off games. We used Bayesian methods to compute marginal probabilities of six outcomes following five different SCDs. We also computed probabilities of the six outcomes following the 16 most frequent SCD-SPD combinations. The pick action (e.g. pick and roll, pop and pop) was the most prevalent SCD (33%). However, this SCD did not produce the highest probability of a free shot (0.235). The highest probability of a free shot followed the SCD without ball (0.409). The pick was performed not only to attempt scoring but also to initiate offenses, as it produced the highest probability leading to a new SCD (0.403). Additionally, the SPD performed influenced the outcome of the SCD. This reinforces the notion that the opposition (offensive-defensive interaction) should be considered. To the best of our knowledge, in team sports, this is the first study to successfully model the tactical features involved in offense-defense interactions. Our analyses revealed that the high frequency of occurrence of some SCDs may be justified not only by an associated high probability of free shots but also by the possibility of progressively create more space in the defense (i.e. a new SCD as outcome). In the second case, it evidences offensive strategic features of progressive disruption of the defensive system through the concatenation of subsequent offensive actions.

  4. Modeling the Offensive-Defensive Interaction and Resulting Outcomes in Basketball

    PubMed Central

    Lamas, Leonardo; Santana, Felipe; Heiner, Matthew; Ugrinowitsch, Carlos; Fellingham, Gilbert

    2015-01-01

    Purpose We analyzed the interaction between offensive (i.e. space creation dynamics -SCDs) and defensive (i.e. space protection dynamics—SPDs) actions in six play outcomes (free shot, contested shot, new SCD, reset, foul, and turnover) in Spanish professional basketball games. Method Data consisted of 1548 SCD-SPD-outcome triples obtained from six play-off games. We used Bayesian methods to compute marginal probabilities of six outcomes following five different SCDs. We also computed probabilities of the six outcomes following the 16 most frequent SCD-SPD combinations. Results The pick action (e.g. pick and roll, pop and pop) was the most prevalent SCD (33%). However, this SCD did not produce the highest probability of a free shot (0.235). The highest probability of a free shot followed the SCD without ball (0.409). The pick was performed not only to attempt scoring but also to initiate offenses, as it produced the highest probability leading to a new SCD (0.403). Additionally, the SPD performed influenced the outcome of the SCD. This reinforces the notion that the opposition (offensive-defensive interaction) should be considered. To the best of our knowledge, in team sports, this is the first study to successfully model the tactical features involved in offense-defense interactions. Our analyses revealed that the high frequency of occurrence of some SCDs may be justified not only by an associated high probability of free shots but also by the possibility of progressively create more space in the defense (i.e. a new SCD as outcome). In the second case, it evidences offensive strategic features of progressive disruption of the defensive system through the concatenation of subsequent offensive actions. PMID:26659134

  5. Optimization of Game Formats in U-10 Soccer Using Logistic Regression Analysis

    PubMed Central

    Amatria, Mario; Arana, Javier; Anguera, M. Teresa; Garzón, Belén

    2016-01-01

    Abstract Small-sided games provide young soccer players with better opportunities to develop their skills and progress as individual and team players. There is, however, little evidence on the effectiveness of different game formats in different age groups, and furthermore, these formats can vary between and even within countries. The Royal Spanish Soccer Association replaced the traditional grassroots 7-a-side format (F-7) with the 8-a-side format (F-8) in the 2011-12 season and the country’s regional federations gradually followed suit. The aim of this observational methodology study was to investigate which of these formats best suited the learning needs of U-10 players transitioning from 5-aside futsal. We built a multiple logistic regression model to predict the success of offensive moves depending on the game format and the area of the pitch in which the move was initiated. Success was defined as a shot at the goal. We also built two simple logistic regression models to evaluate how the game format influenced the acquisition of technicaltactical skills. It was found that the probability of a shot at the goal was higher in F-7 than in F-8 for moves initiated in the Creation Sector-Own Half (0.08 vs 0.07) and the Creation Sector-Opponent's Half (0.18 vs 0.16). The probability was the same (0.04) in the Safety Sector. Children also had more opportunities to control the ball and pass or take a shot in the F-7 format (0.24 vs 0.20), and these were also more likely to be successful in this format (0.28 vs 0.19). PMID:28031768

  6. The ALHAMBRA survey: accurate merger fractions derived by PDF analysis of photometrically close pairs

    NASA Astrophysics Data System (ADS)

    López-Sanjuan, C.; Cenarro, A. J.; Varela, J.; Viironen, K.; Molino, A.; Benítez, N.; Arnalte-Mur, P.; Ascaso, B.; Díaz-García, L. A.; Fernández-Soto, A.; Jiménez-Teja, Y.; Márquez, I.; Masegosa, J.; Moles, M.; Pović, M.; Aguerri, J. A. L.; Alfaro, E.; Aparicio-Villegas, T.; Broadhurst, T.; Cabrera-Caño, J.; Castander, F. J.; Cepa, J.; Cerviño, M.; Cristóbal-Hornillos, D.; Del Olmo, A.; González Delgado, R. M.; Husillos, C.; Infante, L.; Martínez, V. J.; Perea, J.; Prada, F.; Quintana, J. M.

    2015-04-01

    Aims: Our goal is to develop and test a novel methodology to compute accurate close-pair fractions with photometric redshifts. Methods: We improved the currently used methodologies to estimate the merger fraction fm from photometric redshifts by (i) using the full probability distribution functions (PDFs) of the sources in redshift space; (ii) including the variation in the luminosity of the sources with z in both the sample selection and the luminosity ratio constrain; and (iii) splitting individual PDFs into red and blue spectral templates to reliably work with colour selections. We tested the performance of our new methodology with the PDFs provided by the ALHAMBRA photometric survey. Results: The merger fractions and rates from the ALHAMBRA survey agree excellently well with those from spectroscopic work for both the general population and red and blue galaxies. With the merger rate of bright (MB ≤ -20-1.1z) galaxies evolving as (1 + z)n, the power-law index n is higher for blue galaxies (n = 2.7 ± 0.5) than for red galaxies (n = 1.3 ± 0.4), confirming previous results. Integrating the merger rate over cosmic time, we find that the average number of mergers per galaxy since z = 1 is Nmred = 0.57 ± 0.05 for red galaxies and Nmblue = 0.26 ± 0.02 for blue galaxies. Conclusions: Our new methodology statistically exploits all the available information provided by photometric redshift codes and yields accurate measurements of the merger fraction by close pairs from using photometric redshifts alone. Current and future photometric surveys will benefit from this new methodology. Based on observations collected at the German-Spanish Astronomical Center, Calar Alto, jointly operated by the Max-Planck-Institut für Astronomie (MPIA) at Heidelberg and the Instituto de Astrofísica de Andalucía (CSIC).The catalogues, probabilities, and figures of the ALHAMBRA close pairs detected in Sect. 5.1 are available at http://https://cloud.iaa.csic.es/alhambra/catalogues/ClosePairs

  7. An activity canyon characterization of the pharmacological topography.

    PubMed

    Kulkarni, Varsha S; Wild, David J

    2016-01-01

    Highly chemically similar drugs usually possess similar biological activities, but sometimes, small changes in chemistry can result in a large difference in biological effects. Chemically similar drug pairs that show extreme deviations in activity represent distinctive drug interactions having important implications. These associations between chemical and biological similarity are studied as discontinuities in activity landscapes. Particularly, activity cliffs are quantified by the drop in similar activity of chemically similar drugs. In this paper, we construct a landscape using a large drug-target network and consider the rises in similarity and variation in activity along the chemical space. Detailed analysis of structure and activity gives a rigorous quantification of distinctive pairs and the probability of their occurrence. We analyze pairwise similarity (s) and variation (d) in activity of drugs on proteins. Interactions between drugs are quantified by considering pairwise s and d weights jointly with corresponding chemical similarity (c) weights. Similarity and variation in activity are measured as the number of common and uncommon targets of two drugs respectively. Distinctive interactions occur between drugs having high c and above (below) average d (s). Computation of predicted probability of distinctiveness employs joint probability of c, s and of c, d assuming independence of structure and activity. Predictions conform with the observations at different levels of distinctiveness. Results are validated on the data used and another drug ensemble. In the landscape, while s and d decrease as c increases, d maintains value more than s. c ∈ [0.3, 0.64] is the transitional region where rises in d are significantly greater than drops in s. It is fascinating that distinctive interactions filtered with high d and low s are different in nature. It is crucial that high c interactions are more probable of having above average d than s. Identification of distinctive interactions is better with high d than low s. These interactions belong to diverse classes. d is greatest between drugs and analogs prepared for treatment of same class of ailments but with different therapeutic specifications. In contrast, analogs having low s would treat ailments from distinct classes. Intermittent spikes in d along the axis of c represent canyons in the activity landscape. This new representation accounts for distinctiveness through relative rises in s and d. It provides a mathematical basis for predicting the probability of occurrence of distinctiveness. It identifies the drug pairs at varying levels of distinctiveness and non-distinctiveness. The predicted probability formula is validated even if data approximately satisfy the conditions of its construction. Also, the postulated independence of structure and activity is of little significance to the overall assessment. The difference in distinctive interactions obtained by s and d highlights the importance of studying both of them, and reveals how the choice of measurement can affect the interpretation. The methods in this paper can be used to interpret whether or not drug interactions are distinctive and the probability of their occurrence. Practitioners and researchers can rely on this identification for quantitative modeling and assessment.

  8. Continuous-Time Monitoring of Landau-Zener Interference in a Cooper-Pair Box

    NASA Astrophysics Data System (ADS)

    Sillanpää, Mika; Lehtinen, Teijo; Paila, Antti; Makhlin, Yuriy; Hakonen, Pertti

    2006-05-01

    Landau-Zener (LZ) tunneling can occur with a certain probability when crossing energy levels of a quantum two-level system are swept across the minimum energy separation. Here we present experimental evidence of quantum interference effects in solid-state LZ tunneling. We used a Cooper-pair box qubit where the LZ tunneling occurs at the charge degeneracy. By employing a weak nondemolition monitoring, we observe interference between consecutive LZ-tunneling events; we find that the average level occupancies depend on the dynamical phase. The system’s unusually strong linear response is explained by interband relaxation. Our interferometer can be used as a high-resolution Mach-Zehnder type detector for phase and charge.

  9. Continuous-time monitoring of Landau-Zener interference in a cooper-pair box.

    PubMed

    Sillanpää, Mika; Lehtinen, Teijo; Paila, Antti; Makhlin, Yuriy; Hakonen, Pertti

    2006-05-12

    Landau-Zener (LZ) tunneling can occur with a certain probability when crossing energy levels of a quantum two-level system are swept across the minimum energy separation. Here we present experimental evidence of quantum interference effects in solid-state LZ tunneling. We used a Cooper-pair box qubit where the LZ tunneling occurs at the charge degeneracy. By employing a weak nondemolition monitoring, we observe interference between consecutive LZ-tunneling events; we find that the average level occupancies depend on the dynamical phase. The system's unusually strong linear response is explained by interband relaxation. Our interferometer can be used as a high-resolution Mach-Zehnder-type detector for phase and charge.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aaltonen, T.

    We search for resonant production of tt pairs in 4.8 fb -1 integrated luminosity of pp collision data at √s = 1.96 TeV in the lepton+jets decay channel, where one top quark decays leptonically and the other hadronically. A matrix element reconstruction technique is used; for each event a probability density function (pdf) of the tt candidate invariant mass is sampled. These pdfs are used to construct a likelihood function, whereby the cross section for resonant tt production is estimated, given a hypothetical resonance mass and width. The data indicate no evidence of resonant production of tt pairs. A benchmarkmore » model of leptophobic Z' → tt is excluded with m Z' < 900 GeV at 95% confidence level.« less

  11. Violation of continuous-variable Einstein-Podolsky-Rosen steering with discrete measurements.

    PubMed

    Schneeloch, James; Dixon, P Ben; Howland, Gregory A; Broadbent, Curtis J; Howell, John C

    2013-03-29

    In this Letter, we derive an entropic Einstein-Podolsky-Rosen (EPR) steering inequality for continuous-variable systems using only experimentally measured discrete probability distributions and details of the measurement apparatus. We use this inequality to witness EPR steering between the positions and momenta of photon pairs generated in spontaneous parametric down-conversion. We examine the asymmetry between parties in this inequality, and show that this asymmetry can be used to reduce the technical requirements of experimental setups intended to demonstrate the EPR paradox. Furthermore, we develop a more stringent steering inequality that is symmetric between parties, and use it to show that the down-converted photon pairs also exhibit symmetric EPR steering.

  12. Violation of Continuous-Variable Einstein-Podolsky-Rosen Steering with Discrete Measurements

    NASA Astrophysics Data System (ADS)

    Schneeloch, James; Dixon, P. Ben; Howland, Gregory A.; Broadbent, Curtis J.; Howell, John C.

    2013-03-01

    In this Letter, we derive an entropic Einstein-Podolsky-Rosen (EPR) steering inequality for continuous-variable systems using only experimentally measured discrete probability distributions and details of the measurement apparatus. We use this inequality to witness EPR steering between the positions and momenta of photon pairs generated in spontaneous parametric down-conversion. We examine the asymmetry between parties in this inequality, and show that this asymmetry can be used to reduce the technical requirements of experimental setups intended to demonstrate the EPR paradox. Furthermore, we develop a more stringent steering inequality that is symmetric between parties, and use it to show that the down-converted photon pairs also exhibit symmetric EPR steering.

  13. Identifications and limited spectroscopy for Luyten common proper motion stars with probable white dwarf components. I - Pair brighter than 17th magnitude

    NASA Technical Reports Server (NTRS)

    Oswalt, Terry D.; Hintzen, Paul M.; Luyten, Willem J.

    1988-01-01

    Identifications are provided for 103 bright Luyten common proper motion (CPM) stellar systems with m(pg) less than 17.0 mag containing likely white dwarf (WD) components. New spectral types are presented for 55 components, and spectral types for 51 more are available in the literature. With the CPM systems previously published by Giclas et al. (1978), the Luyten stars provide a uniform sample of nearly 200 pairs or multiples brighter than 17h magnitude. Selection effects biasing the combined samples are discussed; in particular, evidence is presented that fewer than 1 percent of wide WD binaries have been detected.

  14. Two-photon interference of polarization-entangled photons in a Franson interferometer.

    PubMed

    Kim, Heonoh; Lee, Sang Min; Kwon, Osung; Moon, Han Seb

    2017-07-18

    We present two-photon interference experiments with polarization-entangled photon pairs in a polarization-based Franson-type interferometer. Although the two photons do not meet at a common beamsplitter, a phase-insensitive Hong-Ou-Mandel type two-photon interference peak and dip fringes are observed, resulting from the two-photon interference effect between two indistinguishable two-photon probability amplitudes leading to a coincidence detection. A spatial quantum beating fringe is also measured for nondegenerate photon pairs in the same interferometer, although the two-photon states have no frequency entanglement. When unentangled polarization-correlated photons are used as an input state, the polarization entanglement is successfully recovered through the interferometer via delayed compensation.

  15. Dependence on solute concentration of the efficiency of scavenging of electrons in recombining geminate ion pairs

    NASA Astrophysics Data System (ADS)

    Tweeten, David W.; Lee, Kaidee; Lipsky, Sanford

    The fluorescence from solutions of hexafluorobenzene in cyclopentane, 2,2,4-trimethylpentane, 2,2-dimethylbutane and tetramethylsilane irradiated with β-particles has been studied as a function of the hexafluorobenzene concentration from c = 10 -3-10 -1 M. The data are analyzed to permit extraction of geminate ion-pair scavenging probability p†. This is found to have a dependence on c entirely similar to what has previously been reported for p† extracted from quenching of solvent fluorescence by perfluorocarbon scavengers, i.e. p† = (α c) 0.7/[1 + (α c) 0.7]. The difference between these results and that for p† obtained via measurement of chemical product formation is discussed.

  16. Landau-Zener transitions for Majorana fermions

    NASA Astrophysics Data System (ADS)

    Khlebnikov, Sergei

    2018-05-01

    One-dimensional systems obtained as low-energy limits of hybrid superconductor-topological insulator devices provide means of production, transport, and destruction of Majorana bound states (MBSs) by variations of the magnetic flux. When two or more pairs of MBSs are present in the intermediate state, there is a possibility of a Landau-Zener transition wherein even a slow variation of the flux leads to production of a quasiparticle pair. We study numerically a version of this process with four MBSs produced and subsequently destroyed and find that, quite universally, the probability of quasiparticle production in it is 50%. This implies that the effect may be a limiting factor in applications requiring a high degree of quantum coherence.

  17. Generation of Single Photons and Entangled Photon Pairs from a Quantum Dot

    NASA Astrophysics Data System (ADS)

    Yamamoto, Y.; Pelton, M.; Santori, C.; Solomon, G. S.

    2002-10-01

    Current quantum cryptography systems are limited by the Poissonian photon statistics of a standard light source: a security loophole is opened up by the possibility of multiple-photon pulses. By replacing the source with a single-photon emitter, transmission rates of secure information can be improved. A single photon source is also essential to implement a linear optics quantum computer. We have investigated the use of single self-assembled InAs/GaAs quantum dots as such single-photon sources, and have seen a hundred-fold reduction in the multi-photon probability as compared to Poissonian pulses. An extension of our experiment should also allow for the generation of triggered, polarizationentangled photon pairs.

  18. Electron-hole pair effects in methane dissociative chemisorption on Ni(111)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luo, Xuan; Jiang, Bin, E-mail: bjiangch@ustc.edu.cn; Juaristi, J. Iñaki

    The dissociative chemisorption of methane on metal surfaces has attracted much attention in recent years as a prototype of gas-surface reactions in understanding the mode specific and bond selective chemistry. In this work, we systematically investigate the influence of electron-hole pair excitations on the dissociative chemisorption of CH{sub 4}/CH{sub 3}D/CHD{sub 3} on Ni(111). The energy dissipation induced by surface electron-hole pair excitations is modeled as a friction force introduced in the generalized Langevin equation, in which the independent atomic friction coefficients are determined within the local-density friction approximation. Quasi-classical trajectory calculations for CH{sub 4}/CH{sub 3}D/CHD{sub 3} have been carried outmore » on a recently developed twelve-dimensional potential energy surface. Comparing the dissociation probabilities obtained with and without friction, our results clearly indicate that the electron-hole pair effects are generally small, both on absolute reactivity of each vibrational state and on the mode specificity and bond selectivity. Given similar observations in both water and methane dissociation processes, we conclude that electron-hole pair excitations would not play an important role as long as the reaction is direct and the interaction time between the molecule and metal electrons is relatively short.« less

  19. Multisensory integration across the senses in young and old adults

    PubMed Central

    Mahoney, Jeannette R.; Li, Po Ching Clara; Oh-Park, Mooyeon; Verghese, Joe; Holtzer, Roee

    2011-01-01

    Stimuli are processed concurrently and across multiple sensory inputs. Here we directly compared the effect of multisensory integration (MSI) on reaction time across three paired sensory inputs in eighteen young (M=19.17 yrs) and eighteen old (M=76.44 yrs) individuals. Participants were determined to be non-demented and without any medical or psychiatric conditions that would affect their performance. Participants responded to randomly presented unisensory (auditory, visual, somatosensory) stimuli and three paired sensory inputs consisting of auditory-somatosensory (AS) auditory-visual (AV) and visual-somatosensory (VS) stimuli. Results revealed that reaction time (RT) to all multisensory pairings was significantly faster than those elicited to the constituent unisensory conditions across age groups; findings that could not be accounted for by simple probability summation. Both young and old participants responded the fastest to multisensory pairings containing somatosensory input. Compared to younger adults, older adults demonstrated a significantly greater RT benefit when processing concurrent VS information. In terms of co-activation, older adults demonstrated a significant increase in the magnitude of visual-somatosensory co-activation (i.e., multisensory integration), while younger adults demonstrated a significant increase in the magnitude of auditory-visual and auditory-somatosensory co-activation. This study provides first evidence in support of the facilitative effect of pairing somatosensory with visual stimuli in older adults. PMID:22024545

  20. Energy-momentum restrictions on the creation of Gott time machines

    NASA Astrophysics Data System (ADS)

    Carroll, Sean M.; Farhi, Edward; Guth, Alan H.; Olum, Ken D.

    1994-11-01

    The discovery by Gott of a remarkably simple spacetime with closed timelike curves (CTC's) provides a tool for investigating how the creation of time machines is prevented in classical general relativity. The Gott spacetime contains two infinitely long, parallel cosmic strings, which can equivalently be viewed as point masses in (2+1)-dimensional gravity. We examine the possibility of building such a time machine in an open universe. Specifically, we consider initial data specified on an edgeless, noncompact, spacelike hypersurface, for which the total momentum is timelike (i.e., not the momentum of a Gott spacetime). In contrast to the case of a closed universe (in which Gott pairs, although not CTC's, can be produced from the decay of stationary particles), we find that there is never enough energy for a Gott-like time machine to evolve from the specified data; it is impossible to accelerate two particles to a sufficiently high velocity. Thus, the no-CTC theorems of Tipler and Hawking are enforced in an open (2+1)-dimensional universe by a mechanism different from that which operates in a closed universe. In proving our result, we develop a simple method to understand the inequalities that restrict the result of combining momenta in (2+1)-dimensional gravity.

Top