Triple helical DNA in a duplex context and base pair opening

PubMed Central

Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

2014-01-01

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

PubMed Central

2017-01-01

Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

Study of recreational land and open space using Skylab imagery

NASA Technical Reports Server (NTRS)

Sattinger, I. J. (Principal Investigator)

1975-01-01

The author has identified the following significant results. An analysis of the statistical uniqueness of each of the signatures of the Gratiot-Saginaw State Game Area was made by computing a matrix of probabilities of misclassification for all possible signature pairs. Within each data set, the 35 signatures were then aggregated into a smaller set of composite signatures by combining groups of signatures having high probabilities of misclassification. Computer separation of forest denisty classes was poor with multispectral scanner data collected on 5 August 1973. Signatures from the scanner data were further analyzed to determine the ranking of spectral channels for computer separation of the scene classes. Probabilities of misclassification were computed for composite signatures using four separate combinations of data source and channel selection.

Generation of Single Photons and Entangled Photon Pairs from a Quantum Dot

NASA Astrophysics Data System (ADS)

Yamamoto, Y.; Pelton, M.; Santori, C.; Solomon, G. S.

2002-10-01

Current quantum cryptography systems are limited by the Poissonian photon statistics of a standard light source: a security loophole is opened up by the possibility of multiple-photon pulses. By replacing the source with a single-photon emitter, transmission rates of secure information can be improved. A single photon source is also essential to implement a linear optics quantum computer. We have investigated the use of single self-assembled InAs/GaAs quantum dots as such single-photon sources, and have seen a hundred-fold reduction in the multi-photon probability as compared to Poissonian pulses. An extension of our experiment should also allow for the generation of triggered, polarizationentangled photon pairs.

Triplet correlation in sheared suspensions of Brownian particles

NASA Astrophysics Data System (ADS)

Yurkovetsky, Yevgeny; Morris, Jeffrey F.

2006-05-01

Triplet microstructure of sheared concentrated suspensions of Brownian monodisperse spherical particles is studied by sampling realizations of a three-dimensional unit cell subject to periodic boundary conditions obtained in accelerated Stokesian dynamics simulations. Triplets are regarded as a bridge between particle pairs and many-particle clusters thought responsible for shear thickening. Triplet-correlation data for weakly sheared near-equilibrium systems display an excluded volume effect of accumulated correlation for equilateral contacting triplets. As the Péclet number increases, there is a change in the preferred contacting isosceles triplet configuration, away from the "closed" triplet where the particles lie at the vertices of an equilateral triangle and toward the fully extended rod-like linear arrangement termed the "open" triplet. This transition is most pronounced for triplets lying in the plane of shear, where the open triplets' angular orientation with respect to the flow is very similar to that of a contacting pair. The correlation of suspension rheology to observed structure signals onset of larger clusters. An investigation of the predictive ability of Kirkwood's superposition approximation (KSA) provides valuable insights into the relationship between the pair and triplet probability distributions and helps achieve a better and more detailed understanding of the interplay of the pair and triplet dynamics. The KSA is seen more successfully to predict the shape of isosceles contacting triplet nonequilibrium distributions in the plane of shear than for similar configurations in equilibrium hard-sphere systems; in the sheared case, the discrepancies in magnitudes of distribution peaks are attributable to two interaction effects when pair average trajectories and locations of particles change in response to real, or "hard," and probabilistically favored ("soft") neighboring excluded volumes and, in the case of open triplets, due to changes in the correlation of the farthest separated pair caused by the fixed presence of the particle in the middle.

Pair Production Induced by Ultrashort and Ultraintense Laser Pulses in Plasmas

NASA Astrophysics Data System (ADS)

Luo, Yue-E.; Wang, Xue-Wen; Wang, Yuan-Sheng; Ji, Shen-Tong; Yu, Hong

2018-06-01

The probability of Schwinger pair production is calculated, which is induced by an ultraintense and ultrashort laser pulse propagating in a plasma. The dependence of the probability on the amplitude of the laser pulse and the frequency of plasmas is analyzed. Particularly, the effect of the pulse duration on the probability is discussed, by introducing a pulse-shape function to describe the temporal shape of the laser pulse. The results show that a laser with shorter pulse is more efficient in pair production. The probability of pair production increases when the order of the duration is comparable to the period of a laser.

Modeling of site occupancy dynamics for northern spotted owls, with emphasis on the effects of barred owls

USGS Publications Warehouse

Olson, Gail S.; Anthony, Robert G.; Forsman, Eric D.; Ackers, Steven H.; Loschl, Peter J.; Reid, Janice A.; Dugger, Katie M.; Glenn, Elizabeth M.; Ripple, William J.

2005-01-01

Northern spotted owls (Strix occidentalis caurina) have been studied intensively since their listing as a threatened species by the U.S. Fish and Wildlife Service in 1990. Studies of spotted owl site occupancy have used various binary response measures, but most of these studies have made the assumption that detectability is perfect, or at least high and not variable. Further, previous studies did not consider temporal variation in site occupancy. We used relatively new methods for open population modeling of site occupancy that incorporated imperfect and variable detectability of spotted owls and allowed modeling of temporal variation in site occupancy, extinction, and colonization probabilities. We also examined the effects of barred owl (S. varia) presence on these parameters. We used spotted owl survey data from 1990 to 2002 for 3 study areas in Oregon, USA, and we used program MARK to develop and analyze site occupancy models. We found per visit detection probabilities averaged <0.70 and were highly variable among study years and study areas. Site occupancy probabilities for owl pairs declined greatly on 1 study area and slightly on the other 2 areas. For all owls, including singles and pairs, site occupancy was mostly stable through time. Barred owl presence had a negative effect on spotted owl detection probabilities, and it had either a positive effect on local-extinction probabilities or a negative effect on colonization probabilities. We conclude that further analyses of spotted owls must account for imperfect and variable detectability and barred owl presence to properly interpret results. Further, because barred owl presence is increasing within the range of northern spotted owls, we expect to see further declines in the proportion of sites occupied by spotted owls.

Hydrophobic interaction between contiguous residues in the S6 transmembrane segment acts as a stimuli integration node in the BK channel

PubMed Central

Carrasquel-Ursulaez, Willy; Contreras, Gustavo F.; Sepúlveda, Romina V.; Aguayo, Daniel; González-Nilo, Fernando

2015-01-01

Large-conductance Ca2+- and voltage-activated K+ channel (BK) open probability is enhanced by depolarization, increasing Ca2+ concentration, or both. These stimuli activate modular voltage and Ca2+ sensors that are allosterically coupled to channel gating. Here, we report a point mutation of a phenylalanine (F380A) in the S6 transmembrane helix that, in the absence of internal Ca2+, profoundly hinders channel opening while showing only minor effects on the voltage sensor active–resting equilibrium. Interpretation of these results using an allosteric model suggests that the F380A mutation greatly increases the free energy difference between open and closed states and uncouples Ca2+ binding from voltage sensor activation and voltage sensor activation from channel opening. However, the presence of a bulky and more hydrophobic amino acid in the F380 position (F380W) increases the intrinsic open–closed equilibrium, weakening the coupling between both sensors with the pore domain. Based on these functional experiments and molecular dynamics simulations, we propose that F380 interacts with another S6 hydrophobic residue (L377) in contiguous subunits. This pair forms a hydrophobic ring important in determining the open–closed equilibrium and, like an integration node, participates in the communication between sensors and between the sensors and pore. Moreover, because of its effects on open probabilities, the F380A mutant can be used for detailed voltage sensor experiments in the presence of permeant cations. PMID:25548136

Manipulation of double-stranded DNA melting by force

NASA Astrophysics Data System (ADS)

Singh, Amit Raj; Granek, Rony

2017-09-01

By integrating elasticity—as described by the Gaussian network model—with bond binding energies that distinguish between different base-pair identities and stacking configurations, we study the force induced melting of a double-stranded DNA (dsDNA). Our approach is a generalization of our previous study of thermal dsDNA denaturation [J. Chem. Phys. 145, 144101 (2016), 10.1063/1.4964285] to that induced by force at finite temperatures. It allows us to obtain semimicroscopic information about the opening of the chain, such as whether the dsDNA opens from one of the ends or from the interior, forming an internal bubble. We study different types of force manipulation: (i) "end unzipping," with force acting at a single end base pair perpendicular to the helix, (ii) "midunzipping," with force acting at a middle base pair perpendicular to the helix, and (iii) "end shearing," where the force acts at opposite ends along the helix. By monitoring the free-energy landscape and probability distribution of intermediate denaturation states, we show that different dominant intermediate states are stabilized depending on the type of force manipulation used. In particular, the bubble state of the sequence L60B36, which we have previously found to be a stable state during thermal denaturation, is absent for end unzipping and end shearing, whereas very similar bubbles are stabilized by midunzipping, or when the force location is near the middle of the chain. Ours results offer a simple tool for stabilizing bubbles and loops using force manipulations at different temperatures, and may implicate on the mechanism in which DNA enzymes or motors open regions of the chain.

Sequence dependency of canonical base pair opening in the DNA double helix

PubMed Central

Villa, Alessandra

2017-01-01

The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

Scalar pair production in a magnetic field in de Sitter universe

NASA Astrophysics Data System (ADS)

Băloi, Mihaela-Andreea; Crucean, Cosmin; Popescu, Diana

2018-05-01

The production of scalar particles by the dipole magnetic field in de Sitter expanding universe is analyzed. The amplitude and probability of transition are computed using perturbative methods. A graphical study of the transition probability is performed obtaining that the rate of pair production is important in the early universe. Our results prove that in the process of pair production by the external magnetic field the momentum conservation law is broken. We also found that the probabilities are maximum when the particles are emitted perpendicular to the direction of magnetic dipole momentum. The total probability is computed and is analysed in terms of the angle between particles momenta.

Melting of genomic DNA: Predictive modeling by nonlinear lattice dynamics

NASA Astrophysics Data System (ADS)

Theodorakopoulos, Nikos

2010-08-01

The melting behavior of long, heterogeneous DNA chains is examined within the framework of the nonlinear lattice dynamics based Peyrard-Bishop-Dauxois (PBD) model. Data for the pBR322 plasmid and the complete T7 phage have been used to obtain model fits and determine parameter dependence on salt content. Melting curves predicted for the complete fd phage and the Y1 and Y2 fragments of the ϕX174 phage without any adjustable parameters are in good agreement with experiment. The calculated probabilities for single base-pair opening are consistent with values obtained from imino proton exchange experiments.

Automatic threshold selection for multi-class open set recognition

NASA Astrophysics Data System (ADS)

Scherreik, Matthew; Rigling, Brian

2017-05-01

Multi-class open set recognition is the problem of supervised classification with additional unknown classes encountered after a model has been trained. An open set classifer often has two core components. The first component is a base classifier which estimates the most likely class of a given example. The second component consists of open set logic which estimates if the example is truly a member of the candidate class. Such a system is operated in a feed-forward fashion. That is, a candidate label is first estimated by the base classifier, and the true membership of the example to the candidate class is estimated afterward. Previous works have developed an iterative threshold selection algorithm for rejecting examples from classes which were not present at training time. In those studies, a Platt-calibrated SVM was used as the base classifier, and the thresholds were applied to class posterior probabilities for rejection. In this work, we investigate the effectiveness of other base classifiers when paired with the threshold selection algorithm and compare their performance with the original SVM solution.

7. View (looking west) of the second floor corridor in ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

7. View (looking west) of the second floor corridor in the south segment of building. The second floor was designed for residential rental rooms. The guardrail, balusters, newel posts, and handrail, as well as the two upper-level door openings with transoms, are original features. The doors, proper, are nonoriginal and probably were installed when the second floor was converted to office use. The pair of doors (one leaf is open and one is closed) is located at the intermediate stair landing. The original exterior doorway (without a door) is located at the bottom of the stair. The upper-level door without a transom is nonoriginal, as are the floor tile and wall paneling. At the time of documentation a suspended ceiling and duct were removed to ... - Stroud Building, 31-33 North Central Avenue, Phoenix, Maricopa County, AZ

The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

NASA Astrophysics Data System (ADS)

Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

2018-01-01

The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

Virtual water trade and bilateral conflicts

NASA Astrophysics Data System (ADS)

De Angelis, Enrico; Metulini, Rodolfo; Bove, Vincenzo; Riccaboni, Massimo

2017-12-01

In light of growing water scarcity, virtual water, or the water embedded in key water-intensive commodities, has been an active area of debate among practitioners and academics alike. As of yet, however, there is no consensus on whether water scarcity affects conflict behavior and we still lack empirical research intending to account for the role of virtual water in affecting the odds of militarized disputes between states. Using quantitative methods and data on virtual water trade, we find that bilateral and multilateral trade openness reduce the probability of war between any given pair of countries, which is consistent with the strategic role of this important commodity and the opportunity cost associated with the loss of trade gains. We also find that the substantive effect of virtual water trade is comparable to that of oil and gas, the archetypal natural resources, in determining interstate conflicts' probability.

An efficient variational method to study the denaturation of DNA induced by superhelical stress

NASA Astrophysics Data System (ADS)

Jost, Daniel; Everaers, Ralf

2010-03-01

Many fundamental biological processes, like transcription or replication, need the opening of the double-stranded DNA. One common way to control the local denaturation is to impose superhelical stress to the DNA using protein machineries. To describe superhelical effect for circular molecules, Benham introduced a model where the standard thermodynamic description of base-pairing is coupled with torsional stress energetics. Here, we introduce an efficient mean-field approximation of the Benham model. Our self-consistent solution is confident and computationally-fast, compared to the full treatment of the model. In particular, our formulation allows to compute the probability of bubble formation for given length and position along the sequence. Evolution of this probability as a function of the superhelical stress could inform us on the ability for organisms to control the strength of superhelicity acting on their genomes.

Pairs of Asteroids Probably of a Common Origin

NASA Astrophysics Data System (ADS)

Vokrouhlický, David; Nesvorný, David

2008-07-01

We report the first observational evidence for pairs of main-belt asteroids with bodies in each pair having nearly identical orbits. The existence of ~60 pairs identified here cannot be reconciled with random fluctuations of the asteroid orbit density and rather suggests a common origin of the paired objects. We propose that the identified pairs formed by (i) collisional disruptions of km-sized and larger parent asteroids, (ii) Yarkovsky-O'Keefe-Radzievski-Paddack (YORP)-induced spin-up and rotational fission of fast-rotating objects, and/or (iii) splitting of unstable asteroid binaries. In case (i), the pairs would be parts of compact collisional families with many km- and sub-km-size members that should be found by future asteroid surveys. Our dynamical analysis suggests that most identified pairs formed within the past lsim1 Myr, in several cases even much more recently. For example, paired asteroids (6070) Rheinland and (54827) 2001 NQ8 probably separated from their common ancestor only 16.5-19 kyr ago. Given their putatively very recent formation, the identified objects are prime candidates for astronomical observations. The title paraphrases that of Hirayama's 1918 paper "Groups of asteroids probably of a common origin," where the first evidence was given for groups of asteroid fragments produced by disruptive collisions.

Nonrandom network connectivity comes in pairs.

PubMed

Hoffmann, Felix Z; Triesch, Jochen

2017-01-01

Overrepresentation of bidirectional connections in local cortical networks has been repeatedly reported and is a focus of the ongoing discussion of nonrandom connectivity. Here we show in a brief mathematical analysis that in a network in which connection probabilities are symmetric in pairs, P ij = P ji , the occurrences of bidirectional connections and nonrandom structures are inherently linked; an overabundance of reciprocally connected pairs emerges necessarily when some pairs of neurons are more likely to be connected than others. Our numerical results imply that such overrepresentation can also be sustained when connection probabilities are only approximately symmetric.

OsDMC1 Is Not Required for Homologous Pairing in Rice Meiosis1[OPEN

PubMed Central

Tang, Ding; Liu, Xiaofei; Du, Guijie; Shen, Yi; Li, Yafei; Cheng, Zhukuan

2016-01-01

Meiotic homologous recombination is pivotal to sexual reproduction. DMC1, a conserved recombinase, is involved in directing single-end invasion between interhomologs during meiotic recombination. In this study, we identified OsDMC1A and OsDMC1B, two closely related proteins in rice (Oryza sativa) with high sequence similarity to DMC1 proteins from other species. Analysis of Osdmc1a and Osdmc1b Tos17 insertion mutants indicated that these genes are functionally redundant. Immunolocalization analysis revealed OsDMC1 foci occurred at leptotene, which disappeared from late pachytene chromosomes in wild-type meiocytes. According to cytological analyses, homologous pairing is accomplished in the Osdmc1a Osdmc1b double mutant, but synapsis is seriously disrupted. The reduced number of bivalents and abnormal OsHEI10 foci in Osdmc1a Osdmc1b establishes an essential role for OsDMC1 in crossover formation. In the absence of OsDMC1, early recombination events probably occur normally, leading to normal localization of γH2AX, PAIR3, OsMRE11, OsCOM1, and OsRAD51C. Moreover, OsDMC1 was not detected in pairing-defective mutants, such as pair2, pair3, Oscom1, and Osrad51c, while it was loaded onto meiotic chromosomes in zep1, Osmer3, Oszip4, and Oshei10. Taken together, these results suggest that during meiosis, OsDMC1 is dispensable for homologous pairing in rice, which is quite different from the DMC1 homologs identified so far in other organisms. PMID:26960731

Probability of coincidental similarity among the orbits of small bodies - I. Pairing

NASA Astrophysics Data System (ADS)

Jopek, Tadeusz Jan; Bronikowska, Małgorzata

2017-09-01

Probability of coincidental clustering among orbits of comets, asteroids and meteoroids depends on many factors like: the size of the orbital sample searched for clusters or the size of the identified group, it is different for groups of 2,3,4,… members. Probability of coincidental clustering is assessed by the numerical simulation, therefore, it depends also on the method used for the synthetic orbits generation. We have tested the impact of some of these factors. For a given size of the orbital sample we have assessed probability of random pairing among several orbital populations of different sizes. We have found how these probabilities vary with the size of the orbital samples. Finally, keeping fixed size of the orbital sample we have shown that the probability of random pairing can be significantly different for the orbital samples obtained by different observation techniques. Also for the user convenience we have obtained several formulae which, for given size of the orbital sample can be used to calculate the similarity threshold corresponding to the small value of the probability of coincidental similarity among two orbits.

Use of visual CO2 feedback as a retrofit solution for improving classroom air quality.

PubMed

Wargocki, P; Da Silva, N A F

2015-02-01

Carbon dioxide (CO2 ) sensors that provide a visual indication were installed in classrooms during normal school operation. During 2-week periods, teachers and students were instructed to open the windows in response to the visual CO2 feedback in 1 week and open them, as they would normally do, without visual feedback, in the other week. In the heating season, two pairs of classrooms were monitored, one pair naturally and the other pair mechanically ventilated. In the cooling season, two pairs of naturally ventilated classrooms were monitored, one pair with split cooling in operation and the other pair with no cooling. Classrooms were matched by grade. Providing visual CO2 feedback reduced CO2 levels, as more windows were opened in this condition. This increased energy use for heating and reduced the cooling requirement in summertime. Split cooling reduced the frequency of window opening only when no visual CO2 feedback was present. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

FAST TRACK COMMUNICATION: Open string pair creation from worldsheet instantons

NASA Astrophysics Data System (ADS)

Schubert, Christian; Torrielli, Alessandro

2010-10-01

Worldline instantons provide a particularly elegant way to derive Schwinger's well-known formula for the pair creation rate due to a constant electric field in quantum electrodynamics. In this communication, we show how to extend this method to the corresponding problem of open string pair creation.

Natal and breeding philopatry in a black brant, Branta bernicla nigricans, metapopulation

USGS Publications Warehouse

Lindberg, Mark S.; Sedinger, James S.; Derksen, Dirk V.; Rockwell, Robert F.

1998-01-01

We estimated natal and breeding philopatry and dispersal probabilities for a metapopulation of Black Brant (Branta bernicla nigricans) based on observations of marked birds at six breeding colonies in Alaska, 1986–1994. Both adult females and males exhibited high (>0.90) probability of philopatry to breeding colonies. Probability of natal philopatry was significantly higher for females than males. Natal dispersal of males was recorded between every pair of colonies, whereas natal dispersal of females was observed between only half of the colony pairs. We suggest that female-biased philopatry was the result of timing of pair formation and characteristics of the mating system of brant, rather than factors related to inbreeding avoidance or optimal discrepancy. Probability of natal philopatry of females increased with age but declined with year of banding. Age-related increase in natal philopatry was positively related to higher breeding probability of older females. Declines in natal philopatry with year of banding corresponded negatively to a period of increasing population density; therefore, local population density may influence the probability of nonbreeding and gene flow among colonies.

The preference of probability over negative values in action selection.

PubMed

Neyedli, Heather F; Welsh, Timothy N

2015-01-01

It has previously been found that when participants are presented with a pair of motor prospects, they can select the prospect with the largest maximum expected gain (MEG). Many of those decisions, however, were trivial because of large differences in MEG between the prospects. The purpose of the present study was to explore participants' preferences when making non-trivial decisions between two motor prospects. Participants were presented with pairs of prospects that: 1) differed in MEG with either only the values or only the probabilities differing between the prospects; and 2) had similar MEG with one prospect having a larger probability of hitting the target and a higher penalty value and the other prospect a smaller probability of hitting the target but a lower penalty value. In different experiments, participants either had 400 ms or 2000 ms to decide between the prospects. It was found that participants chose the configuration with the larger MEG more often when the probability varied between prospects than when the value varied. In pairs with similar MEGs, participants preferred a larger probability of hitting the target over a smaller penalty value. These results indicate that participants prefer probability information over negative value information in a motor selection task.

A short walk in quantum probability

NASA Astrophysics Data System (ADS)

Hudson, Robin

2018-04-01

This is a personal survey of aspects of quantum probability related to the Heisenberg commutation relation for canonical pairs. Using the failure, in general, of non-negativity of the Wigner distribution for canonical pairs to motivate a more satisfactory quantum notion of joint distribution, we visit a central limit theorem for such pairs and a resulting family of quantum planar Brownian motions which deform the classical planar Brownian motion, together with a corresponding family of quantum stochastic areas. This article is part of the themed issue `Hilbert's sixth problem'.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nikitin, N. V., E-mail: nnikit@mail.cern.ch; Sotnikov, V.P., E-mail: sotnikov@physics.msu.ru; Toms, K. S., E-mail: ktoms@mail.cern.ch

A radically new class of Bell inequalities in Wigner’s form was obtained on the basis of Kolmorov’s axiomatization of probability theory and the hypothesis of locality. These inequalities take explicitly into account the dependence on time (time-dependent Bell inequalities in Wigner’s form). By using these inequalities, one can propose a means for experimentally testing Bohr’ complementarity principle in the relativistic region. The inequalities in question open broad possibilities for studying correlations of nonrelativistic and relativistic quantum systems in external fields. The violation of the time-dependent inequalities in quantum mechanics was studied by considering the behavior of a pair of anticorrelatedmore » spins in a constant external magnetic field and oscillations of neutral pseudoscalar mesons. The decay of a pseudoscalar particle to a fermion–antifermion pair is considered within quantum field theory. In order to test experimentally the inequalities proposed in the present study, it is not necessary to perform dedicated noninvasive measurements required in the Leggett–Garg approach, for example.« less

Fluctuations in the DNA double helix

NASA Astrophysics Data System (ADS)

Peyrard, M.; López, S. C.; Angelov, D.

2007-08-01

DNA is not the static entity suggested by the famous double helix structure. It shows large fluctuational openings, in which the bases, which contain the genetic code, are temporarily open. Therefore it is an interesting system to study the effect of nonlinearity on the physical properties of a system. A simple model for DNA, at a mesoscopic scale, can be investigated by computer simulation, in the same spirit as the original work of Fermi, Pasta and Ulam. These calculations raise fundamental questions in statistical physics because they show a temporary breaking of equipartition of energy, regions with large amplitude fluctuations being able to coexist with regions where the fluctuations are very small, even when the model is studied in the canonical ensemble. This phenomenon can be related to nonlinear excitations in the model. The ability of the model to describe the actual properties of DNA is discussed by comparing theoretical and experimental results for the probability that base pairs open an a given temperature in specific DNA sequences. These studies give us indications on the proper description of the effect of the sequence in the mesoscopic model.

Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

PubMed Central

Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

2014-01-01

The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

Gamma-ray generation in the interaction of two tightly focused laser pulses with a low-density target composed of electrons

NASA Astrophysics Data System (ADS)

Jirka, M.; Klimo, O.; Weber, S.; Bulanov, Sergei V.; Esirkepov, Timur Zh.; Korn, G.

2015-05-01

With the continuing development of laser systems, new important and so-far unexplored fields of research related to interaction of ultra-intense laser beams with matter are opening. At intensities of the order of 1022 W=cm2, electrons may be accelerated in the electromagnetic field of the laser wave and achieve such a high energy that they can enter the regime affected by the radiation reaction. Due to the non-linear Thomson and Compton scattering the accelerated electrons emit photons. The interaction of emitted photons with the laser field may result in effective generation of electron-positron pairs by means of the Breit-Wheeler process. In this work we study the influence of laser pulse polarization on gamma-ray generation during interaction of two colliding and tightly focused laser pulses with a low density target composed of electrons. This paper focuses on evolution of electron trajectories and key parameters χe (probability of photon emission) and χγ(probability of pair generation) in the laser field. These interactions are studied using 2D PIC simulations. It is shown that in the case of circularly polarized and tightly focused laser beams, electrons are not following circular trajectories at the magnetic node of the standing wave established in the focus, which leads to lowering the radiation emission efficiency.

Test of a hypothesis of realism in quantum theory using a Bayesian approach

NASA Astrophysics Data System (ADS)

Nikitin, N.; Toms, K.

2017-05-01

In this paper we propose a time-independent equality and time-dependent inequality, suitable for an experimental test of the hypothesis of realism. The derivation of these relations is based on the concept of conditional probability and on Bayes' theorem in the framework of Kolmogorov's axiomatics of probability theory. The equality obtained is intrinsically different from the well-known Greenberger-Horne-Zeilinger (GHZ) equality and its variants, because violation of the proposed equality might be tested in experiments with only two microsystems in a maximally entangled Bell state |Ψ-> , while a test of the GHZ equality requires at least three quantum systems in a special state |ΨGHZ> . The obtained inequality differs from Bell's, Wigner's, and Leggett-Garg inequalities, because it deals with spin s =1 /2 projections onto only two nonparallel directions at two different moments of time, while a test of the Bell and Wigner inequalities requires at least three nonparallel directions, and a test of the Leggett-Garg inequalities requires at least three distinct moments of time. Hence, the proposed inequality seems to open an additional experimental possibility to avoid the "contextuality loophole." Violation of the proposed equality and inequality is illustrated with the behavior of a pair of anticorrelated spins in an external magnetic field and also with the oscillations of flavor-entangled pairs of neutral pseudoscalar mesons.

Landscape of α preformation probability for even-even nuclei in medium mass region

NASA Astrophysics Data System (ADS)

Qian, Yibin; Ren, Zhongzhou

2018-03-01

The behavior of α cluster preformation probability, in α decay, is a rich source of the structural information, such as the clustering, pairing, and shell evolution in heavy nuclei. Meanwhile, the experimental α decay data have been very recently compiled in the newest table NUBASE2016. Through a least square fit to the available experimental data of nuclear charge radii plus the neutron skin thickness, we obtain a new set of parameters for the two-parameter Fermi nucleon density distributions in target nuclei. Subsequently, we make use of these refreshed inputs, involved in the density-dependent cluster model, to extract α preformation factor ({P}α ) for a large range of medium α emitters with N < 126 from the newest data table. Besides checking the supposed smooth pattern of P α in the open-shell region, the special attention has been paid to those exotic α-decaying nuclei around the Z = 50 and N = 82 shell closures. Moreover, the correlation between the α preformation factor and the microscopic correction of nuclear mass, corresponding to the effect of shell and pairing plus deformation, is in particular investigated, to pursue the valuable knowledge of the P α pattern over the nuclide chart. The feature of α preformation factor along with the neutron-proton asymmetry is then detected and discussed to some extent.

Quantifying inbreeding avoidance through extra-pair reproduction

PubMed Central

Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin

2015-01-01

Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females’ alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females’ within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. PMID:25346331

Experimental purification of two-atom entanglement.

PubMed

Reichle, R; Leibfried, D; Knill, E; Britton, J; Blakestad, R B; Jost, J D; Langer, C; Ozeri, R; Seidelin, S; Wineland, D J

2006-10-19

Entanglement is a necessary resource for quantum applications--entanglement established between quantum systems at different locations enables private communication and quantum teleportation, and facilitates quantum information processing. Distributed entanglement is established by preparing an entangled pair of quantum particles in one location, and transporting one member of the pair to another location. However, decoherence during transport reduces the quality (fidelity) of the entanglement. A protocol to achieve entanglement 'purification' has been proposed to improve the fidelity after transport. This protocol uses separate quantum operations at each location and classical communication to distil high-fidelity entangled pairs from lower-fidelity pairs. Proof-of-principle experiments distilling entangled photon pairs have been carried out. However, these experiments obtained distilled pairs with a low probability of success and required destruction of the entangled pairs, rendering them unavailable for further processing. Here we report efficient and non-destructive entanglement purification with atomic quantum bits. Two noisy entangled pairs were created and distilled into one higher-fidelity pair available for further use. Success probabilities were above 35 per cent. The many applications of entanglement purification make it one of the most important techniques in quantum information processing.

A short walk in quantum probability.

PubMed

Hudson, Robin

2018-04-28

This is a personal survey of aspects of quantum probability related to the Heisenberg commutation relation for canonical pairs. Using the failure, in general, of non-negativity of the Wigner distribution for canonical pairs to motivate a more satisfactory quantum notion of joint distribution, we visit a central limit theorem for such pairs and a resulting family of quantum planar Brownian motions which deform the classical planar Brownian motion, together with a corresponding family of quantum stochastic areas.This article is part of the themed issue 'Hilbert's sixth problem'. © 2018 The Author(s).

VizieR Online Data Catalog: Proper motions in M 11 (Su+ 1998)

NASA Astrophysics Data System (ADS)

Su, C.-G.; Zhao, J.-L.; Tian, K.-P.

1997-07-01

Relative proper motions of 872 stars in the open cluster M 11 region are reduced using 10 plate pairs taken over time baselines of 16~70 years with the double astrograph telescope of Shanghai Observatory. The scale is 30"/mm. The plates were measured with the PDS machines in the Purple Mountain Observatory in Nanjing and the Institute of Technology and Communication in Luoyang, China. The average proper motion accuracy is about 1.1mas/yr with 85% of the data better than 1mas/yr. Membership probabilities of 785 stars within 25' centred on M 11 are determined based on their proper motions. The method used is suggested by Su et al. (1995AcApS..15..217S) with some improvements of Zhao & He (1990A&A...237...54Z), in which the space distribution and magnitude dependencies for cluster stars are taken into account. The results are significantly good. The total integrated membership probabilities for all these stars is 547 and the number of stars with probabilities higher than 0.7 is 541. It can be found after the membership determination that there exists mass segregation in M 11. Some comparisons and discussion are also given. (1 data file).

The rise and fall of an ancient Adélie penguin `supercolony' at Cape Adare, Antarctica

NASA Astrophysics Data System (ADS)

Emslie, Steven D.; McKenzie, Ashley; Patterson, William P.

2018-04-01

We report new discoveries and radiocarbon dates on active and abandoned Adélie penguin (Pygoscelis adeliae) colonies at Cape Adare, Antarctica. This colony, first established at approximately 2000 BP (calendar years before present, i.e. 1950), is currently the largest for this species with approximately 338 000 breeding pairs, most located on low-lying Ridley Beach. We hypothesize that this colony first formed after fast ice began blocking open-water access by breeding penguins to the Scott Coast in the southern Ross Sea during a cooling period also at approximately 2000 BP. Our results suggest that the new colony at Cape Adare continued to grow, expanding to a large upper terrace above Ridley Beach, until it exceeded approximately 500 000 breeding pairs (a `supercolony') by approximately 1200 BP. The high marine productivity associated with the Ross Sea polynya and continental shelf break supported this growth, but the colony collapsed to its present size for unknown reasons after approximately 1200 BP. Ridley Beach will probably be abandoned in the near future due to rising sea level in this region. We predict that penguins will retreat to higher elevations at Cape Adare and that the Scott Coast will be reoccupied by breeding penguins as fast ice continues to dissipate earlier each summer, restoring open-water access to beaches there.

The rise and fall of an ancient Adélie penguin 'supercolony' at Cape Adare, Antarctica.

PubMed

Emslie, Steven D; McKenzie, Ashley; Patterson, William P

2018-04-01

We report new discoveries and radiocarbon dates on active and abandoned Adélie penguin ( Pygoscelis adeliae ) colonies at Cape Adare, Antarctica. This colony, first established at approximately 2000 BP (calendar years before present, i.e. 1950), is currently the largest for this species with approximately 338 000 breeding pairs, most located on low-lying Ridley Beach. We hypothesize that this colony first formed after fast ice began blocking open-water access by breeding penguins to the Scott Coast in the southern Ross Sea during a cooling period also at approximately 2000 BP. Our results suggest that the new colony at Cape Adare continued to grow, expanding to a large upper terrace above Ridley Beach, until it exceeded approximately 500 000 breeding pairs (a 'supercolony') by approximately 1200 BP. The high marine productivity associated with the Ross Sea polynya and continental shelf break supported this growth, but the colony collapsed to its present size for unknown reasons after approximately 1200 BP. Ridley Beach will probably be abandoned in the near future due to rising sea level in this region. We predict that penguins will retreat to higher elevations at Cape Adare and that the Scott Coast will be reoccupied by breeding penguins as fast ice continues to dissipate earlier each summer, restoring open-water access to beaches there.

The rise and fall of an ancient Adélie penguin ‘supercolony’ at Cape Adare, Antarctica

PubMed Central

McKenzie, Ashley; Patterson, William P.

2018-01-01

We report new discoveries and radiocarbon dates on active and abandoned Adélie penguin (Pygoscelis adeliae) colonies at Cape Adare, Antarctica. This colony, first established at approximately 2000 BP (calendar years before present, i.e. 1950), is currently the largest for this species with approximately 338 000 breeding pairs, most located on low-lying Ridley Beach. We hypothesize that this colony first formed after fast ice began blocking open-water access by breeding penguins to the Scott Coast in the southern Ross Sea during a cooling period also at approximately 2000 BP. Our results suggest that the new colony at Cape Adare continued to grow, expanding to a large upper terrace above Ridley Beach, until it exceeded approximately 500 000 breeding pairs (a ‘supercolony’) by approximately 1200 BP. The high marine productivity associated with the Ross Sea polynya and continental shelf break supported this growth, but the colony collapsed to its present size for unknown reasons after approximately 1200 BP. Ridley Beach will probably be abandoned in the near future due to rising sea level in this region. We predict that penguins will retreat to higher elevations at Cape Adare and that the Scott Coast will be reoccupied by breeding penguins as fast ice continues to dissipate earlier each summer, restoring open-water access to beaches there. PMID:29765656

Drapery assembly including insulated drapery liner

DOEpatents

Cukierski, Gwendolyn

1983-01-01

A drapery assembly is disclosed for covering a framed wall opening, the assembly including drapery panels hung on a horizontal traverse rod, the rod having a pair of master slides and means for displacing the master slides between open and closed positions. A pair of insulating liner panels are positioned behind the drapery, the remote side edges of the liner panels being connected with the side portions of the opening frame, and the adjacent side edges of the liner panels being connected with a pair of vertically arranged center support members adapted for sliding movement longitudinally of a horizontal track member secured to the upper horizontal portion of the opening frame. Pivotally arranged brackets connect the center support members with the master slides of the traverse rod whereby movement of the master slides to effect opening and closing of the drapery panels effects simultaneous opening and closing of the liner panels.

Quantifying inbreeding avoidance through extra-pair reproduction.

PubMed

Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin

2015-01-01

Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females' alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females' within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

PubMed

Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

2005-01-01

Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

Lesser scaup breeding probability and female survival on the yukon flats, Alaska

USGS Publications Warehouse

Martin, K.H.; Lindberg, M.S.; Schmutz, J.A.; Bertram, M.R.

2009-01-01

Information on the ecology of waterfowl breeding in the boreal forest is lacking, despite the boreal region's importance to continental waterfowl populations and to duck species that are currently declining, such as lesser scaup (Aythya affinis). We estimated breeding probability and breeding season survival of female lesser scaup on the Yukon Flats National Wildlife Refuge, Alaska, USA, in 2005 and 2006. We captured and marked 93 lesser scaup with radiotransmitters during prelaying and nesting periods. Although all marked lesser scaup females were paired throughout prelaying and incubation periods, we estimated breeding probability over both years as 0.12 (SE = 0.05, n = 67) using telemetry. Proportion of lesser scaup females undergoing rapid follicle growth at capture in 2006 was 0.46 (SE = 0.11, n = 37), based on concentration of yolk precursors in blood plasma. By combining methods based on telemetry, yolk precursors, and postovulatory follicles, we estimated maximum breeding probability as 0.68 (SE = 0.08, n = 37) in 2006. Notably, breeding probability was positively related to female body mass. Survival of female lesser scaup during the nesting and brood-rearing periods was 0.92 (SE = 0.05) in 2005 and 0.86 (SE = 0.08) in 2006. Our results suggest that breeding probability is lower than expected for lesser scaup. In addition, the implicit assumption of continental duck-monitoring programs that all paired females attempt to breed should be reevaluated. Recruitment estimates based on annual breeding-pair surveys may overestimate productivity of scaup pairs in the boreal forest. ?? The Wildlife Society.

Quasi-probabilities in conditioned quantum measurement and a geometric/statistical interpretation of Aharonov's weak value

NASA Astrophysics Data System (ADS)

Lee, Jaeha; Tsutsui, Izumi

2017-05-01

We show that the joint behavior of an arbitrary pair of (generally noncommuting) quantum observables can be described by quasi-probabilities, which are an extended version of the standard probabilities used for describing the outcome of measurement for a single observable. The physical situations that require these quasi-probabilities arise when one considers quantum measurement of an observable conditioned by some other variable, with the notable example being the weak measurement employed to obtain Aharonov's weak value. Specifically, we present a general prescription for the construction of quasi-joint probability (QJP) distributions associated with a given combination of observables. These QJP distributions are introduced in two complementary approaches: one from a bottom-up, strictly operational construction realized by examining the mathematical framework of the conditioned measurement scheme, and the other from a top-down viewpoint realized by applying the results of the spectral theorem for normal operators and their Fourier transforms. It is then revealed that, for a pair of simultaneously measurable observables, the QJP distribution reduces to the unique standard joint probability distribution of the pair, whereas for a noncommuting pair there exists an inherent indefiniteness in the choice of such QJP distributions, admitting a multitude of candidates that may equally be used for describing the joint behavior of the pair. In the course of our argument, we find that the QJP distributions furnish the space of operators in the underlying Hilbert space with their characteristic geometric structures such that the orthogonal projections and inner products of observables can be given statistical interpretations as, respectively, “conditionings” and “correlations”. The weak value Aw for an observable A is then given a geometric/statistical interpretation as either the orthogonal projection of A onto the subspace generated by another observable B, or equivalently, as the conditioning of A given B with respect to the QJP distribution under consideration.

Effect of Exposure to Lithium-Paired or Amphetamine-Paired Saccharin Solution on Open Arm Avoidance in an Elevated Plus Maze

ERIC Educational Resources Information Center

Rana, Shadna A.; Parker, Linda A.

2006-01-01

Recent evidence suggests that drug-induced conditioned taste avoidance may be mediated by conditioned fear (e.g., Parker, 2003). The experiments reported here evaluated the effect of exposure to a drug-paired flavor on open arm exploration in an elevated plus maze (EPM), a measure of fear. When rats were tested on a familiar (trial 2) EPM, but not…

Detecting Planet Pairs in Mean Motion Resonances via the Astrometry Method

NASA Astrophysics Data System (ADS)

Wu, Dong-Hong; Liu, Hui-Gen; Yu, Zhou-Yi; Zhang, Hui; Zhou, Ji-Lin

2016-07-01

Gaia is leading us into a new era with a high astrometry precision of ˜10 μas. Under such precision, astrometry can play an important role in detecting and characterizing exoplanets. In particular, we can identify planet pairs in mean motion resonances (MMRs), which constrain the formation and evolution of planetary systems. In accordance with observations, we consider two-Jupiter or two-super-Earth systems in 1:2, 2:3, and 3:4 MMRs. Our simulations show that the false alarm probabilities (FAPs) of a third planet are extremely small, while the two real planets can be fitted well with a signal-to-noise ratio (S/N) \\gt 3. The probability of reconstructing a resonant system is related to the eccentricities and the resonance intensity. Generally, when the S/N ≥slant 10, if the eccentricities of both planets are larger than 0.01 and the resonance is quite strong, the probability of reconstructing the planet pair in MMRs is ≥slant 80 % . Jupiter pairs in MMRs are reconstructed more easily than super-Earth pairs with similar S/N when we consider dynamical stability. FAPs are also calculated when we detect planet pairs in or near MMRs. The FAPs for 1:2 MMRs are the largest, I.e., FAP \\gt 15 % when S/N ≤slant 10. Extrapolating from the Kepler planet pairs near MMRs and assuming a S/N ˜ 3, we discover and reconstruct a few tens of Jupiter pairs and hundreds of super-Earth pairs in 2:3 and 1:2 MMRs within 30 pc. We also compare the differences between even and uneven data cadence and find that planets are better measured with more uniform phase coverage.

Estimation of occupancy, breeding success, and predicted abundance of golden eagles (Aquila chrysaetos) in the Diablo Range, California, 2014

USGS Publications Warehouse

Wiens, J. David; Kolar, Patrick S.; Fuller, Mark R.; Hunt, W. Grainger; Hunt, Teresa

2015-01-01

We used a multistate occupancy sampling design to estimate occupancy, breeding success, and abundance of territorial pairs of golden eagles (Aquila chrysaetos) in the Diablo Range, California, in 2014. This method uses the spatial pattern of detections and non-detections over repeated visits to survey sites to estimate probabilities of occupancy and successful reproduction while accounting for imperfect detection of golden eagles and their young during surveys. The estimated probability of detecting territorial pairs of golden eagles and their young was less than 1 and varied with time of the breeding season, as did the probability of correctly classifying a pair’s breeding status. Imperfect detection and breeding classification led to a sizeable difference between the uncorrected, naïve estimate of the proportion of occupied sites where successful reproduction was observed (0.20) and the model-based estimate (0.30). The analysis further indicated a relatively high overall probability of landscape occupancy by pairs of golden eagles (0.67, standard error = 0.06), but that areas with the greatest occupancy and reproductive potential were patchily distributed. We documented a total of 138 territorial pairs of golden eagles during surveys completed in the 2014 breeding season, which represented about one-half of the 280 pairs we estimated to occur in the broader 5,169-square kilometer region sampled. The study results emphasize the importance of accounting for imperfect detection and spatial heterogeneity in studies of site occupancy, breeding success, and abundance of golden eagles.

Assessing future vent opening locations at the Somma-Vesuvio volcanic complex: 2. Probability maps of the caldera for a future Plinian/sub-Plinian event with uncertainty quantification

NASA Astrophysics Data System (ADS)

Tadini, A.; Bevilacqua, A.; Neri, A.; Cioni, R.; Aspinall, W. P.; Bisson, M.; Isaia, R.; Mazzarini, F.; Valentine, G. A.; Vitale, S.; Baxter, P. J.; Bertagnini, A.; Cerminara, M.; de Michieli Vitturi, M.; Di Roberto, A.; Engwell, S.; Esposti Ongaro, T.; Flandoli, F.; Pistolesi, M.

2017-06-01

In this study, we combine reconstructions of volcanological data sets and inputs from a structured expert judgment to produce a first long-term probability map for vent opening location for the next Plinian or sub-Plinian eruption of Somma-Vesuvio. In the past, the volcano has exhibited significant spatial variability in vent location; this can exert a significant control on where hazards materialize (particularly of pyroclastic density currents). The new vent opening probability mapping has been performed through (i) development of spatial probability density maps with Gaussian kernel functions for different data sets and (ii) weighted linear combination of these spatial density maps. The epistemic uncertainties affecting these data sets were quantified explicitly with expert judgments and implemented following a doubly stochastic approach. Various elicitation pooling metrics and subgroupings of experts and target questions were tested to evaluate the robustness of outcomes. Our findings indicate that (a) Somma-Vesuvio vent opening probabilities are distributed inside the whole caldera, with a peak corresponding to the area of the present crater, but with more than 50% probability that the next vent could open elsewhere within the caldera; (b) there is a mean probability of about 30% that the next vent will open west of the present edifice; (c) there is a mean probability of about 9.5% that the next medium-large eruption will enlarge the present Somma-Vesuvio caldera, and (d) there is a nonnegligible probability (mean value of 6-10%) that the next Plinian or sub-Plinian eruption will have its initial vent opening outside the present Somma-Vesuvio caldera.

Singlet-paired coupled cluster theory for open shells

NASA Astrophysics Data System (ADS)

Gomez, John A.; Henderson, Thomas M.; Scuseria, Gustavo E.

2016-06-01

Restricted single-reference coupled cluster theory truncated to single and double excitations accurately describes weakly correlated systems, but often breaks down in the presence of static or strong correlation. Good coupled cluster energies in the presence of degeneracies can be obtained by using a symmetry-broken reference, such as unrestricted Hartree-Fock, but at the cost of good quantum numbers. A large body of work has shown that modifying the coupled cluster ansatz allows for the treatment of strong correlation within a single-reference, symmetry-adapted framework. The recently introduced singlet-paired coupled cluster doubles (CCD0) method is one such model, which recovers correct behavior for strong correlation without requiring symmetry breaking in the reference. Here, we extend singlet-paired coupled cluster for application to open shells via restricted open-shell singlet-paired coupled cluster singles and doubles (ROCCSD0). The ROCCSD0 approach retains the benefits of standard coupled cluster theory and recovers correct behavior for strongly correlated, open-shell systems using a spin-preserving ROHF reference.

Probe insertion apparatus with inflatable seal

NASA Technical Reports Server (NTRS)

Trimarchi, Paul A. (Inventor)

1990-01-01

A sealing apparatus is disclosed for inserting a probe into a pressure vessel having an elongated opening includes a pair of resiliently deformable seals opposingly disposed in sealing engagement with each other. A retainer is connected to the pressure vessel around the elongated opening and holds the pair of seals rigidly to the pressure vessel. A wedge is engageable with the pair of seals and carries the probe, for longitudinally translating the probe in pressure vessel.

Labeling of Chromosomes in Cell Development and the Appearance of Monozygotic Twins.

PubMed

Jim, Carol; Berkovich, Simon

2015-01-01

Understanding the mechanism behind the structure of the internal cellular clock can lead to advances in the knowledge of origins of pairs of monozygotic twins and higher order multiples as well as other biological phenomena. To gain insight into this mechanism, we analyze possible cell labeling schemes that model an organism's development. Our findings lead us to predict that monozygotic quadruplets are not quadruplets in the traditional sense but rather two pairs of monozygotic twins where the pairs slightly differ-a situation we coin quadruplet twins. From the considered model, the probability of monozygotic twins is found to be (1/2) (K) , and we discover that the probability of monozygotic quadruplets, or triplets as in the case of the death of an embryo, is (1/8) (K) , where K is a species-specific integer representing the number of pairs of homologous chromosomes. The parameter K may determine cancerization with a probability threshold that is approximately inversely proportional to the Hayflick limit. Exposure to some cancerization factors such as small levels of ionizing radiation and chemical pollution may not produce cancer.

Labeling of Chromosomes in Cell Development and the Appearance of Monozygotic Twins

PubMed Central

Berkovich, Simon

2015-01-01

Understanding the mechanism behind the structure of the internal cellular clock can lead to advances in the knowledge of origins of pairs of monozygotic twins and higher order multiples as well as other biological phenomena. To gain insight into this mechanism, we analyze possible cell labeling schemes that model an organism's development. Our findings lead us to predict that monozygotic quadruplets are not quadruplets in the traditional sense but rather two pairs of monozygotic twins where the pairs slightly differ—a situation we coin quadruplet twins. From the considered model, the probability of monozygotic twins is found to be (1/2)K, and we discover that the probability of monozygotic quadruplets, or triplets as in the case of the death of an embryo, is (1/8)K, where K is a species-specific integer representing the number of pairs of homologous chromosomes. The parameter K may determine cancerization with a probability threshold that is approximately inversely proportional to the Hayflick limit. Exposure to some cancerization factors such as small levels of ionizing radiation and chemical pollution may not produce cancer. PMID:26185760

New Common Proper-Motion Pairs with R.A. Between 00h and 01h

NASA Astrophysics Data System (ADS)

Caballero, Rafael

2015-07-01

This paper presents 37 new common proper-motion pairs. The new pairs have been obtained employing a semi-automatic procedure based on the inspection of images using the tool Aladin, completed with information obtained from the catalogs available at VizieR. All the pairs fulfill the Halbwachs criteria, employed to increase the probability of a physical bond between the two components.

Approved Methods and Algorithms for DoD Risk-Based Explosives Siting

DTIC Science & Technology

2007-02-02

glass. Pgha Probability of a person being in the glass hazard area Phit Probability of hit Phit (f) Probability of hit for fatality Phit (maji...Probability of hit for major injury Phit (mini) Probability of hit for minor injury Pi Debris probability densities at the ES PMaj (pair) Individual...combined high-angle and combined low-angle tables. A unique probability of hit is calculated for the three consequences of fatality, Phit (f), major injury

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yujie; Gong, Sha; Wang, Zhen

The thermodynamic and kinetic parameters of an RNA base pair were obtained through a long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The thermodynamic parameters were in good agreement with the nearest-neighbor model. The opening rates showed strong temperature dependence, however, the closing rates showed only weak temperature dependence. The transition path time was weakly temperature dependent and was insensitive to the energy barrier. The diffusion constant exhibited super-Arrhenius behavior. The free energy barrier of breaking a single base stack results from the enthalpy increase, ΔH, caused by the disruption ofmore » hydrogen bonding and base-stacking interactions. The free energy barrier of base pair closing comes from the unfavorable entropy loss, ΔS, caused by the restriction of torsional angles. These results suggest that a one-dimensional free energy surface is sufficient to accurately describe the dynamics of base pair opening and closing, and the dynamics are Brownian.« less

Hard choices in assessing survival past dams — a comparison of single- and paired-release strategies

USGS Publications Warehouse

Zydlewski, Joseph D.; Stich, Daniel S.; Sigourney, Douglas B.

2017-01-01

Mark–recapture models are widely used to estimate survival of salmon smolts migrating past dams. Paired releases have been used to improve estimate accuracy by removing components of mortality not attributable to the dam. This method is accompanied by reduced precision because (i) sample size is reduced relative to a single, large release; and (ii) variance calculations inflate error. We modeled an idealized system with a single dam to assess trade-offs between accuracy and precision and compared methods using root mean squared error (RMSE). Simulations were run under predefined conditions (dam mortality, background mortality, detection probability, and sample size) to determine scenarios when the paired release was preferable to a single release. We demonstrate that a paired-release design provides a theoretical advantage over a single-release design only at large sample sizes and high probabilities of detection. At release numbers typical of many survival studies, paired release can result in overestimation of dam survival. Failures to meet model assumptions of a paired release may result in further overestimation of dam-related survival. Under most conditions, a single-release strategy was preferable.

Increased occurrence of pesticide residues on crops grown in protected environments compared to crops grown in open field conditions.

PubMed

Allen, Gina; Halsall, Crispin J; Ukpebor, Justina; Paul, Nigel D; Ridall, Gareth; Wargent, Jason J

2015-01-01

Crops grown under plastic-clad structures or in greenhouses may be prone to an increased frequency of pesticide residue detections and higher concentrations of pesticides relative to equivalent crops grown in the open field. To test this we examined pesticide data for crops selected from the quarterly reports (2004-2009) of the UK's Pesticide Residue Committee. Five comparison crop pairs were identified whereby one crop of each pair was assumed to have been grown primarily under some form of physical protection ('protected') and the other grown primarily in open field conditions ('open'). For each pair, the number of detectable pesticide residues and the proportion of crop samples containing pesticides were statistically compared (n=100 s samples for each crop). The mean concentrations of selected photolabile pesticides were also compared. For the crop pairings of cabbage ('open') vs. lettuce ('protected') and 'berries' ('open') vs. strawberries ('protected') there was a significantly higher number of pesticides and proportion of samples with multiple residues for the protected crops. Statistically higher concentrations of pesticides, including cypermethrin, cyprodinil, fenhexamid, boscalid and iprodione were also found in the protected crops compared to the open crops. The evidence here demonstrates that, in general, the protected crops possess a higher number of detectable pesticides compared to analogous crops grown in the open. This may be due to different pesticide-use regimes, but also due to slower rates of pesticide removal in protected systems. The findings of this study raise implications for pesticide management in protected-crop systems. Copyright © 2014 Elsevier Ltd. All rights reserved.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Analysis of HIV-1 intersubtype recombination breakpoints suggests region with high pairing probability may be a more fundamental factor than sequence similarity affecting HIV-1 recombination.

PubMed

Jia, Lei; Li, Lin; Gui, Tao; Liu, Siyang; Li, Hanping; Han, Jingwan; Guo, Wei; Liu, Yongjian; Li, Jingyun

2016-09-21

With increasing data on HIV-1, a more relevant molecular model describing mechanism details of HIV-1 genetic recombination usually requires upgrades. Currently an incomplete structural understanding of the copy choice mechanism along with several other issues in the field that lack elucidation led us to perform an analysis of the correlation between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarity to further explore structural mechanisms. Near full length sequences of URFs from Asia, Europe, and Africa (one sequence/patient), and representative sequences of worldwide CRFs were retrieved from the Los Alamos HIV database. Their recombination patterns were analyzed by jpHMM in detail. Then the relationships between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarities were investigated. Pearson correlation test showed that all URF groups and the CRF group exhibit the same breakpoint distribution pattern. Additionally, the Wilcoxon two-sample test indicated a significant and inexplicable limitation of recombination in regions with high pairing probability. These regions have been found to be strongly conserved across distinct biological states (i.e., strong intersubtype similarity), and genetic similarity has been determined to be a very important factor promoting recombination. Thus, the results revealed an unexpected disagreement between intersubtype similarity and breakpoint distribution, which were further confirmed by genetic similarity analysis. Our analysis reveals a critical conflict between results from natural HIV-1 isolates and those from HIV-1-based assay vectors in which genetic similarity has been shown to be a very critical factor promoting recombination. These results indicate the region with high-pairing probabilities may be a more fundamental factor affecting HIV-1 recombination than sequence similarity in natural HIV-1 infections. Our findings will be relevant in furthering the understanding of HIV-1 recombination mechanisms.

The effects of anterior arcuate and dorsomedial frontal cortex lesions on visually guided eye movements: 2. Paired and multiple targets.

PubMed

Schiller, P H; Chou, I

2000-01-01

This study examined the effects of anterior arcuate and dorsomedial frontal cortex lesions on the execution of saccadic eye movements made to paired and multiple targets in rhesus monkeys. Identical paired targets were presented with various temporal asynchronies to determine the temporal offset required to yield equal probability choices to either target. In the intact animal equal probability choices were typically obtained when the targets appeared simultaneously. After unilateral anterior arcuate lesions a major shift arose in the temporal offset required to obtain equal probability choices for paired targets that necessitated presenting the target in the hemifield contralateral to the lesion more than 100 ms prior to the target in the ipsilateral hemifield. This deficit was still pronounced 1 year after the lesion. Dorsomedial frontal cortex lesions produced much smaller but significant shifts in target selection that recovered more rapidly. Paired lesions produced deficits similar to those observed with anterior arcuate lesions alone. Major deficits were also observed on a multiple target temporal discrimination task after anterior arcuate but not after dorsomedial frontal cortex lesions. These results suggest that the frontal eye fields that reside in anterior bank of the arcuate sulcus play an important role in temporal processing and in target selection. Dorsomedial frontal cortex, that contains the medial eye fields, plays a much less important role in the execution of these tasks.

Conflict Probability Estimation for Free Flight

NASA Technical Reports Server (NTRS)

Paielli, Russell A.; Erzberger, Heinz

1996-01-01

The safety and efficiency of free flight will benefit from automated conflict prediction and resolution advisories. Conflict prediction is based on trajectory prediction and is less certain the farther in advance the prediction, however. An estimate is therefore needed of the probability that a conflict will occur, given a pair of predicted trajectories and their levels of uncertainty. A method is developed in this paper to estimate that conflict probability. The trajectory prediction errors are modeled as normally distributed, and the two error covariances for an aircraft pair are combined into a single equivalent covariance of the relative position. A coordinate transformation is then used to derive an analytical solution. Numerical examples and Monte Carlo validation are presented.

Exact calculation of loop formation probability identifies folding motifs in RNA secondary structures

PubMed Central

Sloma, Michael F.; Mathews, David H.

2016-01-01

RNA secondary structure prediction is widely used to analyze RNA sequences. In an RNA partition function calculation, free energy nearest neighbor parameters are used in a dynamic programming algorithm to estimate statistical properties of the secondary structure ensemble. Previously, partition functions have largely been used to estimate the probability that a given pair of nucleotides form a base pair, the conditional stacking probability, the accessibility to binding of a continuous stretch of nucleotides, or a representative sample of RNA structures. Here it is demonstrated that an RNA partition function can also be used to calculate the exact probability of formation of hairpin loops, internal loops, bulge loops, or multibranch loops at a given position. This calculation can also be used to estimate the probability of formation of specific helices. Benchmarking on a set of RNA sequences with known secondary structures indicated that loops that were calculated to be more probable were more likely to be present in the known structure than less probable loops. Furthermore, highly probable loops are more likely to be in the known structure than the set of loops predicted in the lowest free energy structures. PMID:27852924

Ceramic blade attachment system

DOEpatents

Boyd, G.L.

1994-12-13

A turbine blade having a preestablished rate of thermal expansion is attached to a turbine wheel having a preestablished rate of thermal expansion being greater than the preestablished rate of thermal expansion of the turbine blade. The turbine blade has a root portion having a pair of recessed portions thereon. The turbine wheel includes a plurality of openings in which the turbine blade is positioned. Each of the openings have a pair of grooves therein in which are positioned a pair of pins having a generally rectangular cross-section and a reaction surface thereon. A pair of cylindrical rollers interposed respective ones of the pair of reaction surfaces and the pair of recessed portions. The attachment system or turbine assembly provides an economical, reliable and effective attachment of a component having a preestablished rate of thermal expansion to a component having a greater preestablished rate of thermal expansion. 3 figures.

Combined-probability space and certainty or uncertainty relations for a finite-level quantum system

NASA Astrophysics Data System (ADS)

Sehrawat, Arun

2017-08-01

The Born rule provides a probability vector (distribution) with a quantum state for a measurement setting. For two settings, we have a pair of vectors from the same quantum state. Each pair forms a combined-probability vector that obeys certain quantum constraints, which are triangle inequalities in our case. Such a restricted set of combined vectors, called the combined-probability space, is presented here for a d -level quantum system (qudit). The combined space is a compact convex subset of a Euclidean space, and all its extreme points come from a family of parametric curves. Considering a suitable concave function on the combined space to estimate the uncertainty, we deliver an uncertainty relation by finding its global minimum on the curves for a qudit. If one chooses an appropriate concave (or convex) function, then there is no need to search for the absolute minimum (maximum) over the whole space; it will be on the parametric curves. So these curves are quite useful for establishing an uncertainty (or a certainty) relation for a general pair of settings. We also demonstrate that many known tight certainty or uncertainty relations for a qubit can be obtained with the triangle inequalities.

Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.

As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less

Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2′-deoxyadenosine:dT Base Pairing in DNA

PubMed Central

2011-01-01

As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929

mmpdb: An Open-Source Matched Molecular Pair Platform for Large Multiproperty Data Sets.

PubMed

Dalke, Andrew; Hert, Jérôme; Kramer, Christian

2018-05-29

Matched molecular pair analysis (MMPA) enables the automated and systematic compilation of medicinal chemistry rules from compound/property data sets. Here we present mmpdb, an open-source matched molecular pair (MMP) platform to create, compile, store, retrieve, and use MMP rules. mmpdb is suitable for the large data sets typically found in pharmaceutical and agrochemical companies and provides new algorithms for fragment canonicalization and stereochemistry handling. The platform is written in Python and based on the RDKit toolkit. It is freely available from https://github.com/rdkit/mmpdb .

Simultaneous production of lepton pairs in ultraperipheral relativistic heavy ion collisions

NASA Astrophysics Data System (ADS)

Kurban, E.; Güçlü, M. C.

2017-10-01

We calculate the total cross sections and probabilities of electromagnetic productions of electron, muon, and tauon pairs simultaneously. At the CERN Large Hadron Collider (LHC), the available electromagnetic energy is sufficient to produce all kinds of leptons coherently. The masses of muons and tauons are large, so their Compton wavelengths are small enough to interact with the colliding nuclei. Therefore, the realistic nuclear form factors are included in the calculations of electromagnetic pair productions. The cross section calculations show that, at LHC energies, the probabilities of simultaneous productions of all kinds of leptons are increased significantly compared to energies available at the BNL Relativistic Heavy Ion Collider (RHIC) . Experimentally, observing this simultaneous production can give us important information about strong QED.

Causal inference, probability theory, and graphical insights.

PubMed

Baker, Stuart G

2013-11-10

Causal inference from observational studies is a fundamental topic in biostatistics. The causal graph literature typically views probability theory as insufficient to express causal concepts in observational studies. In contrast, the view here is that probability theory is a desirable and sufficient basis for many topics in causal inference for the following two reasons. First, probability theory is generally more flexible than causal graphs: Besides explaining such causal graph topics as M-bias (adjusting for a collider) and bias amplification and attenuation (when adjusting for instrumental variable), probability theory is also the foundation of the paired availability design for historical controls, which does not fit into a causal graph framework. Second, probability theory is the basis for insightful graphical displays including the BK-Plot for understanding Simpson's paradox with a binary confounder, the BK2-Plot for understanding bias amplification and attenuation in the presence of an unobserved binary confounder, and the PAD-Plot for understanding the principal stratification component of the paired availability design. Published 2013. This article is a US Government work and is in the public domain in the USA.

Time- and Space-Order Effects in Timed Discrimination of Brightness and Size of Paired Visual Stimuli

ERIC Educational Resources Information Center

Patching, Geoffrey R.; Englund, Mats P.; Hellstrom, Ake

2012-01-01

Despite the importance of both response probability and response time for testing models of choice, there is a dearth of chronometric studies examining systematic asymmetries that occur over time- and space-orders in the method of paired comparisons. In this study, systematic asymmetries in discriminating the magnitude of paired visual stimuli are…

Distribution of Base Pair Alternations in a Periodic DNA Chain: Application of Pólya Counting to a Physical System

NASA Astrophysics Data System (ADS)

Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos

2018-03-01

In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.

DNA bases ring-expanded with a cyclopentadiene free radical: a theoretical investigation of building blocks with diradical character.

PubMed

Zhao, Peiwen; Bu, Yuxiang

2016-01-14

In this work, we computationally design radical nucleobases which possess improved electronic properties, especially diradical properties through introducing a cyclopentadiene radical. We predict that the detailed electromagnetic features of base assemblies are based on the orientation of the extra five-membered cyclopentadiene ring. Broken symmetry DFT calculations take into account the relevant structures and properties. Our results reveal that both the radicalized DNA bases and the base pairs formed when they combine with their counterparts remain stable and display larger spin delocalization. The mode of embedding the cyclopentadiene free radical in the structures has some influence on the degree of π-conjugation, which results in various diradical characteristics. Single-layered radical base pairs all have an open-shell singlet ground state, but the energy difference between singlet and triplet is not significant. For two-layered radical base pairs, the situation is more complex. All of them have an open-shell state as their ground state, including an open-shell singlet state and an open-shell triplet state. That is, the majority of radical base pairs possess anti-ferromagnetic or ferromagnetic characteristics. We present here a more in-depth discussion and analyses to study the magnetic characteristics of radical bases and base pairs. As an important factor, two-layered radical base pairs also have been carefully analyzed. We hope that all the measurements and results presented here will stimulate further detailed insights into the related mechanisms in modified DNA bases and the design of better ring-expanded DNA magnetic materials.

Resolving dual binding conformations of cellulosome cohesin-dockerin complexes using single-molecule force spectroscopy.

PubMed

Jobst, Markus A; Milles, Lukas F; Schoeler, Constantin; Ott, Wolfgang; Fried, Daniel B; Bayer, Edward A; Gaub, Hermann E; Nash, Michael A

2015-10-31

Receptor-ligand pairs are ordinarily thought to interact through a lock and key mechanism, where a unique molecular conformation is formed upon binding. Contrary to this paradigm, cellulosomal cohesin-dockerin (Coh-Doc) pairs are believed to interact through redundant dual binding modes consisting of two distinct conformations. Here, we combined site-directed mutagenesis and single-molecule force spectroscopy (SMFS) to study the unbinding of Coh:Doc complexes under force. We designed Doc mutations to knock out each binding mode, and compared their single-molecule unfolding patterns as they were dissociated from Coh using an atomic force microscope (AFM) cantilever. Although average bulk measurements were unable to resolve the differences in Doc binding modes due to the similarity of the interactions, with a single-molecule method we were able to discriminate the two modes based on distinct differences in their mechanical properties. We conclude that under native conditions wild-type Doc from Clostridium thermocellum exocellulase Cel48S populates both binding modes with similar probabilities. Given the vast number of Doc domains with predicted dual binding modes across multiple bacterial species, our approach opens up new possibilities for understanding assembly and catalytic properties of a broad range of multi-enzyme complexes.

A stable wavelength-tunable triggered source of single photons and cascaded photon pairs at the telecom C-band

NASA Astrophysics Data System (ADS)

Zeuner, Katharina D.; Paul, Matthias; Lettner, Thomas; Reuterskiöld Hedlund, Carl; Schweickert, Lucas; Steinhauer, Stephan; Yang, Lily; Zichi, Julien; Hammar, Mattias; Jöns, Klaus D.; Zwiller, Val

2018-04-01

The implementation of fiber-based long-range quantum communication requires tunable sources of single photons at the telecom C-band. Stable and easy-to-implement wavelength-tunability of individual sources is crucial to (i) bring remote sources into resonance, (ii) define a wavelength standard, and (iii) ensure scalability to operate a quantum repeater. So far, the most promising sources for true, telecom single photons are semiconductor quantum dots, due to their ability to deterministically and reliably emit single and entangled photons. However, the required wavelength-tunability is hard to attain. Here, we show a stable wavelength-tunable quantum light source by integrating strain-released InAs quantum dots on piezoelectric substrates. We present triggered single-photon emission at 1.55 μm with a multi-photon emission probability as low as 0.097, as well as photon pair emission from the radiative biexciton-exciton cascade. We achieve a tuning range of 0.25 nm which will allow us to spectrally overlap remote quantum dots or tuning distant quantum dots into resonance with quantum memories. This opens up realistic avenues for the implementation of photonic quantum information processing applications at telecom wavelengths.

Application of Monte Carlo cross-validation to identify pathway cross-talk in neonatal sepsis.

PubMed

Zhang, Yuxia; Liu, Cui; Wang, Jingna; Li, Xingxia

2018-03-01

To explore genetic pathway cross-talk in neonates with sepsis, an integrated approach was used in this paper. To explore the potential relationships between differently expressed genes between normal uninfected neonates and neonates with sepsis and pathways, genetic profiling and biologic signaling pathway were first integrated. For different pathways, the score was obtained based upon the genetic expression by quantitatively analyzing the pathway cross-talk. The paired pathways with high cross-talk were identified by random forest classification. The purpose of the work was to find the best pairs of pathways able to discriminate sepsis samples versus normal samples. The results found 10 pairs of pathways, which were probably able to discriminate neonates with sepsis versus normal uninfected neonates. Among them, the best two paired pathways were identified according to analysis of extensive literature. Impact statement To find the best pairs of pathways able to discriminate sepsis samples versus normal samples, an RF classifier, the DS obtained by DEGs of paired pathways significantly associated, and Monte Carlo cross-validation were applied in this paper. Ten pairs of pathways were probably able to discriminate neonates with sepsis versus normal uninfected neonates. Among them, the best two paired pathways ((7) IL-6 Signaling and Phospholipase C Signaling (PLC); (8) Glucocorticoid Receptor (GR) Signaling and Dendritic Cell Maturation) were identified according to analysis of extensive literature.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Băloi, Mihaela-Andreea, E-mail: mihaela.baloi88@e-uvt.ro; Crucean, Cosmin

The production of fermions in dipolar electric fields on de Sitter universe is studied. The amplitude and probability of pair production are computed using the exact solution of the Dirac equation in de Sitter spacetime. The form of the dipolar fields is established using the conformal invariance of the Maxwell equations. We obtain that the momentum conservation law is broken in the process of pair production in dipolar electric fields. Also we establish that there are nonvanishing probabilities for processes in which the helicity is conserved/nonconserved. The Minkowski limit is recovered when the expansion factor becomes zero.

Distinct dissociation kinetics between ion pairs: Solvent-coordinate free-energy landscape analysis.

PubMed

Yonetani, Yoshiteru

2015-07-28

Different ion pairs exhibit different dissociation kinetics; however, while the nature of this process is vital for understanding various molecular systems, the underlying mechanism remains unclear. In this study, to examine the origin of different kinetic rate constants for this process, molecular dynamics simulations were conducted for LiCl, NaCl, KCl, and CsCl in water. The results showed substantial differences in dissociation rate constant, following the trend kLiCl < kNaCl < kKCl < kCsCl. Analysis of the free-energy landscape with a solvent reaction coordinate and subsequent rate component analysis showed that the differences in these rate constants arose predominantly from the variation in solvent-state distribution between the ion pairs. The formation of a water-bridging configuration, in which the water molecule binds to an anion and a cation simultaneously, was identified as a key step in this process: water-bridge formation lowers the related dissociation free-energy barrier, thereby increasing the probability of ion-pair dissociation. Consequently, a higher probability of water-bridge formation leads to a higher ion-pair dissociation rate.

Effects of vegetation manipulation on breeding waterfowl in prairie wetlands--a literature review

USGS Publications Warehouse

Kantrud, H.A.

1986-01-01

Literature on the effects of fire and grazing on the wetlands used by breeding prairie waterfowl is reviewed. Both dabbling and diving ducks and their broods prefer wetlands with openings in the marsh canopy. Decreased use is commonly associated with decreased habitat heterogeneity caused by tall, robust hydrophytes such as Typha spp. and other species adapted to form monotypes in the absence of disturbance. Nearly all previous studies indicate that reductions in height and density of tall, emergent hydrophytes by fire and grazing (unless very intensive) generally benefit breeding waterfowl. Such benefits are an increase in pair density, probably related to increased interspersion of cover and open water which decreases visibility among conspecific pairs, and improvements in their invertebrate food resources that result from increased habitat heterogeneity. Research needs are great because of the drastic changes that have accrued to prairie wetlands through fire suppression, cultivation, and other factors. The physical and biological environments preferred by species of breeding waterfowl during their seasonal and daily activities should be ascertained from future studies in wetland complexes that exist in the highest state of natural preservation. Long-term burning and grazing experiments should follow on specific vegetatively-degraded wetlands judged to be potentially important breeding areas. Seasonality, frequency, and intensity of treatments should be varied and combined and, in addition to measuring the response of the biotic community, the changes in the physical and chemical environment of the wetlands should be monitored to increase our knowledge of causative factors and possible predictive values.

Multiconductor Short/Open Cable Tester

NASA Technical Reports Server (NTRS)

Eichenberg, Dennis

1994-01-01

Frequent or regular testing of multiconductor cables terminated in multipin conductors tedious, if not impossible, task. This inexpensive circuit simplifies open/short testing and is amenable to automation. In operation, pair of connectors selected to match pair of connectors installed on each of cables to be tested. As many connectors accommodated as required, and each can have as many conductors as required. Testing technique implemented with this circuit automated easily with electronic controls and computer interface. Printout provides status of each conductor in cable, indicating which, if any, of conductors has open or short circuit.

Exact calculation of loop formation probability identifies folding motifs in RNA secondary structures.

PubMed

Sloma, Michael F; Mathews, David H

2016-12-01

RNA secondary structure prediction is widely used to analyze RNA sequences. In an RNA partition function calculation, free energy nearest neighbor parameters are used in a dynamic programming algorithm to estimate statistical properties of the secondary structure ensemble. Previously, partition functions have largely been used to estimate the probability that a given pair of nucleotides form a base pair, the conditional stacking probability, the accessibility to binding of a continuous stretch of nucleotides, or a representative sample of RNA structures. Here it is demonstrated that an RNA partition function can also be used to calculate the exact probability of formation of hairpin loops, internal loops, bulge loops, or multibranch loops at a given position. This calculation can also be used to estimate the probability of formation of specific helices. Benchmarking on a set of RNA sequences with known secondary structures indicated that loops that were calculated to be more probable were more likely to be present in the known structure than less probable loops. Furthermore, highly probable loops are more likely to be in the known structure than the set of loops predicted in the lowest free energy structures. © 2016 Sloma and Mathews; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Does prediction error drive one-shot declarative learning?

PubMed

Greve, Andrea; Cooper, Elisa; Kaula, Alexander; Anderson, Michael C; Henson, Richard

2017-06-01

The role of prediction error (PE) in driving learning is well-established in fields such as classical and instrumental conditioning, reward learning and procedural memory; however, its role in human one-shot declarative encoding is less clear. According to one recent hypothesis, PE reflects the divergence between two probability distributions: one reflecting the prior probability (from previous experiences) and the other reflecting the sensory evidence (from the current experience). Assuming unimodal probability distributions, PE can be manipulated in three ways: (1) the distance between the mode of the prior and evidence, (2) the precision of the prior, and (3) the precision of the evidence. We tested these three manipulations across five experiments, in terms of peoples' ability to encode a single presentation of a scene-item pairing as a function of previous exposures to that scene and/or item. Memory was probed by presenting the scene together with three choices for the previously paired item, in which the two foil items were from other pairings within the same condition as the target item. In Experiment 1, we manipulated the evidence to be either consistent or inconsistent with prior expectations, predicting PE to be larger, and hence memory better, when the new pairing was inconsistent. In Experiments 2a-c, we manipulated the precision of the priors, predicting better memory for a new pairing when the (inconsistent) priors were more precise. In Experiment 3, we manipulated both visual noise and prior exposure for unfamiliar faces, before pairing them with scenes, predicting better memory when the sensory evidence was more precise. In all experiments, the PE hypotheses were supported. We discuss alternative explanations of individual experiments, and conclude the Predictive Interactive Multiple Memory Signals (PIMMS) framework provides the most parsimonious account of the full pattern of results.

VizieR Online Data Catalog: Proper motions of PM2000 open clusters (Krone-Martins+, 2010)

NASA Astrophysics Data System (ADS)

Krone-Martins, A.; Soubiran, C.; Ducourant, C.; Teixeira, R.; Le Campion, J. F.

2010-04-01

We present lists of proper-motions and kinematic membership probabilities in the region of 49 open clusters or possible open clusters. The stellar proper motions were taken from the Bordeaux PM2000 catalogue. The segregation between cluster and field stars and the assignment of membership probabilities was accomplished by applying a fully automated method based on parametrisations for the probability distribution functions and genetic algorithm optimisation heuristics associated with a derivative-based hill climbing algorithm for the likelihood optimization. (3 data files).

Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

PubMed

Nonin, S; Leroy, J L; Guéron, M

1995-08-22

We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

Efficient and accurate local single reference correlation methods for high-spin open-shell molecules using pair natural orbitals

NASA Astrophysics Data System (ADS)

Hansen, Andreas; Liakos, Dimitrios G.; Neese, Frank

2011-12-01

A production level implementation of the high-spin open-shell (spin unrestricted) single reference coupled pair, quadratic configuration interaction and coupled cluster methods with up to doubly excited determinants in the framework of the local pair natural orbital (LPNO) concept is reported. This work is an extension of the closed-shell LPNO methods developed earlier [F. Neese, F. Wennmohs, and A. Hansen, J. Chem. Phys. 130, 114108 (2009), 10.1063/1.3086717; F. Neese, A. Hansen, and D. G. Liakos, J. Chem. Phys. 131, 064103 (2009), 10.1063/1.3173827]. The internal space is spanned by localized orbitals, while the external space for each electron pair is represented by a truncated PNO expansion. The laborious integral transformation associated with the large number of PNOs becomes feasible through the extensive use of density fitting (resolution of the identity (RI)) techniques. Technical complications arising for the open-shell case and the use of quasi-restricted orbitals for the construction of the reference determinant are discussed in detail. As in the closed-shell case, only three cutoff parameters control the average number of PNOs per electron pair, the size of the significant pair list, and the number of contributing auxiliary basis functions per PNO. The chosen threshold default values ensure robustness and the results of the parent canonical methods are reproduced to high accuracy. Comprehensive numerical tests on absolute and relative energies as well as timings consistently show that the outstanding performance of the LPNO methods carries over to the open-shell case with minor modifications. Finally, hyperfine couplings calculated with the variational LPNO-CEPA/1 method, for which a well-defined expectation value type density exists, indicate the great potential of the LPNO approach for the efficient calculation of molecular properties.

A new model for approximating RNA folding trajectories and population kinetics

NASA Astrophysics Data System (ADS)

Kirkpatrick, Bonnie; Hajiaghayi, Monir; Condon, Anne

2013-01-01

RNA participates both in functional aspects of the cell and in gene regulation. The interactions of these molecules are mediated by their secondary structure which can be viewed as a planar circle graph with arcs for all the chemical bonds between pairs of bases in the RNA sequence. The problem of predicting RNA secondary structure, specifically the chemically most probable structure, has many useful and efficient algorithms. This leaves RNA folding, the problem of predicting the dynamic behavior of RNA structure over time, as the main open problem. RNA folding is important for functional understanding because some RNA molecules change secondary structure in response to interactions with the environment. The full RNA folding model on at most O(3n) secondary structures is the gold standard. We present a new subset approximation model for the full model, give methods to analyze its accuracy and discuss the relative merits of our model as compared with a pre-existing subset approximation. The main advantage of our model is that it generates Monte Carlo folding pathways with the same probabilities with which they are generated under the full model. The pre-existing subset approximation does not have this property.

Two-photon decay in gold atoms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dunford, R. W.; Kanter, E. P.; Kraessig, B.

2006-07-15

We have measured the energy differential transition probabilities for the two-photon decay of K vacancies in gold atoms (nuclear charge Z=79). This is the heaviest atom for which this information has been obtained, and so is most sensitive to relativistic effects. The experiment determined the shape of the continuum radiation for the transitions 2s{yields}1s, 3s{yields}1s, 3d{yields}1s, and (4s+4d){yields}1s at an emission pair opening angle {theta}={pi}/2. Our results for 3d{yields}1s and (4s+4d){yields}1s extend to energies above and below the region of the intermediate state resonances. No relativistic calculations exist for Au, so we compare with calculations by Mu and Crasemann andmore » Tong et al. for Ag (Z=47) and Xe (Z=54). For equal-energy, back-to-back two-photon decay, the calculations show an increase in transition probability with Z for the 2s{yields}1s and 3d{yields}1s transitions. In contrast, our data, at Z=79, corrected for the angular distribution, give a smaller transition probability than the lower-Z experimental results of Ilakovac et al. and Mokler et al. for Ag and Xe. The shapes of the two-photon continua in our data are in general agreement with theory except that we find anomalously high values for the differential two-photon transition probability for the 3s{yields}1s transition near y=0.35, where y is the fraction of the transition energy carried by the lower-energy photon.« less

Repeated count surveys help standardize multi-agency estimates of American Oystercatcher (Haematopus palliatus) abundance

USGS Publications Warehouse

Hostetter, Nathan J.; Gardner, Beth; Schweitzer, Sara H.; Boettcher, Ruth; Wilke, Alexandra L.; Addison, Lindsay; Swilling, William R.; Pollock, Kenneth H.; Simons, Theodore R.

2015-01-01

The extensive breeding range of many shorebird species can make integration of survey data problematic at regional spatial scales. We evaluated the effectiveness of standardized repeated count surveys coordinated across 8 agencies to estimate the abundance of American Oystercatcher (Haematopus palliatus) breeding pairs in the southeastern United States. Breeding season surveys were conducted across coastal North Carolina (90 plots) and the Eastern Shore of Virginia (3 plots). Plots were visited on 1–5 occasions during April–June 2013. N-mixture models were used to estimate abundance and detection probability in relation to survey date, tide stage, plot size, and plot location (coastal bay vs. barrier island). The estimated abundance of oystercatchers in the surveyed area was 1,048 individuals (95% credible interval: 851–1,408) and 470 pairs (384–637), substantially higher than estimates that did not account for detection probability (maximum counts of 674 individuals and 316 pairs). Detection probability was influenced by a quadratic function of survey date, and increased from mid-April (~0.60) to mid-May (~0.80), then remained relatively constant through June. Detection probability was also higher during high tide than during low, rising, or falling tides. Abundance estimates from N-mixture models were validated at 13 plots by exhaustive productivity studies (2–5 surveys wk−1). Intensive productivity studies identified 78 breeding pairs across 13 productivity plots while the N-mixture model abundance estimate was 74 pairs (62–119) using only 1–5 replicated surveys season−1. Our results indicate that standardized replicated count surveys coordinated across multiple agencies and conducted during a relatively short time window (closure assumption) provide tremendous potential to meet both agency-level (e.g., state) and regional-level (e.g., flyway) objectives in large-scale shorebird monitoring programs.

Transmission events revealed in tuberculosis contact investigations in London.

PubMed

Cavany, Sean M; Vynnycky, Emilia; Sumner, Tom; Macdonald, Neil; Thomas, H Lucy; White, Jacqui; White, Richard G; Maguire, Helen; Anderson, Charlotte

2018-04-27

Contact tracing is a key part of tuberculosis prevention and care, aiming to hasten diagnosis and prevent transmission. The proportion of case-contact pairs for which recent transmission occurred and the typical timespans between the index case and their contact accessing care are not known; we aimed to calculate these. We analysed individual-level TB contact tracing data, collected in London from 20/01/2011-31/12/2015, linked to tuberculosis surveillance and MIRU-VNTR 24-locus strain-typing information. Of pairs of index cases and contacts diagnosed with active tuberculosis, 85/314 (27%) had strain typing data available for both. Of these pairs, 79% (67/85) shared indistinguishable isolates, implying probable recent transmission. Of pairs in which both contact and the index case had a social risk factor, 11/11 (100%) shared indistinguishable isolates, compared to 55/75 (75%) of pairs in which neither had a social risk factor (P = 0.06). The median time interval between the index case and their contact accessing care was 42 days (IQR: 16, 96). As over 20% of pairs did probably not involve recent transmission between index case and contact, the effectiveness of contact tracing is not necessarily limited to those circumstances where the index case has transmitted disease to their close contacts.

What is preexisting strength? Predicting free association probabilities, similarity ratings, and cued recall probabilities.

PubMed

Nelson, Douglas L; Dyrdal, Gunvor M; Goodmon, Leilani B

2005-08-01

Measuring lexical knowledge poses a challenge to the study of the influence of preexisting knowledge on the retrieval of new memories. Many tasks focus on word pairs, but words are embedded in associative networks, so how should preexisting pair strength be measured? It has been measured by free association, similarity ratings, and co-occurrence statistics. Researchers interpret free association response probabilities as unbiased estimates of forward cue-to-target strength. In Study 1, analyses of large free association and extralist cued recall databases indicate that this interpretation is incorrect. Competitor and backward strengths bias free association probabilities, and as with other recall tasks, preexisting strength is described by a ratio rule. In Study 2, associative similarity ratings are predicted by forward and backward, but not by competitor, strength. Preexisting strength is not a unitary construct, because its measurement varies with method. Furthermore, free association probabilities predict extralist cued recall better than do ratings and co-occurrence statistics. The measure that most closely matches the criterion task may provide the best estimate of the identity of preexisting strength.

Behavior of visual field index in advanced glaucoma.

PubMed

Rao, Harsha L; Senthil, Sirisha; Choudhari, Nikhil S; Mandal, Anil K; Garudadri, Chandra S

2013-01-14

To evaluate the magnitude of Visual Field Index (VFI) change attributable to change in the estimation algorithm from the pattern deviation probability plot (PDPP) to the total deviation probability plot (TDPP) when the mean deviation (MD) crosses -20 decibels (dB). In a retrospective study, 37 stable glaucoma eyes in which MD of the VFs crossed -20 dB were identified. For each eye, a pair of VFs was selected so that one VF of the pair had a MD better than but close to -20 dB and the other had a MD worse than but again close to -20 dB. The change in VFI in the VF pairs and its associations with the number of points in probability plots with normal threshold sensitivities were evaluated. Similar pairs of VFs from 28 stable glaucoma eyes where the MD crossed -10 dB were chosen as controls. The change in VFI in VF pairs when the MD crossed 20 dB ranged from 3% to 33% (median: 15%), while the change when MD crossed -10 dB ranged from 1% to 8% (median: 4%). Difference in the number of points with normal threshold sensitivities in PDPP when MD was better than -20 dB compared to those in TDPP when MD crossed -20 dB significantly influenced the VFI change (R(2) = 0.65). Considering the eccentricity of these points further explained the VFI change (R(2) = 0.81). The decrease in VFI when MD crosses -20 dB can be highly variable. This has to be considered with the use of VFI in clinical and research settings.

Interacting star clusters in the Large Magellanic Cloud. Overmerging problem solved by cluster group formation

NASA Astrophysics Data System (ADS)

Leon, Stéphane; Bergond, Gilles; Vallenari, Antonella

1999-04-01

We present the tidal tail distributions of a sample of candidate binary clusters located in the bar of the Large Magellanic Cloud (LMC). One isolated cluster, SL 268, is presented in order to study the effect of the LMC tidal field. All the candidate binary clusters show tidal tails, confirming that the pairs are formed by physically linked objects. The stellar mass in the tails covers a large range, from 1.8x 10(3) to 3x 10(4) \\msun. We derive a total mass estimate for SL 268 and SL 356. At large radii, the projected density profiles of SL 268 and SL 356 fall off as r(-gamma ) , with gamma = 2.27 and gamma =3.44, respectively. Out of 4 pairs or multiple systems, 2 are older than the theoretical survival time of binary clusters (going from a few 10(6) years to 10(8) years). A pair shows too large age difference between the components to be consistent with classical theoretical models of binary cluster formation (Fujimoto & Kumai \\cite{fujimoto97}). We refer to this as the ``overmerging'' problem. A different scenario is proposed: the formation proceeds in large molecular complexes giving birth to groups of clusters over a few 10(7) years. In these groups the expected cluster encounter rate is larger, and tidal capture has higher probability. Cluster pairs are not born together through the splitting of the parent cloud, but formed later by tidal capture. For 3 pairs, we tentatively identify the star cluster group (SCG) memberships. The SCG formation, through the recent cluster starburst triggered by the LMC-SMC encounter, in contrast with the quiescent open cluster formation in the Milky Way can be an explanation to the paucity of binary clusters observed in our Galaxy. Based on observations collected at the European Southern Observatory, La Silla, Chile}

Comparison of Different Risk Perception Measures in Predicting Seasonal Influenza Vaccination among Healthy Chinese Adults in Hong Kong: A Prospective Longitudinal Study

PubMed Central

Liao, Qiuyan; Wong, Wing Sze; Fielding, Richard

2013-01-01

Background Risk perception is a reported predictor of vaccination uptake, but which measures of risk perception best predict influenza vaccination uptake remain unclear. Methodology During the main influenza seasons (between January and March) of 2009 (Wave 1) and 2010 (Wave 2),505 Chinese students and employees from a Hong Kong university completed an online survey. Multivariate logistic regression models were conducted to assess how well different risk perceptions measures in Wave 1 predicted vaccination uptake against seasonal influenza in Wave 2. Principal Findings The results of the multivariate logistic regression models showed that feeling at risk (β = 0.25, p = 0.021) was the better predictor compared with probability judgment while probability judgment (β = 0.25, p = 0.029 ) was better than beliefs about risk in predicting subsequent influenza vaccination uptake. Beliefs about risk and feeling at risk seemed to predict the same aspect of subsequent vaccination uptake because their associations with vaccination uptake became insignificant when paired into the logistic regression model. Similarly, to compare the four scales for assessing probability judgment in predicting vaccination uptake, the 7-point verbal scale remained a significant and stronger predictor for vaccination uptake when paired with other three scales; the 6-point verbal scale was a significant and stronger predictor when paired with the percentage scale or the 2-point verbal scale; and the percentage scale was a significant and stronger predictor only when paired with the 2-point verbal scale. Conclusions/Significance Beliefs about risk and feeling at risk are not well differentiated by Hong Kong Chinese people. Feeling at risk, an affective-cognitive dimension of risk perception predicts subsequent vaccination uptake better than do probability judgments. Among the four scales for assessing risk probability judgment, the 7-point verbal scale offered the best predictive power for subsequent vaccination uptake. PMID:23894292

Comparison of different risk perception measures in predicting seasonal influenza vaccination among healthy Chinese adults in Hong Kong: a prospective longitudinal study.

PubMed

Liao, Qiuyan; Wong, Wing Sze; Fielding, Richard

2013-01-01

Risk perception is a reported predictor of vaccination uptake, but which measures of risk perception best predict influenza vaccination uptake remain unclear. During the main influenza seasons (between January and March) of 2009 (Wave 1) and 2010 (Wave 2),505 Chinese students and employees from a Hong Kong university completed an online survey. Multivariate logistic regression models were conducted to assess how well different risk perceptions measures in Wave 1 predicted vaccination uptake against seasonal influenza in Wave 2. The results of the multivariate logistic regression models showed that feeling at risk (β = 0.25, p = 0.021) was the better predictor compared with probability judgment while probability judgment (β = 0.25, p = 0.029 ) was better than beliefs about risk in predicting subsequent influenza vaccination uptake. Beliefs about risk and feeling at risk seemed to predict the same aspect of subsequent vaccination uptake because their associations with vaccination uptake became insignificant when paired into the logistic regression model. Similarly, to compare the four scales for assessing probability judgment in predicting vaccination uptake, the 7-point verbal scale remained a significant and stronger predictor for vaccination uptake when paired with other three scales; the 6-point verbal scale was a significant and stronger predictor when paired with the percentage scale or the 2-point verbal scale; and the percentage scale was a significant and stronger predictor only when paired with the 2-point verbal scale. Beliefs about risk and feeling at risk are not well differentiated by Hong Kong Chinese people. Feeling at risk, an affective-cognitive dimension of risk perception predicts subsequent vaccination uptake better than do probability judgments. Among the four scales for assessing risk probability judgment, the 7-point verbal scale offered the best predictive power for subsequent vaccination uptake.

Charge recombination in organic photovoltaic devices with high open-circuit voltages.

PubMed

Westenhoff, Sebastian; Howard, Ian A; Hodgkiss, Justin M; Kirov, Kiril R; Bronstein, Hugo A; Williams, Charlotte K; Greenham, Neil C; Friend, Richard H

2008-10-15

A detailed charge recombination mechanism is presented for organic photovoltaic devices with a high open-circuit voltage. In a binary blend comprised of polyfluorene copolymers, the performance-limiting process is found to be the efficient recombination of tightly bound charge pairs into neutral triplet excitons. We arrive at this conclusion using optical transient absorption (TA) spectroscopy with visible and IR probes and over seven decades of time resolution. By resolving the polarization of the TA signal, we track the movement of polaronic states generated at the heterojunction not only in time but also in space. It is found that the photogenerated charge pairs are remarkably immobile at the heterojunction during their lifetime. The charge pairs are shown to be subject to efficient intersystem crossing and terminally recombine into F8BT triplet excitons within approximately 40 ns. Long-range charge separation competes rather unfavorably with intersystem crossing--75% of all charge pairs decay into triplet excitons. Triplet exciton states are thermodynamically accessible in polymer solar cells with high open circuit voltage, and we therefore suggest this loss mechanism to be general. We discuss guidelines for the design of the next generation of organic photovoltaic materials where separating the metastable interfacial charge pairs within approximately 40 ns is paramount.

Structure and conversion kinetics of a bi-stable DNA i-motif: broken symmetry in the [d(5mCCTCC)]4 tetramer.

PubMed

Nonin, S; Leroy, J L

1996-08-23

At slightly acidic pH, protonation of C-rich oligomers results in the formation of a four-stranded structure composed of two parallel duplexes in a head to tail orientation with their hemi-protonated C.C+ pairs intercalated in a so-called i-motif. In all cases reported previously the duplexes are identical. The tetramer formed by the d(5mCCTCC) oligomer is different. The structure is computed on the basis of 55 inter-residue distances derived from NOESY cross-peaks measured at short mixing times. It consists of two intercalated non-equivalent symmetrical duplexes. The base stacking order is C5* C1 C4* C2 (T3*) T3 C2* C4 C1* C5, but the thymidine bases (T3*) of one duplex are looped out and lie in the wide grooves of the tetramer. The thymidine bases T3 stack as a symmetrical T.T pair between the sequentially adjacent C2.C2+ pair and the C2*.C2*+ pair of the other duplex. Numerous exchange cross-peaks provide evidence for duplex interconversion. The interconversion rate is 1.4 s-1 at 0 degree C and the activation energy is 94 kJ/mol. The opening of the T3.T3 pair, the closing of the T3*.T3 pair, and the opening of the C2*.C2*+ pair occur simultaneously with the duplex interconversion. This suggests that the concerted opening and closing of the thymidine bases drive the duplex interconversion. Opening of the C4.C4+ and C4*.C4*+ pairs, and dissociation of the tetramer are not part of the interconversion since they occur at much slower rates. Duplex interconversion within the [d(5mCCTCC)]4 tetramer provides the first structural and kinetics characterization of broken symmetry in a biopolymer. The tetramer formed by d(5mCCUCC) adopts a similar structure, but the rate of duplex interconversion is faster: 40 s-1 at 0 degree C. At 32 degrees C, interconversion is fast on the NMR time scale.

Substituent effects on rates and torquoselectivities of electrocyclic ring-openings of N-substituted 2-azetines.

PubMed

Lopez, Steven A; Houk, K N

2014-07-03

Transition structures for the conrotatory electrocyclic ring-opening reactions of N-substituted 2-azetines were computed with the density functional M06-2X/6-31+G(d,p). A wide range of substituents from π acceptors (e.g., CHO, CN) to π donors (NMe2, OMe) was explored. Acceptor substituents delocalize the nitrogen lone pair and stabilize the reactant state of 2-azetines, while donors destabilize the 2-azetine reactant state. The conrotatory ring-opening is torquoselective, and the transition state for the outward rotation of the N-substituent and inward rotation of the nitrogen lone pair is preferred. This transition structure is stabilized by an interaction between the nitrogen lone pair and the vacant π* orbital. The activation free energies are linearly related to the reaction free energies and the Taft σR(0) parameter.

Tobacco chloroplast tRNALys(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron

PubMed Central

Sugita, Mamoru; Shinozaki, Kazuo; Sugiura, Masahiro

1985-01-01

The nucleotide sequence of a tRNALys(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNAGly(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long. Images PMID:16593561

Tobacco chloroplast tRNA(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron.

PubMed

Sugita, M; Shinozaki, K; Sugiura, M

1985-06-01

The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

NASA Astrophysics Data System (ADS)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Spatial Multiplexing of Atom-Photon Entanglement Sources using Feedforward Control and Switching Networks.

PubMed

Tian, Long; Xu, Zhongxiao; Chen, Lirong; Ge, Wei; Yuan, Haoxiang; Wen, Yafei; Wang, Shengzhi; Li, Shujing; Wang, Hai

2017-09-29

The light-matter quantum interface that can create quantum correlations or entanglement between a photon and one atomic collective excitation is a fundamental building block for a quantum repeater. The intrinsic limit is that the probability of preparing such nonclassical atom-photon correlations has to be kept low in order to suppress multiexcitation. To enhance this probability without introducing multiexcitation errors, a promising scheme is to apply multimode memories to the interface. Significant progress has been made in temporal, spectral, and spatial multiplexing memories, but the enhanced probability for generating the entangled atom-photon pair has not been experimentally realized. Here, by using six spin-wave-photon entanglement sources, a switching network, and feedforward control, we build a multiplexed light-matter interface and then demonstrate a ∼sixfold (∼fourfold) probability increase in generating entangled atom-photon (photon-photon) pairs. The measured compositive Bell parameter for the multiplexed interface is 2.49±0.03 combined with a memory lifetime of up to ∼51  μs.

Camera trap placement and the potential for bias due to trails and other features

PubMed Central

Forrester, Tavis D.

2017-01-01

Camera trapping has become an increasingly widespread tool for wildlife ecologists, with large numbers of studies relying on photo capture rates or presence/absence information. It is increasingly clear that camera placement can directly impact this kind of data, yet these biases are poorly understood. We used a paired camera design to investigate the effect of small-scale habitat features on species richness estimates, and capture rate and detection probability of several mammal species in the Shenandoah Valley of Virginia, USA. Cameras were deployed at either log features or on game trails with a paired camera at a nearby random location. Overall capture rates were significantly higher at trail and log cameras compared to their paired random cameras, and some species showed capture rates as much as 9.7 times greater at feature-based cameras. We recorded more species at both log (17) and trail features (15) than at their paired control cameras (13 and 12 species, respectively), yet richness estimates were indistinguishable after 659 and 385 camera nights of survey effort, respectively. We detected significant increases (ranging from 11–33%) in detection probability for five species resulting from the presence of game trails. For six species detection probability was also influenced by the presence of a log feature. This bias was most pronounced for the three rodents investigated, where in all cases detection probability was substantially higher (24.9–38.2%) at log cameras. Our results indicate that small-scale factors, including the presence of game trails and other features, can have significant impacts on species detection when camera traps are employed. Significant biases may result if the presence and quality of these features are not documented and either incorporated into analytical procedures, or controlled for in study design. PMID:29045478

Camera trap placement and the potential for bias due to trails and other features.

PubMed

Kolowski, Joseph M; Forrester, Tavis D

2017-01-01

Camera trapping has become an increasingly widespread tool for wildlife ecologists, with large numbers of studies relying on photo capture rates or presence/absence information. It is increasingly clear that camera placement can directly impact this kind of data, yet these biases are poorly understood. We used a paired camera design to investigate the effect of small-scale habitat features on species richness estimates, and capture rate and detection probability of several mammal species in the Shenandoah Valley of Virginia, USA. Cameras were deployed at either log features or on game trails with a paired camera at a nearby random location. Overall capture rates were significantly higher at trail and log cameras compared to their paired random cameras, and some species showed capture rates as much as 9.7 times greater at feature-based cameras. We recorded more species at both log (17) and trail features (15) than at their paired control cameras (13 and 12 species, respectively), yet richness estimates were indistinguishable after 659 and 385 camera nights of survey effort, respectively. We detected significant increases (ranging from 11-33%) in detection probability for five species resulting from the presence of game trails. For six species detection probability was also influenced by the presence of a log feature. This bias was most pronounced for the three rodents investigated, where in all cases detection probability was substantially higher (24.9-38.2%) at log cameras. Our results indicate that small-scale factors, including the presence of game trails and other features, can have significant impacts on species detection when camera traps are employed. Significant biases may result if the presence and quality of these features are not documented and either incorporated into analytical procedures, or controlled for in study design.

Open quantum random walk in terms of quantum Bernoulli noise

NASA Astrophysics Data System (ADS)

Wang, Caishi; Wang, Ce; Ren, Suling; Tang, Yuling

2018-03-01

In this paper, we introduce an open quantum random walk, which we call the QBN-based open walk, by means of quantum Bernoulli noise, and study its properties from a random walk point of view. We prove that, with the localized ground state as its initial state, the QBN-based open walk has the same limit probability distribution as the classical random walk. We also show that the probability distributions of the QBN-based open walk include those of the unitary quantum walk recently introduced by Wang and Ye (Quantum Inf Process 15:1897-1908, 2016) as a special case.

Facebook dethroned: Revealing the more likely social media destinations for college students’ depictions of underage drinking

PubMed Central

Boyle, Sarah C.; Earle, Andrew M.; LaBrie, Joseph W.; Ballou, Kayla

2016-01-01

Studies examining representations of college drinking on social media have almost exclusively focused on Facebook. However, recent research suggests college students may be more influenced by peers’ alcohol-related posts on Instagram and Snapchat, two image-based platforms popular among this demographic. One potential explanation for this differential influence is that qualitative distinctions in the types of alcohol-related content posted by students on these three platforms may exist. Informed by undergraduate focus groups, this study examined the hypothesis that, of the three platforms, students tend to use Instagram most often for photos glamourizing drinking and Snapchat for incriminating photos of alcohol misuse and negative consequences. Undergraduate research assistants aided investigators in developing hypothetical vignettes and photographic examples of posts both glamorizing and depicting negative consequences associated with college drinking. In an online survey, vignette and photo stimuli were followed by counterbalanced paired comparisons that presented each possible pair of social media platforms. Undergraduates (N=196) selected the platform from each pair on which they would be more likely to see each post. Generalized Bradley-Terry models examined the probabilities of platform selections. As predicted, Instagram was seen as the most probable destination (and Facebook least probable) for photos depicting alcohol use as attractive and glamorous. Conversely, Snapchat was selected as the most probable destination (and Facebook least probable) for items depicting negative consequences associated with heavy drinking. Results suggest researchers aiming to mitigate the potential influences associated with college students’ glamorous and consequential alcohol-related photos posted social media posts should shift their focus from Facebook to Instagram and Snapchat. PMID:27776267

Chemical Abundances of Main-sequence, Turnoff, Subgiant, and Red Giant Stars from APOGEE Spectra. I. Signatures of Diffusion in the Open Cluster M67

NASA Astrophysics Data System (ADS)

Souto, Diogo; Cunha, Katia; Smith, Verne V.; Allende Prieto, C.; García-Hernández, D. A.; Pinsonneault, Marc; Holzer, Parker; Frinchaboy, Peter; Holtzman, Jon; Johnson, J. A.; Jönsson, Henrik; Majewski, Steven R.; Shetrone, Matthew; Sobeck, Jennifer; Stringfellow, Guy; Teske, Johanna; Zamora, Olga; Zasowski, Gail; Carrera, Ricardo; Stassun, Keivan; Fernandez-Trincado, J. G.; Villanova, Sandro; Minniti, Dante; Santana, Felipe

2018-04-01

Detailed chemical abundance distributions for 14 elements are derived for eight high-probability stellar members of the solar metallicity old open cluster M67 with an age of ∼4 Gyr. The eight stars consist of four pairs, with each pair occupying a distinct phase of stellar evolution: two G dwarfs, two turnoff stars, two G subgiants, and two red clump (RC) K giants. The abundance analysis uses near-IR high-resolution spectra (λ1.5–1.7 μm) from the Apache Point Observatory Galactic Evolution Experiment survey and derives abundances for C, N, O, Na, Mg, Al, Si, K, Ca, Ti, V, Cr, Mn, and Fe. Our derived stellar parameters and metallicity for 2M08510076+1153115 suggest that this star is a solar twin, exhibiting abundance differences relative to the Sun of ≤0.04 dex for all elements. Chemical homogeneity is found within each class of stars (∼0.02 dex), while significant abundance variations (∼0.05–0.20 dex) are found across the different evolutionary phases; the turnoff stars typically have the lowest abundances, while the RCs tend to have the largest. Non-LTE corrections to the LTE-derived abundances are unlikely to explain the differences. A detailed comparison of the derived Fe, Mg, Si, and Ca abundances with recently published surface abundances from stellar models that include chemical diffusion provides a good match between the observed and predicted abundances as a function of stellar mass. Such agreement would indicate the detection of chemical diffusion processes in the stellar members of M67.

Personality Homophily and Geographic Distance in Facebook.

PubMed

Noë, Nyala; Whitaker, Roger M; Allen, Stuart M

2018-05-24

Personality homophily remains an understudied aspect of social networks, with the traditional focus concerning sociodemographic variables as the basis for assortativity, rather than psychological dispositions. We consider the effect of personality homophily on one of the biggest constraints to human social networks: geographic distance. We use the Big five model of personality to make predictions for each of the five facets: Openness to experience, Conscientiousness, Extraversion, Agreeableness, and Neuroticism. Using a network of 313,669 Facebook users, we investigate the difference in geographic distance between homophilous pairs, in which both users scored similarly on a particular facet, and mixed pairs. In accordance with our hypotheses, we find that pairs of open and conscientious users are geographically further apart than mixed pairs. Pairs of extraverts, on the other hand, tend to be geographically closer together. We find mixed results for the Neuroticism facet, and no significant effects for the Agreeableness facet. The results are discussed in the context of personality homophily and the impact of geographic distance on social connections.

Analyzing survival curves at a fixed point in time for paired and clustered right-censored data

PubMed Central

Su, Pei-Fang; Chi, Yunchan; Lee, Chun-Yi; Shyr, Yu; Liao, Yi-De

2018-01-01

In clinical trials, information about certain time points may be of interest in making decisions about treatment effectiveness. Rather than comparing entire survival curves, researchers can focus on the comparison at fixed time points that may have a clinical utility for patients. For two independent samples of right-censored data, Klein et al. (2007) compared survival probabilities at a fixed time point by studying a number of tests based on some transformations of the Kaplan-Meier estimators of the survival function. However, to compare the survival probabilities at a fixed time point for paired right-censored data or clustered right-censored data, their approach would need to be modified. In this paper, we extend the statistics to accommodate the possible within-paired correlation and within-clustered correlation, respectively. We use simulation studies to present comparative results. Finally, we illustrate the implementation of these methods using two real data sets. PMID:29456280

Entropy of finite random binary sequences with weak long-range correlations.

PubMed

Melnik, S S; Usatenko, O V

2014-11-01

We study the N-step binary stationary ergodic Markov chain and analyze its differential entropy. Supposing that the correlations are weak we express the conditional probability function of the chain through the pair correlation function and represent the entropy as a functional of the pair correlator. Since the model uses the two-point correlators instead of the block probability, it makes it possible to calculate the entropy of strings at much longer distances than using standard methods. A fluctuation contribution to the entropy due to finiteness of random chains is examined. This contribution can be of the same order as its regular part even at the relatively short lengths of subsequences. A self-similar structure of entropy with respect to the decimation transformations is revealed for some specific forms of the pair correlation function. Application of the theory to the DNA sequence of the R3 chromosome of Drosophila melanogaster is presented.

Entropy of finite random binary sequences with weak long-range correlations

NASA Astrophysics Data System (ADS)

Melnik, S. S.; Usatenko, O. V.

2014-11-01

We study the N -step binary stationary ergodic Markov chain and analyze its differential entropy. Supposing that the correlations are weak we express the conditional probability function of the chain through the pair correlation function and represent the entropy as a functional of the pair correlator. Since the model uses the two-point correlators instead of the block probability, it makes it possible to calculate the entropy of strings at much longer distances than using standard methods. A fluctuation contribution to the entropy due to finiteness of random chains is examined. This contribution can be of the same order as its regular part even at the relatively short lengths of subsequences. A self-similar structure of entropy with respect to the decimation transformations is revealed for some specific forms of the pair correlation function. Application of the theory to the DNA sequence of the R3 chromosome of Drosophila melanogaster is presented.

Acrocentric chromosome associations in man.

PubMed Central

Jacobs, P A; Mayer, M; Morton, N E

1976-01-01

Heterogeneity among chromosomes was found to be a highly significant source of variation for association proportions, while culture, slide, and observer were negligible sources of variation for association proportions although important for numbers of associations. The consequences of these results for tests of group differences are discussed. It seems evident that each pair of acrocentric chromosomes has its own characteristic probability of entering into association. This is presumably a combination of the probability for each individual member of the pair, a proposition easily tested utilizing acrocentric chromosomes carrying polymorphisms which allow each member of the pair to be individually recognized. A mathematical theory for pairwise satellite association was developed and shown to fit observations on banded chromosomes. While we found very significant heterogeneity among individuals in the frequency with which different chromosomes entered into associations, there was no significant evidence for preferential association between any particular chromosomes, either heterologous or homologous. This finding in our material of apparently random associations between different chromosomes is contrary to claims made by other investigators and should be tested on other material. No correlation was found between the phenotype of the chromosome, as judged by cytogenetic polymorphisms, and its probability of association. PMID:795295

Resolving dual binding conformations of cellulosome cohesin-dockerin complexes using single-molecule force spectroscopy

PubMed Central

Jobst, Markus A; Milles, Lukas F; Schoeler, Constantin; Ott, Wolfgang; Fried, Daniel B; Bayer, Edward A; Gaub, Hermann E; Nash, Michael A

2015-01-01

Receptor-ligand pairs are ordinarily thought to interact through a lock and key mechanism, where a unique molecular conformation is formed upon binding. Contrary to this paradigm, cellulosomal cohesin-dockerin (Coh-Doc) pairs are believed to interact through redundant dual binding modes consisting of two distinct conformations. Here, we combined site-directed mutagenesis and single-molecule force spectroscopy (SMFS) to study the unbinding of Coh:Doc complexes under force. We designed Doc mutations to knock out each binding mode, and compared their single-molecule unfolding patterns as they were dissociated from Coh using an atomic force microscope (AFM) cantilever. Although average bulk measurements were unable to resolve the differences in Doc binding modes due to the similarity of the interactions, with a single-molecule method we were able to discriminate the two modes based on distinct differences in their mechanical properties. We conclude that under native conditions wild-type Doc from Clostridium thermocellum exocellulase Cel48S populates both binding modes with similar probabilities. Given the vast number of Doc domains with predicteddual binding modes across multiple bacterial species, our approach opens up newpossibilities for understanding assembly and catalytic properties of a broadrange of multi-enzyme complexes. DOI: http://dx.doi.org/10.7554/eLife.10319.001 PMID:26519733

Effect of chronic stress on short and long-term plasticity in dentate gyrus; study of recovery and adaptation.

PubMed

Radahmadi, M; Hosseini, N; Nasimi, A

2014-11-07

Stress dramatically affects synaptic plasticity of the hippocampus, disrupts paired-pulse facilitation and impairs long-term potentiation (LTP). This study was performed to find the effects of chronic restraint stress and recovery period on excitability, paired-pulse response, LTP and to find probable adaptation to very long stress in the dentate gyrus. Thirty-eight male Wistar rats were randomly divided into four groups of Control, Rest-Stress (21 days stress), Stress-Rest (recovery) and Stress-Stress (42 days stress: adaptation). Chronic restraint stress was applied 6-h/day. Input-output functions, paired-pulse responses and LTP were recorded from the dentate gyrus while stimulating the perforant pathway. We found that chronic stress attenuated the responsiveness, paired-pulse response and LTP in the dentate gyrus. A 21-day recovery period, after the stress, improved all the three responses toward normal, indicating reversibility of these stress-related hippocampal changes. There was no significant adaptation to very long stress, probably due to severity of stress. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

Study of a New CPM Pair 2Mass 14515781-1619034

NASA Astrophysics Data System (ADS)

Falcon, Israel Tejera

2013-04-01

In this paper I present the results of a study of 2Mass 14515781-1619034 as components of a common proper motion pair. Because PPMXL catalog's proper motion data not provide any information about secondary star, I deduced it independently, obtaining similar proper motions for both components. Halbwalchs' criteria indicates that this is a CPM ystem. The criterion of Francisco Rica, which is based on the compatibility of the kinematic function of the equatorial coordinates, indicates that this pair has a 99% probability of being a physical one (Rica, 2007). Also other important criteria (Dommanget, 1956, Peter Van De Kamp, 1961, Sinachopoulus, 1992, Close, 2003), indicate a physical system. With the absolute visual magnitude of both components, I obtained distance modulus 7.29 and 7.59, which put the components of the system at a distance of 287.1 and 329.6 parsecs. Taking into account errors in determining the magnitudes, this means that the probability that both components are situated at the same distance is 96%. I suggest that this pair be included in the WDS catalog.

Information Theoretic Studies and Assessment of Space Object Identification

DTIC Science & Technology

2014-03-24

localization are contained in Ref. [5]. 1.7.1 A Bayesian MPE Based Analysis of 2D Point-Source-Pair Superresolution In a second recently submitted paper [6], a...related problem of the optical superresolution (OSR) of a pair of equal-brightness point sources separated spatially by a distance (or angle) smaller...1403.4897 [physics.optics] (19 March 2014). 6. S. Prasad, “Asymptotics of Bayesian error probability and 2D pair superresolution ,” submitted to Opt. Express

Monosodium glutamate-associated alterations in open field, anxiety-related and conditioned place preference behaviours in mice.

PubMed

Onaolapo, Olakunle James; Aremu, Olaleye Samuel; Onaolapo, Adejoke Yetunde

2017-07-01

The present study investigated changes in behaviour associated with oral monosodium glutamate (a flavouring agent), using the open field, elevated plus maze and conditioned place preference (CPP) paradigms, respectively. Mice were assigned to two groups for CPP [monosodium glutamate (MSG)-naïve (n = 40) and MSG-pretreated (n = 40)] and two groups for open field (OF) and elevated plus maze (EPM) tests [n = 40 each], respectively. Animals in respective groups were then divided into four subgroups (n = 10) (vehicle or MSG (80, 160 and 320 mg/kg)). MSG-naïve mice were observed in the CPP box in three phases (pre-conditioning, conditioning and post-conditioning). Mice were conditioned to MSG or an equivalent volume of saline. The MSG pretreatment group received vehicle or respective doses of MSG daily for 21 days, prior to conditioning. Mice in the OF or EPM groups received vehicle or doses of MSG (orally) for 21 days, at 10 ml/kg. Open field or EPM behaviours were assessed on days 1 and 21. At the end of the experiments, mice in the OF groups were sacrificed and brain homogenates used to assay glutamate and glutamine. Results showed that administration of MSG was associated with a decrease in rearing, dose-related mixed horizontal locomotor, grooming and anxiety-related response and an increase in brain glutamate/glutamine levels. Following exposure to the CPP paradigm, MSG-naïve and MSG-pretreated mice both showed 'drug-paired' chamber preference. The study concluded that MSG (at the administered doses) was associated with changes in open field activities, anxiety-related behaviours and brain glutamate/glutamine levels; its ingestion also probably leads to a stimulation of the brain reward system.

Projector-Camera Systems for Immersive Training

DTIC Science & Technology

2006-01-01

average to a sequence of 100 captured distortion corrected images. The OpenCV library [ OpenCV ] was used for camera calibration. To correct for...rendering application [Treskunov, Pair, and Swartout, 2004]. It was transposed to take into account different matrix conventions between OpenCV and...Screen Imperfections. Proc. Workshop on Projector-Camera Systems (PROCAMS), Nice, France, IEEE. OpenCV : Open Source Computer Vision. [Available

Variability of hydrologic regimes and morphology in constructed open-ditch channels

USGS Publications Warehouse

Strock, J.S.; Magner, J.A.; Richardson, W.B.; Sadowsky, M.J.; Sands, G.R.; Venterea, R.T.; ,

2004-01-01

Open-ditch ecosystems are potential transporters of considerable loads of nutrients, sediment, pathogens and pesticides from direct inflow from agricultural land to small streams and larger rivers. Our objective was to compare hydrology and channel morphology between two experimental open-ditch channels. An open-ditch research facility incorporating a paired design was constructed during 2002 near Lamberton, MN. A200-m reach of existing drainage channel was converted into a system of four parallel channels. The facility was equipped with water level control devices and instrumentation for flow monitoring and water sample collection on upstream and downstream ends of the system. Hydrographs from simulated flow during year one indicated that paired open-ditch channels responded similarly to changes in inflow. Variability in hydrologic response between open-ditches was attributed to differences in open-ditch channel bottom elevation and vegetation density. No chemical, biological, or atmospheric measurements were made during 2003. Potential future benefits of this research include improved biological diversity and integrity of open-ditch ecosystems, reduce flood peaks and increased flow during critical low-flow periods, improved and more efficient nitrogen retention within the open-ditch ecosystem, and decreased maintenance cost associated with reduced frequency of open-ditch maintenance.

Ab initio molecular orbital and density functional studies on the ring-opening reaction of oxetene.

PubMed

Jayaprakash, S; Jeevanandam, Jebakumar; Subramani, K

2014-11-01

Electrocyclic ring opening (ERO) reaction of 2H-Oxete (oxetene) has been carried out computationally in the gas phase and ring opening barrier has been computed. When comparing the ERO reaction of oxetene with the parent hydrocarbon (cyclobutene), the ring opening of cyclobutene is found to exhibit pericyclic behavior while oxetene shows mild pseudopericyclic nature. Computation of the nucleus-independent chemical shift (NICS) of oxetene adds evidence for pseudopericyclic behavior of oxetene. By locking of lone pair of electrons by hydrogen bonding, it is seen that the pseudopericyclic nature of the ring opening of oxetene is converted into a pericyclic one. CASSCF(5,6)/6-311+G** computation was carried out to understand the extent of involvement of lone pair of electrons during the course of the reaction. CR-CCSD(T)/6-311+G** computation was performed to assess the energies of the reactant, transition state and the product more accurately.

Accelerating calculations of RNA secondary structure partition functions using GPUs

PubMed Central

2013-01-01

Background RNA performs many diverse functions in the cell in addition to its role as a messenger of genetic information. These functions depend on its ability to fold to a unique three-dimensional structure determined by the sequence. The conformation of RNA is in part determined by its secondary structure, or the particular set of contacts between pairs of complementary bases. Prediction of the secondary structure of RNA from its sequence is therefore of great interest, but can be computationally expensive. In this work we accelerate computations of base-pair probababilities using parallel graphics processing units (GPUs). Results Calculation of the probabilities of base pairs in RNA secondary structures using nearest-neighbor standard free energy change parameters has been implemented using CUDA to run on hardware with multiprocessor GPUs. A modified set of recursions was introduced, which reduces memory usage by about 25%. GPUs are fastest in single precision, and for some hardware, restricted to single precision. This may introduce significant roundoff error. However, deviations in base-pair probabilities calculated using single precision were found to be negligible compared to those resulting from shifting the nearest-neighbor parameters by a random amount of magnitude similar to their experimental uncertainties. For large sequences running on our particular hardware, the GPU implementation reduces execution time by a factor of close to 60 compared with an optimized serial implementation, and by a factor of 116 compared with the original code. Conclusions Using GPUs can greatly accelerate computation of RNA secondary structure partition functions, allowing calculation of base-pair probabilities for large sequences in a reasonable amount of time, with a negligible compromise in accuracy due to working in single precision. The source code is integrated into the RNAstructure software package and available for download at http://rna.urmc.rochester.edu. PMID:24180434

Detection of no-model input-output pairs in closed-loop systems.

PubMed

Potts, Alain Segundo; Alvarado, Christiam Segundo Morales; Garcia, Claudio

2017-11-01

The detection of no-model input-output (IO) pairs is important because it can speed up the multivariable system identification process, since all the pairs with null transfer functions are previously discarded and it can also improve the identified model quality, thus improving the performance of model based controllers. In the available literature, the methods focus just on the open-loop case, since in this case there is not the effect of the controller forcing the main diagonal in the transfer matrix to one and all the other terms to zero. In this paper, a modification of a previous method able to detect no-model IO pairs in open-loop systems is presented, but adapted to perform this duty in closed-loop systems. Tests are performed by using the traditional methods and the proposed one to show its effectiveness. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

MRMer, an interactive open source and cross-platform system for data extraction and visualization of multiple reaction monitoring experiments.

PubMed

Martin, Daniel B; Holzman, Ted; May, Damon; Peterson, Amelia; Eastham, Ashley; Eng, Jimmy; McIntosh, Martin

2008-11-01

Multiple reaction monitoring (MRM) mass spectrometry identifies and quantifies specific peptides in a complex mixture with very high sensitivity and speed and thus has promise for the high throughput screening of clinical samples for candidate biomarkers. We have developed an interactive software platform, called MRMer, for managing highly complex MRM-MS experiments, including quantitative analyses using heavy/light isotopic peptide pairs. MRMer parses and extracts information from MS files encoded in the platform-independent mzXML data format. It extracts and infers precursor-product ion transition pairings, computes integrated ion intensities, and permits rapid visual curation for analyses exceeding 1000 precursor-product pairs. Results can be easily output for quantitative comparison of consecutive runs. Additionally MRMer incorporates features that permit the quantitative analysis experiments including heavy and light isotopic peptide pairs. MRMer is open source and provided under the Apache 2.0 license.

Factors related to the joint probability of flooding on paired streams

USGS Publications Warehouse

Koltun, G.F.; Sherwood, J.M.

1998-01-01

The factors related to the joint probabilty of flooding on paired streams were investigated and quantified to provide information to aid in the design of hydraulic structures where the joint probabilty of flooding is an element of the design criteria. Stream pairs were considered to have flooded jointly at the design-year flood threshold (corresponding to the 2-, 10-, 25-, or 50-year instantaneous peak streamflow) if peak streamflows at both streams in the pair were observed or predicted to have equaled or exceeded the threshold on a given calendar day. Daily mean streamflow data were used as a substitute for instantaneous peak streamflow data to determine which flood thresholds were equaled or exceeded on any given day. Instantaneous peak streamflow data, when available, were used preferentially to assess flood-threshold exceedance. Daily mean streamflow data for each stream were paired with concurrent daily mean streamflow data at the other streams. Observed probabilities of joint flooding, determined for the 2-, 10-, 25-, and 50-year flood thresholds, were computed as the ratios of the total number of days when streamflows at both streams concurrently equaled or exceeded their flood thresholds (events) to the total number of days where streamflows at either stream equaled or exceeded its flood threshold (trials). A combination of correlation analyses, graphical analyses, and logistic-regression analyses were used to identify and quantify factors associated with the observed probabilities of joint flooding (event-trial ratios). The analyses indicated that the distance between drainage area centroids, the ratio of the smaller to larger drainage area, the mean drainage area, and the centroid angle adjusted 30 degrees were the basin characteristics most closely associated with the joint probabilty of flooding on paired streams in Ohio. In general, the analyses indicated that the joint probabilty of flooding decreases with an increase in centroid distance and increases with increases in drainage area ratio, mean drainage area, and centroid angle adjusted 30 degrees. Logistic-regression equations were developed, which can be used to estimate the probability that streamflows at two streams jointly equal or exceed the 2-year flood threshold given that the streamflow at one of the two streams equals or exceeds the 2-year flood threshold. The logistic-regression equations are applicable to stream pairs in Ohio (and border areas of adjacent states) that are unregulated, free of significant urban influences, and have characteristics similar to those of the 304 gaged stream pairs used in the logistic-regression analyses. Contingency tables were constructed and analyzed to provide information about the bivariate distribution of floods on paired streams. The contingency tables showed that the percentage of trials in which both streams in the pair concurrently flood at identical recurrence-interval ranges generally increased as centroid distances decreased and was greatest for stream pairs with adjusted centroid angles greater than or equal to 60 degrees and drainage area ratios greater than or equal to 0.01. Also, as centroid distance increased, streamflow at one stream in the pair was more likely to be in a less than 2-year recurrence-interval range when streamflow at the second stream was in a 2-year or greater recurrence-interval range.

CALUTRON ION SOURCE

DOEpatents

Lofgren, E.J.

1959-02-17

An improvement is described in ion source mechanisms whereby the source structure is better adapted to withstanid the ravages of heat, erosion, and deterioration concomitant with operation of an ion source of the calutron type. A pair of molybdenum plates define the exit opening of the arc chamber and are in thermal contact with the walls of the chamber. These plates are maintained at a reduced temperature by a pair of copper blocks in thermal conducting contact therewith to form subsequent diverging margins for the exit opening.

The Everett-Wheeler interpretation and the open future

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sudbery, Anthony

2011-03-28

I discuss the meaning of probability in the Everett-Wheeler interpretation of quantum mechanics, together with the problem of defining histories. To resolve these, I propose an understanding of probability arising from a form of temporal logic: the probability of a future-tense proposition is identified with its truth value in a many-valued and context-dependent logic. In short, probability is degree of truth. These ideas relate to traditional naive ideas of time and chance. Indeed, I argue that Everettian quantum mechanics is the only form of scientific theory that truly incorporates the perception that the future is open.

Time‐dependent renewal‐model probabilities when date of last earthquake is unknown

USGS Publications Warehouse

Field, Edward H.; Jordan, Thomas H.

2015-01-01

We derive time-dependent, renewal-model earthquake probabilities for the case in which the date of the last event is completely unknown, and compare these with the time-independent Poisson probabilities that are customarily used as an approximation in this situation. For typical parameter values, the renewal-model probabilities exceed Poisson results by more than 10% when the forecast duration exceeds ~20% of the mean recurrence interval. We also derive probabilities for the case in which the last event is further constrained to have occurred before historical record keeping began (the historic open interval), which can only serve to increase earthquake probabilities for typically applied renewal models.We conclude that accounting for the historic open interval can improve long-term earthquake rupture forecasts for California and elsewhere.

Strangeness suppression of qq creation observed in exclusive reactions.

PubMed

Mestayer, M D; Park, K; Adhikari, K P; Aghasyan, M; Pereira, S Anefalos; Ball, J; Battaglieri, M; Batourine, V; Bedlinskiy, I; Biselli, A S; Boiarinov, S; Briscoe, W J; Brooks, W K; Burkert, V D; Carman, D S; Celentano, A; Chandavar, S; Charles, G; Colaneri, L; Cole, P L; Contalbrigo, M; Cortes, O; Crede, V; D'Angelo, A; Dashyan, N; De Vita, R; Deur, A; Djalali, C; Doughty, D; Dupre, R; El Alaoui, A; El Fassi, L; Elouadrhiri, L; Eugenio, P; Fedotov, G; Fleming, J A; Forest, T A; Garillon, B; Garçon, M; Ghandilyan, Y; Gilfoyle, G P; Giovanetti, K L; Girod, F X; Goetz, J T; Golovatch, E; Gothe, R W; Griffioen, K A; Guegan, B; Guidal, M; Hakobyan, H; Hanretty, C; Hattawy, M; Holtrop, M; Hughes, S M; Hyde, C E; Ilieva, Y; Ireland, D G; Jiang, H; Jo, H S; Joo, K; Keller, D; Khandaker, M; Kim, A; Kim, W; Koirala, S; Kubarovsky, V; Kuleshov, S V; Lenisa, P; Levine, W I; Livingston, K; Lu, H Y; MacGregor, I J D; Mayer, M; McKinnon, B; Meyer, C A; Mirazita, M; Mokeev, V; Montgomery, R A; Moody, C I; Moutarde, H; Movsisyan, A; Camacho, C Munoz; Nadel-Turonski, P; Niccolai, S; Niculescu, G; Niculescu, I; Osipenko, M; Ostrovidov, A I; Pappalardo, L L; Paremuzyan, R; Peng, P; Phelps, W; Pisano, S; Pogorelko, O; Pozdniakov, S; Price, J W; Protopopescu, D; Puckett, A J R; Raue, B A; Rimal, D; Ripani, M; Rizzo, A; Rosner, G; Roy, P; Sabatié, F; Saini, M S; Schott, D; Schumacher, R A; Simonyan, A; Sokhan, D; Strauch, S; Sytnik, V; Tang, W; Tian, Ye; Ungaro, M; Vernarsky, B; Vlassov, A V; Voskanyan, H; Voutier, E; Walford, N K; Watts, D P; Wei, X; Weinstein, L B; Wood, M H; Zachariou, N; Zhang, J; Zhao, Z W; Zonta, I

2014-10-10

We measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK(+), pπ(0), and nπ(+), with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq creation probabilities for the first time in exclusive two-body production, in which only a single qq pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

Quantum teleportation and entanglement swapping of electron spins in superconducting hybrid structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bubanja, Vladimir, E-mail: vladimir.bubanja@callaghaninnovation.govt.nz

2015-06-15

We present schemes for quantum teleportation and entanglement swapping of electronic spin states in hybrid superconductor–normal-metal systems. The proposed schemes employ subgap transport whereby the lowest order processes involve Cooper pair-electron and double Cooper-pair cotunneling in quantum teleportation and entanglement swapping protocols, respectively. The competition between elastic cotunneling and Cooper-pair splitting results in the success probability of 25% in both cases. Described implementations of these protocols are within reach of present-day experimental techniques.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gomez, John A.; Henderson, Thomas M.; Scuseria, Gustavo E.

Restricted single-reference coupled cluster theory truncated to single and double excitations accurately describes weakly correlated systems, but often breaks down in the presence of static or strong correlation. Good coupled cluster energies in the presence of degeneracies can be obtained by using a symmetry-broken reference, such as unrestricted Hartree-Fock, but at the cost of good quantum numbers. A large body of work has shown that modifying the coupled cluster ansatz allows for the treatment of strong correlation within a single-reference, symmetry-adapted framework. The recently introduced singlet-paired coupled cluster doubles (CCD0) method is one such model, which recovers correct behavior formore » strong correlation without requiring symmetry breaking in the reference. Here, we extend singlet-paired coupled cluster for application to open shells via restricted open-shell singlet-paired coupled cluster singles and doubles (ROCCSD0). The ROCCSD0 approach retains the benefits of standard coupled cluster theory and recovers correct behavior for strongly correlated, open-shell systems using a spin-preserving ROHF reference.« less

Feedback-Driven Trial-by-Trial Learning in Autism Spectrum Disorders

PubMed Central

Solomon, Marjorie; Frank, Michael J.; Ragland, J. Daniel; Smith, Anne C.; Niendam, Tara A.; Lesh, Tyler A.; Grayson, David S.; Beck, Jonathan S.; Matter, John C.; Carter, Cameron S.

2017-01-01

Objective Impairments in learning are central to autism spectrum disorders. The authors investigated the cognitive and neural basis of these deficits in young adults with autism spectrum disorders using a well-characterized probabilistic reinforcement learning paradigm. Method The probabilistic selection task was implemented among matched participants with autism spectrum disorders (N=22) and with typical development (N=25), aged 18–40 years, using rapid event-related functional MRI. Participants were trained to choose the correct stimulus in high-probability (AB), medium-probability (CD), and low-probability (EF) pairs, presented with valid feedback 80%, 70%, and 60% of the time, respectively. Whole-brain voxel-wise and parametric modulator analyses examined early and late learning during the stimulus and feedback epochs of the task. Results The groups exhibited comparable performance on medium- and low-probability pairs. Typically developing persons showed higher accuracy on the high-probability pair, better win-stay performance (selection of the previously rewarded stimulus on the next trial of that type), and more robust recruitment of the anterior and medial prefrontal cortex during the stimulus epoch, suggesting development of an intact reward-based working memory for recent stimulus values. Throughout the feedback epoch, individuals with autism spectrum disorders exhibited greater recruitment of the anterior cingulate and orbito-frontal cortices compared with individuals with typical development, indicating continuing trial-by-trial activity related to feedback processing. Conclusions Individuals with autism spectrum disorders exhibit learning deficits reflecting impaired ability to develop an effective reward-based working memory to guide stimulus selection. Instead, they continue to rely on trial-by-trial feedback processing to support learning dependent upon engagement of the anterior cingulate and orbito-frontal cortices. PMID:25158242

Facebook dethroned: Revealing the more likely social media destinations for college students' depictions of underage drinking.

PubMed

Boyle, Sarah C; Earle, Andrew M; LaBrie, Joseph W; Ballou, Kayla

2017-02-01

Studies examining representations of college drinking on social media have almost exclusively focused on Facebook. However, recent research suggests college students may be more influenced by peers' alcohol-related posts on Instagram and Snapchat, two image-based platforms popular among this demographic. One potential explanation for this differential influence is that qualitative distinctions in the types of alcohol-related content posted by students on these three platforms may exist. Informed by undergraduate focus groups, this study examined the hypothesis that, of the three platforms, students tend to use Instagram most often for photos glamourizing drinking and Snapchat for incriminating photos of alcohol misuse and negative consequences. Undergraduate research assistants aided investigators in developing hypothetical vignettes and photographic examples of posts both glamorizing and depicting negative consequences associated with college drinking. In an online survey, vignette and photo stimuli were followed by counterbalanced paired comparisons that presented each possible pair of social media platforms. Undergraduates (N=196) selected the platform from each pair on which they would be more likely to see each post. Generalized Bradley-Terry models examined the probabilities of platform selections. As predicted, Instagram was seen as the most probable destination (and Facebook least probable) for photos depicting alcohol use as attractive and glamorous. Conversely, Snapchat was selected as the most probable destination (and Facebook least probable) for items depicting negative consequences associated with heavy drinking. Results suggest researchers aiming to mitigate the potential influences associated with college students' glamorous and consequential alcohol-related photos posted social media posts should shift their focus from Facebook to Instagram and Snapchat. Copyright © 2016 Elsevier Ltd. All rights reserved.

Exact transition probabilities in a 6-state Landau–Zener system with path interference

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sinitsyn, Nikolai A.

2015-04-23

In this paper, we identify a nontrivial multistate Landau–Zener (LZ) model for which transition probabilities between any pair of diabatic states can be determined analytically and exactly. In the semiclassical picture, this model features the possibility of interference of different trajectories that connect the same initial and final states. Hence, transition probabilities are generally not described by the incoherent successive application of the LZ formula. Finally, we discuss reasons for integrability of this system and provide numerical tests of the suggested expression for the transition probability matrix.

Evidence of scaling of void probability in nucleus-nucleus interactions at few GeV energy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, Dipak; Biswas, Biswanath; Deb, Argha

1997-11-01

The rapidity gap probability in the {sup 24}Mg-AgBr interaction at 4.5GeV/c/nucleon has been studied in detail. The data reveal scaling behavior of the void probability in the central rapidity domain which confirms the validity of the linked-pair approximation for the N-particle cumulant correlation functions. This scaling behavior appears to be similar to the void probability in the Perseus-Pisces supercluster region of galaxies. {copyright} {ital 1997} {ital The American Physical Society}

THE EVOLUTION OF PRIMORDIAL BINARY OPEN STAR CLUSTERS: MERGERS, SHREDDED SECONDARIES, AND SEPARATED TWINS

DOE Office of Scientific and Technical Information (OSTI.GOV)

De la Fuente Marcos, R.; De la Fuente Marcos, C., E-mail: raul@galaxy.suffolk.e

2010-08-10

The properties of the candidate binary star cluster population in the Magellanic Clouds and Milky Way are similar. The fraction of candidate binaries is {approx}10% and the pair separation histogram exhibits a bimodal distribution commonly attributed to their transient nature. However, if primordial pairs cannot survive for long as recognizable bound systems, how are they ending up? Here, we use simulations to confirm that merging, extreme tidal distortion, and ionization are possible depending on the initial orbital elements and mass ratio of the cluster pair. Merging is observed for initially close pairs but also for wider systems in nearly parabolicmore » orbits. Its characteristic timescale depends on the initial orbital semi-major axis, eccentricity, and cluster pair mass ratio, becoming shorter for closer, more eccentric equal mass pairs. Shredding of the less massive cluster and subsequent separation is observed in all pairs with appreciably different masses. Wide pairs evolve into separated twins characterized by the presence of tidal bridges and separations of 200-500 pc after one Galactic orbit. Most observed binary candidates appear to be following this evolutionary path which translates into the dominant peak (25-30 pc) in the observed pair separation distribution. The secondary peak at smaller separations (10-15 pc) can be explained as due to close pairs in almost circular orbits and/or undergoing merging. Merged clusters exhibit both peculiar radial density and velocity dispersion profiles shaped by synchronization and gravogyro instabilities. Simulations and observations show that long-term binary open cluster stability is unlikely.« less

Understanding the kinetic mechanism of RNA single base pair formation

PubMed Central

Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

2016-01-01

RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466

The pair-production channel in atomic processes

NASA Astrophysics Data System (ADS)

Belkacem, Ali; Sørensen, Allan H.

2006-06-01

Assisted by the creation of electron-positron pairs, new channels for ionization, excitation, and charge transfer open in atomic collisions when the energy is raised to relativistic values. At extreme energies these pair-production channels usually dominate the "traditional" contributions to cross sections that involve only "positive-energy" electrons. An extensive body of theoretical and experimental work has been performed over the last two decades to investigate charge-changing processes catalyzed by pair production in relativistic heavy ion collisions. We review some of these studies.

Mining Time-Resolved Functional Brain Graphs to an EEG-Based Chronnectomic Brain Aged Index (CBAI).

PubMed

Dimitriadis, Stavros I; Salis, Christos I

2017-01-01

The brain at rest consists of spatially and temporal distributed but functionally connected regions that called intrinsic connectivity networks (ICNs). Resting state electroencephalography (rs-EEG) is a way to characterize brain networks without confounds associated with task EEG such as task difficulty and performance. A novel framework of how to study dynamic functional connectivity under the notion of functional connectivity microstates (FCμstates) and symbolic dynamics is further discussed. Furthermore, we introduced a way to construct a single integrated dynamic functional connectivity graph (IDFCG) that preserves both the strength of the connections between every pair of sensors but also the type of dominant intrinsic coupling modes (DICM). The whole methodology is demonstrated in a significant and unexplored task for EEG which is the definition of an objective Chronnectomic Brain Aged index (CBAI) extracted from resting-state data ( N = 94 subjects) with both eyes-open and eyes-closed conditions. Novel features have been defined based on symbolic dynamics and the notion of DICM and FCμstates. The transition rate of FCμstates, the symbolic dynamics based on the evolution of FCμstates (the Markovian Entropy, the complexity index), the probability distribution of DICM, the novel Flexibility Index that captures the dynamic reconfiguration of DICM per pair of EEG sensors and the relative signal power constitute a valuable pool of features that can build the proposed CBAI. Here we applied a feature selection technique and Extreme Learning Machine (ELM) classifier to discriminate young adults from middle-aged and a Support Vector Regressor to build a linear model of the actual age based on EEG-based spatio-temporal features. The most significant type of features for both prediction of age and discrimination of young vs. adults age groups was the dynamic reconfiguration of dominant coupling modes derived from a subset of EEG sensor pairs. Specifically, our results revealed a very high prediction of age for eyes-open ( R 2 = 0.60; y = 0.79x + 8.03) and lower for eyes-closed ( R 2 = 0.48; y = 0.71x + 10.91) while we succeeded to correctly classify young vs. middle-age group with 97.8% accuracy in eyes-open and 87.2% for eyes-closed. Our results were reproduced also in a second dataset for further external validation of the whole analysis. The proposed methodology proved valuable for the characterization of the intrinsic properties of dynamic functional connectivity through the age untangling developmental differences using EEG resting-state recordings.

Green fluorescence protein-based content-mixing assay of SNARE-driven membrane fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heo, Paul; Kong, Byoungjae; Jung, Young-Hun

Soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins mediate intracellular membrane fusion by forming a ternary SNARE complex. A minimalist approach utilizing proteoliposomes with reconstituted SNARE proteins yielded a wealth of information pinpointing the molecular mechanism of SNARE-mediated fusion and its regulation by accessory proteins. Two important attributes of a membrane fusion are lipid-mixing and the formation of an aqueous passage between apposing membranes. These two attributes are typically observed by using various fluorescent dyes. Currently available in vitro assay systems for observing fusion pore opening have several weaknesses such as cargo-bleeding, incomplete removal of unencapsulated dyes, and inadequate information regardingmore » the size of the fusion pore, limiting measurements of the final stage of membrane fusion. In the present study, we used a biotinylated green fluorescence protein and streptavidin conjugated with Dylight 594 (DyStrp) as a Föster resonance energy transfer (FRET) donor and acceptor, respectively. This FRET pair encapsulated in each v-vesicle containing synaptobrevin and t-vesicle containing a binary acceptor complex of syntaxin 1a and synaptosomal-associated protein 25 revealed the opening of a large fusion pore of more than 5 nm, without the unwanted signals from unencapsulated dyes or leakage. This system enabled determination of the stoichiometry of the merging vesicles because the FRET efficiency of the FRET pair depended on the molar ratio between dyes. Here, we report a robust and informative assay for SNARE-mediated fusion pore opening. - Highlights: • SNARE proteins drive membrane fusion and open a pore for cargo release. • Biotinylated GFP and DyStrp was used as the reporter pair of fusion pore opening. • Procedure for efficient SNARE reconstitution and reporter encapsulation was established. • The FRET pair reported opening of a large fusion pore bigger than 5 nm. • The assay was robust and provided information of stoichiometry of vesicle fusion.« less

Estimating juvenile Chinook salmon (Oncorhynchus tshawytscha) abundance from beach seine data collected in the Sacramento–San Joaquin Delta and San Francisco Bay, California

USGS Publications Warehouse

Perry, Russell W.; Kirsch, Joseph E.; Hendrix, A. Noble

2016-06-17

Resource managers rely on abundance or density metrics derived from beach seine surveys to make vital decisions that affect fish population dynamics and assemblage structure. However, abundance and density metrics may be biased by imperfect capture and lack of geographic closure during sampling. Currently, there is considerable uncertainty about the capture efficiency of juvenile Chinook salmon (Oncorhynchus tshawytscha) by beach seines. Heterogeneity in capture can occur through unrealistic assumptions of closure and from variation in the probability of capture caused by environmental conditions. We evaluated the assumptions of closure and the influence of environmental conditions on capture efficiency and abundance estimates of Chinook salmon from beach seining within the Sacramento–San Joaquin Delta and the San Francisco Bay. Beach seine capture efficiency was measured using a stratified random sampling design combined with open and closed replicate depletion sampling. A total of 56 samples were collected during the spring of 2014. To assess variability in capture probability and the absolute abundance of juvenile Chinook salmon, beach seine capture efficiency data were fitted to the paired depletion design using modified N-mixture models. These models allowed us to explicitly test the closure assumption and estimate environmental effects on the probability of capture. We determined that our updated method allowing for lack of closure between depletion samples drastically outperformed traditional data analysis that assumes closure among replicate samples. The best-fit model (lowest-valued Akaike Information Criterion model) included the probability of fish being available for capture (relaxed closure assumption), capture probability modeled as a function of water velocity and percent coverage of fine sediment, and abundance modeled as a function of sample area, temperature, and water velocity. Given that beach seining is a ubiquitous sampling technique for many species, our improved sampling design and analysis could provide significant improvements in density and abundance estimation.

Heterogeneous Defensive Naval Weapon Assignment To Swarming Threats In Real Time

DTIC Science & Technology

2016-03-01

threat Damage potential of target t if it hits the ship [integer from 0 to 3] _ ttarget phit Probability that target t hits the ship [probability...secondary weapon systems on target t [integer] _ tsec phit Probability that secondary weapon systems launched from target t hit the ship...pairing. These parameters are calculated as follows: 310 _ _t t tpriority target threat target phit = × × (3.1) 3_ 10 _ _t t tsec priority sec

Discrete-time moment closure models for epidemic spreading in populations of interacting individuals.

PubMed

Frasca, Mattia; Sharkey, Kieran J

2016-06-21

Understanding the dynamics of spread of infectious diseases between individuals is essential for forecasting the evolution of an epidemic outbreak or for defining intervention policies. The problem is addressed by many approaches including stochastic and deterministic models formulated at diverse scales (individuals, populations) and different levels of detail. Here we consider discrete-time SIR (susceptible-infectious-removed) dynamics propagated on contact networks. We derive a novel set of 'discrete-time moment equations' for the probability of the system states at the level of individual nodes and pairs of nodes. These equations form a set which we close by introducing appropriate approximations of the joint probabilities appearing in them. For the example case of SIR processes, we formulate two types of model, one assuming statistical independence at the level of individuals and one at the level of pairs. From the pair-based model we then derive a model at the level of the population which captures the behavior of epidemics on homogeneous random networks. With respect to their continuous-time counterparts, the models include a larger number of possible transitions from one state to another and joint probabilities with a larger number of individuals. The approach is validated through numerical simulation over different network topologies. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

PSE-HMM: genome-wide CNV detection from NGS data using an HMM with Position-Specific Emission probabilities.

PubMed

Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi

2016-11-03

Copy Number Variation (CNV) is envisaged to be a major source of large structural variations in the human genome. In recent years, many studies apply Next Generation Sequencing (NGS) data for the CNV detection. However, still there is a necessity to invent more accurate computational tools. In this study, mate pair NGS data are used for the CNV detection in a Hidden Markov Model (HMM). The proposed HMM has position specific emission probabilities, i.e. a Gaussian mixture distribution. Each component in the Gaussian mixture distribution captures a different type of aberration that is observed in the mate pairs, after being mapped to the reference genome. These aberrations may include any increase (decrease) in the insertion size or change in the direction of mate pairs that are mapped to the reference genome. This HMM with Position-Specific Emission probabilities (PSE-HMM) is utilized for the genome-wide detection of deletions and tandem duplications. The performance of PSE-HMM is evaluated on a simulated dataset and also on a real data of a Yoruban HapMap individual, NA18507. PSE-HMM is effective in taking observation dependencies into account and reaches a high accuracy in detecting genome-wide CNVs. MATLAB programs are available at http://bs.ipm.ir/softwares/PSE-HMM/ .

Carry-over effects of the social environment on future divorce probability in a wild bird population

PubMed Central

Culina, Antica; Hinde, Camilla A.; Sheldon, Ben C.

2015-01-01

Initial mate choice and re-mating strategies (infidelity and divorce) influence individual fitness. Both of these should be influenced by the social environment, which determines the number and availability of potential partners. While most studies looking at this relationship take a population-level approach, individual-level responses to variation in the social environment remain largely unstudied. Here, we explore carry-over effects on future mating decisions of the social environment in which the initial mating decision occurred. Using detailed data on the winter social networks of great tits, we tested whether the probability of subsequent divorce, a year later, could be predicted by measures of the social environment at the time of pairing. We found that males that had a lower proportion of female associates, and whose partner ranked lower among these, as well as inexperienced breeders, were more likely to divorce after breeding. We found no evidence that a female's social environment influenced the probability of divorce. Our findings highlight the importance of the social environment that individuals experience during initial pair formation on later pairing outcomes, and demonstrate that such effects can be delayed. Exploring these extended effects of the social environment can yield valuable insights into processes and selective pressures acting upon the mating strategies that individuals adopt. PMID:26468239

Significance of stress transfer in time-dependent earthquake probability calculations

USGS Publications Warehouse

Parsons, T.

2005-01-01

A sudden change in stress is seen to modify earthquake rates, but should it also revise earthquake probability? Data used to derive input parameters permits an array of forecasts; so how large a static stress change is require to cause a statistically significant earthquake probability change? To answer that question, effects of parameter and philosophical choices are examined through all phases of sample calculations, Drawing at random from distributions of recurrence-aperiodicity pairs identifies many that recreate long paleoseismic and historic earthquake catalogs. Probability density funtions built from the recurrence-aperiodicity pairs give the range of possible earthquake forecasts under a point process renewal model. Consequences of choices made in stress transfer calculations, such as different slip models, fault rake, dip, and friction are, tracked. For interactions among large faults, calculated peak stress changes may be localized, with most of the receiving fault area changed less than the mean. Thus, to avoid overstating probability change on segments, stress change values should be drawn from a distribution reflecting the spatial pattern rather than using the segment mean. Disparity resulting from interaction probability methodology is also examined. For a fault with a well-understood earthquake history, a minimum stress change to stressing rate ratio of 10:1 to 20:1 is required to significantly skew probabilities with >80-85% confidence. That ratio must be closer to 50:1 to exceed 90-95% confidence levels. Thus revision to earthquake probability is achievable when a perturbing event is very close to the fault in question or the tectonic stressing rate is low.

Corona emission thresholds for three types of hydrometeor interaction in thunderclouds

NASA Astrophysics Data System (ADS)

Blyth, A. M.; Christian, H. J.; Latham, J.

1998-06-01

Laboratory studies have been conducted of the conditions under which glancing collisions, at relative velocities V characteristic of those occurring in thunderstorms, of three types of hydrometeor pairs of precipitation dimension (such as (1) warm drop pairs, (2) supercooled drop pairs, and (3) a supercooled drop and a graupel pellet) produce a corona discharge in an electric field E. In each case, the observed corona is emitted at the tip of an ephemeral liquid filament, of length greater than the dimensions of the interacting hydrometeors, drawn out during each interaction. For each type of hydrometeor pair, the probability f that corona was produced during an interaction increased steadily from zero for increasing values of E above about 150 kV/m, and was significantly in excess of 50% for values of E = 400 kV/m, which is probably about the maximum ambient value occurring in a thunderstorm. We conclude that if the associated hydrometeors are present in strongly electrified regions of thunderstorms (unlikely for interaction type 1 but manifestly possible for types 2 and 3, corona initiation leading to the production of lightning could result from each of the three types of interaction studied.

Constrained-pairing mean-field theory. IV. Inclusion of corresponding pair constraints and connection to unrestricted Hartree-Fock theory.

PubMed

Tsuchimochi, Takashi; Henderson, Thomas M; Scuseria, Gustavo E; Savin, Andreas

2010-10-07

Our previously developed constrained-pairing mean-field theory (CPMFT) is shown to map onto an unrestricted Hartree-Fock (UHF) type method if one imposes a corresponding pair constraint to the correlation problem that forces occupation numbers to occur in pairs adding to one. In this new version, CPMFT has all the advantages of standard independent particle models (orbitals and orbital energies, to mention a few), yet unlike UHF, it can dissociate polyatomic molecules to the correct ground-state restricted open-shell Hartree-Fock atoms or fragments.

The Conjunction Fallacy: A Misunderstanding about Conjunction?

ERIC Educational Resources Information Center

Tentori, Katya; Bonini, Nicolao; Osherson, Daniel

2004-01-01

It is easy to construct pairs of sentences X, Y that lead many people to ascribe higher probability to the conjunction X-and-Y than to the conjuncts X, Y. Whether an error is thereby committed depends on reasoners' interpretation of the expressions "probability" and "and." We report two experiments designed to clarify the normative status of…

A mutli-technique search for the most primitive CO chondrites

NASA Astrophysics Data System (ADS)

Alexander, C. M. O'D.; Greenwood, R. C.; Bowden, R.; Gibson, J. M.; Howard, K. T.; Franchi, I. A.

2018-01-01

As part of a study to identify the most primitive COs and to look for weakly altered CMs amongst the COs, we have conducted a multi-technique study of 16 Antarctic meteorites that had been classified as primitive COs. For this study, we have determined: (1) the bulk H, C and N abundances and isotopes, (2) bulk O isotopic compositions, (3) bulk modal mineralogies, and (4) for some selected samples the abundances and compositions of their insoluble organic matter (IOM). Two of the 16 meteorites do appear to be CMs - BUC 10943 seems to be a fairly typical CM, while MIL 090073 has probably been heated. Of the COs, DOM 08006 appears to be the most primitive CO identified to date and is quite distinct from the other members of its pairing group. The other COs fall into two groups that are less primitive than DOM 08006 and ALH 77307, the previously most primitive CO. The first group is composed of members of the DOM 08004 pairing group, except DOM 08006. The second group is composed of meteorites belonging to the MIL 03377 and MIL 07099 pairing groups. These two pairing groups should probably be combined. There is a dichotomy in the bulk O isotopes between the primitive (all Antarctic finds) and the more metamorphosed COs (mostly falls). This dichotomy can only partly be explained by the terrestrial weathering experienced by the primitive Antarctic samples. It seems that the more equilibrated samples interacted to a greater extent with 16O-poor material, probably water, than the more primitive meteorites.

Breeding ecology of the Puaiohi (Myadestes palmeri)

USGS Publications Warehouse

Snetsinger, T.J.; Herrmann, C.M.; Holmes, D.E.; Hayward, C.D.; Fancy, S.G.

2005-01-01

We studied the breeding ecology of the critically endangered Puaiohi (Myadestes palmeri), a poorly known Hawaiian thrush endemic to the island of Kauai. From 1996 through 1998, we monitored 96 active nests over the course of three breeding seasons. Mean clutch size was 2.0, and pairs produced an average of 1.5 fledglings/successful nest. Pairs renested after failure and some raised multiple broods. The mean annual reproductive effort was 2.1 nesting attempts/territory, and pairs produced a mean 1.1 fledglings/attempt. Large differences in nesting effort and productivity occurred among years, with mean number of fledglings/territory ranging from 0.4 to 4.9. Predation by owls (probably Short-eared Owls, Asia flammeus) and introduced rats (probably black rats, Rattus rattus) accounted for most nest failures. The presence of non-breeding floaters in the population and their largely unsuccessful attempts to gain territories in the study area suggest that the population is near carrying capacity. The high reproductive potential of the Puaiohi may help explain its persistence despite the species' historical rarity.

Survival estimation and the effects of dependency among animals

USGS Publications Warehouse

Schmutz, Joel A.; Ward, David H.; Sedinger, James S.; Rexstad, Eric A.

1995-01-01

Survival models assume that fates of individuals are independent, yet the robustness of this assumption has been poorly quantified. We examine how empirically derived estimates of the variance of survival rates are affected by dependency in survival probability among individuals. We used Monte Carlo simulations to generate known amounts of dependency among pairs of individuals and analyzed these data with Kaplan-Meier and Cormack-Jolly-Seber models. Dependency significantly increased these empirical variances as compared to theoretically derived estimates of variance from the same populations. Using resighting data from 168 pairs of black brant, we used a resampling procedure and program RELEASE to estimate empirical and mean theoretical variances. We estimated that the relationship between paired individuals caused the empirical variance of the survival rate to be 155% larger than the empirical variance for unpaired individuals. Monte Carlo simulations and use of this resampling strategy can provide investigators with information on how robust their data are to this common assumption of independent survival probabilities.

Maximizing detection probability of Wetland-dependent birds during point-count surveys in northwestern Florida

USGS Publications Warehouse

Nadeau, C.P.; Conway, C.J.; Smith, B.S.; Lewis, T.E.

2008-01-01

We conducted 262 call-broadcast point-count surveys (1-6 replicate surveys on each of 62 points) using standardized North American Marsh Bird Monitoring Protocols between 31 May and 7 July 2006 on St. Vincent National Wildlife Refuge, an island off the northwest coast of Florida. We conducted double-blind multiple-observer surveys, paired morning and evening surveys, and paired morning and night surveys to examine the influence of call-broadcast and time of day on detection probability. Observer detection probability for all species pooled was 75% and was similar between passive (69%) and call-broadcast (65%) periods. Detection probability was higher on morning than evening (t = 3.0, P = 0.030) or night (t = 3.4, P = 0.042) surveys when we pooled all species. Detection probability was higher (but not significant for all species) on morning compared to evening or night surveys for all five focal species detected on surveys: Least Bittern (Ixobrychus exilis), Clapper Rail (Rallus longirostris), Purple Gallinule (Porphyrula martinica), Common Moorhen (Gallinula chloropus), and American Coot (Fulica americana). We detected more Least Bitterns (t = 2.4, P = 0.064) and Common Moorhens (t = 2.8, P = 0.026) on morning than evening surveys, and more Clapper Rails (t = 5.1, P = 0.014) on morning than night surveys.

X-ray flares from runaway pair production in active galactic nuclei

NASA Technical Reports Server (NTRS)

Kirk, J. G.; Mastichiadis, A.

1992-01-01

The hard X-ray spectrum of AGNs is nonthermal, probably arising from an electron-positron pair cascade, with some emission reflected off relatively cold matter. There has been interest in models on which protons are accelerated and create relativistic electrons on interaction with a local radiation field. It is shown here that a sufficient column density of protons can lead to runaway pair production: photons generated by the relativistic pairs are the targets for the protons to produce more pairs. This can produce X-ray fluxes with the characteristics observed in AGN. The model predicts the maximum ratio of luminosity to source size as well as their spectrum in the early phases. The same mechanism may also be able to create the knots of synchrotron-radiating pair plasma seen in sources such as 3C273.

21. INTERIOR OF UTILITY ROOM SHOWING OPEN REAR DOOR AT ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

21. INTERIOR OF UTILITY ROOM SHOWING OPEN REAR DOOR AT PHOTO CENTER, PAIRED NARROW 1-LIGHT OVER 1-LIGHT, DOUBLE-HUNG, WOOD-FRAMED WINDOWS AT PHOTO LEFT. OPEN DOOR AT PHOTO RIGHT LEADS TO BATHROOM. VIEW TO SOUTHWEST. - Bishop Creek Hydroelectric System, Plant 4, Worker Cottage, Bishop Creek, Bishop, Inyo County, CA

Measures and Relative Motions of Some Mostly F. G. W. Struve Doubles

NASA Astrophysics Data System (ADS)

Wiley, E. O.

2012-04-01

Measures of 59 pairs of double stars with long observational histories using "lucky imaging" techniques are reported. Relative motions of 59 pairs are investigated using histories of observation, scatter plots of relative motion, ordinary least-squares (OLS) and total proper motion analyses performed in "R," an open source programming language. A scatter plot of the coefficient of determinations derived from the OLS y|epoch and OLS x|epoch clearly separates common proper motion pairs from optical pairs and what are termed "long-period binary candidates." Differences in proper motion separate optical pairs from long-term binary candidates. An Appendix is provided that details how to use known rectilinear pairs as calibration pairs for the program REDUC.

Strangeness suppression of q q ¯ creation observed in exclusive reactions

DOE PAGES

Mestayer, M. D.; Park, K.; Adhikari, K. P.; ...

2014-10-10

In this study, we measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK +, pπ 0, and nπ +, with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq¯ creation probabilities for the first time in exclusive two-body production, in which only a single qq¯ pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

Strangeness Suppression of qq ¯ Creation Observed in Exclusive Reactions

NASA Astrophysics Data System (ADS)

Mestayer, M. D.; Park, K.; Adhikari, K. P.; Aghasyan, M.; Pereira, S. Anefalos; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Biselli, A. S.; Boiarinov, S.; Briscoe, W. J.; Brooks, W. K.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Colaneri, L.; Cole, P. L.; Contalbrigo, M.; Cortes, O.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; Deur, A.; Djalali, C.; Doughty, D.; Dupre, R.; Alaoui, A. El; Fassi, L. El; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Fleming, J. A.; Forest, T. A.; Garillon, B.; Garçon, M.; Ghandilyan, Y.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guegan, B.; Guidal, M.; Hakobyan, H.; Hanretty, C.; Hattawy, M.; Holtrop, M.; Hughes, S. M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Jiang, H.; Jo, H. S.; Joo, K.; Keller, D.; Khandaker, M.; Kim, A.; Kim, W.; Koirala, S.; Kubarovsky, V.; Kuleshov, S. V.; Lenisa, P.; Levine, W. I.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; Mayer, M.; McKinnon, B.; Meyer, C. A.; Mirazita, M.; Mokeev, V.; Montgomery, R. A.; Moody, C. I.; Moutarde, H.; Movsisyan, A.; Camacho, C. Munoz; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I.; Pappalardo, L. L.; Paremuzyan, R.; Peng, P.; Phelps, W.; Pisano, S.; Pogorelko, O.; Pozdniakov, S.; Price, J. W.; Protopopescu, D.; Puckett, A. J. R.; Raue, B. A.; Rimal, D.; Ripani, M.; Rizzo, A.; Rosner, G.; Roy, P.; Sabatié, F.; Saini, M. S.; Schott, D.; Schumacher, R. A.; Simonyan, A.; Sokhan, D.; Strauch, S.; Sytnik, V.; Tang, W.; Tian, Ye; Ungaro, M.; Vernarsky, B.; Vlassov, A. V.; Voskanyan, H.; Voutier, E.; Walford, N. K.; Watts, D. P.; Wei, X.; Weinstein, L. B.; Wood, M. H.; Zachariou, N.; Zhang, J.; Zhao, Z. W.; Zonta, I.; CLAS Collaboration

2014-10-01

We measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK+, pπ0, and nπ+, with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq ¯ creation probabilities for the first time in exclusive two-body production, in which only a single qq ¯ pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

Strangeness suppression of q q ¯ creation observed in exclusive reactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mestayer, M. D.; Park, K.; Adhikari, K. P.

In this study, we measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK +, pπ 0, and nπ +, with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq¯ creation probabilities for the first time in exclusive two-body production, in which only a single qq¯ pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

Letter order is not coded by open bigrams

PubMed Central

Kinoshita, Sachiko; Norris, Dennis

2013-01-01

Open bigram (OB) models (e.g., SERIOL: Whitney, 2001, 2008; Binary OB, Grainger & van Heuven, 2003; Overlap OB, Grainger et al., 2006; Local combination detector model, Dehaene et al., 2005) posit that letter order in a word is coded by a set of ordered letter pairs. We report three experiments using bigram primes in the same-different match task, investigating the effects of order reversal and the number of letters intervening between the letters in the target. Reversed bigrams (e.g., fo-OF, ob-ABOLISH) produced robust priming, in direct contradiction to the assumption that letter order is coded by the presence of ordered letter pairs. Also in contradiction to the core assumption of current open bigram models, non-contiguous bigrams spanning three letters in the target (e.g., bs-ABOLISH) showed robust priming effects, equivalent in size to contiguous bigrams (e.g., bo-ABOLISH). These results question the role of open bigrams in coding letter order. PMID:23914048

Perceiving and Acting on Complex Affordances: How Children and Adults Bicycle Across Two Lanes of Opposing Traffic

PubMed Central

Grechkin, Timofey Y.; Chihak, Benjamin J.; Cremer, James F.; Kearney, Joseph K.; Plumert, Jodie M.

2014-01-01

This investigation examined how children and adults negotiate a challenging perceptual-motor problem with significant real-world implications – bicycling across two lanes of opposing traffic. Twelve- and 14-year-olds and adults rode a bicycling simulator through an immersive virtual environment. Participants crossed intersections with continuous cross traffic coming from opposing directions. Opportunities for crossing were divided into aligned (far gap opens with or before near gap) and rolling (far gap opens after near gap) gap pairs. Children and adults preferred rolling to aligned gap pairs, though this preference was stronger for adults than for children. Crossing aligned versus rolling gap pairs produced substantial differences in direction of travel, speed of crossing, and timing of entry into the near and far lanes. For both aligned and rolling gap pairs, children demonstrated less skill than adults in coordinating self and object movement. These findings have implications for understanding perception-action-cognition links and for understanding risk factors underlying car-bicycle collisions. PMID:22924952

Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

DTIC Science & Technology

2014-12-11

Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein,†,‡ Peter J...bidentate” target recognition, with affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such...constructs, because they can be linked via standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult

AB INITIO PULSAR MAGNETOSPHERE: THREE-DIMENSIONAL PARTICLE-IN-CELL SIMULATIONS OF OBLIQUE PULSARS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Philippov, Alexander A.; Spitkovsky, Anatoly; Cerutti, Benoit, E-mail: sashaph@princeton.edu

2015-03-01

We present “first-principles” relativistic particle-in-cell simulations of the oblique pulsar magnetosphere with pair formation. The magnetosphere starts to form with particles extracted from the surface of the neutron star. These particles are accelerated by surface electric fields and emit photons capable of producing electron–positron pairs. We inject secondary pairs at the locations of primary energetic particles whose energy exceeds the threshold for pair formation. We find solutions that are close to the ideal force-free magnetosphere with the Y-point and current sheet. Solutions with obliquities ≤40° do not show pair production in the open field line region because the local currentmore » density along the magnetic field is below the Goldreich–Julian value. The bulk outflow in these solutions is charge-separated, and pair formation happens in the current sheet and return current layer only. Solutions with higher inclinations show pair production in the open field line region, with high multiplicity of the bulk flow and the size of the pair-producing region increasing with inclination. We observe the spin-down of the star to be comparable to MHD model predictions. The magnetic dissipation in the current sheet ranges between 20% for the aligned rotator and 3% for the orthogonal rotator. Our results suggest that for low obliquity neutron stars with suppressed pair formation at the light cylinder, the presence of phenomena related to pair activity in the bulk of the polar region, e.g., radio emission, may crucially depend on the physics beyond our simplified model, such as the effects of curved spacetime or multipolar surface fields.« less

A dynamical study of the multiple system 17 Cygni ABFG

NASA Astrophysics Data System (ADS)

Romanenko, L. G.

2017-03-01

Adynamical study of the relative motions of the components of the inner pairs AB (ADS 12913) and FG (ADS 12889) of the quadruple heirarchical system 17 Cygni (WDS 19464+3344) is presented, as well as analysis of themotions of the outer pair AB-FG. The study is based on CCD observations obtained on the 26-inch refractor of the Pulkovo Observatory (2003-2013), position observations from the WDS catalog, Hipparcos parallaxes, and radial velocities of the components from literature data. A family of orbits for 17 Cyg AB is obtained for the first time, and has a most probable period of 6200 yrs. The apparent motion parameters (AMP) method is used, since the entire visible arc of the orbit over 1832-2013 is only 4°. The AMP method is also used to calculate the orbit of the 17 Cyg FG pair, which has a period of 238 yrs, yielding results in good agreement with the orbits derived in other studies. The ephemerides of the obtained AMP orbits, the position data for the AF pair from the WDS catalog (11 positions during 1893-2002), and Pulkovo CCD observations for 2007-2013 are used to calculate the apparent motion parameters of AB-FG outer pair, as well as a family of close-to-parabolic orbits with periods of 3.7 million years ormore. All the orbits (for both the inner and the outer pairs) are steeply inclined to theGalactic plane. Monte Carlo simulations are used to compute the probability that the outer pair is gravitationally bound, which is 47%. The similarity of the proper motions and radial velocities of all the components provides evidence that they all belong to a single stellar stream. Data from the CNS3 catalog are used to compose a list of candidate members of this stream.

Phase Transition for the Large-Dimensional Contact Process with Random Recovery Rates on Open Clusters

NASA Astrophysics Data System (ADS)

Xue, Xiaofeng

2016-12-01

In this paper we are concerned with the contact process with random recovery rates on open clusters of bond percolation on Z^d. Let ξ be a random variable such that P(ξ ≥ 1)=1, which ensures E1/ξ <+∞, then we assign i. i. d. copies of ξ on the vertices as the random recovery rates. Assuming that each edge is open with probability p and the infection can only spread through the open edges, then we obtain that limsup _{d→ +∞}λ _d≤ λ _c=1/pE{1}/{ξ}, where λ _d is the critical value of the process on Z^d, i.e., the maximum of the infection rates with which the infection dies out with probability one when only the origin is infected at t=0. To prove the above main result, we show that the following phase transition occurs. Assuming that lceil log drceil vertices are infected at t=0, where these vertices can be located anywhere, then when the infection rate λ >λ _c, the process survives with high probability as d→ +∞ while when λ <λ _c, the process dies out at time O(log d) with high probability.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aaltonen, T.; Brucken, E.; Devoto, F.

We search for resonant production of tt pairs in 4.8 fb{sup -1} integrated luminosity of pp collision data at {radical}(s)=1.96 TeV in the lepton+jets decay channel, where one top quark decays leptonically and the other hadronically. A matrix-element reconstruction technique is used; for each event a probability density function of the tt candidate invariant mass is sampled. These probability density functions are used to construct a likelihood function, whereby the cross section for resonant tt production is estimated, given a hypothetical resonance mass and width. The data indicate no evidence of resonant production of tt pairs. A benchmark model ofmore » leptophobic Z{sup '}{yields}tt is excluded with m{sub Z}{sup '}<900 GeV/c{sup 2} at 95% confidence level.« less

Microsatellites for Carpotroche brasiliensis (Flacourtiaceae), a useful species for agroforestry and ecosystem conservation.

PubMed

Bittencourt, Flora; Alves, Jackeline S; Gaiotto, Fernanda A

2015-12-01

We developed microsatellite markers for Carpotroche brasiliensis (Flacourtiaceae), a dioecious tree that is used as a food resource by midsize animals of the Brazilian fauna. We designed 30 primer pairs using next-generation sequencing and classified 25 pairs as polymorphic. Observed heterozygosity ranged from 0.5 to 1.0, and expected heterozygosity ranged from 0.418 to 0.907. The combined probability of exclusion was greater than 0.999 and the combined probability of identity was less than 0.001, indicating that these microsatellites are appropriate for investigations of genetic structure, individual identification, and paternity testing. The developed molecular tools may contribute to future studies of population genetics, answering ecological and evolutionary questions regarding efficient conservation strategies for C. brasiliensis.

Statistics on continuous IBD data: Exact distribution evaluation for a pair of full(half)-sibs and a pair of a (great-) grandchild with a (great-) grandparent

PubMed Central

Stefanov, Valeri T

2002-01-01

Background Pairs of related individuals are widely used in linkage analysis. Most of the tests for linkage analysis are based on statistics associated with identity by descent (IBD) data. The current biotechnology provides data on very densely packed loci, and therefore, it may provide almost continuous IBD data for pairs of closely related individuals. Therefore, the distribution theory for statistics on continuous IBD data is of interest. In particular, distributional results which allow the evaluation of p-values for relevant tests are of importance. Results A technology is provided for numerical evaluation, with any given accuracy, of the cumulative probabilities of some statistics on continuous genome data for pairs of closely related individuals. In the case of a pair of full-sibs, the following statistics are considered: (i) the proportion of genome with 2 (at least 1) haplotypes shared identical-by-descent (IBD) on a chromosomal segment, (ii) the number of distinct pieces (subsegments) of a chromosomal segment, on each of which exactly 2 (at least 1) haplotypes are shared IBD. The natural counterparts of these statistics for the other relationships are also considered. Relevant Maple codes are provided for a rapid evaluation of the cumulative probabilities of such statistics. The genomic continuum model, with Haldane's model for the crossover process, is assumed. Conclusions A technology, together with relevant software codes for its automated implementation, are provided for exact evaluation of the distributions of relevant statistics associated with continuous genome data on closely related individuals. PMID:11996673

Changes of spontaneous miniature excitatory postsynaptic currents in rat hippocampal pyramidal cells induced by aniracetam.

PubMed

Ghamari-Langroudi, M; Glavinovíc, M I

1998-01-01

Spontaneous miniature excitatory postsynaptic currents (mEPSCs) in rat hippocampal pyramidal neurones in slices (CA1 region) were recorded at 35-37 degrees C using the whole-cell patch-clamp technique before and after addition of aniracetam (1 mM) to determine how a partial blockade of desensitization alters the relationship between the amplitude (A) and kinetics of mEPSCs, and to evaluate the factors that determine their variability. The rise time (taur) and the time constant of decay of mEPSCs (taud) are essentially amplitude independent in control conditions, but become clearly amplitude dependent in the presence of aniracetam. The slopes of the best fitting lines to taud:A and taur:A data pairs were (+/- SD; ms/pA; n = 5): (1) (control) 0.07 +/- 0.02 and 0.008 +/- 0.003; (2) (aniracetam) 0.40 +/- 0.19 and 0.22 +/- 0.22. The amplitude-dependent prolongation of taud is explained by the concentration dependence of two related processes, the buffering of glutamate molecules by AMPA receptor channels, and the occupancy of the double-bound activatable states. A slower deactivation makes an amplitude-independent contribution. Desensitization reduces the amplitude dependence of taud by minimizing repeated openings of alpha-amino-3-hydroxy-methyl-isoxazole (AMPA) receptor channels. A greater amplitude dependence of taur probably involves both pre- and postsynaptic factors. The variability of A and taud values did not change significantly, but the factors underlying the variability of taud values were much affected. The greater amplitude dependence and the greater scatter about the best fitting lines to taud:A data pairs are approximately balanced by the greater mean values. The greater scatter of taud about the best fitting lines probably occurs because the saturation of AMPA receptors is not the same at different synapses with different numbers of AMPA receptors.

Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

PubMed

Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

2014-08-15

We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.

Analytic energy gradients in combined second order Møller-Plesset perturbation theory and conductorlike polarizable continuum model calculation.

PubMed

Si, Dejun; Li, Hui

2011-10-14

The analytic energy gradients in combined second order Møller-Plesset perturbation theory and conductorlike polarizable continuum model calculations are derived and implemented for spin-restricted closed shell (RMP2), Z-averaged spin-restricted open shell (ZAPT2), and spin-unrestricted open shell (UMP2) cases. Using these methods, the geometries of the S(0) ground state and the T(1) state of three nucleobase pairs (guanine-cytosine, adenine-thymine, and adenine-uracil) in the gas phase and aqueous solution phase are optimized. It is found that in both the gas phase and the aqueous solution phase the hydrogen bonds in the T(1) state pairs are weakened by ~1 kcal/mol as compared to those in the S(0) state pairs. © 2011 American Institute of Physics

Magnetically-enhanced open string pair production

NASA Astrophysics Data System (ADS)

Lu, J. X.

2017-12-01

We consider the stringy interaction between two parallel stacks of D3 branes placed at a separation. Each stack of D3 branes in a similar fashion carry an electric flux and a magnetic flux with the two sharing no common field strength index. The interaction amplitude has an imaginary part, giving rise to the Schwinger-like pair production of open strings. We find a significantly enhanced rate of this production when the two electric fluxes are almost identical and the brane separation is on the order of string scale. This enhancement will be largest if the two magnetic fluxes are opposite in direction. This novel enhancement results from the interplay of the non-perturbative Schwinger-type pair production due to the electric flux and the stringy tachyon due to the magnetic flux, and may have realistic physical applications.

23. SECOND FLOOR EAST SIDE APARTMENT LIVING ROOM INTERIOR. PAIRED ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

23. SECOND FLOOR EAST SIDE APARTMENT LIVING ROOM INTERIOR. PAIRED 4-LIGHT OVER 1-LIGHT DOUBLE-HUNG, WOOD-FRAME WINDOWS FLANK ENTRY DOOR. DOORWAY AT PHOTO RIGHT OPENS TO KITCHEN. VIEW TO SOUTHEAST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

The Use of Sun Elevation Angle for Stereogrammetric Boreal Forest Height in Open Canopies

NASA Technical Reports Server (NTRS)

Montesano, Paul M.; Neigh, Christopher; Sun, Guoqing; Duncanson, Laura Innice; Van Den Hoek, Jamon; Ranson, Kenneth Jon

2017-01-01

Stereogrammetry applied to globally available high resolution spaceborne imagery (HRSI; less than 5 m spatial resolution) yields fine-scaled digital surface models (DSMs) of elevation. These DSMs may represent elevations that range from the ground to the vegetation canopy surface, are produced from stereoscopic image pairs (stereo pairs) that have a variety of acquisition characteristics, and have been coupled with lidar data of forest structure and ground surface elevation to examine forest height. This work explores surface elevations from HRSI DSMs derived from two types of acquisitions in open canopy forests. We (1) apply an automated mass-production stereogrammetry workflow to along-track HRSI stereo pairs, (2) identify multiple spatially coincident DSMs whose stereo pairs were acquired under different solar geometry, (3) vertically co-register these DSMs using coincident spaceborne lidar footprints (from ICESat-GLAS) as reference, and(4) examine differences in surface elevations between the reference lidar and the co-registered HRSI DSMs associated with two general types of acquisitions (DSM types) from different sun elevation angles. We find that these DSM types, distinguished by sun elevation angle at the time of stereo pair acquisition, are associated with different surface elevations estimated from automated stereogrammetry in open canopy forests. For DSM values with corresponding reference ground surface elevation from spaceborne lidar footprints in open canopy northern Siberian Larix forests with slopes less than10, our results show that HRSI DSM acquired with sun elevation angles greater than 35deg and less than 25deg (during snow-free conditions) produced characteristic and consistently distinct distributions of elevation differences from reference lidar. The former include DSMs of near-ground surfaces with root mean square errors less than 0.68 m relative to lidar. The latter, particularly those with angles less than 10deg, show distributions with larger differences from lidar that are associated with open canopy forests whose vegetation surface elevations are captured. Terrain aspect did not have a strong effect on the distribution of vegetation surfaces. Using the two DSM types together, the distribution of DSM-differenced heights in forests (6.0 m, sigma = 1.4 m) was consistent with the distribution of plot-level mean tree heights (6.5m, sigma = 1.2 m). We conclude that the variation in sun elevation angle at time of stereo pair acquisition can create illumination conditions conducive for capturing elevations of surfaces either near the ground or associated with vegetation canopy. Knowledge of HRSI acquisition solar geometry and snow cover can be used to understand and combine stereogrammetric surface elevation estimates to co-register rand difference overlapping DSMs, providing a means to map forest height at fine scales, resolving the vertical structure of groups of trees from spaceborne platforms in open canopy forests.

Analysis and inundation mapping of the April-May 2011 flood at selected locations in northern and eastern Arkansas and southern Missouri

USGS Publications Warehouse

Westerman, Drew A.; Merriman, Katherine R.; De Lanois, Jeanne L.; Berenbrock, Charles

2013-01-01

Precipitation that fell from April 19 through May 3, 2011, resulted in widespread flooding across northern and eastern Arkansas and southern Missouri. The first storm produced a total of approximately 16 inches of precipitation over an 8-day period, and the following storms produced as much as 12 inches of precipitation over a 2-day period. Moderate to major flooding occurred quickly along many streams within Arkansas and Missouri (including the Black, Cache, Illinois, St. Francis, and White Rivers) at levels that had not been seen since the historic 1927 floods. The 2011 flood claimed an estimated 21 lives in Arkansas and Missouri, and damage caused by the flooding resulted in a Federal Disaster Declaration for 59 Arkansas counties that received Federal or State assistance. To further the goal of documenting and understanding floods, the U.S. Geological Survey, in cooperation with the Federal Emergency Management Agency, the U.S. Army Corps of Engineers–Little Rock and Memphis Districts, and Arkansas Natural Resources Commission, conducted a study to summarize meteorological and hydrological conditions before the flood; computed flood-peak magnitudes for 39 streamgages; estimated annual exceedance probabilities for 37 of those streamgages; determined the joint probabilities for 11 streamgages paired to the Mississippi River at Helena, Arkansas, which refers to the probability that locations on two paired streams simultaneously experience floods of a magnitude greater than or equal to a given annual exceedance probability; collected high-water marks; constructed flood-peak inundation maps showing maximum flood extent and water depths; and summarized flood damages and effects. For the period of record used in this report, peak-of-record stage occurred at 24 of the 39 streamgages, and peak-of-record streamflow occurred at 13 of the 30 streamgages where streamflow was determined. Annual exceedance probabilities were estimated to be less than 0.5 percent at three streamgages. The joint probability values for streamgages paired with the Mississippi River at Helena, Ark., streamgage indicate a low probability of concurrent flooding with the paired streamgages. The inundation maps show the flood-peak extent and water depth of flooding for two stream reaches on the White River and two on the Black River; the vicinities of the communities of Holly Grove and Cotton Plant, Ark.; a reach of the White River that includes the crossing of Interstate 40 north of De Valls Bluff, Ark.; and the Tailwaters of Beaver Dam near Eureka Springs, Ark., Table Rock Dam near Branson, Mo., and Bull Shoals Dam near Flippin, Ark. The data and inundation maps can be used for flood response, recovery, and planning efforts by Federal, State, and local agencies.

Cavity-backed, micro-strip dipole antenna array

NASA Technical Reports Server (NTRS)

Ellis, H., Jr. (Inventor)

1981-01-01

A flush-mounted antenna assembly includes a generally rectangular, conductive, box structure open along one face to form a cavity. Within the cavity a pair of mutually orthogonal dielectric plane surfaces in an "egg crate" arrangement are mounted normal to the plane of the open face, each diagonally within the cavity. Each dielectric plane supports a pair of printed circuit dipoles typically each fed from the opposite side of the dielectric plane by a printed "cone-shaped" feed line trace which also serve as an impedance matching device and functions as a balun connected from an unbalanced strip line external feed. The open face of the conductive cavity can be flush mounted with a randome thereover, the assembly thereby being flush with the skin of a aircraft or space vehicle.

Cavity-backed, micro-strip dipole antenna array

NASA Astrophysics Data System (ADS)

Ellis, H., Jr.

1981-09-01

A flush-mounted antenna assembly includes a generally rectangular, conductive, box structure open along one face to form a cavity. Within the cavity a pair of mutually orthogonal dielectric plane surfaces in an "egg crate" arrangement are mounted normal to the plane of the open face, each diagonally within the cavity. Each dielectric plane supports a pair of printed circuit dipoles typically each fed from the opposite side of the dielectric plane by a printed "cone-shaped" feed line trace which also serve as an impedance matching device and functions as a balun connected from an unbalanced strip line external feed. The open face of the conductive cavity can be flush mounted with a randome thereover, the assembly thereby being flush with the skin of a aircraft or space vehicle.

Mechanisms of anabolic androgenic steroid inhibition of mammalian ɛ-subunit-containing GABAA receptors

PubMed Central

Jones, Brian L; Whiting, Paul J; Henderson, Leslie P

2006-01-01

GABAergic transmission regulates the activity of gonadotrophin-releasing hormone (GnRH) neurons in the preoptic area/hypothalamus that control the onset of puberty and the expression of reproductive behaviours. One of the hallmarks of illicit use of anabolic androgenic steroids (AAS) is disruption of behaviours under neuroendocrine control. GnRH neurons are among a limited population of cells that express high levels of the ɛ-subunit of the GABAA receptor. To better understand the actions of AAS on neuroendocrine mechanisms, we have characterized modulation of GABAA receptor-mediated currents in mouse native GnRH neurons and in heterologous cells expressing recombinant α2β3ɛ-receptors. GnRH neurons exhibited robust currents in response to millimolar concentrations of GABA and a picrotoxin (PTX)-sensitive, bicuculline-insensitive current that probably arises from spontaneous openings of GABAA receptors. The AAS 17α-methyltestosterone (17α-MeT) inhibited spontaneous and GABA-evoked currents in GnRH neurons. For recombinant α2β3ɛ-receptors, 17α-MeT inhibited phasic and tonic GABA-elicited responses, accelerated desensitization and slowed paired pulse response recovery. Single channel analysis indicated that GABA-evoked events could be described by three open dwell components and that 17α-MeT enhanced residence in the intermediate dwell state. This AAS also inhibited a PTX-sensitive, spontaneous current (open probability, ∼0.15–0.2) in a concentration-dependent fashion (IC50 ≈ 9 μm). Kinetic modelling indicated that the inhibition induced by 17α-MeT occurs by an allosteric block in which the AAS interacts preferentially with a closed state and promotes accumulation in that state. Finally, studies with a G302S mutant ɛ-subunit suggest that this residue within the transmembrane domain TM2 plays a role in mediating AAS binding and modulation. In sum, our results indicate that inclusion of the ɛ-subunit significantly alters the profile of AAS modulation and that this allosteric inhibition of native GnRH neurons should be considered with regard to AAS disruption of neuroendocrine control. PMID:16543268

Estimating disperser abundance using open population models that incorporate data from continuous detection PIT arrays

USGS Publications Warehouse

Dzul, Maria C.; Yackulic, Charles B.; Korman, Josh

2017-01-01

Autonomous passive integrated transponder (PIT) tag antenna systems continuously detect individually marked organisms at one or more fixed points over long time periods. Estimating abundance using data from autonomous antennae can be challenging, because these systems do not detect unmarked individuals. Here we pair PIT antennae data from a tributary with mark-recapture sampling data in a mainstem river to estimate the number of fish moving from the mainstem to the tributary. We then use our model to estimate abundance of non-native rainbow trout Oncorhynchus mykiss that move from the Colorado River to the Little Colorado River (LCR), the latter of which is important spawning and rearing habitat for federally-endangered humpback chub Gila cypha. We estimate 226 rainbow trout (95% CI: 127-370) entered the LCR from October 2013-April 2014. We discuss the challenges of incorporating detections from autonomous PIT antenna systems into mark-recapture population models, particularly in regards to using information about spatial location to estimate movement and detection probabilities.

Intermicrotubular actin filaments in the transalar cytoskeletal arrays of Drosophila.

PubMed

Mogensen, M M; Tucker, J B

1988-11-01

Rabbit muscle myosin subfragment S1 decorates 6 nm diameter filaments in Drosophila wing epidermal cells in the arrowhead fashion characteristic of the binding of subfragment S1 to actin filaments. The filaments in question are concentrated between microtubules that are mostly composed of 15 protofilaments and form cell surface-associated transcellular bundles. There are indications that the majority of the actin filaments have the same polarity and that, like the microtubules, they may elongate from sites at the apical surfaces of the cells. The bundles of F actin and microtubules occur in dorsal and ventral epidermal cell layers of a wing blade. They are joined in dorso-ventral pairs by attachment desmosomes. These transalar cytoskeletal arrays may provide an example of a situation where actin filaments operate as stiffeners rather than active generators of force in conjunction with myosin. The arrays probably function as noncontractile pillars to maintain basal cell extensions and keep haemocoelic spaces open in the highly folded and expanding wing blades of late pupae.

Systematic integration of biomedical knowledge prioritizes drugs for repurposing

PubMed Central

Himmelstein, Daniel Scott; Lizee, Antoine; Hessler, Christine; Brueggeman, Leo; Chen, Sabrina L; Hadley, Dexter; Green, Ari; Khankhanian, Pouya

2017-01-01

The ability to computationally predict whether a compound treats a disease would improve the economy and success rate of drug approval. This study describes Project Rephetio to systematically model drug efficacy based on 755 existing treatments. First, we constructed Hetionet (neo4j.het.io), an integrative network encoding knowledge from millions of biomedical studies. Hetionet v1.0 consists of 47,031 nodes of 11 types and 2,250,197 relationships of 24 types. Data were integrated from 29 public resources to connect compounds, diseases, genes, anatomies, pathways, biological processes, molecular functions, cellular components, pharmacologic classes, side effects, and symptoms. Next, we identified network patterns that distinguish treatments from non-treatments. Then, we predicted the probability of treatment for 209,168 compound–disease pairs (het.io/repurpose). Our predictions validated on two external sets of treatment and provided pharmacological insights on epilepsy, suggesting they will help prioritize drug repurposing candidates. This study was entirely open and received realtime feedback from 40 community members. PMID:28936969

Ultrastructure of the genital organs in interstitial polychaetes. III. Penes and ejaculatory ducts in Hesionides arenaria (Hesionidae)

NASA Astrophysics Data System (ADS)

Westheide, W.

1982-12-01

The ejaculatory ducts of the two paired copulatory organs in the interstitial polychaete Hesionides arenaria are ciliated tubes, which open into simple, partly groove-like, non-stiffened penis papillae. The larger part of the ducts within the dorsal body wall is surrounded by circular muscle cells. Voluminous gland cell bodies lie between the pharynx-gut system and the body wall in the anterior part of the body; they extend anteriorly like long, thin necks, of which severl are always united in prominent strands. Their distal ends are expanded and penetrate the ducts. Six different types of glands can be distinguished according to the ultrastructure of their secretory granules. They produce the sheath of the double spermatophore or probably contain lytic enzymes that provide for the penetration of sperm into the body of the female. Differences in ultrastructure of the male organs in the interstitial genera Hesionides and Microphthalmus do not support the recent erection of the subfamily “Microphthalminae”.

Penetration Barrier of Water through Graphynes' Pores: First-Principles Predictions and Force Field Optimization.

PubMed

Bartolomei, Massimiliano; Carmona-Novillo, Estela; Hernández, Marta I; Campos-Martínez, José; Pirani, Fernando; Giorgi, Giacomo; Yamashita, Koichi

2014-02-20

Graphynes are novel two-dimensional carbon-based materials that have been proposed as molecular filters, especially for water purification technologies. We carry out first-principles electronic structure calculations at the MP2C level of theory to assess the interaction between water and graphyne, graphdiyne, and graphtriyne pores. The computed penetration barriers suggest that water transport is unfeasible through graphyne while being unimpeded for graphtriyne. For graphdiyne, with a pore size almost matching that of water, a low barrier is found that in turn disappears if an active hydrogen bond with an additional water molecule on the opposite side of the opening is considered. Thus, in contrast with previous determinations, our results do not exclude graphdiyne as a promising membrane for water filtration. In fact, present calculations lead to water permeation probabilities that are 2 orders of magnitude larger than estimations based on common force fields. A new pair potential for the water-carbon noncovalent component of the interaction is proposed for molecular dynamics simulations involving graphdiyne and water.

Simple scheme for encoding and decoding a qubit in unknown state for various topological codes

PubMed Central

Łodyga, Justyna; Mazurek, Paweł; Grudka, Andrzej; Horodecki, Michał

2015-01-01

We present a scheme for encoding and decoding an unknown state for CSS codes, based on syndrome measurements. We illustrate our method by means of Kitaev toric code, defected-lattice code, topological subsystem code and 3D Haah code. The protocol is local whenever in a given code the crossings between the logical operators consist of next neighbour pairs, which holds for the above codes. For subsystem code we also present scheme in a noisy case, where we allow for bit and phase-flip errors on qubits as well as state preparation and syndrome measurement errors. Similar scheme can be built for two other codes. We show that the fidelity of the protected qubit in the noisy scenario in a large code size limit is of , where p is a probability of error on a single qubit per time step. Regarding Haah code we provide noiseless scheme, leaving the noisy case as an open problem. PMID:25754905

Emergence and stability of intermediate open vesicles in disk-to-vesicle transitions.

PubMed

Li, Jianfeng; Zhang, Hongdong; Qiu, Feng; Shi, An-Chang

2013-07-01

The transition between two basic structures, a disk and an enclosed vesicle, of a finite membrane is studied by examining the minimum energy path (MEP) connecting these two states. The MEP is constructed using the string method applied to continuum elastic membrane models. The results reveal that, besides the commonly observed disk and vesicle, open vesicles (bowl-shaped vesicles or vesicles with a pore) can become stable or metastable shapes. The emergence, stability, and probability distribution of these open vesicles are analyzed. It is demonstrated that open vesicles can be stabilized by higher-order elastic energies. The estimated probability distribution of the different structures is in good agreement with available experiments.

Calculation of transmission probability by solving an eigenvalue problem

NASA Astrophysics Data System (ADS)

Bubin, Sergiy; Varga, Kálmán

2010-11-01

The electron transmission probability in nanodevices is calculated by solving an eigenvalue problem. The eigenvalues are the transmission probabilities and the number of nonzero eigenvalues is equal to the number of open quantum transmission eigenchannels. The number of open eigenchannels is typically a few dozen at most, thus the computational cost amounts to the calculation of a few outer eigenvalues of a complex Hermitian matrix (the transmission matrix). The method is implemented on a real space grid basis providing an alternative to localized atomic orbital based quantum transport calculations. Numerical examples are presented to illustrate the efficiency of the method.

The rise and fall of a challenger: the Bullet Cluster in Λ cold dark matter simulations

NASA Astrophysics Data System (ADS)

Thompson, Robert; Davé, Romeel; Nagamine, Kentaro

2015-09-01

The Bullet Cluster has provided some of the best evidence for the Λ cold dark matter (ΛCDM) model via direct empirical proof of the existence of collisionless dark matter, while posing a serious challenge owing to the unusually high inferred pairwise velocities of its progenitor clusters. Here, we investigate the probability of finding such a high-velocity pair in large-volume N-body simulations, particularly focusing on differences between halo-finding algorithms. We find that algorithms that do not account for the kinematics of infalling groups yield vastly different statistics and probabilities. When employing the ROCKSTAR halo finder that considers particle velocities, we find numerous Bullet-like pair candidates that closely match not only the high pairwise velocity, but also the mass, mass ratio, separation distance, and collision angle of the initial conditions that have been shown to produce the Bullet Cluster in non-cosmological hydrodynamic simulations. The probability of finding a high pairwise velocity pair among haloes with Mhalo ≥ 1014 M⊙ is 4.6 × 10-4 using ROCKSTAR, while it is ≈34 × lower using a friends-of-friends (FoF)-based approach as in previous studies. This is because the typical spatial extent of Bullet progenitors is such that FoF tends to group them into a single halo despite clearly distinct kinematics. Further requiring an appropriately high average mass among the two progenitors, we find the comoving number density of potential Bullet-like candidates to be of the order of ≈10-10 Mpc-3. Our findings suggest that ΛCDM straightforwardly produces massive, high relative velocity halo pairs analogous to Bullet Cluster progenitors, and hence the Bullet Cluster does not present a challenge to the ΛCDM model.

Application of Archimedean copulas to the impact assessment of hydro-climatic variables in semi-arid aquifers of western India

NASA Astrophysics Data System (ADS)

Wable, Pawan S.; Jha, Madan K.

2018-02-01

The effects of rainfall and the El Niño Southern Oscillation (ENSO) on groundwater in a semi-arid basin of India were analyzed using Archimedean copulas considering 17 years of data for monsoon rainfall, post-monsoon groundwater level (PMGL) and ENSO Index. The evaluated dependence among these hydro-climatic variables revealed that PMGL-Rainfall and PMGL-ENSO Index pairs have significant dependence. Hence, these pairs were used for modeling dependence by employing four types of Archimedean copulas: Ali-Mikhail-Haq, Clayton, Gumbel-Hougaard, and Frank. For the copula modeling, the results of probability distributions fitting to these hydro-climatic variables indicated that the PMGL and rainfall time series are best represented by Weibull and lognormal distributions, respectively, while the non-parametric kernel-based normal distribution is the most suitable for the ENSO Index. Further, the PMGL-Rainfall pair is best modeled by the Clayton copula, and the PMGL-ENSO Index pair is best modeled by the Frank copula. The Clayton copula-based conditional probability of PMGL being less than or equal to its average value at a given mean rainfall is above 70% for 33% of the study area. In contrast, the spatial variation of the Frank copula-based probability of PMGL being less than or equal to its average value is 35-40% in 23% of the study area during El Niño phase, while it is below 15% in 35% of the area during the La Niña phase. This copula-based methodology can be applied under data-scarce conditions for exploring the impacts of rainfall and ENSO on groundwater at basin scales.

Robust prediction of consensus secondary structures using averaged base pairing probability matrices.

PubMed

Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi

2007-02-15

Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.

Colour assortative pairing in a colour polymorphic lizard is independent of population morph diversity

NASA Astrophysics Data System (ADS)

Pérez i de Lanuza, Guillem; Font, Enrique; Carretero, Miguel Ángel

2016-10-01

Previous work with a colour polymorphic population of Podarcis muralis (Lacertidae) revealed that lizards pair by ventral colour, favouring the same colour (i.e. homomorphic) pairs. Such assortative pairing, which probably results in colour assortative mating, can have consequences for the genetic structure of the population and potentially promote speciation. The population previously studied, located in the Pyrenees, encompasses white, yellow and orange animals, as well as intermediate white-orange and yellow-orange morphs. However, other Pyrenean populations of P. muralis have less ventral colour morphs. Our aim in this study is to test the generality of the assortative colour pairing system, extending our previous analyses to populations with different morph compositions and frequencies. The results show that the assortative pattern of pairing is similar in all the populations analysed and, hence, independent of morph composition and not restricted to pentamorphic populations. This suggests that assortative pairing by colour is a general phenomenon for colour polymorphic populations of P. muralis.

High-Speed Quantum Key Distribution Using Photonic Integrated Circuits

DTIC Science & Technology

2013-01-01

protocol [14] that uses energy-time entanglement of pairs of photons. We are employing the QPIC architecture to implement a novel high-dimensional disper...continuous Hilbert spaces using measures of the covariance matrix. Although we focus the discussion on a scheme employing entangled photon pairs...is the probability that parameter estimation fails [20]. The parameter ε̄ accounts for the accuracy of estimating the smooth min- entropy , which

Stimulated emission of Cooper pairs in a high-temperature cuprate superconductor

DOE PAGES

Zhang, Wentao; Miller, Tristan; Smallwood, Christopher L.; ...

2016-07-01

The concept of stimulated emission of bosons has played an important role in modern science and technology, and constitutes the working principle for lasers. In a stimulated emission process, an incoming photon enhances the probability that an excited atomic state will transition to a lower energy state and generate a second photon of the same energy. It is expected, but not experimentally shown, that stimulated emission contributes significantly to the zero resistance current in a superconductor by enhancing the probability that scattered Cooper pairs will return to the macroscopically occupied condensate instead of entering any other state. Here, we usemore » time- and angle-resolved photoemission spectroscopy to study the initial rise of the non-equilibrium quasiparticle population in a Bi 2 Sr 2 CaCu 2 O 8+δ cuprate superconductor induced by an ultrashort laser pulse. Our finding reveals significantly slower buildup of quasiparticles in the superconducting state than in the normal state. The slower buildup only occurs when the pump pulse is too weak to deplete the superconducting condensate, and for cuts inside the Fermi arc region. We propose this is a manifestation of stimulated recombination of broken Cooper pairs, and signals an important momentum space dichotomy in the formation of Cooper pairs inside and outside the Fermi arc region.« less

Resonance of an unshared electron pair between two atoms connected by a single bond

PubMed Central

Pauling, Linus

1983-01-01

The reported structure of the dimer of a compound of bicovalent tin indicates that the tin-tin bond is of a new type. It can be described as involving resonance between two structures in which there is transfer of an electron pair from one tin atom to the other. The tin atoms are connected by a single covalent bond (each also forms two covalent bonds with carbon atoms), and an unshared electron pair resonates between the fourth sp3 orbitals of the two atoms. Similar structures probably occur in digermene and distannene. PMID:16593329

Sauter-Schwinger pair creation dynamically assisted by a plane wave

NASA Astrophysics Data System (ADS)

Torgrimsson, Greger; Schneider, Christian; Schützhold, Ralf

2018-05-01

We study electron-positron pair creation by a strong and constant electric field superimposed with a weaker transversal plane wave which is incident perpendicularly (or under some angle). Comparing the fully nonperturbative approach based on the world-line instanton method with a perturbative expansion into powers of the strength of the weaker plane wave, we find good agreement—provided that the latter is carried out to sufficiently high orders. As usual for the dynamically assisted Sauter-Schwinger effect, the additional plane wave induces an exponential enhancement of the pair-creation probability if the combined Keldysh parameter exceeds a certain threshold.

Star formation rates in isolated galaxies selected from the Two-Micron All-Sky Survey

NASA Astrophysics Data System (ADS)

Melnyk, O.; Karachentseva, V.; Karachentsev, I.

2015-08-01

We have considered the star formation properties of 1616 isolated galaxies from the 2MASS XSC (Extended Source Catalog) selected sample (2MIG) with the far-ultraviolet GALEX magnitudes. This sample was then compared with corresponding properties of isolated galaxies from the Local Orphan Galaxies (LOG) catalogue and paired galaxies. We found that different selection algorithms define different populations of isolated galaxies. The population of the LOG catalogue, selected from non-clustered galaxies in the Local Supercluster volume, mostly consists of low-mass spiral and late-type galaxies. The specific star formation rate (SSFR) upper limit in isolated and paired galaxies does not exceed the value of ˜dex(-9.4). This is probably common for galaxies of differing activity and environment (at least at z < 0.06). The fractions of quenched galaxies are nearly twice as high in the paired galaxy sample as in the 2MIG isolated galaxy sample. From the behaviour of (S)SFR versus M* relations we deduced that the characteristic value influencing evolutionary processes is the galaxy mass. However, the environmental influence is notable: paired massive galaxies with logM* > 11.5 have higher (S)SFR than isolated galaxies. Our results suggest that the environment helps to trigger the star formation in the highest mass galaxies. We found that the fraction of AGN in the paired sample is only a little higher than in our isolated galaxy sample. We assume that AGN phenomenon is probably defined by secular galaxy evolution.

A selection of giant radio sources from NVSS

DOE PAGES

Proctor, D. D.

2016-06-01

Results of the application of pattern-recognition techniques to the problem of identifying giant radio sources (GRSs) from the data in the NVSS catalog are presented, and issues affecting the process are explored. Decision-tree pattern-recognition software was applied to training-set source pairs developed from known NVSS large-angular-size radio galaxies. The full training set consisted of 51,195 source pairs, 48 of which were known GRSs for which each lobe was primarily represented by a single catalog component. The source pairs had a maximum separation ofmore » $$20^{\\prime} $$ and a minimum component area of 1.87 square arcmin at the 1.4 mJy level. The importance of comparing the resulting probability distributions of the training and application sets for cases of unknown class ratio is demonstrated. The probability of correctly ranking a randomly selected (GRS, non-GRS) pair from the best of the tested classifiers was determined to be 97.8 ± 1.5%. The best classifiers were applied to the over 870,000 candidate pairs from the entire catalog. Images of higher-ranked sources were visually screened, and a table of over 1600 candidates, including morphological annotation, is presented. These systems include doubles and triples, wide-angle tail and narrow-angle tail, S- or Z-shaped systems, and core-jets and resolved cores. In conclusion, while some resolved-lobe systems are recovered with this technique, generally it is expected that such systems would require a different approach.« less

Statistical deprojection of galaxy pairs

NASA Astrophysics Data System (ADS)

Nottale, Laurent; Chamaraux, Pierre

2018-06-01

Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

Inferring relationships between pairs of individuals from locus heterozygosities

PubMed Central

Presciuttini, Silvano; Toni, Chiara; Tempestini, Elena; Verdiani, Simonetta; Casarino, Lucia; Spinetti, Isabella; Stefano, Francesco De; Domenici, Ranieri; Bailey-Wilson, Joan E

2002-01-01

Background The traditional exact method for inferring relationships between individuals from genetic data is not easily applicable in all situations that may be encountered in several fields of applied genetics. This study describes an approach that gives affordable results and is easily applicable; it is based on the probabilities that two individuals share 0, 1 or both alleles at a locus identical by state. Results We show that these probabilities (zi) depend on locus heterozygosity (H), and are scarcely affected by variation of the distribution of allele frequencies. This allows us to obtain empirical curves relating zi's to H for a series of common relationships, so that the likelihood ratio of a pair of relationships between any two individuals, given their genotypes at a locus, is a function of a single parameter, H. Application to large samples of mother-child and full-sib pairs shows that the statistical power of this method to infer the correct relationship is not much lower than the exact method. Analysis of a large database of STR data proves that locus heterozygosity does not vary significantly among Caucasian populations, apart from special cases, so that the likelihood ratio of the more common relationships between pairs of individuals may be obtained by looking at tabulated zi values. Conclusions A simple method is provided, which may be used by any scientist with the help of a calculator or a spreadsheet to compute the likelihood ratios of common alternative relationships between pairs of individuals. PMID:12441003

Covariance Based Pre-Filters and Screening Criteria for Conjunction Analysis

NASA Astrophysics Data System (ADS)

George, E., Chan, K.

2012-09-01

Several relationships are developed relating object size, initial covariance and range at closest approach to probability of collision. These relationships address the following questions: - Given the objects' initial covariance and combined hard body size, what is the maximum possible value of the probability of collision (Pc)? - Given the objects' initial covariance, what is the maximum combined hard body radius for which the probability of collision does not exceed the tolerance limit? - Given the objects' initial covariance and the combined hard body radius, what is the minimum miss distance for which the probability of collision does not exceed the tolerance limit? - Given the objects' initial covariance and the miss distance, what is the maximum combined hard body radius for which the probability of collision does not exceed the tolerance limit? The first relationship above allows the elimination of object pairs from conjunction analysis (CA) on the basis of the initial covariance and hard-body sizes of the objects. The application of this pre-filter to present day catalogs with estimated covariance results in the elimination of approximately 35% of object pairs as unable to ever conjunct with a probability of collision exceeding 1x10-6. Because Pc is directly proportional to object size and inversely proportional to covariance size, this pre-filter will have a significantly larger impact on future catalogs, which are expected to contain a much larger fraction of small debris tracked only by a limited subset of available sensors. This relationship also provides a mathematically rigorous basis for eliminating objects from analysis entirely based on element set age or quality - a practice commonly done by rough rules of thumb today. Further, these relations can be used to determine the required geometric screening radius for all objects. This analysis reveals the screening volumes for small objects are much larger than needed, while the screening volumes for pairs of large objects may be inadequate. These relationships may also form the basis of an important metric for catalog maintenance by defining the maximum allowable covariance size for effective conjunction analysis. The application of these techniques promises to greatly improve the efficiency and completeness of conjunction analysis.

Photon pair source via two coupling single quantum emitters

NASA Astrophysics Data System (ADS)

Peng, Yong-Gang; Zheng, Yu-Jun

2015-10-01

We study the two coupling two-level single molecules driven by an external field as a photon pair source. The probability of emitting two photons, P2, is employed to describe the photon pair source quality in a short time, and the correlation coefficient RAB is employed to describe the photon pair source quality in a long time limit. The results demonstrate that the coupling single quantum emitters can be considered as a stable photon pair source. Project supported by the National Natural Science Foundation of China (Grand Nos. 91021009, 21073110, and 11374191), the Natural Science Foundation of Shandong Province, China (Grant No. ZR2013AQ020), the Postdoctoral Science Foundation of China (Grant No. 2013M531584), the Doctoral Program of Higher Education of China (Grant Nos. 20130131110005 and 20130131120006), and the Taishan Scholarship Project of Shandong Province, China.

PARTS: Probabilistic Alignment for RNA joinT Secondary structure prediction

PubMed Central

Harmanci, Arif Ozgun; Sharma, Gaurav; Mathews, David H.

2008-01-01

A novel method is presented for joint prediction of alignment and common secondary structures of two RNA sequences. The joint consideration of common secondary structures and alignment is accomplished by structural alignment over a search space defined by the newly introduced motif called matched helical regions. The matched helical region formulation generalizes previously employed constraints for structural alignment and thereby better accommodates the structural variability within RNA families. A probabilistic model based on pseudo free energies obtained from precomputed base pairing and alignment probabilities is utilized for scoring structural alignments. Maximum a posteriori (MAP) common secondary structures, sequence alignment and joint posterior probabilities of base pairing are obtained from the model via a dynamic programming algorithm called PARTS. The advantage of the more general structural alignment of PARTS is seen in secondary structure predictions for the RNase P family. For this family, the PARTS MAP predictions of secondary structures and alignment perform significantly better than prior methods that utilize a more restrictive structural alignment model. For the tRNA and 5S rRNA families, the richer structural alignment model of PARTS does not offer a benefit and the method therefore performs comparably with existing alternatives. For all RNA families studied, the posterior probability estimates obtained from PARTS offer an improvement over posterior probability estimates from a single sequence prediction. When considering the base pairings predicted over a threshold value of confidence, the combination of sensitivity and positive predictive value is superior for PARTS than for the single sequence prediction. PARTS source code is available for download under the GNU public license at http://rna.urmc.rochester.edu. PMID:18304945

A probabilistic analysis of the implications of instrument failures on ESA's Swarm mission for its individual satellite orbit deployments

NASA Astrophysics Data System (ADS)

Jackson, Andrew

2015-07-01

On launch, one of Swarm's absolute scalar magnetometers (ASMs) failed to function, leaving an asymmetrical arrangement of redundant spares on different spacecrafts. A decision was required concerning the deployment of individual satellites into the low-orbit pair or the higher "lonely" orbit. I analyse the probabilities for successful operation of two of the science components of the Swarm mission in terms of a classical probabilistic failure analysis, with a view to concluding a favourable assignment for the satellite with the single working ASM. I concentrate on the following two science aspects: the east-west gradiometer aspect of the lower pair of satellites and the constellation aspect, which requires a working ASM in each of the two orbital planes. I use the so-called "expert solicitation" probabilities for instrument failure solicited from Mission Advisory Group (MAG) members. My conclusion from the analysis is that it is better to have redundancy of ASMs in the lonely satellite orbit. Although the opposite scenario, having redundancy (and thus four ASMs) in the lower orbit, increases the chance of a working gradiometer late in the mission; it does so at the expense of a likely constellation. Although the results are presented based on actual MAG members' probabilities, the results are rather generic, excepting the case when the probability of individual ASM failure is very small; in this case, any arrangement will ensure a successful mission since there is essentially no failure expected at all. Since the very design of the lower pair is to enable common mode rejection of external signals, it is likely that its work can be successfully achieved during the first 5 years of the mission.

The Finite-Size Scaling Relation for the Order-Parameter Probability Distribution of the Six-Dimensional Ising Model

NASA Astrophysics Data System (ADS)

Merdan, Ziya; Karakuş, Özlem

2016-11-01

The six dimensional Ising model with nearest-neighbor pair interactions has been simulated and verified numerically on the Creutz Cellular Automaton by using five bit demons near the infinite-lattice critical temperature with the linear dimensions L=4,6,8,10. The order parameter probability distribution for six dimensional Ising model has been calculated at the critical temperature. The constants of the analytical function have been estimated by fitting to probability function obtained numerically at the finite size critical point.

Remission and Recovery in the Treatment for Adolescents with Depression Study (TADS): Acute and Long-term Outcomes

PubMed Central

Kennard, Betsy D.; Silva, Susan G.; Tonev, Simon; Rohde, Paul; Hughes, Jennifer L.; Vitiello, Benedetto; Kratochvil, Christopher J.; Curry, John F.; Emslie, Graham J.; Reinecke, Mark; March, John

2010-01-01

Objective We examine remission rate probabilities, recovery rates, and residual symptoms across 36 weeks in the Treatment for Adolescents with Depression Study (TADS). Method TADS, a multisite clinical trial, randomized 439 adolescents with major depressive disorder (MDD) to 12 weeks of treatment to fluoxetine (FLX), cognitive behavioral therapy (CBT), their combination (COMB), or pill placebo (PBO). The PBO group, treated openly after week 12, was not included in the subsequent analyses. Treatment differences in remission rates and probabilities of remission over time are compared. Recovery rates in remitters at week 12 (acute phase remitters) and week 18 (continuation phase remitters) are summarized. We also examined whether residual symptoms at the end of 12 weeks of acute treatment predicted later remission. Results At Week 36, the estimated remission rates for intention-to-treat cases were: COMB: 60%, FLX: 55%; CBT: 64%; overall: 60%. Paired comparisons reveal that at week 24 all active treatments converge on remission outcomes. The recovery rate at Week 36 was 65% for acute phase remitters and 71% for continuation phase remitters, with no significant between-treatment differences in recovery rates. Residual symptoms at the end of acute treatment predicted failure to achieve remission at weeks 18 and 36. Conclusions The majority of depressed adolescents in all three treatment modalities achieved remission at the end of nine months of treatment. PMID:19127172

Reply to `Comment on ``Higher order effects in lepton-pair production in relativistic heavy ion collisions'' '

NASA Astrophysics Data System (ADS)

Güçlü, M. C.

2001-04-01

In this Reply, I will show that including the Coulomb corrections to the lepton-pair production in heavy-ion collisions also violates the unitarity. Therefore, the points stressed by U. Eichmann are not complete and the multipair production problem is still an open question.

Attractive interaction between Mn atoms on the GaAs(110) surface observed by scanning tunneling microscopy.

PubMed

Taninaka, Atsushi; Yoshida, Shoji; Kanazawa, Ken; Hayaki, Eiko; Takeuchi, Osamu; Shigekawa, Hidemi

2016-06-16

Scanning tunneling microscopy/spectroscopy (STM/STS) was carried out to investigate the structures of Mn atoms deposited on a GaAs(110) surface at room temperature to directly observe the characteristics of interactions between Mn atoms in GaAs. Mn atoms were paired with a probability higher than the random distribution, indicating an attractive interaction between them. In fact, re-pairing of unpaired Mn atoms was observed during STS measurement. The pair initially had a new structure, which was transformed during STS measurement into one of those formed by atom manipulation at 4 K. Mn atoms in pairs and trimers were aligned in the <110> direction, which is theoretically predicted to produce a high Curie temperature.

Productivity and breeding habitat of loggerhead shrikes in a southwestern urban environment

USGS Publications Warehouse

Boal, C.W.; Estabrook, T.S.; Duerr, A.E.

2003-01-01

Declines in loggerhead shrike (Lanius ludovicianus) populations have been associated in part with habitat loss and degradation, including that resulting from urbanization. We monitored the productivity and examined nesting habitat of loggerhead shrikes nesting in an urban environment in Tucson, Arizona. We located 22 breeding pairs in 1997 and 26 breeding pairs in 1998, with a 72% breeding area reoccupancy between years. Mean fledgling numbers were 2.28/ nesting attempt and 3.11/successful nest. Although some pairs initially failed and renested, 91% and 73% of shrike pairs successfully fledged young in 1997 and 1998, respectively. Mayfield estimates of nesting success were 78% in 1997 and 65% in 1998. Nest sites were characterized by more trees >3 m in height, taller nest trees than those randomly available, and a greater proportion of bare ground surface than at random sites. Shrike breeding territories had lower proportions of residential and commercial development and greater proportions of open areas with low-growing vegetation than randomly available. Some shrikes nested in school playgrounds, residential front yards, and parking lots, if adjacent open space was available.

Real-time observation of the initiation of RNA polymerase II transcription.

PubMed

Fazal, Furqan M; Meng, Cong A; Murakami, Kenji; Kornberg, Roger D; Block, Steven M

2015-09-10

Biochemical and structural studies have shown that the initiation of RNA polymerase II transcription proceeds in the following stages: assembly of the polymerase with general transcription factors and promoter DNA in a 'closed' preinitiation complex (PIC); unwinding of about 15 base pairs of the promoter DNA to form an 'open' complex; scanning downstream to a transcription start site; synthesis of a short transcript, thought to be about 10 nucleotides long; and promoter escape. Here we have assembled a 32-protein, 1.5-megadalton PIC derived from Saccharomyces cerevisiae, and observe subsequent initiation processes in real time with optical tweezers. Contrary to expectation, scanning driven by the transcription factor IIH involved the rapid opening of an extended transcription bubble, averaging 85 base pairs, accompanied by the synthesis of a transcript up to the entire length of the extended bubble, followed by promoter escape. PICs that failed to achieve promoter escape nevertheless formed open complexes and extended bubbles, which collapsed back to closed or open complexes, resulting in repeated futile scanning.

Promise and problems in using stress triggering models for time-dependent earthquake hazard assessment

NASA Astrophysics Data System (ADS)

Cocco, M.

2001-12-01

Earthquake stress changes can promote failures on favorably oriented faults and modify the seismicity pattern over broad regions around the causative faults. Because the induced stress perturbations modify the rate of production of earthquakes, they alter the probability of seismic events in a specified time window. Comparing the Coulomb stress changes with the seismicity rate changes and aftershock patterns can statistically test the role of stress transfer in earthquake occurrence. The interaction probability may represent a further tool to test the stress trigger or shadow model. The probability model, which incorporate stress transfer, has the main advantage to include the contributions of the induced stress perturbation (a static step in its present formulation), the loading rate and the fault constitutive properties. Because the mechanical conditions of the secondary faults at the time of application of the induced load are largely unkown, stress triggering can only be tested on fault populations and not on single earthquake pairs with a specified time delay. The interaction probability can represent the most suitable tool to test the interaction between large magnitude earthquakes. Despite these important implications and the stimulating perspectives, there exist problems in understanding earthquake interaction that should motivate future research but at the same time limit its immediate social applications. One major limitation is that we are unable to predict how and if the induced stress perturbations modify the ratio between small versus large magnitude earthquakes. In other words, we cannot distinguish between a change in this ratio in favor of small events or of large magnitude earthquakes, because the interaction probability is independent of magnitude. Another problem concerns the reconstruction of the stressing history. The interaction probability model is based on the response to a static step; however, we know that other processes contribute to the stressing history perturbing the faults (such as dynamic stress changes, post-seismic stress changes caused by viscolelastic relaxation or fluid flow). If, for instance, we believe that dynamic stress changes can trigger aftershocks or earthquakes years after the passing of the seismic waves through the fault, the perspective of calculating interaction probability is untenable. It is therefore clear we have learned a lot on earthquake interaction incorporating fault constitutive properties, allowing to solve existing controversy, but leaving open questions for future research.

Pairing call-response surveys and distance sampling for a mammalian carnivore

USGS Publications Warehouse

Hansen, Sara J. K.; Frair, Jacqueline L.; Underwood, Harold B.; Gibbs, James P.

2015-01-01

Density estimates accounting for differential animal detectability are difficult to acquire for wide-ranging and elusive species such as mammalian carnivores. Pairing distance sampling with call-response surveys may provide an efficient means of tracking changes in populations of coyotes (Canis latrans), a species of particular interest in the eastern United States. Blind field trials in rural New York State indicated 119-m linear error for triangulated coyote calls, and a 1.8-km distance threshold for call detectability, which was sufficient to estimate a detection function with precision using distance sampling. We conducted statewide road-based surveys with sampling locations spaced ≥6 km apart from June to August 2010. Each detected call (be it a single or group) counted as a single object, representing 1 territorial pair, because of uncertainty in the number of vocalizing animals. From 524 survey points and 75 detections, we estimated the probability of detecting a calling coyote to be 0.17 ± 0.02 SE, yielding a detection-corrected index of 0.75 pairs/10 km2 (95% CI: 0.52–1.1, 18.5% CV) for a minimum of 8,133 pairs across rural New York State. Importantly, we consider this an index rather than true estimate of abundance given the unknown probability of coyote availability for detection during our surveys. Even so, pairing distance sampling with call-response surveys provided a novel, efficient, and noninvasive means of monitoring populations of wide-ranging and elusive, albeit reliably vocal, mammalian carnivores. Our approach offers an effective new means of tracking species like coyotes, one that is readily extendable to other species and geographic extents, provided key assumptions of distance sampling are met.

Assessing relative abundance and reproductive success of shrubsteppe raptors

USGS Publications Warehouse

Lehman, Robert N.; Carpenter, L.B.; Steenhof, Karen; Kochert, Michael N.

1998-01-01

From 1991-1994, we quantified relative abundance and reproductive success of the Ferruginous Hawk (Buteo regalis), Northern Harrier (Circus cyaneus), Burrowing Owl (Speotytoc unicularia), and Short-eared Owl (Asio flammeus) on the shrubsteppe plateaus (benchlands) in and near the Snake River Birds of Prey National Conservation Area in southwestern Idaho. To assess relative abundance, we searched randomly selected plots using four sampling methods: point counts, line transects, and quadrats of two sizes. On a persampling-effort basis, transects were slightly more effective than point counts and quadrats for locating raptor nests (3.4 pairs detected/100 h of effort vs. 2.2-3.1 pairs). Random sampling using quadrats failed to detect a Short-eared Owl population increase from 1993 to 1994. To evaluate nesting success, we tried to determine reproductive outcome for all nesting attempts located during random, historical, and incidental nest searches. We compared nesting success estimates based on all nesting attempts, on attempts found during incubation, and the Mayfield model. Most pairs used to evaluate success were pairs found incidentally. Visits to historical nesting areas yielded the highest number of pairs per sampling effort (14.6/100 h), but reoccupancy rates for most species decreased through time. Estimates based on all attempts had the highest sample sizes but probably overestimated success for all species except the Ferruginous Hawk. Estimates of success based on nesting attempts found during incubation had the lowest sample sizes. All three methods yielded biased nesting snccess estimates for the Northern Harrier and Short-eared Owl. The estimate based on pairs found during incubation probably provided the least biased estimate for the Burrowing Owl. Assessments of nesting success were hindered by difficulties in confirming egg laying and nesting success for all species except the Ferruginous hawk.

Partner Loss in Monogamous Rodents: Modulation of Pain and Emotional Behavior in Male Prairie Voles.

PubMed

Osako, Yoji; Nobuhara, Reiko; Arai, Young-Chang P; Tanaka, Kenjiro; Young, Larry J; Nishihara, Makoto; Mitsui, Shinichi; Yuri, Kazunari

2018-01-01

Pain is modulated by psychosocial factors, and social stress-induced hyperalgesia is a common clinical symptom in pain disorders. To provide a new animal model for studying social modulation of pain, we examined pain behaviors in monogamous prairie voles experiencing partner loss. After cohabitation with novel females, males (n = 79) were divided into two groups on the basis of preference test scores. Half of the males of each group were separated from their partner (loss group), whereas the other half remained paired (paired group). Thus, males from both groups experienced social isolation. Open field tests, plantar tests, and formalin tests were then conducted on males to assess anxiety and pain-related behaviors. Loss males showing partner preferences (n = 20) displayed a significant increase in anxiety-related behavior in the open-field test (central area/total distance: 13.65% [1.58%] for paired versus 6.45% [0.87%] for loss; p < .001), a low threshold of thermal stimulus in the plantar test (withdrawal latencies: 9.69 [0.98] seconds for paired versus 6.15 [0.75] seconds for loss; p = .037), and exacerbated pain behaviors in the formalin test (total number of lifts: 40.33 [4.46] for paired versus 54.42 [1.91] for loss; p = .042) as compared with paired males (n = 20). Thermal thresholds in the plantar test significantly correlated with anxiety-related behavior in the open-field test (r = 0.64). No such differences were observed in the males that did not display partner preferences (r = 0.15). Results indicate that social bonds and their disruption, but not social housing without bonding followed by isolation, modulate pain and emotion in male prairie voles. The prairie vole is a useful model for exploring the neural mechanisms by which social relationships contribute to pain and nociceptive processing in humans.

Paired-pulse flash-visual evoked potentials: new methods revive an old test.

PubMed

Cantello, Roberto; Strigaro, Gionata; Prandi, Paolo; Varrasi, Claudia; Mula, Marco; Monaco, Francesco

2011-08-01

We aimed at reviving with modern technology the paired flash-visual evoked potential (F-VEP) testing of the visual system excitability. In the 1960s, methodological problems hindered this test, which was expected to provide important physiologic information. We studied 22 consenting healthy subjects (10 men). We recorded F-VEPs from electrodes over occipital and central brain regions. We delivered single flashes, mixed at random to flash pairs at the interstimulus interval (ISI) of 333, 125, 62.5, 50, 33, and 16.5 ms, (i.e. an internal frequency (IF) of 3, 8, 16, 20, 30, and 60 Hz). Recordings were performed with the subject's eyes closed and opened. The F-VEP was split into a "main complex" and an "afterdischarge", which we analyzed statistically in relation to the eye state (closed or open) and to the changes due to paired stimulation. The eye state affected the single F-VEP size, latency and shape significantly (p<0.05). On paired stimulation, the test (second) F-VEP exhibited significant (p<0.05), ISI-dependent size changes, such as a progressive decrease for ISIs from 62.5 to 16.5 ms (IFs of 16-60 Hz), whose timing/amount varied significantly (p<0.05) according to the eye state and to the F-VEP epoch considered. Suppression of the test F-VEP was never complete, even for the shortest ISI (ISI=16.5 ms, IF=60 Hz). The eye state (closed or open) must be considered meticulously when studying F-VEPs. F-VEP changes on paired stimulation express neural inhibition within the visual system, which can be depicted as ISI-dependent curves. Modern equipment and simplified measures render this an easy test, with statistical validity, providing specific information on the excitability properties of the visual system. Copyright © 2011 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

Matrix Concentration Inequalities via the Method of Exchangeable Pairs

DTIC Science & Technology

2012-01-27

viewed as an exchangeable pairs version of the Burkholder –Davis–Gundy (BDG) inequality from classical martingale theory [Bur73]. Matrix extensions of...non-commutative probability. Math. Ann., 319:1–16, 2001. [Bur73] D. L. Burkholder . Distribution function inequalities for martingales. Ann. Probab., 1...Statist. Assoc., 58(301):13–30, 1963. [JX03] M. Junge and Q. Xu. Noncommutative Burkholder /Rosenthal inequalities. Ann. Probab., 31(2):948–995, 2003

Evaluation of Image Segmentation and Object Recognition Algorithms for Image Parsing

DTIC Science & Technology

2013-09-01

generation of the features from the key points. OpenCV uses Euclidean distance to match the key points and has the option to use Manhattan distance...feature vector includes polarity and intensity information. Final step is matching the key points. In OpenCV , Euclidean distance or Manhattan...the code below is one way and OpenCV offers the function radiusMatch (a pair must have a distance less than a given maximum distance). OpenCV’s

Inhibition of the calcium channel by intracellular protons in single ventricular myocytes of the guinea-pig.

PubMed Central

Kaibara, M; Kameyama, M

1988-01-01

1. The inhibitory effects of intracellular protons (Hi+) on the L-type Ca2+ channel activity were investigated in single ventricular myocytes of guinea-pigs by using the patch-clamp method in the open-cell-attached patch configuration, where 'run down' of the channel was partially prevented. 2. Hi+ reduced the unitary Ba2+ current of the Ca2+ channel by 10-20% without changing the maximum slope conductance. 3. Hi+ did not alter the number of channels in patches containing one or two channels. 4. Hi+ markedly reduced the mean current normalized by the unitary current, which gave the open-state probability multiplied by the number of channels in the patch. The dose-response curve between Hi+ and the open-state probability indicated half-maximum inhibition at pHi 6.6 and an apparent Hill coefficient of 1. 5. Hi+ shifted both the steady-state activation and inactivation curves in a negative direction by 10-15 mV, and the effects were reversible. 6. Hi+ did not affect the fast open-closed kinetics represented by the C-C-O scheme, apart from increasing the slow time constant of the closed time. 7. Hi+ increased the percentage of blank sweeps and reduced that of non-blank sweeps resulting in a decreased probability of channel opening. 8. Photo-oxidation with Rose Bengal abolished the reducing effect of Hi+ on the open-state probability (Po) in two out of ten experiments, suggesting the possible involvement of histidine residues in the Hi+ effect. 9. The above results indicate that Hi+ inhibits the Ba2+ current mainly by affecting the slow gating mechanism of the channel. PMID:2855346

Tri-state logic circuit

NASA Technical Reports Server (NTRS)

Pryor, Richard Lee (Inventor)

1977-01-01

A line driver including a pair of complementary transistors having their conduction paths serially connected between an operating and a reference potential and their bases connected through a first switch to a signal input terminal. A second switch is connected between the common base connection and the common connection of the conduction paths. With the second switch open and the first closed, an output voltage, responsive to the input signal, corresponding to first or second binary values is obtained. When the second switch is closed and the first opened, the transistor pair is turned off, disconnecting the line driver from its load, thereby providing tri-state logic operation.

System for automatically switching transformer coupled lines

NASA Technical Reports Server (NTRS)

Dwinell, W. S. (Inventor)

1979-01-01

A system is presented for automatically controlling transformer coupled alternating current electric lines. The secondary winding of each transformer is provided with a center tap. A switching circuit is connected to the center taps of a pair of secondary windings and includes a switch controller. An impedance is connected between the center taps of the opposite pair of secondary windings. The switching circuit has continuity when the AC lines are continuous and discontinuity with any disconnect of the AC lines. Normally open switching means are provided in at least one AC line. The switch controller automatically opens the switching means when the AC lines become separated.

14. FIRST FLOOR APARTMENT LIVING ROOM INTERIOR. FRONT ENTRY DOOR ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

14. FIRST FLOOR APARTMENT LIVING ROOM INTERIOR. FRONT ENTRY DOOR IS AT PHOTO CENTER FLANKED BY A PAIRED 4-LIGHT OVER 4-LIGHT DOUBLE-HUNG, WOOD-FRAME WINDOWS. OPEN DOORWAY TO PHOTO RIGHT OPENS TO NORTH BEDROOM. DOORWAY TO PHOTO LEFT OPENS TO KITCHEN. VIEW TO NORTHEAST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

16. FIRST FLOOR APARTMENT KITCHEN INTERIOR SHOWING OPEN DOORWAY TO ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

16. FIRST FLOOR APARTMENT KITCHEN INTERIOR SHOWING OPEN DOORWAY TO LIVING ROOM AND PAIRED 6-LIGHT OVER 6-LIGHT DOUBLE-HUNG, WOOD-FRAME WINDOWS OVER SINK. VIEW TO EAST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

A Framework for Final Drive Simultaneous Failure Diagnosis Based on Fuzzy Entropy and Sparse Bayesian Extreme Learning Machine

PubMed Central

Ye, Qing; Pan, Hao; Liu, Changhua

2015-01-01

This research proposes a novel framework of final drive simultaneous failure diagnosis containing feature extraction, training paired diagnostic models, generating decision threshold, and recognizing simultaneous failure modes. In feature extraction module, adopt wavelet package transform and fuzzy entropy to reduce noise interference and extract representative features of failure mode. Use single failure sample to construct probability classifiers based on paired sparse Bayesian extreme learning machine which is trained only by single failure modes and have high generalization and sparsity of sparse Bayesian learning approach. To generate optimal decision threshold which can convert probability output obtained from classifiers into final simultaneous failure modes, this research proposes using samples containing both single and simultaneous failure modes and Grid search method which is superior to traditional techniques in global optimization. Compared with other frequently used diagnostic approaches based on support vector machine and probability neural networks, experiment results based on F 1-measure value verify that the diagnostic accuracy and efficiency of the proposed framework which are crucial for simultaneous failure diagnosis are superior to the existing approach. PMID:25722717

Designing heteropolymers to fold into unique structures via water-mediated interactions.

PubMed

Jamadagni, Sumanth N; Bosoy, Christian; Garde, Shekhar

2010-10-28

Hydrophobic homopolymers collapse into globular structures in water driven by hydrophobic interactions. Here we employ extensive molecular dynamics simulations to study the collapse of heteropolymers containing one or two pairs of oppositely charged monomers. We show that charging a pair of monomers can dramatically alter the most stable conformations from compact globular to more open hairpin-like. We systematically explore a subset of the sequence space of one- and two-charge-pair polymers, focusing on the locations of the charge pairs. Conformational stability is governed by a balance of hydrophobic interactions, hydration and interactions of charge groups, water-mediated charged-hydrophobic monomer repulsions, and other factors. As a result, placing charge pairs in the middle, away from the hairpin ends, leads to stable hairpin-like structures. Turning off the monomer-water attractions enhances hydrophobic interactions significantly leading to a collapse into compact globular structures even for two-charge-pair heteropolymers. In contrast, the addition of salt leads to open and extended structures, suggesting that solvation of charged monomer sites by salt ions dominates the salt-induced enhancement of hydrophobic interactions. We also test the ability of a predictive scheme based on the additivity of free energy of contact formation. The success of the scheme for symmetric two-charge-pair sequences and the failure for their flipped versions highlight the complexity of the heteropolymer conformation space and of the design problem. Collectively, our results underscore the ability of tuning water-mediated interactions to design stable nonglobular structures in water and present model heteropolymers for further studies in the extended thermodynamic space and in inhomogeneous environments.

Galactic Doppelgängers: The Chemical Similarity Among Field Stars and Among Stars with a Common Birth Origin

NASA Astrophysics Data System (ADS)

Ness, M.; Rix, H.-W.; Hogg, David W.; Casey, A. R.; Holtzman, J.; Fouesneau, M.; Zasowski, G.; Geisler, D.; Shetrone, M.; Minniti, D.; Frinchaboy, Peter M.; Roman-Lopes, Alexandre

2018-02-01

We explore to what extent stars within Galactic disk open clusters resemble each other in the high-dimensional space of their photospheric element abundances and contrast this with pairs of field stars. Our analysis is based on abundances for 20 elements, homogeneously derived from APOGEE spectra (with carefully quantified uncertainties of typically 0.03 dex). We consider 90 red giant stars in seven open clusters and find that most stars within a cluster have abundances in most elements that are indistinguishable (in a {χ }2-sense) from those of the other members, as expected for stellar birth siblings. An analogous analysis among pairs of > 1000 field stars shows that highly significant abundance differences in the 20 dimensional space can be established for the vast majority of these pairs, and that the APOGEE-based abundance measurements have high discriminating power. However, pairs of field stars whose abundances are indistinguishable even at 0.03 dex precision exist: ∼0.3% of all field star pairs and ∼1.0% of field star pairs at the same (solar) metallicity [Fe/H] = 0 ± 0.02. Most of these pairs are presumably not birth siblings from the same cluster, but rather doppelgängers. Our analysis implies that “chemical tagging” in the strict sense, identifying birth siblings for typical disk stars through their abundance similarity alone, will not work with such data. However, our approach shows that abundances have extremely valuable information for probabilistic chemo-orbital modeling, and combined with velocities, we have identified new cluster members from the field.

Incorporating sequence information into the scoring function: a hidden Markov model for improved peptide identification.

PubMed

Khatun, Jainab; Hamlett, Eric; Giddings, Morgan C

2008-03-01

The identification of peptides by tandem mass spectrometry (MS/MS) is a central method of proteomics research, but due to the complexity of MS/MS data and the large databases searched, the accuracy of peptide identification algorithms remains limited. To improve the accuracy of identification we applied a machine-learning approach using a hidden Markov model (HMM) to capture the complex and often subtle links between a peptide sequence and its MS/MS spectrum. Our model, HMM_Score, represents ion types as HMM states and calculates the maximum joint probability for a peptide/spectrum pair using emission probabilities from three factors: the amino acids adjacent to each fragmentation site, the mass dependence of ion types and the intensity dependence of ion types. The Viterbi algorithm is used to calculate the most probable assignment between ion types in a spectrum and a peptide sequence, then a correction factor is added to account for the propensity of the model to favor longer peptides. An expectation value is calculated based on the model score to assess the significance of each peptide/spectrum match. We trained and tested HMM_Score on three data sets generated by two different mass spectrometer types. For a reference data set recently reported in the literature and validated using seven identification algorithms, HMM_Score produced 43% more positive identification results at a 1% false positive rate than the best of two other commonly used algorithms, Mascot and X!Tandem. HMM_Score is a highly accurate platform for peptide identification that works well for a variety of mass spectrometer and biological sample types. The program is freely available on ProteomeCommons via an OpenSource license. See http://bioinfo.unc.edu/downloads/ for the download link.

Detail section extending from shore. Note the paired support pilings, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Detail section extending from shore. Note the paired support pilings, concrete curbs with rectangular openings for drainage, and large-diameter metal pipe suspended under the deck. USS MISSOURI in background - U.S. Naval Base, Pearl Harbor, Gasoline Wharf, Offshore, near the intersection of Hornet Avenue & Curtis Street, Ford Island, Pearl City, Honolulu County, HI

Switch wear leveling

DOEpatents

Wu, Hunter; Sealy, Kylee; Gilchrist, Aaron

2015-09-01

An apparatus for switch wear leveling includes a switching module that controls switching for two or more pairs of switches in a switching power converter. The switching module controls switches based on a duty cycle control technique and closes and opens each switch in a switching sequence. The pairs of switches connect to a positive and negative terminal of a DC voltage source. For a first switching sequence a first switch of a pair of switches has a higher switching power loss than a second switch of the pair of switches. The apparatus includes a switch rotation module that changes the switching sequence of the two or more pairs of switches from the first switching sequence to a second switching sequence. The second switch of a pair of switches has a higher switching power loss than the first switch of the pair of switches during the second switching sequence.

Pair production in low-energy collisions of uranium nuclei beyond the monopole approximation

NASA Astrophysics Data System (ADS)

Maltsev, I. A.; Shabaev, V. M.; Tupitsyn, I. I.; Kozhedub, Y. S.; Plunien, G.; Stöhlker, Th.

2017-10-01

A method for calculation of electron-positron pair production in low-energy heavy-ion collisions beyond the monopole approximation is presented. The method is based on the numerical solving of the time-dependent Dirac equation with the full two-center potential. The one-electron wave functions are expanded in the finite basis set constructed on the two-dimensional spatial grid. Employing the developed approach the probabilities of bound-free pair production are calculated for collisions of bare uranium nuclei at the energy near the Coulomb barrier. The obtained results are compared with the corresponding values calculated in the monopole approximation.

Changes in flexibility upon binding: Application of the self-consistent pair contact probability method to protein-protein interactions

NASA Astrophysics Data System (ADS)

Canino, Lawrence S.; Shen, Tongye; McCammon, J. Andrew

2002-12-01

We extend the self-consistent pair contact probability method to the evaluation of the partition function for a protein complex at thermodynamic equilibrium. Specifically, we adapt the method for multichain models and introduce a parametrization for amino acid-specific pairwise interactions. This method is similar to the Gaussian network model but allows for the adjusting of the strengths of native state contacts. The method is first validated on a high resolution x-ray crystal structure of bovine Pancreatic Phospholipase A2 by comparing calculated B-factors with reported values. We then examine binding-induced changes in flexibility in protein-protein complexes, comparing computed results with those obtained from x-ray crystal structures and molecular dynamics simulations. In particular, we focus on the mouse acetylcholinesterase:fasciculin II and the human α-thrombin:thrombomodulin complexes.

Universal fingerprinting chip server.

PubMed

Casique-Almazán, Janet; Larios-Serrato, Violeta; Olguín-Ruíz, Gabriela Edith; Sánchez-Vallejo, Carlos Javier; Maldonado-Rodríguez, Rogelio; Méndez-Tenorio, Alfonso

2012-01-01

The Virtual Hybridization approach predicts the most probable hybridization sites across a target nucleic acid of known sequence, including both perfect and mismatched pairings. Potential hybridization sites, having a user-defined minimum number of bases that are paired with the oligonucleotide probe, are first identified. Then free energy values are evaluated for each potential hybridization site, and if it has a calculated free energy of equal or higher negative value than a user-defined free energy cut-off value, it is considered as a site of high probability of hybridization. The Universal Fingerprinting Chip Applications Server contains the software for visualizing predicted hybridization patterns, which yields a simulated hybridization fingerprint that can be compared with experimentally derived fingerprints or with a virtual fingerprint arising from a different sample. The database is available for free at http://bioinformatica.homelinux.org/UFCVH/

Surface code quantum communication.

PubMed

Fowler, Austin G; Wang, David S; Hill, Charles D; Ladd, Thaddeus D; Van Meter, Rodney; Hollenberg, Lloyd C L

2010-05-07

Quantum communication typically involves a linear chain of repeater stations, each capable of reliable local quantum computation and connected to their nearest neighbors by unreliable communication links. The communication rate of existing protocols is low as two-way classical communication is used. By using a surface code across the repeater chain and generating Bell pairs between neighboring stations with probability of heralded success greater than 0.65 and fidelity greater than 0.96, we show that two-way communication can be avoided and quantum information can be sent over arbitrary distances with arbitrarily low error at a rate limited only by the local gate speed. This is achieved by using the unreliable Bell pairs to measure nonlocal stabilizers and feeding heralded failure information into post-transmission error correction. Our scheme also applies when the probability of heralded success is arbitrarily low.

Accounting for individual behavioural variation in studies of habitat selection.

PubMed

Wirsing, Aaron J; Heithaus, Michael R

2014-03-01

A caribou wearing an animal-borne video camera (a) and animal-borne video footage taken from systems deployed on mule deer (Odocoileus hemionus) in north-central Washington state, USA (b-d). When paired with tracking technology, animal-borne video can reveal detailed information about behaviour and environmental features at each location: (b) feeding, (c) vigilant in the open, (d) vigilant in cover, (e) resting in the open. Accordingly, animal-borne video systems should allow for analyses of habitat selection by individuals in particular behavioural states. In Focus: DeCesare, N.J., Hebblewhite, M., Bradley, M., Hervieux, D., Neufeld, L. & Musiani, M. (2014) Linking habitat selection and predation risk to spatial variation in survival. Journal of Animal Ecology, 83, 343-352. Resource selection is often assumed to confer enhanced fitness, but this assumption is rarely examined. In a study involving woodland caribou subject to grey wolf predation, DeCesare et al. (2014) show that while patterns of selection by caribou did correspond with a fitness proxy (survival probability), individuals did not avoid wolf predation risk to the extent that would minimize mortality. Here, we use the results of this paper as a springboard for discussing the choice of fitness proxies and the need to account for individual behavioural variation in studies of resource selection. © 2014 The Authors. Journal of Animal Ecology © 2014 British Ecological Society.

Risky Business: Do Native Rodents Use Habitat and Odor Cues to Manage Predation Risk in Australian Deserts?

PubMed Central

Spencer, Emma E.; Crowther, Mathew S.; Dickman, Christopher R.

2014-01-01

In open, arid environments with limited shelter there may be strong selection on small prey species to develop behaviors that facilitate predator avoidance. Here, we predicted that rodents should avoid predator odor and open habitats to reduce their probability of encounter with potential predators, and tested our predictions using a native Australian desert rodent, the spinifex hopping-mouse (Notomys alexis). We tested the foraging and movement responses of N. alexis to non-native predator (fox and cat) odor, in sheltered and open macro- and microhabitats. Rodents did not respond to predator odor, perhaps reflecting the inconsistent selection pressure that is imposed on prey species in the desert environment due to the transience of predator-presence. However, they foraged primarily in the open and moved preferentially across open sand. The results suggest that N. alexis relies on escape rather than avoidance behavior when managing predation risk, with its bipedal movement probably allowing it to exploit open environments most effectively. PMID:24587396

Risky business: do native rodents use habitat and odor cues to manage predation risk in Australian deserts?

PubMed

Spencer, Emma E; Crowther, Mathew S; Dickman, Christopher R

2014-01-01

In open, arid environments with limited shelter there may be strong selection on small prey species to develop behaviors that facilitate predator avoidance. Here, we predicted that rodents should avoid predator odor and open habitats to reduce their probability of encounter with potential predators, and tested our predictions using a native Australian desert rodent, the spinifex hopping-mouse (Notomys alexis). We tested the foraging and movement responses of N. alexis to non-native predator (fox and cat) odor, in sheltered and open macro- and microhabitats. Rodents did not respond to predator odor, perhaps reflecting the inconsistent selection pressure that is imposed on prey species in the desert environment due to the transience of predator-presence. However, they foraged primarily in the open and moved preferentially across open sand. The results suggest that N. alexis relies on escape rather than avoidance behavior when managing predation risk, with its bipedal movement probably allowing it to exploit open environments most effectively.

On the correlations between the polyhedron eccentricity parameters and the bond-valence sums for the cations with one lone electron pair.

PubMed

Sidey, Vasyl

2008-08-01

Applicability of the Wang-Liebau polyhedron eccentricity parameter in the bond-valence model [Wang & Liebau (2007). Acta Cryst. B63, 216-228] has been found to be doubtful: the correlations between the values of the polyhedron eccentricity parameters and the bond-valence sums calculated for the cations with one lone electron pair are probably an artifact of the poorly determined bond-valence parameters.

Compensatory Evolution of Intrinsic Transcription Terminators in Bacillus Cereus

PubMed Central

Safina, Ksenia R.; Mironov, Andrey A.

2017-01-01

Many RNA molecules possess complicated secondary structure critical to their function. Mutations in double-helical regions of RNA may disrupt Watson–Crick (WC) interactions causing structure destabilization or even complete loss of function. Such disruption can be compensated by another mutation restoring base pairing, as has been shown for mRNA, rRNA and tRNA. Here, we investigate the evolution of intrinsic transcription terminators between closely related strains of Bacillus cereus. While the terminator structure is maintained by strong natural selection, as evidenced by the low frequency of disrupting mutations, we observe multiple instances of pairs of disrupting-compensating mutations in RNA structure stems. Such two-step switches between different WC pairs occur very fast, consistent with the low fitness conferred by the intermediate non-WC variant. Still, they are not instantaneous, and probably involve transient fixation of the intermediate variant. The GU wobble pair is the most frequent intermediate, and remains fixed longer than other intermediates, consistent with its less disruptive effect on the RNA structure. Double switches involving non-GU intermediates are more frequent at the ends of RNA stems, probably because they are associated with smaller fitness loss. Together, these results show that the fitness landscape of bacterial transcription terminators is rather rugged, but that the fitness valleys associated with unpaired stem nucleotides are rather shallow, facilitating evolution. PMID:28201729

Chirality Characterization of Dispersed Single Wall Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Namkung, Min; Williams, Phillip A.; Mayweather, Candis D.; Wincheski, Buzz; Park, Cheol; Namkung, Juock S.

2005-01-01

Raman scattering and optical absorption spectroscopy are used for the chirality characterization of HiPco single wall carbon nanotubes (SWNTs) dispersed in aqueous solution with the surfactant sodium dodecylbenzene sulfonate. Radial breathing mode (RBM) Raman peaks for semiconducting and metallic SWNTs are identified by directly comparing the Raman spectra with the Kataura plot. The SWNT diameters are calculated from these resonant peak positions. Next, a list of (n, m) pairs, yielding the SWNT diameters within a few percent of that obtained from each resonant peak position, is established. The interband transition energies for the list of SWNT (n, m) pairs are calculated based on the tight binding energy expression for each list of the (n, m) pairs, and the pairs yielding the closest values to the corresponding experimental optical absorption peaks are selected. The results reveal that (1, 11), (4, 11), and (0, 11) as the most probable chiralities of the semiconducting nanotubes. The results also reveal that (4, 16), (6, 12) and (8, 8) are the most probable chiralities for the metallic nanotubes. Directly relating the Raman scattering data to the optical absorption spectra, the present method is considered the simplest technique currently available. Another advantage of this technique is the use of the E(sup 8)(sub 11) peaks in the optical absorption spectrum in the analysis to enhance the accuracy in the results.

Effects of fire on golden eagle territory occupancy and reproductive success

USGS Publications Warehouse

Kochert, Michael N.; Steenhof, Karen; Marzluff, J.M.; Carpenter, L.B.

1999-01-01

We examined effects of fire on golden eagle (Aquila chrysaetos) territory occupancy and reproductive success in southwestern Idaho because wildfires since 1980 have resulted in large-scale losses of shrub habitat in the Snake River Plain. Success (percentage of pairs that raised young) at burned territories declined after major fires (P = 0.004). Pairs in burned areas that could expand into adjacent vacant territories were as successful as pairs in unburned territories and more successful than pairs in burned territories that could not expand. Success at extensively burned territories was lowest 4-6 years after burning but increased 4-5 years later. The incidence and extent of fires did not help predict territories that would have low occupancy and success rates in postburn years. The presence of a vacant neighboring territory and the amount of agriculture and proportion of shrubs within 3 km of the nesting centroid best predicted probability of territory occupancy. Nesting success during preburn years best predicted the probability of a territory being successful in postburn years. Burned territories with high success rates during preburn years continued to have high success rates during postburn years, and those with low success in preburn years continued to be less successful after burning. In areas where much shrub habitat has been lost to fire, management for golden eagles should include active fire suppression and rehabilitation of burned areas.

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

PubMed

Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

2005-03-10

Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

Subthalamic nucleus long-range synchronization—an independent hallmark of human Parkinson's disease

PubMed Central

Moshel, Shay; Shamir, Reuben R.; Raz, Aeyal; de Noriega, Fernando R.; Eitan, Renana; Bergman, Hagai; Israel, Zvi

2013-01-01

Beta-band synchronous oscillations in the dorsolateral region of the subthalamic nucleus (STN) of human patients with Parkinson's disease (PD) have been frequently reported. However, the correlation between STN oscillations and synchronization has not been thoroughly explored. The simultaneous recordings of 2390 multi-unit pairs recorded by two parallel microelectrodes (separated by fixed distance of 2 mm, n = 72 trajectories with two electrode tracks >4 mm STN span) in 57 PD patients undergoing STN deep brain stimulation surgery were analyzed. Automatic procedures were utilized to divide the STN into dorsolateral oscillatory and ventromedial non-oscillatory regions, and to quantify the intensity of STN oscillations and synchronicity. Finally, the synchronicity of simultaneously vs. non-simultaneously recorded pairs were compared using a shuffling procedure. Synchronization was observed predominately in the beta range and only between multi-unit pairs in the dorsolateral oscillatory region (n = 615). In paired recordings between sites in the dorsolateral and ventromedial (n = 548) and ventromedial-ventromedial region pairs (n = 1227), no synchronization was observed. Oscillation and synchronicity intensity decline along the STN dorsolateral-ventromedial axis suggesting a fuzzy border between the STN regions. Synchronization strength was significantly correlated to the oscillation power, but synchronization was no longer observed following shuffling. We conclude that STN long-range beta oscillatory synchronization is due to increased neuronal coupling in the Parkinsonian brain and does not merely reflect the outcome of oscillations at similar frequency. The neural synchronization in the dorsolateral (probably the motor domain) STN probably augments the pathological changes in firing rate and patterns of subthalamic neurons in PD patients. PMID:24312018

The Best of Two Open Worlds at the National Open University of Nigeria

ERIC Educational Resources Information Center

Agbu, Jane-frances Obiageli; Mulder, Fred; de Vries, Fred; Tenebe, Vincent; Caine, Abel

2016-01-01

It will be wise for educational institutions, from primary to tertiary level, globally, to reflect on their position and profile with respect to the new concepts of Open Educational Resources (OER) and Massive Open Online Courses (MOOCs). Responses will be diverse of course but the potential is so manifest that many institutions probably will…

Phase transitions in Nowak Sznajd opinion dynamics

NASA Astrophysics Data System (ADS)

Wołoszyn, Maciej; Stauffer, Dietrich; Kułakowski, Krzysztof

2007-05-01

The Nowak modification of the Sznajd opinion dynamics model on the square lattice assumes that with probability β the opinions flip due to mass-media advertising from down to up, and vice versa. Besides, with probability α the Sznajd rule applies that a neighbour pair agreeing in its two opinions convinces all its six neighbours of that opinion. Our Monte Carlo simulations and mean-field theory find sharp phase transitions in the parameter space.

Noise thresholds for optical quantum computers.

PubMed

Dawson, Christopher M; Haselgrove, Henry L; Nielsen, Michael A

2006-01-20

In this Letter we numerically investigate the fault-tolerant threshold for optical cluster-state quantum computing. We allow both photon loss noise and depolarizing noise (as a general proxy for all local noise), and obtain a threshold region of allowed pairs of values for the two types of noise. Roughly speaking, our results show that scalable optical quantum computing is possible for photon loss probabilities <3 x 10(-3), and for depolarization probabilities <10(-4).

Selectivity assessment of DB-200 and DB-VRX open-tubular capillary columns.

PubMed

Kiridena, W; Koziola, W W; Poole, C F

2001-10-12

The solvation parameter model is used to study the influence of composition and temperature on the selectivity of two poly(siloxane) stationary phases used for open-tubular capillary column gas chromatography. The poly(methyltrifluoropropyldimethylsiloxane) stationary phase, DB-200, has low cohesion, intermediate dipolarity/polarizability, low hydrogen-bond basicity, no hydrogen-bond acidity, and repulsive electron lone pair interactions. The DB-VRX stationary phase has low cohesion, low dipolarity/polarizability, low hydrogen-bond basicity and no hydrogen-bond acidity and no capacity for electron lone pair interactions. The selectivity of the two stationary phases is complementary to those in a database of 11 stationary phase chemistries determined under the same experimental conditions.

General Model of Photon-Pair Detection with an Image Sensor

NASA Astrophysics Data System (ADS)

Defienne, Hugo; Reichert, Matthew; Fleischer, Jason W.

2018-05-01

We develop an analytic model that relates intensity correlation measurements performed by an image sensor to the properties of photon pairs illuminating it. Experiments using an effective single-photon counting camera, a linear electron-multiplying charge-coupled device camera, and a standard CCD camera confirm the model. The results open the field of quantum optical sensing using conventional detectors.

Arthroscopic suture anchor repair of the lateral ligament ankle complex: a cadaveric study.

PubMed

Giza, Eric; Shin, Edward C; Wong, Stephanie E; Acevedo, Jorge I; Mangone, Peter G; Olson, Kirstina; Anderson, Matthew J

2013-11-01

Operative treatment of mechanical ankle instability is indicated for patients with multiple sprains and continued episodes of instability. Open repair of the lateral ankle ligaments involves exposure of the attenuated ligaments and advancement back to their anatomic insertions on the fibula using bone tunnels or suture implants. Open and arthroscopic fixation are equal in strength to failure for anatomic Broström repair. Controlled laboratory study. Seven matched pairs of human cadaveric ankle specimens were randomized into 2 groups of anatomic Broström repair: open or arthroscopic. The calcaneofibular ligament and anterior talofibular ligament were excised from their origin on the fibula. In the open repair group, 2 suture anchors were used to reattach the ligaments to their anatomic origins. In the arthroscopic repair group, identical suture anchors were used for repair via an arthroscopic technique. The ligaments were cyclically loaded 20 times and then tested to failure. Torque to failure, degrees to failure, initial stiffness, and working stiffness were measured. A matched-pair analysis was performed. Power analysis of 0.8 demonstrated that 7 pairs needed to show a difference of 30%, with a 15% standard error at a significance level of α = .05. There was no difference in the degrees to failure, torque to failure, or stiffness for the repaired ligament complex. Nine of 14 specimens failed at the suture anchor. There is no statistical difference in strength or stiffness of a traditional open repair as compared with an arthroscopic anatomic repair of the lateral ligaments of the ankle. An arthroscopic technique can be considered for lateral ligament stabilization in patients with mild to moderate mechanical instability.

Operation REDWING, Report of the Manager Albuquerque Operations

DTIC Science & Technology

1983-01-31

on their experience in three previous operations (IVY, GREENHOUSE , and CASTLE) AEC authorized, and Holmes & Narver pur chased and shipped to the...Operation GREENHOUSE and one 51-pair cable installed prior to REDWING. One of the 16-pair cables developed shorted and opened pairs. When an...refrigerators, dehumidification units, 20’ ■.r.. i..jjj||.t.^. .M , ., ». i .. —■■■"■= •>•■•— :- •’ ■’ ■■-■■ ■- ’■ • APPENDIX lII-3.10-l

Automated measurement of spatial preference in the open field test with transmitted lighting.

PubMed

Kulikov, Alexander V; Tikhonova, Maria A; Kulikov, Victor A

2008-05-30

New modification of the open field was designed to improve automation of the test. The main innovations were: (1) transmitted lighting and (2) estimation of probability to find pixels associated with an animal in the selected region of arena as an objective index of spatial preference. Transmitted (inverted) lighting significantly ameliorated the contrast between an animal and arena and allowed to track white animals with similar efficacy as colored ones. Probability as a measure of preference of selected region was mathematically proved and experimentally verified. A good correlation between probability and classic indices of spatial preference (number of region entries and time spent therein) was shown. The algorithm of calculation of probability to find pixels associated with an animal in the selected region was implemented in the EthoStudio software. Significant interstrain differences in locomotion and the central zone preference (index of anxiety) were shown using the inverted lighting and the EthoStudio software in mice of six inbred strains. The effects of arena shape (circle or square) and a novel object presence in the center of arena on the open field behavior in mice were studied.

Fitness consequences of nest desertion in an endangered host, the least Bell's vireo

USGS Publications Warehouse

Kus, Barbara E.

2002-01-01

Recent analyses of the impact of cowbird parasitism on host productivity suggest that while parasitism reduces productivity on a per-nest basis, the ability of pairs to desert parasitized nests and renest allows them to achieve productivity comparable to that of unparasitized pairs. This has implications for the management of several endangered species that are highly vulnerable to parasitism and consequently the target of cowbird control programs. I calculated seasonal nesting effort (number of nests per pair) and productivity of 568 pairs of Least Bell's Vireos (Vireo bellii pusillus) monitored over 11 years at the San Luis Rey River in San Diego County, California (where cowbird trapping has reduced, but not eliminated, parasitism), assigning pairs to one of three groups: (1) deserters, (2) rescued (parasitized pairs with nests “rescued” from probable failure by the removal of cowbird eggs), and (3) unparasitized. Parasitized pairs attempted significantly more nests per season than did unparasitized pairs, with deserters producing more nests than rescued pairs. However, productivity of deserting pairs was significantly lower than that of both rescued and unparasitized pairs, largely because subsequent nests of deserting pairs were also parasitized. Seasonal productivity of rescued and unparasitized pairs was comparable, indicating that in this species, reduction of cowbird impacts through nest manipulation to remove cowbird eggs is effective. Desertion by Least Bell's Vireos does not appear to be an adequate natural defense against parasitism, suggesting the need for continued cowbird control while vireo populations are re-established.

Physical constraints of cultural evolution of dialects in killer whales.

PubMed

Filatova, Olga A; Samarra, Filipa I P; Barrett-Lennard, Lance G; Miller, Patrick J O; Ford, John K B; Yurk, Harald; Matkin, Craig O; Hoyt, Erich

2016-11-01

Odontocete sounds are produced by two pairs of phonic lips situated in soft nares below the blowhole; the right pair is larger and is more likely to produce clicks, while the left pair is more likely to produce whistles. This has important implications for the cultural evolution of delphinid sounds: the greater the physical constraints, the greater the probability of random convergence. In this paper the authors examine the call structure of eight killer whale populations to identify structural constraints and to determine if they are consistent among all populations. Constraints were especially pronounced in two-voiced calls. In the calls of all eight populations, the lower component of two-voiced (biphonic) calls was typically centered below 4 kHz, while the upper component was typically above that value. The lower component of two-voiced calls had a narrower frequency range than single-voiced calls in all populations. This may be because some single-voiced calls are homologous to the lower component, while others are homologous to the higher component of two-voiced calls. Physical constraints on the call structure reduce the possible variation and increase the probability of random convergence, producing similar calls in different populations.

5. EXTERIOR OF SOUTH END OF HOUSE SHOWING OPEN DOOR ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

5. EXTERIOR OF SOUTH END OF HOUSE SHOWING OPEN DOOR TO BASEMENT BELOW KITCHEN, ORIGINAL PAIRED WOODFRAMED SLIDING-GLASS WINDOWS ON KITCHEN WALL AND 1LIGHT OVER 1-LIGHT DOUBLE-HUNG WINDOW ON STORM PORCH ADDITION. VIEW TO WEST. - Rush Creek Hydroelectric System, Clubhouse Cottage, Rush Creek, June Lake, Mono County, CA

Conceptual Framework for Parametrically Measuring the Desirability of Open Educational Resources Using D-Index

ERIC Educational Resources Information Center

Abeywardena, Ishan Sudeera; Tham, Choy Yoong; Raviraja, S.

2012-01-01

Open educational resources (OER) are a global phenomenon that is fast gaining credibility in many academic circles as a possible solution for bridging the knowledge divide. With increased funding and advocacy from governmental and nongovernmental organisations paired with generous philanthropy, many OER repositories, which host a vast array of…

30 CFR 57.22213 - Air flow (III mines).

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Air flow (III mines). 57.22213 Section 57.22213... Methane in Metal and Nonmetal Mines Ventilation § 57.22213 Air flow (III mines). The quantity of air coursed through the last open crosscut in pairs or sets of entries, or through other ventilation openings...

Open Markov Processes and Reaction Networks

ERIC Educational Resources Information Center

Swistock Pollard, Blake Stephen

2017-01-01

We begin by defining the concept of "open" Markov processes, which are continuous-time Markov chains where probability can flow in and out through certain "boundary" states. We study open Markov processes which in the absence of such boundary flows admit equilibrium states satisfying detailed balance, meaning that the net flow…

The Origin of Complex Quantum Amplitudes

NASA Astrophysics Data System (ADS)

Goyal, Philip; Knuth, Kevin H.; Skilling, John

2009-12-01

Physics is real. Measurement produces real numbers. Yet quantum mechanics uses complex arithmetic, in which √-1 is necessary but mysteriously relates to nothing else. By applying the same sort of symmetry arguments that Cox [1, 2] used to justify probability calculus, we are now able to explain this puzzle. The dual device/object nature of observation requires us to describe the world in terms of pairs of real numbers about which we never have full knowledge. These pairs combine according to complex arithmetic, using Feynman's rules.

DNA dynamics in aqueous solution: opening the double helix

NASA Technical Reports Server (NTRS)

Pohorille, A.; Ross, W. S.; Tinoco, I. Jr; MacElroy, R. D. (Principal Investigator)

1990-01-01

The opening of a DNA base pair is a simple reaction that is a prerequisite for replication, transcription, and other vital biological functions. Understanding the molecular mechanisms of biological reactions is crucial for predicting and, ultimately, controlling them. Realistic computer simulations of the reactions can provide the needed understanding. To model even the simplest reaction in aqueous solution requires hundreds of hours of supercomputing time. We have used molecular dynamics techniques to simulate fraying of the ends of a six base pair double strand of DNA, [TCGCGA]2, where the four bases of DNA are denoted by T (thymine), C (cytosine), G (guanine), and A (adenine), and to estimate the free energy barrier to this process. The calculations, in which the DNA was surrounded by 2,594 water molecules, required 50 hours of CRAY-2 CPU time for every simulated 100 picoseconds. A free energy barrier to fraying, which is mainly characterized by the movement of adenine away from thymine into aqueous environment, was estimated to be 4 kcal/mol. Another fraying pathway, which leads to stacking between terminal adenine and thymine, was also observed. These detailed pictures of the motions and energetics of DNA base pair opening in water are a first step toward understanding how DNA will interact with any molecule.

Plasmonic Landau damping in active environments

NASA Astrophysics Data System (ADS)

Thakkar, Niket; Montoni, Nicholas P.; Cherqui, Charles; Masiello, David J.

2018-03-01

Optical manipulation of charge on the nanoscale is of fundamental importance to an array of proposed technologies from selective photocatalysis to nanophotonics. Open plasmonic systems where collective electron oscillations release energy and charge to their environments offer a potential means to this end as plasmons can rapidly decay into energetic electron-hole pairs; however, isolating this decay from other plasmon-environment interactions remains a challenge. Here we present an analytic theory of noble-metal nanoparticles that quantitatively models plasmon decay into electron-hole pairs, demonstrates that this decay depends significantly on the nanoparticle's dielectric environment, and disentangles this effect from competing decay pathways. Using our approach to incorporate embedding material and substrate effects on plasmon-electron interaction, we show that predictions from the model agree with four separate experiments. Finally, examination of coupled nanoparticle-emitter systems further shows that the hybridized in-phase mode more efficiently decays to photons whereas the out-of-phase mode more efficiently decays to electron-hole pairs, offering a strategy to tailor open plasmonic systems for charge manipulation.

Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

PubMed Central

Jarausch, W; Saillard, C; Dosba, F; Bové, J M

1994-01-01

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

Secondary structure of the 3'-noncoding region of flavivirus genomes: comparative analysis of base pairing probabilities.

PubMed

Rauscher, S; Flamm, C; Mandl, C W; Heinz, F X; Stadler, P F

1997-07-01

The prediction of the complete matrix of base pairing probabilities was applied to the 3' noncoding region (NCR) of flavivirus genomes. This approach identifies not only well-defined secondary structure elements, but also regions of high structural flexibility. Flaviviruses, many of which are important human pathogens, have a common genomic organization, but exhibit a significant degree of RNA sequence diversity in the functionally important 3'-NCR. We demonstrate the presence of secondary structures shared by all flaviviruses, as well as structural features that are characteristic for groups of viruses within the genus reflecting the established classification scheme. The significance of most of the predicted structures is corroborated by compensatory mutations. The availability of infectious clones for several flaviviruses will allow the assessment of these structural elements in processes of the viral life cycle, such as replication and assembly.

The ambivalent effect of lattice structure on a spatial game

NASA Astrophysics Data System (ADS)

Zhang, Hui; Gao, Meng; Li, Zizhen; Maa, Zhihui; Wang, Hailong

2011-06-01

The evolution of cooperation is studied in lattice-structured populations, in which each individual who adopts one of the following strategies ‘always defect' (ALLD), ‘tit-for-tat' (TFT), and ‘always cooperate' (ALLC) plays the repeated Prisoner's Dilemma game with its neighbors according to an asynchronous update rule. Computer simulations are applied to analyse the dynamics depending on major parameters. Mathematical analyses based on invasion probability analysis, mean-field approximation, as well as pair approximation are also used. We find that the lattice structure promotes the evolution of cooperation compared with a non-spatial population, this is also confirmed by invasion probability analysis in one dimension. Meanwhile, it also inhibits the evolution of cooperation due to the advantage of being spiteful, which indicates the key role of specific life-history assumptions. Mean-field approximation fails to predict the outcome of computer simulations. Pair approximation is accurate in two dimensions but fails in one dimension.

Modelling human mobility patterns using photographic data shared online.

PubMed

Barchiesi, Daniele; Preis, Tobias; Bishop, Steven; Moat, Helen Susannah

2015-08-01

Humans are inherently mobile creatures. The way we move around our environment has consequences for a wide range of problems, including the design of efficient transportation systems and the planning of urban areas. Here, we gather data about the position in space and time of about 16 000 individuals who uploaded geo-tagged images from locations within the UK to the Flickr photo-sharing website. Inspired by the theory of Lévy flights, which has previously been used to describe the statistical properties of human mobility, we design a machine learning algorithm to infer the probability of finding people in geographical locations and the probability of movement between pairs of locations. Our findings are in general agreement with official figures in the UK and on travel flows between pairs of major cities, suggesting that online data sources may be used to quantify and model large-scale human mobility patterns.

Modelling human mobility patterns using photographic data shared online

PubMed Central

Barchiesi, Daniele; Preis, Tobias; Bishop, Steven; Moat, Helen Susannah

2015-01-01

Humans are inherently mobile creatures. The way we move around our environment has consequences for a wide range of problems, including the design of efficient transportation systems and the planning of urban areas. Here, we gather data about the position in space and time of about 16 000 individuals who uploaded geo-tagged images from locations within the UK to the Flickr photo-sharing website. Inspired by the theory of Lévy flights, which has previously been used to describe the statistical properties of human mobility, we design a machine learning algorithm to infer the probability of finding people in geographical locations and the probability of movement between pairs of locations. Our findings are in general agreement with official figures in the UK and on travel flows between pairs of major cities, suggesting that online data sources may be used to quantify and model large-scale human mobility patterns. PMID:26361545

Upper bounds on the error probabilities and asymptotic error exponents in quantum multiple state discrimination

NASA Astrophysics Data System (ADS)

Audenaert, Koenraad M. R.; Mosonyi, Milán

2014-10-01

We consider the multiple hypothesis testing problem for symmetric quantum state discrimination between r given states σ1, …, σr. By splitting up the overall test into multiple binary tests in various ways we obtain a number of upper bounds on the optimal error probability in terms of the binary error probabilities. These upper bounds allow us to deduce various bounds on the asymptotic error rate, for which it has been hypothesized that it is given by the multi-hypothesis quantum Chernoff bound (or Chernoff divergence) C(σ1, …, σr), as recently introduced by Nussbaum and Szkoła in analogy with Salikhov's classical multi-hypothesis Chernoff bound. This quantity is defined as the minimum of the pairwise binary Chernoff divergences min _{j

Tracking the coherent generation of polaron pairs in conjugated polymers

NASA Astrophysics Data System (ADS)

de Sio, Antonietta; Troiani, Filippo; Maiuri, Margherita; Réhault, Julien; Sommer, Ephraim; Lim, James; Huelga, Susana F.; Plenio, Martin B.; Rozzi, Carlo Andrea; Cerullo, Giulio; Molinari, Elisa; Lienau, Christoph

2016-12-01

The optical excitation of organic semiconductors not only generates charge-neutral electron-hole pairs (excitons), but also charge-separated polaron pairs with high yield. The microscopic mechanisms underlying this charge separation have been debated for many years. Here we use ultrafast two-dimensional electronic spectroscopy to study the dynamics of polaron pair formation in a prototypical polymer thin film on a sub-20-fs time scale. We observe multi-period peak oscillations persisting for up to about 1 ps as distinct signatures of vibronic quantum coherence at room temperature. The measured two-dimensional spectra show pronounced peak splittings revealing that the elementary optical excitations of this polymer are hybridized exciton-polaron-pairs, strongly coupled to a dominant underdamped vibrational mode. Coherent vibronic coupling induces ultrafast polaron pair formation, accelerates the charge separation dynamics and makes it insensitive to disorder. These findings open up new perspectives for tailoring light-to-current conversion in organic materials.

Computing under-ice discharge: A proof-of-concept using hydroacoustics and the Probability Concept

NASA Astrophysics Data System (ADS)

Fulton, John W.; Henneberg, Mark F.; Mills, Taylor J.; Kohn, Michael S.; Epstein, Brian; Hittle, Elizabeth A.; Damschen, William C.; Laveau, Christopher D.; Lambrecht, Jason M.; Farmer, William H.

2018-07-01

Under-ice discharge is estimated using open-water reference hydrographs; however, the ratings for ice-affected sites are generally qualified as poor. The U.S. Geological Survey (USGS), in collaboration with the Colorado Water Conservation Board, conducted a proof-of-concept to develop an alternative method for computing under-ice discharge using hydroacoustics and the Probability Concept. The study site was located south of Minturn, Colorado (CO), USA, and was selected because of (1) its proximity to the existing USGS streamgage 09064600 Eagle River near Minturn, CO, and (2) its ease-of-access to verify discharge using a variety of conventional methods. From late September 2014 to early March 2015, hydraulic conditions varied from open water to under ice. These temporal changes led to variations in water depth and velocity. Hydroacoustics (tethered and uplooking acoustic Doppler current profilers and acoustic Doppler velocimeters) were deployed to measure the vertical-velocity profile at a singularly important vertical of the channel-cross section. Because the velocity profile was non-standard and cannot be characterized using a Power Law or Log Law, velocity data were analyzed using the Probability Concept, which is a probabilistic formulation of the velocity distribution. The Probability Concept-derived discharge was compared to conventional methods including stage-discharge and index-velocity ratings and concurrent field measurements; each is complicated by the dynamics of ice formation, pressure influences on stage measurements, and variations in cross-sectional area due to ice formation. No particular discharge method was assigned as truth. Rather one statistical metric (Kolmogorov-Smirnov; KS), agreement plots, and concurrent measurements provided a measure of comparability between various methods. Regardless of the method employed, comparisons between each method revealed encouraging results depending on the flow conditions and the absence or presence of ice cover. For example, during lower discharges dominated by under-ice and transition (intermittent open-water and under-ice) conditions, the KS metric suggests there is not sufficient information to reject the null hypothesis and implies that the Probability Concept and index-velocity rating represent similar distributions. During high-flow, open-water conditions, the comparisons are less definitive; therefore, it is important that the appropriate analytical method and instrumentation be selected. Six conventional discharge measurements were collected concurrently with Probability Concept-derived discharges with percent differences (%) of -9.0%, -21%, -8.6%, 17.8%, 3.6%, and -2.3%. This proof-of-concept demonstrates that riverine discharges can be computed using the Probability Concept for a range of hydraulic extremes (variations in discharge, open-water and under-ice conditions) immediately after the siting phase is complete, which typically requires one day. Computing real-time discharges is particularly important at sites, where (1) new streamgages are planned, (2) river hydraulics are complex, and (3) shifts in the stage-discharge rating are needed to correct the streamflow record. Use of the Probability Concept does not preclude the need to maintain a stage-area relation. Both the Probability Concept and index-velocity rating offer water-resource managers and decision makers alternatives for computing real-time discharge for open-water and under-ice conditions.

Computing under-ice discharge: A proof-of-concept using hydroacoustics and the Probability Concept

USGS Publications Warehouse

Fulton, John W.; Henneberg, Mark F.; Mills, Taylor J.; Kohn, Michael S.; Epstein, Brian; Hittle, Elizabeth A.; Damschen, William C.; Laveau, Christopher D.; Lambrecht, Jason M.; Farmer, William H.

2018-01-01

Under-ice discharge is estimated using open-water reference hydrographs; however, the ratings for ice-affected sites are generally qualified as poor. The U.S. Geological Survey (USGS), in collaboration with the Colorado Water Conservation Board, conducted a proof-of-concept to develop an alternative method for computing under-ice discharge using hydroacoustics and the Probability Concept.The study site was located south of Minturn, Colorado (CO), USA, and was selected because of (1) its proximity to the existing USGS streamgage 09064600 Eagle River near Minturn, CO, and (2) its ease-of-access to verify discharge using a variety of conventional methods. From late September 2014 to early March 2015, hydraulic conditions varied from open water to under ice. These temporal changes led to variations in water depth and velocity. Hydroacoustics (tethered and uplooking acoustic Doppler current profilers and acoustic Doppler velocimeters) were deployed to measure the vertical-velocity profile at a singularly important vertical of the channel-cross section. Because the velocity profile was non-standard and cannot be characterized using a Power Law or Log Law, velocity data were analyzed using the Probability Concept, which is a probabilistic formulation of the velocity distribution. The Probability Concept-derived discharge was compared to conventional methods including stage-discharge and index-velocity ratings and concurrent field measurements; each is complicated by the dynamics of ice formation, pressure influences on stage measurements, and variations in cross-sectional area due to ice formation.No particular discharge method was assigned as truth. Rather one statistical metric (Kolmogorov-Smirnov; KS), agreement plots, and concurrent measurements provided a measure of comparability between various methods. Regardless of the method employed, comparisons between each method revealed encouraging results depending on the flow conditions and the absence or presence of ice cover.For example, during lower discharges dominated by under-ice and transition (intermittent open-water and under-ice) conditions, the KS metric suggests there is not sufficient information to reject the null hypothesis and implies that the Probability Concept and index-velocity rating represent similar distributions. During high-flow, open-water conditions, the comparisons are less definitive; therefore, it is important that the appropriate analytical method and instrumentation be selected. Six conventional discharge measurements were collected concurrently with Probability Concept-derived discharges with percent differences (%) of −9.0%, −21%, −8.6%, 17.8%, 3.6%, and −2.3%.This proof-of-concept demonstrates that riverine discharges can be computed using the Probability Concept for a range of hydraulic extremes (variations in discharge, open-water and under-ice conditions) immediately after the siting phase is complete, which typically requires one day. Computing real-time discharges is particularly important at sites, where (1) new streamgages are planned, (2) river hydraulics are complex, and (3) shifts in the stage-discharge rating are needed to correct the streamflow record. Use of the Probability Concept does not preclude the need to maintain a stage-area relation. Both the Probability Concept and index-velocity rating offer water-resource managers and decision makers alternatives for computing real-time discharge for open-water and under-ice conditions.

Individualized Levels System and Systematic Stimulus Pairing to Reduce Multiply Controlled Aggression of a Child With Autism Spectrum Disorder.

PubMed

Randall, Kayla R; Lambert, Joseph M; Matthews, Mary P; Houchins-Juarez, Nealetta J

2018-05-01

Research has shown that physical aggression is common in individuals with autism spectrum disorder (ASD). Interventions for multiply controlled aggression may be complex and difficult to implement with fidelity. As a result, the probability of treatment efficacy for this class of behavior may suffer. We designed an individualized levels system to reduce the physical aggression of an 11-year-old female with ASD. We then employed a systematic stimulus pairing procedure to facilitate generalization. Results suggest individualized levels systems can suppress multiply controlled aggression and that systematic stimulus pairing is an effective way to transfer treatment effects from trained therapists to caregivers.

Single-Pixel Optical Fluctuation Analysis of Calcium Channel Function in Active Zones of Motor Nerve Terminals

PubMed Central

Luo, Fujun; Dittrich, Markus; Stiles, Joel R.; Meriney, Stephen D.

2011-01-01

We used high-resolution fluorescence imaging and single-pixel optical fluctuation analysis to estimate the opening probability of individual voltage-gated calcium (Ca2+) channels during an action potential and the number of such Ca2+ channels within active zones of frog neuromuscular junctions. Analysis revealed ~36 Ca2+ channels within each active zone, similar to the number of docked synaptic vesicles but far less than the total number of transmembrane particles reported based on freeze-fracture analysis (~200–250). The probability that each channel opened during an action potential was only ~0.2. These results suggest why each active zone averages only one quantal release event during every other action potential, despite a substantial number of docked vesicles. With sparse Ca2+ channels and low opening probability, triggering of fusion for each vesicle is primarily controlled by Ca2+ influx through individual Ca2+ channels. In contrast, the entire synapse is highly reliable because it contains hundreds of active zones. PMID:21813687

Comprehensive Assessment of Models and Events based on Library tools (CAMEL)

NASA Astrophysics Data System (ADS)

Rastaetter, L.; Boblitt, J. M.; DeZeeuw, D.; Mays, M. L.; Kuznetsova, M. M.; Wiegand, C.

2017-12-01

At the Community Coordinated Modeling Center (CCMC), the assessment of modeling skill using a library of model-data comparison metrics is taken to the next level by fully integrating the ability to request a series of runs with the same model parameters for a list of events. The CAMEL framework initiates and runs a series of selected, pre-defined simulation settings for participating models (e.g., WSA-ENLIL, SWMF-SC+IH for the heliosphere, SWMF-GM, OpenGGCM, LFM, GUMICS for the magnetosphere) and performs post-processing using existing tools for a host of different output parameters. The framework compares the resulting time series data with respective observational data and computes a suite of metrics such as Prediction Efficiency, Root Mean Square Error, Probability of Detection, Probability of False Detection, Heidke Skill Score for each model-data pair. The system then plots scores by event and aggregated over all events for all participating models and run settings. We are building on past experiences with model-data comparisons of magnetosphere and ionosphere model outputs in GEM2008, GEM-CEDAR CETI2010 and Operational Space Weather Model challenges (2010-2013). We can apply the framework also to solar-heliosphere as well as radiation belt models. The CAMEL framework takes advantage of model simulations described with Space Physics Archive Search and Extract (SPASE) metadata and a database backend design developed for a next-generation Run-on-Request system at the CCMC.

Implications of fault constitutive properties for earthquake prediction

USGS Publications Warehouse

Dieterich, J.H.; Kilgore, B.

1996-01-01

The rate- and state-dependent constitutive formulation for fault slip characterizes an exceptional variety of materials over a wide range of sliding conditions. This formulation provides a unified representation of diverse sliding phenomena including slip weakening over a characteristic sliding distance D(c), apparent fracture energy at a rupture front, time- dependent healing after rapid slip, and various other transient and slip rate effects. Laboratory observations and theoretical models both indicate that earthquake nucleation is accompanied by long intervals of accelerating slip. Strains from the nucleation process on buried faults generally could not be detected if laboratory values of D, apply to faults in nature. However, scaling of D(c) is presently an open question and the possibility exists that measurable premonitory creep may precede some earthquakes. Earthquake activity is modeled as a sequence of earthquake nucleation events. In this model, earthquake clustering arises from sensitivity of nucleation times to the stress changes induced by prior earthquakes. The model gives the characteristic Omori aftershock decay law and assigns physical interpretation to aftershock parameters. The seismicity formulation predicts large changes of earthquake probabilities result from stress changes. Two mechanisms for foreshocks are proposed that describe observed frequency of occurrence of foreshock-mainshock pairs by time and magnitude. With the first mechanism, foreshocks represent a manifestation of earthquake clustering in which the stress change at the time of the foreshock increases the probability of earthquakes at all magnitudes including the eventual mainshock. With the second model, accelerating fault slip on the mainshock nucleation zone triggers foreshocks.

Implications of fault constitutive properties for earthquake prediction.

PubMed

Dieterich, J H; Kilgore, B

1996-04-30

The rate- and state-dependent constitutive formulation for fault slip characterizes an exceptional variety of materials over a wide range of sliding conditions. This formulation provides a unified representation of diverse sliding phenomena including slip weakening over a characteristic sliding distance Dc, apparent fracture energy at a rupture front, time-dependent healing after rapid slip, and various other transient and slip rate effects. Laboratory observations and theoretical models both indicate that earthquake nucleation is accompanied by long intervals of accelerating slip. Strains from the nucleation process on buried faults generally could not be detected if laboratory values of Dc apply to faults in nature. However, scaling of Dc is presently an open question and the possibility exists that measurable premonitory creep may precede some earthquakes. Earthquake activity is modeled as a sequence of earthquake nucleation events. In this model, earthquake clustering arises from sensitivity of nucleation times to the stress changes induced by prior earthquakes. The model gives the characteristic Omori aftershock decay law and assigns physical interpretation to aftershock parameters. The seismicity formulation predicts large changes of earthquake probabilities result from stress changes. Two mechanisms for foreshocks are proposed that describe observed frequency of occurrence of foreshock-mainshock pairs by time and magnitude. With the first mechanism, foreshocks represent a manifestation of earthquake clustering in which the stress change at the time of the foreshock increases the probability of earthquakes at all magnitudes including the eventual mainshock. With the second model, accelerating fault slip on the mainshock nucleation zone triggers foreshocks.

Dropout rates in medical students at one school before and after the installation of admission tests in Austria.

PubMed

Reibnegger, Gilbert; Caluba, Hans-Christian; Ithaler, Daniel; Manhal, Simone; Neges, Heide Maria; Smolle, Josef

2011-08-01

Admission to medical studies in Austria since academic year 2005-2006 has been regulated by admission tests. At the Medical University of Graz, an admission test focusing on secondary-school-level knowledge in natural sciences has been used for this purpose. The impact of this important change on dropout rates of female versus male students and older versus younger students is reported. All 2,860 students admitted to the human medicine diploma program at the Medical University of Graz from academic years 2002-2003 to 2008-2009 were included. Nonparametric and semiparametric survival analysis techniques were employed to compare cumulative probability of dropout between demographic groups. Cumulative probability of dropout was significantly reduced in students selected by active admission procedure versus those admitted openly (P < .0001). Relative hazard ratio of selected versus openly admitted students was only 0.145 (95% CI, 0.106-0.198). Among openly admitted students, but not for selected ones, the cumulative probabilities for dropout were higher for females (P < .0001) and for older students (P < .0001). Generally, dropout hazard is highest during the second year of study. The introduction of admission testing significantly decreased the cumulative probability for dropout. In openly admitted students a significantly higher risk for dropout was found in female students and in older students, whereas no such effects can be detected after admission testing. Future research should focus on the sex dependence, with the aim of improving success rates among female applicants on the admission tests.

Conservation of an Intact vif Gene of Human Immunodeficiency Virus Type 1 during Maternal-Fetal Transmission

PubMed Central

Yedavalli, Venkat R. K.; Chappey, Colombe; Matala, Erik; Ahmad, Nafees

1998-01-01

The human immunodeficiency virus type 1 (HIV-1) vif gene is conserved among most lentiviruses, suggesting that vif is important for natural infection. To determine whether an intact vif gene is positively selected during mother-to-infant transmission, we analyzed vif sequences from five infected mother-infant pairs following perinatal transmission. The coding potential of the vif open reading frame directly derived from uncultured peripheral blood mononuclear cell DNA was maintained in most of the 78,912 bp sequenced. We found that 123 of the 137 clones analyzed showed an 89.8% frequency of intact vif open reading frames. There was a low degree of heterogeneity of vif genes within mothers, within infants, and between epidemiologically linked mother-infant pairs. The distances between vif sequences were greater in epidemiologically unlinked individuals than in epidemiologically linked mother-infant pairs. Furthermore, the epidemiologically linked mother-infant pair vif sequences displayed similar patterns that were not seen in vif sequences from epidemiologically unlinked individuals. The functional domains, including the two cysteines at positions 114 and 133, a serine phosphorylation site at position 144, and the C-terminal basic amino acids essential for vif protein function, were highly conserved in most of the sequences. Phylogenetic analyses of 137 mother-infant pair vif sequences and 187 other available vif sequences from HIV-1 databases revealed distinct clusters for vif sequences from each mother-infant pair and for other vif sequences. Taken together, these findings suggest that vif plays an important role in HIV-1 infection and replication in mothers and their perinatally infected infants. PMID:9445004

Academic achievement of twins and singletons in early adulthood: Taiwanese cohort study.

PubMed

Tsou, Meng-Ting; Tsou, Meng-Wen; Wu, Ming-Ping; Liu, Jin-Tan

2008-07-21

To examine the long term effects of low birth weight on academic achievements in twins and singletons and to determine whether the academic achievement of twins in early adulthood is inferior to that of singletons. Cohort study. Taiwanese nationwide register of academic outcome. A cohort of 218 972 singletons and 1687 twins born in Taiwan, 1983-5. College attendance and test scores in the college joint entrance examinations. After adjustment for birth weight, gestational age, birth order, and sex and the sociodemographic characteristics of the parents, twins were found to have significantly lower mean test scores than singletons in Chinese, mathematics, and natural science, as well as a 2.2% lower probability of attending college. Low birthweight twins had an 8.5% lower probability of college attendance than normal weight twins, while low birthweight singletons had only a 3.2% lower probability. The negative effects of low birth weight on the test scores in English and mathematics were substantially greater for twins than for singletons. The twin pair analysis showed that the association between birth weight and academic achievement scores, which existed for opposite sex twin pairs, was not discernible for same sex twin pairs, indicating that birth weight might partly reflect other underlying genetic variations. These data support the proposition that twins perform less well academically than singletons. Low birth weight has a negative association with subsequent academic achievement in early adulthood, with the effect being stronger for twins than for singletons. The association between birth weight and academic performance might be partly attributable to genetic factors.

A compositional framework for Markov processes

NASA Astrophysics Data System (ADS)

Baez, John C.; Fong, Brendan; Pollard, Blake S.

2016-03-01

We define the concept of an "open" Markov process, or more precisely, continuous-time Markov chain, which is one where probability can flow in or out of certain states called "inputs" and "outputs." One can build up a Markov process from smaller open pieces. This process is formalized by making open Markov processes into the morphisms of a dagger compact category. We show that the behavior of a detailed balanced open Markov process is determined by a principle of minimum dissipation, closely related to Prigogine's principle of minimum entropy production. Using this fact, we set up a functor mapping open detailed balanced Markov processes to open circuits made of linear resistors. We also describe how to "black box" an open Markov process, obtaining the linear relation between input and output data that holds in any steady state, including nonequilibrium steady states with a nonzero flow of probability through the system. We prove that black boxing gives a symmetric monoidal dagger functor sending open detailed balanced Markov processes to Lagrangian relations between symplectic vector spaces. This allows us to compute the steady state behavior of an open detailed balanced Markov process from the behaviors of smaller pieces from which it is built. We relate this black box functor to a previously constructed black box functor for circuits.

Evolution from BCS superconductivity to Bose condensation: Calculation of the zero-temperature phase coherence length

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pistolesi, F.; Strinati, G.C.

1996-06-01

We consider a fermionic system at zero temperature interacting through an effective nonretarded potential of the type introduced by Nozi{grave e}res and Schmitt-Rink, and calculate the {ital phase} coherence length {xi}{sub phase} (associated with the spatial fluctuations of the superconducting order parameter) by exploiting a functional-integral formulation for the correlation functions and the associated loop expansion. This formulation is especially suited to follow the evolution of the fermionic system from a BCS-type superconductor for weak coupling to a Bose-condensed system for strong coupling, since in the latter limit a {ital direct} mapping of the original fermionic system onto an effectivemore » system of bosons with a residual boson-boson interaction can be established. Explicit calculations are performed at the one-loop order. The phase coherence length {xi}{sub phase} is compared with the coherence length {xi}{sub pair} for two-electron correlation, which is relevant to distinguish the weak- ({ital k}{sub {ital F}}{xi}{sub pair}{gt}1) from the strong- ({ital k}{sub {ital F}}{xi}{sub pair}{lt}1) coupling limits ({ital k}{sub {ital F}} being the Fermi wave vector) {ital as} {ital well} {ital as} to follow the crossover in between. It is shown that {xi}{sub phase} coincides with {xi}{sub pair} down to {ital k}{sub {ital F}}{xi}{sub pair}{approx_equal}10, {xi}{sub pair} in turn coinciding with the Pippard coherence length. In the strong-coupling limit we find instead that {xi}{sub phase}{gt}{xi}{sub pair}, with {xi}{sub pair} coinciding with the radius of the bound-electron pair. From the mapping onto an effective system of bosons in the strong-coupling limit we further relate {xi}{sub pair} with the {open_quote}{open_quote}range{close_quote}{close_quote} of the residual boson-boson interaction, which is physically the only significant length associated with the dynamics of the bosonic system. {copyright} {ital 1996 The American Physical Society.}« less

Microgravity and Charge Transfer in the Neuronal Membrane: Implications for Computational Neurobiology

NASA Technical Reports Server (NTRS)

Wallace, Ron

1995-01-01

Evidence from natural and artificial membranes indicates that the neural membrane is a liquid crystal. A liquid-to-gel phase transition caused by the application of superposed electromagnetic fields to the outer membrane surface releases spin-correlated electron pairs which propagate through a charge transfer complex. The propagation generates Rydberg atoms in the lipid bilayer lattice. In the present model, charge density configurations in promoted orbitals interact as cellular automata and perform computations in Hilbert space. Due to the small binding energies of promoted orbitals, their automata are highly sensitive to microgravitational perturbations. It is proposed that spacetime is classical on the Rydberg scale, but formed of contiguous moving segments, each of which displays topological equivalence. This stochasticity is reflected in randomized Riemannian tensor values. Spacetime segments interact with charge automata as components of a computational process. At the termination of the algorithm, an orbital of high probability density is embedded in a more stabilized microscopic spacetime. This state permits the opening of an ion channel and the conversion of a quantum algorithm into a macroscopic frequency code.

[An image of Saint Ottilia with reading stones].

PubMed

Daxecker, F; Broucek, A

1995-01-01

Reading stones to facilitate reading in cases of presbyopia are mentioned in the literature, for example in the works of the Middle High German poet Albrecht and of Konrad of Würzburg. Most representations of the abbess, Saint Ottilia, show her holding a book with a pair of eyes in her hands. A gothic altarpiece (1485-1490), kept in the museum of the Premonstratensian Canons of Wilten in Innsbruck, Tyrol, shows a triune representation of St. Anne, the mother of the Virgin, with Mary and Jesus and St. Ursula with her companions. St. Ottilia is depicted on the edge of the painting. Two lenses, one on either side of the open book in her hand, magnify the letters underneath. As the two lenses are not held together by bows or similar devices, they are probably a rare representation of reading stones. The alter showing scenes of the life of St. Mary and St. Ursula was done by Ludwig Konraiter. A panel on the same alter, depicting the death of the Virgin, shows an apostle with rivet spectacles.

Integrating Physical and Topographic Information Into a Fuzzy Scheme to Map Flooded Area by SAR.

PubMed

Pierdicca, Nazzareno; Chini, Marco; Pulvirenti, Luca; Macina, Flavia

2008-07-10

A flood mapping procedure based on a fuzzy sets theory has been developed. The method is based on the integration of Synthetic Aperture Radar (SAR) measurements with additional data on the inundated area, such as a land cover map and a digital elevation model (DEM). The information on land cover has allowed us to account for both specular reflection, typical of open water, and double bounce backscattering, typical of forested and urban areas. DEM has been exploited to include simple hydraulic considerations on the dependence of inundation probability on surface characteristics. Contextual information has been taken into account too. The proposed algorithm has been tested on a flood occurred in Italy on November 1994. A pair of ERS-1 images, collected before and after (three days later) the flood, has been used. The results have been compared with the data provided by a ground survey carried out when the flood reached its maximum extension. Despite the temporal mismatch between the survey and the post-inundation SAR image, the comparison has yielded encouraging results, with the 87% of the pixels correctly classified as inundated.

A three-state kinetic agent-based model to analyze tax evasion dynamics

NASA Astrophysics Data System (ADS)

Crokidakis, Nuno

2014-11-01

In this work we study the problem of tax evasion on a fully-connected population. For this purpose, we consider that the agents may be in three different states, namely honest tax payers, tax evaders and undecided, that are individuals in an intermediate class among honests and evaders. Every individual can change his/her state following a kinetic exchange opinion dynamics, where the agents interact by pairs with competitive negative (with probability q) and positive (with probability 1-q) couplings, representing agreement/disagreement between pairs of agents. In addition, we consider the punishment rules of the Zaklan econophysics model, for which there is a probability pa of an audit each agent is subject to in every period and a length of time k detected tax evaders remain honest. Our results suggest that below the critical point qc=1/4 of the opinion dynamics the compliance is high, and the punishment rules have a small effect in the population. On the other hand, for q>qc the tax evasion can be considerably reduced by the enforcement mechanism. We also discuss the impact of the presence of the undecided agents in the evolution of the system.

Nuclear p ⊥-broadening of an energetic parton pair

NASA Astrophysics Data System (ADS)

Cougoulic, Florian; Peigné, Stéphane

2018-05-01

We revisit the transverse momentum broadening of a fast parton pair crossing a nuclear medium, putting emphasis on the pair global color state, for any number of colors N and within the eikonal limit for parton propagation and the Gaussian approximation for the gluon field of the target. The pair transverse momentum probability distribution is derived in a kinetic equation approach, and is determined by an operator ℬ describing the possible transitions between the pair color states when crossing the medium. The exponential of ℬ encompasses the 4-point correlators of Wilson lines in the saturation formalism. We emphasize the relation of ℬ with the anomalous dimension matrices appearing in the study of soft gluon radiation associated to hard 2 → 2 partonic processes. In a well-chosen, orthonormal basis of the pair color states, we rederive ℬ for any type of parton pair, making maximal use of SU( N) invariants and using `birdtrack' color pictorial notations, providing a quite economical derivation of all previously known 4-point correlators (or equivalently, anomalous dimension matrices for 2 → 2 parton scattering). We discuss some general features of the pair transverse momentum distribution. The latter simplifies in the `compact pair expansion' which singles out the global charges (Casimirs) of the pair color states. This study should provide the necessary tools to address nuclear broadening of n-parton systems in phenomenology while highlighting the color structure of the process.

The interval between cancer diagnosis among mothers and offspring in a population-based cohort.

PubMed

Paltiel, Ora; Friedlander, Yehiel; Deutsch, Lisa; Yanetz, Rebecca; Calderon-Margalit, Ronit; Tiram, Efrat; Hochner, Hagit; Barchana, Micha; Harlap, Susan; Manor, Orly

2007-01-01

Familial cancers may be due to shared genes or environment, or chance aggregation. We explored the possibility that ascertainment bias influences cancer detection in families, bearing upon the time interval between diagnosis of affected mothers and offspring. The Jerusalem Perinatal Study (JPS) comprises all mothers (n = 39,734) from Western Jerusalem who gave birth 1964 -1976 and their offspring (n = 88,829). After linking identification numbers with Israel's Cancer Registry we measured the absolute time interval between initial cancer diagnoses in affected mother-offspring pairs. We tested the probability of obtaining intervals as short as those observed by chance alone, using a permutation test on the median interval. By June 2003 cancer had developed in 105 mother-offspring pairs within the cohort. Common sites among mothers were breast (47%), colorectal (9%), non-Hodgkin lymphoma (NHL) (8%) and cervix (7%), while for offspring in affected pairs common cancers were leukemia (12.4%), thyroid (13.3%), NHL (10.5%), breast (10.5%) and melanoma (7.6%). The median interval between diagnoses was 5.9 years, but for 33% of affected pairs the interval was < or =3 years. The probability of this occurring by chance alone was 0.03. This held true whether the offspring's or mother's diagnosis was first (P < 0.01). In a population-based cohort followed for three decades, the absolute interval between the diagnosis of cancer in mothers and their offspring is shorter than expected by chance. Explanations include shared environmental exposures or the possibility that cancer ascertainment in one pair member affects health behaviors in the other resulting in early diagnosis. The latter may bias the estimation of anticipation and survival in familial cancers.

Informing disease models with temporal and spatial contact structure among GPS-collared individuals in wild populations.

PubMed

Williams, David M; Dechen Quinn, Amy C; Porter, William F

2014-01-01

Contacts between hosts are essential for transmission of many infectious agents. Understanding how contacts, and thus transmission rates, occur in space and time is critical to effectively responding to disease outbreaks in free-ranging animal populations. Contacts between animals in the wild are often difficult to observe or measure directly. Instead, one must infer contacts from metrics such as proximity in space and time. Our objective was to examine how contacts between white-tailed deer (Odocoileus virginianus) vary in space and among seasons. We used GPS movement data from 71 deer in central New York State to quantify potential direct contacts between deer and indirect overlap in space use across time and space. Daily probabilities of direct contact decreased from winter (0.05-0.14), to low levels post-parturition through summer (0.00-0.02), and increased during the rut to winter levels. The cumulative distribution for the spatial structure of direct and indirect contact probabilities around a hypothetical point of occurrence increased rapidly with distance for deer pairs separated by 1,000 m-7,000 m. Ninety-five percent of the probabilities of direct contact occurred among deer pairs within 8,500 m of one another, and 99% within 10,900 m. Probabilities of indirect contact accumulated across greater spatial extents: 95% at 11,900 m and 99% at 49,000 m. Contacts were spatially consistent across seasons, indicating that although contact rates differ seasonally, they occur proportionally across similar landscape extents. Distributions of contact probabilities across space can inform management decisions for assessing risk and allocating resources in response.

Isoscalar neutron-proton pairing and SU(4)-symmetry breaking in Gamow-Teller transitions

NASA Astrophysics Data System (ADS)

Kaneko, K.; Sun, Y.; Mizusaki, T.

2018-05-01

The isoscalar neutron-proton pairing is thought to be important for nuclei with equal number of protons and neutrons but its manifestation in structure properties remains to be understood. We investigate the Gamow-Teller (GT) transitions for the f7 /2-shell nuclei in large-scale shell-model calculations with the realistic Hamiltonian. We show that the isoscalar T =0 ,Jπ=1+ neutron-proton pairing interaction plays a decisive role for the concentration of GT strengths at the first-excited 11+ state in 42Sc, and that the suppression of these strengths in 46V, 50Mn, and 54Co is mainly caused by the spin-orbit force supplemented by the quadrupole-quadrupole interaction. Based on the good reproduction of the charge-exchange reaction data, we further analyze the interplay between the isoscalar and isovector pairing correlations. We conclude that even for the most promising A =42 nuclei where the SU(4) isoscalar-isovector-pairing symmetry is less broken, the probability of forming an isoscalar neutron-proton pairing condensation is less than 60% as compared to the expectation at the SU(4)-symmetry limit.

A Few Meters Matter: Local Habitats Drive Reproductive Cycles in a Tropical Lizard.

PubMed

Otero, Luisa M; Huey, Raymond B; Gorman, George C

2015-09-01

Reproductive phenology often varies geographically within species, driven by environmental gradients that alter growth and reproduction. However, environments can differ between adjacent habitats at single localities. In lowland Puerto Rico, both open (sunny, warm) and forested (shady, cool) habitats may be only meters apart. The lizard Anolis cristatellus lives in both habitats: it thermoregulates carefully in the open but is a thermoconformer in the forest. To determine whether reproduction differs between habitats, we compared reproductive cycles of females in open versus forest habitats at two localities for over 2 years. Open females were more likely than forest females to be reproductive throughout the year, probably because open females were able to bask and thereby achieve warmer body temperatures. These between-habitat differences in reproduction were especially marked in cool months and are equivalent in magnitude to those between populations separated by elevation. Thus, environmental differences (even on a microlandscape scale) matter to reproduction and probably to demography.

Colonic aberrant crypts may originate from impaired fissioning: relevance to increased risk of neoplasia.

PubMed

Kristt, D; Bryan, K; Gal, R

1999-12-01

Colonic aberrant crypt foci (ACF) can be identified on the unembedded mucosal surface as clusters of abnormal crypts with enlarged, surface opening. Because dysplasia is frequent, and may be a precursor of carcinoma, epithelial changes have been well studied. However, the basis for the distinctive changes in crypt architecture remain unclear. We hypothesized that some of the architectural alterations of aberrant crypts may reflect impaired fissioning during normal crypt duplication cycles. Fissioning begins at the crypt base. Using morphometric and immunocytochemical approaches, we examined 55 human ACF, both dysplastic and nondysplastic, for their architectural features. Non-ACF mucosa was compared. Microscopically, all lesions contained crypts that were attached, paired, dilated, and angulated. In 3 dimensions, these features related to multiple, individual complexes of connected crypts, referred to as connected crypt structures (CCSs). CCSs terminated in enlarged surface openings (2 to 5 x normal) which are morphometrically equivalent to the macroscopic aberrant crypts (P > .1). These openings trap marker dye. Support for an origin of CCSs in impaired basal fissioning is 3-fold. Crypt profiles in ACF are twice as frequent in basal mucosa as superficially (P < .001); in normal mucosa, the ratio is 1. In a CCS with vertically connected, co-planar crypts, the upper parent crypt diameter was the sum of diameters of inferiorly attached daughter crypts (P > .1). Proliferating cell marker, Ki-67, is not expressed at attachment points. In non-ACF mucosa, isolated CCSs consistently occur at foci of mechanical crypt distortion such as mucosal folds. We conclude that a CCS is a fundamental component of ACF of all histotypes. Impairment of normal crypt fissioning is probably a major factor in the histogenesis of CCSs, which often occurs in settings of mechanical distortion of the mucosa. The pathological significance of this process may be in the formation of enlarged crypt openings. The latter could trap dietary carcinogens as they trap dye, and thereby predispose the CCS to dysplasia.

Pairing preferences of the model mono-valence mono-atomic ions investigated by molecular simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Qiang; Department of Chemistry, Bohai University, Jinzhou 121000; Zhang, Ruiting

2014-05-14

We carried out a series of potential of mean force calculations to study the pairing preferences of a series of model mono-atomic 1:1 ions with evenly varied sizes. The probabilities of forming the contact ion pair (CIP) and the single water separate ion pair (SIP) were presented in the two-dimensional plots with respect to the ion sizes. The pairing preferences reflected in these plots largely agree with the empirical rule of matching ion sizes in the small and big size regions. In the region that the ion sizes are close to the size of the water molecule; however, a significantmore » deviation from this conventional rule is observed. Our further analysis indicated that this deviation originates from the competition between CIP and the water bridging SIP state. The competition is mainly an enthalpy modulated phenomenon in which the existing of the water bridging plays a significant role.« less

Search for Open binaries in the Southern Celestial Hemisphere using SPM4

NASA Astrophysics Data System (ADS)

Dávila, E.; Vieira, K.; Rosales, K.

2018-01-01

Open binaries' weak gravitational binding makes them vulnerable to any perturbation, turning them into excellent probes of the gravitational field where they are located. Currently there are only a few hundreds known or suspected open binaries, therefore a search for more of these systems is highly encouraging by looking for pairs of stars with common proper motions in an extensive, deep, and high quality astrometric catalog such as the SPM4 (Girard et al. 2011).

A hybrid double-observer sightability model for aerial surveys

USGS Publications Warehouse

Griffin, Paul C.; Lubow, Bruce C.; Jenkins, Kurt J.; Vales, David J.; Moeller, Barbara J.; Reid, Mason; Happe, Patricia J.; Mccorquodale, Scott M.; Tirhi, Michelle J.; Schaberi, Jim P.; Beirne, Katherine

2013-01-01

Raw counts from aerial surveys make no correction for undetected animals and provide no estimate of precision with which to judge the utility of the counts. Sightability modeling and double-observer (DO) modeling are 2 commonly used approaches to account for detection bias and to estimate precision in aerial surveys. We developed a hybrid DO sightability model (model MH) that uses the strength of each approach to overcome the weakness in the other, for aerial surveys of elk (Cervus elaphus). The hybrid approach uses detection patterns of 2 independent observer pairs in a helicopter and telemetry-based detections of collared elk groups. Candidate MH models reflected hypotheses about effects of recorded covariates and unmodeled heterogeneity on the separate front-seat observer pair and back-seat observer pair detection probabilities. Group size and concealing vegetation cover strongly influenced detection probabilities. The pilot's previous experience participating in aerial surveys influenced detection by the front pair of observers if the elk group was on the pilot's side of the helicopter flight path. In 9 surveys in Mount Rainier National Park, the raw number of elk counted was approximately 80–93% of the abundance estimated by model MH. Uncorrected ratios of bulls per 100 cows generally were low compared to estimates adjusted for detection bias, but ratios of calves per 100 cows were comparable whether based on raw survey counts or adjusted estimates. The hybrid method was an improvement over commonly used alternatives, with improved precision compared to sightability modeling and reduced bias compared to DO modeling.

Quasi-stationary states and fermion pair creation from a vacuum in supercritical Coulomb field

NASA Astrophysics Data System (ADS)

Khalilov, V. R.

2017-12-01

Creation of charged fermion pair from a vacuum in so-called supercritical Coulomb potential is examined for the case when fermions can move only in the same (one) plane. In which case, quantum dynamics of charged massive or massless fermions can be described by the two-dimensional Dirac Hamiltonians with an usual (-a/r) Coulomb potential. These Hamiltonians are singular and require the additional definition in order for them to be treated as self-adjoint quantum-mechanical operators. We construct the self-adjoint two-dimensional Dirac Hamiltonians with a Coulomb potential and determine the quantum-mechanical states for such Hamiltonians in the corresponding Hilbert spaces of square-integrable functions. We determine the scattering amplitude in which the self-adjoint extension parameter is incorporated and then obtain equations implicitly defining possible discrete energy spectra of the self-adjoint Dirac Hamiltonians with a Coulomb potential. It is shown that this quantum system becomes unstable in the presence of a supercritical Coulomb potential which manifests in the appearance of quasi-stationary states in the lower (negative) energy continuum. The energy spectrum of those states is quasi-discrete, consists of broadened levels with widths related to the inverse lifetimes of the quasi-stationary states as well as the probability of creation of charged fermion pair by a supercritical Coulomb field. Explicit analytical expressions for the creation probabilities of charged (massive or massless) fermion pair are obtained in a supercritical Coulomb field.

Organocatalytic Ring-Opening Polymerization of Trimethylene Carbonate to Yield a Biodegradable Polycarbonate

ERIC Educational Resources Information Center

Chan, Julian M. W.; Zhang, Xiangyi; Brennan, Megan K.; Sardon, Haritz; Engler, Amanda C.; Fox, Courtney H.; Frank, Curtis W.; Waymouth, Robert M.; Hedrick, James L.

2015-01-01

In this laboratory experiment, students work in pairs to synthesize a simple aliphatic polycarbonate via ring-opening polymerization of trimethylene carbonate using 1,8-diazabicyclo[5.4.0]undec-7-ene and thiourea as organocatalysts. Following polymer isolation, students cool the material in a dry ice/acetone bath to observe its glass-transition…

Improving strand pairing prediction through exploring folding cooperativity

PubMed Central

Jeong, Jieun; Berman, Piotr; Przytycka, Teresa M.

2008-01-01

The topology of β-sheets is defined by the pattern of hydrogen-bonded strand pairing. Therefore, predicting hydrogen bonded strand partners is a fundamental step towards predicting β-sheet topology. At the same time, finding the correct partners is very difficult due to long range interactions involved in strand pairing. Additionally, patterns of aminoacids observed in β-sheet formations are very general and therefore difficult to use for computational recognition of specific contacts between strands. In this work, we report a new strand pairing algorithm. To address above mentioned difficulties, our algorithm attempts to mimic elements of the folding process. Namely, in addition to ensuring that the predicted hydrogen bonded strand pairs satisfy basic global consistency constraints, it takes into account hypothetical folding pathways. Consistently with this view, introducing hydrogen bonds between a pair of strands changes the probabilities of forming hydrogen bonds between other pairs of strand. We demonstrate that this approach provides an improvement over previously proposed algorithms. We also compare the performance of this method to that of a global optimization algorithm that poses the problem as integer linear programming optimization problem and solves it using ILOG CPLEX™ package. PMID:18989036

Open-Closed Homotopy Algebras and Strong Homotopy Leibniz Pairs Through Koszul Operad Theory

NASA Astrophysics Data System (ADS)

Hoefel, Eduardo; Livernet, Muriel

2012-08-01

Open-closed homotopy algebras (OCHA) and strong homotopy Leibniz pairs (SHLP) were introduced by Kajiura and Stasheff in 2004. In an appendix to their paper, Markl observed that an SHLP is equivalent to an algebra over the minimal model of a certain operad, without showing that the operad is Koszul. In the present paper, we show that both OCHA and SHLP are algebras over the minimal model of the zeroth homology of two versions of the Swiss-cheese operad and prove that these two operads are Koszul. As an application, we show that the OCHA operad is non-formal as a 2-colored operad but is formal as an algebra in the category of 2-collections.

Dynamic Equilibrium of Cardiac Troponin C's Hydrophobic Cleft and Its Modulation by Ca2+ Sensitizers and a Ca2+ Sensitivity Blunting Phosphomimic, cTnT(T204E).

PubMed

Schlecht, William; Dong, Wen-Ji

2017-10-18

Several studies have suggested that conformational dynamics are important in the regulation of thin filament activation in cardiac troponin C (cTnC); however, little direct evidence has been offered to support these claims. In this study, a dye homodimerization approach is developed and implemented that allows the determination of the dynamic equilibrium between open and closed conformations in cTnC's hydrophobic cleft. Modulation of this equilibrium by Ca 2+ , cardiac troponin I (cTnI), cardiac troponin T (cTnT), Ca 2+ -sensitizers, and a Ca 2+ -desensitizing phosphomimic of cTnT (cTnT(T204E) is characterized. Isolated cTnC contained a small open conformation population in the absence of Ca 2+ that increased significantly upon the addition of saturating levels of Ca 2+ . This suggests that the Ca 2+ -induced activation of thin filament arises from an increase in the probability of hydrophobic cleft opening. The inclusion of cTnI increased the population of open cTnC, and the inclusion of cTnT had the opposite effect. Samples containing Ca 2+ -desensitizing cTnT(T204E) showed a slight but insignificant decrease in open conformation probability compared to samples with cardiac troponin T, wild type [cTnT(wt)], while Ca 2+ sensitizer treated samples generally increased open conformation probability. These findings show that an equilibrium between the open and closed conformations of cTnC's hydrophobic cleft play a significant role in tuning the Ca 2+ sensitivity of the heart.

Exact one-sided confidence limits for the difference between two correlated proportions.

PubMed

Lloyd, Chris J; Moldovan, Max V

2007-08-15

We construct exact and optimal one-sided upper and lower confidence bounds for the difference between two probabilities based on matched binary pairs using well-established optimality theory of Buehler. Starting with five different approximate lower and upper limits, we adjust them to have coverage probability exactly equal to the desired nominal level and then compare the resulting exact limits by their mean size. Exact limits based on the signed root likelihood ratio statistic are preferred and recommended for practical use.

System for testing bearings

NASA Technical Reports Server (NTRS)

Gibson, John C. (Inventor)

1993-01-01

Disclosed here is a system for testing bearings wherein a pair of spaced bearings provides support for a shaft on which is mounted a bearing to be tested, this bearing being mounted in a bearing holder spaced from and in alignment with the pair of bearings. The bearing holder is provided with an annular collar positioned in an opening in the bearing holder for holding the bearing to be tested. A screw threaded through the bearing holder into engagement with the annular collar can be turned to force the collar radially out of alignment with the pair of bearings to apply a radial load to the bearing.

Time series regression-based pairs trading in the Korean equities market

NASA Astrophysics Data System (ADS)

Kim, Saejoon; Heo, Jun

2017-07-01

Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

Coherent triplet excitation suppresses the heading error of the avian compass

NASA Astrophysics Data System (ADS)

Katsoprinakis, G. E.; Dellis, A. T.; Kominis, I. K.

2010-08-01

Radical-ion pair reactions are currently understood to underlie the biochemical magnetic compass of migratory birds. It was recently shown that radical-ion pair reactions form a rich playground for the application of quantum-information-science concepts and effects. We will show here that the intricate interplay between the quantum Zeno effect and the coherent excitation of radical-ion pairs leads to an exquisite angular sensitivity of the reaction yields. This results in a significant and previously unanticipated suppression of the avian compass heading error, opening the way to quantum engineering precision biological sensors.

All-reflective optical target illumination system with high numerical aperture

DOEpatents

Sigler, Robert D.

1978-01-01

An all-reflective optical system for providing illumination of a target focal region at high numerical aperture from a pair of co-axially, confluent collimated light beams. A target cavity is defined by a pair of opposed inner ellipsoidal reflectors having respective first focal points within a target region and second focal points at a vertex opening in the opposing reflector. Outwardly of each inner reflector is the opposed combination of a spherical reflector, and an outer generally ellipsoidal reflector having an aberrated first focal point coincident with the focus of the opposing spherical reflector and a second focal point coincident with the second focal point of the opposing inner ellipsoidal reflector through a vertex opening in the spherical reflector. The confluent collimated beams are incident through vertex openings in the outer ellipsoidal reflectors onto respective opposing spherical reflectors. Each beam is reflected by the associated spherical reflector onto the opposing outer ellipsoidal reflector and focused thereby onto the opposing inner ellipsoidal reflector, and then onto the target region.

The non-parametric Parzen's window in stereo vision matching.

PubMed

Pajares, G; de la Cruz, J

2002-01-01

This paper presents an approach to the local stereovision matching problem using edge segments as features with four attributes. From these attributes we compute a matching probability between pairs of features of the stereo images. A correspondence is said true when such a probability is maximum. We introduce a nonparametric strategy based on Parzen's window (1962) to estimate a probability density function (PDF) which is used to obtain the matching probability. This is the main finding of the paper. A comparative analysis of other recent matching methods is included to show that this finding can be justified theoretically. A generalization of the proposed method is made in order to give guidelines about its use with the similarity constraint and also in different environments where other features and attributes are more suitable.

Synchrotron cooling and annihilation of an e/+/-e/-/ plasma - The radiation mechanism for the 5 March, 1979 transient

NASA Technical Reports Server (NTRS)

Ramaty, R.; Bussard, R. W.; Lingenfelter, R. E.

1981-01-01

Positron-electron pair radiation is examined as a mechanism that could be responsible for the impulsive phase emission of the 5 March, 1979 transient. Synchrotron cooling and subsequent annihilation of the pairs can account for the energy spectrum, the very high brightness, and the 0.4 MeV feature observed from this transient, whose source is likely to be a neutron star in the supernova remnant N49 in the Large Magellanic Cloud. In this model, the observed radiation is produced in the skin layer of a hot, radiation-dominated pair atmosphere, probably confined to the vicinity of the neutron star by a strong magnetic field. In this layer, about 10 to the 12th generations of pairs are formed (by photon-photon collisions), cooled and annihilated during the 0.15 s duration of the impulsive phase.

Connections between the dynamical symmetries in the microscopic shell model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Georgieva, A. I., E-mail: anageorg@issp.bas.bg; Drumev, K. P.

2016-03-25

The dynamical symmetries of the microscopic shell model appear as the limiting cases of a symmetry adapted Pairing-Plus-Quadrupole Model /PQM/, with a Hamiltonian containing isoscalar and isovector pairing and quadrupole interactions. We establish a correspondence between each of the three types of pairing bases and Elliott’s SU(3) basis, that describes collective rotation of nuclear systems with quadrupole deformation. It is derived from their complementarity to the same LS coupling chain of the shell model number conserving algebra. The probability distribution of the S U(3) basis states within the pairing eigenstates is also obtained through a numerical diagonalization of the PQMmore » Hamiltonian in each limit. We introduce control parameters, which define the phase diagram of the model and determine the role of each term of the Hamiltonian in the correct reproduction of the experimental data for the considered nuclei.« less

Beyond BCS pairing in high-density neutron matter

NASA Astrophysics Data System (ADS)

Rios, A.; Ding, D.; Dussan, H.; Dickhoff, W. H.; Witte, S. J.; Polls, A.

2018-01-01

Pairing gaps in neutron matter need to be computed in a wide range of densities to address open questions in neutron star phenomenology. Traditionally, the Bardeen-Cooper-Schrieffer approach has been used to compute gaps from bare nucleon-nucleon interactions. Here, we incorporate the influence of short- and long-range correlations into pairing properties. Short-range correlations are treated including the appropriate fragmentation of single-particle states, and they suppress the gaps substantially. Long-range correlations dress the pairing interaction via density and spin modes, and provide a relatively small correction. We use three different interactions as a starting point to control for any systematic effects. Results are relevant for neutron-star cooling scenarios, in particular in view of the recent observational data on Cassiopeia A.

Pulsar extinction. [astrophysics

NASA Technical Reports Server (NTRS)

Sturrock, P. A.; Baker, K.; Turk, J. S.

1975-01-01

Radio emission from pulsars, attributed to an instability associated with the creation of electron-positron pairs from gamma rays was investigated. The condition for pair creation therefore lead to an extinction condition. The relevant physical processes were analyzed in the context of a mathematical model, according to which radiation originated at the polar caps and magnetic field lines changed from a closed configuration to an open configuration at the force balance or corotation radius.

A Comparison of the Results of Many-Facet Rasch Analyses Based on Crossed and Judge Pair Designs

ERIC Educational Resources Information Center

Ilhan, Mustafa

2016-01-01

The aim of this study was to compare the results of many-facet Rasch analyses based on crossed and judge pair designs. The study was conducted with 168 eighth grade students and five judges. The study data were collected using an achievement test with open-ended questions and a holistic rubric that was used to rate the responses. In the data…

Long-life partners or sex friends? Impact of parental pair bond on offspring personality.

PubMed

Le Bot, Océane; Lumineau, Sophie; de Margerie, Emmanuel; Pittet, Florent; Trabalon, Marie; Houdelier, Cécilia

2014-12-01

Previous investigations reported that some traits of parental relationships, including pair-bond duration or mate behavioural compatibility, influence subsequent offspring fitness by acting on their behaviour and growth and thus their early survival. We hypothesized that the development of a pair bond between sexual partners would have a prenatal influence. This study investigated the impact of two pairing managements on the egg characteristics and development of offspring of Japanese quail (Coturnix c. japonica). Thirty males and 30 females were paired either continuously (C; mates together all the time) or non-continuously (NC; pairs met only three times a week for 5 min). Separation-reunion tests evaluated parental pair bond. Egg yolk testosterone and androstenedione levels were evaluated, and the somatic and behavioural development of C and NC chicks was assessed. Our results revealed that members of C pairs were attached to their mates and, although no significant differences in androgen levels could be evidenced between egg sets, a higher proportion of C pairs' eggs were fertilized and their chicks appeared less emotive and more social. Our results revealed that the parental relationship can modulate the behavioural development of their offspring, probably via non-genetic effects, and this could play a major role in the emergence of inter-individual variability. © 2014. Published by The Company of Biologists Ltd.

Electrically Controlled Valve With Small Motor

NASA Technical Reports Server (NTRS)

Reinicke, Robert H.; Mohtar, Rafic; Nelson, Richard O.

1992-01-01

Design of electrically controlled valve exploits force-multiplying principle to overcome large back-pressure force resisting initial opening. Design makes possible to open valve by use of relatively small motor adequate for rest of valve motion, but otherwise not large enough to open valve. In simple linear lifting, small horizontal forces applied to pair of taut cables to lift large weight through short distance. In rotary lifting, similar effect achieved by rotating, about an axis, disk to which initially axial cables attached.

Orbits of 15 visual binaries

NASA Astrophysics Data System (ADS)

Heintz, W. D.

1981-04-01

Micrometer observations in 1979-1980 permitted the computation of substantially revised or new orbital elements for 15 visual pairs. They include the bright stars 52 Ari and 78 UMa (in the UMa cluster), four faint dK pairs, and the probable triple ADS 16185. Ephemerides for equator of data are listed in a table along with the orbital elements of the binaries. The measured positions and their residuals are listed in a second table. The considered binaries include ADS 896, 2336, 6315, 7054, 7629, 8092, 8555, 8739, 13987, 16185, Rst 1658, 3906, 3972, 4529, and Jsp 691.

Jonckheere Double Star Photometry - Part XI: Lepus & Vulpecula

NASA Astrophysics Data System (ADS)

Knapp, Wilfried; Nanson, John

2018-07-01

If any double star discoverer is in urgent need of photometry then it is Jonckheere. There are over 3000 Jonckheere objects listed in the WDS catalog and a good part of them with magnitudes obviously far too bright. This report covers the Jonckheere objects in the constellations Lep and Vul. At least one image per object was taken with V-filter to allow for visual magnitude measurement by differential photometry. All objects were additionally checked for common proper motion. Five qualify indeed as most probably CPM pairs with an additional five as potential CPM pairs.

Multiclass Posterior Probability Twin SVM for Motor Imagery EEG Classification.

PubMed

She, Qingshan; Ma, Yuliang; Meng, Ming; Luo, Zhizeng

2015-01-01

Motor imagery electroencephalography is widely used in the brain-computer interface systems. Due to inherent characteristics of electroencephalography signals, accurate and real-time multiclass classification is always challenging. In order to solve this problem, a multiclass posterior probability solution for twin SVM is proposed by the ranking continuous output and pairwise coupling in this paper. First, two-class posterior probability model is constructed to approximate the posterior probability by the ranking continuous output techniques and Platt's estimating method. Secondly, a solution of multiclass probabilistic outputs for twin SVM is provided by combining every pair of class probabilities according to the method of pairwise coupling. Finally, the proposed method is compared with multiclass SVM and twin SVM via voting, and multiclass posterior probability SVM using different coupling approaches. The efficacy on the classification accuracy and time complexity of the proposed method has been demonstrated by both the UCI benchmark datasets and real world EEG data from BCI Competition IV Dataset 2a, respectively.

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

PubMed

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

DOE PAGES

Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

2015-01-29

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

PubMed Central

2016-01-01

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

Answer to Question {number_sign}30 [{open_quote}{open_quote}How are positrons moderated?,{close_quote}{close_quote} Thomas D. Rossing, Am. J. Phys. {bold 63}(12), 1065 (1995)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weber, M.; Lynn, K.G.

1996-07-01

The positrons from {beta}{sup +} decaying sources loss energyat a much faster rate than they annihilate. As the energy of the positrons drops, core excitations, plasmon excitation, electron/hole pair creation, and phonon scattering are the dominant processes of further energy loss.

16. NORTH BEDROOM INTERIOR SHOWING OPEN DOOR TO BATHROOM AT ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

16. NORTH BEDROOM INTERIOR SHOWING OPEN DOOR TO BATHROOM AT PHOTO LEFT, TWO 1 OVER 1 LIGHT DOUBLEHUNG, WOODFRAME WINDOWS IN A PAIRED ARRANGEMENT AT PHOTO CENTER, AND THE CLOSED DOOR TO THE KITCHEN AT PHOTO RIGHT. VIEW TO WEST. - Big Creek Hydroelectric System, Big Creek Town, Operator House, Orchard Avenue south of Huntington Lake Road, Big Creek, Fresno County, CA

Two-axis sagittal focusing monochromator

DOEpatents

Haas, Edwin G; Stelmach, Christopher; Zhong, Zhong

2014-05-13

An x-ray focusing device and method for adjustably focusing x-rays in two orthogonal directions simultaneously. The device and method can be operated remotely using two pairs of orthogonal benders mounted on a rigid, open frame such that x-rays may pass through the opening in the frame. The added x-ray flux allows significantly higher brightness from the same x-ray source.

The neural correlates of subjective utility of monetary outcome and probability weight in economic and in motor decision under risk

PubMed Central

Wu, Shih-Wei; Delgado, Mauricio R.; Maloney, Laurence T.

2011-01-01

In decision under risk, people choose between lotteries that contain a list of potential outcomes paired with their probabilities of occurrence. We previously developed a method for translating such lotteries to mathematically equivalent motor lotteries. The probability of each outcome in a motor lottery is determined by the subject’s noise in executing a movement. In this study, we used functional magnetic resonance imaging in humans to compare the neural correlates of monetary outcome and probability in classical lottery tasks where information about probability was explicitly communicated to the subjects and in mathematically equivalent motor lottery tasks where probability was implicit in the subjects’ own motor noise. We found that activity in the medial prefrontal cortex (mPFC) and the posterior cingulate cortex (PCC) quantitatively represent the subjective utility of monetary outcome in both tasks. For probability, we found that the mPFC significantly tracked the distortion of such information in both tasks. Specifically, activity in mPFC represents probability information but not the physical properties of the stimuli correlated with this information. Together, the results demonstrate that mPFC represents probability from two distinct forms of decision under risk. PMID:21677166

The neural correlates of subjective utility of monetary outcome and probability weight in economic and in motor decision under risk.

PubMed

Wu, Shih-Wei; Delgado, Mauricio R; Maloney, Laurence T

2011-06-15

In decision under risk, people choose between lotteries that contain a list of potential outcomes paired with their probabilities of occurrence. We previously developed a method for translating such lotteries to mathematically equivalent "motor lotteries." The probability of each outcome in a motor lottery is determined by the subject's noise in executing a movement. In this study, we used functional magnetic resonance imaging in humans to compare the neural correlates of monetary outcome and probability in classical lottery tasks in which information about probability was explicitly communicated to the subjects and in mathematically equivalent motor lottery tasks in which probability was implicit in the subjects' own motor noise. We found that activity in the medial prefrontal cortex (mPFC) and the posterior cingulate cortex quantitatively represent the subjective utility of monetary outcome in both tasks. For probability, we found that the mPFC significantly tracked the distortion of such information in both tasks. Specifically, activity in mPFC represents probability information but not the physical properties of the stimuli correlated with this information. Together, the results demonstrate that mPFC represents probability from two distinct forms of decision under risk.

A System-Level Throughput Model for Quantum Key Distribution

DTIC Science & Technology

2015-09-17

object. In quantum entanglement , the physical properties of particle pairs or groups of particles are correlated – the quantum state of each particle...One-Time Pad Algorithm ............................................................................. 8 Figure 2. Photon Polarization [19...64 Poisson distribution for multi- photon probability (29

Probabilistic Open Set Recognition

NASA Astrophysics Data System (ADS)

Jain, Lalit Prithviraj

Real-world tasks in computer vision, pattern recognition and machine learning often touch upon the open set recognition problem: multi-class recognition with incomplete knowledge of the world and many unknown inputs. An obvious way to approach such problems is to develop a recognition system that thresholds probabilities to reject unknown classes. Traditional rejection techniques are not about the unknown; they are about the uncertain boundary and rejection around that boundary. Thus traditional techniques only represent the "known unknowns". However, a proper open set recognition algorithm is needed to reduce the risk from the "unknown unknowns". This dissertation examines this concept and finds existing probabilistic multi-class recognition approaches are ineffective for true open set recognition. We hypothesize the cause is due to weak adhoc assumptions combined with closed-world assumptions made by existing calibration techniques. Intuitively, if we could accurately model just the positive data for any known class without overfitting, we could reject the large set of unknown classes even under this assumption of incomplete class knowledge. For this, we formulate the problem as one of modeling positive training data by invoking statistical extreme value theory (EVT) near the decision boundary of positive data with respect to negative data. We provide a new algorithm called the PI-SVM for estimating the unnormalized posterior probability of class inclusion. This dissertation also introduces a new open set recognition model called Compact Abating Probability (CAP), where the probability of class membership decreases in value (abates) as points move from known data toward open space. We show that CAP models improve open set recognition for multiple algorithms. Leveraging the CAP formulation, we go on to describe the novel Weibull-calibrated SVM (W-SVM) algorithm, which combines the useful properties of statistical EVT for score calibration with one-class and binary support vector machines. Building from the success of statistical EVT based recognition methods such as PI-SVM and W-SVM on the open set problem, we present a new general supervised learning algorithm for multi-class classification and multi-class open set recognition called the Extreme Value Local Basis (EVLB). The design of this algorithm is motivated by the observation that extrema from known negative class distributions are the closest negative points to any positive sample during training, and thus should be used to define the parameters of a probabilistic decision model. In the EVLB, the kernel distribution for each positive training sample is estimated via an EVT distribution fit over the distances to the separating hyperplane between positive training sample and closest negative samples, with a subset of the overall positive training data retained to form a probabilistic decision boundary. Using this subset as a frame of reference, the probability of a sample at test time decreases as it moves away from the positive class. Possessing this property, the EVLB is well-suited to open set recognition problems where samples from unknown or novel classes are encountered at test. Our experimental evaluation shows that the EVLB provides a substantial improvement in scalability compared to standard radial basis function kernel machines, as well as P I-SVM and W-SVM, with improved accuracy in many cases. We evaluate our algorithm on open set variations of the standard visual learning benchmarks, as well as with an open subset of classes from Caltech 256 and ImageNet. Our experiments show that PI-SVM, WSVM and EVLB provide significant advances over the previous state-of-the-art solutions for the same tasks.

Probability of identity by descent in metapopulations.

PubMed Central

Kaj, I; Lascoux, M

1999-01-01

Equilibrium probabilities of identity by descent (IBD), for pairs of genes within individuals, for genes between individuals within subpopulations, and for genes between subpopulations are calculated in metapopulation models with fixed or varying colony sizes. A continuous-time analog to the Moran model was used in either case. For fixed-colony size both propagule and migrant pool models were considered. The varying population size model is based on a birth-death-immigration (BDI) process, to which migration between colonies is added. Wright's F statistics are calculated and compared to previous results. Adding between-island migration to the BDI model can have an important effect on the equilibrium probabilities of IBD and on Wright's index. PMID:10388835

Phene Plate (PhP) biochemical fingerprinting. A screening method for epidemiological typing of enterococcal isolates.

PubMed

Saeedi, B; Tärnberg, M; Gill, H; Hällgren, A; Jonasson, J; Nilsson, L E; Isaksson, B; Kühn, I; Hanberger, H

2005-09-01

Pulsed-field gel electrophoresis (PFGE) is currently considered the gold standard for genotyping of enterococci. However, PFGE is both expensive and time-consuming. The purpose of this study was to investigate whether the PhP system can be used as a reliable clinical screening method for detection of genetically related isolates of enterococci. If so, it should be possible to minimize the number of isolates subjected to PFGE typing, which would save time and money. Ninety-nine clinical enterococcal isolates were analysed by PhP (similarity levels 0.90-0.975) and PFGE (similarity levels < or =3 and < or =6 bands) and all possible pairs of isolates were cross-classified as matched or mismatched. We found that the probability that a pair of isolates (A and B) belonging to the same type according to PhP also belong to the same cluster according to PFGE, i.e. p(A(PFGE)=B(PFGE) * A(PhP)=B(PhP)), and the probability that a pair of isolates of different types according to PhP also belong to different clusters according to PFGE, i.e. p(A(PFGE) not equalB(PFGE) * A(PhP) not equalB(PhP)), was relatively high for E. faecalis (0.86 and 0.96, respectively), but was lower for E. faecium (0.51 and 0.77, respectively). The concordance which shows the probability that PhP and PFGE agree on match or mismatch was 86%-93% for E. faecalis and 54%-66% for E. faecium, which indicates that the PhP method may be useful for epidemiological typing of E. faecalis in the current settings but not for E. faecium.

Page turning system

NASA Technical Reports Server (NTRS)

Kerley, James J. (Inventor); Eklund, Wayne D. (Inventor)

1992-01-01

A device for holding reading materials for use by readers without arm mobility is presented. The device is adapted to hold the reading materials in position for reading with the pages displayed to enable turning by use of a rubber tipped stick that is held in the mouth and has a pair of rectangular frames. The frames are for holding and positioning the reading materials opened in reading posture with the pages displayed at a substantially unobstructed sighting position for reading. The pair of rectangular frames are connected to one another by a hinge so the angle between the frames may be varied thereby varying the inclination of the reading material. A pair of bent spring mounted wires for holding opposing pages of the reading material open for reading without substantial visual interference of the pages is mounted to the base. The wires are also adjustable to the thickness of the reading material and have a variable friction adjustment. This enables the force of the wires against the pages to be varied and permits the reader to manipulate the pages with the stick.

Open-loop frequency acquisition for suppressed-carrier biphase signals using one-pole arm filters

NASA Technical Reports Server (NTRS)

Shah, B.; Holmes, J. K.

1991-01-01

Open loop frequency acquisition performance is discussed for suppressed carrier binary phase shift keyed signals in terms of the probability of detecting the carrier frequency offset when the arms of the Costas loop detector have one pole filters. The approach, which does not require symbol timing, uses fast Fourier transforms (FFTs) to detect the carrier frequency offset. The detection probability, which depends on both the 3 dB arm filter bandwidth and the received symbol signal to noise ratio, is derived and is shown to be independent of symbol timing. It is shown that the performance of this technique is slightly better that other open loop acquisition techniques which use integrators in the arms and whose detection performance varies with symbol timing.

Fingerprint Recognition with Identical Twin Fingerprints

PubMed Central

Yang, Xin; Tian, Jie

2012-01-01

Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar. PMID:22558204

Generating intrinsically disordered protein conformational ensembles from a Markov chain

NASA Astrophysics Data System (ADS)

Cukier, Robert I.

2018-03-01

Intrinsically disordered proteins (IDPs) sample a diverse conformational space. They are important to signaling and regulatory pathways in cells. An entropy penalty must be payed when an IDP becomes ordered upon interaction with another protein or a ligand. Thus, the degree of conformational disorder of an IDP is of interest. We create a dichotomic Markov model that can explore entropic features of an IDP. The Markov condition introduces local (neighbor residues in a protein sequence) rotamer dependences that arise from van der Waals and other chemical constraints. A protein sequence of length N is characterized by its (information) entropy and mutual information, MIMC, the latter providing a measure of the dependence among the random variables describing the rotamer probabilities of the residues that comprise the sequence. For a Markov chain, the MIMC is proportional to the pair mutual information MI which depends on the singlet and pair probabilities of neighbor residue rotamer sampling. All 2N sequence states are generated, along with their probabilities, and contrasted with the probabilities under the assumption of independent residues. An efficient method to generate realizations of the chain is also provided. The chain entropy, MIMC, and state probabilities provide the ingredients to distinguish different scenarios using the terminologies: MoRF (molecular recognition feature), not-MoRF, and not-IDP. A MoRF corresponds to large entropy and large MIMC (strong dependence among the residues' rotamer sampling), a not-MoRF corresponds to large entropy but small MIMC, and not-IDP corresponds to low entropy irrespective of the MIMC. We show that MorFs are most appropriate as descriptors of IDPs. They provide a reasonable number of high-population states that reflect the dependences between neighbor residues, thus classifying them as IDPs, yet without very large entropy that might lead to a too high entropy penalty.

Informing Disease Models with Temporal and Spatial Contact Structure among GPS-Collared Individuals in Wild Populations

PubMed Central

Williams, David M.; Dechen Quinn, Amy C.; Porter, William F.

2014-01-01

Contacts between hosts are essential for transmission of many infectious agents. Understanding how contacts, and thus transmission rates, occur in space and time is critical to effectively responding to disease outbreaks in free-ranging animal populations. Contacts between animals in the wild are often difficult to observe or measure directly. Instead, one must infer contacts from metrics such as proximity in space and time. Our objective was to examine how contacts between white-tailed deer (Odocoileus virginianus) vary in space and among seasons. We used GPS movement data from 71 deer in central New York State to quantify potential direct contacts between deer and indirect overlap in space use across time and space. Daily probabilities of direct contact decreased from winter (0.05–0.14), to low levels post-parturition through summer (0.00–0.02), and increased during the rut to winter levels. The cumulative distribution for the spatial structure of direct and indirect contact probabilities around a hypothetical point of occurrence increased rapidly with distance for deer pairs separated by 1,000 m – 7,000 m. Ninety-five percent of the probabilities of direct contact occurred among deer pairs within 8,500 m of one another, and 99% within 10,900 m. Probabilities of indirect contact accumulated across greater spatial extents: 95% at 11,900 m and 99% at 49,000 m. Contacts were spatially consistent across seasons, indicating that although contact rates differ seasonally, they occur proportionally across similar landscape extents. Distributions of contact probabilities across space can inform management decisions for assessing risk and allocating resources in response. PMID:24409293

Fingerprint recognition with identical twin fingerprints.

PubMed

Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

2012-01-01

Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

Open WorldCat and Its Impact on Academic Libraries

ERIC Educational Resources Information Center

El-Sherbini, Magda

2007-01-01

This paper analyzes librarians' reactions to the Open OCLC WorldCat. A detailed survey was sent to ARL libraries to explore what, if anything, the libraries are currently doing to prepare for these changes and how they plan to cope with the probability of having all their records open to the whole world. Survey findings indicate that most of the…

Sudden transition and sudden change from open spin environments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Zheng-Da; School of Science, Jiangnan University, Wuxi 214122; Xu, Jing-Bo, E-mail: xujb@zju.edu.cn

2014-11-15

We investigate the necessary conditions for the existence of sudden transition or sudden change phenomenon for appropriate initial states under dephasing. As illustrative examples, we study the behaviors of quantum correlation dynamics of two noninteracting qubits in independent and common open spin environments, respectively. For the independent environments case, we find that the quantum correlation dynamics is closely related to the Loschmidt echo and the dynamics exhibits a sudden transition from classical to quantum correlation decay. It is also shown that the sudden change phenomenon may occur for the common environment case and stationary quantum discord is found at themore » high temperature region of the environment. Finally, we investigate the quantum criticality of the open spin environment by exploring the probability distribution of the Loschmidt echo and the scaling transformation behavior of quantum discord, respectively. - Highlights: • Sudden transition or sudden change from open spin baths are studied. • Quantum discord is related to the Loschmidt echo in independent open spin baths. • Steady quantum discord is found in a common open spin bath. • The probability distribution of the Loschmidt echo is analyzed. • The scaling transformation behavior of quantum discord is displayed.« less

VizieR Online Data Catalog: Shape parameters for 154 Galactic open clusters (Zhai+, 2017)

NASA Astrophysics Data System (ADS)

Zhai, M.; Abt, H.; Zhao, G.; Li, C.

2017-06-01

The data used are from database WEBDA (http://www.univie.ac.at/webda/). We have found 946 open clusters with equatorial coordinates for each cluster member. Since cluster members are easily contaminated by field stars, we have only adopted stars with membership probabilities higher than 70% as cluster members. It is rarely possible to determine a cluster's shape with a small number of members, so we have only considered relatively richer clusters, which host more than 20 of the most probable member stars. After these selections, there are 154 clusters left. (1 data file).

Electron-conformational transformations govern the temperature dependence of the cardiac ryanodine receptor gating

NASA Astrophysics Data System (ADS)

Moskvin, A. S.; Iaparov, B. I.; Ryvkin, A. M.; Solovyova, O. E.; Markhasin, V. S.

2015-07-01

Temperature influences many aspects of cardiac excitation-contraction coupling, in particular, hypothermia increases the open probability ( P open) of cardiac sarcoplasmic reticulum (SR) Ca2+-release channels (ryanodine-sensitive RyR channels) rising the SR Ca2+ load in mammalian myocytes. However, to the best of our knowledge, no theoretical models are available for that effect. Traditional Markov chain models do not provide a reasonable molecular mechanistic insight on the origin of the temperature effects. Here in the paper we address a simple physically clear electron-conformational model to describe the RyR gating and argue that a synergetic effect of external thermal fluctuation forces (Gaussian-Markovian noise) and internal friction via the temperature stimulation/suppression of the open-close RyR tunneling probability can be considered as a main contributor to temperature effects on the RyR gating. Results of the computer modeling allowed us to successfully reproduce all the temperature effects observed for an isolated RyR gating in vitro under reducing the temperature: increase in P open and mean open time without any significant effect on mean closed

Validation of an automated fluorescein method for determining bromide in water

USGS Publications Warehouse

Fishman, M. J.; Schroder, L.J.; Friedman, L.C.

1985-01-01

Surface, atmospheric precipitation and deionized water samples were spiked with ??g l-1 concentrations of bromide, and the solutions stored in polyethylene and polytetrafluoroethylene bottles. Bromide was determined periodically for 30 days. Automated fluorescein and ion chromatography methods were used to determine bromide in these prepared samples. Analysis of the data by the paired t-test indicates that the two methods are not significantly different at a probability of 95% for samples containing from 0.015 to 0.5 mg l-1 of bromide. The correlation coefficient for the same sets of paired data is 0.9987. Recovery data, except for the surface water samples to which 0.005 mg l-1 of bromide was added, range from 89 to 112%. There appears to be no loss of bromide from solution in either type of container.Surface, atmospheric precipitation and deionized water samples were spiked with mu g l** minus **1 concentrations of bromide, and the solutions stored in polyethylene and polytetrafluoroethylene bottles. Bromide was determined periodically for 30 days. Automated fluorescein and ion chromatography methods were used to determine bromide in these prepared samples. Analysis of the data by the paired t-test indicates that the two methods are not significantly different at a probability of 95% for samples containing from 0. 015 to 0. 5 mg l** minus **1 of bromide. The correlation coefficient for the same sets of paired data is 0. 9987. Recovery data, except for the surface water samples to which 0. 005 mg l** minus **1 of bromide was added, range from 89 to 112%. Refs.

We are not the 99 percent: quantifying asphericity in the distribution of Local Group satellites

NASA Astrophysics Data System (ADS)

Forero-Romero, Jaime E.; Arias, Verónica

2018-05-01

We use simulations to build an analytic probability distribution for the asphericity in the satellite distribution around Local Group (LG) type galaxies in the Lambda Cold Dark Matter (LCDM) paradigm. We use this distribution to estimate the atypicality of the satellite distributions in the LG even when the underlying simulations do not have enough systems fully resembling the LG in terms of its typical masses, separation and kinematics. We demonstrate the method using three different simulations (Illustris-1, Illustris-1-Dark and ELVIS) and a number of satellites ranging from 11 to 15. Detailed results differ greatly among the simulations suggesting a strong influence of the typical DM halo mass, the number of satellites and the simulated baryonic effects. However, there are three common trends. First, at most 2% of the pairs are expected to have satellite distributions with the same asphericity as the LG; second, at most 80% of the pairs have a halo with a satellite distribution as aspherical as in M31; and third, at most 4% of the pairs have a halo with satellite distribution as planar as in the MW. These quantitative results place the LG at the level of a 3σ outlier in the LCDM paradigm. We suggest that understanding the reasons for this atypicality requires quantifying the asphericity probability distribution as a function of halo mass and large scale environment. The approach presented here can facilitate that kind of study and other comparisons between different numerical setups and choices to study satellites around LG pairs in simulations.

Environmental correlates of breeding in the Crested Caracara (Caracara cheriway)

USGS Publications Warehouse

Morrison, J.L.; Pias, Kyle E.; Cohen, J.B.; Catlin, D.H.

2009-01-01

We evaluated the influence of weather on reproduction of the Crested Caracara (Caracara cheriway) in an agricultural landscape in south-central Florida. We used a mixed logistic-regression modeling approach within an information-theoretic framework to examine the influence of total rainfall, rainfall frequency, and temperature on the number of breeding pairs, timing of breeding, nest success, and productivity of Crested Caracaras during 1994–2000. The best models indicated an influence of rainfall frequency and laying period on reproduction. More individuals nested and more pairs nested earlier during years with more frequent rainfall in late summer and early fall. Pairs that nested later in each breeding season had smaller clutches, lower nest success and productivity, and higher probability of nest failure. More frequent rainfall during early spring months that are usually characterized by water deficit (March–May), more frequent rainfall during the fall drawdown period (September–November), and a shorter winter dry period showed some association with higher probability of brood reduction and lower nest success. The proportion of nests that failed was higher in “wet” years, when total rainfall during the breeding season (September–April) was >10% above the 20-year average. Rainfall may influence reproduction in Crested Caracaras indirectly through food resources. As total rainfall increased during February–April, when most pairs are feeding nestlings or dependent fledglings, the proportion of drawdown-dependent species (those that become available as rainfall decreases and wetlands become isolated and shallow) in the diet of Crested Caracaras declined, which may indicate reduced availability of foraging habitat for this primarily terrestrial raptor.

Fluctuation theorem for entropy production during effusion of a relativistic ideal gas.

PubMed

Cleuren, B; Willaert, K; Engel, A; Van den Broeck, C

2008-02-01

The probability distribution of the entropy production for the effusion of a relativistic ideal gas is calculated explicitly. This result is then extended to include particle and antiparticle pair production and annihilation. In both cases, the fluctuation theorem is verified.

Open Screw Placement in a 1.5 mm LCP Over a Fracture Gap Decreases Fatigue Life

PubMed Central

Alwen, Sarah G. J.; Kapatkin, Amy S.; Garcia, Tanya C.; Milgram, Joshua; Stover, Susan M.

2018-01-01

Objective To investigate the influence of plate and screw hole position on the stability of simulated radial fractures stabilized with a 1.5 mm condylar locking compression plate (LCP). Study Design In vitro mechanical testing of paired cadaveric limbs. Sample Population Paired radii (n = 7) stabilized with a 1.5 mm condylar LCP with an open screw hole positioned either proximal to (PG), or over (OG), a simulated small fracture gap. Methods Constructs were cycled in axial compression at a simulated trot load until failure or a maximum of 200,000 cycles. Specimens that sustained 200,000 cycles without failure were then loaded in axial compression in a single cycle to failure. Construct cyclic axial stiffness and gap strain, fatigue life, and residual strength were evaluated and compared between constructs using analysis of variance. Results Of pairs that had a failure during cyclic loading, OG constructs survived fewer cycles (54,700 ± 60,600) than PG (116,800 ± 49,300). OG constructs had significantly lower initial stiffness throughout cyclic loading and higher gap strain range within the first 1,000 cycles than PG constructs. Residual strength variables were not significantly different between constructs, however yield loads occurred at loads only marginally higher than approximated trot loads. Fatigue life decreased with increasing body weight. Conclusion Fracture fixation stability is compromised by an open screw hole directly over a fracture gap compared to the open screw hole being buttressed by bone in the model studied. The 1.5 mm condylar LCP may be insufficient stabilization in dogs with appropriate radial geometry but high body weights. PMID:29876361

On the joint spectral density of bivariate random sequences. Thesis Technical Report No. 21

NASA Technical Reports Server (NTRS)

Aalfs, David D.

1995-01-01

For univariate random sequences, the power spectral density acts like a probability density function of the frequencies present in the sequence. This dissertation extends that concept to bivariate random sequences. For this purpose, a function called the joint spectral density is defined that represents a joint probability weighing of the frequency content of pairs of random sequences. Given a pair of random sequences, the joint spectral density is not uniquely determined in the absence of any constraints. Two approaches to constraining the sequences are suggested: (1) assume the sequences are the margins of some stationary random field, (2) assume the sequences conform to a particular model that is linked to the joint spectral density. For both approaches, the properties of the resulting sequences are investigated in some detail, and simulation is used to corroborate theoretical results. It is concluded that under either of these two constraints, the joint spectral density can be computed from the non-stationary cross-correlation.

Flavor network and the principles of food pairing

NASA Astrophysics Data System (ADS)

Ahn, Yong-Yeol; Ahnert, Sebastian E.; Bagrow, James P.; Barabási, Albert-László

2011-12-01

The cultural diversity of culinary practice, as illustrated by the variety of regional cuisines, raises the question of whether there are any general patterns that determine the ingredient combinations used in food today or principles that transcend individual tastes and recipes. We introduce a flavor network that captures the flavor compounds shared by culinary ingredients. Western cuisines show a tendency to use ingredient pairs that share many flavor compounds, supporting the so-called food pairing hypothesis. By contrast, East Asian cuisines tend to avoid compound sharing ingredients. Given the increasing availability of information on food preparation, our data-driven investigation opens new avenues towards a systematic understanding of culinary practice.

Pair-Starved Pulsar Magnetospheres

NASA Technical Reports Server (NTRS)

Muslimov, Alex G.; Harding, Alice K.

2009-01-01

We propose a simple analytic model for the innermost (within the light cylinder of canonical radius, approx. c/Omega) structure of open-magnetic-field lines of a rotating neutron star (NS) with relativistic outflow of charged particles (electrons/positrons) and arbitrary angle between the NS spin and magnetic axes. We present the self-consistent solution of Maxwell's equations for the magnetic field and electric current in the pair-starved regime where the density of electron-positron plasma generated above the pulsar polar cap is not sufficient to completely screen the accelerating electric field and thus establish thee E . B = 0 condition above the pair-formation front up to the very high altitudes within the light cylinder. The proposed mode1 may provide a theoretical framework for developing the refined model of the global pair-starved pulsar magnetosphere.

Excluding joint probabilities from quantum theory

NASA Astrophysics Data System (ADS)

Allahverdyan, Armen E.; Danageozian, Arshag

2018-03-01

Quantum theory does not provide a unique definition for the joint probability of two noncommuting observables, which is the next important question after the Born's probability for a single observable. Instead, various definitions were suggested, e.g., via quasiprobabilities or via hidden-variable theories. After reviewing open issues of the joint probability, we relate it to quantum imprecise probabilities, which are noncontextual and are consistent with all constraints expected from a quantum probability. We study two noncommuting observables in a two-dimensional Hilbert space and show that there is no precise joint probability that applies for any quantum state and is consistent with imprecise probabilities. This contrasts with theorems by Bell and Kochen-Specker that exclude joint probabilities for more than two noncommuting observables, in Hilbert space with dimension larger than two. If measurement contexts are included into the definition, joint probabilities are not excluded anymore, but they are still constrained by imprecise probabilities.

Probability, not linear summation, mediates the detection of concentric orientation-defined textures.

PubMed

Schmidtmann, Gunnar; Jennings, Ben J; Bell, Jason; Kingdom, Frederick A A

2015-01-01

Previous studies investigating signal integration in circular Glass patterns have concluded that the information in these patterns is linearly summed across the entire display for detection. Here we test whether an alternative form of summation, probability summation (PS), modeled under the assumptions of Signal Detection Theory (SDT), can be rejected as a model of Glass pattern detection. PS under SDT alone predicts that the exponent β of the Quick- (or Weibull-) fitted psychometric function should decrease with increasing signal area. We measured spatial integration in circular, radial, spiral, and parallel Glass patterns, as well as comparable patterns composed of Gabors instead of dot pairs. We measured the signal-to-noise ratio required for detection as a function of the size of the area containing signal, with the remaining area containing dot-pair or Gabor-orientation noise. Contrary to some previous studies, we found that the strength of summation never reached values close to linear summation for any stimuli. More importantly, the exponent β systematically decreased with signal area, as predicted by PS under SDT. We applied a model for PS under SDT and found that it gave a good account of the data. We conclude that probability summation is the most likely basis for the detection of circular, radial, spiral, and parallel orientation-defined textures.

Social Effects on Rat Spatial Choice in an Open Field Task

ERIC Educational Resources Information Center

Keller, Matthew R.; Brown, Michael F.

2011-01-01

Pairs of rats foraged in trials either together or separately in an open field apparatus for pellets hidden in discreet locations in a 5 x 5 matrix. Trial duration was either 1 or 4 min. The tendency to choose locations that had earlier been visited by another rat was examined by comparing the choices made in the presence and absence of the other…

Think Pair Share with Formative Assessment for Junior High School Student

NASA Astrophysics Data System (ADS)

Pradana, O. R. Y.; Sujadi, I.; Pramudya, I.

2017-09-01

Geometry is a science related to abstract thinking ability so that not many students are able to understand this material well. In this case, the learning model plays a crucial role in improving student achievement. This means that a less precise learning model will cause difficulties for students. Therefore, this study provides a quantitative explanation of the Think Pair Share learning model combined with the formative assessment. This study aims to test the Think Pair Share with the formative assessment on junior high school students. This research uses a quantitative approach of Pretest-Posttest in control group and experiment group. ANOVA test and Scheffe test used to analyse the effectiveness this learning. Findings in this study are student achievement on the material geometry with Think Pair Share using formative assessment has increased significantly. This happens probably because this learning makes students become more active during learning. Hope in the future, Think Pair Share with formative assessment be a useful learning for teachers and this learning applied by the teacher around the world especially on the material geometry.

Cluster membership probability: polarimetric approach

NASA Astrophysics Data System (ADS)

Medhi, Biman J.; Tamura, Motohide

2013-04-01

Interstellar polarimetric data of the six open clusters Hogg 15, NGC 6611, NGC 5606, NGC 6231, NGC 5749 and NGC 6250 have been used to estimate the membership probability for the stars within them. For proper-motion member stars, the membership probability estimated using the polarimetric data is in good agreement with the proper-motion cluster membership probability. However, for proper-motion non-member stars, the membership probability estimated by the polarimetric method is in total disagreement with the proper-motion cluster membership probability. The inconsistencies in the determined memberships may be because of the fundamental differences between the two methods of determination: one is based on stellar proper motion in space and the other is based on selective extinction of the stellar output by the asymmetric aligned dust grains present in the interstellar medium. The results and analysis suggest that the scatter of the Stokes vectors q (per cent) and u (per cent) for the proper-motion member stars depends on the interstellar and intracluster differential reddening in the open cluster. It is found that this method could be used to estimate the cluster membership probability if we have additional polarimetric and photometric information for a star to identify it as a probable member/non-member of a particular cluster, such as the maximum wavelength value (λmax), the unit weight error of the fit (σ1), the dispersion in the polarimetric position angles (overline{ɛ }), reddening (E(B - V)) or the differential intracluster reddening (ΔE(B - V)). This method could also be used to estimate the membership probability of known member stars having no membership probability as well as to resolve disagreements about membership among different proper-motion surveys.

Measuring kinetics of complex single ion channel data using mean-variance histograms.

PubMed

Patlak, J B

1993-07-01

The measurement of single ion channel kinetics is difficult when those channels exhibit subconductance events. When the kinetics are fast, and when the current magnitudes are small, as is the case for Na+, Ca2+, and some K+ channels, these difficulties can lead to serious errors in the estimation of channel kinetics. I present here a method, based on the construction and analysis of mean-variance histograms, that can overcome these problems. A mean-variance histogram is constructed by calculating the mean current and the current variance within a brief "window" (a set of N consecutive data samples) superimposed on the digitized raw channel data. Systematic movement of this window over the data produces large numbers of mean-variance pairs which can be assembled into a two-dimensional histogram. Defined current levels (open, closed, or sublevel) appear in such plots as low variance regions. The total number of events in such low variance regions is estimated by curve fitting and plotted as a function of window width. This function decreases with the same time constants as the original dwell time probability distribution for each of the regions. The method can therefore be used: 1) to present a qualitative summary of the single channel data from which the signal-to-noise ratio, open channel noise, steadiness of the baseline, and number of conductance levels can be quickly determined; 2) to quantify the dwell time distribution in each of the levels exhibited. In this paper I present the analysis of a Na+ channel recording that had a number of complexities. The signal-to-noise ratio was only about 8 for the main open state, open channel noise, and fast flickers to other states were present, as were a substantial number of subconductance states. "Standard" half-amplitude threshold analysis of these data produce open and closed time histograms that were well fitted by the sum of two exponentials, but with apparently erroneous time constants, whereas the mean-variance histogram technique provided a more credible analysis of the open, closed, and subconductance times for the patch. I also show that the method produces accurate results on simulated data in a wide variety of conditions, whereas the half-amplitude method, when applied to complex simulated data shows the same errors as were apparent in the real data. The utility and the limitations of this new method are discussed.

Computer simulation on the collision-sticking dynamics of two colloidal particles in an optical trap.

PubMed

Xu, Shenghua; Sun, Zhiwei

2007-04-14

Collisions of a particle pair induced by optical tweezers have been employed to study colloidal stability. In order to deepen insights regarding the collision-sticking dynamics of a particle pair in the optical trap that were observed in experimental approaches at the particle level, the authors carry out a Brownian dynamics simulation. In the simulation, various contributing factors, including the Derjaguin-Landau-Verwey-Overbeek interaction of particles, hydrodynamic interactions, optical trapping forces on the two particles, and the Brownian motion, were all taken into account. The simulation reproduces the tendencies of the accumulated sticking probability during the trapping duration for the trapped particle pair described in our previous study and provides an explanation for why the two entangled particles in the trap experience two different statuses.

Quadratic RK shooting solution for a environmental parameter prediction boundary value problem

NASA Astrophysics Data System (ADS)

Famelis, Ioannis Th.; Tsitouras, Ch.

2014-10-01

Using tools of Information Geometry, the minimum distance between two elements of a statistical manifold is defined by the corresponding geodesic, e.g. the minimum length curve that connects them. Such a curve, where the probability distribution functions in the case of our meteorological data are two parameter Weibull distributions, satisfies a 2nd order Boundary Value (BV) system. We study the numerical treatment of the resulting special quadratic form system using Shooting method. We compare the solutions of the problem when we employ a classical Singly Diagonally Implicit Runge Kutta (SDIRK) 4(3) pair of methods and a quadratic SDIRK 5(3) pair . Both pairs have the same computational costs whereas the second one attains higher order as it is specially constructed for quadratic problems.

Relative commutativity degree of some dihedral groups

NASA Astrophysics Data System (ADS)

Abdul Hamid, Muhanizah; Mohd Ali, Nor Muhainiah; Sarmin, Nor Haniza; Abd Manaf, Fadila Normahia

2013-04-01

The commutativity degree of a finite group G was introduced by Erdos and Turan for symmetric groups, finite groups and finite rings in 1968. The commutativity degree, P(G), is defined as the probability that a random pair of elements in a group commute. The relative commutativity degree of a group G is defined as the probability for an element of subgroup, H and an element of G to commute with one another and denoted by P(H,G). In this research the relative commutativity degree of some dihedral groups are determined.

Implications of fault constitutive properties for earthquake prediction.

PubMed Central

Dieterich, J H; Kilgore, B

1996-01-01

The rate- and state-dependent constitutive formulation for fault slip characterizes an exceptional variety of materials over a wide range of sliding conditions. This formulation provides a unified representation of diverse sliding phenomena including slip weakening over a characteristic sliding distance Dc, apparent fracture energy at a rupture front, time-dependent healing after rapid slip, and various other transient and slip rate effects. Laboratory observations and theoretical models both indicate that earthquake nucleation is accompanied by long intervals of accelerating slip. Strains from the nucleation process on buried faults generally could not be detected if laboratory values of Dc apply to faults in nature. However, scaling of Dc is presently an open question and the possibility exists that measurable premonitory creep may precede some earthquakes. Earthquake activity is modeled as a sequence of earthquake nucleation events. In this model, earthquake clustering arises from sensitivity of nucleation times to the stress changes induced by prior earthquakes. The model gives the characteristic Omori aftershock decay law and assigns physical interpretation to aftershock parameters. The seismicity formulation predicts large changes of earthquake probabilities result from stress changes. Two mechanisms for foreshocks are proposed that describe observed frequency of occurrence of foreshock-mainshock pairs by time and magnitude. With the first mechanism, foreshocks represent a manifestation of earthquake clustering in which the stress change at the time of the foreshock increases the probability of earthquakes at all magnitudes including the eventual mainshock. With the second model, accelerating fault slip on the mainshock nucleation zone triggers foreshocks. Images Fig. 3 PMID:11607666

Structural energetics of the adenine tract from an intrinsic transcription terminator.

PubMed

Huang, Yuegao; Weng, Xiaoli; Russu, Irina M

2010-04-02

Intrinsic transcription termination sites generally contain a tract of adenines in the DNA template that yields a tract of uracils at the 3' end of the nascent RNA. To understand how this base sequence contributes to termination of transcription, we have investigated two nucleic acid structures. The first is the RNA-DNA hybrid that contains the uracil tract 5'-rUUUUUAU-3' from the tR2 intrinsic terminator of bacteriophage lambda. The second is the homologous DNA-DNA duplex that contains the adenine tract 5'-dATAAAAA-3'. This duplex is present at the tR2 site when the DNA is not transcribed. The opening and the stability of each rU-dA/dT-dA base pair in the two structures are characterized by imino proton exchange and nuclear magnetic resonance spectroscopy. The results reveal concerted opening of the central rU-dA base pairs in the RNA-DNA hybrid. Furthermore, the stability profile of the adenine tract in the RNA-DNA hybrid is very different from that of the tract in the template DNA-DNA duplex. In the RNA-DNA hybrid, the stabilities of rU-dA base pairs range from 4.3 to 6.5 kcal/mol (at 10 degrees C). The sites of lowest stability are identified at the central positions of the tract. In the template DNA-DNA duplex, the dT-dA base pairs are more stable than the corresponding rU-dA base pairs in the hybrid by 0.9 to 4.6 kcal/mol and, in contrast to the RNA-DNA hybrid, the central base pairs have the highest stability. These results suggest that the central rU-dA/dT-dA base pairs in the adenine tract make the largest energetic contributions to transcription termination by promoting both the dissociation of the RNA transcript and the closing of the transcription bubble. The results also suggest that the high stability of dT-dA base pairs in the DNA provides a signal for the pausing of RNA polymerase at the termination site. Copyright 2010 Elsevier Ltd. All rights reserved.

Open Quantum Random Walks on the Half-Line: The Karlin-McGregor Formula, Path Counting and Foster's Theorem

NASA Astrophysics Data System (ADS)

Jacq, Thomas S.; Lardizabal, Carlos F.

2017-11-01

In this work we consider open quantum random walks on the non-negative integers. By considering orthogonal matrix polynomials we are able to describe transition probability expressions for classes of walks via a matrix version of the Karlin-McGregor formula. We focus on absorbing boundary conditions and, for simpler classes of examples, we consider path counting and the corresponding combinatorial tools. A non-commutative version of the gambler's ruin is studied by obtaining the probability of reaching a certain fortune and the mean time to reach a fortune or ruin in terms of generating functions. In the case of the Hadamard coin, a counting technique for boundary restricted paths in a lattice is also presented. We discuss an open quantum version of Foster's Theorem for the expected return time together with applications.

Virial Coefficients for the Liquid Argon

NASA Astrophysics Data System (ADS)

Korth, Micheal; Kim, Saesun

2014-03-01

We begin with a geometric model of hard colliding spheres and calculate probability densities in an iterative sequence of calculations that lead to the pair correlation function. The model is based on a kinetic theory approach developed by Shinomoto, to which we added an interatomic potential for argon based on the model from Aziz. From values of the pair correlation function at various values of density, we were able to find viral coefficients of liquid argon. The low order coefficients are in good agreement with theoretical hard sphere coefficients, but appropriate data for argon to which these results might be compared is difficult to find.

Unitary limit in crossed Andreev transport

DOE PAGES

Sadovskyy, I. A.; Lesovik, G. B.; Vinokur, V. M.

2015-10-08

One of the most promising approaches for generating spin- and energy-entangled electron pairs is splitting a Cooper pair into the metal through spatially separated terminals. Utilizing hybrid systems with the energy-dependent barriers at the superconductor/normal metal (NS) interfaces, one can achieve a practically 100% efficiency outcome of entangled electrons. We investigate a minimalistic one-dimensional model comprising a superconductor and two metallic leads and derive an expression for an electron-to-hole transmission probability as a measure of splitting efficiency. We find the conditions for achieving 100% efficiency and present analytical results for the differential conductance and differential noise.

Initiation at closely spaced replication origins in a yeast chromosome.

PubMed

Brewer, B J; Fangman, W L

1993-12-10

Replication of eukaryotic chromosomes involves initiation at origins spaced an average of 50 to 100 kilobase pairs. In yeast, potential origins can be recognized as autonomous replication sequences (ARSs) that allow maintenance of plasmids. However, there are more ARS elements than active chromosomal origins. The possibility was examined that close spacing of ARSs can lead to inactive origins. Two ARSs located 6.5 kilobase pairs apart can indeed interfere with each other. Replication is initiated from one or the other ARS with equal probability, but rarely (< 5%) from both ARSs on the same DNA molecule.

A positivity result in the theory of Macdonald polynomials

PubMed Central

Garsia, A. M.; Haglund, J.

2001-01-01

We outline here a proof that a certain rational function Cn(q, t), which has come to be known as the “q, t-Catalan,” is in fact a polynomial with positive integer coefficients. This has been an open problem since 1994. Because Cn(q, t) evaluates to the Catalan number at t = q = 1, it has also been an open problem to find a pair of statistics a, b on the collection 𝒟n of Dyck paths Π of length 2n yielding Cn(q, t) = ∑π ta(Π)qb(Π). Our proof is based on a recursion for Cn(q, t) suggested by a pair of statistics recently proposed by J. Haglund. One of the byproducts of our results is a proof of the validity of Haglund's conjecture. PMID:11274351

Dual origin of pairing in nuclei

NASA Astrophysics Data System (ADS)

Idini, A.; Potel, G.; Barranco, F.; Vigezzi, E.; Broglia, R. A.

2016-11-01

The pairing correlations of the nucleus 120Sn are calculated by solving the Nambu-Gor'kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong 1 S 0 short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- ( v p bare) and long-range ( v p ind) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

Bivariate extreme value distributions

NASA Technical Reports Server (NTRS)

Elshamy, M.

1992-01-01

In certain engineering applications, such as those occurring in the analyses of ascent structural loads for the Space Transportation System (STS), some of the load variables have a lower bound of zero. Thus, the need for practical models of bivariate extreme value probability distribution functions with lower limits was identified. We discuss the Gumbel models and present practical forms of bivariate extreme probability distributions of Weibull and Frechet types with two parameters. Bivariate extreme value probability distribution functions can be expressed in terms of the marginal extremel distributions and a 'dependence' function subject to certain analytical conditions. Properties of such bivariate extreme distributions, sums and differences of paired extremals, as well as the corresponding forms of conditional distributions, are discussed. Practical estimation techniques are also given.

The effect of incremental changes in phonotactic probability and neighborhood density on word learning by preschool children

PubMed Central

Storkel, Holly L.; Bontempo, Daniel E.; Aschenbrenner, Andrew J.; Maekawa, Junko; Lee, Su-Yeon

2013-01-01

Purpose Phonotactic probability or neighborhood density have predominately been defined using gross distinctions (i.e., low vs. high). The current studies examined the influence of finer changes in probability (Experiment 1) and density (Experiment 2) on word learning. Method The full range of probability or density was examined by sampling five nonwords from each of four quartiles. Three- and 5-year-old children received training on nonword-nonobject pairs. Learning was measured in a picture-naming task immediately following training and 1-week after training. Results were analyzed using multi-level modeling. Results A linear spline model best captured nonlinearities in phonotactic probability. Specifically word learning improved as probability increased in the lowest quartile, worsened as probability increased in the midlow quartile, and then remained stable and poor in the two highest quartiles. An ordinary linear model sufficiently described neighborhood density. Here, word learning improved as density increased across all quartiles. Conclusion Given these different patterns, phonotactic probability and neighborhood density appear to influence different word learning processes. Specifically, phonotactic probability may affect recognition that a sound sequence is an acceptable word in the language and is a novel word for the child, whereas neighborhood density may influence creation of a new representation in long-term memory. PMID:23882005

Open Mess Management Career Ladder AFS 742X0 and CEM Code 74200.

DTIC Science & Technology

1980-12-01

I. OPEN MESS MANAGERS (SPC049, N=187) 11. FOOD / BEVERAGE OPERATIONS ASSISTANI MANAGERS ’LUSTER (GRP076, N=92) a. Bar and Operations Managers (GKP085...said they will or probably will reenlist. 1I. FOOD / BEVERAGE OPERATIONS ASSISTANT MANAGERS CLUSTER (GRP076).- This cluster of 9-2 reslpo nrts-(23...operation of open mess food and beverage functions. The majority of these airmen identify themselves as Assistant Managers of open mess facilities and are

Freezing transition of the random bond RNA model: Statistical properties of the pairing weights

NASA Astrophysics Data System (ADS)

Monthus, Cécile; Garel, Thomas

2007-03-01

To characterize the pairing specificity of RNA secondary structures as a function of temperature, we analyze the statistics of the pairing weights as follows: for each base (i) of the sequence of length N , we consider the (N-1) pairing weights wi(j) with the other bases (j≠i) of the sequence. We numerically compute the probability distributions P1(w) of the maximal weight wimax=maxj[wi(j)] , the probability distribution Π(Y2) of the parameter Y2(i)=∑jwi2(j) , as well as the average values of the moments Yk(i)=∑jwik(j) . We find that there are two important temperatures TcTgap , the distribution P1(w) vanishes at some value w0(T)<1 , and accordingly the moments Yk(i)¯ decay exponentially as [w0(T)]k in k . For T

Bonding in Heavier Group 14 Zero-Valent Complexes-A Combined Maximum Probability Domain and Valence Bond Theory Approach.

PubMed

Turek, Jan; Braïda, Benoît; De Proft, Frank

2017-10-17

The bonding in heavier Group 14 zero-valent complexes of a general formula L 2 E (E=Si-Pb; L=phosphine, N-heterocyclic and acyclic carbene, cyclic tetrylene and carbon monoxide) is probed by combining valence bond (VB) theory and maximum probability domain (MPD) approaches. All studied complexes are initially evaluated on the basis of the structural parameters and the shape of frontier orbitals revealing a bent structural motif and the presence of two lone pairs at the central E atom. For the VB calculations three resonance structures are suggested, representing the "ylidone", "ylidene" and "bent allene" structures, respectively. The influence of both ligands and central atoms on the bonding situation is clearly expressed in different weights of the resonance structures for the particular complexes. In general, the bonding in the studied E 0 compounds, the tetrylones, is best described as a resonating combination of "ylidone" and "ylidene" structures with a minor contribution of the "bent allene" structure. Moreover, the VB calculations allow for a straightforward assessment of the π-backbonding (E→L) stabilization energy. The validity of the suggested resonance model is further confirmed by the complementary MPD calculations focusing on the E lone pair region as well as the E-L bonding region. Likewise, the MPD method reveals a strong influence of the σ-donating and π-accepting properties of the ligand. In particular, either one single domain or two symmetrical domains are found in the lone pair region of the central atom, supporting the predominance of either the "ylidene" or "ylidone" structures having one or two lone pairs at the central atom, respectively. Furthermore, the calculated average populations in the lone pair MPDs correlate very well with the natural bond orbital (NBO) populations, and can be related to the average number of electrons that is backdonated to the ligands. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Kappa statistic for clustered matched-pair data.

PubMed

Yang, Zhao; Zhou, Ming

2014-07-10

Kappa statistic is widely used to assess the agreement between two procedures in the independent matched-pair data. For matched-pair data collected in clusters, on the basis of the delta method and sampling techniques, we propose a nonparametric variance estimator for the kappa statistic without within-cluster correlation structure or distributional assumptions. The results of an extensive Monte Carlo simulation study demonstrate that the proposed kappa statistic provides consistent estimation and the proposed variance estimator behaves reasonably well for at least a moderately large number of clusters (e.g., K ≥50). Compared with the variance estimator ignoring dependence within a cluster, the proposed variance estimator performs better in maintaining the nominal coverage probability when the intra-cluster correlation is fair (ρ ≥0.3), with more pronounced improvement when ρ is further increased. To illustrate the practical application of the proposed estimator, we analyze two real data examples of clustered matched-pair data. Copyright © 2014 John Wiley & Sons, Ltd.

Active Listening in a Bat Cocktail Party: Adaptive Echolocation and Flight Behaviors of Big Brown Bats, Eptesicus fuscus, Foraging in a Cluttered Acoustic Environment.

PubMed

Warnecke, Michaela; Chiu, Chen; Engelberg, Jonathan; Moss, Cynthia F

2015-09-01

In their natural environment, big brown bats forage for small insects in open spaces, as well as in vegetation and in the presence of acoustic clutter. While searching and hunting for prey, bats experience sonar interference, not only from densely cluttered environments, but also from calls of conspecifics foraging in close proximity. Previous work has shown that when two bats compete for a single prey item in a relatively open environment, one of the bats may go silent for extended periods of time, which can serve to minimize sonar interference between conspecifics. Additionally, pairs of big brown bats have been shown to adjust frequency characteristics of their vocalizations to avoid acoustic interference in echo processing. In this study, we extended previous work by examining how the presence of conspecifics and environmental clutter influence the bat's echolocation behavior. By recording multichannel audio and video data of bats engaged in insect capture in open and cluttered spaces, we quantified the bats' vocal and flight behaviors. Big brown bats flew individually and in pairs in an open and cluttered room, and the results of this study shed light on the different strategies that this species employs to negotiate a complex and dynamic environment. © 2015 S. Karger AG, Basel.

Selfish routing equilibrium in stochastic traffic network: A probability-dominant description.

PubMed

Zhang, Wenyi; He, Zhengbing; Guan, Wei; Ma, Rui

2017-01-01

This paper suggests a probability-dominant user equilibrium (PdUE) model to describe the selfish routing equilibrium in a stochastic traffic network. At PdUE, travel demands are only assigned to the most dominant routes in the same origin-destination pair. A probability-dominant rerouting dynamic model is proposed to explain the behavioral mechanism of PdUE. To facilitate applications, the logit formula of PdUE is developed, of which a well-designed route set is not indispensable and the equivalent varitional inequality formation is simple. Two routing strategies, i.e., the probability-dominant strategy (PDS) and the dominant probability strategy (DPS), are discussed through a hypothetical experiment. It is found that, whether out of insurance or striving for perfection, PDS is a better choice than DPS. For more general cases, the conducted numerical tests lead to the same conclusion. These imply that PdUE (rather than the conventional stochastic user equilibrium) is a desirable selfish routing equilibrium for a stochastic network, given that the probability distributions of travel time are available to travelers.

Selfish routing equilibrium in stochastic traffic network: A probability-dominant description

PubMed Central

Zhang, Wenyi; Guan, Wei; Ma, Rui

2017-01-01

This paper suggests a probability-dominant user equilibrium (PdUE) model to describe the selfish routing equilibrium in a stochastic traffic network. At PdUE, travel demands are only assigned to the most dominant routes in the same origin-destination pair. A probability-dominant rerouting dynamic model is proposed to explain the behavioral mechanism of PdUE. To facilitate applications, the logit formula of PdUE is developed, of which a well-designed route set is not indispensable and the equivalent varitional inequality formation is simple. Two routing strategies, i.e., the probability-dominant strategy (PDS) and the dominant probability strategy (DPS), are discussed through a hypothetical experiment. It is found that, whether out of insurance or striving for perfection, PDS is a better choice than DPS. For more general cases, the conducted numerical tests lead to the same conclusion. These imply that PdUE (rather than the conventional stochastic user equilibrium) is a desirable selfish routing equilibrium for a stochastic network, given that the probability distributions of travel time are available to travelers. PMID:28829834

Force Density Function Relationships in 2-D Granular Media

NASA Technical Reports Server (NTRS)

Youngquist, Robert C.; Metzger, Philip T.; Kilts, Kelly N.

2004-01-01

An integral transform relationship is developed to convert between two important probability density functions (distributions) used in the study of contact forces in granular physics. Developing this transform has now made it possible to compare and relate various theoretical approaches with one another and with the experimental data despite the fact that one may predict the Cartesian probability density and another the force magnitude probability density. Also, the transforms identify which functional forms are relevant to describe the probability density observed in nature, and so the modified Bessel function of the second kind has been identified as the relevant form for the Cartesian probability density corresponding to exponential forms in the force magnitude distribution. Furthermore, it is shown that this transform pair supplies a sufficient mathematical framework to describe the evolution of the force magnitude distribution under shearing. Apart from the choice of several coefficients, whose evolution of values must be explained in the physics, this framework successfully reproduces the features of the distribution that are taken to be an indicator of jamming and unjamming in a granular packing. Key words. Granular Physics, Probability Density Functions, Fourier Transforms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Philippov, Alexander A.; Cerutti, Benoit; Spitkovsky, Anatoly

It has recently been demonstrated that self-consistent particle-in-cell simulations of low-obliquity pulsar magnetospheres in flat spacetime show weak particle acceleration and no pair production near the poles. We investigate the validity of this conclusion in a more realistic spacetime geometry via general-relativistic particle-in-cell simulations of the aligned pulsar magnetosphere with pair formation. We find that the addition of the frame-dragging effect makes the local current density along the magnetic field larger than the Goldreich–Julian value, which leads to unscreened parallel electric fields and the ignition of a pair cascade. When pair production is active, we observe field oscillations in themore » open field bundle, which could be related to pulsar radio emission. We conclude that general-relativistic effects are essential for the existence of the pulsar mechanism in low-obliquity rotators.« less

In situ measurement system

DOEpatents

Lord, D.E.

1980-11-24

A multipurpose in situ underground measurement system comprising a plurality of long electrical resistance elements in the form of rigid reinforcing bars, each having an open loop hairpin configuration of shorter length than the other resistance elements. The resistance elements are arranged in pairs in a unitized structure, and grouted in place in the underground volume. Measurement means are provided for obtaining for each pair the electrical resistance of each element and the difference in electrical resistance of the paired elements, which difference values may be used in analytical methods involving resistance as a function of temperature. A scanner means sequentially connects the resistance-measuring apparatus to each individual pair of elements. A source of heating current is also selectively connectable for heating the elements to an initial predetermined temperature prior to electrical resistance measurements when used as an anemometer.

SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

PubMed

Villard, Pierre; Malausa, Thibaut

2013-07-01

SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

Design of an activity landscape view taking compound-based feature probabilities into account.

PubMed

Zhang, Bijun; Vogt, Martin; Bajorath, Jürgen

2014-09-01

Activity landscapes (ALs) of compound data sets are rationalized as graphical representations that integrate similarity and potency relationships between active compounds. ALs enable the visualization of structure-activity relationship (SAR) information and are thus computational tools of interest for medicinal chemistry. For AL generation, similarity and potency relationships are typically evaluated in a pairwise manner and major AL features are assessed at the level of compound pairs. In this study, we add a conditional probability formalism to AL design that makes it possible to quantify the probability of individual compounds to contribute to characteristic AL features. Making this information graphically accessible in a molecular network-based AL representation is shown to further increase AL information content and helps to quickly focus on SAR-informative compound subsets. This feature probability-based AL variant extends the current spectrum of AL representations for medicinal chemistry applications.

Synergistic interplay of Gβγ and phosphatidylinositol 4,5-bisphosphate dictates Kv7.4 channel activity.

PubMed

Povstyan, Oleksandr V; Barrese, Vincenzo; Stott, Jennifer B; Greenwood, Iain A

2017-02-01

Kv7.4 channels are key determinants of arterial contractility and cochlear mechanosensation that, like all Kv7 channels, have an obligatory requirement for phosphatidylinositol 4,5-bisphosphate (PIP 2 ). βγ G proteins (Gβγ) have been identified as novel positive regulators of Kv7.4. The present study ascertained whether Gβγ increased Kv7.4 open probability through an increased sensitivity to PIP 2 . In HEK cells stably expressing Kv7.4, PIP 2 or Gβγ increased open probability in a concentration dependent manner. Depleting PIP 2 prevented any Gβγ-mediated stimulation whilst an array of Gβγ inhibitors prohibited any PIP 2 -induced current enhancement. A combination of PIP 2 and Gβγ at sub-efficacious concentrations increased channel open probability considerably. The stimulatory effects of three Kv7.2-7.5 channel activators were also lost by PIP 2 depletion or Gβγ inhibitors. This study alters substantially our understanding of the fundamental processes that dictate Kv7.4 activity, revealing a more complex and subtle paradigm where the reliance on local phosphoinositide is dictated by interaction with Gβγ.

A new probable stem lineage crustacean with three-dimensionally preserved soft parts from the Herefordshire (Silurian) Lagerstätte, UK

PubMed Central

Siveter, Derek J; Sutton, Mark D; Briggs, Derek E.G; Siveter, David J

2007-01-01

A new arthropod with three-dimensionally preserved soft parts, Tanazios dokeron, is described from the Wenlock Series (Silurian) of Herefordshire, England, UK. Serial grinding, digital photographic and computer rendering techniques yielded ‘virtual fossils’ in the round for study. The body tagmata of T. dokeron comprise a head shield and a long trunk. The head shield bears six pairs of horn-like spines and the head bears five pairs of appendages. The antennule, antenna and mandible are all uniramous, and the mandible includes a gnathobasic coxa. Appendages four and five are biramous and similar to those of the trunk: each comprises a limb base with an endite, an enditic membrane, and two epipodites, plus an endopod and exopod. The hypostome bears a large cone-like projection centrally, and there may be a short labrum. The trunk has some 64 segments and at least 60 appendage pairs. A very small telson has the anus sited ventrally in its posterior part and also bears a caudal furca. Comparative morphological and cladistic analyses of T. dokeron indicate a crustacean affinity, with a probable position in the eucrustacean stem group. As such the epipodites in T. dokeron are the first recorded in a eucrustacean stem taxon. The new species is interpreted as a benthic or nektobenthic scavenger. PMID:17609185

Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

PubMed Central

2018-01-01

Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424

Fluctuation relation for heat exchange in Markovian open quantum systems

NASA Astrophysics Data System (ADS)

Ramezani, M.; Golshani, M.; Rezakhani, A. T.

2018-04-01

A fluctuation relation for the heat exchange of an open quantum system under a thermalizing Markovian dynamics is derived. We show that the probability that the system absorbs an amount of heat from its bath, at a given time interval, divided by the probability of the reverse process (releasing the same amount of heat to the bath) is given by an exponential factor which depends on the amount of heat and the difference between the temperatures of the system and the bath. Interestingly, this relation is akin to the standard form of the fluctuation relation (for forward-backward dynamics). We also argue that the probability of the violation of the second law of thermodynamics in the form of the Clausius statement (i.e., net heat transfer from a cold system to its hot bath) drops exponentially with both the amount of heat and the temperature differences of the baths.

Fluctuation relation for heat exchange in Markovian open quantum systems.

PubMed

Ramezani, M; Golshani, M; Rezakhani, A T

2018-04-01

A fluctuation relation for the heat exchange of an open quantum system under a thermalizing Markovian dynamics is derived. We show that the probability that the system absorbs an amount of heat from its bath, at a given time interval, divided by the probability of the reverse process (releasing the same amount of heat to the bath) is given by an exponential factor which depends on the amount of heat and the difference between the temperatures of the system and the bath. Interestingly, this relation is akin to the standard form of the fluctuation relation (for forward-backward dynamics). We also argue that the probability of the violation of the second law of thermodynamics in the form of the Clausius statement (i.e., net heat transfer from a cold system to its hot bath) drops exponentially with both the amount of heat and the temperature differences of the baths.

Determining open cluster membership. A Bayesian framework for quantitative member classification

NASA Astrophysics Data System (ADS)

Stott, Jonathan J.

2018-01-01

Aims: My goal is to develop a quantitative algorithm for assessing open cluster membership probabilities. The algorithm is designed to work with single-epoch observations. In its simplest form, only one set of program images and one set of reference images are required. Methods: The algorithm is based on a two-stage joint astrometric and photometric assessment of cluster membership probabilities. The probabilities were computed within a Bayesian framework using any available prior information. Where possible, the algorithm emphasizes simplicity over mathematical sophistication. Results: The algorithm was implemented and tested against three observational fields using published survey data. M 67 and NGC 654 were selected as cluster examples while a third, cluster-free, field was used for the final test data set. The algorithm shows good quantitative agreement with the existing surveys and has a false-positive rate significantly lower than the astrometric or photometric methods used individually.

Flavor network and the principles of food pairing

PubMed Central

Ahn, Yong-Yeol; Ahnert, Sebastian E.; Bagrow, James P.; Barabási, Albert-László

2011-01-01

The cultural diversity of culinary practice, as illustrated by the variety of regional cuisines, raises the question of whether there are any general patterns that determine the ingredient combinations used in food today or principles that transcend individual tastes and recipes. We introduce a flavor network that captures the flavor compounds shared by culinary ingredients. Western cuisines show a tendency to use ingredient pairs that share many flavor compounds, supporting the so-called food pairing hypothesis. By contrast, East Asian cuisines tend to avoid compound sharing ingredients. Given the increasing availability of information on food preparation, our data-driven investigation opens new avenues towards a systematic understanding of culinary practice. PMID:22355711

Topological phases in a Kitaev chain with imbalanced pairing

NASA Astrophysics Data System (ADS)

Li, C.; Zhang, X. Z.; Zhang, G.; Song, Z.

2018-03-01

We systematically study a Kitaev chain with imbalanced pair creation and annihilation, which is introduced by non-Hermitian pairing terms. An exact phase diagram shows that the topological phase is still robust under the influence of the conditional imbalance. The gapped phases are characterized by a topological invariant, the extended Zak phase, which is defined by the biorthonormal inner product. Such phases are destroyed at the points where the coalescence of ground states occurs, associated with the time-reversal symmetry breaking. We find that the Majorana edge modes also exist in an open chain in the time-reversal symmetry-unbroken region, demonstrating the bulk-edge correspondence in such a non-Hermitian system.

Understanding the Thermodynamics of Biological Order

ERIC Educational Resources Information Center

Peterson, Jacob

2012-01-01

By growth in size and complexity (i.e., changing from more probable to less probable states), plants and animals appear to defy the second law of thermodynamics. The usual explanation describes the input of nutrient and sunlight energy into open thermodynamic systems. However, energy input alone does not address the ability to organize and create…

Resonances in the cumulative reaction probability for a model electronically nonadiabatic reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qi, J.; Bowman, J.M.

1996-05-01

The cumulative reaction probability, flux{endash}flux correlation function, and rate constant are calculated for a model, two-state, electronically nonadiabatic reaction, given by Shin and Light [S. Shin and J. C. Light, J. Chem. Phys. {bold 101}, 2836 (1994)]. We apply straightforward generalizations of the flux matrix/absorbing boundary condition approach of Miller and co-workers to obtain these quantities. The upper adiabatic electronic potential supports bound states, and these manifest themselves as {open_quote}{open_quote}recrossing{close_quote}{close_quote} resonances in the cumulative reaction probability, at total energies above the barrier to reaction on the lower adiabatic potential. At energies below the barrier, the cumulative reaction probability for themore » coupled system is shifted to higher energies relative to the one obtained for the ground state potential. This is due to the effect of an additional effective barrier caused by the nuclear kinetic operator acting on the ground state, adiabatic electronic wave function, as discussed earlier by Shin and Light. Calculations are reported for five sets of electronically nonadiabatic coupling parameters. {copyright} {ital 1996 American Institute of Physics.}« less

Magnetic field enhancement of organic photovoltaic cells performance.

PubMed

Oviedo-Casado, S; Urbina, A; Prior, J

2017-06-27

Charge separation is a critical process for achieving high efficiencies in organic photovoltaic cells. The initial tightly bound excitonic electron-hole pair has to dissociate fast enough in order to avoid photocurrent generation and thus power conversion efficiency loss via geminate recombination. Such process takes place assisted by transitional states that lie between the initial exciton and the free charge state. Due to spin conservation rules these intermediate charge transfer states typically have singlet character. Here we propose a donor-acceptor model for a generic organic photovoltaic cell in which the process of charge separation is modulated by a magnetic field which tunes the energy levels. The impact of a magnetic field is to intensify the generation of charge transfer states with triplet character via inter-system crossing. As the ground state of the system has singlet character, triplet states are recombination-protected, thus leading to a higher probability of successful charge separation. Using the open quantum systems formalism we demonstrate that the population of triplet charge transfer states grows in the presence of a magnetic field, and discuss the impact on carrier population and hence photocurrent, highlighting its potential as a tool for research on charge transfer kinetics in this complex systems.

Integrating Physical and Topographic Information Into a Fuzzy Scheme to Map Flooded Area by SAR

PubMed Central

Pierdicca, Nazzareno; Chini, Marco; Pulvirenti, Luca; Macina, Flavia

2008-01-01

A flood mapping procedure based on a fuzzy sets theory has been developed. The method is based on the integration of Synthetic Aperture Radar (SAR) measurements with additional data on the inundated area, such as a land cover map and a digital elevation model (DEM). The information on land cover has allowed us to account for both specular reflection, typical of open water, and double bounce backscattering, typical of forested and urban areas. DEM has been exploited to include simple hydraulic considerations on the dependence of inundation probability on surface characteristics. Contextual information has been taken into account too. The proposed algorithm has been tested on a flood occurred in Italy on November 1994. A pair of ERS-1 images, collected before and after (three days later) the flood, has been used. The results have been compared with the data provided by a ground survey carried out when the flood reached its maximum extension. Despite the temporal mismatch between the survey and the post-inundation SAR image, the comparison has yielded encouraging results, with the 87% of the pixels correctly classified as inundated. PMID:27879928

Correlations between Community Structure and Link Formation in Complex Networks

PubMed Central

Liu, Zhen; He, Jia-Lin; Kapoor, Komal; Srivastava, Jaideep

2013-01-01

Background Links in complex networks commonly represent specific ties between pairs of nodes, such as protein-protein interactions in biological networks or friendships in social networks. However, understanding the mechanism of link formation in complex networks is a long standing challenge for network analysis and data mining. Methodology/Principal Findings Links in complex networks have a tendency to cluster locally and form so-called communities. This widely existed phenomenon reflects some underlying mechanism of link formation. To study the correlations between community structure and link formation, we present a general computational framework including a theory for network partitioning and link probability estimation. Our approach enables us to accurately identify missing links in partially observed networks in an efficient way. The links having high connection likelihoods in the communities reveal that links are formed preferentially to create cliques and accordingly promote the clustering level of the communities. The experimental results verify that such a mechanism can be well captured by our approach. Conclusions/Significance Our findings provide a new insight into understanding how links are created in the communities. The computational framework opens a wide range of possibilities to develop new approaches and applications, such as community detection and missing link prediction. PMID:24039818

Redescription of Spirodentalium Walcott ( Gastropoda: Late Cambrian) from Wisconsin ( USA).

USGS Publications Warehouse

Yochelson, E.L.

1987-01-01

Spirodentalium Walcott, 1890, was originally described as a scaphopod. A reinterpretation of the type lot suggests that its overall shape is that of an open-coiled gastropod. If so, this is probably the earliest known open-coiled form and it is sinistral in coiling direction. -Author

College Students' Openness toward Autism Spectrum Disorders: Improving Peer Acceptance

ERIC Educational Resources Information Center

Nevill, Rose E. A.; White, Susan W.

2011-01-01

One probable consequence of rising rates of autism spectrum disorder diagnosis in individuals without co-occurring intellectual disability is that more young adults with diagnoses or traits of ASD will attend college and require appropriate supports. This study sought to explore college students' openness to peers who demonstrate…

Two-photon geometrical phase

NASA Astrophysics Data System (ADS)

Strekalov, D. V.; Shih, Y. H.

1997-10-01

An advanced wave model is applied to a two-photon interference experiment to show that the observed interference effect is due to the geometrical phase of a two-photon state produced in spontaneous parametric down-conversion. The polarization state of the signal-idler pair is changed adiabatically so that the ``loop'' on the Poincaré sphere is opened in the signal channel and closed in the idler channel. Therefore, we observed an essentially nonlocal geometrical phase, shared by the entangled photon pair, or a biphoton.

Alternative probability theories for cognitive psychology.

PubMed

Narens, Louis

2014-01-01

Various proposals for generalizing event spaces for probability functions have been put forth in the mathematical, scientific, and philosophic literatures. In cognitive psychology such generalizations are used for explaining puzzling results in decision theory and for modeling the influence of context effects. This commentary discusses proposals for generalizing probability theory to event spaces that are not necessarily boolean algebras. Two prominent examples are quantum probability theory, which is based on the set of closed subspaces of a Hilbert space, and topological probability theory, which is based on the set of open sets of a topology. Both have been applied to a variety of cognitive situations. This commentary focuses on how event space properties can influence probability concepts and impact cognitive modeling. Copyright © 2013 Cognitive Science Society, Inc.

Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

PubMed Central

Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

2013-01-01

Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

Cowbird removals unexpectedly increase productivity of a brood parasite and the songbird host.

PubMed

Kosciuch, Karl L; Sandercock, Brett K

2008-03-01

Generalist brood parasites reduce productivity and population growth of avian hosts and have been implicated in population declines of several songbirds of conservation concern. To estimate the demographic effects of brood parasitism on Bell's Vireos (Vireo bellii), we removed Brown-headed Cowbirds (Molothrus ater) in a replicated switchback experimental design. Cowbird removals decreased parasitism frequency from 77% and 85% at unmanipulated plots to 58% and 47% at removal plots in 2004 and 2005, respectively. Vireo productivity per pair was higher at cowbird removal plots when years were pooled (mean = 2.6 +/- 0.2 [SE] young per pair) compared to unmanipulated plots (1.2 +/- 0.1). Nest desertion frequency was lower at cowbird removal plots (35% of parasitized nests) compared to unmanipulated plots (69%) because removal of host eggs was the proximate cue for nest desertion, and vireos experienced lower rates of egg loss at cowbird removal plots. Nest success was higher among unparasitized than parasitized nests, and parasitized nests at cowbird removal plots had a higher probability of success than parasitized nests at unmanipulated plots. Unexpectedly, cowbird productivity from vireo pairs was higher at cowbird removal plots (mean = 0.3 +/- 0.06 young per pair) than at unmanipulated plots (0.1 +/- 0.03) because fewer parasitized nests were deserted and the probability of nest success was higher. Our study provides the first evidence that increases in cowbird productivity may be an unintended consequence of cowbird control programs, especially during the initial years of trapping when parasitism may only be moderately reduced. Thus, understanding the demographic impacts of cowbird removals requires an informed understanding of the behavioral ecology of host-parasite interactions.

Technical Report on Modeling for Quasispecies Abundance Inference with Confidence Intervals from Metagenomic Sequence Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

McLoughlin, K.

2016-01-11

The overall aim of this project is to develop a software package, called MetaQuant, that can determine the constituents of a complex microbial sample and estimate their relative abundances by analysis of metagenomic sequencing data. The goal for Task 1 is to create a generative model describing the stochastic process underlying the creation of sequence read pairs in the data set. The stages in this generative process include the selection of a source genome sequence for each read pair, with probability dependent on its abundance in the sample. The other stages describe the evolution of the source genome from itsmore » nearest common ancestor with a reference genome, breakage of the source DNA into short fragments, and the errors in sequencing the ends of the fragments to produce read pairs.« less

Effects of selective serotonin reuptake inhibitors on thought-action fusion, metacognitions, and thought suppression in obsessive-compulsive disorder.

PubMed

Besiroglu, Lutfullah; Çetinkaya, Nuralay; Selvi, Yavuz; Atli, Abdullah

2011-01-01

We aimed to assess whether cognitive processes change over time in patients with obsessive-compulsive disorder (OCD) receiving selective serotonin reuptake inhibitors without cognitive behavioral therapy and to investigate the factors associated with probable cognitive changes. During the 16 weeks of the study, 55 patients who met the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, criteria for OCD received open-label treatment with sertraline (100-200 mg/d) or fluoxetine (40-80 mg/d) and were assessed using the Yale-Brown Obsessive-Compulsive Scale, Beck Depression Inventory (BDI), Thought-Action Fusion Scale (TAFS), Metacognitions Questionnaire (MCQ-30), and White Bear Suppression Inventory (WBSI). The Yale-Brown Obsessive-Compulsive Scale (P < .001), BDI (P < .001), TAFS morality (P < .005), MCQ-30 (P < .01), and WBSI (P < .005) scores at follow-up were significantly lower than baseline scores. When we excluded OCD patients with depressive disorder (n = 12), statistical significance in paired comparisons for MCQ and WBSI disappeared. Similarly, when OCD patients with religious obsessions (n = 16) were excluded, paired comparisons for MCQ and TAF morality were not statistically significant. Changes in BDI, TAFS morality, MCQ-30, and WBSI (P < .005) were significantly correlated with changes in severity of obsessions, but not that of compulsions. After controlling for the change in depression severity, significant correlations between changes in obsessive and cognitive scales did not continue to have statistical significance. The BDI changes (P < .05) significantly explained the changes in symptom severity in a linear regression model. Our findings suggest that selective serotonin reuptake inhibitors can change appraisals of obsessive intrusions via their effects on negative emotions. Copyright © 2011 Elsevier Inc. All rights reserved.

Competition in saccade target selection reveals attentional guidance by simultaneously active working memory representations.

PubMed

Beck, Valerie M; Hollingworth, Andrew

2017-02-01

The content of visual working memory (VWM) guides attention, but whether this interaction is limited to a single VWM representation or functional for multiple VWM representations is under debate. To test this issue, we developed a gaze-contingent search paradigm to directly manipulate selection history and examine the competition between multiple cue-matching saccade target objects. Participants first saw a dual-color cue followed by two pairs of colored objects presented sequentially. For each pair, participants selectively fixated an object that matched one of the cued colors. Critically, for the second pair, the cued color from the first pair was presented either with a new distractor color or with the second cued color. In the latter case, if two cued colors in VWM interact with selection simultaneously, we expected the second cued color object to generate substantial competition for selection, even though the first cued color was used to guide attention in the immediately previous pair. Indeed, in the second pair, selection probability of the first cued color was substantially reduced in the presence of the second cued color. This competition between cue-matching objects provides strong evidence that both VWM representations interacted simultaneously with selection. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Why do some women prefer submissive men? Hierarchically disparate couples reach higher reproductive success in European urban humans.

PubMed

Jozifkova, Eva; Konvicka, Martin; Flegr, Jaroslav

2014-01-01

Equality between partners is considering a feature of the functional partnerships in westernized societies. However, the evolutionary consequences of how in-pair hierarchy influences reproduction are less known. Attraction of some high-ranking women towards low-ranking men represents a puzzle. Young urban adults (120 men, 171 women) filled out a questionnaire focused on their sexual preference for higher or lower ranking partners, their future in-pair hierarchy, and hierarchy between their parents. Human pairs with a hierarchic disparity between partners conceive more offspring than pairs of equally-ranking individuals, who, in turn, conceive more offspring than pairs of two dominating partners. Importantly, the higher reproductive success of hierarchically disparate pairs holds, regardless of which sex, male or female, is the dominant one. In addition, the subjects preferring hierarchy disparity in partnerships were with greater probability sexually aroused by such disparity, suggesting that both the partnership preference and the triggers of sexual arousal may reflect a mating strategy. These results challenge the frequently held belief in within-pair equality as a trademark of functional partnerships. It rather appears that existence of some disparity improves within-pair cohesion, facilitating both cooperation between partners and improving the pairs' ability to face societal challenges. The parallel existence of submissivity-dominance hierarchies within human sexes allows for the parallel existence of alternative reproductive strategies, and may form a background for the diversity of mating systems observed in human societies. Arousal of overemphasized dominance/submissiveness may explain sadomasochistic sex, still little understood from the evolutionary psychology point of view.

Cardiac sodium channel Markov model with temperature dependence and recovery from inactivation.

PubMed Central

Irvine, L A; Jafri, M S; Winslow, R L

1999-01-01

A Markov model of the cardiac sodium channel is presented. The model is similar to the CA1 hippocampal neuron sodium channel model developed by Kuo and Bean (1994. Neuron. 12:819-829) with the following modifications: 1) an additional open state is added; 2) open-inactivated transitions are made voltage-dependent; and 3) channel rate constants are exponential functions of enthalpy, entropy, and voltage and have explicit temperature dependence. Model parameters are determined using a simulated annealing algorithm to minimize the error between model responses and various experimental data sets. The model reproduces a wide range of experimental data including ionic currents, gating currents, tail currents, steady-state inactivation, recovery from inactivation, and open time distributions over a temperature range of 10 degrees C to 25 degrees C. The model also predicts measures of single channel activity such as first latency, probability of a null sweep, and probability of reopening. PMID:10096885

Means for supporting fuel elements in a nuclear reactor

DOEpatents

Andrews, Harry N.; Keller, Herbert W.

1980-01-01

A grid structure for a nuclear reactor fuel assembly comprising a plurality of connecting members forming at least one longitudinally extending opening peripheral and inner fuel element openings through each of which openings at least one nuclear fuel element extends, said connecting members forming wall means surrounding said each peripheral and inner fuel element opening, a pair of rigid projections longitudinally spaced from one another extending from a portion of said wall means into said each peripheral and inner opening for rigidly engaging said each fuel element, respectively, yet permit individual longitudinal slippage thereof, and resilient means formed integrally on and from said wall means and positioned in said each peripheral and inner opening in opposed relationship with said projections and located to engage said fuel element to bias the latter into engagement with said rigid projections, respectively

Quantum chemistry study on the open end of single-walled carbon nanotubes

NASA Astrophysics Data System (ADS)

Hou, Shimin; Shen, Ziyong; Zhao, Xingyu; Xue, Zengquan

2003-05-01

Geometrical and electronic structures of open-ended single-walled carbon nanotubes (SWCNTs) are calculated using density functional theory (DFT) with hybrid functional (B3LYP) approximation. Due to different distances between carbon atoms along the edge, reconstruction occurs at the open end of the (4,4) armchair SWCNT, i.e., triple bonds are formed in the carbon atom pairs at the mouth; however, for the (6,0) zigzag SWCNT, electrons in dangling bonds still remain at 'no-bonding' states. The ionization potential (IP) of both (4,4) and (6,0) SWCNTs is increased by their negative intrinsic dipole moments, and localized electronic states existed at both of their open ends.

The formation of catalytically competent enzyme-substrate complex is not a bottleneck in lesion excision by human alkyladenine DNA glycosylase.

PubMed

Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S

2017-04-01

Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, T m , and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (T m (F/T) < T m (εA/T) < T m (Hx/T) < T m (A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.

Infants' statistical learning: 2- and 5-month-olds' segmentation of continuous visual sequences.

PubMed

Slone, Lauren Krogh; Johnson, Scott P

2015-05-01

Past research suggests that infants have powerful statistical learning abilities; however, studies of infants' visual statistical learning offer differing accounts of the developmental trajectory of and constraints on this learning. To elucidate this issue, the current study tested the hypothesis that young infants' segmentation of visual sequences depends on redundant statistical cues to segmentation. A sample of 20 2-month-olds and 20 5-month-olds observed a continuous sequence of looming shapes in which unit boundaries were defined by both transitional probability and co-occurrence frequency. Following habituation, only 5-month-olds showed evidence of statistically segmenting the sequence, looking longer to a statistically improbable shape pair than to a probable pair. These results reaffirm the power of statistical learning in infants as young as 5 months but also suggest considerable development of statistical segmentation ability between 2 and 5 months of age. Moreover, the results do not support the idea that infants' ability to segment visual sequences based on transitional probabilities and/or co-occurrence frequencies is functional at the onset of visual experience, as has been suggested previously. Rather, this type of statistical segmentation appears to be constrained by the developmental state of the learner. Factors contributing to the development of statistical segmentation ability during early infancy, including memory and attention, are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.

Operation of the PAVE PAWS Radar System at Beale Air Force Base, California. Part 2. Public Comment & AF Response.

DTIC Science & Technology

1980-07-01

trip next month to Europe , and when I come back. It’s for this reason that I was not able to have it all typed and prepared, and the Air Force was...millimeter of culture medium. A mutational event such as a change in a single base pair in the bacterial DNA, which is impossible to detect by standard...100) bacteria, a rare single mutation event with a probability of say I in 100,000,000, the probability of 10-8, will thus be amplified by a factor of

The separation distance distribution in electron-donor-acceptor systems and the wavelength dependence of free ion yields

NASA Astrophysics Data System (ADS)

Zhou, Jinwei; Findley, Bret R.; Braun, Charles L.; Sutin, Norman

2001-06-01

We recently reported that free radical ion quantum yields for electron-donor-acceptor (EDA) systems of alkylbenzenes-tetracyanoethylene (TCNE) exhibit a remarkable wavelength dependence in dichloromethane, a medium polarity solvent. We proposed that weak absorption by long-distance, unassociated or "random" D⋯A pairs is mainly responsible for the free radical ion yield. Here a model for the wavelength dependence of the free ion yield is developed for four systems in which differing degrees of EDA complex formation are present: 1,3,5-tri-tert-butylbenzene-TCNE in which only random pairs exist due to the bulky groups on the electron donor, and toluene—TCNE, 1,3,5-triethylbenzene-TCNE and 1,3,5-trimethylbenzene-TCNE. Mulliken-Hush theory is used to determine the excitation distance distribution of unassociated, random pairs at different wavelengths. For each absorption distribution, free radical ion yields at different wavelengths are then calculated using Onsager's result for the ion separation probability. Encouraging agreement between the calculated yields and our experimental results is obtained. As far as we are aware, this is the first time that photoexcitation of unassociated donor/acceptor pairs has been invoked as the source of separated radical ion pairs.

An Effective Big Data Supervised Imbalanced Classification Approach for Ortholog Detection in Related Yeast Species

PubMed Central

Galpert, Deborah; del Río, Sara; Herrera, Francisco; Ancede-Gallardo, Evys; Antunes, Agostinho; Agüero-Chapin, Guillermin

2015-01-01

Orthology detection requires more effective scaling algorithms. In this paper, a set of gene pair features based on similarity measures (alignment scores, sequence length, gene membership to conserved regions, and physicochemical profiles) are combined in a supervised pairwise ortholog detection approach to improve effectiveness considering low ortholog ratios in relation to the possible pairwise comparison between two genomes. In this scenario, big data supervised classifiers managing imbalance between ortholog and nonortholog pair classes allow for an effective scaling solution built from two genomes and extended to other genome pairs. The supervised approach was compared with RBH, RSD, and OMA algorithms by using the following yeast genome pairs: Saccharomyces cerevisiae-Kluyveromyces lactis, Saccharomyces cerevisiae-Candida glabrata, and Saccharomyces cerevisiae-Schizosaccharomyces pombe as benchmark datasets. Because of the large amount of imbalanced data, the building and testing of the supervised model were only possible by using big data supervised classifiers managing imbalance. Evaluation metrics taking low ortholog ratios into account were applied. From the effectiveness perspective, MapReduce Random Oversampling combined with Spark SVM outperformed RBH, RSD, and OMA, probably because of the consideration of gene pair features beyond alignment similarities combined with the advances in big data supervised classification. PMID:26605337

Pair and triplet approximation of a spatial lattice population model with multiscale dispersal using Markov chains for estimating spatial autocorrelation.

PubMed

Hiebeler, David E; Millett, Nicholas E

2011-06-21

We investigate a spatial lattice model of a population employing dispersal to nearest and second-nearest neighbors, as well as long-distance dispersal across the landscape. The model is studied via stochastic spatial simulations, ordinary pair approximation, and triplet approximation. The latter method, which uses the probabilities of state configurations of contiguous blocks of three sites as its state variables, is demonstrated to be greatly superior to pair approximations for estimating spatial correlation information at various scales. Correlations between pairs of sites separated by arbitrary distances are estimated by constructing spatial Markov processes using the information from both approximations. These correlations demonstrate why pair approximation misses basic qualitative features of the model, such as decreasing population density as a large proportion of offspring are dropped on second-nearest neighbors, and why triplet approximation is able to include them. Analytical and numerical results show that, excluding long-distance dispersal, the initial growth rate of an invading population is maximized and the equilibrium population density is also roughly maximized when the population spreads its offspring evenly over nearest and second-nearest neighboring sites. Copyright © 2011 Elsevier Ltd. All rights reserved.

An Effective Big Data Supervised Imbalanced Classification Approach for Ortholog Detection in Related Yeast Species.

PubMed

Galpert, Deborah; Del Río, Sara; Herrera, Francisco; Ancede-Gallardo, Evys; Antunes, Agostinho; Agüero-Chapin, Guillermin

2015-01-01

Orthology detection requires more effective scaling algorithms. In this paper, a set of gene pair features based on similarity measures (alignment scores, sequence length, gene membership to conserved regions, and physicochemical profiles) are combined in a supervised pairwise ortholog detection approach to improve effectiveness considering low ortholog ratios in relation to the possible pairwise comparison between two genomes. In this scenario, big data supervised classifiers managing imbalance between ortholog and nonortholog pair classes allow for an effective scaling solution built from two genomes and extended to other genome pairs. The supervised approach was compared with RBH, RSD, and OMA algorithms by using the following yeast genome pairs: Saccharomyces cerevisiae-Kluyveromyces lactis, Saccharomyces cerevisiae-Candida glabrata, and Saccharomyces cerevisiae-Schizosaccharomyces pombe as benchmark datasets. Because of the large amount of imbalanced data, the building and testing of the supervised model were only possible by using big data supervised classifiers managing imbalance. Evaluation metrics taking low ortholog ratios into account were applied. From the effectiveness perspective, MapReduce Random Oversampling combined with Spark SVM outperformed RBH, RSD, and OMA, probably because of the consideration of gene pair features beyond alignment similarities combined with the advances in big data supervised classification.

The probability of quantal secretion near a single calcium channel of an active zone.

PubMed Central

Bennett, M R; Farnell, L; Gibson, W G

2000-01-01

A Monte Carlo analysis has been made of calcium dynamics and quantal secretion at microdomains in which the calcium reaches very high concentrations over distances of <50 nm from a channel and for which calcium dynamics are dominated by diffusion. The kinetics of calcium ions in microdomains due to either the spontaneous or evoked opening of a calcium channel, both of which are stochastic events, are described in the presence of endogenous fixed and mobile buffers. Fluctuations in the number of calcium ions within 50 nm of a channel are considerable, with the standard deviation about half the mean. Within 10 nm of a channel these numbers of ions can give rise to calcium concentrations of the order of 100 microM. The temporal changes in free calcium and calcium bound to different affinity indicators in the volume of an entire varicosity or bouton following the opening of a single channel are also determined. A Monte Carlo analysis is also presented of how the dynamics of calcium ions at active zones, after the arrival of an action potential and the stochastic opening of a calcium channel, determine the probability of exocytosis from docked vesicles near the channel. The synaptic vesicles in active zones are found docked in a complex with their calcium-sensor associated proteins and a voltage-sensitive calcium channel, forming a secretory unit. The probability of quantal secretion from an isolated secretory unit has been determined for different distances of an open calcium channel from the calcium sensor within an individual unit: a threefold decrease in the probability of secretion of a quantum occurs with a doubling of the distance from 25 to 50 nm. The Monte Carlo analysis also shows that the probability of secretion of a quantum is most sensitive to the size of the single-channel current compared with its sensitivity to either the binding rates of the sites on the calcium-sensor protein or to the number of these sites that must bind a calcium ion to trigger exocytosis of a vesicle. PMID:10777721

Ensemble modeling of stochastic unsteady open-channel flow in terms of its time-space evolutionary probability distribution - Part 2: numerical application

NASA Astrophysics Data System (ADS)

Dib, Alain; Kavvas, M. Levent

2018-03-01

The characteristic form of the Saint-Venant equations is solved in a stochastic setting by using a newly proposed Fokker-Planck Equation (FPE) methodology. This methodology computes the ensemble behavior and variability of the unsteady flow in open channels by directly solving for the flow variables' time-space evolutionary probability distribution. The new methodology is tested on a stochastic unsteady open-channel flow problem, with an uncertainty arising from the channel's roughness coefficient. The computed statistical descriptions of the flow variables are compared to the results obtained through Monte Carlo (MC) simulations in order to evaluate the performance of the FPE methodology. The comparisons show that the proposed methodology can adequately predict the results of the considered stochastic flow problem, including the ensemble averages, variances, and probability density functions in time and space. Unlike the large number of simulations performed by the MC approach, only one simulation is required by the FPE methodology. Moreover, the total computational time of the FPE methodology is smaller than that of the MC approach, which could prove to be a particularly crucial advantage in systems with a large number of uncertain parameters. As such, the results obtained in this study indicate that the proposed FPE methodology is a powerful and time-efficient approach for predicting the ensemble average and variance behavior, in both space and time, for an open-channel flow process under an uncertain roughness coefficient.

Open star clusters in the Milky Way. Comparison of photometric and trigonometric distance scales based on Gaia TGAS data

NASA Astrophysics Data System (ADS)

Kovaleva, Dana A.; Piskunov, Anatoly E.; Kharchenko, Nina V.; Röser, Siegfried; Schilbach, Elena; Scholz, Ralf-Dieter; Reffert, Sabine; Yen, Steffi X.

2017-10-01

Context. The global survey of star clusters in the Milky Way (MWSC) is a comprehensive list of 3061 objects that provides, among other parameters, distances to clusters based on isochrone fitting. The Tycho-Gaia Astrometric Solution (TGAS) catalogue, which is a part of Gaia data release 1 (Gaia DR1), delivers accurate trigonometric parallax measurements for more than 2 million stars, including those in star clusters. Aims: We compare the open cluster photometric distance scale with the measurements given by the trigonometric parallaxes from TGAS to evaluate the consistency between these values. Methods: The average parallaxes of probable cluster members available in TGAS provide the trigonometric distance scale of open clusters, while the photometric scale is given by the distances published in the MWSC. Sixty-four clusters are suited for comparison as they have more than 16 probable members with parallax measurements in TGAS. We computed the average parallaxes of the probable members and compared these to the photometric parallaxes derived within the MWSC. Results: We find a good agreement between the trigonometric TGAS-based and the photometric MWSC-based distance scales of open clusters, which for distances less than 2.3 kpc coincide at a level of about 0.1 mas with no dependence on the distance. If at all, there is a slight systematic offset along the Galactic equator between 30° and 160° galactic longitude.

Ab-initio Pulsar Magnetosphere: Particle Acceleration in Oblique Rotators and High-energy Emission Modeling

NASA Astrophysics Data System (ADS)

Philippov, Alexander A.; Spitkovsky, Anatoly

2018-03-01

We perform global particle-in-cell simulations of pulsar magnetospheres, including pair production, ion extraction from the surface, frame-dragging corrections, and high-energy photon emission and propagation. In the case of oblique rotators, the effects of general relativity increase the fraction of the open field lines that support active pair discharge. We find that the plasma density and particle energy flux in the pulsar wind are highly non-uniform with latitude. A significant fraction of the outgoing particle energy flux is carried by energetic ions, which are extracted from the stellar surface. Their energies may extend up to a large fraction of the open field line voltage, making them interesting candidates for ultra-high-energy cosmic rays. We show that pulsar gamma-ray radiation is dominated by synchrotron emission, produced by particles that are energized by relativistic magnetic reconnection close to the Y-point and in the equatorial current sheet. In most cases, the calculated light curves contain two strong peaks, which is in general agreement with Fermi observations. The radiative efficiency decreases with increasing pulsar inclination and increasing efficiency of pair production in the current sheet, which explains the observed scatter in L γ versus \\dot{E}. We find that the high-frequency cutoff in the spectra is regulated by the pair-loading of the current sheet. Our findings lay the foundation for quantitative interpretation of Fermi observations of gamma-ray pulsars.

Survival probability of a truncated radial oscillator subject to periodic kicks

NASA Astrophysics Data System (ADS)

Tanabe, Seiichi; Watanabe, Shinichi; Saif, Farhan; Matsuzawa, Michio

2002-03-01

Classical and quantum survival probabilities are compared for a truncated radial oscillator undergoing impulsive interactions with periodic laser pulses represented here as kicks. The system is truncated in the sense that the harmonic potential is made valid only within a finite range; the rest of the space is treated as a perfect absorber. Exploring extended values of the parameters of this model [Phys. Rev. A 63, 052721 (2001)], we supplement discussions on classical and quantum features near resonances. The classical system proves to be quasi-integrable and preserves phase-space area despite the momentum transfered by the kicks, exhibiting simple yet rich phase-space features. A geometrical argument reveals quantum-classical correspondence in the locations of minima in the paired survival probabilities while the ``ionization'' rates differ due to quantum tunneling.

Recovering a Probabilistic Knowledge Structure by Constraining Its Parameter Space

ERIC Educational Resources Information Center

Stefanutti, Luca; Robusto, Egidio

2009-01-01

In the Basic Local Independence Model (BLIM) of Doignon and Falmagne ("Knowledge Spaces," Springer, Berlin, 1999), the probabilistic relationship between the latent knowledge states and the observable response patterns is established by the introduction of a pair of parameters for each of the problems: a lucky guess probability and a careless…

New Center Applies Cost-Benefit Analysis to Education Policies

ERIC Educational Resources Information Center

Viadero, Debra

2008-01-01

This article describes the Center for Benefit-Cost Studies of Education, at Teachers College, Columbia University. Launched last year by a pair of economists, the center specializes in calculating and comparing the long- and short-term costs--and probable payoffs--of different educational strategies that promise to improve students' lives. Studies…

Across Space and Time: Infants Learn from Backward and Forward Visual Statistics

ERIC Educational Resources Information Center

Tummeltshammer, Kristen; Amso, Dima; French, Robert M.; Kirkham, Natasha Z.

2017-01-01

This study investigates whether infants are sensitive to backward and forward transitional probabilities within temporal and spatial visual streams. Two groups of 8-month-old infants were familiarized with an artificial grammar of shapes, comprising backward and forward base pairs (i.e. two shapes linked by strong backward or forward transitional…

Probabilistic biological network alignment.

PubMed

Todor, Andrei; Dobra, Alin; Kahveci, Tamer

2013-01-01

Interactions between molecules are probabilistic events. An interaction may or may not happen with some probability, depending on a variety of factors such as the size, abundance, or proximity of the interacting molecules. In this paper, we consider the problem of aligning two biological networks. Unlike existing methods, we allow one of the two networks to contain probabilistic interactions. Allowing interaction probabilities makes the alignment more biologically relevant at the expense of explosive growth in the number of alternative topologies that may arise from different subsets of interactions that take place. We develop a novel method that efficiently and precisely characterizes this massive search space. We represent the topological similarity between pairs of aligned molecules (i.e., proteins) with the help of random variables and compute their expected values. We validate our method showing that, without sacrificing the running time performance, it can produce novel alignments. Our results also demonstrate that our method identifies biologically meaningful mappings under a comprehensive set of criteria used in the literature as well as the statistical coherence measure that we developed to analyze the statistical significance of the similarity of the functions of the aligned protein pairs.

Anomalous maximum and minimum for the dissociation of a geminate pair in energetically disordered media

NASA Astrophysics Data System (ADS)

Govatski, J. A.; da Luz, M. G. E.; Koehler, M.

2015-01-01

We study the geminated pair dissociation probability φ as function of applied electric field and temperature in energetically disordered nD media. Regardless nD, for certain parameters regions φ versus the disorder degree (σ) displays anomalous minimum (maximum) at low (moderate) fields. This behavior is compatible with a transport energy which reaches a maximum and then decreases to negative values as σ increases. Our results explain the temperature dependence of the persistent photoconductivity in C60 single crystals going through order-disorder transitions. They also indicate how an energetic disorder spatial variation may contribute to higher exciton dissociation in multicomponent donor/acceptor systems.

Search for first generation leptoquark pair production in the electron + missing energy + jets final state

DOE PAGES

Abazov, Victor Mukhamedovich

2011-10-11

We present a search for the pair production of first generation scalar leptoquarks (LQ) in data corresponding to an integrated luminosity of 5.4 fb -1 collected with the D0 detector at the Fermilab Tevatron Collider in pp collisions at √s = 1.96 TeV. In the channel LQLQ → eqν eq, where q,q are u or d quarks, no significant excess of data over background is observed, and we set a 95% C.L. lower limit of 326 GeV on the leptoquark mass, assuming equal probabilities of leptoquark decays to eq and ν eq.

A new exact and more powerful unconditional test of no treatment effect from binary matched pairs.

PubMed

Lloyd, Chris J

2008-09-01

We consider the problem of testing for a difference in the probability of success from matched binary pairs. Starting with three standard inexact tests, the nuisance parameter is first estimated and then the residual dependence is eliminated by maximization, producing what I call an E+M P-value. The E+M P-value based on McNemar's statistic is shown numerically to dominate previous suggestions, including partially maximized P-values as described in Berger and Sidik (2003, Statistical Methods in Medical Research 12, 91-108). The latter method, however, may have computational advantages for large samples.

Schizophrenia: A genome scan targets chromosomes 3p and 8p as potential sites of susceptibility genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pulver, A.E.; Lasseter, V.K.; Kasch, L.

Using a systematically ascertained sample of 57 families, each having 2 or more members with a consensus diagnosis of schizophrenia (DSM-III-R criteria), we have carried out linkage studies of 520 loci, covering approximately 70% of the genome for susceptibility loci for schizophrenia. A two-stage strategy based on lod score thresholds from simulation studies of our sample identified regions for further exploration. In each region, a dense map of highly informative dinucleotide repeat polymorphisms (heterozygosity greater than .70) was analyzed using dominant, recessive, and {open_quotes}affected only{close_quotes} models and nonparametric sib pair identity-by-descent methods. For one region, 8p22-p21, affected sib-pair analyses gavemore » a P value = .0001, corresponding to a lod score approximately equal to 3.00. For 8p22-p21, the maximum two-point lod score occurred using the {open_quotes}affected only{close_quotes} recessive model (Z{sub max} = 2.35; {theta}{sub M} = {theta}{sub F}); allowing for a constant sex difference in recombination fractions found in reference pedigrees, Z{sub max} = 2.78 ({theta}{sub M}/{theta}{sub F} = 3). For a second region, 3p26-p24, the maximum two-point lod score was 2.34 ({open_quotes}affected only{close_quotes} dominant model), and the affected sib-pair P value was .01. These two regions are worthy of further exploration as potential sites of susceptibility genes for schizophrenia. 59 refs., 2 figs., 4 tabs.« less

Voting for a personality: Do first impressions and self-evaluations affect voting decisions?

PubMed

Koppensteiner, Markus; Stephan, Pia

2014-08-01

Participants were asked to assess their own personality (i.e. Big Five scales), the personality of politicians shown in brief silent video clips, and the probability that they would vote for these politicians. Response surface analyses (RSA) revealed noteworthy effects of self-ratings and observer-ratings of openness, agreeableness, and emotional stability on voting probability. Furthermore, the participants perceived themselves as being more open, more agreeable, more emotionally stable, and more extraverted than the average politician. The study supports previous findings that first impressions affect decision making on important issues. Results also indicate that when only nonverbal information is available people prefer political candidates they perceive as having personality traits they value in themselves.

Habitat specialization through germination cueing: a comparative study of herbs from forests and open habitats.

PubMed

Ten Brink, Dirk-Jan; Hendriksma, Harmen Pieter; Bruun, Hans Henrik

2013-02-01

This study examined the adaptive association between seed germination ecology and specialization to either forest or open habitats across a range of evolutionary lineages of seed plants, in order to test the hypotheses that (1) species' specialization to open vs. shaded habitats is consistently accompanied by specialization in their regeneration niche; and (2) species are thereby adapted to utilize different windows of opportunity in time (season) and space (habitat). Seed germination response to temperature, light and stratification was tested for 17 congeneric pairs, each consisting of one forest species and one open-habitat species. A factorial design was used with temperature levels and diurnal temperature variation (10 °C constant, 15-5 °C fluctuating, 20 °C constant, 25-15 °C fluctuating), and two light levels (light and darkness) and a cold stratification treatment. The congeneric species pair design took phylogenetic dependence into account. Species from open habitats germinated better at high temperatures, whereas forest species performed equally well at low and high temperatures. Forest species tended to germinate only after a period of cold stratification that could break dormancy, while species from open habitats generally germinated without cold stratification. The empirically derived germination strategies correspond quite well with establishment opportunities for forest and open-habitat plant species in nature. Annual changes in temperature and light regime in temperate forest delimit windows of opportunity for germination and establishment. Germination strategies of forest plants are adaptations to utilize such narrow windows in time. Conversely, lack of fit between germination ecology and environment may explain why species of open habitats generally fail to establish in forests. Germination strategy should be considered an important mechanism for habitat specialization in temperate herbs to forest habitats. The findings strongly suggest that phases in the plant life cycle other than the established phase should be considered important in adaptive specialization.

Cloning and characterization of an abalone (Haliotis discus hannai) actin gene

NASA Astrophysics Data System (ADS)

Ma, Hongming; Xu, Wei; Mai, Kangsen; Liufu, Zhiguo; Chen, Hong

2004-10-01

An actin encoding gene was cloned by using RT-PCR, 3‧ RACE and 5‧ RACE from abalone Haliotis discus hannai. The full length of the gene is 1532 base pairs, which contains a long 3‧ untranslated region of 307 base pairs and 79 base pairs of 5‧ untranslated sequence. The open reading frame encodes 376 amino acid residues. Sequence comparison with those of human and other mollusks showed high conservation among species at amino acid level. The identities was 96%, 97% and 96% respectively compared with Aplysia californica, Biomphalaria glabrata and Homo sapience β-actin. It is also indicated that this actin is more similar to the human cytoplasmic actin (β-actin) than to human muscle actin.

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Nasal Anatomy

MedlinePlus

... below. The nasal cavity is surrounded by paired, air-filled chambers on each side, and these lie towards the ... and left “choana” and open into a common chamber called the ... When we breathe in, air travels through the nostril, through the right and ...

Linkage of Viral Sequences among HIV-Infected Village Residents in Botswana: Estimation of Linkage Rates in the Presence of Missing Data

PubMed Central

Carnegie, Nicole Bohme; Wang, Rui; Novitsky, Vladimir; De Gruttola, Victor

2014-01-01

Linkage analysis is useful in investigating disease transmission dynamics and the effect of interventions on them, but estimates of probabilities of linkage between infected people from observed data can be biased downward when missingness is informative. We investigate variation in the rates at which subjects' viral genotypes link across groups defined by viral load (low/high) and antiretroviral treatment (ART) status using blood samples from household surveys in the Northeast sector of Mochudi, Botswana. The probability of obtaining a sequence from a sample varies with viral load; samples with low viral load are harder to amplify. Pairwise genetic distances were estimated from aligned nucleotide sequences of HIV-1C env gp120. It is first shown that the probability that randomly selected sequences are linked can be estimated consistently from observed data. This is then used to develop estimates of the probability that a sequence from one group links to at least one sequence from another group under the assumption of independence across pairs. Furthermore, a resampling approach is developed that accounts for the presence of correlation across pairs, with diagnostics for assessing the reliability of the method. Sequences were obtained for 65% of subjects with high viral load (HVL, n = 117), 54% of subjects with low viral load but not on ART (LVL, n = 180), and 45% of subjects on ART (ART, n = 126). The probability of linkage between two individuals is highest if both have HVL, and lowest if one has LVL and the other has LVL or is on ART. Linkage across groups is high for HVL and lower for LVL and ART. Adjustment for missing data increases the group-wise linkage rates by 40–100%, and changes the relative rates between groups. Bias in inferences regarding HIV viral linkage that arise from differential ability to genotype samples can be reduced by appropriate methods for accommodating missing data. PMID:24415932

Linkage of viral sequences among HIV-infected village residents in Botswana: estimation of linkage rates in the presence of missing data.

PubMed

Carnegie, Nicole Bohme; Wang, Rui; Novitsky, Vladimir; De Gruttola, Victor

2014-01-01

Linkage analysis is useful in investigating disease transmission dynamics and the effect of interventions on them, but estimates of probabilities of linkage between infected people from observed data can be biased downward when missingness is informative. We investigate variation in the rates at which subjects' viral genotypes link across groups defined by viral load (low/high) and antiretroviral treatment (ART) status using blood samples from household surveys in the Northeast sector of Mochudi, Botswana. The probability of obtaining a sequence from a sample varies with viral load; samples with low viral load are harder to amplify. Pairwise genetic distances were estimated from aligned nucleotide sequences of HIV-1C env gp120. It is first shown that the probability that randomly selected sequences are linked can be estimated consistently from observed data. This is then used to develop estimates of the probability that a sequence from one group links to at least one sequence from another group under the assumption of independence across pairs. Furthermore, a resampling approach is developed that accounts for the presence of correlation across pairs, with diagnostics for assessing the reliability of the method. Sequences were obtained for 65% of subjects with high viral load (HVL, n = 117), 54% of subjects with low viral load but not on ART (LVL, n = 180), and 45% of subjects on ART (ART, n = 126). The probability of linkage between two individuals is highest if both have HVL, and lowest if one has LVL and the other has LVL or is on ART. Linkage across groups is high for HVL and lower for LVL and ART. Adjustment for missing data increases the group-wise linkage rates by 40-100%, and changes the relative rates between groups. Bias in inferences regarding HIV viral linkage that arise from differential ability to genotype samples can be reduced by appropriate methods for accommodating missing data.

Efficient pairwise RNA structure prediction using probabilistic alignment constraints in Dynalign

PubMed Central

2007-01-01

Background Joint alignment and secondary structure prediction of two RNA sequences can significantly improve the accuracy of the structural predictions. Methods addressing this problem, however, are forced to employ constraints that reduce computation by restricting the alignments and/or structures (i.e. folds) that are permissible. In this paper, a new methodology is presented for the purpose of establishing alignment constraints based on nucleotide alignment and insertion posterior probabilities. Using a hidden Markov model, posterior probabilities of alignment and insertion are computed for all possible pairings of nucleotide positions from the two sequences. These alignment and insertion posterior probabilities are additively combined to obtain probabilities of co-incidence for nucleotide position pairs. A suitable alignment constraint is obtained by thresholding the co-incidence probabilities. The constraint is integrated with Dynalign, a free energy minimization algorithm for joint alignment and secondary structure prediction. The resulting method is benchmarked against the previous version of Dynalign and against other programs for pairwise RNA structure prediction. Results The proposed technique eliminates manual parameter selection in Dynalign and provides significant computational time savings in comparison to prior constraints in Dynalign while simultaneously providing a small improvement in the structural prediction accuracy. Savings are also realized in memory. In experiments over a 5S RNA dataset with average sequence length of approximately 120 nucleotides, the method reduces computation by a factor of 2. The method performs favorably in comparison to other programs for pairwise RNA structure prediction: yielding better accuracy, on average, and requiring significantly lesser computational resources. Conclusion Probabilistic analysis can be utilized in order to automate the determination of alignment constraints for pairwise RNA structure prediction methods in a principled fashion. These constraints can reduce the computational and memory requirements of these methods while maintaining or improving their accuracy of structural prediction. This extends the practical reach of these methods to longer length sequences. The revised Dynalign code is freely available for download. PMID:17445273

Morphometric analyses of hominoid crania, probabilities of conspecificity and an approximation of a biological species constant.

PubMed

Thackeray, J F; Dykes, S

2016-02-01

Thackeray has previously explored the possibility of using a morphometric approach to quantify the "amount" of variation within species and to assess probabilities of conspecificity when two fossil specimens are compared, instead of "pigeon-holing" them into discrete species. In an attempt to obtain a statistical (probabilistic) definition of a species, Thackeray has recognized an approximation of a biological species constant (T=-1.61) based on the log-transformed standard error of the coefficient m (log sem) in regression analysis of cranial and other data from pairs of specimens of conspecific extant species, associated with regression equations of the form y=mx+c where m is the slope and c is the intercept, using measurements of any specimen A (x axis), and any specimen B of the same species (y axis). The log-transformed standard error of the co-efficient m (log sem) is a measure of the degree of similarity between pairs of specimens, and in this study shows central tendency around a mean value of -1.61 and standard deviation 0.10 for modern conspecific specimens. In this paper we focus attention on the need to take into account the range of difference in log sem values (Δlog sem or "delta log sem") obtained from comparisons when specimen A (x axis) is compared to B (y axis), and secondly when specimen A (y axis) is compared to B (x axis). Thackeray's approach can be refined to focus on high probabilities of conspecificity for pairs of specimens for which log sem is less than -1.61 and for which Δlog sem is less than 0.03. We appeal for the adoption of a concept here called "sigma taxonomy" (as opposed to "alpha taxonomy"), recognizing that boundaries between species are not always well defined. Copyright © 2015 Elsevier GmbH. All rights reserved.

All-inside arthroscopic modified Broström operation for chronic ankle instability: a biomechanical study.

PubMed

Lee, Kyung Tai; Kim, Eung Soo; Kim, Young Ho; Ryu, Je Seong; Rhyu, Im Joo; Lee, Young Koo

2016-04-01

The all-inside arthroscopic modified Broström operation has been developed for lateral ankle instability. We compared the biomechanical parameters of the all-inside arthroscopic procedure to the open modified Broström operation. Eleven matched pairs of human cadaver specimens [average age 71.5 (range 58-98) years] were subject to the arthroscopic modified Broström operation using a suture anchor and the open modified Broström operation. The ligaments were loaded cyclically 20 times and then tested to failure. Torque to failure, degrees to failure, and stiffness were measured. A matched-pair analysis was performed. There was no significant difference in torque to failure between the open and arthroscopic modified Broström operation (19.9 ± 8.9 vs. 23.3 ± 12.1 Nm, n.s). The degrees to failure did not differ significantly between the open and arthroscopic modified Broström operations (46.8 ± 9.9° vs. 46.7 ± 7.6°, n.s). The working construct stiffness (or stiffness to failure) was no significant difference in the two groups (0.438 ± 0.21 vs. 0.487 ± 0.268 Nm/deg for the open and arthroscopic modified Broström operations, respectively, n.s). The all-inside arthroscopic modified Broström operation and the open modified Broström operation resulted in no significantly different torque to failure, degrees to failure, and working construct stiffness with no significant differences (n.s, n.s, and n.s, respectively). Our results indicate that the arthroscopic modified Broström operation is a reasonable alternative procedure for chronic ankle instability.

Simultaneous minimization of leaf travel distance and tongue-and-groove effect for segmental intensity-modulated radiation therapy.

PubMed

Dai, Jianrong; Que, William

2004-12-07

This paper introduces a method to simultaneously minimize the leaf travel distance and the tongue-and-groove effect for IMRT leaf sequences to be delivered in segmental mode. The basic idea is to add a large enough number of openings through cutting or splitting existing openings for those leaf pairs with openings fewer than the number of segments so that all leaf pairs have the same number of openings. The cutting positions are optimally determined with a simulated annealing technique called adaptive simulated annealing. The optimization goal is set to minimize the weighted summation of the leaf travel distance and tongue-and-groove effect. Its performance was evaluated with 19 beams from three clinical cases; one brain, one head-and-neck and one prostate case. The results show that it can reduce the leaf travel distance and (or) tongue-and-groove effect; the reduction of the leaf travel distance reaches its maximum of about 50% when minimized alone; the reduction of the tongue-and-groove reaches its maximum of about 70% when minimized alone. The maximum reduction in the leaf travel distance translates to a 1 to 2 min reduction in treatment delivery time per fraction, depending on leaf speed. If the method is implemented clinically, it could result in significant savings in treatment delivery time, and also result in significant reduction in the wear-and-tear of MLC mechanics.

BOOK REVIEW: OPENING SCIENCE, THE EVOLVING GUIDE ...

EPA Pesticide Factsheets

The way we get our funding, collaborate, do our research, and get the word out has evolved over hundreds of years but we can imagine a more open science world, largely facilitated by the internet. The movement towards this more open way of doing and presenting science is coming, and it is not taking hundreds of years. If you are interested in these trends, and would like to find out more about where this is all headed and what it means to you, consider downloding Opening Science, edited by Sönke Bartling and Sascha Friesike, subtitled The Evolving Guide on How the Internet is Changing Research, Collaboration, and Scholarly Publishing. In 26 chapters by various authors from a range of disciplines the book explores the developing world of open science, starting from the first scientific revolution and bringing us to the next scientific revolution, sometimes referred to as “Science 2.0”. Some of the articles deal with the impact of the changing landscape of how science is done, looking at the impact of open science on Academia, or journal publishing, or medical research. Many of the articles look at the uses, pitfalls, and impact of specific tools, like microblogging (think Twitter), social networking, and reference management. There is lots of discussion and definition of terms you might use or misuse like “altmetrics” and “impact factor”. Science will probably never be completely open, and Twitter will probably never replace the journal article,

End-to-end distance and contour length distribution functions of DNA helices

NASA Astrophysics Data System (ADS)

Zoli, Marco

2018-06-01

I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

Cross-contact chain

NASA Technical Reports Server (NTRS)

Lieneweg, Udo (Inventor)

1988-01-01

A system is provided for use with wafers that include multiple integrated circuits that include two conductive layers in contact at multiple interfaces. Contact chains are formed beside the integrated circuits, each contact chain formed of the same two layers as the circuits, in the form of conductive segments alternating between the upper and lower layers and with the ends of the segments connected in series through interfaces. A current source passes a current through the series-connected segments, by way of a pair of current tabs connected to opposite ends of the series of segments. While the current flows, voltage measurements are taken between each of a plurality of pairs of voltage tabs, the two tabs of each pair connected to opposite ends of an interface that lies along the series-connected segments. A plot of interface conductances on a normal probability chart, enables prediction of the yield of good integrated circuits from the wafer.

Cross-contact chain

NASA Technical Reports Server (NTRS)

Lieneweg, U. (Inventor)

1986-01-01

A system is provided for use with wafers that include multiple integrated circuits that include two conductive layers in contact at multiple interfaces. Contact chains are formed beside the integrated circuits, each contact chain formed of the same two layers as the circuits, in the form of conductive segments alternating between the upper and lower layers and with the ends of the segments connected in series through interfaces. A current source passes a current through the series-connected segments, by way of a pair of current tabs connected to opposite ends of the series of segments. While the current flows, voltage measurements are taken between each of a plurality of pairs of voltage tabs, the two tabs of each pair connected to opposite ends of an interface that lies along the series-connected segments. A plot of interface conductances on normal probability chart enables prediction of the yield of good integrated circuits from the wafer.

Reliability evaluation of a multistate network subject to time constraint under routing policy

NASA Astrophysics Data System (ADS)

Lin, Yi-Kuei

2013-08-01

A multistate network is a stochastic network composed of multistate arcs in which each arc has several possible capacities and may fail due to failure, maintenance, etc. The quality of a multistate network depends on how to meet the customer's requirements and how to provide the service in time. The system reliability, the probability that a given amount of data can be transmitted through a pair of minimal paths (MPs) simultaneously under the time constraint, is a proper index to evaluate the quality of a multistate network. An efficient solution procedure is first proposed to calculate it. In order to further enhance the system reliability, the network administrator decides the routing policy in advance to indicate the first and the second priority pairs of MPs. The second priority pair of MPs takes charge of the transmission duty if the first fails. The system reliability under the routing policy can be subsequently evaluated.

General theory of the multistage geminate reactions of the isolated pairs of reactants. II. Detailed balance and universal asymptotes of kinetics.

PubMed

Kipriyanov, Alexey A; Doktorov, Alexander B

2014-10-14

The analysis of general (matrix) kinetic equations for the mean survival probabilities of any of the species in a sample (or mean concentrations) has been made for a wide class of the multistage geminate reactions of the isolated pairs. These kinetic equations (obtained in the frame of the kinetic approach based on the concept of "effective" particles in Paper I) take into account various possible elementary reactions (stages of a multistage reaction) excluding monomolecular, but including physical and chemical processes of the change in internal quantum states carried out with the isolated pairs of reactants (or isolated reactants). The general basic principles of total and detailed balance have been established. The behavior of the reacting system has been considered on macroscopic time scales, and the universal long-term kinetics has been determined.

Conformation of viroids.

PubMed Central

Henco, K; Riesner, D; Sanger, H L

1977-01-01

Viroids are uncoated infectious RNA molecules (MW 107 000-127 000) known as pathogens of certain higher plants. Thermodynamic and kinetic studies were carried out on highly purified viroid preparations by applying UV-absorption melting analysis and temperature jump methods. The thermal denaturation of viroids is characterized by high thermal stability, high cooperativity and a high degree of base pairing. Two relaxation processes could be resolved; a process in the sec range could be evaluated as an independent all-or-none-transition with the following properties: reaction enthalpy= 550 kcal/mol, activation enthalpy of the dissociation = 470 kcal/mol; G : C content = 72 %. These data indicate the existence of an uninterrupted double helix of 52 base pairs. A process in the msec range involves 15 - 25 base pairs which are most probably distributed over several short double helical stretches. A tentative model for the secondary structure of viroids isproposed and the possible functional implications of their physicochemical properties are discussed. PMID:866174

Generalized quantum interference of correlated photon pairs.

PubMed

Kim, Heonoh; Lee, Sang Min; Moon, Han Seb

2015-05-07

Superposition and indistinguishablility between probability amplitudes have played an essential role in observing quantum interference effects of correlated photons. The Hong-Ou-Mandel interference and interferences of the path-entangled photon number state are of special interest in the field of quantum information technologies. However, a fully generalized two-photon quantum interferometric scheme accounting for the Hong-Ou-Mandel scheme and path-entangled photon number states has not yet been proposed. Here we report the experimental demonstrations of the generalized two-photon interferometry with both the interferometric properties of the Hong-Ou-Mandel effect and the fully unfolded version of the path-entangled photon number state using photon-pair sources, which are independently generated by spontaneous parametric down-conversion. Our experimental scheme explains two-photon interference fringes revealing single- and two-photon coherence properties in a single interferometer setup. Using the proposed interferometric measurement, it is possible to directly estimate the joint spectral intensity of a photon pair source.

Experiment and modeling of paired effect on evacuation from a three-dimensional space

NASA Astrophysics Data System (ADS)

Jun, Hu; Huijun, Sun; Juan, Wei; Xiaodan, Chen; Lei, You; Musong, Gu

2014-10-01

A novel three-dimensional cellular automata evacuation model was proposed based on stairs factor for paired effect and variety velocities in pedestrian evacuation. In the model pedestrians' moving probability of target position at the next moment was defined based on distance profit and repulsive force profit, and evacuation strategy was elaborated in detail through analyzing variety velocities and repulsive phenomenon in moving process. At last, experiments with the simulation platform were conducted to study the relationships of evacuation time, average velocity and pedestrian velocity. The results showed that when the ratio of single pedestrian was higher in the system, the shortest route strategy was good for improving evacuation efficiency; in turn, if ratio of paired pedestrians was higher, it is good for improving evacuation efficiency to adopt strategy that avoided conflicts, and priority should be given to scattered evacuation.

The place of the Local Group in the cosmic web

NASA Astrophysics Data System (ADS)

Forero-Romero, Jaime E.; González, Roberto

2016-10-01

We use the Bolshoi Simulation to find the most probable location of the Local Group (LG) in the cosmic web. Our LG simulacra are pairs of halos with isolation and kinematic properties consistent with observations. The cosmic web is defined using a tidal tensor approach. We find that the LG's preferred location is regions with a dark matter overdensity close to the cosmic average. This makes filaments and sheets the preferred environment. We also find a strong alignment between the LG and the cosmic web. The orbital angular momentum is preferentially perpendicular to the smallest tidal eigenvector, while the vector connecting the two halos is strongly aligned along the the smallest tidal eigenvector and perpendicular to the largest tidal eigenvector; the pair lies and moves along filaments and sheets. We do not find any evidence for an alignment between the spin of each halo in the pair and the cosmic web.

Quantum control on entangled bipartite qubits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delgado, Francisco

2010-04-15

Ising interactions between qubits can produce distortion on entangled pairs generated for engineering purposes (e.g., for quantum computation or quantum cryptography). The presence of parasite magnetic fields destroys or alters the expected behavior for which it was intended. In addition, these pairs are generated with some dispersion in their original configuration, so their discrimination is necessary for applications. Nevertheless, discrimination should be made after Ising distortion. Quantum control helps in both problems; making some projective measurements upon the pair to decide the original state to replace it, or just trying to reconstruct it using some procedures which do not altermore » their quantum nature. Results about the performance of these procedures are reported. First, we will work with pure systems studying restrictions and advantages. Then, we will extend these operations for mixed states generated with uncertainty in the time of distortion, correcting them by assuming the control prescriptions for the most probable one.« less

Statistical models for predicting pair dispersion and particle clustering in isotropic turbulence and their applications

NASA Astrophysics Data System (ADS)

Zaichik, Leonid I.; Alipchenkov, Vladimir M.

2009-10-01

The purpose of this paper is twofold: (i) to advance and extend the statistical two-point models of pair dispersion and particle clustering in isotropic turbulence that were previously proposed by Zaichik and Alipchenkov (2003 Phys. Fluids15 1776-87 2007 Phys. Fluids 19, 113308) and (ii) to present some applications of these models. The models developed are based on a kinetic equation for the two-point probability density function of the relative velocity distribution of two particles. These models predict the pair relative velocity statistics and the preferential accumulation of heavy particles in stationary and decaying homogeneous isotropic turbulent flows. Moreover, the models are applied to predict the effect of particle clustering on turbulent collisions, sedimentation and intensity of microwave radiation as well as to calculate the mean filtered subgrid stress of the particulate phase. Model predictions are compared with direct numerical simulations and experimental measurements.

General theory of multistage geminate reactions of isolated pairs of reactants. I. Kinetic equations.

PubMed

Doktorov, Alexander B; Kipriyanov, Alexey A

2014-05-14

General matrix approach to the consideration of multistage geminate reactions of isolated pairs of reactants depending on reactant mobility is formulated on the basis of the concept of "effective" particles. Various elementary reactions (stages of multistage reaction including physicochemical processes of internal quantum state changes) proceeding with the participation of isolated pairs of reactants (or isolated reactants) are taken into account. Investigation has been made in terms of kinetic approach implying the derivation of general (matrix) kinetic equations for local and mean probabilities of finding any of the reaction species in the sample under study (or for local and mean concentrations). The recipes for the calculation of kinetic coefficients of the equations for mean quantities in terms of relative coordinates of reactants have been formulated in the general case of inhomogeneous reacting systems. Important specific case of homogeneous reacting systems is considered.

Molecular interactions involved in proton-dependent gating in KcsA potassium channels

PubMed Central

Posson, David J.; Thompson, Ameer N.; McCoy, Jason G.

2013-01-01

The bacterial potassium channel KcsA is gated open by the binding of protons to amino acids on the intracellular side of the channel. We have identified, via channel mutagenesis and x-ray crystallography, two pH-sensing amino acids and a set of nearby residues involved in molecular interactions that influence gating. We found that the minimal mutation of one histidine (H25) and one glutamate (E118) near the cytoplasmic gate completely abolished pH-dependent gating. Mutation of nearby residues either alone or in pairs altered the channel’s response to pH. In addition, mutations of certain pairs of residues dramatically increased the energy barriers between the closed and open states. We proposed a Monod–Wyman–Changeux model for proton binding and pH-dependent gating in KcsA, where H25 is a “strong” sensor displaying a large shift in pKa between closed and open states, and E118 is a “weak” pH sensor. Modifying model parameters that are involved in either the intrinsic gating equilibrium or the pKa values of the pH-sensing residues was sufficient to capture the effects of all mutations. PMID:24218397

Longitudinal Study of Hepatitis A Infection by Saliva Sampling: The Kinetics of HAV Markers in Saliva Revealed the Application of Saliva Tests for Hepatitis A Study.

PubMed

Amado Leon, Luciane Almeida; de Almeida, Adilson José; de Paula, Vanessa Salete; Tourinho, Renata Santos; Villela, Daniel Antunes Maciel; Gaspar, Ana Maria Coimbra; Lewis-Ximenez, Lia Laura; Pinto, Marcelo Alves

2015-01-01

Despite the increasing numbers of studies investigating hepatitis A diagnostic through saliva, the frequency and the pattern of hepatitis A virus (HAV) markers in this fluid still remains unknown. To address this issue, we carried on a longitudinal study to examine the kinetics of HAV markers in saliva, in comparison with serum samples. The present study followed-up ten patients with acute hepatitis A infection during 180 days post diagnosis (dpd). Total anti-HAV was detected in paired serum and saliva samples until the end of the follow-up, showing a peak titer at 90th. However, total anti-HAV level was higher in serum than in saliva samples. This HAV marker showed a probability of 100% to be detected in both serum and saliva during 180 dpd. The IgM anti-HAV could be detected in saliva up to 150 dpd, showing the highest frequency at 30th, when it was detected in all individuals. During the first month of HAV infection, this acute HAV marker showed a detection probability of 100% in paired samples. The detection of IgM anti-HAV in saliva was not dependent on its level in serum, HAV-RNA detection and/or viral load, since no association was found between IgM anti-HAV positivity in saliva and any of these parameter (p>0.05). Most of the patients (80%) were found to contain HAV-RNA in saliva, mainly at early acute phase (30th day). However, it was possible to demonstrate the HAV RNA presence in paired samples for more than 90 days, even after seroconversion. No significant relationship was observed between salivary HAV-RNA positivity and serum viral load, demonstrating that serum viral load is not predictive of HAV-RNA detection in saliva. Similar viral load was seen in paired samples (on average 104 copies/mL). These data demonstrate that the best diagnostic coverage can be achieved by salivary anti-HAV antibodies and HAV-RNA tests during 30-90 dpd. The long detection and high probability of specific-HAV antibodies positivity in saliva samples make the assessment of salivary antibodies a useful tool for diagnosis and epidemiological studies. The high frequency of HAV-RNA in saliva and the probability of detection of about 50%, during the first 30 dpd, demonstrate that saliva is also useful for molecular investigation of hepatitis A cases, mainly during the early course of infection. Therefore, the collection of saliva may provide a simple, cheap and non-invasive means of diagnosis, epidemiological surveys and monitoring of hepatitis A infection purposes.

Longitudinal Study of Hepatitis A Infection by Saliva Sampling: The Kinetics of HAV Markers in Saliva Revealed the Application of Saliva Tests for Hepatitis A Study

PubMed Central

Amado Leon, Luciane Almeida; de Almeida, Adilson José; de Paula, Vanessa Salete; Tourinho, Renata Santos; Villela, Daniel Antunes Maciel; Gaspar, Ana Maria Coimbra; Lewis-Ximenez, Lia Laura; Pinto, Marcelo Alves

2015-01-01

Despite the increasing numbers of studies investigating hepatitis A diagnostic through saliva, the frequency and the pattern of hepatitis A virus (HAV) markers in this fluid still remains unknown. To address this issue, we carried on a longitudinal study to examine the kinetics of HAV markers in saliva, in comparison with serum samples. The present study followed-up ten patients with acute hepatitis A infection during 180 days post diagnosis (dpd). Total anti-HAV was detected in paired serum and saliva samples until the end of the follow-up, showing a peak titer at 90th. However, total anti-HAV level was higher in serum than in saliva samples. This HAV marker showed a probability of 100% to be detected in both serum and saliva during 180 dpd. The IgM anti-HAV could be detected in saliva up to 150 dpd, showing the highest frequency at 30th, when it was detected in all individuals. During the first month of HAV infection, this acute HAV marker showed a detection probability of 100% in paired samples. The detection of IgM anti-HAV in saliva was not dependent on its level in serum, HAV-RNA detection and/or viral load, since no association was found between IgM anti-HAV positivity in saliva and any of these parameter (p>0.05). Most of the patients (80%) were found to contain HAV-RNA in saliva, mainly at early acute phase (30th day). However, it was possible to demonstrate the HAV RNA presence in paired samples for more than 90 days, even after seroconversion. No significant relationship was observed between salivary HAV-RNA positivity and serum viral load, demonstrating that serum viral load is not predictive of HAV-RNA detection in saliva. Similar viral load was seen in paired samples (on average 104 copies/mL). These data demonstrate that the best diagnostic coverage can be achieved by salivary anti-HAV antibodies and HAV-RNA tests during 30–90 dpd. The long detection and high probability of specific-HAV antibodies positivity in saliva samples make the assessment of salivary antibodies a useful tool for diagnosis and epidemiological studies. The high frequency of HAV-RNA in saliva and the probability of detection of about 50%, during the first 30 dpd, demonstrate that saliva is also useful for molecular investigation of hepatitis A cases, mainly during the early course of infection. Therefore, the collection of saliva may provide a simple, cheap and non-invasive means of diagnosis, epidemiological surveys and monitoring of hepatitis A infection purposes. PMID:26690904

Insulin activates single amiloride-blockable Na channels in a distal nephron cell line (A6).

PubMed

Marunaka, Y; Hagiwara, N; Tohda, H

1992-09-01

Using the patch-clamp technique, we studied the effect of insulin on an amiloride-blockable Na channel in the apical membrane of a distal nephron cell line (A6) cultured on permeable collagen films for 10-14 days. NPo (N, number of channels per patch membrane; Po, average value of open probability of individual channels in the patch) under baseline conditions was 0.88 +/- 0.12 (SE)(n = 17). After making cell-attached patches on the apical membrane which contained Na channels, insulin (1 mU/ml) was applied to the serosal bath. While maintaining the cell-attached patch, NPo significantly increased to 1.48 +/- 0.19 (n = 17; P less than 0.001) after 5-10 min of insulin application. The open probability of Na channels was 0.39 +/- 0.01 (n = 38) under baseline condition, and increased to 0.66 +/- 0.03 (n = 38, P less than 0.001) after addition of insulin. The baseline single-channel conductance was 4pS, and neither the single-channel conductance nor the current-voltage relationship was significantly changed by insulin. These results indicate that insulin increases Na absorption in the distal nephron by increasing the open probability of the amiloride-blockable Na channel.

Phonotactic Probability Effects in Children Who Stutter

PubMed Central

Anderson, Julie D.; Byrd, Courtney T.

2008-01-01

Purpose The purpose of this study was to examine the influence of phonotactic probability, the frequency of different sound segments and segment sequences, on the overall fluency with which words are produced by preschool children who stutter (CWS), as well as to determine whether it has an effect on the type of stuttered disfluency produced. Method A 500+ word language sample was obtained from 19 CWS. Each stuttered word was randomly paired with a fluently produced word that closely matched it in grammatical class, word length, familiarity, word and neighborhood frequency, and neighborhood density. Phonotactic probability values were obtained for the stuttered and fluent words from an online database. Results Phonotactic probability did not have a significant influence on the overall susceptibility of words to stuttering, but it did impact the type of stuttered disfluency produced. In specific, single-syllable word repetitions were significantly lower in phonotactic probability than fluently produced words, as well as part-word repetitions and sound prolongations. Conclusions In general, the differential impact of phonotactic probability on the type of stuttering-like disfluency produced by young CWS provides some support for the notion that different disfluency types may originate in the disruption of different levels of processing. PMID:18658056

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

PubMed Central

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

Predicted sequence of cortical tau and amyloid-β deposition in Alzheimer disease spectrum.

PubMed

Cho, Hanna; Lee, Hye Sun; Choi, Jae Yong; Lee, Jae Hoon; Ryu, Young Hoon; Lee, Myung Sik; Lyoo, Chul Hyoung

2018-04-17

We investigated sequential order between tau and amyloid-β (Aβ) deposition in Alzheimer disease spectrum using a conditional probability method. Two hundred twenty participants underwent 18 F-flortaucipir and 18 F-florbetaben positron emission tomography scans and neuropsychological tests. The presence of tau and Aβ in each region and impairment in each cognitive domain were determined by Z-score cutoffs. By comparing pairs of conditional probabilities, the sequential order of tau and Aβ deposition were determined. Probability for the presence of tau in the entorhinal cortex was higher than that of Aβ in all cortical regions, and in the medial temporal cortices, probability for the presence of tau was higher than that of Aβ. Conversely, in the remaining neocortex above the inferior temporal cortex, probability for the presence of Aβ was always higher than that of tau. Tau pathology in the entorhinal cortex may appear earlier than neocortical Aβ and may spread in the absence of Aβ within the neighboring medial temporal regions. However, Aβ may be required for massive tau deposition in the distant cortical areas. Copyright © 2018 Elsevier Inc. All rights reserved.

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

PubMed Central

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Characteristic dynamics near two coalescing eigenvalues incorporating continuum threshold effects

NASA Astrophysics Data System (ADS)

Garmon, Savannah; Ordonez, Gonzalo

2017-06-01

It has been reported in the literature that the survival probability P(t) near an exceptional point where two eigenstates coalesce should generally exhibit an evolution P (t ) ˜t2e-Γ t, in which Γ is the decay rate of the coalesced eigenstate; this has been verified in a microwave billiard experiment [B. Dietz et al., Phys. Rev. E 75, 027201 (2007)]. However, the heuristic effective Hamiltonian that is usually employed to obtain this result ignores the possible influence of the continuum threshold on the dynamics. By contrast, in this work we employ an analytical approach starting from the microscopic Hamiltonian representing two simple models in order to show that the continuum threshold has a strong influence on the dynamics near exceptional points in a variety of circumstances. To report our results, we divide the exceptional points in Hermitian open quantum systems into two cases: at an EP2A two virtual bound states coalesce before forming a resonance, anti-resonance pair with complex conjugate eigenvalues, while at an EP2B two resonances coalesce before forming two different resonances. For the EP2B, which is the case studied in the microwave billiard experiment, we verify that the survival probability exhibits the previously reported modified exponential decay on intermediate time scales, but this is replaced with an inverse power law on very long time scales. Meanwhile, for the EP2A the influence from the continuum threshold is so strong that the evolution is non-exponential on all time scales and the heuristic approach fails completely. When the EP2A appears very near the threshold, we obtain the novel evolution P (t ) ˜1 -C1√{t } on intermediate time scales, while further away the parabolic decay (Zeno dynamics) on short time scales is enhanced.

Peculiarities of Clutch Forming Rails and Wheel Block Construction

NASA Astrophysics Data System (ADS)

Shiler, V. V.; Galiev, I. I.; Shiler, A. V.

2018-03-01

The clutch of the wheel and rail is significantly influenced by the design features of the standard wheel pair, which are manifested in the presence of "parasitic" slipping of the wheels along the rails during its movement. The purpose of the presented work is to evaluate new design solutions for wheel sets. The research was carried out using methods of comparative simulation modelling and physical prototyping. A new design of the wheel pair (block wheel pair) is proposed, which features an independent rotation of all surfaces of the wheels in contact with the rails. The block construction of the wheel pair forms open mechanical contours with the track gauge, which completely eliminates the "parasitic" slippage. As a result, in the process of implementing traction or braking forces, the coupling coefficient of the block construction of the wheel pair is significantly higher than that of existing structures. In addition, in the run-out mode, the resistance to movement of the block wheel pair is half as much. All this will allow one to significantly reduce the energy consumption for traction of trains, wear of track elements and crew, and to increase the speed and safety of train traffic.

Fermion superfluid with hybridized s- and p-wave pairings

NASA Astrophysics Data System (ADS)

Zhou, LiHong; Yi, Wei; Cui, XiaoLing

2017-12-01

Ever since the pioneering work of Bardeen, Cooper and Schrieffer in the 1950s, exploring novel pairing mechanisms for fermion superfluids has become one of the central tasks in modern physics. Here, we investigate a new type of fermion superfluid with hybridized s- and p-wave pairings in an ultracold spin-1/2 Fermi gas. Its occurrence is facilitated by the co-existence of comparable s- and p-wave interactions, which is realizable in a two-component 40K Fermi gas with close-by s- and p-wave Feshbach resonances. The hybridized superfluid state is stable over a considerable parameter region on the phase diagram, and can lead to intriguing patterns of spin densities and pairing fields in momentum space. In particular, it can induce a phase-locked p-wave pairing in the fermion species that has no p-wave interactions. The hybridized nature of this novel superfluid can also be confirmed by measuring the s- and p-wave contacts, which can be extracted from the high-momentum tail of the momentum distribution of each spin component. These results enrich our knowledge of pairing superfluidity in Fermi systems, and open the avenue for achieving novel fermion superfluids with multiple partial-wave scatterings in cold atomic gases.

Interaction of paired cortical and peripheral nerve stimulation on human motor neurons.

PubMed

Poon, David E; Roy, Francois D; Gorassini, Monica A; Stein, Richard B

2008-06-01

This paper contrasts responses in the soleus muscle of normal human subjects to two major inputs: the tibial nerve (TN) and the corticospinal tract. Paired transcranial magnetic stimulation (TMS) of the motor cortex at intervals of 10-25 ms strongly facilitated the motor evoked potential (MEP) produced by the second stimulus. In contrast, paired TN stimulation produced a depression of the reflex response to the second stimulus. Direct activation of the pyramidal tract did not facilitate a second response, suggesting that the MEP facilitation observed using paired TMS occurred in the cortex. A TN stimulus also depressed a subsequent MEP. Since the TN stimulus depressed both inputs, the mechanism is probably post-synaptic, such as afterhyperpolarization of motor neurons. Presynaptic mechanisms, such as homosynaptic depression, would only affect the pathway used as a conditioning stimulus. When TN and TMS pulses were paired, the largest facilitation occurred when TMS preceded TN by about 5 ms, which is optimal for summation of the two pathways at the level of the spinal motor neurons. A later, smaller facilitation occurred when a single TN stimulus preceded TMS by 50-60 ms, an interval that allows enough time for the sensory afferent input to reach the sensory cortex and be relayed to the motor cortex. Other work indicates that repetitively pairing nerve stimuli and TMS at these intervals, known as paired associative stimulation, produces long-term increases in the MEP and may be useful in strengthening residual pathways after damage to the central nervous system.

Using sightability-adjusted brood-pair ratios to estimate waterfowl productivity

USGS Publications Warehouse

Pagano, Anthony M.; Amundson, Courtney L.; Pieron, Matthew R.; Arnold, Todd W.; Kimmel, Timothy C.

2014-01-01

Historically, biologists used brood-pair ratios (BPRs) as an index to waterfowl productivity to help guide management decisions and evaluate conservation practices. However, BPRs are biased by imperfect detection probabilities, especially for broods. We conducted roadside surveys for breeding waterfowl pairs on 7–8 study sites in the springs of 2006–2008 in northeastern North Dakota, USA. Later each year, we conducted replicate counts of broods on the same wetlands and used mark–recapture methods to estimate sightability-adjusted BPRs (SA-BPRs). Traditional roadside brood surveys detected only 30–45% of the available broods, depending on species. We explored the potential for using SA-BPRs to measure hen success (i.e., the probability a female hatches ≥1 egg across all nesting attempts) for mallards (Anas platyrhynchos) and other upland-nesting dabbling ducks (Anas spp.). We found that SA-BPRs explained 40% of the variation in hen success over 5 species of dabbling ducks, and we were able to detect an effect of predator reduction on hen success in combined dabblers, but not in mallards alone. However, we found no relationship between SA-BPRs and mallard fledging rates (hen success × initial brood size × duckling survival). Our results suggest that SA-BPRs can provide a cost-effective alternative to traditional measures of productivity such as nesting success, but not to measures of duckling survival. Nevertheless, SA-BPRs may be useful in areas where traditional measures of waterfowl productivity are logistically or financially challenging.

Performance of six diagnostic tests to screen for Chagas disease in blood banks andprevalence of Trypanosoma cruzi infection among donors with inconclusive serologyscreening based on the analysis of epidemiological variables.

PubMed

Pereira, Gilberto de Araujo; Louzada-Neto, Francisco; Barbosa, Valdirene de Fátima; Ferreira-Silva, Márcia Maria; de Moraes-Souza, Helio

2012-01-01

The frequent occurrence of inconclusive serology in blood banks and the absence of a gold standard test for Chagas'disease led us to examine the efficacy of the blood culture test and five commercial tests (ELISA, IIF, HAI, c-ELISA, rec-ELISA) used in screening blood donors for Chagas disease, as well as to investigate the prevalence of Trypanosoma cruzi infection among donors with inconclusive serology screening in respect to some epidemiological variables. To obtain estimates of interest we considered a Bayesian latent class model with inclusion of covariates from the logit link. A better performance was observed with some categories of epidemiological variables. In addition, all pairs of tests (excluding the blood culture test) presented as good alternatives for both screening (sensitivity > 99.96% in parallel testing) and for confirmation (specificity > 99.93% in serial testing) of Chagas disease. The prevalence of 13.30% observed in the stratum of donors with inconclusive serology, means that probably most of these are non-reactive serology. In addition, depending on the level of specific epidemiological variables, the absence of infection can be predicted with a probability of 100% in this group from the pairs of tests using parallel testing. The epidemiological variables can lead to improved test results and thus assist in the clarification of inconclusive serology screening results. Moreover, all combinations of pairs using the five commercial tests are good alternatives to confirm results.

Developing a Model and Applications for Probabilities of Student Success: A Case Study of Predictive Analytics

ERIC Educational Resources Information Center

Calvert, Carol Elaine

2014-01-01

This case study relates to distance learning students on open access courses. It demonstrates the use of predictive analytics to generate a model of the probabilities of success and retention at different points, or milestones, in a student journey. A core set of explanatory variables has been established and their varying relative importance at…

Gravity and decoherence: the double slit experiment revisited

NASA Astrophysics Data System (ADS)

Samuel, Joseph

2018-02-01

The double slit experiment is iconic and widely used in classrooms to demonstrate the fundamental mystery of quantum physics. The puzzling feature is that the probability of an electron arriving at the detector when both slits are open is not the sum of the probabilities when the slits are open separately. The superposition principle of quantum mechanics tells us to add amplitudes rather than probabilities and this results in interference. This experiment defies our classical intuition that the probabilities of exclusive events add. In understanding the emergence of the classical world from the quantum one, there have been suggestions by Feynman, Diosi and Penrose that gravity is responsible for suppressing interference. This idea has been pursued in many different forms ever since, predominantly within Newtonian approaches to gravity. In this paper, we propose and theoretically analyse two ‘gedanken’ or thought experiments which lend strong support to the idea that gravity is responsible for decoherence. The first makes the point that thermal radiation can suppress interference. The second shows that in an accelerating frame, Unruh radiation does the same. Invoking the Einstein equivalence principle to relate acceleration to gravity, we support the view that gravity is responsible for decoherence.

Interactions between similar and dissimilar charged interfaces in the presence of multivalent anions.

PubMed

Moazzami-Gudarzi, Mohsen; Adam, Pavel; Smith, Alexander M; Trefalt, Gregor; Szilágyi, István; Maroni, Plinio; Borkovec, Michal

2018-04-04

Direct force measurements involving amidine latex (AL) and sulfate latex (SL) particles in aqueous solutions containing multivalent ferrocyanide anions are presented. These measurements feature three different pairs of particles, namely SL-SL, AL-SL, and AL-AL. The force profiles are quantitatively interpreted in terms of the theory by Derjaguin, Landau, Verwey, and Overbeek (DLVO) that is combined with a short-ranged exponential attraction. In monovalent salt solutions, the AL particles are positively charged, while the SL particles are negatively charged. In solutions containing ferrocyanide, the charge of the AL particles is reversed as the concentration is increased. The longer-ranged component of all force profiles is fully compatible with DLVO theory, provided effects of charge regulation are included. At shorter distances, an additional exponential attraction must be introduced, whereby the respective decay length is about 2 nm for the AL-AL pair, and below 1 nm for the SL-SL pair. This non-DLVO force is intermediate for the asymmetric AL-SL pair. These additional forces are probably related to charge fluctuations, patch-charged interactions, or hydrophobic forces.

Algorithmic information theory and the hidden variable question

NASA Technical Reports Server (NTRS)

Fuchs, Christopher

1992-01-01

The admissibility of certain nonlocal hidden-variable theories are explained via information theory. Consider a pair of Stern-Gerlach devices with fixed nonparallel orientations that periodically perform spin measurements on identically prepared pairs of electrons in the singlet spin state. Suppose the outcomes are recorded as binary strings l and r (with l sub n and r sub n denoting their n-length prefixes). The hidden-variable theories considered here require that there exists a recursive function which may be used to transform l sub n into r sub n for any n. This note demonstrates that such a theory cannot reproduce all the statistical predictions of quantum mechanics. Specifically, consider an ensemble of outcome pairs (l,r). From the associated probability measure, the Shannon entropies H sub n and H bar sub n for strings l sub n and pairs (l sub n, r sub n) may be formed. It is shown that such a theory requires that the absolute value of H bar sub n - H sub n be bounded - contrasting the quantum mechanical prediction that it grow with n.

Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

PubMed Central

Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

1997-01-01

RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

PubMed

Romero, Eduardo E; Hernandez, Florencio E

2018-01-03

Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

Magnetic photon splitting and gamma ray burst spectra

NASA Technical Reports Server (NTRS)

Baring, Matthew G.

1992-01-01

The splitting of photons into two photons becomes both possible and significant in magnetic fields in excess of 10(exp 12) Gauss. Below the threshold energy, 2m sub e c(exp 2) for single photon pair production, splitting can be an astronomically observable phenomenon evident in gamma ray burst spectra. In such circumstances, it was found that magnetic photon splitting reprocesses the gamma ray burst continuum by degrading the photon energy, with a net effect that is quite similar to pair cascade reprocessing of the spectrum. Results are presented for the spectral modifications due to splitting, taking into account the different probabilities for splitting for different polarization modes. Unpolarized and polarized pair cascade photon spectra form the input spectra for the model, which calculates the resulting splitting reprocessed spectra numerically by solving the photon kinetic equations for each polarization mode. This inclusion of photon polarizations is found to not alter previous predictions that splitting produce a significant flattening of the hard X ray continuum and a bump at MeV energies below a pair production turnover. The spectrum near the bump is always strongly polarized.

Unbiased clustering estimation in the presence of missing observations

NASA Astrophysics Data System (ADS)

Bianchi, Davide; Percival, Will J.

2017-11-01

In order to be efficient, spectroscopic galaxy redshift surveys do not obtain redshifts for all galaxies in the population targeted. The missing galaxies are often clustered, commonly leading to a lower proportion of successful observations in dense regions. One example is the close-pair issue for SDSS spectroscopic galaxy surveys, which have a deficit of pairs of observed galaxies with angular separation closer than the hardware limit on placing neighbouring fibres. Spatially clustered missing observations will exist in the next generations of surveys. Various schemes have previously been suggested to mitigate these effects, but none works for all situations. We argue that the solution is to link the missing galaxies to those observed with statistically equivalent clustering properties, and that the best way to do this is to rerun the targeting algorithm, varying the angular position of the observations. Provided that every pair has a non-zero probability of being observed in one realization of the algorithm, then a pair-upweighting scheme linking targets to successful observations, can correct these issues. We present such a scheme, and demonstrate its validity using realizations of an idealized simple survey strategy.

A sensitivity analysis for missing outcomes due to truncation by death under the matched-pairs design.

PubMed

Imai, Kosuke; Jiang, Zhichao

2018-04-29

The matched-pairs design enables researchers to efficiently infer causal effects from randomized experiments. In this paper, we exploit the key feature of the matched-pairs design and develop a sensitivity analysis for missing outcomes due to truncation by death, in which the outcomes of interest (e.g., quality of life measures) are not even well defined for some units (e.g., deceased patients). Our key idea is that if 2 nearly identical observations are paired prior to the randomization of the treatment, the missingness of one unit's outcome is informative about the potential missingness of the other unit's outcome under an alternative treatment condition. We consider the average treatment effect among always-observed pairs (ATOP) whose units exhibit no missing outcome regardless of their treatment status. The naive estimator based on available pairs is unbiased for the ATOP if 2 units of the same pair are identical in terms of their missingness patterns. The proposed sensitivity analysis characterizes how the bounds of the ATOP widen as the degree of the within-pair similarity decreases. We further extend the methodology to the matched-pairs design in observational studies. Our simulation studies show that informative bounds can be obtained under some scenarios when the proportion of missing data is not too large. The proposed methodology is also applied to the randomized evaluation of the Mexican universal health insurance program. An open-source software package is available for implementing the proposed research. Copyright © 2018 John Wiley & Sons, Ltd.

Dual origin of pairing in nuclei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Idini, A.; Potel, G.; Barranco, F.

The pairing correlations of the nucleus {sup 120}Sn are calculated by solving the Nambu–Gor’kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairingmore » interaction. The first is the strong {sup 1}S{sub 0} short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- (v{sub p}{sup bare}) and long-range (v{sub p}{sup ind}) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.« less

Acid-induced exchange of the imino proton in G.C pairs.

PubMed Central

Nonin, S; Leroy, J L; Gueron, M

1996-01-01

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

Acid-induced exchange of the imino proton in G.C pairs.

PubMed

Nonin, S; Leroy, J L; Gueron, M

1996-02-15

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

Answer to Question {number_sign}21 [{open_quote}{open_quote}Snell{close_quote}s law in quantum mechanics,{close_quote}{close_quote} Steve Blau and Brad Halfpap, Am. J. Phys. {bold 63} (7), 583 (1995)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Milonni, P.W.

1996-07-01

The quantum mechanical description of reflection and refraction in terms of photons is further extrapolated. The probability amplitude for a photon to be found inside or outside the medium is derived.

Late quaternary environments, Denali National Park and Preserve, Alaska

USGS Publications Warehouse

Elias, S.A.; Short, S.K.; Waythomas, C.F.

1996-01-01

Late Quaternary pollen, plant macrofossils, and insect fossils were studied from sites along three rivers in the foothills north of the Alaska Range in Denali National Park and Preserve. The aim was to carry out a reconaissance of late Quaternary organic sediments in the region, emphasizing the mid-Wisconsin, or Boutellier interstadial interval. Samples of probable early- to mid-Boutellier age (ca. 60 000 to 40 000 B.P.) from Unit 2 at the Toklat High Bluffs site indicate open boreal woodland with dense alder shrub vegetation. Organic Unit 1 at the Foraker River Slump site indicates open taiga with shrubs of probable Boutellier age. Fossil evidence from the youngest horizon in this unit indicates graminoid tundra environments, marking the transition from interstadial to late Wisconsin glacial environments. Early Holocene samples from the Foraker exposures suggest birch shrub tundra; coniferous forest apparently became established only alter 6500 B.P. Local variations in forest composition at the Foraker and Sushana sites were probably the result of disturbances, such as fire.

A novel approach to estimate the eruptive potential and probability in open conduit volcanoes

PubMed Central

De Gregorio, Sofia; Camarda, Marco

2016-01-01

In open conduit volcanoes, volatile-rich magma continuously enters into the feeding system nevertheless the eruptive activity occurs intermittently. From a practical perspective, the continuous steady input of magma in the feeding system is not able to produce eruptive events alone, but rather surplus of magma inputs are required to trigger the eruptive activity. The greater the amount of surplus of magma within the feeding system, the higher is the eruptive probability.Despite this observation, eruptive potential evaluations are commonly based on the regular magma supply, and in eruptive probability evaluations, generally any magma input has the same weight. Conversely, herein we present a novel approach based on the quantification of surplus of magma progressively intruded in the feeding system. To quantify the surplus of magma, we suggest to process temporal series of measurable parameters linked to the magma supply. We successfully performed a practical application on Mt Etna using the soil CO2 flux recorded over ten years. PMID:27456812

A novel approach to estimate the eruptive potential and probability in open conduit volcanoes.

PubMed

De Gregorio, Sofia; Camarda, Marco

2016-07-26

In open conduit volcanoes, volatile-rich magma continuously enters into the feeding system nevertheless the eruptive activity occurs intermittently. From a practical perspective, the continuous steady input of magma in the feeding system is not able to produce eruptive events alone, but rather surplus of magma inputs are required to trigger the eruptive activity. The greater the amount of surplus of magma within the feeding system, the higher is the eruptive probability.Despite this observation, eruptive potential evaluations are commonly based on the regular magma supply, and in eruptive probability evaluations, generally any magma input has the same weight. Conversely, herein we present a novel approach based on the quantification of surplus of magma progressively intruded in the feeding system. To quantify the surplus of magma, we suggest to process temporal series of measurable parameters linked to the magma supply. We successfully performed a practical application on Mt Etna using the soil CO2 flux recorded over ten years.

N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

PubMed Central

Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

2013-01-01

We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

Integrated electrical connector

DOEpatents

Benett, William J.; Ackler, Harold D.

2005-05-24

An electrical connector is formed from a sheet of electrically conductive material that lies in between the two layers of nonconducting material that comprise the casing of an electrical chip. The connector is electrically connected to an electrical element embedded within the chip. An opening in the sheet is concentrically aligned with a pair of larger holes respectively bored through the nonconducting layers. The opening is also smaller than the diameter of an electrically conductive contact pin. However, the sheet is composed flexible material so that the opening adapts to the diameter of the pin when the pin is inserted therethrough. The periphery of the opening applies force to the sides of the pin when the pin is inserted, and thus holds the pin within the opening and in contact with the sheet, by friction. The pin can be withdrawn from the connector by applying sufficient axial force.

Characterization of the IMF By-dependent field-aligned currents in the cleft region based on DE 2 observations

NASA Technical Reports Server (NTRS)

Taguchi, S.; Sugiura, M.; Winningham, J. D.; Slavin, J. A.

1993-01-01

The magnetic field and plasma data from 47 passes of DE-2 are used to study the IMF By-dependent distribution of field-aligned currents in the cleft region. It is proposed that the low-latitude cleft current (LCC) region is not an extension of the region 1 or region 2 current system and that a pair of LCCs and high-latitude cleft currents (HCCs) constitutes the cleft field-aligned current regime. The proposed pair of cleft field-aligned currents is explained with a qualitative model in which this pair of currents is generated on open field lines that have just been reconnected on the dayside magnetopause. The electric fields are transmitted along the field lines to the ionosphere, creating a poleward electric field and a pair of field-aligned currents when By is positive; the pair of field-aligned currents consists of a downward current at lower latitudes and an upward current at higher latitudes. In the By negative case, the model explains the reversal of the field-aligned current direction in the LCC and HCC regions.

Attentional Regulation in Young Twins with Probable Stuttering, High Nonfluency, and Typical Fluency

ERIC Educational Resources Information Center

Felsenfeld, Susan; van Beljsterveldt, Catharina Eugenie Maria; Boomsma, Dorret Irene

2010-01-01

Purpose: Using a sample of 20,445 Dutch twins, this study examined the relationship between speech fluency and attentional regulation in children. A secondary objective was to identify etiological overlap between nonfluency and poor attention using fluency-discordant twin pairs. Method: Three fluency groups were created at age 5 using a parent…

Assessing risk to birds from industrial wind energy development via paired resource selection nodels

Treesearch

Tricia A. Miller; Robert P. Brooks; Michael Lanzone; David Brandes; Jeff Cooper; Kieran O' malley; Charles Maisonneuve; Junior Tremblay; Adam Duerr; Todd Katzner

2014-01-01

When wildlife habitat overlaps with industrial development animals may be harmed. Because wildlife and people select resources to maximize biological fitness and economic return, respectively, we estimated risk, the probability of eagles encountering and being affected by turbines, by overlaying models of resource selection for each entity. This conceptual framework...

Properties of Decameter IIIb-III Pairs

NASA Astrophysics Data System (ADS)

Melnik, V. N.; Brazhenko, A. I.; Frantsuzenko, A. V.; Dorovskyy, V. V.; Rucker, H. O.

2018-02-01

A large number of Type IIIb-III pairs, in which the first component is a Type IIIb burst and the second one is a Type III burst, are often recorded during decameter Type III burst storms. From the beginning of their observation, the question of whether the components of these pairs are the first and the second harmonics of radio emission or not has remained open. We discuss properties of decameter IIIb-III pairs in detail to answer this question. The components of these pairs, Type IIIb bursts and Type III bursts, have essentially different durations and polarizations. At the same time their frequency drift rates are rather close, provided that the drift rates of Type IIIb bursts are a little larger those of Type III bursts at the same frequency. Frequency ratios of the bursts at the same moment are close to two. This points at a harmonic connection of the components in IIIb-III pairs. At the same time there was a serious difficulty, namely why the first harmonic had fine frequency structure in the form of striae and the second harmonic did not have it. Recently Loi, Cairns, and Li ( Astrophys. J. 790, 67, 2014) succeeded in solving this problem. The physical aspects of observational properties of decameter IIIb-III pairs are discussed and pros and cons of harmonic character of Type IIIb bursts and Type III bursts in IIIb-III pairs are presented. We conclude that practically all properties of the IIIb-III pair components can be understood in the framework of the harmonic relation of the components of the IIIb-III pairs.

Engineered plant biomass feedstock particles

DOEpatents

Dooley, James H [Federal Way, WA; Lanning, David N [Federal Way, WA; Broderick, Thomas F [Lake Forest Park, WA

2011-10-18

A novel class of flowable biomass feedstock particles with unusually large surface areas that can be manufactured in remarkably uniform sizes using low-energy comminution techniques. The feedstock particles are roughly parallelepiped in shape and characterized by a length dimension (L) aligned substantially with the grain direction and defining a substantially uniform distance along the grain, a width dimension (W) normal to L and aligned cross grain, and a height dimension (H) normal to W and L. The particles exhibit a disrupted grain structure with prominent end and surface checks that greatly enhances their skeletal surface area as compared to their envelope surface area. The L.times.H dimensions define a pair of substantially parallel side surfaces characterized by substantially intact longitudinally arrayed fibers. The W.times.H dimensions define a pair of substantially parallel end surfaces characterized by crosscut fibers and end checking between fibers. The L.times.W dimensions define a pair of substantially parallel top surfaces characterized by some surface checking between longitudinally arrayed fibers. At least 80% of the particles pass through a 1/4 inch screen having a 6.3 mm nominal sieve opening but are retained by a No. 10 screen having a 2 mm nominal sieve opening. The feedstock particles are manufactured from a variety of plant biomass materials including wood, crop residues, plantation grasses, hemp, bagasse, and bamboo.

XaNSoNS: GPU-accelerated simulator of diffraction patterns of nanoparticles

NASA Astrophysics Data System (ADS)

Neverov, V. S.

XaNSoNS is an open source software with GPU support, which simulates X-ray and neutron 1D (or 2D) diffraction patterns and pair-distribution functions (PDF) for amorphous or crystalline nanoparticles (up to ∼107 atoms) of heterogeneous structural content. Among the multiple parameters of the structure the user may specify atomic displacements, site occupancies, molecular displacements and molecular rotations. The software uses general equations nonspecific to crystalline structures to calculate the scattering intensity. It supports four major standards of parallel computing: MPI, OpenMP, Nvidia CUDA and OpenCL, enabling it to run on various architectures, from CPU-based HPCs to consumer-level GPUs.

Coherent exciton transport in dendrimers and continuous-time quantum walks

NASA Astrophysics Data System (ADS)

Mülken, Oliver; Bierbaum, Veronika; Blumen, Alexander

2006-03-01

We model coherent exciton transport in dendrimers by continuous-time quantum walks. For dendrimers up to the second generation the coherent transport shows perfect recurrences when the initial excitation starts at the central node. For larger dendrimers, the recurrence ceases to be perfect, a fact which resembles results for discrete quantum carpets. Moreover, depending on the initial excitation site, we find that the coherent transport to certain nodes of the dendrimer has a very low probability. When the initial excitation starts from the central node, the problem can be mapped onto a line which simplifies the computational effort. Furthermore, the long time average of the quantum mechanical transition probabilities between pairs of nodes shows characteristic patterns and allows us to classify the nodes into clusters with identical limiting probabilities. For the (space) average of the quantum mechanical probability to be still or to be again at the initial site, we obtain, based on the Cauchy-Schwarz inequality, a simple lower bound which depends only on the eigenvalue spectrum of the Hamiltonian.

Bond-length distributions for ions bonded to oxygen: results for the non-metals and discussion of lone-pair stereoactivity and the polymerization of PO4

PubMed Central

Gagné, Olivier Charles

2018-01-01

Bond-length distributions are examined for three configurations of the H+ ion, 16 configurations of the group 14–16 non-metal ions and seven configurations of the group 17 ions bonded to oxygen, for 223 coordination polyhedra and 452 bond distances for the H+ ion, 5957 coordination polyhedra and 22 784 bond distances for the group 14–16 non-metal ions, and 248 coordination polyhedra and 1394 bond distances for the group 17 non-metal ions. H⋯O and O—H + H⋯O distances correlate with O⋯O distance (R 2 = 0.94 and 0.96): H⋯O = 1.273 × O⋯O – 1.717 Å; O—H + H⋯O = 1.068 × O⋯O – 0.170 Å. These equations may be used to locate the hydrogen atom more accurately in a structure refined by X-ray diffraction. For non-metal elements that occur with lone-pair electrons, the most observed state between the n versus n+2 oxidation state is that of highest oxidation state for period 3 cations, and lowest oxidation state for period 4 and 5 cations when bonded to O2−. Observed O—X—O bond angles indicate that the period 3 non-metal ions P3+, S4+, Cl3+ and Cl5+ are lone-pair seteroactive when bonded to O2−, even though they do not form secondary bonds. There is no strong correlation between the degree of lone-pair stereoactivity and coordination number when including secondary bonds. There is no correlation between lone-pair stereoactivity and bond-valence sum at the central cation. In synthetic compounds, PO4 polymerizes via one or two bridging oxygen atoms, but not by three. Partitioning our PO4 dataset shows that multi-modality in the distribution of bond lengths is caused by the different bond-valence constraints that arise for Obr = 0, 1 and 2. For strongly bonded cations, i.e. oxyanions, the most probable cause of mean bond length variation is the effect of structure type, i.e. stress induced by the inability of a structure to follow its a priori bond lengths. For ions with stereoactive lone-pair electrons, the most probable cause of variation is bond-length distortion.

Measuring kinetics of complex single ion channel data using mean-variance histograms.

PubMed Central

Patlak, J B

1993-01-01

The measurement of single ion channel kinetics is difficult when those channels exhibit subconductance events. When the kinetics are fast, and when the current magnitudes are small, as is the case for Na+, Ca2+, and some K+ channels, these difficulties can lead to serious errors in the estimation of channel kinetics. I present here a method, based on the construction and analysis of mean-variance histograms, that can overcome these problems. A mean-variance histogram is constructed by calculating the mean current and the current variance within a brief "window" (a set of N consecutive data samples) superimposed on the digitized raw channel data. Systematic movement of this window over the data produces large numbers of mean-variance pairs which can be assembled into a two-dimensional histogram. Defined current levels (open, closed, or sublevel) appear in such plots as low variance regions. The total number of events in such low variance regions is estimated by curve fitting and plotted as a function of window width. This function decreases with the same time constants as the original dwell time probability distribution for each of the regions. The method can therefore be used: 1) to present a qualitative summary of the single channel data from which the signal-to-noise ratio, open channel noise, steadiness of the baseline, and number of conductance levels can be quickly determined; 2) to quantify the dwell time distribution in each of the levels exhibited. In this paper I present the analysis of a Na+ channel recording that had a number of complexities. The signal-to-noise ratio was only about 8 for the main open state, open channel noise, and fast flickers to other states were present, as were a substantial number of subconductance states. "Standard" half-amplitude threshold analysis of these data produce open and closed time histograms that were well fitted by the sum of two exponentials, but with apparently erroneous time constants, whereas the mean-variance histogram technique provided a more credible analysis of the open, closed, and subconductance times for the patch. I also show that the method produces accurate results on simulated data in a wide variety of conditions, whereas the half-amplitude method, when applied to complex simulated data shows the same errors as were apparent in the real data. The utility and the limitations of this new method are discussed. Images FIGURE 2 FIGURE 4 FIGURE 8 FIGURE 9 PMID:7690261

[OPEN FIELD BEHAVIOR AS A PREDICTIVE CRITERIA REFLECTING RATS CORTICOSTERONELEVEL BEFORE AND AFTER STRESS].

PubMed

Umriukhin, P E; Grigorchuk, O S

2015-12-01

In the presented study we investigated the possibility to use the open field behavior data for prediction of corticosterone level in rat blood plasma before and after stress. It is shown that the most reliable open field behavior parameters, reflecting high probability of significant upregulation of corticosterone after 3 hours of immobilization, are the short latency of first movement and low locomotor activity during the test. Rats with high corticosterone at normal non-stress conditions are characterized by low locomotor activity and on the contrary long latency period for the entrance of open field center.

The origin of polynucleotide-directed protein synthesis

NASA Technical Reports Server (NTRS)

Orgel, Leslie E.

1989-01-01

If protein synthesis evolved in an RNA world it was probably preceded by simpler processes by means of which interaction with amino acids conferred selective advantage on replicating RNA molecules. It is suggested that at first the simple attachment of amino acids to the 2'(3') termini of RNA templates favored initiation of replication at the end of the template rather than at internal positions. The second stage in the evolution of protein synthesis would probably have been the association of pairs of charged RNA adaptors in such a way as to favor noncoded formation of peptides. Only after this process had become efficient could coded synthesis have begun.