Translational Entropy and DNA Duplex Stability.
Privalov, Peter L; Crane-Robinson, Colyn
2018-01-09
Investigation of folding/unfolding DNA duplexes of various size and composition by superprecise calorimetry has revised several long-held beliefs concerning the forces responsible for the formation of the double helix. It was established that: 1) the enthalpy and the entropy of duplex unfolding are temperature dependent, increasing with temperature rise and having the same heat capacity increment for CG and AT pairs; 2) the enthalpy of AT melting is greater than that of the CG pair, so the stabilizing effect of the CG pair in comparison with AT results not from its larger enthalpic contribution (as expected from its extra hydrogen bond), but from the larger entropic contribution of the AT pair that results from its ability to fix ordered water in the minor groove and release it upon duplex unfolding; 3) the translation entropy, resulting from the appearance of a new kinetic unit on duplex dissociation, determines the dependence of duplex stability on its length and its concentration (it is an order-of-magnitude smaller than predicted from the statistical mechanics of gases and is fully expressed by the stoichiometric correction term); 4) changes in duplex stability on reshuffling the sequence (the "nearest-neighbor effect") result from the immobilized water molecules fixed by AT pairs in the minor groove; and 5) the evaluated thermodynamic components permit a quantitative expression of DNA duplex stability. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion
Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.
2014-01-01
The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089
Moreira, Bernardo G; You, Yong; Owczarzy, Richard
2015-03-01
Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.
Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences
König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.
2013-01-01
G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141
Noronha, Anne M; Noll, David M; Wilds, Christopher J; Miller, Paul S
2002-01-22
The preparation and physical properties of short DNA duplexes that contain a N(4)C-ethyl-N(4)C interstrand cross-link are described. Duplexes that contain an interstrand cross-link between mismatched C-C residues and duplexes in which the C residues of a -CG- or -GC- step are linked to give "staggered" interstrand cross-links were prepared using a novel N(4)C-ethyl-N(4)C phosphoramidite reagent. Duplexes with the C-C mismatch cross-link have UV thermal transition temperatures that are 25 degrees C higher than the melting temperatures of control duplexes in which the cross-link is replaced with a G-C base pair. It appears that this cross-link stabilizes adjacent base pairs and does not perturb the structure of the helix, a conclusion that is supported by the CD spectrum of this duplex and by molecular models. An even higher level of stabilization, 49 degrees C, is seen with the duplex that contains a -CG- staggered cross-link. Molecular models suggest that this cross-link may induce propeller twisting in the cross-linked base pairs, and the CD spectrum of this duplex exhibits an unusual negative band at 298 nm, although the remainder of the spectrum is similar to that of B-form DNA. Mismatched C-C or -CG- staggered cross-linked duplexes that have complementary overhanging ends can undergo self-ligation catalyzed by T4 DNA ligase. Analysis of the ligated oligomers by nondenaturing polyacrylamide gel electrophoresis shows that the resulting oligomers migrate in a manner similar to that of a mixture of non-cross-linked control oligomers and suggests that these cross-links do not result in significant bending of the helix. However, the orientation of the staggered cross-link can have a significant effect on the structure and stability of the cross-linked duplex. Thus, the thermal stability of the duplex that contains a -GC- staggered cross-link is 10 degrees C lower than the melting temperature of the control, non-cross-linked duplex. Unlike the -CG- staggered cross-link, in which the cross-linked base pairs can still maintain hydrogen bond contacts, molecular models suggest that formation of the -GC- staggered cross-link disrupts hydrogen bonding and may also perturb adjacent base pairs leading to an overall reduction in helix stability. Duplexes with specifically positioned and oriented cross-links can be used as substrates to study DNA repair mechanisms.
The loss of a hydrogen bond: Thermodynamic contributions of a non-standard nucleotide
Jolley, Elizabeth A.
2017-01-01
Abstract Non-standard nucleotides are ubiquitous in RNA. Thermodynamic studies with RNA duplexes containing non-standard nucleotides, whether incorporated naturally or chemically, can provide insight into the stability of Watson–Crick pairs and the role of specific functional groups in stabilizing a Watson–Crick pair. For example, an A-U, inosine•U and pseudouridine•A pair each form two hydrogen bonds. However, an RNA duplex containing a central I•U pair or central Ψ•A pair is 2.4 kcal/mol less stable or 1.7 kcal/mol more stable, respectively, than the corresponding duplex containing an A-U pair. In the non-standard nucleotide purine, hydrogen replaces the exocyclic amino group of A. This replacement results in a P•U pair containing only one hydrogen bond. Optical melting studies were performed with RNA duplexes containing P•U pairs adjacent to different nearest neighbors. The resulting thermodynamic parameters were compared to RNA duplexes containing A-U pairs in order to determine the contribution of the hydrogen bond involving the exocyclic amino group. Results indicate a loss of 1.78 kcal/mol, on average, when an internal P•U replaces A-U in an RNA duplex. This value is compared to the thermodynamics of a hydrogen bond determined by similar methods. Nearest neighbor parameters were derived for use in free energy and secondary structure prediction software. PMID:28180321
NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.
Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L
2014-03-07
Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.
Thermodynamic insights into 2-thiouridine-enhanced RNA hybridization
Larsen, Aaron T.; Fahrenbach, Albert C.; Sheng, Jia; Pian, Julia; Szostak, Jack W.
2015-01-01
Nucleobase modifications dramatically alter nucleic acid structure and thermodynamics. 2-thiouridine (s2U) is a modified nucleobase found in tRNAs and known to stabilize U:A base pairs and destabilize U:G wobble pairs. The recently reported crystal structures of s2U-containing RNA duplexes do not entirely explain the mechanisms responsible for the stabilizing effect of s2U or whether this effect is entropic or enthalpic in origin. We present here thermodynamic evaluations of duplex formation using ITC and UV thermal denaturation with RNA duplexes containing internal s2U:A and s2U:U pairs and their native counterparts. These results indicate that s2U stabilizes both duplexes. The stabilizing effect is entropic in origin and likely results from the s2U-induced preorganization of the single-stranded RNA prior to hybridization. The same preorganizing effect is likely responsible for structurally resolving the s2U:U pair-containing duplex into a single conformation with a well-defined H-bond geometry. We also evaluate the effect of s2U on single strand conformation using UV- and CD-monitored thermal denaturation and on nucleoside conformation using 1H NMR spectroscopy, MD and umbrella sampling. These results provide insights into the effects that nucleobase modification has on RNA structure and thermodynamics and inform efforts toward improving both ribozyme-catalyzed and nonenzymatic RNA copying. PMID:26240387
Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes
Watkins, Norman E.; SantaLucia, John
2005-01-01
Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
The energetic basis of the DNA double helix: a combined microcalorimetric approach
Vaitiekunas, Paulius; Crane-Robinson, Colyn; Privalov, Peter L.
2015-01-01
Microcalorimetric studies of DNA duplexes and their component single strands showed that association enthalpies of unfolded complementary strands into completely folded duplexes increase linearly with temperature and do not depend on salt concentration, i.e. duplex formation results in a constant heat capacity decrement, identical for CG and AT pairs. Although duplex thermostability increases with CG content, the enthalpic and entropic contributions of an AT pair to duplex formation exceed that of a CG pair when compared at the same temperature. The reduced contribution of AT pairs to duplex stabilization comes not from their lower enthalpy, as previously supposed, but from their larger entropy contribution. This larger enthalpy and particularly the greater entropy results from water fixed by the AT pair in the minor groove. As the increased entropy of an AT pair exceeds that of melting ice, the water molecule fixed by this pair must affect those of its neighbors. Water in the minor groove is, thus, orchestrated by the arrangement of AT groups, i.e. is context dependent. In contrast, water hydrating exposed nonpolar surfaces of bases is responsible for the heat capacity increment on dissociation and, therefore, for the temperature dependence of all thermodynamic characteristics of the double helix. PMID:26304541
O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.
2006-01-01
Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533
Structural energetics of the adenine tract from an intrinsic transcription terminator.
Huang, Yuegao; Weng, Xiaoli; Russu, Irina M
2010-04-02
Intrinsic transcription termination sites generally contain a tract of adenines in the DNA template that yields a tract of uracils at the 3' end of the nascent RNA. To understand how this base sequence contributes to termination of transcription, we have investigated two nucleic acid structures. The first is the RNA-DNA hybrid that contains the uracil tract 5'-rUUUUUAU-3' from the tR2 intrinsic terminator of bacteriophage lambda. The second is the homologous DNA-DNA duplex that contains the adenine tract 5'-dATAAAAA-3'. This duplex is present at the tR2 site when the DNA is not transcribed. The opening and the stability of each rU-dA/dT-dA base pair in the two structures are characterized by imino proton exchange and nuclear magnetic resonance spectroscopy. The results reveal concerted opening of the central rU-dA base pairs in the RNA-DNA hybrid. Furthermore, the stability profile of the adenine tract in the RNA-DNA hybrid is very different from that of the tract in the template DNA-DNA duplex. In the RNA-DNA hybrid, the stabilities of rU-dA base pairs range from 4.3 to 6.5 kcal/mol (at 10 degrees C). The sites of lowest stability are identified at the central positions of the tract. In the template DNA-DNA duplex, the dT-dA base pairs are more stable than the corresponding rU-dA base pairs in the hybrid by 0.9 to 4.6 kcal/mol and, in contrast to the RNA-DNA hybrid, the central base pairs have the highest stability. These results suggest that the central rU-dA/dT-dA base pairs in the adenine tract make the largest energetic contributions to transcription termination by promoting both the dissociation of the RNA transcript and the closing of the transcription bubble. The results also suggest that the high stability of dT-dA base pairs in the DNA provides a signal for the pausing of RNA polymerase at the termination site. Copyright 2010 Elsevier Ltd. All rights reserved.
Gupta, Sharad K; Sur, Souvik; Prasad Ojha, Rajendra; Tandon, Vibha
2013-07-01
This paper describes the synthesis of a novel 8-aza-7-deazapurin-2,6-diamine (DPP)-containing peptide nucleic acid (PNA) monomer and Boc protecting group-based oligomerization of PNA, replacing adenine (A) with DPP monomers in the PNA strand. The PNA oligomers were synthesized against the biologically relevant SV40 promoter region (2494-AATTTTTTTTATTTA-2508) of pEGFP-N3 plasmid. The DPP-PNA·DNA duplex showed enhanced stability as compared to normal duplex (A-PNA·DNA). The electronic distribution of DPP monomer suggested that DPP had better electron donor properties over 2,6-diamino purine. UV melting and thermodynamic analysis revealed that the PNA oligomer containing a diaminopyrazolo(3,4-d)pyrimidine moiety (DPP) stabilized the PNA·DNA hybrids compared to A-PNA·DNA. DPP-PNA·DNA duplex showed higher water activity (Δnw = 38.5) in comparison to A-PNA·DNA duplex (Δnw = 14.5). The 50 ns molecular dynamics simulations of PNA·DNA duplex containing DPP or unmodified nucleobase-A showed average H-bond distances in the DPP-dT base pair of 2.90 Å (OH-N bond) and 2.91 Å (NH-N bond), which were comparably shorter than in the A-dT base pair, in which the average distances were 3.18 Å (OH-N bond) and 2.97 Å (NH-N bond), and there was one additional H-bond in the DPP-dT base pair of around 2.98 Å (O2H-N2 bond), supporting the higher stability of DPP-PNA·DNA. The analysis of molecular dynamics simulation data showed that the system binding free energy increased at a rate of approximately -4.5 kcal mol(-1) per DPP base of the PNA·DNA duplex. In summary, increased thermal stability, stronger hydrogen bonding and more stable conformation in the DPP-PNA·DNA duplex make it a better candidate as antisense/antigene therapeutic agents.
Thermal stability of DNA quadruplex-duplex hybrids.
Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân
2014-01-14
DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.
Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos
2018-01-01
Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486
Solution structure and stability of the DNA undecamer duplexes containing oxanine mismatch
Pack, Seung Pil; Morimoto, Hirohisa; Makino, Keisuke; Tajima, Kunihiko; Kanaori, Kenji
2012-01-01
Solution structures of DNA duplexes containing oxanine (Oxa, O) opposite a cytosine (O:C duplex) and opposite a thymine (O:T duplex) have been solved by the combined use of 1H NMR and restrained molecular dynamics calculation. One mismatch pair was introduced into the center of the 11-mer duplex of [d(GTGACO6CACTG)/d(CAGTGX17GTCAC), X = C or T]. 1H NMR chemical shifts and nuclear Overhauser enhancement (NOE) intensities indicate that both the duplexes adopt an overall right-handed B-type conformation. Exchangeable resonances of C17 4-amino proton of the O:C duplex and of T17 imino proton of O:T duplex showed unusual chemical shifts, and disappeared with temperature increasing up to 30°C, although the melting temperatures were >50°C. The O:C mismatch takes a wobble geometry with positive shear parameter where the Oxa ring shifted toward the major groove and the paired C17 toward the minor groove, while, in the O:T mismatch pair with the negative shear, the Oxa ring slightly shifted toward the minor groove and the paired T17 toward the major groove. The Oxa mismatch pairs can be wobbled largely because of no hydrogen bond to the O1 position of the Oxa base, and may occupy positions in the strands that optimize the stacking with adjacent bases. PMID:22039100
Stacked-unstacked equilibrium at the nick site of DNA.
Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D
2004-09-17
Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri
Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the basesmore » and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.« less
Copp, William; Denisov, Alexey Y.; Xie, Jingwei; Noronha, Anne M.; Liczner, Christopher; Safaee, Nozhat
2017-01-01
Abstract Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2′-deoxyribose, 2′-O-methyl-ribose, 2′-deoxy-2′-fluoro-ribose, arabinose and 2′-deoxy-2′-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2’ modifications gave a variety of effects. Arabinose and 2′-deoxy-2′-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2′-O-methyl and 2′-deoxy-2′-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. PMID:28973475
Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle
2017-09-29
Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2014-02-24
The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Teng, Ye; Pramanik, Smritimoy; Tateishi-Karimata, Hisae; Ohyama, Tatsuya; Sugimoto, Naoki
2018-02-05
The trinucleotide repeat d(CXG) (X = A, C, G or T) is the most common sequence causing repeat expansion disorders. The formation of non-canonical structures, such as hairpin structures with X-X mismatches, has been proposed to affect gene expression and regulation, which are important in pathological studies of these devastating neurological diseases. However, little information is available regarding the thermodynamics of the repeat sequence under crowded cellular conditions where many non-canonical structures such as G-quadruplexes are highly stabilized, while duplexes are destabilised. In this study, we investigated the different stabilities of X-X mismatches in the context of internal d(CXG) self-complementary sequences in an environment with a high concentration of cosolutes to mimic the crowding conditions in cells. The stabilities of full-matched duplexes and duplexes with A-A, G-G, and T-T mismatched base pairs under molecular crowding conditions were notably decreased compared to under dilute conditions. However, the stability of the DNA duplex with a C-C mismatch base pair was only slightly destabilised. Investigating different stabilities of X-X mismatches in d(CXG) sequences is important for improving our understanding of the formation and transition of multiple non-canonical structures in trinucleotide repeat diseases, and may provide insights for pathological studies and drug development. Copyright © 2018 Elsevier Inc. All rights reserved.
Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.
Nakano, Shu-ichi; Sugimoto, Naoki
2014-08-05
The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.
Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko
2015-10-12
A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara
2015-01-01
2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hibio, Naoki; Hino, Kimihiro; Shimizu, Eigo; Nagata, Yoshiro; Ui-Tei, Kumiko
2012-01-01
MicroRNAs (miRNAs) are key regulators of sequence-specific gene silencing. However, crucial factors that determine the efficacy of miRNA-mediated target gene silencing are poorly understood. Here we mathematized base-pairing stability and showed that miRNAs with an unstable 5′ terminal duplex and stable seed-target duplex exhibit strong silencing activity. The results are consistent with the previous findings that an RNA strand with unstable 5′ terminal in miRNA duplex easily loads onto the RNA-induced silencing complex (RISC), and miRNA recognizes target mRNAs with seed-complementary sequences to direct posttranscriptional repression. Our results suggested that both the unwinding and target recognition processes of miRNAs could be proficiently controlled by the thermodynamics of base-pairing in protein-free condition. Interestingly, such thermodynamic parameters might be evolutionarily well adapted to the body temperatures of various species. PMID:23251782
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sakuraba, Shun; Asai, Kiyoshi; Kameda, Tomoshi
2015-11-05
The dimerization free energies of RNA-RNA duplexes are fundamental values that represent the structural stability of RNA complexes. We report a comparative analysis of RNA-RNA duplex dimerization free-energy changes upon mutations, estimated from a molecular dynamics simulation and experiments. A linear regression for nine pairs of double-stranded RNA sequences, six base pairs each, yielded a mean absolute deviation of 0.55 kcal/mol and an R(2) value of 0.97, indicating quantitative agreement between simulations and experimental data. The observed accuracy indicates that the molecular dynamics simulation with the current molecular force field is capable of estimating the thermodynamic properties of RNA molecules.
Wang, Xiaoyu; Hoshika, Shuichi; Peterson, Raymond J; Kim, Myong-Jung; Benner, Steven A; Kahn, Jason D
2017-05-19
Synthetic nucleobases presenting non-Watson-Crick arrangements of hydrogen bond donor and acceptor groups can form additional nucleotide pairs that stabilize duplex DNA independent of the standard A:T and G:C pairs. The pair between 2-amino-3-nitropyridin-6-one 2'-deoxyriboside (presenting a {donor-donor-acceptor} hydrogen bonding pattern on the Watson-Crick face of the small component, trivially designated Z) and imidazo[1,2-a]-1,3,5-triazin-4(8H)one 2'-deoxyriboside (presenting an {acceptor-acceptor-donor} hydrogen bonding pattern on the large component, trivially designated P) is one of these extra pairs for which a substantial amount of molecular biology has been developed. Here, we report the results of UV absorbance melting measurements and determine the energetics of binding of DNA strands containing Z and P to give short duplexes containing Z:P pairs as well as various mismatches comprising Z and P. All measurements were done at 1 M NaCl in buffer (10 mM Na cacodylate, 0.5 mM EDTA, pH 7.0). Thermodynamic parameters (ΔH°, ΔS°, and ΔG° 37 ) for oligonucleotide hybridization were extracted. Consistent with the Watson-Crick model that considers both geometric and hydrogen bonding complementarity, the Z:P pair was found to contribute more to duplex stability than any mismatches involving either nonstandard nucleotide. Further, the Z:P pair is more stable than a C:G pair. The Z:G pair was found to be the most stable mismatch, forming either a deprotonated mismatched pair or a wobble base pair analogous to the stable T:G mismatch. The C:P pair is less stable, perhaps analogous to the wobble pair observed for C:O 6 -methyl-G, in which the pyrimidine is displaced into the minor groove. The Z:A and T:P mismatches are much less stable. Parameters for predicting the thermodynamics of oligonucleotides containing Z and P bases are provided. This represents the first case where this has been done for a synthetic genetic system.
Duplex Interrogation by a Direct DNA Repair Protein in Search of Base Damage
Yi, Chengqi; Chen, Baoen; Qi, Bo; Zhang, Wen; Jia, Guifang; Zhang, Liang; Li, Charles J.; Dinner, Aaron R.; Yang, Cai-Guang; He, Chuan
2012-01-01
ALKBH2 is a direct DNA repair dioxygenase guarding mammalian genome against N1-methyladenine, N3-methylcytosine, and 1,N6-ethenoadenine damage. A prerequisite for repair is to identify these lesions in the genome. Here we present crystal structures of ALKBH2 bound to different duplex DNAs. Together with computational and biochemical analyses, our results suggest that DNA interrogation by ALKBH2 displays two novel features: i) ALKBH2 probes base-pair stability and detects base pairs with reduced stability; ii) ALKBH2 does not have nor need a “damage-checking site”, which is critical for preventing spurious base-cleavage for several glycosylases. The demethylation mechanism of ALKBH2 insures that only cognate lesions are oxidized and reversed to normal bases, and that a flipped, non-substrate base remains intact in the active site. Overall, the combination of duplex interrogation and oxidation chemistry allows ALKBH2 to detect and process diverse lesions efficiently and correctly. PMID:22659876
Panczyk, Tomasz; Wolski, Pawel
2018-06-01
This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.
Maltseva, T; Sandström, A; Ivanova, I M; Sergeyev, D S; Zarytova, V F; Chattopadhyaya, J
1993-05-01
The mechanism through which modified oligo-DNA analogues act as antisense repressors at the transcriptional and translational level of gene expression is based on the information content in the nucleotide sequence which is determined by the specific base pairing. The efficiency of such action is largely determined by the stability of the duplex formed between the oligonucleotide reagent and the target sequence and also by the mismatched base pairing, such as G-A, that occurs during replication or recombination. We herein report that the phenazinium (Pzn)-tethered matched duplex p(d(TGTTTGGC)):(Pzn)-p(d(CCAAACA)) (III) (Tm = 50 degrees C) has a much larger stability than the parent matched duplex p(d(TGTTTGGC)):p(d(CCAAACA)) (I) (Tm = 30 degrees C). On the other hand, the Pzn-tethered G-A-mismatched duplex p(d(TGTTTGGC)):(Pzn)-p(d(ACAAACA)) (IV) (Tm = 34 degrees C) is only slightly more stable than its parent mismatched duplex p(d(TGTTTGGC)):p(d(ACAAACA)) (Tm = 25 degrees C). A detailed 500 MHz NMR study and constrained MD refinements of NMR-derived structures have been undertaken for the DNA duplexes (I), (II), (III) and (IV) in order to understand the structural basis of stabilization of Pzn-tethered matched DNA duplex (delta Tm = 20 degrees C) compared to mismatched duplex (delta Tm = 9 degrees C). Assignment of the 1H-NMR (500 MHz) spectra of the duplexes has been carried out by 2D NOESY, HOHAHA and DQF-COSY experiments. The torsion angles have been extracted from the J-coupling constants obtained by simulation of most of the DQF-COSY cross-peaks using program SMART. The solution structure of the duplexes were assessed by an iterative hybride relaxation matrix method (MORASS) combined with NOESY distances and torsion angles restrained molecular dynamics (MD) using program Amber 4.0. The standard Amber 4.0 force-field parameters were used for the oligonucleotide in conjunction with the new parameters for Pzn residue which was obtained by full geometry optimization using ab initio program (3-21G basis set). It has been shown that mismatched G-A bases are in the anti-anti conformation. The mismatched 7G-1A form stable base pairs through inter-strand hydrogen bonds (N7(A)...HN2(G) (1.92 A) with a subtended angle of 176 degrees and N3(G)...HN6(A) (2.01 A) with a subtended angle of 153 degrees (the 'amino-type' hydrogen bond)) and a propeller twist of 36 degrees for 7G-1A residues.(ABSTRACT TRUNCATED AT 400 WORDS)
Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S
2017-04-01
Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, T m , and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (T m (F/T) < T m (εA/T) < T m (Hx/T) < T m (A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.
Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang
2016-01-01
RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599
Duplex unwinding and ATPase activities of the DEAD-box helicase eIF4A are coupled by eIF4G and eIF4B
Özeş, Ali R.; Feoktistova, Kateryna; Avanzino, Brian C.; Fraser, Christopher S.
2011-01-01
Eukaryotic initiation factor 4A (eIF4A) is a DEAD-box helicase that stimulates translation initiation by unwinding mRNA secondary structure. The accessory proteins, eIF4G, eIF4B, and eIF4H enhance the duplex unwinding activity of eIF4A, but the extent to which they modulate eIF4A activity is poorly understood. Here, we use real time fluorescence assays to determine the kinetic parameters of duplex unwinding and ATP hydrolysis by these initiation factors. To ensure efficient duplex unwinding, eIF4B and eIF4G cooperatively activate the duplex unwinding activity of eIF4A. Our data reveal that eIF4H is much less efficient at stimulating eIF4A unwinding activity than eIF4B, implying that eIF4H is not able to completely substitute for eIF4B in duplex unwinding. By monitoring unwinding and ATPase assays using identical conditions, we demonstrate that eIF4B couples the ATP hydrolysis cycle of eIF4A with strand separation, thereby minimizing non-productive unwinding events. Using duplex substrates with altered GC contents, but with similar predicted thermal stabilities, we further show that the rate of formation of productive unwinding complexes is strongly influenced by the local stability per base pair in addition to the stability of the entire duplex. This finding explains how a change in the GC content of a hairpin while maintaining overall predicted thermal stability is able to influence translation initiation. PMID:21840318
Iadevaia, Giulia; Núñez-Villanueva, Diego; Stross, Alexander E; Hunter, Christopher A
2018-06-06
Synthetic oligomers equipped with complementary H-bond donor and acceptor side chains form multiply H-bonded duplexes in organic solvents. Comparison of the duplex forming properties of four families of oligomers with different backbones shows that formation of an extended duplex with three or four inter-strand H-bonds is more challenging than formation of complexes that make only two H-bonds. The stabilities of 1 : 1 complexes formed between length complementary homo-oligomers equipped with either phosphine oxide or phenol recognition modules were measured in toluene. When the backbone is very flexible (pentane-1,5-diyl thioether), the stability increases uniformly by an order of magnitude for each additional base-pair added to the duplex: the effective molarities for formation of the first intramolecular H-bond (duplex initiation) and subsequent intramolecular H-bonds (duplex propagation) are similar. This flexible system is compared with three more rigid backbones that are isomeric combinations of an aromatic ring and methylene groups. One of the rigid systems behaves in exactly the same way as the flexible backbone, but the other two do not. For these systems, the effective molarity for formation of the first intramolecular H-bond is the same as that found for the other two backbones, but additional H-bonds are not formed between the longer oligomers. The effective molarities are too low for duplex propagation in these systems, because the oligomer backbones cannot adopt conformations compatible with formation of an extended duplex.
C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.
Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E
2015-07-20
Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Base pairing and structural insights into the 5-formylcytosine in RNA duplex
Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia
2016-01-01
Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978
Zn2+ selectively stabilizes FdU-substituted DNA through a unique major groove binding motif
Ghosh, Supratim; Salsbury, Freddie R.; Horita, David A.; Gmeiner, William H.
2011-01-01
We report, based on semi-empirical calculations, that Zn2+ binds duplex DNA containing consecutive FdU–dA base pairs in the major groove with distorted trigonal bipyramidal geometry. In this previously uncharacterized binding motif, O4 and F5 on consecutive FdU are axial ligands while three water molecules complete the coordination sphere. NMR spectroscopy confirmed Zn2+ complexation occurred with maintenance of base pairing while a slight hypsochromic shift in circular dichroism (CD) spectra indicated moderate structural distortion relative to B-form DNA. Zn2+ complexation inhibited ethidium bromide (EtBr) intercalation and stabilized FdU-substituted duplex DNA (ΔTm > 15°C). Mg2+ neither inhibited EtBr complexation nor had as strong of a stabilizing effect. DNA sequences that did not contain consecutive FdU were not stabilized by Zn2+. A lipofectamine preparation of the Zn2+–DNA complex displayed enhanced cytotoxicity toward prostate cancer cells relative to the individual components prepared as lipofectamine complexes indicating the potential utility of Zn2+–DNA complexes for cancer treatment. PMID:21296761
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki
2015-01-01
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600
Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.
2016-01-01
A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150
Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.
2016-01-01
The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929
Nakano, Shu-ichi; Kitagawa, Yuichi; Miyoshi, Daisuke; Sugimoto, Naoki
2014-01-01
Nucleic acids are useful for biomedical targeting and sensing applications in which the molecular environment is different from that of a dilute aqueous solution. In this study, the influence of various types of mixed solutions of water and water-soluble organic compounds on RNA was investigated by measuring the catalytic activity of the hammerhead ribozyme and the thermodynamic stability of an oligonucleotide duplex. The compounds with a net neutral charge, such as poly(ethylene glycol), small primary alcohols, amide compounds, and aprotic solvent molecules, added at high concentrations changed the ribozyme-catalyzed RNA cleavage rate, with the magnitude of the effect dependent on the NaCl concentration. These compounds also changed the thermodynamic stability of RNA base pairs of an oligonucleotide duplex and its dependence on the NaCl concentration. Specific interactions with RNA molecules and reduced water activity could account for the inhibiting effects on the ribozyme catalysis and destabilizing effects on the duplex stability. The salt concentration dependence data correlated with the dielectric constant, but not with water activity, viscosity, and the size of organic compounds. This observation suggests the significance of the dielectric constant effects on the RNA reactions under molecular crowding conditions created by organic compounds. PMID:25161873
Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations.
Owczarzy, Richard; Moreira, Bernardo G; You, Yong; Behlke, Mark A; Walder, Joseph A
2008-05-13
Accurate predictions of DNA stability in physiological and enzyme buffers are important for the design of many biological and biochemical assays. We therefore investigated the effects of magnesium, potassium, sodium, Tris ions, and deoxynucleoside triphosphates on melting profiles of duplex DNA oligomers and collected large melting data sets. An empirical correction function was developed that predicts melting temperatures, transition enthalpies, entropies, and free energies in buffers containing magnesium and monovalent cations. The new correction function significantly improves the accuracy of predictions and accounts for ion concentration, G-C base pair content, and length of the oligonucleotides. The competitive effects of potassium and magnesium ions were characterized. If the concentration ratio of [Mg (2+)] (0.5)/[Mon (+)] is less than 0.22 M (-1/2), monovalent ions (K (+), Na (+)) are dominant. Effects of magnesium ions dominate and determine duplex stability at higher ratios. Typical reaction conditions for PCR and DNA sequencing (1.5-5 mM magnesium and 20-100 mM monovalent cations) fall within this range. Conditions were identified where monovalent and divalent cations compete and their stability effects are more complex. When duplexes denature, some of the Mg (2+) ions associated with the DNA are released. The number of released magnesium ions per phosphate charge is sequence dependent and decreases surprisingly with increasing oligonucleotide length.
NASA Technical Reports Server (NTRS)
Frank, Natia L.; Meade, Thomas J.
2003-01-01
Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.
Hughesman, Curtis B; Turner, Robin F B; Haynes, Charles A
2011-06-14
Melting thermodynamic data obtained by differential scanning calorimetry (DSC) are reported for 43 duplexed oligonucleotides containing one or more locked nucleic acid (LNA) substitutions. The measured heat capacity change (ΔC(p)) for the helix-to-coil transition is used to compute the changes in enthalpy and entropy for melting of an LNA-bearing duplex at the T(m) of its corresponding isosequential unmodified DNA duplex to allow rigorous thermodynamic analysis of the stability enhancements provided by LNA substitutions. Contrary to previous studies, our analysis shows that the origin of the improved stability is almost exclusively a net reduction (ΔΔS° < 0) in the entropy gain accompanying the helix-to-coil transition, with the magnitude of the reduction dependent on the type of nucleobase and its base pairing properties. This knowledge and our average measured value for ΔC(p) of 42 ± 11 cal mol(-1) K(-1) bp(-1) are then used to derive a new model that accurately predicts melting thermodynamics and the increased melting temperature (ΔT(m)) of heteroduplexes formed between an unmodified DNA strand and a complementary strand containing any number and configuration of standard LNA nucleotides A, T, C, and G. This single-base thermodynamic (SBT) model requires only four entropy-related parameters in addition to ΔC(p). Finally, DSC data for 20 duplexes containing the nucleobase-modified LNAs 2-aminoadenine (D) and 2-thiothymine (H) are reported and used to determine SBT model parameters for D and H. The data and model suggest that along with the greater stability enhancement provided by D and H bases relative to their corresponding A and T analogues, the unique pseudocomplementary properties of D-H base pairs may make their use appealing for in vitro and in vivo applications.
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki
2015-12-02
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Pilch, D S; Brousseau, R; Shafer, R H
1990-01-01
We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Lee, Joon-Hwa; Bae, Sung-Hun; Choi, Byong-Seok
2000-01-01
In contrast to the highly mutagenic pyrimidine(6–4)pyrimidone photoproduct, its Dewar valence isomer (Dewar product) has low mutagenic potential and produces a broad range of mutations [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the mutagenic property of the Dewar product, we used experimental NMR restraints and molecular dynamics to determine the solution structure of a Dewar-lesion DNA decamer duplex. This DNA decamer duplex (DW/GA duplex) contains a mismatched base pair between the 3′ T residue of the Dewar lesion (T6) and an opposed G residue (G15). The 3′ T (T6) of the Dewar lesion formed stable hydrogen bonds with the opposing G15 residue. However, the helical bending and unwinding angles of the DW/GA duplex were much larger than those of a second duplex that contains the Dewar lesion and opposing A15 and A16 residues (DW/AA duplex). The DW/GA duplex showed poorer stacking interactions at the two bases of the Dewar product and at the adjacent A7⋅T14 base pair than did the DW/AA duplex. These structural features imply that no thermal stability or conformational benefit is obtained by incorporating a G instead of an A opposite the 3′ T of the Dewar lesion. These properties may thus facilitate the preferential incorporation of an A in accordance with the A rule during translesion replication and lead to the low frequency of 3′ T→C mutations observed at this site. PMID:10758155
Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J
2007-05-01
Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.
Sheng, Jia; Hassan, Abdalla E A; Zhang, Wen; Zhou, Jianfeng; Xu, Bingqian; Soares, Alexei S; Huang, Zhen
2011-05-01
We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNA duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation. © The Author(s) 2011. Published by Oxford University Press.
Sheng, Jia; Hassan, Abdalla E. A.; Zhang, Wen; Zhou, Jianfeng; Xu, Bingqian; Soares, Alexei S.; Huang, Zhen
2011-01-01
We report here the first synthesis of 5-phenyl–telluride–thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNA duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation. PMID:21245037
DOE Office of Scientific and Technical Information (OSTI.GOV)
J Sheng; A Hassan; W Zhang
2011-12-31
We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNAmore » duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheng, J.; Soares, A.; Hassan, A. E. A.
2011-05-01
We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNAmore » duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation.« less
Spasic, Aleksandar; Kennedy, Scott D; Needham, Laura; Manoharan, Muthiah; Kierzek, Ryszard; Turner, Douglas H; Mathews, David H
2018-05-01
The RNA "GAGU" duplex, (5'GAC GAGU GUCA) 2 , contains the internal loop (5'-GAGU-3') 2 , which has two conformations in solution as determined by NMR spectroscopy. The major conformation has a loop structure consisting of trans -Watson-Crick/Hoogsteen GG pairs, A residues stacked on each other, U residues bulged outside the helix, and all sugars with a C2'- endo conformation. This differs markedly from the internal loops, (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-UAGG-3') 2 , which all have cis -Watson-Crick/Watson-Crick AG "imino" pairs flanked by cis -Watson-Crick/Watson-Crick canonical pairs resulting in maximal hydrogen bonding. Here, molecular dynamics was used to test whether the Amber force field (ff99 + bsc0 + OL3) approximates molecular interactions well enough to keep stable the unexpected conformation of the GAGU major duplex structure and the NMR structures of the duplexes containing (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-U AG G-3') 2 internal loops. One-microsecond simulations were repeated four times for each of the duplexes starting in their NMR conformations. With the exception of (5'-UAGG-3') 2 , equivalent simulations were also run starting with alternative conformations. Results indicate that the Amber force field keeps the NMR conformations of the duplexes stable for at least 1 µsec. They also demonstrate an unexpected minor conformation for the (5'-GAGU-3') 2 loop that is consistent with newly measured NMR spectra of duplexes with natural and modified nucleotides. Thus, unrestrained simulations led to the determination of the previously unknown minor conformation. The stability of the native (5'-GAGU-3') 2 internal loop as compared to other loops can be explained by changes in hydrogen bonding and stacking as the flanking bases are changed. © 2018 Spasic et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Spermine Condenses DNA, but Not RNA Duplexes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Katz, Andrea M.; Tolokh, Igor S.; Pabit, Suzette A.
Interactions between the polyamine spermine and nucleic acids drive important cellular processes. Spermine condenses DNA, and some RNAs such as poly(rA):poly(rU). A large fraction of the spermine present in cells is bound to RNA, but apparently does not condense it. Here, we study the effect of spermine binding to short duplex RNA and DNA and compare our findings with predictions of molecular dynamics simulations. When small numbers of spermine are introduced, RNA with a designed sequence, containing a mixture of 14 GC pairs and 11 AU pairs, resists condensation relative to DNA of an equivalent sequence or to 25 basemore » pair poly(rA):poly(rU) RNA. Comparison of wide-angle x-ray scattering profiles with simulation suggests that spermine is sequestered deep within the major groove of mixed sequence RNA, preventing condensation by limiting opportunities to bridge to other molecules as well as stabilizing the RNA by locking it into a particular conformation. In contrast, for DNA, simulations suggest that spermine binds external to the duplex, offering opportunities for intermolecular interaction. The goal of this study is to explain how RNA can remain soluble, and available for interaction with other molecules in the cell, despite the presence of spermine at concentrations high enough to precipitate DNA.« less
NASA Technical Reports Server (NTRS)
Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A.
1995-01-01
In most metazoans, the telomeric cytosine-rich strand repeating sequence is d(TAACCC). The crystal structure of this sequence was solved to 1.9-A resolution. Four strands associate via the cytosine-containing parts to form a four-stranded intercalated structure held together by C.C+ hydrogen bonds. The base-paired strands are parallel to each other, and the two duplexes are intercalated into each other in opposite orientations. One TAA end forms a highly stabilized loop with the 5' thymine Hoogsteen-base-paired to the third adenine. The 5' end of this loop is in close proximity to the 3' end of one of the other intercalated cytosine strands. Instead of being entirely in a DNA duplex, this structure suggests the possibility of an alternative conformation for the cytosine-rich telomere strands.
Nonin, S; Leroy, J L
1996-08-23
At slightly acidic pH, protonation of C-rich oligomers results in the formation of a four-stranded structure composed of two parallel duplexes in a head to tail orientation with their hemi-protonated C.C+ pairs intercalated in a so-called i-motif. In all cases reported previously the duplexes are identical. The tetramer formed by the d(5mCCTCC) oligomer is different. The structure is computed on the basis of 55 inter-residue distances derived from NOESY cross-peaks measured at short mixing times. It consists of two intercalated non-equivalent symmetrical duplexes. The base stacking order is C5* C1 C4* C2 (T3*) T3 C2* C4 C1* C5, but the thymidine bases (T3*) of one duplex are looped out and lie in the wide grooves of the tetramer. The thymidine bases T3 stack as a symmetrical T.T pair between the sequentially adjacent C2.C2+ pair and the C2*.C2*+ pair of the other duplex. Numerous exchange cross-peaks provide evidence for duplex interconversion. The interconversion rate is 1.4 s-1 at 0 degree C and the activation energy is 94 kJ/mol. The opening of the T3.T3 pair, the closing of the T3*.T3 pair, and the opening of the C2*.C2*+ pair occur simultaneously with the duplex interconversion. This suggests that the concerted opening and closing of the thymidine bases drive the duplex interconversion. Opening of the C4.C4+ and C4*.C4*+ pairs, and dissociation of the tetramer are not part of the interconversion since they occur at much slower rates. Duplex interconversion within the [d(5mCCTCC)]4 tetramer provides the first structural and kinetics characterization of broken symmetry in a biopolymer. The tetramer formed by d(5mCCUCC) adopts a similar structure, but the rate of duplex interconversion is faster: 40 s-1 at 0 degree C. At 32 degrees C, interconversion is fast on the NMR time scale.
The Crystal Structure of Non-Modified and Bipyridine-Modified PNA Duplexes
Yeh, Joanne I.; Pohl, Ehmke; Truan, Daphne; He, Wei; Sheldrick, George M.; Du, Shoucheng; Achim, Catalina
2011-01-01
Peptide nucleic acid (PNA) is a synthetic analogue of DNA that commonly has an N-aminoethlyl-glycine backbone. The crystal structure of two PNA duplexes, one containing eight standard nucleobase pairs (GGCATCGG)2 (pdb: 3MBS), and the other containing the same nucleobase pairs and a central pair of bipyridine ligands (pdb: 3MBU), has been solved with a resolution of 1.2 Å and 1.05 Å, respectively. The non-modified PNA duplex adopts a P-type helical structure s i m i l a r t o that of previously characterized PNAs. The atomic-level resolution of the structures allowed us to observe for the first time specific modes of interaction between the terminal lysines of the PNA and the backbone and nucleobases situated in the vicinity of the lysines, which are considered an important factor in the induction of a preferred handedness in PNA duplexes. These results support the notion that while PNA typically adopts a P-type helical structure, its flexibility is relatively high. For example, the base pair rise in the bipyridine-containing PNA is the largest measured to date in a PNA homoduplex. The two bipyridines are bulged out of the duplex and are aligned parallel to the minor groove of the PNA. In the case of the bipyridine-containing PNA, two bipyridines from adjacent PNA duplexes form a π-stacked pair that relates the duplexes within the crystal. The bulging out of the bipyridines causes bending of the PNA duplex, which is in contrast to the structure previously reported for biphenyl-modified DNA duplexes in solution, where the biphenyls are π-stacking with adjacent nucleobase pairs and adopt an intrahelical geometry [Johar et al., Chem. Eur. J., 2008, 14, 2080]. This difference shows that relatively small perturbations can significantly impact the relative position of nucleobase analogues in nucleic acid duplexes. PMID:20859960
Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles
2015-02-17
Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a quantitative PCR or dPCR assay. This potential is demonstrated by using the model to design allele-specific probes that completely discriminate and quantify clinically relevant mutant alleles (BRAF V600E and KIT D816V) in a dPCR assay.
Sanders, Jeffrey M.; Wampole, Matthew E.; Chen, Chang-Po; Sethi, Dalip; Singh, Amrita; Dupradeau, François-Yves; Wang, Fan; Gray, Brian D.; Thakur, Mathew L.; Wickstrom, Eric
2013-01-01
Genetic disorders can arise from single base substitutions in a single gene. A single base substitution for wild type guanine in the twelfth codon of KRAS2 mRNA occurs frequently to initiate lung, pancreatic, and colon cancer. We have observed single base mismatch specificity in radioimaging of mutant KRAS2 mRNA in tumors in mice by in vivo hybridization with radiolabeled peptide nucleic acid (PNA) dodecamers. We hypothesized that multi-mutant specificity could be achieved with a PNA dodecamer incorporating hypoxanthine, which can form Watson-Crick basepairs with adenine, cytosine, thymine, and uracil. Using molecular dynamics simulations and free energy calculations, we show that hypoxanthine substitutions in PNAs are tolerated in KRAS2 RNA-PNA duplexes where wild type guanine is replaced by mutant uracil or adenine in RNA. To validate our predictions, we synthesized PNA dodecamers with hypoxanthine, and then measured the thermal stability of RNA-PNA duplexes. Circular dichroism thermal melting results showed that hypoxanthine-containing PNAs are more stable in duplexes where hypoxanthine-adenine and hypoxanthine-uracil base pairs are formed than single mismatch duplexes or duplexes containing hypoxanthine-guanine opposition. PMID:23972113
Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.
2013-01-01
Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567
Guo, Xiurong; Seela, Frank
2017-09-04
α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Patel, D J; Canuel, L L
1977-07-01
The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.
Patel, Dinshaw J.; Canuel, Lita L.
1977-01-01
The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613
Suresh, Gorle; Priyakumar, U Deva
2015-09-01
Modified nucleic acids have found profound applications in nucleic acid based technologies such as antisense and antiviral therapies. Previous studies on chemically modified nucleic acids have suggested that modifications incorporated in furanose sugar especially at 2'-position attribute special properties to nucleic acids when compared to other modifications. 2'-O-methyl modification to deoxyribose sugars of DNA-RNA hybrids is one such modification that increases nucleic acid stability and has become an attractive class of compounds for potential antisense applications. It has been reported that modification of DNA strands with 2'-O-methyl group reverses the thermodynamic stability of DNA-RNA hybrid duplexes. Molecular dynamics simulations have been performed on two hybrid duplexes (DR and RD) which differ from each other and 2'-O-methyl modified counterparts to investigate the effect of 2'-O-methyl modification on their duplex stability. The results obtained suggest that the modification drives the conformations of both the hybrid duplexes towards A-RNA like conformation. The modified hybrid duplexes exhibit significantly contrasting dynamics and hydration patterns compared to respective parent duplexes. In line with the experimental results, the relative binding free energies suggest that the introduced modifications stabilize the less stable DR hybrid, but destabilize the more stable RD duplex. Binding free energy calculations suggest that the increased hydrophobicity is primarily responsible for the reversal of thermodynamic stability of hybrid duplexes. Free energy component analysis further provides insights into the stability of modified duplexes. Copyright © 2015 Elsevier Inc. All rights reserved.
Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands
NASA Astrophysics Data System (ADS)
Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree
2018-05-01
In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.
Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.
2011-01-01
The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242
Triple helical DNA in a duplex context and base pair opening
Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra
2014-01-01
It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466
Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A
2016-05-01
The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright © 2015. Published by Elsevier B.V.
Effect of Cavity Size of Mesoporous Silica on Short DNA Duplex Stability.
Masuda, Tsubasa; Shibuya, Yuuta; Arai, Shota; Kobayashi, Sayaka; Suzuki, Sotaro; Kijima, Jun; Itoh, Tetsuji; Sato, Yusuke; Nishizawa, Seiichi; Yamaguchi, Akira
2018-05-15
We studied the stabilities of short (4- and 3-bp) DNA duplexes within silica mesopores modified with a positively charged trimethyl aminopropyl (TMAP) monolayer (BJH pore diameter 1.6-7.4 nm). The DNA fragments with fluorescent dye were introduced into the pores, and their fluorescence resonance energy transfer (FRET) response was measured to estimate the structuring energies of the short DNA duplexes under cryogenic conditions (temperature 233-323 K). The results confirmed the enthalpic stability gain of the duplex within size-matched pores (1.6 and 2.3 nm). The hybridization equilibrium constants found for the size-matched pores were 2 orders of magnitude larger than those for large pores (≥3.5 nm), and this size-matching effect for the enhanced duplex stability was explained by a tight electrostatic interaction between the duplex and the surface TMAP groups. These results indicate the requirement of the precise regulation of mesopore size to ensure the stabilization of hydrogen-bonded supramolecular assemblies.
DNA hybridization kinetics: zippering, internal displacement and sequence dependence.
Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A
2013-10-01
Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.
Approximation methods for the stability analysis of complete synchronization on duplex networks
NASA Astrophysics Data System (ADS)
Han, Wenchen; Yang, Junzhong
2018-01-01
Recently, the synchronization on multi-layer networks has drawn a lot of attention. In this work, we study the stability of the complete synchronization on duplex networks. We investigate effects of coupling function on the complete synchronization on duplex networks. We propose two approximation methods to deal with the stability of the complete synchronization on duplex networks. In the first method, we introduce a modified master stability function and, in the second method, we only take into consideration the contributions of a few most unstable transverse modes to the stability of the complete synchronization. We find that both methods work well for predicting the stability of the complete synchronization for small networks. For large networks, the second method still works pretty well.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tripathi, S.; Zhang, D.; Paukstelis, P. J.
DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less
An intercalation-locked parallel-stranded DNA tetraplex
Tripathi, S.; Zhang, D.; Paukstelis, P. J.
2015-01-27
DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less
Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun
2017-07-19
RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.
Kocalka, Petr; Andersen, Nicolai K; Jensen, Frank; Nielsen, Poul
2007-11-23
A general protocol for converting alkyl and aryl halides into azides and for converting these in situ into 1,4-disubstituted triazoles was applied with 5-ethynyl-2'-deoxyuridine. This afforded three modified 2'-deoxyuridine analogues with either unsubstituted or 1-phenyl-/1-benzyl-substituted triazoles in their 5-positions. Modelling demonstrates coplanarity of the two heteroaromatic rings, and UV spectroscopy showed the uracil pK(a) values to be almost unchanged. The three nucleosides were introduced into nonamer oligonucleotides by phosphoramidite chemistry. The heteroaromatic triazoles became positioned in the major grooves of the short dsDNA and DNA-RNA duplexes. While single modifications led to decreased duplex stability, the stacking of four consecutive modifications led to enhanced duplex stability, especially for DNA-RNA duplexes. The duplex structures were studied by CD spectroscopy and molecular dynamics simulations, which supported the conjecture that the duplex stabilizing effect is due to efficient stacking of the heteroaromatic triazoles.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Salon, J.; Jiang, J; Sheng, J
2008-01-01
To investigate nucleic acid base pairing and stacking via atom-specific mutagenesis and crystallography, we have synthesized for the first time the 6-Se-deoxyguanosine phosphoramidite and incorporated it into DNAs via solid-phase synthesis with a coupling yield over 97%. We found that the UV absorption of the Se-DNAs red-shifts over 100 nm to 360 nm ({Epsilon} = 2.3 x 10{sup 4} M{sup -1} cm{sup -1}), the Se-DNAs are yellow colored, and this Se modification is relatively stable in water and at elevated temperature. Moreover, we successfully crystallized a ternary complex of the Se-G-DNA, RNA and RNase H. The crystal structure determination andmore » analysis reveal that the overall structures of the native and Se-modified nucleic acid duplexes are very similar, the selenium atom participates in a Se-mediated hydrogen bond (Se H-N), and the {sup Se}G and C form a base pair similar to the natural G-C pair though the Se-modification causes the base-pair to shift (approximately 0.3 {angstrom}). Our biophysical and structural studies provide new insights into the nucleic acid flexibility, duplex recognition and stability. Furthermore, this novel selenium modification of nucleic acids can be used to investigate chemogenetics and structure of nucleic acids and their protein complexes.« less
Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.
2016-01-01
Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050
Strand-invading linear probe combined with unmodified PNA.
Asanuma, Hiroyuki; Niwa, Rie; Akahane, Mariko; Murayama, Keiji; Kashida, Hiromu; Kamiya, Yukiko
2016-09-15
Efficient strand invasion by a linear probe to fluorescently label double-stranded DNA has been implemented by employing a probe and unmodified PNA. As a fluorophore, we utilized ethynylperylene. Multiple ethynylperylene residues were incorporated into the DNA probe via a d-threoninol scaffold. The ethynylperylene did not significantly disrupt hybridization with complementary DNA. The linear probe self-quenched in the absence of target DNA and did not hybridize with PNA. A gel-shift assay revealed that linear probe and PNA combination invaded the central region of double-stranded DNA upon heat-shock treatment to form a double duplex. To further suppress the background emission and increase the stability of the probe/DNA duplex, a probe containing anthraquinones as well as ethynylperylene was synthesized. This probe and PNA invader pair detected an internal sequence in a double-stranded DNA with high sensitivity when heat shock treatment was used. The probe and PNA pair was able to invade at the terminus of a long double-stranded DNA at 40°C at 100mM NaCl concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ganguly, Manjori; Szulik, Marta W.; Donahue, Patrick S.; Clancy, Kate; Stone, Michael P.; Gold, Barry
2012-01-01
Oxidation of DNA due to exposure to reactive oxygen species is a major source of DNA damage. One of the oxidation lesions formed, 5-hydroxy-2'-deoxycytidine, has been shown to miscode by some replicative DNA polymerases but not by error prone polymerases capable of translesion synthesis. The 5-hydroxy-2'-deoxycytidine lesion is repaired by DNA glycosylases that require the 5-hydroxycytidine base to be extrahelical so it can enter into the enzyme's active site where it is excised off the DNA backbone to afford an abasic site. The thermodynamic and NMR results presented herein, describe the effect of a 5-hydroxy-2'-deoxycytidine•2'-deoxyguanosine base pair on the stability of two different DNA duplexes. The results demonstrate that the lesion is highly destabilizing and that the energy barrier for the unstacking of 5-hydroxy-2'-deoxycytidine from the DNA duplex may be low. This could provide a thermodynamic mode of adduct identification by DNA glycosylases that require the lesion to be extrahelical. PMID:22332945
Dynamics of spontaneous flipping of a mismatched base in DNA duplex.
Yin, Yandong; Yang, Lijiang; Zheng, Guanqun; Gu, Chan; Yi, Chengqi; He, Chuan; Gao, Yi Qin; Zhao, Xin Sheng
2014-06-03
DNA base flipping is a fundamental theme in DNA biophysics. The dynamics for a B-DNA base to spontaneously flip out of the double helix has significant implications in various DNA-protein interactions but are still poorly understood. The spontaneous base-flipping rate obtained previously via the imino proton exchange assay is most likely the rate of base wobbling instead of flipping. Using the diffusion-decelerated fluorescence correlation spectroscopy together with molecular dynamics simulations, we show that a base of a single mismatched base pair (T-G, T-T, or T-C) in a double-stranded DNA can spontaneously flip out of the DNA duplex. The extrahelical lifetimes are on the order of 10 ms, whereas the intrahelical lifetimes range from 0.3 to 20 s depending on the stability of the base pairs. These findings provide detailed understanding on the dynamics of DNA base flipping and lay down foundation to fully understand how exactly the repair proteins search and locate the target mismatched base among a vast excess of matched DNA bases.
Fazakerley, G V; Quignard, E; Teoule, R; Guy, A; Guschlbauer, W
1987-09-15
We report two-dimensional NOE (NOESY) spectra on the sequence d(GCGATCATGG).d(CCATGATCGC) which contains the unmethylated dam site. As expected the DNA adopts a B-form conformation but appears to be distorted at the TG step of the second strand. This distorsion, probably bending, is not seen on the opposite strand. When the first strand is methylated on adenine in the GATC or CATG sequence the NOESY spectra indicate little or no change in the conformation. However the single strand-duplex exchange is slowed down to the slow-exchange region on a proton NMR time scale. We have assigned the exchangeable imino and cytidine amino resonances of the three duplexes. From the imino linewidths as a function of temperature, we observe that the unmethylated and the hemimethylated Gm6ATC duplexes melt normally from the ends. However, this is not so for the hemimethylated Cm6ATG duplex which, apart from the terminal base pairs, melts cooperatively and at higher temperature. In spectra recorded in H2O a second duplex is observed, for the Gm6ATC sequence, which we have not been able to identify. It is however unlikely to be a hairpin structure. Ultraviolet-melting curves also indicate the presence of two transitions for this duplex. The effect of methylation upon base-pair lifetimes has been studied by comparing the above three duplexes. Little effect is observed upon methylation in the GATC sequence but a drastic increase in the lifetimes of all base pairs is observed upon methylation in the CATG sequence.
Tomcho, Jeremy C; Tillman, Magdalena R; Znosko, Brent M
2015-09-01
Predicting the secondary structure of RNA is an intermediate in predicting RNA three-dimensional structure. Commonly, determining RNA secondary structure from sequence uses free energy minimization and nearest neighbor parameters. Current algorithms utilize a sequence-independent model to predict free energy contributions of dinucleotide bulges. To determine if a sequence-dependent model would be more accurate, short RNA duplexes containing dinucleotide bulges with different sequences and nearest neighbor combinations were optically melted to derive thermodynamic parameters. These data suggested energy contributions of dinucleotide bulges were sequence-dependent, and a sequence-dependent model was derived. This model assigns free energy penalties based on the identity of nucleotides in the bulge (3.06 kcal/mol for two purines, 2.93 kcal/mol for two pyrimidines, 2.71 kcal/mol for 5'-purine-pyrimidine-3', and 2.41 kcal/mol for 5'-pyrimidine-purine-3'). The predictive model also includes a 0.45 kcal/mol penalty for an A-U pair adjacent to the bulge and a -0.28 kcal/mol bonus for a G-U pair adjacent to the bulge. The new sequence-dependent model results in predicted values within, on average, 0.17 kcal/mol of experimental values, a significant improvement over the sequence-independent model. This model and new experimental values can be incorporated into algorithms that predict RNA stability and secondary structure from sequence.
NASA Astrophysics Data System (ADS)
Birrento, Monica L.; Bryan, Tracy M.; Samosorn, Siritron; Beck, Jennifer L.
2015-07-01
Electrospray ionization mass spectrometry (ESI-MS) conditions were optimized for simultaneous observation of a bimolecular qDNA and a Watson-Crick base-paired duplex DNA/RNA hybrid. The DNA sequence used was telomeric DNA, and the RNA contained the template for telomerase-mediated telomeric DNA synthesis. Addition of RNA to the quadruplex DNA (qDNA) resulted in formation of the duplex DNA/RNA hybrid. Melting profiles obtained using circular dichroism spectroscopy confirmed that the DNA/RNA hybrid exhibited greater thermal stability than the bimolecular qDNA in solution. Binding of a 13-substituted berberine ( 1) derivative to the bimolecular qDNA stabilized its structure as evidenced by an increase in its stability in the mass spectrometer, and an increase in its circular dichroism (CD) melting temperature of 10°C. The DNA/RNA hybrid did not bind the ligand extensively and its thermal stability was unchanged in the presence of ( 1). The qDNA-ligand complex resisted unfolding in the presence of excess RNA, limiting the formation of the DNA/RNA hybrid. Previously, it has been proposed that DNA secondary structures, such as qDNA, may be involved in the telomerase mechanism. DNA/RNA hybrid structures occur at the active site of telomerase. The results presented in the current work show that if telomeric DNA was folded into a qDNA structure, it is possible for a DNA/RNA hybrid to form as is required during template alignment. The discrimination of ligand ( 1) for binding to the bimolecular qDNA over the DNA/RNA hybrid positions it as a useful compound for probing the role(s), if any, of antiparallel qDNA in the telomerase mechanism.
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nanopore Analysis of the 5-Guanidinohydantoin to Iminoallantoin Isomerization in Duplex DNA.
Zeng, Tao; Fleming, Aaron M; Ding, Yun; Ren, Hang; White, Henry S; Burrows, Cynthia J
2018-04-06
In DNA, guanine oxidation yields diastereomers of 5-guanidinohydantoin (Gh) as one of the major products. In nucleosides and single-stranded DNA, Gh is in a pH-dependent equilibrium with its constitutional isomer iminoallantoin (Ia). Herein, the isomerization reaction between Gh and Ia was monitored in duplex DNA using a protein nanopore by measuring the ionic current when duplex DNA interacts with the pore under an electrophoretic force. Monitoring current levels in this single-molecule method proved to be superior for analysis of population distributions in an equilibrating mixture of four isomers in duplex DNA as a function of pH. The results identified Gh as a major isomer observed when base paired with A, C, or G at pH 6.4-8.4, and Ia was a minor isomer of the reaction mixture that was only observed when the pH was >7.4 in the duplex DNA context. The present results suggest that Gh will be the dominant isomer in duplex DNA under physiological conditions regardless of the base-pairing partner in the duplex.
Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.
Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke
2016-01-01
We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.
Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex
Ueda, Yu-mi; Zouzumi, Yu-ki; Maruyama, Atsushi; Nakano, Shu-ichi; Sugimoto, Naoki; Miyoshi, Daisuke
2016-01-01
Abstract We systematically investigated effects of molecular crowding with trimethylamine N-oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences. PMID:27933115
Thermodynamic and hydration effects for the incorporation of a cationic 3-aminopropyl chain into DNA
Soto, Ana Maria; Kankia, Besik I.; Dande, Prasad; Gold, Barry; Marky, Luis A.
2002-01-01
The introduction of cationic 5-(ω-aminoalkyl)-2′-deoxypyrimidines into duplex DNA has been shown to induce DNA bending. In order to understand the energetic and hydration contributions for the incorporation of a cationic side chain in DNA a combination of spectroscopy, calorimetry and density techniques were used. Specifically, the temperature unfolding and isothermal formation was studied for a pair of duplexes with sequence d(CGTAGUCG TGC)/d(GCACGACTACG), where U represents 2′-deoxyuridine (‘control’) or 5-(3-aminopropyl)-2′-deoxyuridine (‘modified’). Continuous variation experiments confirmed 1:1 stoichiometries for each duplex and the circular dichroism spectra show that both duplexes adopted the B conformation. UV and differential scanning calorimetry melting experiments reveal that each duplex unfolds in two-state transitions. In low salt buffer, the ‘modified’ duplex is more stable and unfolds with a lower endothermic heat and lower release of counterion and water. This electrostatic stabilization is entropy driven and disappears at higher salt concentrations. Complete thermodynamic profiles at 15°C show that the favorable formation of each duplex results from the compensation of a favorable exothermic heat with an unfavorable entropy contribution. However, the isothermal profiles yielded a differential enthalpy of 8.8 kcal/mol, which is 4.3 kcal/mol higher than the differential enthalpy observed in the unfolding profiles. This indicates that the presence of the aminopropyl chain induces an increase in base stacking interactions in the modified single strand and a decrease in base stacking interactions in the modified duplex. Furthermore, the formation of the ‘control’ duplex releases water while the ‘modified’ duplex takes up water. Relative to the control duplex, formation of the modified duplex at 15°C yielded a marginal differential ΔG° term, positive ΔΔHITC–Δ(TΔS) compensation, negative ΔΔV and a net release of counterions. The opposite signs of the differential enthalpy–entropy compensation and differential volume change terms show a net uptake of structural water around polar and non-polar groups. This indicates that incorporation of the aminopropyl chain induces a higher exposure of aromatic bases to the solvent, which may be consistent with a small and local bend in the ‘modified’ duplex. PMID:12136099
Nucleic acid duplexes incorporating a dissociable covalent base pair
NASA Technical Reports Server (NTRS)
Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)
1999-01-01
We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.
Nick-free formation of reciprocal heteroduplexes: a simple solution to the topological problem.
Wilson, J H
1979-01-01
Because the individual strands of DNA are intertwined, formation of heteroduplex structures between duplexes--as in presumed recombination intermediates--presents a topological puzzle, known as the winding problem. Previous approaches to this problem have assumed that single-strand breaks are required to permit formation of fully coiled heteroduplexes. This paper describes a simple, nick-free solution to the winding problem that satisfies all topological constraints. Homologous duplexes associated by their minor-groove surfaces can switch strand pairing to form reciprocal heteroduplexes that coil together into a compact, four-stranded helix throughout the region of pairing. Model building shows that this fused heteroduplex structure is plausible, being composed entirely of right-handed primary helices with Watson-Crick base pairing throughout. Its simplicity of formation, structural symmetry, and high degree of specificity are suggestive of a natural mechanism for alignment by base pairing between intact homologous duplexes. Implications for genetic recombination are discussed. Images PMID:291028
Sequence-dependent base pair stepping dynamics in XPD helicase unwinding
Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R
2013-01-01
Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615
Kenfack, Cyril A; Piémont, Etienne; Ben Gaied, Nouha; Burger, Alain; Mély, Yves
2008-08-14
8-Vinyl-deoxyadenosine (8VA) has been recently introduced as a fluorescent analogue of adenosine that is less perturbing and less quenched than the well-established 2-amino-deoxyribosylpurine (2AP) probe when inserted in oligonucleotides. To further validate 8VA as a fluorescent substitute of A, we compared the ability of 8VA and 2AP in sequences of the type d(CGT TTT XNX TTT TGC) (with N=8VA or 2AP and X=T and C) to discriminate the nature of the opposite base (Y) in duplexes. For both probes, systematic variations in the amplitudes of the short- and long-lived lifetimes of the fluorescence intensity decays as well as in the amplitude of the fast rotational correlation time of the fluorescence anisotropy decays were observed as a function of the nature of Y. From these parameters, we inferred a stability order 8VA-T > 8VA-G > 8VA-A > 8VA-C, similar to the stability order with the native A base, but different from the stability order with 2AP. Using a combination of molecular mechanics and ab initio calculations, we found that the time-resolved parameters of 8VA, but not the 2AP ones, correlate well with the geometry and the strength of the A-Y base-pairing interaction. This may be rationalized by the smaller structural and electronic perturbations induced by the vinyl group in position 8 as compared to the amino group at position 2. As a consequence, substitution of A by 8VA in a base pair was found to only minimally modify the structure and interaction energy of the base pair. Thus, 8VA can be used as a fluorescent substitute of the natural A, to straightforwardly discriminate the nature of the opposite base. This may find interesting applications notably in the elucidation of the mechanisms and dynamics of the DNA mismatch repair system.
Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena
2018-02-01
Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.
Crystal structure of a four-stranded intercalated DNA: d(C4)
NASA Technical Reports Server (NTRS)
Chen, L.; Cai, L.; Zhang, X.; Rich, A.
1994-01-01
The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.
Influence of 5-N-carboxamide modifications on the thermodynamic stability of oligonucleotides
Wolk, Steven K.; Shoemaker, Richard K.; Mayfield, Wes S.; Mestdagh, Andrew L.; Janjic, Nebojsa
2015-01-01
We have recently shown that the incorporation of modified nucleotides such as 5-N-carboxamide-deoxyuridines into random nucleic acid libraries improves success rates in SELEX experiments and facilitates the identification of ligands with slow off-rates. Here we report the impact of these modifications on the thermodynamic stability of both duplexes and intramolecular ‘single-stranded’ structures. Within duplexes, large, hydrophobic naphthyl groups were destabilizing relative to the all natural DNA duplex, while the hydrophilic groups exhibited somewhat improved duplex stability. All of the significant changes in stability were driven by opposing contributions from the enthalpic and entropic terms. In contrast, both benzyl and naphthyl modifications stabilized intramolecular single-stranded structures relative to their natural DNA analogs, consistent with the notion that intramolecular folding allows formation of novel, stabilizing hydrophobic interactions. Imino proton NMR data provided evidence that elements of the folded structure form at temperatures well below the Tm, with a melting transition that is distinctly less cooperative when compared to duplex DNA. Although there are no data to suggest that the unmodified DNA sequences fold into structures similar to their modified analogs, this still represents clear evidence that these modifications impart thermodynamic stability to the folded structure not achievable with unmodified DNA. PMID:26438535
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bag, Subhendu Sekhar; Talukdar, Sangita; Kundu, Rajen; Saito, Isao; Jana, Subhashis
2014-01-25
Dual door entry to exciplex formation was established in a chimeric DNA duplex wherein a fluorescent non-nucleosidic base surrogate () is paired against a fluorescent nucleosidic base surrogate (). Packing of the nucleobases via intercalative stacking interactions led to an exciplex emission either via FRET from the donor or direct excitation of the FRET acceptor .
Carr, Carolyn E; Khutsishvili, Irine; Marky, Luis A
2018-06-22
Triplex formation occurs via interaction of a third strand with the major groove of double stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of poly(rA)•poly(rU) (Duplex) and poly(rA)•2poly(rU) (Triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques. The folding of these two helices yielded an uptake of ions, ΔnNa+ = 0.15 mol Na+/mol base-pair (Duplex) and 0.30 mol Na+/mole base-triplet (Triplex), which are consistent with their polymer behavior and the higher charge density parameter of triple helices. The osmotic stress technique yielded a release of structural water, ΔnW = 2 mol H2O/mol base-pair (Duplex unfolding into single strands) and an uptake of structural water, ΔnW = 2 mol H2O/mole base-pair (Triplex unfolding into Duplex and a single strand). However, an overall release of electrostricted waters is obtained for the unfolding of both complexes from pressure perturbation calorimetric experiments. In total, the ΔV values obtained for the unfolding of Triplex into Duplex and a single strand correspond to an immobilization of two structural waters and a release of three electrostricted waters. The ΔV values obtained for the unfolding of Duplex into two single strands correspond to the release of two structural waters and the immobilization of four electrostricted water molecules.
Nucleic acid duplexes incorporating a dissociable covalent base pair
Gao, Kui; Orgel, Leslie E.
1999-01-01
We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299
Probing of miniPEGγ-PNA-DNA Hybrid Duplex Stability with AFM Force Spectroscopy.
Dutta, Samrat; Armitage, Bruce A; Lyubchenko, Yuri L
2016-03-15
Peptide nucleic acids (PNA) are synthetic polymers, the neutral peptide backbone of which provides elevated stability to PNA-PNA and PNA-DNA hybrid duplexes. It was demonstrated that incorporation of diethylene glycol (miniPEG) at the γ position of the peptide backbone increased the thermal stability of the hybrid duplexes (Sahu, B. et al. J. Org. Chem. 2011, 76, 5614-5627). Here, we applied atomic force microscopy (AFM) based single molecule force spectroscopy and dynamic force spectroscopy (DFS) to test the strength and stability of the hybrid 10 bp duplex. This hybrid duplex consisted of miniPEGγ-PNA and DNA of the same length (γ(MP)PNA-DNA), which we compared to a DNA duplex with a homologous sequence. AFM force spectroscopy data obtained at the same conditions showed that the γ(MP)PNA-DNA hybrid is more stable than the DNA counterpart, 65 ± 15 pN vs 47 ± 15 pN, respectively. The DFS measurements performed in a range of pulling speeds analyzed in the framework of the Bell-Evans approach yielded a dissociation constant, koff ≈ 0.030 ± 0.01 s⁻¹ for γ(MP)PNA-DNA hybrid duplex vs 0.375 ± 0.18 s⁻¹ for the DNA-DNA duplex suggesting that the hybrid duplex is much more stable. Correlating the high affinity of γ(MP)PNA-DNA to slow dissociation kinetics is consistent with prior bulk characterization by surface plasmon resonance. Given the growing interest in γ(MP)PNA as well as other synthetic DNA analogues, the use of single molecule experiments along with computational analysis of force spectroscopy data will provide direct characterization of various modifications as well as higher order structures such as triplexes and quadruplexes.
An Enzyme-Catalyzed Multistep DNA Refolding Mechanism in Hairpin Telomere Formation
Shi, Ke; Huang, Wai Mun; Aihara, Hideki
2013-01-01
Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting–rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions. PMID:23382649
Manalo, Marlon N; Kong, Xiangming; LiWang, Andy
2007-04-01
Hydrogen-bond lengths of nucleic acids are (1) longer in DNA than in RNA, and (2) sequence dependent. The physicochemical basis for these variations in hydrogen-bond lengths is unknown, however. Here, the notion that hydration plays a significant role in nucleic acid hydrogen-bond lengths is tested. Watson-Crick N1...N3 hydrogen-bond lengths of several DNA and RNA duplexes are gauged using imino 1J(NH) measurements, and ethanol is used as a cosolvent to lower water activity. We find that 1J(NH) values of DNA and RNA become less negative with added ethanol, which suggests that mild dehydration reduces hydrogen-bond lengths even as the overall thermal stabilities of these duplexes decrease. The 1J(NH) of DNA are increased in 8 mol% ethanol to those of RNA in water, which suggests that the greater hydration of DNA plays a significant role in its longer hydrogen bonds. The data also suggest that ethanol-induced dehydration is greater for the more hydrated G:C base pairs and thereby results in greater hydrogen-bond shortening than for the less hydrated A:T/U base pairs of DNA and RNA.
Using small RNA deep sequencing data to detect siRNA duplexes induced by plant viruses
USDA-ARS?s Scientific Manuscript database
Small interfering RNA (siRNA) duplexes are produced in plants during virus infection, which are short (usually 21 to 24-base pair) double-stranded RNAs (dsRNAs) with several overhanging nucleotides on the 5' end and 3' end. The investigation of the siRNA duplexes is useful to better understand the R...
Analysis of Structural Flexibility of Damaged DNA Using Thiol-Tethered Oligonucleotide Duplexes
Fujita, Masashi; Watanabe, Shun; Yoshizawa, Mariko; Yamamoto, Junpei; Iwai, Shigenori
2015-01-01
Bent structures are formed in DNA by the binding of small molecules or proteins. We developed a chemical method to detect bent DNA structures. Oligonucleotide duplexes in which two mercaptoalkyl groups were attached to the positions facing each other across the major groove were prepared. When the duplex contained the cisplatin adduct, which was proved to induce static helix bending, interstrand disulfide bond formation under an oxygen atmosphere was detected by HPLC analyses, but not in the non-adducted duplex, when the two thiol-tethered nucleosides were separated by six base pairs. When the insert was five and seven base pairs, the disulfide bond was formed and was not formed, respectively, regardless of the cisplatin adduct formation. The same reaction was observed in the duplexes containing an abasic site analog and the (6–4) photoproduct. Compared with the cisplatin case, the disulfide bond formation was slower in these duplexes, but the reaction rate was nearly independent of the linker length. These results indicate that dynamic structural changes of the abasic site- and (6–4) photoproduct-containing duplexes could be detected by our method. It is strongly suggested that the UV-damaged DNA-binding protein, which specifically binds these duplexes and functions at the first step of global-genome nucleotide excision repair, recognizes the easily bendable nature of damaged DNA. PMID:25679955
Halder, Sukanya; Bhattacharyya, Dhananjay
2012-10-04
Internal loops within RNA duplex regions are formed by single or tandem basepairing mismatches with flanking canonical Watson-Crick basepairs on both sides. They are the most common motif observed in RNA secondary structures and play integral functional and structural roles. In this report, we have studied the structural features of 1 × 1, 2 × 2, and 3 × 3 internal loops using all-atom molecular dynamics (MD) simulation technique with explicit solvent model. As MD simulation is intricately dependent on the choice of force-field and these are often rather approximate, we have used both the most popular force-fields for nucleic acids-CHARMM27 and AMBER94-for a comparative analysis. We find that tandem noncanonical basepairs forming 2 × 2 and 3 × 3 internal loops are considerably more stable than the single mismatches forming 1 × 1 internal loops, irrespective of the force field. We have also analyzed crystal structure database to study the conservation of these helical fragments in the corresponding sets of RNA structures. We observe that the nature of stability in MD simulations mimic their fluctuating natures in crystal data sets also, probably indicating reliable natures of both the force fields to reproduce experimental results. We also notice significant structural changes in the wobble G:U basepairs present in these double helical stretches, leading to a biphasic stability for these wobble pairs to release the deformational strains introduced by internal loops within duplex regions.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sequence-Selective Formation of Synthetic H-Bonded Duplexes
2017-01-01
Oligomers equipped with a sequence of phenol and pyridine N-oxide groups form duplexes via H-bonding interactions between these recognition units. Reductive amination chemistry was used to synthesize all possible 3-mer sequences: AAA, AAD, ADA, DAA, ADD, DAD, DDA, and DDD. Pairwise interactions between the oligomers were investigated using NMR titration and dilution experiments in toluene. The measured association constants vary by 3 orders of magnitude (102 to 105 M–1). Antiparallel sequence-complementary oligomers generally form more stable complexes than mismatched duplexes. Mismatched duplexes that have an excess of H-bond donors are stabilized by the interaction of two phenol donors with one pyridine N-oxide acceptor. Oligomers that have a H-bond donor and acceptor on the ends of the chain can fold to form intramolecular H-bonds in the free state. The 1,3-folding equilibrium competes with duplex formation and lowers the stability of duplexes involving these sequences. As a result, some of the mismatch duplexes are more stable than some of the sequence-complementary duplexes. However, the most stable mismatch duplexes contain DDD and compete with the most stable sequence-complementary duplex, AAA·DDD, so in mixtures that contain all eight sequences, sequence-complementary duplexes dominate. Even higher fidelity sequence selectivity can be achieved if alternating donor–acceptor sequences are avoided. PMID:28857551
Effects of fluorescent dyes, quenchers, and dangling ends on DNA duplex stability.
Moreira, Bernardo G; You, Yong; Behlke, Mark A; Owczarzy, Richard
2005-02-11
Single and dual-labeled fluorescent oligodeoxynucleotides are used in many molecular biology applications. We investigated the effects of commonly used fluorescent dyes and quenchers on the thermodynamic stability of a model probe-target DNA duplex. We demonstrate that those effects can be significant. Fluorescent dyes and quenchers were attached to the probe ends. In certain combinations, these groups stabilized the duplex up to 1.8kcal/mol and increased T(m) up to 4.3 degrees C. None of the groups tested significantly destabilized the duplex. Rank order of potency was, starting with the most stabilizing group: Iowa Black RQ approximately Black Hole 2>Cy5 approximately Cy3>Black Hole 1>QSY7 approximately Iowa Black FQ>Texas Red approximately TAMRA>FAM approximately HEX approximately Dabcyl>TET. Longer linkers decreased stabilizing effects. Hybridizations to targets with various dangling ends were also studied and were found to have only minor effects on thermodynamic stability. Depending on the dye/quencher combination employed, it can be important to include thermodynamic contributions from fluorophore and quencher when designing oligonucleotide probe assays.
47 CFR 80.701 - Scope of service.
Code of Federal Regulations, 2010 CFR
2010-10-01
... the paired duplex channels listed in subpart H of this part. Alaska-private fixed stations may operate... fixed stations or with ship stations, and on duplex frequencies listed in subpart H of this part when...
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Structure and stability of the consecutive stereoregulated chiral phosphorothioate DNA duplex.
Kanaori, K; Tamura, Y; Wada, T; Nishi, M; Kanehara, H; Morii, T; Tajima, K; Makino, K
1999-12-07
The duplex structures of the stereoregulated phosphorothioate DNAs, [R(p),R(p)]- and [S(p),S(p)]-[d(GC(ps)T(ps)ACG)] (ps, phosphorothioate; PS-DNA), with their complementary RNA have been investigated by combined use of (1)H NMR and restrained molecular dynamics calculation. Compared to those obtained for the unmodified duplex structures (PO-DNA.RNA), the NOE cross-peak intensities are virtually identical for the PS-DNA.RNA hybrid duplexes. The structural analysis on the basis of the NOE restraints reveals that all of the three DNA.RNA duplexes take a A-form conformation and that there is no significant difference in the base stacking for the DNA.RNA hybrid duplexes. On the other hand, the NOE cross-peak intensities of the protons around the central T(ps)A step of the PS-DNA.DNA duplexes are apparently different from those of PO-DNA. DNA. The chemical shifts of H8/6 and H1' at the T(ps)A step are also largely different among PS-DNA.DNAs and PO-DNA.DNA, suggesting that the DNA.DNA structure is readily changed by the introduction of the phosphorothioate groups to the central T(p)A step. The structure calculations indicate that all of these DNA.DNA duplexes are B-form although there exist some small differences in helical parameters between the [R(p),R(p)]- and [S(p),S(p)]PS-DNA.DNA duplexes. The melting temperatures (T(m)) were determined for all of the duplexes by plotting the chemical shift change of isolated peaks as a function of temperature. For the PS-DNA.RNA hybrid duplexes, the [S(p),S(p)] isomer is less stable than the [R(p),R(p)] isomer while this trend is reversed for the PS-DNA.DNA duplexes. Consequently, although the PS-DNA.RNA duplexes take the similar A-form structure, the duplex stability is different between PS-DNA.RNA duplexes. The stability of the DNA.RNA duplexes may not be governed by the A-form structure itself but by some other factors such as the hydration around the phosphorothioate backbone, although the T(m) difference of the DNA.DNA duplexes could be explained by the structural factor.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Otto, C., Thomas, G.A.; Peticolas, W.L.; Rippe, K.
Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5{prime}-d-((A){sub 10}TAATTTTAAATATTT)-3{prime} (D1) and 5{prime}-d((T){sub 10}ATTAAAATTTATAAA)-3{prime} (D2) in H{sub 2}O and D{sub 2}O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5{prime}-d(AAATATTTAAAATTA-(T){sub 10})-3{prime} (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly(d(A)){center dot}poly(d(T)) and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due tomore » changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent with formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogeneous sequence and high A,T content are observed at 843 and 1,092 cm{sup {minus}1} in the spectra of the parallel-stranded duplex.« less
NASA Astrophysics Data System (ADS)
Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker
2001-04-01
Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.
Lee, Joon-Hwa; Park, Chin-Ju; Shin, Jae-Sun; Ikegami, Takahisa; Akutsu, Hideo; Choi, Byong-Seok
2004-01-01
The cis-syn cyclobutane pyrimidine dimer (CPD) is a cytotoxic, mutagenic and carcinogenic DNA photoproduct and is repaired by the nucleotide excision repair (NER) pathway in mammalian cells. The XPC-hHR23B complex as the initiator of global genomic NER binds to sites of certain kinds of DNA damage. Although CPDs are rarely recognized by the XPC-hHR23B complex, the presence of mismatched bases opposite a CPD significantly increased the binding affinity of the XPC-hHR23B complex to the CPD. In order to decipher the properties of the DNA structures that determine the binding affinity for XPC-hHR23B to DNA, we carried out structural analyses of the various types of CPDs by NMR spectroscopy. The DNA duplex which contains a single 3' T*G wobble pair in a CPD (CPD/GA duplex) induces little conformational distortion. However, severe distortion of the helical conformation occurs when a CPD contains double T*G wobble pairs (CPD/GG duplex) even though the T residues of the CPD form stable hydrogen bonds with the opposite G residues. The helical bending angle of the CPD/GG duplex was larger than those of the CPD/GA duplex and properly matched CPD/AA duplex. The fluctuation of the backbone conformation and significant changes in the widths of the major and minor grooves at the double T*G wobble paired site were also observed in the CPD/GG duplex. These structural features were also found in a duplex that contains the (6-4) adduct, which is efficiently recognized by the XPC-hHR23B complex. Thus, we suggest that the unique structural features of the DNA double helix (that is, helical bending, flexible backbone conformation, and significant changes of the major and/or minor grooves) might be important factors in determining the binding affinity of the XPC-hHR23B complex to DNA.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-01-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536
Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G
2015-05-14
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Acid-induced exchange of the imino proton in G.C pairs.
Nonin, S; Leroy, J L; Gueron, M
1996-01-01
Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298
Acid-induced exchange of the imino proton in G.C pairs.
Nonin, S; Leroy, J L; Gueron, M
1996-02-15
Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.
Paiva, Anthony M; Sheardy, Richard D
2005-04-20
The formation of unusual structures during DNA replication has been invoked for gene expansion in genomes possessing triplet repeat sequences, CNG, where N = A, C, G, or T. In particular, it has been suggested that the daughter strand of the leading strand partially dissociates from the parent strand and forms a hairpin. The equilibrium between the fully duplexed parent:daugter species and the parent:hairpin species is dependent upon their relative stabilities and the rates of reannealing of the daughter strand back to the parent. These stabilities and rates are ultimately influenced by the sequence context of the DNA and its length. Previous work has demonstrated that longer strands are more stable than shorter strands and that the identity of N also influences the thermal stability [Paiva, A. M.; Sheardy, R. D. Biochemistry 2004, 43, 14218-14227]. Here, we show that the rate of duplex formation from complementary hairpins is also sequence context and length dependent. In particular, longer duplexes have higher activation energies than shorter duplexes of the same sequence context. Further, [(CCG):(GGC)] duplexes have lower activation energies than corresponding [(CAG):(GTC)] duplexes of the same length. Hence, hairpins formed from long CNG sequences are more thermodynamically stable and have slower kinetics for reannealing to their complement than shorter analogues. Gene expansion can now be explained in terms of thermodynamics and kinetics.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-01-01
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116
Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.
Hernández, Armando R; Peterson, Larryn W; Kool, Eric T
2012-08-17
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.
Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases
Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.
2012-01-01
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660
Istrate, Alena; Katolik, Adam; Istrate, Andrei; Leumann, Christian J
2017-08-01
We describe the synthesis, thermal stability, structural and RNase H activation properties of 2'β-fluoro-tricyclo nucleic acids (2'F-tc-ANA). Three 2'F-tc-ANA nucleosides (T, 5Me C and A) were synthesized starting from a previously described fluorinated tricyclo sugar intermediate. NMR analysis and quantum mechanical calculations indicate that 2'F-tc-ANA nucleosides prefer sugar conformations in the East and South regions of the pseudorotational cycle. UV-melting experiments revealed that non-consecutive insertions of 2'F-tc-ANA units in DNA reduce the affinity to DNA and RNA complements. However, an oligonucleotide with five contiguous 2'F-tc-ANA-T insertions exhibits increased affinity to complementary RNA. Moreover, a fully modified 10-mer 2'F-tc-ANA oligonucleotide paired to both DNA (+1.6 °C/mod) and RNA (+2.5 °C/mod) with significantly higher affinity compared to corresponding unmodified DNA, and similar affinity compared to corresponding tc-DNA. In addition, CD spectroscopy and molecular dynamics simulations indicate that the conformation of the 2'F-tc-ANA/RNA duplex is similar to that of a DNA/RNA duplex. Moreover, in some sequence contexts, 2'F-tc-ANA promotes RNase H-mediated cleavage of a complementary RNA strand. Taken together, 2'F-tc-ANA represents a nucleic acid analogue that offers the advantage of high RNA affinity while maintaining the ability to activate RNase H, and can be considered a prospective candidate for gene silencing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Small molecule-mediated duplex formation of nucleic acids with 'incompatible' backbones.
Cafferty, Brian J; Musetti, Caterina; Kim, Keunsoo; Horowitz, Eric D; Krishnamurthy, Ramanarayanan; Hud, Nicholas V
2016-04-07
Proflavine, a known intercalator of DNA and RNA, promotes duplex formation by nucleic acids with natural and non-natural backbones that otherwise form duplexes with low thermal stability, and even some that show no sign of duplex formation in the absence of proflavine. These findings demonstrate the potential for intercalators to be used as cofactors for the assembly of rationally designed nucleic acid structures, and could provide fundamental insights regarding intercalation of natural nucleic acid duplexes.
Bhuiya, Sutanwi; Haque, Lucy; Goswami, Rapti; Das, Suman
2017-12-14
The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 10 6 M -1 ) compared to that for the duplex counterpart (1.0 × 10 5 M -1 ). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.
NASA Technical Reports Server (NTRS)
Wu, Xiaolin; Delgado, Guillermo; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert
2003-01-01
Replacement of adenine by 2,6-diaminopurine-two nucleobases to be considered equivalent from an etlological point of view-strongly enhances the stability of TNA/TNA, TNA/RNA, or TNA/DNA duplexes and efficiently accelerates template-directed ligation of TNA ligands.
Base opening in RNA and DNA duplexes: implication for RNA stability.
Chen, Y Z; Mohan, V; Griffey, R H
2000-05-01
The energetics of a low-energy single base opening in several RNA duplex crystal structures has been calculated and compared to DNA duplexes. Base opening in RNA appears to have an overall preference towards the major groove, similar to results previously reported for B-DNA. Movement of each of the adenine, uracil, and cytosine bases into the minor groove is blocked by a high-energy barrier due to severe close contact with neighboring bases. Guanine bases are able to open towards both grooves because of the unique orientation of the base that avoids steric clash along the opening pathway. RNA bases are found to have a substantially smaller major groove opening extent than that of their B-DNA counterparts. A comparison with base opening behavior of A-DNA duplexes suggests that this difference results from helix constraint associated with A-form backbone conformation. The reduced opening extent correlates with the RNA duplex stability and is consistent with observed slower imino proton exchange rates in RNA duplexes.
NASA Astrophysics Data System (ADS)
Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J.; Schürch, Stefan
2016-07-01
Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes.
Capturing RNA Folding Free Energy with Coarse-Grained Molecular Dynamics Simulations
Bell, David R.; Cheng, Sara Y.; Salazar, Heber; Ren, Pengyu
2017-01-01
We introduce a coarse-grained RNA model for molecular dynamics simulations, RACER (RnA CoarsE-gRained). RACER achieves accurate native structure prediction for a number of RNAs (average RMSD of 2.93 Å) and the sequence-specific variation of free energy is in excellent agreement with experimentally measured stabilities (R2 = 0.93). Using RACER, we identified hydrogen-bonding (or base pairing), base stacking, and electrostatic interactions as essential driving forces for RNA folding. Also, we found that separating pairing vs. stacking interactions allowed RACER to distinguish folded vs. unfolded states. In RACER, base pairing and stacking interactions each provide an approximate stability of 3–4 kcal/mol for an A-form helix. RACER was developed based on PDB structural statistics and experimental thermodynamic data. In contrast with previous work, RACER implements a novel effective vdW potential energy function, which led us to re-parameterize hydrogen bond and electrostatic potential energy functions. Further, RACER is validated and optimized using a simulated annealing protocol to generate potential energy vs. RMSD landscapes. Finally, RACER is tested using extensive equilibrium pulling simulations (0.86 ms total) on eleven RNA sequences (hairpins and duplexes). PMID:28393861
Near-atomic resolution visualization of human transcription promoter opening
He, Yuan; Yan, Chunli; Fang, Jie; Inouye, Carla; Tjian, Robert; Ivanov, Ivaylo; Nogales, Eva
2016-01-01
In eukaryotic transcription initiation, a large multi-subunit pre-initiation complex (PIC) that assembles at the core promoter is required for the opening of the duplex DNA and identification of the start site for transcription by RNA polymerase II. Here we use cryo-electron microscropy (cryo-EM) to determine near-atomic resolution structures of the human PIC in a closed state (engaged with duplex DNA), an open state (engaged with a transcription bubble), and an initially transcribing complex (containing six base pairs of DNA–RNA hybrid). Our studies provide structures for previously uncharacterized components of the PIC, such as TFIIE and TFIIH, and segments of TFIIA, TFIIB and TFIIF. Comparison of the different structures reveals the sequential conformational changes that accompany the transition from each state to the next throughout the transcription initiation process. This analysis illustrates the key role of TFIIB in transcription bubble stabilization and provides strong structural support for a translocase activity of XPB. PMID:27193682
Moriguchi, Tomohisa; Sakai, Hideaki; Suzuki, Hideo; Shinozuka, Kazuo
2008-09-01
Novel phosphorothioate-modified oligodeoxynucleotides (S-ODNs) containing a deoxyuridine derivative bearing a spermine moiety at the C-5 position were synthesized. The study of the thermal stability and the thermodynamic stability showed that the modified S-ODNs have been able to form the stable duplexes with the complementary DNA. It was also found that the duplex composed of the modified S-ODN and its complementary RNA strand is the substrate for Escherichia coli RNase H, and the cleavage of the RNA strand by the enzyme was almost similar as in the case of the unmodified one.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.
As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less
2011-01-01
As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929
Capturing a DNA duplex under near-physiological conditions
NASA Astrophysics Data System (ADS)
Zhang, Huijuan; Xu, Wei; Liu, Xiaogang; Stellacci, Francesco; Thong, John T. L.
2010-10-01
We report in situ trapping of a thiolated DNA duplex with eight base pairs into a polymer-protected gold nanogap device under near-physiological conditions. The double-stranded DNA was captured by electrophoresis and covalently attached to the nanogap electrodes through sulfur-gold bonding interaction. The immobilization of the DNA duplex was confirmed by direct electrical measurements under near-physiological conditions. The conductance of the DNA duplex was estimated to be 0.09 μS. We also demonstrate the control of DNA dehybridization by heating the device to temperatures above the melting point of the DNA.
Unique Dynamic Properties of DNA Duplexes Containing Interstrand Crosslinks†
Friedman, Joshua I.; Jiang, Yu Lin; Miller, Paul S.; Stivers, James T.
2010-01-01
Bifunctional DNA alkylating agents form a diverse assortment of covalent DNA interstrand crosslinked (ICL) structures that are potent cytotoxins. Since it is implausible that cells could possess distinct DNA repair systems for each individual ICL, it is believed that common structural and dynamic features of ICL damage are recognized, rather than specific structural characteristics of each cross-linking agent. Investigation of the structural and dynamic properties of ICLs that might be important for recognition has been complicated by heterogeneous incorporation of these lesions into DNA. To address this problem we have synthesized and characterized several homogenous ICL-DNAs containing site–specific staggered N4-cytosine-ethyl-N4-cytosine crosslinks. Staggered crosslinks were introduced in two ways: in a manner that preserves the overall structure of B-form duplex DNA, and in a manner that highly distorts the DNA structure, with the goal of understanding how structural and dynamic properties of diverse ICL duplexes might flag these sites for repair. Measurements of base pair opening dynamics in the B-form ICL duplex by 1H NMR linewidth or imino proton solvent exchange showed that the guanine base opposite to the crosslinked cytosine opened at least an order of magnitude more slowly than when in a control matched normal duplex. To a lesser degree, the B-form ICL also induced a decrease in base pair opening dynamics that extended from the site of the crosslink to adjacent base pairs. In contrast, the non-B-form ICL showed extensive conformational dynamics at the site of the cross link, which extended over the entire DNA sequence. Since DNA duplexes containing the B-form and non-B-form ICL crosslinks have both been shown to be incised when incubated in mammalian whole cell extracts, while a matched normal duplex is not, we conclude that intrinsic DNA dynamics is not a requirement for specific damage incision of these ICLs. Instead, we propose a general model where destabilized ICL-duplexes serve to energetically facilitate binding of DNA repair factors that must induce bubbles or other distortions in the duplex. However, the essential requirement for incision is an immobile Y-junction where the repair factors are stably bound at the site of the ICL, and the two DNA strands are unpaired. PMID:21174443
Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides
Pasternak, Anna; Wengel, Jesper
2010-01-01
Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4.0–6.6 kcal/mol. Slight destabilization, by ∼0.5–1.5 kcal/mol, is observed for 5′- or 3′-terminal UNA residues. Furthermore, thermodynamic effects caused by UNA residues are extremely additive with ΔG°37 conformity up to 98%. Direct mismatches involving UNA residues decrease the thermodynamic stability less than unmodified mismatches in RNA duplexes. Additionally, the presence of UNA residues adjacent to unpaired RNA residues reduces mismatch discrimination. Thermodynamic analysis of UNA 5′- and 3′-dangling ends revealed that stacking interactions of UNA residues are always less favourable than that of RNA residues. Finally, circular dichroism spectra imply no changes in overall A-form structure of UNA–RNA/RNA duplexes relative to the unmodified RNA duplexes. PMID:20562222
Izanloo, Cobra
2017-09-02
An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
A fault-tolerant information processing concept for space vehicles.
NASA Technical Reports Server (NTRS)
Hopkins, A. L., Jr.
1971-01-01
A distributed fault-tolerant information processing system is proposed, comprising a central multiprocessor, dedicated local processors, and multiplexed input-output buses connecting them together. The processors in the multiprocessor are duplicated for error detection, which is felt to be less expensive than using coded redundancy of comparable effectiveness. Error recovery is made possible by a triplicated scratchpad memory in each processor. The main multiprocessor memory uses replicated memory for error detection and correction. Local processors use any of three conventional redundancy techniques: voting, duplex pairs with backup, and duplex pairs in independent subsystems.
RNA Tertiary Interactions in a Riboswitch Stabilize the Structure of a Kink Turn
Schroeder, Kersten T.; Daldrop, Peter; Lilley, David M.J.
2011-01-01
Summary The kink turn is a widespread RNA motif that introduces an acute kink into the axis of duplex RNA, typically comprising a bulge followed by a G⋅A and A⋅G pairs. The kinked conformation is stabilized by metal ions, or the binding of proteins including L7Ae. We now demonstrate a third mechanism for the stabilization of k-turn structure, involving tertiary interactions within a larger RNA structure. The SAM-I riboswitch contains an essential standard k-turn sequence that kinks a helix so that its terminal loop can make a long-range interaction. We find that some sequence variations in the k-turn within the riboswitch do not prevent SAM binding, despite preventing the folding of the k-turn in isolation. Furthermore, two crystal structures show that the sequence-variant k-turns are conventionally folded within the riboswitch. This study shows that the folded structure of the k-turn can be stabilized by tertiary interactions within a larger RNA structure. PMID:21893284
Park, Jaeyeong; Jo, Min Cheol; Jeong, Hyeok Jae; Sohn, Seok Su; Kwak, Jai-Hyun; Kim, Hyoung Seop; Lee, Sunghak
2017-11-16
Phenomena occurring in duplex lightweight steels under dynamic loading are hardly investigated, although its understanding is essentially needed in applications of automotive steels. In this study, quasi-static and dynamic tensile properties of duplex lightweight steels were investigated by focusing on how TRIP and TWIP mechanisms were varied under the quasi-static and dynamic loading conditions. As the annealing temperature increased, the grain size and volume fraction of austenite increased, thereby gradually decreasing austenite stability. The strain-hardening rate curves displayed a multiple-stage strain-hardening behavior, which was closely related with deformation mechanisms. Under the dynamic loading, the temperature rise due to adiabatic heating raised the austenite stability, which resulted in the reduction in the TRIP amount. Though the 950 °C-annealed specimen having the lowest austenite stability showed the very low ductility and strength under the quasi-static loading, it exhibited the tensile elongation up to 54% as well as high strain-hardening rate and tensile strength (1038 MPa) due to appropriate austenite stability under dynamic loading. Since dynamic properties of the present duplex lightweight steels show the excellent strength-ductility combination as well as continuously high strain hardening, they can be sufficiently applied to automotive steel sheets demanded for stronger vehicle bodies and safety enhancement.
Aarattuthodiyil, Suja; Byrd, Alicia K.; Raney, Kevin D.
2014-01-01
Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding. PMID:25249618
Evolution of specific 3'-5'-linkages in RNA in pre-biotic soup: a new hypothesis.
Kumar, Vaijayanti A
2016-11-02
This article reviews the different possibilities towards progression of the formation of DNA/RNA in the chemical world, before life, in enzyme-free conditions. The advent of deoxyribo- and ribopentose-sugars, nucleosides, nucleotides and oligonucleotides in the prebiotic soup is briefly discussed. Further, the formation of early single stranded oligomers, base-pairing possibilities and information transfer based on the stability parameters of the derived duplexes is reviewed. Each theory has its own merits and demerits which we have elaborated upon. Lastly, using clues from this literature, a possible explanation for the specific 3'-5'-linkages in RNA is proposed.
Recognition of DNA/RNA bulges by antimicrobial and antitumor metallohelices.
Malina, Jaroslav; Scott, Peter; Brabec, Viktor
2015-09-07
Bulged structures have been identified in nucleic acids and have been shown to be linked to biomolecular processes involved in numerous diseases. Thus, chemical agents with affinity for bulged nucleic acids are of general biological significance. Herein, the mechanism of specific recognition and stabilization of bulged DNA and RNA by helical bimetallic species was established through detailed molecular biophysics and biochemistry assays. These agents, known as 'flexicates', are potential mimetics of α-helical peptides in cancer treatment, exhibiting antimicrobial and antitumor effects. The flexicates have positive impacts on the thermal stability of DNA duplexes containing bulges, which means that the flexicates interact with the duplexes containing bulges, and that these interactions stabilize the secondary structures of these duplexes. Notably, the stabilising effect of the flexicates increases with the size of the bulge, the maximal stabilization is observed for the duplexes containing a bulge composed of at least three bases. The flexicates bind most preferentially to the bulges composed of pyrimidines flanked on both sides also by pyrimidines. It is suggested that it is so because these bulges exhibit greatest conformational variability in comparison with other combinations of bases in the bulge loop and bases flanking the bulge. Finally, the results indicate that there is only one dominant binding site for the flexicates on the DNA and RNA bulges and that the flexicates bind directly to the bulge or in its close proximity. It is also shown that the flexicates effectively bind to RNA duplexes containing the bulged region of HIV-1 TAR RNA.
NASA Technical Reports Server (NTRS)
Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.
2002-01-01
The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.
Full-duplex optical communication system
NASA Technical Reports Server (NTRS)
Shay, Thomas M. (Inventor); Hazzard, David A. (Inventor); Horan, Stephen (Inventor); Payne, Jason A. (Inventor)
2004-01-01
A method of full-duplex electromagnetic communication wherein a pair of data modulation formats are selected for the forward and return data links respectively such that the forward data electro-magnetic beam serves as a carrier for the return data. A method of encoding optical information is used wherein right-hand and left-hand circular polarizations are assigned to optical information to represent binary states. An application for an earth to low earth orbit optical communications system is presented which implements the full-duplex communication and circular polarization keying modulation format.
Poomsuk, Nattawee; Vilaivan, Tirayut; Siriwong, Khatcharin
2018-06-12
Peptide nucleic acid (PNA) is a powerful biomolecule with a wide variety of important applications. In this work, the molecular structures and binding affinity of PNA with a D-prolyl-2-aminocyclopentane carboxylic acid backbone (acpcPNA) that binds to both DNA and RNA were studied using molecular dynamics simulations. The simulated structures of acpcPNA-DNA and acpcPNA-RNA duplexes more closely resembled the typical structures of B-DNA and A-RNA than the corresponding duplexes of aegPNA. The calculated binding free energies are in good agreement with the experimental results that the acpcPNA-DNA duplex is more stable than the acpcPNA-RNA duplex regardless of the base sequences. The results provide further insights in the relationship between structure and stability of this unique PNA system. Copyright © 2018 Elsevier Inc. All rights reserved.
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.
Nonin, S; Leroy, J L; Guéron, M
1995-08-22
We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].
A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition
Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.
2003-01-01
A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209
Force-Induced Rupture of a DNA Duplex: From Fundamentals to Force Sensors.
Mosayebi, Majid; Louis, Ard A; Doye, Jonathan P K; Ouldridge, Thomas E
2015-12-22
The rupture of double-stranded DNA under stress is a key process in biophysics and nanotechnology. In this article, we consider the shear-induced rupture of short DNA duplexes, a system that has been given new importance by recently designed force sensors and nanotechnological devices. We argue that rupture must be understood as an activated process, where the duplex state is metastable and the strands will separate in a finite time that depends on the duplex length and the force applied. Thus, the critical shearing force required to rupture a duplex depends strongly on the time scale of observation. We use simple models of DNA to show that this approach naturally captures the observed dependence of the force required to rupture a duplex within a given time on duplex length. In particular, this critical force is zero for the shortest duplexes, before rising sharply and then plateauing in the long length limit. The prevailing approach, based on identifying when the presence of each additional base pair within the duplex is thermodynamically unfavorable rather than allowing for metastability, does not predict a time-scale-dependent critical force and does not naturally incorporate a critical force of zero for the shortest duplexes. We demonstrate that our findings have important consequences for the behavior of a new force-sensing nanodevice, which operates in a mixed mode that interpolates between shearing and unzipping. At a fixed time scale and duplex length, the critical force exhibits a sigmoidal dependence on the fraction of the duplex that is subject to shearing.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Effects of magnesium ions on the stabilization of RNA oligomers of defined structures.
Serra, Martin J; Baird, John D; Dale, Taraka; Fey, Bridget L; Retatagos, Kimberly; Westhof, Eric
2002-01-01
Optical melting was used to determine the stabilities of 11 small RNA oligomers of defined secondary structure as a function of magnesium ion concentration. The oligomers included helices composed of Watson-Crick base pairs, GA tandem base pairs, GU tandem base pairs, and loop E motifs (both eubacterial and eukaryotic). The effect of magnesium ion concentration on stability was interpreted in terms of two simple models. The first assumes an uptake of metal ion upon duplex formation. The second assumes nonspecific electrostatic attraction of metal ions to the RNA oligomer. For all oligomers, except the eubacterial loop E, the data could best be interpreted as nonspecific binding of metal ions to the RNAs. The effect of magnesium ions on the stability of the eubacterial loop E was distinct from that seen with the other oligomers in two ways. First, the extent of stabilization by magnesium ions (as measured by either change in melting temperature or free energy) was three times greater than that observed for the other helical oligomers. Second, the presence of magnesium ions produces a doubling of the enthalpy for the melting transition. These results indicate that magnesium ion stabilizes the eubacterial loop E sequence by chelating the RNA specifically. Further, these results on a rather small system shed light on the large enthalpy changes observed upon thermal unfolding of large RNAs like group I introns. It is suggested that parts of those large enthalpy changes observed in the folding of RNAs may be assigned to variations in the hydration states and types of coordinating atoms in some specifically bound magnesium ions and to an increase in the observed cooperativity of the folding transition due to the binding of those magnesium ions coupling the two stems together. Brownian dynamic simulations, carried out to visualize the metal ion binding sites, reveal rather delocalized ionic densities in all oligomers, except for the eubacterial loop E, in which precisely located ion densities were previously calculated. PMID:12003491
Single-molecule fluorescence reveals the unwinding stepping mechanism of replicative helicase.
Syed, Salman; Pandey, Manjula; Patel, Smita S; Ha, Taekjip
2014-03-27
Bacteriophage T7 gp4 serves as a model protein for replicative helicases that couples deoxythymidine triphosphate (dTTP) hydrolysis to directional movement and DNA strand separation. We employed single-molecule fluorescence resonance energy transfer methods to resolve steps during DNA unwinding by T7 helicase. We confirm that the unwinding rate of T7 helicase decreases with increasing base pair stability. For duplexes containing >35% guanine-cytosine (GC) base pairs, we observed stochastic pauses every 2-3 bp during unwinding. The dwells on each pause were distributed nonexponentially, consistent with two or three rounds of dTTP hydrolysis before each unwinding step. Moreover, we observed backward movements of the enzyme on GC-rich DNAs at low dTTP concentrations. Our data suggest a coupling ratio of 1:1 between base pairs unwound and dTTP hydrolysis, and they further support the concept that nucleic acid motors can have a hierarchy of different-sized steps or can accumulate elastic energy before transitioning to a subsequent phase. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, X.; Patel, D.J.
The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H/sub 2/O and D/sub 2/O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding themore » dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
The cardiac muscle duplex as a method to study myocardial heterogeneity
Solovyova, O.; Katsnelson, L.B.; Konovalov, P.V.; Kursanov, A.G.; Vikulova, N.A.; Kohl, P.; Markhasin, V.S.
2014-01-01
This paper reviews the development and application of paired muscle preparations, called duplex, for the investigation of mechanisms and consequences of intra-myocardial electro-mechanical heterogeneity. We illustrate the utility of the underlying combined experimental and computational approach for conceptual development and integration of basic science insight with clinically relevant settings, using previously published and new data. Directions for further study are identified. PMID:25106702
Synthesis of native-like crosslinked duplex RNA and study of its properties.
Onizuka, Kazumitsu; Hazemi, Madoka E; Thomas, Justin M; Monteleone, Leanna R; Yamada, Ken; Imoto, Shuhei; Beal, Peter A; Nagatsugi, Fumi
2017-04-01
A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in order to carry out its functions. We have endeavored to prepare the covalently crosslinked native-like duplex RNA, which could be useful for biochemical studies and RNA nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in RNA. We measured melting temperatures and CD spectra to identify the properties of the VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic stability without disturbing the natural conformation of dsRNA. In addition, a competitive binding experiment with the duplex RNA binding enzyme, ADAR2, showed the crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural dsRNA, confirming that it has finely preserved the natural traits of duplex RNA. Copyright © 2017. Published by Elsevier Ltd.
Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R
1998-09-23
The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.
[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].
Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan
2015-04-01
To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.
Tertiary structure-based analysis of microRNA–target interactions
Gan, Hin Hark; Gunsalus, Kristin C.
2013-01-01
Current computational analysis of microRNA interactions is based largely on primary and secondary structure analysis. Computationally efficient tertiary structure-based methods are needed to enable more realistic modeling of the molecular interactions underlying miRNA-mediated translational repression. We incorporate algorithms for predicting duplex RNA structures, ionic strength effects, duplex entropy and free energy, and docking of duplex–Argonaute protein complexes into a pipeline to model and predict miRNA–target duplex binding energies. To ensure modeling accuracy and computational efficiency, we use an all-atom description of RNA and a continuum description of ionic interactions using the Poisson–Boltzmann equation. Our method predicts the conformations of two constructs of Caenorhabditis elegans let-7 miRNA–target duplexes to an accuracy of ∼3.8 Å root mean square distance of their NMR structures. We also show that the computed duplex formation enthalpies, entropies, and free energies for eight miRNA–target duplexes agree with titration calorimetry data. Analysis of duplex–Argonaute docking shows that structural distortions arising from single-base-pair mismatches in the seed region influence the activity of the complex by destabilizing both duplex hybridization and its association with Argonaute. Collectively, these results demonstrate that tertiary structure-based modeling of miRNA interactions can reveal structural mechanisms not accessible with current secondary structure-based methods. PMID:23417009
Pley, H W; Flaherty, K M; McKay, D B
1994-11-03
In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.
Liu, Yi; Xu, Jianfeng; Karimiahmadabadi, Mansoureh; Zhou, Chuanzheng; Chattopadhyaya, Jyoti
2010-11-05
2',4'-Propylene-bridged thymidine (carba-ENA-T) and five 8'-Me/NH(2)/OH modified carba-ENA-T analogues have been prepared through intramolecular radical addition to C═N of the tethered oxime-ether. These carba-ENA nucleosides have been subsequently incorporated into 15mer oligodeoxynucleotides (AON), and their affinity toward cDNA and RNA, nuclease resistance, and RNase H recruitment capability have been investigated in comparison with those of the native and ENA counterparts. These carba-ENAs modified AONs are highly RNA-selective since all of them led to slight thermal stabilization effect for the AON:RNA duplex, but quite large destabilization effect for the AON:DNA duplex. It was found that different C8' substituents (at the bottom of the minor groove) on carba-ENA-T only led to rather small variation of thermal stability of the AON:RNA duplexes. We, however, observed that the parent carba-ENA-T modified AONs exhibited higher nucleolytic stability than those of the ENA-T modified counterparts. The nucleolytic stability of carba-ENA-T modified AONs can be further modulated by C8' substituent to variable extents depending on not only the chemical nature but also the stereochemical orientation of the C8' substituents: Thus, (1) 8'S-Me on carba-ENA increases the nucleolytic stability but 8'R-Me leads to a decreased effect; (2) 8'R-OH on carba-ENA had little, if any, effect on nuclease resistance but 8'S-OH resulted in significantly decreased nucleolytic stability; and (3) 8'-NH(2) substituted carba-ENA leads to obvious loss in the nuclease resistance. The RNA strand in all of the carba-ENA derivatives modified AON:RNA hybrid duplexes can be digested by RNase H1 with high efficiency, even at twice the rate of those of the native and ENA modified counterpart.
Zhu, Yu; Liang, Lin; Luo, Yakun; Wang, Guihua; Wang, Chunren; Cui, Yudong; Ai, Xia; Cui, Shangjin
2017-02-01
In this study, a novel duplex nanoparticle-assisted polymerase chain reaction (nanoPCR) assay was developed to detect porcine epidemic diarrhea virus (PEDV) and porcine transmissible gastroenteritis virus (TGEV). Two pairs of primers were designed based on the conserved region within the N gene of PEDV and TGEV. In a screening of 114 clinical samples from four provinces in China for PEDV and TGEV, 48.2 and 3.5 % of the samples, respectively, tested positive. Under optimized conditions, the duplex nanoPCR assay had a detection limit of 7.6 × 10 1 and 8.5 × 10 1 copies μL -1 for PEDV and TGEV, respectively. The sensitivity of the duplex nanoPCR assay was ten times higher than that of a conventional PCR assay. Moreover, no fragments were amplified when the duplex nanoPCR assay was used to test samples containing other porcine viruses. Our results indicate that the duplex nanoPCR assay described here is useful for the rapid detection of PEDV and TGEV and can be applied in clinical diagnosis.
Zhang, X; Gottlieb, P A
1995-01-01
Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate binding of the complex by altering the intrinsic properties of the DNA. Two specific attributes are required to achieve the lowest free energy of interaction. The DNA must have two interstrand hydrogen bonds to stabilize the duplex and it must have properties associated with directional bending or unwinding. This analysis does not rule out contributions by direct interactions between the protein and the central region of the operator but underscores how indirect effects play a major role in complex formation in this system. Images PMID:7784203
H-Bond Self-Assembly: Folding versus Duplex Formation.
Núñez-Villanueva, Diego; Iadevaia, Giulia; Stross, Alexander E; Jinks, Michael A; Swain, Jonathan A; Hunter, Christopher A
2017-05-17
Linear oligomers equipped with complementary H-bond donor (D) and acceptor (A) sites can interact via intermolecular H-bonds to form duplexes or fold via intramolecular H-bonds. These competing equilibria have been quantified using NMR titration and dilution experiments for seven systems featuring different recognition sites and backbones. For all seven architectures, duplex formation is observed for homo-sequence 2-mers (AA·DD) where there are no competing folding equilibria. The corresponding hetero-sequence AD 2-mers also form duplexes, but the observed self-association constants are strongly affected by folding equilibria in the monomeric states. When the backbone is flexible (five or more rotatable bonds separating the recognition sites), intramolecular H-bonding is favored, and the folded state is highly populated. For these systems, the stability of the AD·AD duplex is 1-2 orders of magnitude lower than that of the corresponding AA·DD duplex. However, for three architectures which have more rigid backbones (fewer than five rotatable bonds), intramolecular interactions are not observed, and folding does not compete with duplex formation. These systems are promising candidates for the development of longer, mixed-sequence synthetic information molecules that show sequence-selective duplex formation.
Development of dansyl-modified oligonucleotide probes responding to structural changes in a duplex.
Suzuki, Yoshio; Kowata, Keiko; Komatsu, Yasuo
2013-11-15
We have synthesized a nonnucleoside amidite block of dansyl fluorophore to prepare dansyl-modified oligonucleotides (ONTs). The fluorescence intensities of dansyl-ONT specifically increased by the presence of adjacent guanosine residues but, significantly reduced in a dansyl-flipping duplex. These changes were caused by solvatochromism effect due to the number of guanine which is hydrophobic functional group and the external environment of dansyl group. The fluorescence intensities could be plotted as a function of the ONTs concentrations and the increase in the fluorescence was observed to equimolar concentrations of target DNA. This duplex exhibited higher melting temperature relative to the corresponding duplexes containing other base pairs. Similar changes in fluorescence could be detected upon hybridization with complementary RNAs. Thus, the dansyl-modified ONTs provide sequence specific fluorescent probe of DNA and RNA. Copyright © 2013 Elsevier Ltd. All rights reserved.
Reducing the background fluorescence in mice receiving fluorophore/inhibitor DNA duplexes.
Liang, Minmin; Liu, Xinrong; Liu, Guozheng; Dou, Shuping; Cheng, Dengfeng; Liu, Yuxia; Rusckowski, Mary; Hnatowich, Donald J
2011-02-07
In principle, a DNA duplex consisting of an antisense fluorophore-conjugated major strand hybridized to a shorter complementary inhibitor-conjugated minor strand should provide fluorescence only in the tumor after intravenous administration if designed to remain intact except in the presence in tumor of its mRNA target. While we have obtained impressive tumor images in mice using this approach, there remains some background fluorescence. In this study, tissue homogenates of selected mouse organs were incubated with a test duplex and the kinetics of duplex dissociation in normal tissues were measured. In this manner we were able to identify the liver as the likely major source responsible for the duplex dissociation providing this fluorescence background. Thereafter liver homogenates were used to screen a series of duplex candidates with variable-length minor strands, and dissociation was measured by gel electrophoresis. The selected fluorophore/inhibitor duplex with improved stability displayed an insignificant (P > 0.05) background fluorescence after administration to SKH-1 normal mice and apparently without affecting target mRNA binding in vitro in cell culture or in vivo in tumor bearing mice.
Direct Duplex Detection: An Emerging Tool in the RNA Structure Analysis Toolbox.
Weidmann, Chase A; Mustoe, Anthony M; Weeks, Kevin M
2016-09-01
While a variety of powerful tools exists for analyzing RNA structure, identifying long-range and intermolecular base-pairing interactions has remained challenging. Recently, three groups introduced a high-throughput strategy that uses psoralen-mediated crosslinking to directly identify RNA-RNA duplexes in cells. Initial application of these methods highlights the preponderance of long-range structures within and between RNA molecules and their widespread structural dynamics. Copyright © 2016 Elsevier Ltd. All rights reserved.
Banyasz, Akos; Ketola, Tiia; Martínez-Fernández, Lara; Improta, Roberto; Markovitsi, Dimitra
2018-04-17
There is increasing evidence that the direct absorption of photons with energies that are lower than the ionization potential of nucleobases may result in oxidative damage to DNA. The present work, which combines nanosecond transient absorption spectroscopy and quantum mechanical calculations, studies this process in alternating adenine-thymine duplexes (AT)n. We show that the one-photon ionization quantum yield of (AT)10 at 266 nm (4.66 eV) is (1.5 ± 0.3) × 10-3. According to our PCM/TD-DFT calculations carried out on model duplexes composed of two base pairs, (AT)1 and (TA)1, simultaneous base pairing and stacking does not induce important changes in the absorption spectra of the adenine radical cation and deprotonated radical. The adenine radicals, thus identified in the time-resolved spectra, disappear with a lifetime of 2.5 ms, giving rise to a reaction product that absorbs at 350 nm. In parallel, the fingerprint of reaction intermediates other than radicals, formed directly from singlet excited states and assigned to AT/TA dimers, is detected at shorter wavelengths. PCM/TD-DFT calculations are carried out to map the pathways leading to such species and to characterize their absorption spectra; we find that, in addition to the path leading to the well-known TA* photoproduct, an AT photo-dimerization path may be operative in duplexes.
Synthesis and structure of duplex DNA containing the genotoxic nucleobase lesion N7-methylguanine
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, S.; Bowman, B.R.; Ueno, Y.
2008-11-03
The predominant product of aberrant DNA methylation is the genotoxic lesion N7-methyl-2{prime}-deoxyguanosine (m{sup 7}dG). M{sup 7}dG is recognized and excised by lesion-specific DNA glycosylases, namely AlkA in E. coli and Aag in humans. Structural studies of m{sup 7}dG recognition and catalysis by these enzymes have been hampered due to a lack of efficient means by which to incorporate the chemically labile m{sup 7}dG moiety site-specifically into DNA on a preparative scale. Here we report a solution to this problem. We stabilized the lesion toward acid-catalyzed and glycosylase-catalyzed depurination by 2{prime}-fluorination and toward base-catalyzed degradation using mild, nonaqueous conditions in themore » DNA deprotection reaction. Duplex DNA containing 2{prime}-fluoro-m{sup 7}dG (Fm{sup 7}dG) cocrystallized with AlkA as a host-guest complex in which the lesion-containing segment of DNA was nearly devoid of protein contacts, thus enabling the first direct visualization of the N7-methylguanine lesion nucleobase in DNA. The structure reveals that the base-pairing mode of Fm{sup 7}dG:C is nearly identical to that of G:C, and Fm{sup 7}dG does not induce any apparent structural disturbance of the duplex structure. These observations suggest that AlkA and Aag must perform a structurally invasive interrogation of DNA in order to detect the presence of intrahelical m{sup 7}dG lesions.« less
Duplex Healing of Selectively Thiolated Guanosine Mismatches through a Cd2+ Chemical Stimulus.
Lunn, Samantha M L; Hribesh, Samira; Whitfield, Colette J; Hall, Michael J; Houlton, Andrew; Bronowska, Agnieszka K; Tuite, Eimer M; Pike, Andrew R
2018-03-25
The on-column selective conversion of guanosine to thioguanosine (tG) yields modified oligomers that exhibit destabilisation over the fully complementary duplex. Restoration to a stabilised duplex is induced through thio-directed Cd 2+ coordination; a route for healing DNA damage. Short oligomers are G-specifically thiolated through a modified on-column protocol without the need for costly thioguanosine phosphoramidites. Addition of Cd 2+ ions to a duplex containing a highly disrupted tG central mismatch sequence, 3'-A 6 tG 4 T 6 -5', suggests a (tG) 8 Cd 2 central coordination regime, resulting in increased base stacking and duplex stability. Equilibrium molecular dynamic calculations support the hypothesis of metal-induced healing of the thiolated duplex. The 2 nm displacement of the central tG mismatched region is dramatically reduced after the addition of a chemical stimuli, Cd 2+ ions, returning to a minimized fluctuational state comparable to the unmodified fully complementary oligomer. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Stone, M J; Nedderman, A N; Williams, D H; Lin, P K; Brown, D M
1991-12-05
In order to reach a more detailed understanding of the mechanism of the mutagenic action of methoxyamine and of N4-methoxycytidine and its 2'-deoxyribo-analogue, the solution structures of the self-complementary octanucleotide, d(CGAATTCG) and its analogues, d(CGAATCCG), d(CGAATMCG) and d(CGAATPCG) (designated 8mer-AT, 8mer-AC, 8mer-AM, and 8mer-AP, respectively), were investigated by 1H nuclear magnetic resonance spectroscopy; M is N4-methoxycytosine (mo4C) and P is an analogue, the bicyclic dihydropyrimido[4,5-c][1,2]oxazin-7-one, in which the N-O bond is held in the anti configuration with respect to N3 of the cytosine ring. Correlated spectroscopy and nuclear Overhauser spectroscopy allowed assignment of the base, anomeric and H2'/H2" protons in 8mers-AT, -AM and -AP, and showed that all three had features consistent with a regular B-DNA duplex structure. Duplex-to-coil transition temperatures were determined to be 52(+/- 2) degrees C (8mer-AT), 51(+/- 2) degrees C (8mer-AP), 32(+/- 2) degrees C (8mer-AM); on the chemical shift timescale, the melting transition was fast for 8mer-AT and 8mer-AP, but slow for 8mer-AM. Imino proton spectra were indicative of Watson-Crick base-pairing in 8mers-AT, -AP and -AM. The 8mer-AP duplex had a structure and melting characteristics virtually identical with those of the 8mer-AT duplex. The preferred syn configuration of the methoxyl group in M had a destabilising effect on the 8mer-AM duplex. At low temperatures, the A.M base-pair was in fast equilibrium between Watson-Crick and wobble configurations, with the methoxyl function anti-oriented, but the melting transition was accompanied by isomerization of the methoxyl group to the syn conformation. This syn-anti isomerization was the rate-determining step in the duplex-to-coil transition. The 8mer-AC oligomer did not form a stable duplex.
2017-01-01
The effect of S-substitution on the O6 guanine site of a 13-mer DNA duplex containing a G:T mismatch is studied using molecular dynamics. The structure, dynamic evolution and hydration of the S-substituted duplex are compared with those of a normal duplex, a duplex with S-substitution on guanine, but no mismatch and a duplex with just a G:T mismatch. The S-substituted mismatch leads to cell death rather than repair. One suggestion is that the G:T mismatch recognition protein recognises the S-substituted mismatch (GS:T) as G:T. This leads to a cycle of futile repair ending in DNA breakage and cell death. We find that some structural features of the helix are similar for the duplex with the G:T mismatch and that with the S-substituted mismatch, but differ from the normal duplex, notably the helical twist. These differences arise from the change in the hydrogen-bonding pattern of the base pair. However a marked feature of the S-substituted G:T mismatch duplex is a very large opening. This showed considerable variability. It is suggested that this enlarged opening would lend support to an alternative model of cell death in which the mismatch protein attaches to thioguanine and activates downstream damage-response pathways. Attack on the sulphur by reactive oxygen species, also leading to cell death, would also be aided by the large, variable opening. PMID:28910418
Algasaier, Sana I.; Exell, Jack C.; Bennet, Ian A.; Thompson, Mark J.; Gotham, Victoria J. B.; Shaw, Steven J.; Craggs, Timothy D.; Finger, L. David; Grasby, Jane A.
2016-01-01
Human flap endonuclease-1 (hFEN1) catalyzes the essential removal of single-stranded flaps arising at DNA junctions during replication and repair processes. hFEN1 biological function must be precisely controlled, and consequently, the protein relies on a combination of protein and substrate conformational changes as a prerequisite for reaction. These include substrate bending at the duplex-duplex junction and transfer of unpaired reacting duplex end into the active site. When present, 5′-flaps are thought to thread under the helical cap, limiting reaction to flaps with free 5′-termini in vivo. Here we monitored DNA bending by FRET and DNA unpairing using 2-aminopurine exciton pair CD to determine the DNA and protein requirements for these substrate conformational changes. Binding of DNA to hFEN1 in a bent conformation occurred independently of 5′-flap accommodation and did not require active site metal ions or the presence of conserved active site residues. More stringent requirements exist for transfer of the substrate to the active site. Placement of the scissile phosphate diester in the active site required the presence of divalent metal ions, a free 5′-flap (if present), a Watson-Crick base pair at the terminus of the reacting duplex, and the intact secondary structure of the enzyme helical cap. Optimal positioning of the scissile phosphate additionally required active site conserved residues Tyr40, Asp181, and Arg100 and a reacting duplex 5′-phosphate. These studies suggest a FEN1 reaction mechanism where junctions are bound and 5′-flaps are threaded (when present), and finally the substrate is transferred onto active site metals initiating cleavage. PMID:26884332
Maximizing synchronizability of duplex networks
NASA Astrophysics Data System (ADS)
Wei, Xiang; Emenheiser, Jeffrey; Wu, Xiaoqun; Lu, Jun-an; D'Souza, Raissa M.
2018-01-01
We study the synchronizability of duplex networks formed by two randomly generated network layers with different patterns of interlayer node connections. According to the master stability function, we use the smallest nonzero eigenvalue and the eigenratio between the largest and the second smallest eigenvalues of supra-Laplacian matrices to characterize synchronizability on various duplexes. We find that the interlayer linking weight and linking fraction have a profound impact on synchronizability of duplex networks. The increasingly large inter-layer coupling weight is found to cause either decreasing or constant synchronizability for different classes of network dynamics. In addition, negative node degree correlation across interlayer links outperforms positive degree correlation when most interlayer links are present. The reverse is true when a few interlayer links are present. The numerical results and understanding based on these representative duplex networks are illustrative and instructive for building insights into maximizing synchronizability of more realistic multiplex networks.
Tsuruoka, H; Shohda, K; Wada, T; Sekine, M
2000-11-03
To synthesize oligonucleotides containing 2'-O-phosphate groups, four kinds of ribonucleoside 3'-phosphoramidite building blocks 6a-d having the bis(2-cyano-1,1-dimethylethoxy)thiophosphoryl (BCMETP) group were prepared according to our previous phosphorylation procedure. These phosphoramidite units 6a-d were not contaminated with 3'-regioisomers and were successfully applied to solid-phase synthesis to give oligodeoxyuridylates 15, 16 and oligouridylates 21, 22. Self-complementary Drew-Dickerson DNA 12mers 24-28 replaced by a 2'-O-phosphorylated ribonucleotide at various positions were similarly synthesized. In these syntheses, it turned out that KI(3) was the most effective reagent for oxidative desulfurization of the initially generated thiophosphate group to the phosphate group on polymer supports. Without using this conversion step, a tridecadeoxyuridylate 17 incorporating a 2'-O-thiophosphorylated uridine derivative was also synthesized. To investigate the effect of the 2'-phosphate group on the thermal stability and 3D-structure of DNA(RNA) duplexes, T(m) measurement of the self-complementary oligonucleotides obtained and MD simulation of heptamer duplexes 33-36 were carried out. According to these analyses, it was suggested that the nucleoside ribose moiety phosphorylated at the 2'-hydroxyl function predominantly preferred C2'-endo to C3'-endo conformation in DNA duplexes so that it did not significantly affect the stability of the DNA duplex. On the other hand, the 2'-modified ribose moiety was expelled to give a C3'-endo conformation in RNA duplexes so that the RNA duplexes were extremely destabilized.
Hands-on work fine-tunes X-band PIN-diode duplexer
NASA Astrophysics Data System (ADS)
Schneider, P.
1985-06-01
Computer-aided design (CAD) programs for fabricating PIN-diode duplexers are useful in avoiding time-consuming cut-and-try techniques. Nevertheless, to attain minimum insertion loss, only experimentation yields the optimum microstrip circuitry. A PIN-diode duplexer, consisting of two SPST PIN-diode switches and a pair of 3-dB Lange microstrip couplers, designed for an X-band transmit/receive module exemplifies what is possible when computer-derived designs and experimentation are used together. Differences between the measured and computer-generated figures for insertion loss can be attributed to several factors not included in the CAD program - for example, radiation and connector losses. Mechanical tolerances of the microstrip PC board and variations in the SMA connector-to-microstrip transition contribute to the discrepancy.
Laser Safety Method For Duplex Open Loop Parallel Optical Link
Baumgartner, Steven John; Hedin, Daniel Scott; Paschal, Matthew James
2003-12-02
A method and apparatus are provided to ensure that laser optical power does not exceed a "safe" level in an open loop parallel optical link in the event that a fiber optic ribbon cable is broken or otherwise severed. A duplex parallel optical link includes a transmitter and receiver pair and a fiber optic ribbon that includes a designated number of channels that cannot be split. The duplex transceiver includes a corresponding transmitter and receiver that are physically attached to each other and cannot be detached therefrom, so as to ensure safe, laser optical power in the event that the fiber optic ribbon cable is broken or severed. Safe optical power is ensured by redundant current and voltage safety checks.
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays
NASA Technical Reports Server (NTRS)
Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.
2003-01-01
The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.
Evaluation of Anti-HIV-1 Mutagenic Nucleoside Analogues*
Vivet-Boudou, Valérie; Isel, Catherine; El Safadi, Yazan; Smyth, Redmond P.; Laumond, Géraldine; Moog, Christiane; Paillart, Jean-Christophe; Marquet, Roland
2015-01-01
Because of their high mutation rates, RNA viruses and retroviruses replicate close to the threshold of viability. Their existence as quasi-species has pioneered the concept of “lethal mutagenesis” that prompted us to synthesize pyrimidine nucleoside analogues with antiviral activity in cell culture consistent with an accumulation of deleterious mutations in the HIV-1 genome. However, testing all potentially mutagenic compounds in cell-based assays is tedious and costly. Here, we describe two simple in vitro biophysical/biochemical assays that allow prediction of the mutagenic potential of deoxyribonucleoside analogues. The first assay compares the thermal stabilities of matched and mismatched base pairs in DNA duplexes containing or not the nucleoside analogues as follows. A promising candidate should display a small destabilization of the matched base pair compared with the natural nucleoside and the smallest gap possible between the stabilities of the matched and mismatched base pairs. From this assay, we predicted that two of our compounds, 5-hydroxymethyl-2′-deoxyuridine and 5-hydroxymethyl-2′-deoxycytidine, should be mutagenic. The second in vitro reverse transcription assay assesses DNA synthesis opposite nucleoside analogues inserted into a template strand and subsequent extension of the newly synthesized base pairs. Once again, only 5-hydroxymethyl-2′-deoxyuridine and 5-hydroxymethyl-2′-deoxycytidine are predicted to be efficient mutagens. The predictive potential of our fast and easy first line screens was confirmed by detailed analysis of the mutation spectrum induced by the compounds in cell culture because only compounds 5-hydroxymethyl-2′-deoxyuridine and 5-hydroxymethyl-2′-deoxycytidine were found to increase the mutation frequency by 3.1- and 3.4-fold, respectively. PMID:25398876
Evaluation of anti-HIV-1 mutagenic nucleoside analogues.
Vivet-Boudou, Valérie; Isel, Catherine; El Safadi, Yazan; Smyth, Redmond P; Laumond, Géraldine; Moog, Christiane; Paillart, Jean-Christophe; Marquet, Roland
2015-01-02
Because of their high mutation rates, RNA viruses and retroviruses replicate close to the threshold of viability. Their existence as quasi-species has pioneered the concept of "lethal mutagenesis" that prompted us to synthesize pyrimidine nucleoside analogues with antiviral activity in cell culture consistent with an accumulation of deleterious mutations in the HIV-1 genome. However, testing all potentially mutagenic compounds in cell-based assays is tedious and costly. Here, we describe two simple in vitro biophysical/biochemical assays that allow prediction of the mutagenic potential of deoxyribonucleoside analogues. The first assay compares the thermal stabilities of matched and mismatched base pairs in DNA duplexes containing or not the nucleoside analogues as follows. A promising candidate should display a small destabilization of the matched base pair compared with the natural nucleoside and the smallest gap possible between the stabilities of the matched and mismatched base pairs. From this assay, we predicted that two of our compounds, 5-hydroxymethyl-2'-deoxyuridine and 5-hydroxymethyl-2'-deoxycytidine, should be mutagenic. The second in vitro reverse transcription assay assesses DNA synthesis opposite nucleoside analogues inserted into a template strand and subsequent extension of the newly synthesized base pairs. Once again, only 5-hydroxymethyl-2'-deoxyuridine and 5-hydroxymethyl-2'-deoxycytidine are predicted to be efficient mutagens. The predictive potential of our fast and easy first line screens was confirmed by detailed analysis of the mutation spectrum induced by the compounds in cell culture because only compounds 5-hydroxymethyl-2'-deoxyuridine and 5-hydroxymethyl-2'-deoxycytidine were found to increase the mutation frequency by 3.1- and 3.4-fold, respectively. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Schnier, Paul D.; Klassen, John S.; Strittmatter, Eric F.; Williams*, Evan R.
2005-01-01
The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)23−, (CCGG)23−, (AATTAAT)23−, (CCGGCCG)23−, A7·T73−, A7·A73−, T7·T73−, and A7·C73− were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 1013 to 1019 s−1. Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a – base) and w ions. Four pieces of evidence are presented which indicate that Watson–Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A7·T73−, to the single strands is significantly higher than that for the related noncomplementary A7·A73− and T7·T73− dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A7·A73− and A7·C73− but not for A7·T73− consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (−ΔHd) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A7·T73− duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent. PMID:16498487
Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L
2015-03-01
Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.
G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*
Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang
2015-01-01
The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683
Lee, Joon-Hwa; Hwang, Geum-Sook; Choi, Byong-Seok
1999-01-01
The pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct] is one of the major photoproducts induced by UV irradiation of DNA and occurs at TpT sites. The (6–4) adduct is highly mutagenic and leads most often to a 3′ T → C transition with 85% replicating error frequency [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the specific 3′ T → C transition of the (6–4) adduct, we have used experimental NMR restraints and molecular dynamics to determine the solution structure of a (6–4)-lesion DNA decamer duplex that contains a mismatched base pair between the 3′ T residue and an opposed G residue. Normal Watson–Crick-type hydrogen bonding is retained at the 5′ T of the lesion site. The O2 carbonyl of the 3′ T residue forms hydrogen bonds with the imino and amino protons of the opposed G residue. This potential hydrogen bonding stabilizes the overall helix and restores the highly distorted conformation of the (6–4) adduct to the typical B-form-like DNA structure. This structural feature can explain the marked preference for the insertion of an A residue opposite the 5′ T and a G residue opposite the 3′ T of the (6–4) lesion during trans-lesion synthesis. Thus these insertions yield the predominant 3′ T → C transition. PMID:10359763
Solution structure of a modified 2′,5′-linked RNA hairpin involved in an equilibrium with duplex
Plevnik, Miha; Gdaniec, Zofia; Plavec, Janez
2005-01-01
The isomerization of phosphodiester functionality of nucleic acids from 3′,5′- to a less common 2′,5′-linkage influences the complex interplay of stereoelectronic effects that drive pseudorotational equilibrium of sugar rings and thus affect the conformational propensities for compact or more extended structures. The present study highlights the subtle balance of non-covalent forces at play in structural equilibrium of 2′,5′-linked RNA analogue, 3′-O-(2-methoxyethyl) substituted dodecamer *CG*CGAA*U*U*CG*CG, 3′-MOE-2′,5′-RNA, where all cytosines and uracils are methylated at C5. The NMR and UV spectroscopic studies have shown that 3′-MOE-2′,5′-RNA adopts both hairpin and duplex secondary structures, which are involved in a dynamic exchange that is slow on the NMR timescale and exhibits strand and salt concentration as well as pH dependence. Unusual effect of pH over a narrow physiological range is observed for imino proton resonances with exchange broadening observed at lower pH and relatively sharp lines observed at higher pH. The solution structure of 3′-MOE-2′,5′-RNA hairpin displays a unique and well-defined loop, which is stabilized by Watson–Crick A5·*U8 base pair and by n → π* stacking interactions of O4′ lone-pair electrons of A6 and *U8 with aromatic rings of A5 and *U7, respectively. In contrast, the stem region of 3′-MOE-2′,5′-RNA hairpin is more flexible. Our data highlight the important feature of backbone modifications that can have pronounced effects on interstrand association of nucleic acids. PMID:15788747
Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.
Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T
2016-05-05
Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.
Suresh, Gorle; Srinivasan, Harini; Nanda, Shivani; Priyakumar, U Deva
2016-06-21
Riboswitches are structured RNA motifs that control gene expression by sensing the concentrations of specific metabolites and make up a promising new class of antibiotic targets. S-Adenosylmethionine (SAM)-III riboswitch, mainly found in lactic acid bacteria, is involved in regulating methionine and SAM biosynthetic pathways. SAM-III riboswitch regulates the gene expression by switching the translation process on and off with respect to the absence and presence of the SAM ligand, respectively. In this study, an attempt is made to understand the key conformational transitions involved in ligand binding using atomistic molecular dynamics (MD) simulations performed in an explicit solvent environment. G26 is found to recognize the SAM ligand by forming hydrogen bonds, whereas the absence of the ligand leads to opening of the binding pocket. Consistent with experimental results, the absence of the SAM ligand weakens the base pairing interactions between the nucleobases that are part of the Shine-Dalgarno (SD) and anti-Shine-Dalgarno (aSD) sequences, which in turn facilitates recognition of the SD sequence by ribosomes. Detailed analysis reveals that a duplex-like structure formed by nucleotides from different parts of the RNA and the adenine base of the ligand is crucial for the stability of the completely folded state in the presence of the ligand. Previous experimental studies have shown that the SAM-III riboswitch exists in equilibrium between the unfolded and partially folded states in the absence of the ligand, which completely folds upon binding of the ligand. Comparison of the results presented here to the available experimental data indicates the structures obtained using the MD simulations resemble the partially folded state. Thus, this study provides a detailed understanding of the fully and partially folded structures of the SAM-III riboswitch in the presence and absence of the ligand, respectively. This study hypothesizes a dual role for the SAM ligand, which facilitates conformational switching between partially and fully folded states by forming a stable duplex-like structure and strengthening the interactions between SD and aSD nucleotides.
Nucleic acid nanomaterials: Silver-wired DNA
NASA Astrophysics Data System (ADS)
Auffinger, Pascal; Ennifar, Eric
2017-10-01
DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.
Water-evaporation reduction by duplex films: application to the human tear film.
Cerretani, Colin F; Ho, Nghia H; Radke, C J
2013-09-01
Water-evaporation reduction by duplex-oil films is especially important to understand the physiology of the human tear film. Secreted lipids, called meibum, form a duplex film that coats the aqueous tear film and purportedly reduces tear evaporation. Lipid-layer deficiency is correlated with the occurrence of dry-eye disease; however, in-vitro experiments fail to show water-evaporation reduction by tear-lipid duplex films. We review the available literature on water-evaporation reduction by duplex-oil films and outline the theoretical underpinnings of spreading and evaporation kinetics that govern behavior of these systems. A dissolution-diffusion model unifies the data reported in the literature and identifies dewetting of duplex films into lenses as a key challenge to obtaining significant evaporation reduction. We develop an improved apparatus for measuring evaporation reduction by duplex-oil films including simultaneous assessment of film coverage, stability, and temperature, all under controlled external mass transfer. New data reported in this study fit into the larger body of work conducted on water-evaporation reduction by duplex-oil films. Duplex-oil films of oxidized mineral oil/mucin (MOx/BSM), human meibum (HM), and bovine meibum (BM) reduce water evaporation by a dissolution-diffusion mechanism, as confirmed by agreement between measurement and theory. The water permeability of oxidized-mineral-oil duplex films agrees with those reported in the literature, after correction for the presence of mucin. We find that duplex-oil films of bovine and human meibum at physiologic temperature reduce water evaporation only 6-8% for a 100-nm film thickness pertinent to the human tear film. Comparison to in-vivo human tear-evaporation measurements is inconclusive because evaporation from a clean-water surface is not measured and because the mass-transfer resistance is not characterized. Copyright © 2013 Elsevier B.V. All rights reserved.
Tomori, Takahito; Miyatake, Yuya; Sato, Yuta; Kanamori, Takashi; Masaki, Yoshiaki; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji
2015-03-20
Synthesis of peptide nucleic acids (PNAs) is reported with new pyridazine-type nucleobases: 3-aminopyridazine (aPz) and 1-aminophthalazine (aPh) as cytosine analogs, and pyridazin-3-one (Pz(O)) and phthalazin-1-one (Ph(O)) as thymine analogs. The PNAs having an aPz or a Pz(O) formed duplexes with each complementary oligodeoxynucleotide forming a base pair with G or A, respectively, as evaluated by using UV melting analyses and circular dichroism (CD) spectra.
Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht
2008-01-01
Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387
Tanabe, Tomotaka; Funahashi, Tatsuya; Nakao, Hiroshi; Maki, Jun; Yamamoto, Shigeo
2013-08-01
High-affinity iron acquisition in Vibrio parahaemolyticus is mediated by the cognate siderophore vibrioferrin. We have previously reported that the vibrioferrin biosynthesis operon (pvsOp) is regulated at the transcriptional level by the iron-responsive repressor Fur (T. Tanabe, T. Funahashi, H. Nakao, S. Miyoshi, S. Shinoda, and S. Yamamoto, J. Bacteriol. 185:6938-6949, 2003). In this study, we identified the Fur-regulated small RNA RyhB and the RNA chaperone Hfq protein as additional regulatory proteins of vibrioferrin biosynthesis. We found that vibrioferrin production was greatly impaired in both the ryhB and hfq deletion mutants, and a TargetRNA search (http://snowwhite.wellesley.edu/targetRNA/index2.html) revealed that the 5'-untranslated region of pvsOp mRNA (pvsOp 5'-UTR) contains a potential base-pairing region required for the formation of the RyhB-pvsOp 5'-UTR duplex. An electrophoresis mobility shift assay indicated that RyhB can directly bind to the pvsOp 5'-UTR with the aid of Hfq. Rifampin chase experiments indicated that the half-life of pvsOp mRNA in the ryhB and hfq mutants was approximately 3-fold shorter than that in the parental strain, suggesting that both RyhB and Hfq are engaged in the stabilization of pvsOp mRNA. Chrome azurol S assays followed by electrophoresis mobility shift assays and rifampin chase experiments carried out for mutant strains indicated that base pairing between RyhB and the pvsOp 5'-UTR results in an increase in the stability of pvsOp mRNA, thereby leading to the promotion of vibrioferrin production. It is unprecedented that RyhB confers increased stability on a polycistronic mRNA involved in siderophore biosynthesis as a direct target.
Process for stabilizing dimensions of duplex stainless steels for service at elevated temperatures
Hull, Frederick C.; Tobin, John C.
1981-01-01
Duplex stainless steel materials containing austenite plus delta ferrite, are dimensionally stabilized by heating the material to a reaction temperature between about 1050.degree.-1450.degree. F. (566.degree.-788.degree. C.), holding it at this temperature during transformation of delta ferrite to austenite plus sigma phase, and subsequently heating to a reversion temperature between about 1625.degree.-1750.degree. F. (885.degree.-954.degree. C.), whereby the sigma phase transforms back to ferrite, but the austenite remains dispersed in the ferrite phase. Final controlled cooling permits transformation of ferrite to austenite plus sigma and, later, precipitation of carbides.
Wang, S; Kool, E T
1995-04-11
Described is a systematic study of the effects of varied backbone structure on the stabilities of pyr.pur.pyr triple helices. The effects were measured using six circular 34 base oligonucleotides containing DNA (D), RNA (R) and/or 2'-O-methyl-RNA (M) residues designed to bind a complementary single-stranded purine target strand by triple helix formation. Eighteen different backbone combinations were studied at pH 5.5 and 7.0 by optical melting experiments and the results compared with the stabilities of the corresponding Watson-Crick duplexes. When the target purine strand is DNA, all circles form pH-dependent triple helical complexes which are considerably stronger than the duplexes alone. When RNA is the target, five of the nine complexes studied are of the pH-dependent triplex type and the other four complexes are not significantly stronger than the corresponding duplexes. The results are useful in the design of the highest affinity ligands for single- and double-stranded DNAs and RNAs and also point out novel ways to engender DNA- or RNA-selective binding.
Effects of non-CpG site methylation on DNA thermal stability: a fluorescence study
Nardo, Luca; Lamperti, Marco; Salerno, Domenico; Cassina, Valeria; Missana, Natalia; Bondani, Maria; Tempestini, Alessia; Mantegazza, Francesco
2015-01-01
Cytosine methylation is a widespread epigenetic regulation mechanism. In healthy mature cells, methylation occurs at CpG dinucleotides within promoters, where it primarily silences gene expression by modifying the binding affinity of transcription factors to the promoters. Conversely, a recent study showed that in stem cells and cancer cell precursors, methylation also occurs at non-CpG pairs and involves introns and even gene bodies. The epigenetic role of such methylations and the molecular mechanisms by which they induce gene regulation remain elusive. The topology of both physiological and aberrant non-CpG methylation patterns still has to be detailed and could be revealed by using the differential stability of the duplexes formed between site-specific oligonucleotide probes and the corresponding methylated regions of genomic DNA. Here, we present a systematic study of the thermal stability of a DNA oligonucleotide sequence as a function of the number and position of non-CpG methylation sites. The melting temperatures were determined by monitoring the fluorescence of donor-acceptor dual-labelled oligonucleotides at various temperatures. An empirical model that estimates the methylation-induced variations in the standard values of hybridization entropy and enthalpy was developed. PMID:26354864
Deleavey, Glen F.; Watts, Jonathan K.; Alain, Tommy; Robert, Francis; Kalota, Anna; Aishwarya, Veenu; Pelletier, Jerry; Gewirtz, Alan M.; Sonenberg, Nahum; Damha, Masad J.
2010-01-01
We report that combining a DNA analog (2′F-ANA) with rigid RNA analogs [2′F-RNA and/or locked nucleic acid (LNA)] in siRNA duplexes can produce gene silencing agents with enhanced potency. The favored conformations of these two analogs are different, and combining them in a 1–1 pattern led to reduced affinity, whereas alternating short continuous regions of individual modifications increased affinity relative to an RNA:RNA duplex. Thus, the binding affinity at key regions of the siRNA duplex could be tuned by changing the pattern of incorporation of DNA-like and RNA-like nucleotides. These heavily or fully modified duplexes are active against a range of mRNA targets. Effective patterns of modification were chosen based on screens using two sequences targeting firefly luciferase. We then applied the most effective duplex designs to the knockdown of the eIF4E binding proteins 4E-BP1 and 4E-BP2. We identified modified duplexes with potency comparable to native siRNA. Modified duplexes showed dramatically enhanced stability to serum nucleases, and were characterized by circular dichroism and thermal denaturation studies. Chemical modification significantly reduced the immunostimulatory properties of these siRNAs in human peripheral blood mononuclear cells. PMID:20413581
Andersen, Nicolai Krog; Døssing, Holger; Jensen, Frank; Vester, Birte; Nielsen, Poul
2011-08-05
5-(1-Phenyl-1,2,3-triazol-4-yl)-2'-deoxycytidine was synthesized from a modified CuAAC protocol and incorporated into mixed pyrimidine oligonucleotide sequences together with the corresponding 5-(1-phenyl-1,2,3-triazol-4-yl)-2'-deoxyuridine. With consecutive incorporations of the two modified nucleosides, improved duplex formation with a complementary RNA and improved triplex formation with a complementary DNA duplex were observed. The improvement is due to π-π stacking of the phenyl-triazole moieties in the major groove. The strongest stacking and most pronounced positive influence on thermal stability was found in between the uridine analogues or with the cytidine analogue placed in the 3' direction to the uridine analogue. Modeling indicated a different orientation of the phenyl-triazole moieties in the major groove to account for the difference between the two nucleotides. The modified oligonucleotides were all found to be significantly stabilized toward nucleolytic degration.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Man, Viet Hoang; Pan, Feng; Sagui, Celeste, E-mail: sagui@ncsu.edu
We explore the use of a fast laser melting simulation approach combined with atomistic molecular dynamics simulations in order to determine the melting and healing responses of B-DNA and Z-DNA dodecamers with the same d(5′-CGCGCGCGCGCG-3′){sub 2} sequence. The frequency of the laser pulse is specifically tuned to disrupt Watson-Crick hydrogen bonds, thus inducing melting of the DNA duplexes. Subsequently, the structures relax and partially refold, depending on the field strength. In addition to the inherent interest of the nonequilibrium melting process, we propose that fast melting by an infrared laser pulse could be used as a technique for a fastmore » comparison of relative stabilities of same-sequence oligonucleotides with different secondary structures with full atomistic detail of the structures and solvent. This could be particularly useful for nonstandard secondary structures involving non-canonical base pairs, mismatches, etc.« less
Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt
1998-01-01
This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668
Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation
Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin
2017-01-01
The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA–DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA–DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs. PMID:28484024
Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation.
Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin
2017-05-23
The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA-DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA-DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs.
Chip-to-Chip Half Duplex Spiking Data Communication over Power Supply Rails
NASA Astrophysics Data System (ADS)
Hashida, Takushi; Nagata, Makoto
Chip-to-chip serial data communication is superposed on power supply over common Vdd/Vss connections through chip, package, and board traces. A power line transceiver demonstrates half duplex spiking communication at more than 100Mbps. A pair of transceivers consumes 1.35mA from 3.3V, at 130Mbps. On-chip power line LC low pass filter attenuates pseudo-differential communication spikes by 30dB, purifying power supply current for internal circuits. Bi-directional spiking communication was successfully examined in a 90-nm CMOS prototype setup of on-chip waveform capturing. A micro controller forwards clock pulses to and receives data streams from a comparator based waveform capturer formed on a different chip, through a single pair of power and ground traces. The bit error rate is small enough not to degrade waveform acquisition capability, maintaining the spurious free dynamic range of higher than 50dB.
2015-01-01
DNA oxidation by reactive oxygen species is nonrandom, potentially leading to accumulation of nucleobase damage and mutations at specific sites within the genome. We now present the first quantitative data for sequence-dependent formation of structurally defined oxidative nucleobase adducts along p53 gene-derived DNA duplexes using a novel isotope labeling-based approach. Our results reveal that local nucleobase sequence context differentially alters the yields of 2,2,4-triamino-2H-oxal-5-one (Z) and 8-oxo-7,8-dihydro-2′-deoxyguanosine (OG) in double stranded DNA. While both lesions are overproduced within endogenously methylated MeCG dinucleotides and at 5′ Gs in runs of several guanines, the formation of Z (but not OG) is strongly preferred at solvent-exposed guanine nucleobases at duplex ends. Targeted oxidation of MeCG sequences may be caused by a lowered ionization potential of guanine bases paired with MeC and the preferential intercalation of riboflavin photosensitizer adjacent to MeC:G base pairs. Importantly, some of the most frequently oxidized positions coincide with the known p53 lung cancer mutational “hotspots” at codons 245 (GGC), 248 (CGG), and 158 (CGC) respectively, supporting a possible role of oxidative degradation of DNA in the initiation of lung cancer. PMID:24571128
Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo
2011-01-01
To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642
Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo
2011-04-01
To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.
Zeglis, Brian M.; Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.
2009-01-01
Two crystal structures are determined for Δ-Rh(bpy)2(chrysi)3+ (chrysi = 5,6-chrysenequinone diimine) bound to the oligonucleotide duplex 5′-CGGAAATTACCG-3′ containing two adenosine-adenosine mismatches (italics) through metalloinsertion. Diffraction quality crystals with two different space groups (P3221 and P43212) were obtained under very similar crystallization conditions. In both structures, the bulky rhodium complex inserts into the two mismatched sites from the minor groove side, ejecting the mismatched bases into the major groove. The conformational changes are localized to the mismatched site; the metal complex replaces the mismatched base pair without an increase in base pair rise. The expansive metal complex is accommodated in the duplex by a slight opening in the phosphodiester backbone; all sugars retain a C2′-endo puckering, and flanking base pairs neither stretch nor shear. The structures differ, however, in that in one of the structures, an additional metal complex is bound by intercalation from the major groove at the central 5′-AT-3′ step. We conclude that this additional metal complex is intercalated into this central step because of crystal packing forces. The structures described here of Δ-Rh(bpy)2(chrysi)3+ bound to thermodynamically destabilized AA mismatches share critical features with binding by metalloinsertion in two other oligonucleotides containing different single base mismatches. These results underscore the generality of the metalloinsertion as a new mode of non-covalent binding by small molecules with a DNA duplex. PMID:19374348
Experience with duplex bearings in narrow angle oscillating applications
NASA Technical Reports Server (NTRS)
Phinney, D. D.; Pollard, C. L.; Hinricks, J. T.
1988-01-01
Duplex ball bearings are matched pairs on which the abutting faces of the rings have been accurately ground so that when the rings are clamped together, a controlled amount of interference (preload) exists across the balls. These bearings are vulnerable to radial temperature gradients, blocking in oscillation and increased sensitivity to contamination. These conditions decrease the service life of these bearings. It was decided that an accelerated thermal vacuum life test should be conducted. The test apparatus and results are described and the rationale is presented for reducing a multiyear life test on oil lubricated bearings to less than a year.
Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).
Schneider, Uffe Vest
2012-01-01
This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.
Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella
2017-02-23
Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.
RNA major groove modifications improve siRNA stability and biological activity
Terrazas, Montserrat; Kool, Eric T.
2009-01-01
RNA 5-methyl and 5-propynyl pyrimidine analogs were substituted into short interfering RNAs (siRNAs) to probe major groove steric effects in the active RNA-induced silencing complex (RISC). Synthetic RNA guide strands containing varied combinations of propynyl and methyl substitution revealed that all C-5 substitutions increased the thermal stability of siRNA duplexes containing them. Cellular gene suppression experiments using luciferase targets in HeLa cells showed that the bulky 5-propynyl modification was detrimental to RNA interference activity, despite its stabilization of the helix. Detrimental effects of this substitution were greatest at the 5′-half of the guide strand, suggesting close steric approach of proteins in the RISC complex with that end of the siRNA/mRNA duplex. However, substitutions with the smaller 5-methyl group resulted in gene silencing activities comparable to or better than that of wild-type siRNA. The major groove modifications also increased the serum stability of siRNAs. PMID:19042976
Achievable degrees of freedom of MIMO two-way relay interference channel with delayed CSIT
NASA Astrophysics Data System (ADS)
Li, Qingyun; Wu, Gang; Li, Shaoqian
2016-10-01
In this paper, assuming each node has delayed channel state information at the transmitter (CSIT), we investigate the achievable degrees of freedom (DOF) of MIMO two-way relay interference channel in frequency division duplex (FDD) systems, where there are K user pairs (i.e., 2K users) and each user in a user pair exchanges messages with the other user in the same user pair simultaneously via an intermediate relay. We propose a two-stage transmission scheme and derive the closed-form expressions for its achievable DOF.
Photophysical Characterization of Enhanced 6-Methylisoxanthopterin Fluorescence in Duplex DNA.
Moreno, Andrew; Knee, J L; Mukerji, Ishita
2016-12-08
The structure and dynamic motions of bases in DNA duplexes and other constructs are important for understanding mechanisms of selectivity and recognition of DNA-binding proteins. The fluorescent guanine analogue, 6-methylisoxanthopterin 6-MI, is well suited to this purpose as it exhibits an unexpected 3- to 4-fold increase in relative quantum yield upon duplex formation when incorporated into the following sequences: ATFAA, AAFTA, or ATFTA (where F represents 6-MI). To better understand some of the factors leading to the 6-MI fluorescence increase upon duplex formation, we characterized the effect of local sequence and structural perturbations on 6-MI photophysics through temperature melts, quantum yield measurements, fluorescence quenching assays, and fluorescence lifetime measurements. By examining 21 sequences we have determined that the duplex-enhanced fluorescence (DEF) depends on the composition of bases adjacent to 6-MI and the presence of adenines at locations n ± 2 from the probe. Investigation of duplex stability and local solvent accessibility measurements support a model in which the DEF arises from a constrained geometry of 6-MI in the duplex, which remains H-bonded to cytosine, stacked with adjacent bases and inaccessible to quenchers. Perturbation of DNA structure through the introduction of an unpaired base 3' to 6-MI or a mismatched basepair increases 6-MI dynamic motion leading to fluorescence quenching and a reduction in quantum yield. Molecular dynamics simulations suggest the enhanced fluorescence results from a greater degree of twist at the X-F step relative to the quenched duplexes examined. These results point to a model where adenine residues located at n ± 2 from 6-MI induce a structural geometry with greater twist in the duplex that hinders local motion reducing dynamic quenching and producing an increase in 6-MI fluorescence.
NASA Astrophysics Data System (ADS)
Konforti, Boyana B.; Davis, Ronald W.
1987-02-01
The RecA protein of Escherichia coli is important for genetic recombination in vivo and can promote synapsis and strand exchange in vitro. The DNA pairing and strand exchange reactions have been well characterized in reactions with circular single strands and linear duplexes, but little is known about these two processes using substrates more characteristic of those likely to exist in the cell. Single-stranded linear DNAs were prepared by separating strands of duplex molecules or by cleaving single-stranded circles at a unique restriction site created by annealing a short defined oligonucleotide to the circle. Analysis by gel electrophoresis and electron microscopy revealed that, in the presence of RecA and single-stranded binding proteins, a free 3' homologous end is essential for stable joint molecule formation between linear single-stranded and circular duplex DNA.
McManus, Hilary A; Sanchez, Daniel J; Karol, Kenneth G
2017-01-01
Comparative studies of chloroplast genomes (plastomes) across the Chlorophyceae are revealing dynamic patterns of size variation, gene content, and genome rearrangements. Phylogenomic analyses are improving resolution of relationships, and uncovering novel lineages as new plastomes continue to be characterized. To gain further insight into the evolution of the chlorophyte plastome and increase the number of representative plastomes for the Sphaeropleales, this study presents two fully sequenced plastomes from the green algal family Hydrodictyaceae (Sphaeropleales, Chlorophyceae), one from Hydrodictyon reticulatum and the other from Pediastrum duplex . Genomic DNA from Hydrodictyon reticulatum and Pediastrum duplex was subjected to Illumina paired-end sequencing and the complete plastomes were assembled for each. Plastome size and gene content were characterized and compared with other plastomes from the Sphaeropleales. Homology searches using BLASTX were used to characterize introns and open reading frames (orfs) ≥ 300 bp. A phylogenetic analysis of gene order across the Sphaeropleales was performed. The plastome of Hydrodictyon reticulatum is 225,641 bp and Pediastrum duplex is 232,554 bp. The plastome structure and gene order of H. reticulatum and P. duplex are more similar to each other than to other members of the Sphaeropleales. Numerous unique open reading frames are found in both plastomes and the plastome of P. duplex contains putative viral protein genes, not found in other Sphaeropleales plastomes. Gene order analyses support the monophyly of the Hydrodictyaceae and their sister relationship to the Neochloridaceae. The complete plastomes of Hydrodictyon reticulatum and Pediastrum duplex , representing the largest of the Sphaeropleales sequenced thus far, once again highlight the variability in size, architecture, gene order and content across the Chlorophyceae. Novel intron insertion sites and unique orfs indicate recent, independent invasions into each plastome, a hypothesis testable with an expanded plastome investigation within the Hydrodictyaceae.
Functional Architecture of T7 RNA Polymerase Transcription Complexes
Nayak, Dhananjaya; Guo, Qing; Sousa, Rui
2007-01-01
Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086
Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.
Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I
1998-01-01
The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977
Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.
Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I
1998-02-01
The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.
Marathias, V M; Sawicki, M J; Bolton, P H
1999-07-15
The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.
Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.
2009-01-01
Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246
Programmable energy landscapes for kinetic control of DNA strand displacement.
Machinek, Robert R F; Ouldridge, Thomas E; Haley, Natalie E C; Bath, Jonathan; Turberfield, Andrew J
2014-11-10
DNA is used to construct synthetic systems that sense, actuate, move and compute. The operation of many dynamic DNA devices depends on toehold-mediated strand displacement, by which one DNA strand displaces another from a duplex. Kinetic control of strand displacement is particularly important in autonomous molecular machinery and molecular computation, in which non-equilibrium systems are controlled through rates of competing processes. Here, we introduce a new method based on the creation of mismatched base pairs as kinetic barriers to strand displacement. Reaction rate constants can be tuned across three orders of magnitude by altering the position of such a defect without significantly changing the stabilities of reactants or products. By modelling reaction free-energy landscapes, we explore the mechanistic basis of this control mechanism. We also demonstrate that oxDNA, a coarse-grained model of DNA, is capable of accurately predicting and explaining the impact of mismatches on displacement kinetics.
Tetrahelical monomolecular architecture of DNA: a new building block for nanotechnology.
Kankia, Besik
2014-06-12
DNA nanotechnology typically relies on Watson-Crick base pairing as both a recognition and structural element. This limits structural versatility and introduces errors during self-assembly of DNA. Guanine (G) quartet motifs show promise as an alternative to DNA duplexes, but the synthesis of long, precisely defined molecules is a significant challenge. Here we demonstrate a continuous tetrahelical DNA architecture capable of programmed self-assembly. We report that the homopolymer consisting of (G3T)3G3 monomeric units has the capability to fold into a monomolecular DNA tetrahelix with unprecedented speed and stability. For instance, in the presence of 1 mM K(+) ions the dimer, (G3T)2, folds readily and melts above 100 °C. These findings have the potential to revolutionize DNA nanotechnology by introducing fast and error-free self-assembly of long and extraordinarily stable molecules.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hong Junmei; Wei Na; Chalk, Alistair
RISC (RNA-induced silencing complex) is a central protein complex in RNAi, into which a siRNA strand is assembled to become effective in gene silencing. By using an in vitro RNAi reaction based on Drosophila embryo extract, an asymmetric model was recently proposed for RISC assembly of siRNA strands, suggesting that the strand that is more loosely paired at its 5' end is selectively assembled into RISC and results in target gene silencing. However, in the present study, we were unable to establish such a correlation in cell-based RNAi assays, as well as in large-scale RNAi data analyses. This suggests thatmore » the thermodynamic stability of siRNA is not a major determinant of gene silencing in mammalian cells. Further studies on fork siRNAs showed that mismatch at the 5' end of the siRNA sense strand decreased RISC assembly of the antisense strand, but surprisingly did not increase RISC assembly of the sense strand. More interestingly, measurements of melting temperature showed that the terminal stability of fork siRNAs correlated with the positions of the mismatches, but not gene silencing efficacy. In summary, our data demonstrate that there is no definite correlation between siRNA stability and gene silencing in mammalian cells, which suggests that instead of thermodynamic stability, other features of the siRNA duplex contribute to RISC assembly in RNAi.« less
Focusing on RISC assembly in mammalian cells.
Hong, Junmei; Wei, Na; Chalk, Alistair; Wang, Jue; Song, Yutong; Yi, Fan; Qiao, Ren-Ping; Sonnhammer, Erik L L; Wahlestedt, Claes; Liang, Zicai; Du, Quan
2008-04-11
RISC (RNA-induced silencing complex) is a central protein complex in RNAi, into which a siRNA strand is assembled to become effective in gene silencing. By using an in vitro RNAi reaction based on Drosophila embryo extract, an asymmetric model was recently proposed for RISC assembly of siRNA strands, suggesting that the strand that is more loosely paired at its 5' end is selectively assembled into RISC and results in target gene silencing. However, in the present study, we were unable to establish such a correlation in cell-based RNAi assays, as well as in large-scale RNAi data analyses. This suggests that the thermodynamic stability of siRNA is not a major determinant of gene silencing in mammalian cells. Further studies on fork siRNAs showed that mismatch at the 5' end of the siRNA sense strand decreased RISC assembly of the antisense strand, but surprisingly did not increase RISC assembly of the sense strand. More interestingly, measurements of melting temperature showed that the terminal stability of fork siRNAs correlated with the positions of the mismatches, but not gene silencing efficacy. In summary, our data demonstrate that there is no definite correlation between siRNA stability and gene silencing in mammalian cells, which suggests that instead of thermodynamic stability, other features of the siRNA duplex contribute to RISC assembly in RNAi.
Explicit ions/implicit water generalized Born model for nucleic acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolokh, Igor S.; Thomas, Dennis G.; Onufriev, Alexey V.
Ion atmosphere around highly charged nucleic acid molecules plays a significant role in their dynamics, structure and interactions. Here we utilized the implicit solvent framework to develop a model for the explicit treatment of ions interacting with nucleic acid molecules. The proposed explicit ions/implicit water model is based on a significantly modified generalized Born (GB) model, and utilizes a non-standard approach to defining the solute/solvent dielectric boundary. Specifically, the model includes modifications to the GB interaction terms for the case of multiple interacting solutes – disconnected dielectric boundary around the solute-ion or ion-ion pairs. Fully analytical description of all energymore » components for charge-charge interactions is provided. The effectiveness of the approach is demonstrated by calculating the potential of mean force (PMF) for Na+-Cl− ion pair and by carrying out a set of Monte Carlo (MC) simulations of mono- and trivalent ions interacting with DNA and RNA duplexes. The monovalent (Na+) and trivalent (CoHex3+) counterion distributions predicted by the model are in close quantitative agreement with all-atom explicit water molecular dynamics simulations used as reference. Expressed in the units of energy, the maximum deviations of local ion concentrations from the reference are within kBT. The proposed explicit ions/implicit water GB model is able to resolve subtle features and differences of CoHex distributions around DNA and RNA duplexes. These features include preferential CoHex binding inside the major groove of RNA duplex, in contrast to CoHex biding at the "external" surface of the sugar-phosphate backbone of DNA duplex; these differences in the counterion binding patters were shown earlier to be responsible for the observed drastic differences in condensation propensities between short DNA and RNA duplexes. MC simulations of CoHex ions interacting with homopolymeric poly(dA·dT) DNA duplex with modified (de-methylated) and native Thymine bases are used to explore the physics behind CoHex-Thymine interactions. The simulations suggest that the ion desolvation penalty due to proximity to the low dielectric volume of the methyl group can contribute significantly to CoHex-Thymine interactions. Compared to the steric repulsion between the ion and the methyl group, the desolvation penalty interaction has a longer range, and may be important to consider in the context of methylation effects on DNA condensation.« less
Explicit ions/implicit water generalized Born model for nucleic acids
NASA Astrophysics Data System (ADS)
Tolokh, Igor S.; Thomas, Dennis G.; Onufriev, Alexey V.
2018-05-01
The ion atmosphere around highly charged nucleic acid molecules plays a significant role in their dynamics, structure, and interactions. Here we utilized the implicit solvent framework to develop a model for the explicit treatment of ions interacting with nucleic acid molecules. The proposed explicit ions/implicit water model is based on a significantly modified generalized Born (GB) model and utilizes a non-standard approach to define the solute/solvent dielectric boundary. Specifically, the model includes modifications to the GB interaction terms for the case of multiple interacting solutes—disconnected dielectric boundary around the solute-ion or ion-ion pairs. A fully analytical description of all energy components for charge-charge interactions is provided. The effectiveness of the approach is demonstrated by calculating the potential of mean force for Na+-Cl- ion pair and by carrying out a set of Monte Carlo (MC) simulations of mono- and trivalent ions interacting with DNA and RNA duplexes. The monovalent (Na+) and trivalent (CoHex3+) counterion distributions predicted by the model are in close quantitative agreement with all-atom explicit water molecular dynamics simulations used as reference. Expressed in the units of energy, the maximum deviations of local ion concentrations from the reference are within kBT. The proposed explicit ions/implicit water GB model is able to resolve subtle features and differences of CoHex distributions around DNA and RNA duplexes. These features include preferential CoHex binding inside the major groove of the RNA duplex, in contrast to CoHex biding at the "external" surface of the sugar-phosphate backbone of the DNA duplex; these differences in the counterion binding patters were earlier shown to be responsible for the observed drastic differences in condensation propensities between short DNA and RNA duplexes. MC simulations of CoHex ions interacting with the homopolymeric poly(dA.dT) DNA duplex with modified (de-methylated) and native thymine bases are used to explore the physics behind CoHex-thymine interactions. The simulations suggest that the ion desolvation penalty due to proximity to the low dielectric volume of the methyl group can contribute significantly to CoHex-thymine interactions. Compared to the steric repulsion between the ion and the methyl group, the desolvation penalty interaction has a longer range and may be important to consider in the context of methylation effects on DNA condensation.
An integrated, structure- and energy-based view of the genetic code.
Grosjean, Henri; Westhof, Eric
2016-09-30
The principles of mRNA decoding are conserved among all extant life forms. We present an integrative view of all the interaction networks between mRNA, tRNA and rRNA: the intrinsic stability of codon-anticodon duplex, the conformation of the anticodon hairpin, the presence of modified nucleotides, the occurrence of non-Watson-Crick pairs in the codon-anticodon helix and the interactions with bases of rRNA at the A-site decoding site. We derive a more information-rich, alternative representation of the genetic code, that is circular with an unsymmetrical distribution of codons leading to a clear segregation between GC-rich 4-codon boxes and AU-rich 2:2-codon and 3:1-codon boxes. All tRNA sequence variations can be visualized, within an internal structural and energy framework, for each organism, and each anticodon of the sense codons. The multiplicity and complexity of nucleotide modifications at positions 34 and 37 of the anticodon loop segregate meaningfully, and correlate well with the necessity to stabilize AU-rich codon-anticodon pairs and to avoid miscoding in split codon boxes. The evolution and expansion of the genetic code is viewed as being originally based on GC content with progressive introduction of A/U together with tRNA modifications. The representation we present should help the engineering of the genetic code to include non-natural amino acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Multilayer checkpoints for microRNA authenticity during RISC assembly.
Kawamata, Tomoko; Yoda, Mayuko; Tomari, Yukihide
2011-09-01
MicroRNAs (miRNAs) function through the RNA-induced silencing complex (RISC), which contains an Argonaute (Ago) protein at the core. RISC assembly follows a two-step pathway: miRNA/miRNA* duplex loading into Ago, and separation of the two strands within Ago. Here we show that the 5' phosphate of the miRNA strand is essential for duplex loading into Ago, whereas the preferred 5' nucleotide of the miRNA strand and the base-pairing status in the seed region and the middle of the 3' region function as additive anchors to Ago. Consequently, the miRNA authenticity is inspected at multiple steps during RISC assembly.
TAPIR, a web server for the prediction of plant microRNA targets, including target mimics.
Bonnet, Eric; He, Ying; Billiau, Kenny; Van de Peer, Yves
2010-06-15
We present a new web server called TAPIR, designed for the prediction of plant microRNA targets. The server offers the possibility to search for plant miRNA targets using a fast and a precise algorithm. The precise option is much slower but guarantees to find less perfectly paired miRNA-target duplexes. Furthermore, the precise option allows the prediction of target mimics, which are characterized by a miRNA-target duplex having a large loop, making them undetectable by traditional tools. The TAPIR web server can be accessed at: http://bioinformatics.psb.ugent.be/webtools/tapir. Supplementary data are available at Bioinformatics online.
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.
mRNA–mRNA duplexes that auto-elicit Staufen1-mediated mRNA decay
Gong, Chenguang; Tang, Yalan; Maquat, Lynne E.
2013-01-01
We report a new mechanism by which human mRNAs crosstalk: an Alu element in the 3'-untranslated region (3' UTR) of one mRNA can base-pair with a partially complementary Alu element in the 3' UTR of a different mRNA thereby creating a Staufen1 (STAU1)-binding site (SBS). STAU1 binding to a 3' UTR SBS was previously shown to trigger STAU1-mediated mRNA decay (SMD) by directly recruiting the ATP-dependent RNA helicase UPF1, which is also a key factor in the mechanistically related nonsense-mediated mRNA decay (NMD) pathway. In the case of a 3' UTR SBS created via mRNA–mRNA base-pairing, we show that SMD targets both mRNAs in the duplex provided that both mRNAs are translated. If only one mRNA is translated, then it alone is targeted for SMD. We demonstrate the importance of mRNA–mRNA-triggered SMD to the processes of cell migration and invasion. PMID:24056942
Makiguchi, Wataru; Tanabe, Junki; Yamada, Hidekazu; Iida, Hiroki; Taura, Daisuke; Ousaka, Naoki; Yashima, Eiji
2015-01-01
Self-recognition and self-discrimination within complex mixtures are of fundamental importance in biological systems, which entirely rely on the preprogrammed monomer sequences and homochirality of biological macromolecules. Here we report artificial chirality- and sequence-selective successive self-sorting of chiral dimeric strands bearing carboxylic acid or amidine groups joined by chiral amide linkers with different sequences through homo- and complementary-duplex formations. A mixture of carboxylic acid dimers linked by racemic-1,2-cyclohexane bis-amides with different amide sequences (NHCO or CONH) self-associate to form homoduplexes in a completely sequence-selective way, the structures of which are different from each other depending on the linker amide sequences. The further addition of an enantiopure amide-linked amidine dimer to a mixture of the racemic carboxylic acid dimers resulted in the formation of a single optically pure complementary duplex with a 100% diastereoselectivity and complete sequence specificity stabilized by the amidinium–carboxylate salt bridges, leading to the perfect chirality- and sequence-selective duplex formation. PMID:26051291
2015-01-01
The dimensions and arrangements of aromatic rings (topology) in adducts derived from the reactions of polycyclic aromatic hydrocarbon (PAH) diol epoxide metabolites with DNA influence the distortions and stabilities of double-stranded DNA, and hence their recognition and processing by the human nucleotide excision repair (NER) system. Dibenzo[a,l]pyrene (DB[a,l]P) is a highly tumorigenic six-ring PAH, which contains a nonplanar and aromatic fjord region that is absent in the structurally related bay region five-ring PAH benzo[a]pyrene (B[a]P). The PAH diol epoxide–DNA adducts formed include the stereoisomeric 14S and 14Rtrans-anti-DB[a,l]P-N2-dG and the stereochemically analogous 10S- and 10R-B[a]P-N2-dG (B[a]P-dG) guanine adducts. However, nuclear magnetic resonance (NMR) solution studies of the 14S-DB[a,l]P-N2-dG adduct in DNA have not yet been presented. Here we have investigated the 14S-DB[a,l]P-N2-dG adduct in two different sequence contexts using NMR methods with distance-restrained molecular dynamics simulations. In duplexes with dC opposite the adduct deleted, a well-resolved base-displaced intercalative adduct conformation can be observed. In full duplexes, in contrast to the intercalated 14R stereoisomeric adduct, the bulky DB[a,l]P residue in the 14S adduct is positioned in a greatly widened and distorted minor groove, with significant disruptions and distortions of base pairing at the lesion site and two 5′-side adjacent base pairs. These unique structural features are significantly different from those of the stereochemically analogous but smaller B[a]P-dG adduct. The greater size and different topology of the DB[a,l]P aromatic ring system lead to greater structurally destabilizing DNA distortions that are partially compensated by stabilizing DB[a,l]P-DNA van der Waals interactions, whose combined effects impact the NER response to the adduct. These structural results broaden our understanding of the structure–function relationship in NER. PMID:24617538
Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J
2001-06-01
A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)<==>(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)<==>(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition, 55 NMR-derived backbone dihedral constraints per strand were used for both structures. The main effect of the Hoogsteen basepairs in (1B) on the overall structure is a narrowing of the minor groove and a corresponding widening of the major groove. The Hoogsteen basepairing at the central A6:T7 basepairs in (1B) has enforced a syn conformation on the glycosyl torsion of the 2'-deoxyaristeromycin moiety, A6, as a result of substitution of the endocyclic 4'-oxygen in the natural sugar with a methylene group in A6. A comparison of the Watson-Crick basepaired duplex (1A) to the Hoogsteen basepaired duplex (1B) shows that only a few changes, mainly in alpha, sigma and gamma torsions, in the sugar-phosphate backbone seem to be necessary to accommodate the Hoogsteen basepair.
Thermal Stability of RNA Structures with Bulky Cations in Mixed Aqueous Solutions.
Nakano, Shu-Ichi; Tanino, Yuichi; Hirayama, Hidenobu; Sugimoto, Naoki
2016-10-04
Bulky cations are used to develop nucleic-acid-based technologies for medical and technological applications in which nucleic acids function under nonaqueous conditions. In this study, the thermal stability of RNA structures was measured in the presence of various bulky cations in aqueous mixtures with organic solvents or polymer additives. The stability of oligonucleotide, transfer RNA, and polynucleotide structures was decreased in the presence of salts of tetrabutylammonium and tetrapentylammonium ions, and the stability and salt concentration dependences were dependent on cation sizes. The degree to which stability was dependent on salt concentration was correlated with reciprocals of the dielectric constants of mixed solutions, regardless of interactions between the cosolutes and RNA. Our results show that organic solvents affect the strength of electrostatic interactions between RNA and cations. Analysis of ion binding to RNA indicated greater enhancement of cation binding to RNA single strands than to duplexes in media with low dielectric constants. Furthermore, background bulky ions changed the dependence of RNA duplex stability on the concentration of metal ion salts. These unique properties of large tetraalkylammonium ions are useful for controlling the stability of RNA structures and its sensitivity to metal ion salts. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Genotyping by alkaline dehybridization using graphically encoded particles.
Zhang, Huaibin; DeConinck, Adam J; Slimmer, Scott C; Doyle, Patrick S; Lewis, Jennifer A; Nuzzo, Ralph G
2011-03-01
This work describes a nonenzymatic, isothermal genotyping method based on the kinetic differences exhibited in the dehybridization of perfectly matched (PM) and single-base mismatched (MM) DNA duplexes in an alkaline solution. Multifunctional encoded hydrogel particles incorporating allele-specific oligonucleotide (ASO) probes in two distinct regions were fabricated by using microfluidic-based stop-flow lithography. Each particle contained two distinct ASO probe sequences differing at a single base position, and thus each particle was capable of simultaneously probing two distinct target alleles. Fluorescently labeled target alleles were annealed to both probe regions of a particle, and the rate of duplex dehybridization was monitored by using fluorescence microscopy. Duplex dehybridization was achieved through an alkaline stimulus using either a pH step function or a temporal pH gradient. When a single target probe sequence was used, the rate of mismatch duplex dehybridization could be discriminated from the rate of perfect match duplex dehybridization. In a more demanding application in which two distinct probe sequences were used, we found that the rate profiles provided a means to discriminate probe dehybridizations from both of the two mismatched duplexes as well as to distinguish at high certainty the dehybridization of the two perfectly matched duplexes. These results demonstrate an ability of alkaline dehybridization to correctly discriminate the rank hierarchy of thermodynamic stability among four sets of perfect match and single-base mismatch duplexes. We further demonstrate that these rate profiles are strongly temperature dependent and illustrate how the sensitivity can be compensated beneficially by the use of an actuating gradient pH field. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Jain, Deepak R; Anandi V, Libi; Lahiri, Mayurika; Ganesh, Krishna N
2014-10-17
Intrinsically cationic and chiral C(γ)-substituted peptide nucleic acid (PNA) analogues have been synthesized in the form of γ(S)-ethyleneamino (eam)- and γ(S)-ethyleneguanidino (egd)-PNA with two carbon spacers from the backbone. The relative stabilization (ΔTm) of duplexes from modified cationic PNAs as compared to 2-aminoethylglycyl (aeg)-PNA is better with complementary DNA (PNA:DNA) than with complementary RNA (PNA:RNA). Inherently, PNA:RNA duplexes have higher stability than PNA:DNA duplexes, and the guanidino PNAs are superior to amino PNAs. The cationic PNAs were found to be specific toward their complementary DNA target as seen from their significantly lower binding with DNA having single base mismatch. The differential binding avidity of cationic PNAs was assessed by the displacement of DNA duplex intercalated ethidium bromide and gel electrophoresis. The live cell imaging of amino/guanidino PNAs demonstrated their ability to penetrate the cell membrane in 3T3 and MCF-7 cells, and cationic PNAs were found to be accumulated in the vicinity of the nuclear membrane in the cytoplasm. Fluorescence-activated cell sorter (FACS) analysis of cell permeability showed the efficiency to be dependent upon the nature of cationic functional group, with guanidino PNAs being better than the amino PNAs in both cell lines. The results are useful to design new biofunctional cationic PNA analogues that not only bind RNA better but also show improved cell permeability.
Dutta, Udayan; Cohenford, Menashi A; Dain, Joel A
2007-01-15
Advanced glycation end products (AGEs) play a significant role in the pathophysiology of diabetes leading to such conditions as atherosclerosis, cataract formation, and renal dysfunction. While the formation of nucleoside AGEs was previously demonstrated, no extensive studies have been performed to assess the effect of AGEs on DNA structure and folding. The objective of this study was to investigate the nonenzymatic glycation of two DNA oligonucleotide duplexes with one duplex consisting of deoxy-poly(A)15 and deoxy-poly(T)15 and the other consisting of deoxy-poly(GA)15 and deoxy-poly(CT)15. With D-glucose, D-galactose, D/L-glyceraldehyde, and D-glucosamine serving as the model glycating carbohydrates, D-glucosamine was found to exhibit the greatest effect on the stability and structure of the oligonucleotide duplexes, a finding that was confirmed by circular dichroism. The nonenzymatic glycation of deoxy-poly(AT) by D-glucosamine destabilized the deoxy-poly(AT) structure and changed its conformation from A form to X form. D-glucosamine also altered the conformation of deoxy-poly(GA)15 and deoxy-poly(CT)15 from A form to B form. Capillary electrophoresis and ultraviolet and fluorescence spectroscopy revealed that, of the various purines and pyrimidines, 2'-deoxyguanosine and guanine were most reactive with D-glucosamine. The nonenzymatic modification of nucleic acids warrants further investigation because this phenomenon may occur in vivo, altering DNA structure and/or function.
Funahashi, Tatsuya; Nakao, Hiroshi; Maki, Jun; Yamamoto, Shigeo
2013-01-01
High-affinity iron acquisition in Vibrio parahaemolyticus is mediated by the cognate siderophore vibrioferrin. We have previously reported that the vibrioferrin biosynthesis operon (pvsOp) is regulated at the transcriptional level by the iron-responsive repressor Fur (T. Tanabe, T. Funahashi, H. Nakao, S. Miyoshi, S. Shinoda, and S. Yamamoto, J. Bacteriol. 185:6938–6949, 2003). In this study, we identified the Fur-regulated small RNA RyhB and the RNA chaperone Hfq protein as additional regulatory proteins of vibrioferrin biosynthesis. We found that vibrioferrin production was greatly impaired in both the ryhB and hfq deletion mutants, and a TargetRNA search (http://snowwhite.wellesley.edu/targetRNA/index2.html) revealed that the 5′-untranslated region of pvsOp mRNA (pvsOp 5′-UTR) contains a potential base-pairing region required for the formation of the RyhB-pvsOp 5′-UTR duplex. An electrophoresis mobility shift assay indicated that RyhB can directly bind to the pvsOp 5′-UTR with the aid of Hfq. Rifampin chase experiments indicated that the half-life of pvsOp mRNA in the ryhB and hfq mutants was approximately 3-fold shorter than that in the parental strain, suggesting that both RyhB and Hfq are engaged in the stabilization of pvsOp mRNA. Chrome azurol S assays followed by electrophoresis mobility shift assays and rifampin chase experiments carried out for mutant strains indicated that base pairing between RyhB and the pvsOp 5′-UTR results in an increase in the stability of pvsOp mRNA, thereby leading to the promotion of vibrioferrin production. It is unprecedented that RyhB confers increased stability on a polycistronic mRNA involved in siderophore biosynthesis as a direct target. PMID:23772063
NASA Astrophysics Data System (ADS)
Moallemi, Mohammad; Zarei-Hanzaki, Abbas; Eskandari, Mostafa; Burrows, Andrew; Alimadadi, Hossein
2017-08-01
A new metastable Ni-free duplex stainless steel has been designed with superior plasticity by optimizing austenite stability using thermodynamic calculations of stacking fault energy and with reference to literature findings. Several characterization methods comprising optical microscopy, magnetic phase measurements, X-ray diffraction (XRD) and electron backscattered diffraction were employed to study the plastic deformation behavior and to identify the operating plasticity mechanisms. The results obtained show that the newly designed duplex alloy exhibits some extraordinary mechanical properties, including an ultimate tensile strength of 900 MPa and elongation to fracture of 94 pct due to the synergistic effects of transformation-induced plasticity and twinning-induced plasticity. The deformation mechanism of austenite is complex and includes deformation banding, strain-induced martensite formation, and deformation-induced twinning, while the ferrite phase mainly deforms by dislocation slip. Texture analysis indicates that the Copper and Rotated Brass textures in austenite (FCC phase) and {001}<110> texture in ferrite and martensite (BCC phases) are the main active components during tensile deformation. The predominance of these components is logically related to the strain-induced martensite and/or twin formation.
pH-independent triple-helix formation with 6-oxocytidine as cytidine analogue.
Parsch, U; Engels, J W
2000-07-03
The syntheses of six different phosphoramidite building blocks of 6-oxocytosine and 5-allyl-6-oxocytosine as analogues of N(3)-protonated cytosine are described. These compounds have been incorporated into oligonucleotides by standard solid-phase synthesis. Hybridization of 15-mer Hoogsteen strands with target 21-mer duplexes was investigated. Comparison of the triplex-forming abilities of the different building blocks revealed that: i) 5-allyl substitution has a negative influence on triplex stability, ii) a uniform backbone of the Hoogsteen strand stabilizes triplexes relative to mixed backbones; iii) RNA strands with 6-oxocytidine or 5-allyl-6-oxocytidine do not form a triple helix with the DNA target duplex, probably due to backbone torsional constraints; and (iv) a 15-mer DNA sequence with three isolated 2'-deoxy-6-oxocytidines has the highest T(m) of all cytidine analogues investigated in this study. CD experiments provided further evidence for the presence or absence of triplex structures. In the course of these temperature-dependent CD measurements we were able to detect duplex and triplex melting independent from each other at selected wavelengths. This methodology is especially interesting in cases where UV melting curves show only one transition owing to spectral overlap.
Thermodynamic and structural characterization of 2′-nitrogen-modified RNA duplexes
Pham, John W.; Radhakrishnan, Ishwar; Sontheimer, Erik J.
2004-01-01
2′-aminonucleosides are commonly used as sites of post-synthetic chemical modification within nucleic acids. As part of a larger cross-linking strategy, we appended alkyl groups onto the N2′ position of 2′-amino-modified RNAs via 2′-ureido and 2′-amido linkages. We have characterized the thermodynamics of 2′-amino, 2′-alkylamido and 2′-alkylureido-modified RNA duplexes and show that 2′-ureido-modified RNAs are significantly more stable than analogous 2′-amido-modified RNAs. Using NMR spectroscopy and NMR-based molecular modeling of 2′-modified RNA duplexes, we examined the effects that 2′-nitrogen modifications have on RNA helices. Our data suggest that the 2′-ureido group forms a specific intra-nucleoside interaction that cannot occur within 2′-amido-modified helices. These results indicate that 2′-ureido modifications are superior to analogous 2′-amido ones for applications that require stable base pairing. PMID:15247335
Multilayer checkpoints for microRNA authenticity during RISC assembly
Kawamata, Tomoko; Yoda, Mayuko; Tomari, Yukihide
2011-01-01
MicroRNAs (miRNAs) function through the RNA-induced silencing complex (RISC), which contains an Argonaute (Ago) protein at the core. RISC assembly follows a two-step pathway: miRNA/miRNA* duplex loading into Ago, and separation of the two strands within Ago. Here we show that the 5′ phosphate of the miRNA strand is essential for duplex loading into Ago, whereas the preferred 5′ nucleotide of the miRNA strand and the base-pairing status in the seed region and the middle of the 3′ region function as additive anchors to Ago. Consequently, the miRNA authenticity is inspected at multiple steps during RISC assembly. PMID:21738221
Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs
Shen, Xiulong; Corey, David R
2018-01-01
Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946
Willwand, K; Baldauf, A Q; Deleu, L; Mumtsidu, E; Costello, E; Beard, P; Rommelaere, J
1997-10-01
The right-end telomere of replicative form (RF) DNA of the autonomous parvovirus minute virus of mice (MVM) consists of a sequence that is self-complementary except for a three nucleotide loop around the axis of symmetry and an interior bulge of three unpaired nucleotides on one strand (designated the right-end 'bubble'). This right-end inverted repeat can exist in the form of a folded-back strand (hairpin conformation) or in an extended form, base-paired to a copy strand (duplex conformation). We recently reported that the right-end telomere is processed in an A9 cell extract supplemented with the MVM nonstructural protein NS1. This processing is shown here to result from the NS1-dependent nicking of the complementary strand at a unique position 21 nt inboard of the folded-back genomic 5' end. DNA species terminating in duplex or hairpin configurations, or in a mutated structure that has lost the right-end bulge, are all cleaved in the presence of NS1, indicating that features distinguishing these structures are not prerequisites for nicking under the in vitro conditions tested. Cleavage of the hairpin structure is followed by strand-displacement synthesis, generating the right-end duplex conformation, while processing of the duplex structure leads to the release of free right-end telomeres. In the majority of molecules, displacement synthesis at the right terminus stops a few nucleotides before reaching the end of the template strand, possibly due to NS1 which is covalently bound to this end. A fraction of the right-end duplex product undergoes melting and re-folding into hairpin structures (formation of a 'rabbit-ear' structure).
Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van
2012-01-01
A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744
Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van
2012-08-01
A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.
The Formation of Martensitic Austenite During Nitridation of Martensitic and Duplex Stainless Steels
NASA Astrophysics Data System (ADS)
Zangiabadi, Amirali; Dalton, John C.; Wang, Danqi; Ernst, Frank; Heuer, Arthur H.
2017-01-01
Isothermal martensite/ferrite-to-austenite phase transformations have been observed after low-temperature nitridation in the martensite and δ-ferrite phases in 15-5 PH (precipitation hardening), 17-7 PH, and 2205 (duplex) stainless steels. These transformations, in the region with nitrogen concentrations of 8 to 16 at. pct, are consistent with the notion that nitrogen is a strong austenite stabilizer and substitutional diffusion is effectively frozen at the paraequilibrium temperatures of our experiments. Our microstructural and diffraction analyses provide conclusive evidence for the martensitic nature of these phase transformations.
Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A
2018-02-01
Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.
Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W
1987-01-01
We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602
Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M
2017-05-19
In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
NASA Astrophysics Data System (ADS)
Xie, Fei; Zhang, Ge; Pan, Jianwei
2018-02-01
Thin cases and long treating time are shortcomings of conventional duplex treatment of aluminizing followed by nitriding (DTAN). Alternating current field (ACF) enhanced DTAN was carried out on AISI 1045 steel by applying an ACF to treated samples and treating agents with a pair of electrodes for overcoming those shortcomings. By investigating cases' structures, phases, composition and hardness distributions of differently treated samples, preliminary studies were made on characterizations of the ACF enhanced duplex treatment to AISI 1045 steel. The results show that, with the help of the ACF, the surface Al-rich phase Al5Fe2 formed in conventional pack aluminizing can be easily avoided and the aluminizing process is dramatically promoted. The aluminizing case can be nitrided either with conventional pack nitriding or ACF enhanced pack nitriding. By applying ACF to pack nitriding, the diffusion of nitrogen into the aluminizing case is promoted. AlN, Fe2∼3N and solid solution of N in iron are efficiently formed as a result of reactions of N with the aluminizing case. A duplex treated case with an effective thickness of more than 170 μm can be obtained by the alternating current field enhanced 4 h pack aluminizing plus 4 h pack nitriding.
Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K.
2017-01-01
Abstract In the canonical DNA double helix, Watson–Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02–0.4%) and short-lived (lifetimes ∼0.2–2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. PMID:28369571
Lee, Hui Sun; Lee, Soo Nam; Joo, Chul Hyun; Lee, Heuiran; Lee, Han Saem; Yoon, Seung Yong; Kim, Yoo Kyum; Choe, Han
2007-03-01
RNA interference (RNAi) is a 'knock-down' reaction to reduce expression of a specific gene through highly regulated, enzyme-mediated processes. Small interfering RNAs (siRNAs) are RNA molecules that play an effector role in RNAi and can bind the PAZ domains present in Dicer and RISC. We investigated the interaction between the PAZ domain and the siRNA-like duplexes through dissociation molecular dynamics (DMD) simulations. Specifically, we focused on the response of the PAZ domain to various 3'-overhang structures of the siRNA-like duplexes. We found that the siRNA-like duplex with the 3' UU-overhang made relatively more stable complex with the PAZ domain compared to those with 3' CC-, AA-, and GG-overhangs. The siRNA-like duplex with UU-overhang was easily dissociated from the PAZ domain once the structural stability of the complex is impaired. Interestingly, the 3' UU-overhang spent the least time at the periphery region of the binding pocket during the dissociation process, which can be mainly attributable to UU-overhang's smallest number of hydrogen bonds.
Mariappan, S V Santhana; Cheng, Xun; van Breemen, Richard B; Silks, Louis A; Gupta, Goutam
2004-11-15
The formation of a GAA/TTC DNA triplex has been implicated in Friedreich's ataxia. The destabilization of GAA/TTC DNA triplexes either by pH or by binding to appropriate ligands was analyzed by nuclear magnetic resonance (NMR) and positive-ion electrospray mass spectrometry. The triplexes and duplexes were identified by changes in the NMR chemical shifts of H8, H1, H4, 15N7, and 15N4. The lowest pH at which the duplex is detectable depends upon the overall stability and the relative number of Hoogsteen C composite function G to T composite function A basepairs. A melting pH (pHm) of 7.6 was observed for the destabilization of the (GAA)2T4(TTC)2T4(CTT)2 triplex to the corresponding Watson-Crick duplex and the T4(CTT)2 overhang. The mass spectrometric analyses of (TTC)6.(GAA)6 composite function(TTC)6 triplex detected ions due to both triplex and single-stranded oligonucleotides under acidic conditions. The triplex ions disappeared completely at alkaline pH. Duplex and single strands were detectable only at neutral and alkaline pH values. Mass spectrometric analyses also showed that minor groove-binding ligands berenil, netropsin, and distamycin and the intercalating ligand acridine orange destabilize the (TTC)6.(GAA)6 composite function (TTC)6 triplex. These NMR and mass spectrometric methods may function as screening assays for the discovery of agents that destabilize GAA/TTC triplexes and as general methods for the characterization of structure, dynamics, and stability of DNA and DNA-ligand complexes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Feng; Li, Feng; Ganguly, Manjori
2008-11-14
Site-specific insertion of t-(3-aminopropyl)-2'-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}T{sup 8}C{sup 9}{und Z}{sup 10}C{sup 11}G{sup 12})-3'{center_dot}5'-d (C{sup 13}G{sup 14}C{sup 15}G{sup 16}A{sup 17}A{sup 18}T{sup 19}T{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup Z10}) and 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}{und X}{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup 2+Z10}) (X = 73dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD{sup 2+Z10} duplex reveals that the tethered cations at base pairs A{supmore » 5}{center_dot}X{sup 20} and X{sup 8}{center_dot}A{sup 17} extend within the major groove in the 3'-direction, toward conserved Mg{sup 2+} binding sites located adjacent to N+2 base pairs C{sup 3}{center_dot}Z{sup 22} and Z{sup 10}{center_dot}C{sup 15}. Bridging waters located between the tethered amines and either Z{sup 10} or Z{sup 22} O{sup 6} stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD{sup 2+Z10} duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z{sup 10} O{sup 6} and Z{sup 22} O{sup 6}. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C{center_dot}G base pair, facilitating interstrand cross-linking.« less
New t-gap insertion-deletion-like metrics for DNA hybridization thermodynamic modeling.
D'yachkov, Arkadii G; Macula, Anthony J; Pogozelski, Wendy K; Renz, Thomas E; Rykov, Vyacheslav V; Torney, David C
2006-05-01
We discuss the concept of t-gap block isomorphic subsequences and use it to describe new abstract string metrics that are similar to the Levenshtein insertion-deletion metric. Some of the metrics that we define can be used to model a thermodynamic distance function on single-stranded DNA sequences. Our model captures a key aspect of the nearest neighbor thermodynamic model for hybridized DNA duplexes. One version of our metric gives the maximum number of stacked pairs of hydrogen bonded nucleotide base pairs that can be present in any secondary structure in a hybridized DNA duplex without pseudoknots. Thermodynamic distance functions are important components in the construction of DNA codes, and DNA codes are important components in biomolecular computing, nanotechnology, and other biotechnical applications that employ DNA hybridization assays. We show how our new distances can be calculated by using a dynamic programming method, and we derive a Varshamov-Gilbert-like lower bound on the size of some of codes using these distance functions as constraints. We also discuss software implementation of our DNA code design methods.
A metallo-DNA nanowire with uninterrupted one-dimensional silver array
NASA Astrophysics Data System (ADS)
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Hattori, Yoshikazu; Saneyoshi, Hisao; Ono, Akira; Tanaka, Yoshiyuki
2017-10-01
The double-helix structure of DNA, in which complementary strands reversibly hybridize to each other, not only explains how genetic information is stored and replicated, but also has proved very attractive for the development of nanomaterials. The discovery of metal-mediated base pairs has prompted the generation of short metal-DNA hybrid duplexes by a bottom-up approach. Here we describe a metallo-DNA nanowire—whose structure was solved by high-resolution X-ray crystallography—that consists of dodecamer duplexes held together by four different metal-mediated base pairs (the previously observed C-Ag-C, as well as G-Ag-G, G-Ag-C and T-Ag-T) and linked to each other through G overhangs involved in interduplex G-Ag-G. The resulting hybrid nanowires are 2 nm wide with a length of the order of micrometres to millimetres, and hold the silver ions in uninterrupted one-dimensional arrays along the DNA helical axis. The hybrid nanowires are further assembled into three-dimensional lattices by interactions between adenine residues, fully bulged out of the double helix.
DNA denaturation bubbles: free-energy landscape and nucleation/closure rates.
Sicard, François; Destainville, Nicolas; Manghi, Manoel
2015-01-21
The issue of the nucleation and slow closure mechanisms of non-superhelical stress-induced denaturation bubbles in DNA is tackled using coarse-grained MetaDynamics and Brownian simulations. A minimal mesoscopic model is used where the double helix is made of two interacting bead-spring rotating strands with a prescribed torsional modulus in the duplex state. We demonstrate that timescales for the nucleation (respectively, closure) of an approximately 10 base-pair bubble, in agreement with experiments, are associated with the crossing of a free-energy barrier of 22 kBT (respectively, 13 kBT) at room temperature T. MetaDynamics allows us to reconstruct accurately the free-energy landscape, to show that the free-energy barriers come from the difference in torsional energy between the bubble and duplex states, and thus to highlight the limiting step, a collective twisting, that controls the nucleation/closure mechanism, and to access opening time scales on the millisecond range. Contrary to small breathing bubbles, those more than 4 base-pair bubbles are of biological relevance, for example, when a pre-existing state of denaturation is required by specific DNA-binding proteins.
Structure of yeast Argonaute with guide RNA
Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.
2012-01-01
The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195
Förster, Charlotte; Brauer, Arnd B. E.; Brode, Svenja; Schmidt, Kathrin S.; Perbandt, Markus; Meyer, Arne; Rypniewski, Wojciech; Betzel, Christian; Kurreck, Jens; Fürste, Jens P.; Erdmann, Volker A.
2006-01-01
The pharmacokinetic properties of an aptamer against the tumour-marker protein tenascin-C have recently been successfully improved by the introduction of locked nucleic acids (LNAs) into the terminal stem of the aptamer. Since it is believed that this post-SELEX optimization is likely to provide a more general route to enhance the in vitro and in vivo stability of aptamers, elucidation of the structural basis of this improvement was embarked upon. Here, the crystallographic and X-ray diffraction data of the isolated aptamer stem encompassed in a six-base-pair duplex both with and without the LNA modification are presented. The obtained all-LNA crystals belong to space group P41212 or P43212, with unit-cell parameters a = b = 52.80, c = 62.83 Å; the all-RNA crystals belong to space group R32, with unit-cell parameters a = b = 45.21, c = 186.97 Å, γ = 120.00°. PMID:16820689
RACER a Coarse-Grained RNA Model for Capturing Folding Free Energy in Molecular Dynamics Simulations
NASA Astrophysics Data System (ADS)
Cheng, Sara; Bell, David; Ren, Pengyu
RACER is a coarse-grained RNA model that can be used in molecular dynamics simulations to predict native structures and sequence-specific variation of free energy of various RNA structures. RACER is capable of accurate prediction of native structures of duplexes and hairpins (average RMSD of 4.15 angstroms), and RACER can capture sequence-specific variation of free energy in excellent agreement with experimentally measured stabilities (r-squared =0.98). The RACER model implements a new effective non-bonded potential and re-parameterization of hydrogen bond and Debye-Huckel potentials. Insights from the RACER model include the importance of treating pairing and stacking interactions separately in order to distinguish folded an unfolded states and identification of hydrogen-bonding, base stacking, and electrostatic interactions as essential driving forces for RNA folding. Future applications of the RACER model include predicting free energy landscapes of more complex RNA structures and use of RACER for multiscale simulations.
Smectic phase in suspensions of gapped DNA duplexes
Salamonczyk, Miroslaw; Zhang, Jing; Portale, Giuseppe; ...
2016-11-15
Smectic ordering in aqueous solutions of monodisperse stiff double-stranded DNA fragments is known not to occur, in spite of the fact that these systems exhibit both chiral nematic and columnar mesophases. Here, we show, unambiguously, that a smectic-A type of phase is formed by increasing the DNA's flexibility through the introduction of an unpaired single-stranded DNA spacer in the middle of each duplex. This is unusual for a lyotropic system, where flexibility typically destabilizes the smectic phase. We also report on simulations suggesting that the gapped duplexes (resembling chain-sticks) attain a folded conformation in the smectic layers, and argue thatmore » this layer structure, which we designate as smectic-fA phase, is thermodynamically stabilized by both entropic and energetic contributions to the system's free energy. These results demonstrate that DNA as a building block offers an exquisitely tunable means to engineer a potentially rich assortment of lyotropic liquid crystals.« less
Improved Force Fields for Peptide Nucleic Acids with Optimized Backbone Torsion Parameters.
Jasiński, Maciej; Feig, Michael; Trylska, Joanna
2018-06-06
Peptide nucleic acids are promising nucleic acid analogs for antisense therapies as they can form stable duplex and triplex structures with DNA and RNA. Computational studies of PNA-containing duplexes and triplexes are an important component for guiding their design, yet existing force fields have not been well validated and parametrized with modern computational capabilities. We present updated CHARMM and Amber force fields for PNA that greatly improve the stability of simulated PNA-containing duplexes and triplexes in comparison with experimental structures and allow such systems to be studied on microsecond time scales. The force field modifications focus on reparametrized PNA backbone torsion angles to match high-level quantum mechanics reference energies for a model compound. The microsecond simulations of PNA-PNA, PNA-DNA, PNA-RNA, and PNA-DNA-PNA complexes also allowed a comprehensive analysis of hydration and ion interactions with such systems.
Abiotic ligation of DNA oligomers templated by their liquid crystal ordering
NASA Astrophysics Data System (ADS)
Fraccia, Tommaso P.; Smith, Gregory P.; Zanchetta, Giuliano; Paraboschi, Elvezia; Yi, Yougwooo; Walba, David M.; Dieci, Giorgio; Clark, Noel A.; Bellini, Tommaso
2015-03-01
It has been observed that concentrated solutions of short DNA oligomers develop liquid crystal ordering as the result of a hierarchically structured supramolecular self-assembly. In mixtures of oligomers with various degree of complementarity, liquid crystal microdomains are formed via the selective aggregation of those oligomers that have a sufficient degree of duplexing and propensity for physical polymerization. Here we show that such domains act as fluid and permeable microreactors in which the order-stabilized molecular contacts between duplex terminals serve as physical templates for their chemical ligation. In the presence of abiotic condensing agents, liquid crystal ordering markedly enhances ligation efficacy, thereby enhancing its own phase stability. The coupling between order-templated ligation and selectivity provided by supramolecular ordering enables an autocatalytic cycle favouring the growth of DNA chains, up to biologically relevant lengths, from few-base long oligomers. This finding suggests a novel scenario for the abiotic origin of nucleic acids.
NASA Technical Reports Server (NTRS)
Egli, M.; Usman, N.; Rich, A.
1993-01-01
We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.
Stavros, Kallie M.; Hawkins, Edward K.; Rizzo, Carmelo J.; Stone, Michael P.
2014-01-01
2-Amino-3-methylimidazo[4,5-f]quinolone (IQ), a heterocyclic amine found in cooked meats, undergoes bioactivation to a nitrenium ion, which alkylates guanines at both the C8-dG and N2-dG positions. The conformation of a site-specific N2-dG-IQ adduct in an oligodeoxynucleotide duplex containing the iterated CG repeat restriction site of the NarI endonuclease has been determined. The IQ moiety intercalates, with the IQ H4a and CH3 protons facing the minor groove, and the IQ H7a, H8a and H9a protons facing the major groove. The adducted dG maintains the anti-conformation about the glycosyl bond. The complementary dC is extruded into the major groove. The duplex maintains its thermal stability, which is attributed to stacking between the IQ moiety and the 5′- and 3′-neighboring base pairs. This conformation is compared to that of the C8-dG-IQ adduct in the same sequence, which also formed a ‘base-displaced intercalated’ conformation. However, the C8-dG-IQ adopted the syn conformation placing the Watson−Crick edge of the modified dG into the major groove. In addition, the C8-dG-IQ adduct was oriented with the IQ CH3 group and H4a and H5a facing the major groove. These differences may lead to differential processing during DNA repair and replication. PMID:24366876
Teuben, J M; Bauer, C; Wang, A H; Reedijk, J
1999-09-21
The platinum 1,3-d(GXG) intrastrand cross-link is one of the adducts formed in the reaction of the antitumor drug cisplatin with DNA, and in fact the major adduct found in cells treated with the cisplatin analogue carboplatin. To determine the 3D structure of this adduct, the duplex d(CTCTGTGTCTC).d(GAGACACAGAG)], where GTG denotes a platinum 1,3-intrastrand cross-link, was prepared and studied with high-resolution (1)H NMR. The solution structure was determined using the SPEDREF protocol, which includes an iterative NOE-restrained refinement procedure. Calculated and recorded NOE spectra were found to be in good agreement (NMR R factor 22%). The studied duplex is more distorted from B-DNA than previously determined structures of the 1,2-d(GG) intrastrand adducts. The base pairing is lost for the 5'G-C and the central T-A base pair in the GTG lesion, and the central thymine is extruded from the minor groove. To accommodate this lesion, the minor groove is widened, and the 5'-guanine ribose adopts an N-type conformation. The helix is unwound locally and is significantly bent toward the major groove. Significant difference between the structural distortion of the 1, 3-d(GTG) cross-link and other Pt-DNA cross-links sheds new light on the observed differences in protein recognition of these lesions, and thus on the possible differences in mechanisms of action of the various Pt-DNA adducts formed in treatment with platinum anticancer complexes.
Shen, Zhanhang; Mulholland, Kelly A; Zheng, Yujun; Wu, Chun
2017-09-01
DNA G-quadruplex structures are emerging cancer-specific targets for chemotherapeutics. Ligands that bind to and stabilize DNA G-quadruplexes have the potential to be anti-cancer drugs. Lack of binding selectivity to DNA G-quadruplex over DNA duplex remains a major challenge when attempting to develop G-quadruplex ligands into successful anti-cancer drugs. Thorough understanding of the binding nature of existing non-selective ligands that bind to both DNA quadruplex and DNA duplex will help to address this challenge. Daunomycin and doxorubicin, two commonly used anticancer drugs, are examples of non-selective DNA ligands. In this study, we extended our early all-atom binding simulation studies between doxorubicin and a DNA duplex (d(CGATCG) 2 ) to probe the binding between daunomycin and a parallel DNA quadruplex (d(TGGGGT) 4 ) and DNA duplex. In addition to the end stacking mode, which mimics the mode in the crystal structure, a pure groove binding mode was observed in our free binding simulations. The dynamic and energetic properties of these two binding modes are thoroughly examined, and a detailed comparison is made between DNA quadruplex binding modes and DNA duplex binding modes. Implications on the design of more selective DNA quadruplex ligands are also discussed. Graphical abstract Top stacking and groov binding modes from the MD simulations.
Miyoshi, Daisuke; Ueda, Yu-Mi; Shimada, Naohiko; Nakano, Shu-Ichi; Sugimoto, Naoki; Maruyama, Atsushi
2014-09-01
Electrostatic interactions play a major role in protein-DNA interactions. As a model system of a cationic protein, herein we focused on a comb-type copolymer of a polycation backbone and dextran side chains, poly(L-lysine)-graft-dextran (PLL-g-Dex), which has been reported to form soluble interpolyelectrolyte complexes with DNA strands. We investigated the effects of PLL-g-Dex on the conformation and thermodynamics of DNA oligonucleotides forming various secondary structures. Thermodynamic analysis of the DNA structures showed that the parallel conformations involved in both DNA duplexes and triplexes were significantly and specifically stabilized by PLL-g-Dex. On the basis of thermodynamic parameters, it was further possible to design DNA switches that undergo structural transition responding to PLL-g-Dex from an antiparallel duplex to a parallel triplex even with mismatches in the third strand hybridization. These results suggest that polycationic molecules are able to induce structural polymorphism of DNA oligonucleotides, because of the conformation-selective stabilization effects. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Triplex-forming oligonucleotides: a third strand for DNA nanotechnology
2018-01-01
Abstract DNA self-assembly has proved to be a useful bottom-up strategy for the construction of user-defined nanoscale objects, lattices and devices. The design of these structures has largely relied on exploiting simple base pairing rules and the formation of double-helical domains as secondary structural elements. However, other helical forms involving specific non-canonical base-base interactions have introduced a novel paradigm into the process of engineering with DNA. The most notable of these is a three-stranded complex generated by the binding of a third strand within the duplex major groove, generating a triple-helical (‘triplex’) structure. The sequence, structural and assembly requirements that differentiate triplexes from their duplex counterparts has allowed the design of nanostructures for both dynamic and/or structural purposes, as well as a means to target non-nucleic acid components to precise locations within a nanostructure scaffold. Here, we review the properties of triplexes that have proved useful in the engineering of DNA nanostructures, with an emphasis on applications that hitherto have not been possible by duplex formation alone. PMID:29228337
NASA Astrophysics Data System (ADS)
Ghobadi, Ahmadreza F.; Jayaraman, Arthi
DNA hybridization is the basis of various bio-nano technologies, such as DNA origami and assembly of DNA-functionalized nanoparticles. A hybridized double stranded (ds) DNA is formed when complementary nucleobases on hybridizing strands exhibit specific and directional hydrogen bonds through canonical Watson-Crick base-pairing interactions. In recent years, the need for cheaper alternatives and significant synthetic advances have driven design of DNA mimics with new backbone chemistries. However, a fundamental understanding of how these backbone modifications in the oligo-nucleic acids impact the hybridization and melting behavior of the duplex is still lacking. In this talk, we present our recent findings on impact of varying backbone chemistry on hybridization of oligo-nucleic acid duplexes. We use coarse-grained molecular dynamics simulations to isolate the effect of strand flexibility, electrostatic interactions and nucleobase spacing on the melting curves for duplexes with various strand sequences and concentrations. Since conjugation of oligo-nucleic acids with polymers serve as building blocks for thermo-responsive polymer networks and gels, we also present the effect of such conjugation on hybridization thermodynamics and polymer conformation.
Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore
NASA Technical Reports Server (NTRS)
Vercoutere, Wenonah; DeGuzman, Veronica
2003-01-01
The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.
Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper
2017-04-19
Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.
Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing
2008-06-04
Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost.
PNPase autocontrols its expression by degrading a double-stranded structure in the pnp mRNA leader
Jarrige, Anne-Charlotte; Mathy, Nathalie; Portier, Claude
2001-01-01
Polynucleotide phosphorylase synthesis is autocontrolled at a post-transcriptional level in an RNase III-dependent mechanism. RNase III cleaves a long stem–loop in the pnp leader, which triggers pnp mRNA instability, resulting in a decrease in the synthesis of polynucleotide phosphorylase. The staggered cleavage by RNase III removes the upper part of the stem–loop structure, creating a duplex with a short 3′ extension. Mutations or high temperatures, which destabilize the cleaved stem–loop, decrease expression of pnp, while mutations that stabilize the stem increase expression. We propose that the dangling 3′ end of the duplex created by RNase III constitutes a target for polynucleotide phosphorylase, which binds to and degrades the upstream half of this duplex, hence inducing pnp mRNA instability. Consistent with this interpretation, a pnp mRNA starting at the downstream RNase III processing site exhibits a very low level of expression, regardless of the presence of polynucleotide phosphorylase. Moreover, using an in vitro synthesized pnp leader transcript, it is shown that polynucleotide phosphorylase is able to digest the duplex formed after RNase III cleavage. PMID:11726520
Zhang, Hong; Liu, Xuewen; He, Xiaojun; Liu, Ying; Tan, Lifeng
2014-11-01
There is renewed interest in investigating triple helices because these novel structures have been implicated as a possible means of controlling cellular processes by endogenous or exogenous mechanisms. Due to the Hoogsteen base pairing, triple helices are, however, thermodynamically less stable than the corresponding duplexes. The poor stability of triple helices limits their practical applications under physiological conditions. In contrast to DNA triple helices, small molecules stabilizing RNA triple helices at present are less well established. Furthermore, most of these studies are limited to organic compounds and, to a far lesser extent, to metal complexes. In this work, two Ru(II) complexes, [Ru(bpy)2(btip)](2+) (Ru1) and [Ru(phen)2(btip)](2+) (Ru2), have been synthesized and characterized. The binding properties of the two metal complexes with the triple RNA poly(U)˙poly(A)*poly(U) were studied by various biophysical and density functional theory methods. The main results obtained here suggest that the slight binding difference in Ru1 and Ru2 may be attributed to the planarity of the intercalative ligand and the LUMO level of Ru(II) complexes. This study further advances our knowledge on the triplex RNA-binding by metal complexes, particularly Ru(II) complexes.
Johnson, Kevin M.; Price, Nathan E.; Wang, Jin; Fekry, Mostafa I.; Dutta, Sanjay; Seiner, Derrick R.; Wang, Yinsheng; Gates, Kent S.
2014-01-01
We recently reported that the aldehyde residue of an abasic (Ap) site in duplex DNA can generate an interstrand cross-link via reaction with a guanine residue on the opposing strand. This finding is intriguing because the highly deleterious nature of interstrand cross-links suggests that even small amounts of Ap-derived cross-links could make a significant contribution to the biological consequences stemming from the generation of Ap sites in cellular DNA. Incubation of 21-bp duplexes containing a central 5′-CAp sequence under conditions of reductive amination (NaCNBH3, pH 5.2) generated much higher yields of cross-linked DNA than reported previously. At pH 7, in the absence of reducing agents, these Ap-containing duplexes also produced cross-linked duplexes that were readily detected on denaturing polyacrylamide gels. Cross-link formation was not highly sensitive to reaction conditions and, once formed, the cross-link was stable to a variety of work-up conditions. Results of multiple experiments including MALDI-TOF mass spectrometry, gel mobility, methoxyamine capping of the Ap aldehyde, inosine-for-guanine replacement, hydroxyl radical footprinting, and LCMS/MS were consistent with a cross-linking mechanism involving reversible reaction of the Ap aldehyde residue with the N2-amino group of the opposing guanine residue in 5′-CAp sequences to generate hemiaminal, imine, or cyclic hemiaminal cross-links (7-10) that were irreversibly converted under conditions of reductive amination (NaCNBH3/pH 5.2) to a stable amine linkage. Further support for the importance of the exocyclic N2-amino group in this reaction was provided by an experiment showing that installation of a 2-aminopurine-thymine base pair at the cross-linking site produced high yields (15-30%) of a cross-linked duplex at neutral pH, in the absence of NaCNBH3. PMID:23215239
Gholami, Somayeh; Kompany-Zareh, Mohsen
2013-07-01
Actinomycin D (Act D), an oncogenic c-Myc promoter binder, interferes with the action of RNA polymerase. There is great demand for high-throughput technology able to monitor the activity of DNA-binding drugs. To this end, binding of 7-aminoactinomycin D (7AAD) to the duplex c-Myc promoter was investigated by use of 2D-photoluminescence emission (2D-PLE), and the resulting data were subjected to analysis by use of convenient and powerful multi-way approaches. Fluorescence measurements were performed by use of the quantum dot (QD)-conjugated c-Myc promoter. Intercalation of 7AAD within duplex base pairs resulted in efficient energy transfer from drug to QD via fluorescence resonance energy transfer (FRET). Multi-way analysis of the three-way data array obtained from titration experiments was performed by use of restricted Tucker3 and hard trilinear decomposition (HTD). These techniques enable analysis of high-dimensional and complex data from nanobiological systems which include several spectrally overlapped structures. It was almost impossible to obtain robust and meaningful information about the FRET process for such high overlap data by use of classical analysis. The soft approach had the important advantage over univariate classical methods of enabling us to investigate the source of variance in the fluorescence signal of the DNA-drug complex. It was established that hard trilinear decomposition analysis of FRET-measured data overcomes the problem of rank deficiency, enabling calculation of concentration profiles and pure spectra for all species, including non-fluorophores. The hard modeling approach was also used for determination of equilibrium constants for the hybridization and intercalation equilibria, using nonlinear fit data analysis. The intercalation constant 3.6 × 10(6) mol(-1) L and hybridization stability 1.0 × 10(8) mol(-1) L obtained were in good agreement with values reported in the literature. The analytical concentration of the QD-labeled DNA was determined by use of nonlinear fitting, without using external standard calibration samples. This study was a successful application of multi-way chemometric methods to investigation of nano-biotechnological systems where several overlapped species coexist in solution.
Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.
Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki
2012-06-01
DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.
Structural and thermodynamic analysis of modified nucleosides in self-assembled DNA cross-tiles.
Hakker, Lauren; Marchi, Alexandria N; Harris, Kimberly A; LaBean, Thomas H; Agris, Paul F
2014-01-01
DNA Holliday junctions are important natural strand-exchange structures that form during homologous recombination. Immobile four-arm junctions, analogs to Holliday junctions, have been designed to self-assemble into cross-tile structures by maximizing Watson-Crick base pairing and fixed crossover points. The cross-tiles, self-assembled from base pair recognition between designed single-stranded DNAs, form higher order lattice structures through cohesion of self-associating sticky ends. These cross-tiles have 16 unpaired nucleosides in the central loop at the junction of the four duplex stems. The importance of the centralized unpaired nucleosides to the structure's thermodynamic stability and self-assembly is unknown. Cross-tile DNA nanostructures were designed and constructed from nine single-stranded DNAs with four shell strands, four arms, and a central loop containing 16 unpaired bases. The 16 unpaired bases were either 2'-deoxyribothymidines, 2'-O-methylribouridines, or abasic 1',2'-dideoxyribonucleosides. Thermodynamic profiles and structural base-stacking contributions were assessed using UV absorption spectroscopy during thermal denaturation and circular dichroism spectroscopy, respectively, and the resulting structures were observed by atomic force microscopy. There were surprisingly significant changes in the thermodynamic and structural properties of lattice formation as a result of altering only the 16 unpaired, centralized nucleosides. The 16 unpaired 2'-O-methyluridines were stabilizing and produced uniform tubular structures. In contrast, the abasic nucleosides were destabilizing producing a mixture of structures. These results strongly indicate the importance of a small number of centrally located unpaired nucleosides within the structures. Since minor modifications lead to palpable changes in lattice formation, DNA cross-tiles present an easily manipulated structure convenient for applications in biomedical and biosensing devices.
Dicer is dispensable for asymmetric RISC loading in mammals
Betancur, Juan G.; Tomari, Yukihide
2012-01-01
In flies, asymmetric loading of small RNA duplexes into Argonaute2-containing RNA-induced silencing complex (Ago2-RISC) requires Dicer-2/R2D2 heterodimer, which acts as a protein sensor for the thermodynamic stabilities of the ends of small RNA duplexes. However, the mechanism of small RNA asymmetry sensing in mammalian RISC assembly remains obscure. Here, we quantitatively examined RISC assembly and target silencing activity in the presence or absence of Dicer in mammals. Our data show that, unlike the well-characterized fly Ago2-RISC assembly pathway, mammalian Dicer is dispensable for asymmetric RISC loading in vivo and in vitro. PMID:22106413
Dicer is dispensable for asymmetric RISC loading in mammals.
Betancur, Juan G; Tomari, Yukihide
2012-01-01
In flies, asymmetric loading of small RNA duplexes into Argonaute2-containing RNA-induced silencing complex (Ago2-RISC) requires Dicer-2/R2D2 heterodimer, which acts as a protein sensor for the thermodynamic stabilities of the ends of small RNA duplexes. However, the mechanism of small RNA asymmetry sensing in mammalian RISC assembly remains obscure. Here, we quantitatively examined RISC assembly and target silencing activity in the presence or absence of Dicer in mammals. Our data show that, unlike the well-characterized fly Ago2-RISC assembly pathway, mammalian Dicer is dispensable for asymmetric RISC loading in vivo and in vitro.
Nonin, S; Phan, A T; Leroy, J L
1997-09-15
Repetitive cytosine-rich DNA sequences have been identified in telomeres and centromeres of eukaryotic chromosomes. These sequences play a role in maintaining chromosome stability during replication and may be involved in chromosome pairing during meiosis. The C-rich repeats can fold into an 'i-motif' structure, in which two parallel-stranded duplexes with hemiprotonated C.C+ pairs are intercalated. Previous NMR studies of naturally occurring repeats have produced poor NMR spectra. This led us to investigate oligonucleotides, based on natural sequences, to produce higher quality spectra and thus provide further information as to the structure and possible biological function of the i-motif. NMR spectroscopy has shown that d(5mCCTTTACC) forms an i-motif dimer of symmetry-related and intercalated folded strands. The high-definition structure is computed on the basis of the build-up rates of 29 intraresidue and 35 interresidue nuclear Overhauser effect (NOE) connectivities. The i-motif core includes intercalated interstrand C.C+ pairs stacked in the order 2*.8/1.7*/1*.7/2.8* (where one strand is distinguished by an asterisk and the numbers relate to the base positions within the repeat). The TTTA sequences form two loops which span the two wide grooves on opposite sides of the i-motif core; the i-motif core is extended at both ends by the stacking of A6 onto C2.C8+. The lifetimes of pairs C2.C8+ and 5mC1.C7+ are 1 ms and 1 s, respectively, at 15 degrees C. Anomalous exchange properties of the T3 imino proton indicate hydrogen bonding to A6 N7 via a water bridge. The d(5mCCTTTTCC) deoxyoligonucleotide, in which position 6 is occupied by a thymidine instead of an adenine, also forms a symmetric i-motif dimer. However, in this structure the two TTTT loops are located on the same side of the i-motif core and the C.C+ pairs are formed by equivalent cytidines stacked in the order 8*.8/1.1*/7*.7/2.2*. Oligodeoxynucleotides containing two C-rich repeats can fold and dimerize into an i-motif. The change of folding topology resulting from the substitution of a single nucleoside emphasizes the influence of the loop residues on the i-motif structure formed by two folded strands.
50 years of DNA ‘Breathing’: Reflections on Old and New Approaches
von Hippel, Peter H.; Johnson, Neil P.; Marcus, Andrew H.
2015-01-01
Summary The coding sequences for genes, and much other regulatory information involved in genome expression, are located ‘inside’ the DNA duplex. Thus the ‘macromolecular machines’ that read-out this information from the base sequence of the DNA must somehow access the DNA ‘interior’. Double-stranded (ds) DNA is a highly structured and cooperatively stabilized system at physiological temperatures, but is also only marginally stable and undergoes a cooperative ‘melting phase transition’ at temperatures not far above physiological. Furthermore, due to its length and heterogeneous sequence, with AT-rich segments being less stable than GC-rich segments, the DNA genome ‘melts’ in a multistate fashion. Therefore the DNA genome must also manifest thermally driven structural (‘breathing’) fluctuations at physiological temperatures that should reflect the heterogeneity of the dsDNA stability near the melting temperature. Thus many of the breathing fluctuations of dsDNA are likely also to be sequence dependent, and could well contain information that should be ‘readable’ and useable by regulatory proteins and protein complexes in site-specific binding reactions involving dsDNA ‘opening’. Our laboratory has been involved in studying the breathing fluctuations of duplex DNA for about 50 years. In this ‘Reflections’ article we present a relatively chronological overview of these studies, starting with the use of simple chemical probes (such as hydrogen exchange, formaldehyde and simple DNA ‘melting’ proteins) to examine the local stability of the dsDNA structure, and culminating in sophisticated spectroscopic approaches that can be used to monitor the breathing-dependent interactions of regulatory complexes with their duplex DNA targets in ‘real time’. PMID:23840028
Schneider, Uffe V.; Géci, Imrich; Jøhnk, Nina; Mikkelsen, Nikolaj D.; Pedersen, Erik B.; Lisby, Gorm
2011-01-01
The sensitivity and specificity of clinical diagnostic assays using DNA hybridization techniques are limited by the dissociation of double-stranded DNA (dsDNA) antiparallel duplex helices. This situation can be improved by addition of DNA stabilizing molecules such as nucleic acid intercalators. Here, we report the synthesis of a novel ortho-Twisted Intercalating Nucleic Acid (TINA) amidite utilizing the phosphoramidite approach, and examine the stabilizing effect of ortho- and para-TINA molecules in antiparallel DNA duplex formation. In a thermal stability assay, ortho- and para-TINA molecules increased the melting point (Tm) of Watson-Crick based antiparallel DNA duplexes. The increase in Tm was greatest when the intercalators were placed at the 5′ and 3′ termini (preferable) or, if placed internally, for each half or whole helix turn. Terminally positioned TINA molecules improved analytical sensitivity in a DNA hybridization capture assay targeting the Escherichia coli rrs gene. The corresponding sequence from the Pseudomonas aeruginosa rrs gene was used as cross-reactivity control. At 150 mM ionic strength, analytical sensitivity was improved 27-fold by addition of ortho-TINA molecules and 7-fold by addition of para-TINA molecules (versus the unmodified DNA oligonucleotide), with a 4-fold increase retained at 1 M ionic strength. Both intercalators sustained the discrimination of mismatches in the dsDNA (indicated by ΔTm), unless placed directly adjacent to the mismatch – in which case they partly concealed ΔTm (most pronounced for para-TINA molecules). We anticipate that the presented rules for placement of TINA molecules will be broadly applicable in hybridization capture assays and target amplification systems. PMID:21673988
Hu, Qin; Zhu, Dekang; Ma, Guangpeng; Cheng, Anchun; Wang, Mingshu; Chen, Shun; Jia, Renyong; Liu, Mafeng; Sun, Kunfeng; Yang, Qiao; Wu, Ying; Chen, Xiaoyue
2016-10-01
Duck hepatitis A virus (DHAV) is a highly infectious pathogen that causes significant bleeding lesions in the viscera of ducklings less than 3 weeks old. There are three serotypes of DHAV: serotype 1 (DHAV-1), serotype 2 (DHAV-2) and serotype 3 (DHAV-3). These serotypes have no cross-antigenicity with each other. To establish an rRT-PCR assay for the rapid detection of a mixed infection of DHAV-1 and DHAV-3, two pairs of primers and a pair of matching TaqMan probes were designed based on conserved regions of DHAV-1 VP0 and DHAV-3 VP3. Finally, we established a one-step duplex rRT-PCR assay with high specificity and sensitivity for the simultaneous detection of DHAV-1 and DHAV-3. This method showed no cross-antigenicity with the other pathogens tested, including duck plague virus, Muscovy duck parvovirus, Riemerella anatipestifer, and pathogenic E. coli from ducks. Sensitivity tests identified the minimum detection limits of this method as 98 (DHAV-1) and 10 (DHAV-3) copies/reaction. To validate the method, thirty-eight clinical samples and thirty artificially infected samples collected from dead duck embryos were studied. Thirty-seven samples were positive for DHAV-1, seventeen samples were positive for DHAV-3, and fourteen samples were positive for a mixed infection using the duplex rRT-PCR method. The method established in this study is specific, sensitive, convenient and timesaving and is a powerful tool for detecting DHAV-1, DHAV-3, and their mixed infection and for conducting surveys of pandemic virus strains. Copyright © 2016. Published by Elsevier B.V.
Cilli, Piera; Minoprio, Anna; Bossa, Cecilia; Bignami, Margherita; Mazzei, Filomena
2015-01-01
The cellular pool of ribonucleotide triphosphates (rNTPs) is higher than that of deoxyribonucleotide triphosphates. To ensure genome stability, DNA polymerases must discriminate against rNTPs and incorporated ribonucleotides must be removed by ribonucleotide excision repair (RER). We investigated DNA polymerase β (POL β) capacity to incorporate ribonucleotides into trinucleotide repeated DNA sequences and the efficiency of base excision repair (BER) and RER enzymes (OGG1, MUTYH, and RNase H2) when presented with an incorrect sugar and an oxidized base. POL β incorporated rAMP and rCMP opposite 7,8-dihydro-8-oxoguanine (8-oxodG) and extended both mispairs. In addition, POL β was able to insert and elongate an oxidized rGMP when paired with dA. We show that RNase H2 always preserves the capacity to remove a single ribonucleotide when paired to an oxidized base or to incise an oxidized ribonucleotide in a DNA duplex. In contrast, BER activity is affected by the presence of a ribonucleotide opposite an 8-oxodG. In particular, MUTYH activity on 8-oxodG:rA mispairs is fully inhibited, although its binding capacity is retained. This results in the reduction of RNase H2 incision capability of this substrate. Thus complex mispairs formed by an oxidized base and a ribonucleotide can compromise BER and RER in repeated sequences. PMID:26338705
Individual Basepair Stability of DNA and RNA Studied by NMR-Detected Solvent Exchange
Steinert, Hannah S.; Rinnenthal, Jörg; Schwalbe, Harald
2012-01-01
In this study, we have optimized NMR methodology to determine the thermodynamic parameters of basepair opening in DNA and RNA duplexes by characterizing the temperature dependence of imino proton exchange rates of individual basepairs. Contributions of the nuclear Overhauser effect to exchange rates measured with inversion recovery experiments are quantified, and the influence of intrinsic and external catalysis exchange mechanisms on the imino proton exchange rates is analyzed. Basepairs in DNA and RNA have an approximately equal stability, and the enthalpy and entropy values of their basepair dissociation are correlated linearly. Furthermore, the compensation temperature, Tc, which is derived from the slope of the correlation, coincides with the melting temperature, and duplex unfolding occurs at that temperature where all basepairs are equally thermodynamically stable. The impact of protium-deuterium exchange of the imino hydrogen on the free energy of RNA basepair opening is investigated, and it is found that two A·U basepairs show distinct fractionation factors. PMID:22713572
Ovaere, Margriet; Sponer, Jiri; Sponer, Judit E.; Herdewijn, Piet; Van Meervelt, Luc
2012-01-01
Altritol nucleic acids (ANAs) are a promising new tool in the development of artificial small interfering ribonucleic acids (siRNAs) for therapeutical applications. To mimic the siRNA:messenger RNA (mRNA) interactions, the crystal structure of the ANA:RNA construct a(CCGUAAUGCC-P):r(GGCAUUACGG) was determined to 1.96 Å resolution which revealed the hybrid to form an A-type helix. As this A-form is a major requirement in the RNAi process, this crystal structure confirms the potential of altritol-modified siRNAs. Moreover, in the ANA strands, a new type of intrastrand interactions was found between the O2′ hydroxyl group of one residue and the sugar ring O4′ atom of the next residue. These interactions were further investigated by quantum chemical methods. Besides hydration effects, these intrastrand hydrogen bonds may also contribute to the stability of ANA:RNA duplexes. PMID:22638588
Mismatch and G-Stack Modulated Probe Signals on SNP Microarrays
Binder, Hans; Fasold, Mario; Glomb, Torsten
2009-01-01
Background Single nucleotide polymorphism (SNP) arrays are important tools widely used for genotyping and copy number estimation. This technology utilizes the specific affinity of fragmented DNA for binding to surface-attached oligonucleotide DNA probes. We analyze the variability of the probe signals of Affymetrix GeneChip SNP arrays as a function of the probe sequence to identify relevant sequence motifs which potentially cause systematic biases of genotyping and copy number estimates. Methodology/Principal Findings The probe design of GeneChip SNP arrays enables us to disentangle different sources of intensity modulations such as the number of mismatches per duplex, matched and mismatched base pairings including nearest and next-nearest neighbors and their position along the probe sequence. The effect of probe sequence was estimated in terms of triple-motifs with central matches and mismatches which include all 256 combinations of possible base pairings. The probe/target interactions on the chip can be decomposed into nearest neighbor contributions which correlate well with free energy terms of DNA/DNA-interactions in solution. The effect of mismatches is about twice as large as that of canonical pairings. Runs of guanines (G) and the particular type of mismatched pairings formed in cross-allelic probe/target duplexes constitute sources of systematic biases of the probe signals with consequences for genotyping and copy number estimates. The poly-G effect seems to be related to the crowded arrangement of probes which facilitates complex formation of neighboring probes with at minimum three adjacent G's in their sequence. Conclusions The applied method of “triple-averaging” represents a model-free approach to estimate the mean intensity contributions of different sequence motifs which can be applied in calibration algorithms to correct signal values for sequence effects. Rules for appropriate sequence corrections are suggested. PMID:19924253
Why double-stranded RNA resists condensation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolokh, Igor S.; Pabit, Suzette; Katz, Andrea M.
2014-09-15
The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to attraction between the negatively charged helices and eventually to condensation. Surprisingly, this effect is suppressed in double-stranded RNA, which carries the same charge as the DNA, but assumes a different double helical form. However, additional characterization of short (25 base-pairs) nucleic acid (NA) duplex structures by circular dichroism shows that measured differences in condensation are not solely determined by duplex helical geometry. Here we combine experiment, theory, and atomistic simulations to propose a mechanism that connects the observed variations in condensation of short NA duplexesmore » with the spatial variation of cobalt hexammine (CoHex) binding at the NA duplex surface. The atomistic picture that emerged showed that CoHex distributions around the NA reveals two major NA-CoHex binding modes -- internal and external -- distinguished by the proximity of bound CoHex to the helical axis. Decreasing trends in experimentally observed condensation propensity of the four studied NA duplexes (from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA) are explained by the progressive decrease of a single quantity: the fraction of CoHex ions in the external binding mode. Thus, while NA condensation depends on a complex interplay between various structural and sequence features, our coupled experimental and theoretical results suggest a new model in which a single parameter connects the NA condensation propensity with geometry and sequence dependence of CoHex binding.« less
Mechanism-based inhibition of C5-cytosine DNA methyltransferases by 2-H pyrimidinone.
Hurd, P J; Whitmarsh, A J; Baldwin, G S; Kelly, S M; Waltho, J P; Price, N C; Connolly, B A; Hornby, D P
1999-02-19
DNA duplexes in which the target cytosine base is replaced by 2-H pyrimidinone have previously been shown to bind with a significantly greater affinity to C5-cytosine DNA methyltransferases than unmodified DNA. Here, it is shown that 2-H pyrimidinone, when incorporated into DNA duplexes containing the recognition sites for M.HgaI-2 and M.MspI, elicits the formation of inhibitory covalent nucleoprotein complexes. We have found that although covalent complexes are formed between 2-H pyrimidinone-modified DNA and both M.HgaI-2 and M.MspI, the kinetics of complex formation are quite distinct in each case. Moreover, the formation of a covalent complex is still observed between 2-H pyrimidinone DNA and M.MspI in which the active-site cysteine residue is replaced by serine or threonine. Covalent complex formation between M.MspI and 2-H pyrimidinone occurs as a direct result of nucleophilic attack by the residue at the catalytic position, which is enhanced by the absence of the 4-amino function in the base. The substitution of the catalytic cysteine residue by tyrosine or chemical modification of the wild-type enzyme with N-ethylmaleimide, abolishes covalent interaction. Nevertheless the 2-H pyrimidinone-substituted duplex still binds to M.MspI with a greater affinity than a standard cognate duplex, since the 2-H pyrimidinone base is mis-paired with guanine. Copyright 1999 Academic Press.
Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing
2008-01-01
Background Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. Results We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. Conclusion The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost. PMID:18522756
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.
NASA Technical Reports Server (NTRS)
Kanavarioti, Anastassia
1992-01-01
A scenario is proposed for the non-enzymatic self-replication of short RNA molecules. The self-replication of an oligopyrimidine strand is considered and the process of template-directed synthesis based on recognition within a double helix is discussed. Replication mechanisms are suggested for selected oligonucleotides. The mechanisms are based on Watson-Crick base pairing between complementary nucleotides as well as Hoogsteen base pairing between a duplex and the complementary third strand. It is suggested that self-replication based on these mechanisms may be accomplished but may result in a substantial amount of misinformation transfer when mixed oligonucleotides are used.
Hybrid recursive active filters for duplexing in RF transmitter front-ends
NASA Astrophysics Data System (ADS)
Gottardo, Giuseppe; Donati, Giovanni; Musolff, Christian; Fischer, Georg; Felgentreff, Tilman
2016-08-01
Duplex filters in modern base transceiver stations shape the channel in order to perform common frequency division duplex operations. Usually, they are designed as cavity filters, which are expensive and have large dimensions. Thanks to the emerging digital technology and fast digital converters, it is possible to transfer the efforts of designing analog duplex filters into digital numeric algorithms applied to feedback structures, operating on power. This solution provides the shaping of the signal spectrum directly at the output of the radio frequency (RF) power amplifiers (PAs) relaxing the transmitter design especially in the duplexer and in the antenna sections. The design of a digital baseband feedback applied to the analog power RF amplifiers (hybrid filter) is presented and verified by measurements. A model to describe the hybrid system is investigated, and the relation between phase and resonance peaks of the resulting periodic band-pass transfer function is described. The stability condition of the system is analyzed using Nyquist criterion. A solution involving a number of digital feedback and forward branches is investigated defining the parameters of the recursive structure. This solution allows the closed loop system to show a periodic band pass with up to 500 kHz bandwidth at the output of the RF amplifier. The band-pass magnitude reaches up to 17 dB selectivity. The rejection of the PA noise in the out-of-band frequencies is verified by measurements. The filter is tested with a modulated LTE (Long Term Evolution) signal showing an ACPR (Adjacent Channel Power Ratio) enhancement of 10 dB of the transmitted signal.
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2015-01-01
The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Jinhee; Chen, Ying-Pin; Perry, Zachary
A series of molybdenum- and copper-based MOPs were synthesized through coordination-driven process of a bridging ligand (3,3 -PDBAD, L1) and dimetal paddlewheel clusters. Three conformers of the ligand exist with an ideal bridging angle between the two carboxylate groups of 0° (H2α-L1), 120° (H2β-L1), and of 90° (H2γ-L1), respectively. At ambient or lower temperature, H2L1 and Mo2(OAc)4 or Cu2(OAc)4 were crystallized into a molecular square with γ-L1 and Mo2/Cu2 units. With proper temperature elevation, not only the molecular square with γ-L1 but also a lantern-shaped cage with α-L1 formed simultaneously. Similar to how Watson–Crick pairs stabilize the helical structure ofmore » duplex DNA, the core–shell molecular assembly possesses favorable H-bonding interaction sites. This is dictated by the ligand conformation in the shell, coding for the formation and providing stabilization of the central lantern shaped core, which was not observed without this complementary interaction. On the basis of the crystallographic implications, a heterobimetallic cage was obtained through a postsynthetic metal ion metathesis, showing different reactivity of coordination bonds in the core and shell. As an innovative synthetic strategy, the site-selective metathesis broadens the structural diversity and properties of coordination assemblies.« less
Lin, Jiangguo; Countryman, Preston; Buncher, Noah; Kaur, Parminder; E, Longjiang; Zhang, Yiyun; Gibson, Greg; You, Changjiang; Watkins, Simon C; Piehler, Jacob; Opresko, Patricia L; Kad, Neil M; Wang, Hong
2014-02-01
Human telomeres are maintained by the shelterin protein complex in which TRF1 and TRF2 bind directly to duplex telomeric DNA. How these proteins find telomeric sequences among a genome of billions of base pairs and how they find protein partners to form the shelterin complex remains uncertain. Using single-molecule fluorescence imaging of quantum dot-labeled TRF1 and TRF2, we study how these proteins locate TTAGGG repeats on DNA tightropes. By virtue of its basic domain TRF2 performs an extensive 1D search on nontelomeric DNA, whereas TRF1's 1D search is limited. Unlike the stable and static associations observed for other proteins at specific binding sites, TRF proteins possess reduced binding stability marked by transient binding (∼ 9-17 s) and slow 1D diffusion on specific telomeric regions. These slow diffusion constants yield activation energy barriers to sliding ∼ 2.8-3.6 κ(B)T greater than those for nontelomeric DNA. We propose that the TRF proteins use 1D sliding to find protein partners and assemble the shelterin complex, which in turn stabilizes the interaction with specific telomeric DNA. This 'tag-team proofreading' represents a more general mechanism to ensure a specific set of proteins interact with each other on long repetitive specific DNA sequences without requiring external energy sources.
Confirming the 3D Solution Structure of a Short Double-Stranded DNA Sequence Using NMR Spectroscopy
ERIC Educational Resources Information Center
Ruhayel, Rasha A.; Berners-Price, Susan J.
2010-01-01
2D [superscript 1]H NOESY NMR spectroscopy is routinely used to give information on the closeness of hydrogen atoms through space. This work is based on a 2D [superscript 1]H NOESY NMR spectrum of a 12 base-pair DNA duplex. This 6-h laboratory workshop aims to provide advanced-level chemistry students with a basic, yet solid, understanding of how…
Johnson, Sarah E; Reiling-Steffensmeier, Calliste; Lee, Hui-Ting; Marky, Luis A
2018-01-25
Our laboratory is interested in developing methods that can be used for the control of gene expression. In this work, we are investigating the reaction of an intramolecular complex containing a triplex-duplex junction with partially complementary strands. We used a combination of isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and spectroscopy techniques to determine standard thermodynamic profiles for these targeting reactions. Specifically, we have designed single strands to target one loop (CTTTC) or two loops (CTTTC and GCAA) of this complex. Both reactions yielded exothermic enthalpies of -66.3 and -82.8 kcal/mol by ITC, in excellent agreement with the reaction enthalpies of -72.7 and -88.7 kcal/mol, respectively, obtained from DSC Hess cycles. The favorable heat contributions result from the formation of base-pair stacks involving mainly the unpaired bases of the loops. This shows that each complementary strand is able to invade and disrupt the secondary structure. The simultaneous targeting of two loops yielded a more favorable reaction free energy, by approximately -8 kcal/mol, which corresponds to the formation of roughly four base-pair stacks involving the unpaired bases of the 5'-GCAA loop. The main conclusion is that the targeting of loops with a large number of unpaired bases results in a more favorable reaction free energy.
Meng, Zhenyu; Kubar, Tomas; Mu, Yuguang; Shao, Fangwei
2018-05-08
Charge transport (CT) through biomolecules is of high significance in the research fields of biology, nanotechnology, and molecular devices. Inspired by our previous work that showed the binding of ionic liquid (IL) facilitated charge transport in duplex DNA, in silico simulation is a useful means to understand the microscopic mechanism of the facilitation phenomenon. Here molecular dynamics simulations (MD) of duplex DNA in water and hydrated ionic liquids were employed to explore the helical parameters. Principal component analysis was further applied to capture the subtle conformational changes of helical DNA upon different environmental impacts. Sequentially, CT rates were calculated by a QM/MM simulation of the flickering resonance model based upon MD trajectories. Herein, MD simulation illustrated that the binding of ionic liquids can restrain dynamic conformation and lower the on-site energy of the DNA base. Confined movement among the adjacent base pairs was highly related to the increase of electronic coupling among base pairs, which may lead DNA to a CT facilitated state. Sequentially combining MD and QM/MM analysis, the rational correlations among the binding modes, the conformational changes, and CT rates illustrated the facilitation effects from hydrated IL on DNA CT and supported a conformational-gating mechanism.
Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix
Phan, Anh Tuân; Mergny, Jean-Louis
2002-01-01
Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E
2010-06-01
A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.
6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.
Berressem, R; Engels, J W
1995-01-01
2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied. PMID:7567457
6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.
Berressem, R; Engels, J W
1995-09-11
2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied.
Kupriushkin, M S; Pyshnyĭ, D V
2012-01-01
Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.
Orell, Alvaro; Tripp, Vanessa; Aliaga-Tobar, Victor; Albers, Sonja-Verena; Maracaja-Coutinho, Vinicius; Randau, Lennart
2018-05-18
Non-coding RNAs (ncRNA) are involved in essential biological processes in all three domains of life. The regulatory potential of ncRNAs in Archaea is, however, not fully explored. In this study, RNA-seq analyses identified a set of 29 ncRNA transcripts in the hyperthermophilic archaeon Sulfolobus acidocaldarius that were differentially expressed in response to biofilm formation. The most abundant ncRNA of this set was found to be resistant to RNase R treatment (RNase R resistant RNA, RrrR(+)) due to duplex formation with a reverse complementary RNA (RrrR(-)). The deletion of the RrrR(+) gene resulted in significantly impaired biofilm formation, while its overproduction increased biofilm yield. RrrR(+) was found to act as an antisense RNA against the mRNA of a hypothetical membrane protein. The RrrR(+) transcript was shown to be stabilized by the presence of the RrrR(-) strand in S. acidocaldarius cell extracts. The accumulation of these RrrR duplexes correlates with an apparent absence of dsRNA degrading RNase III domains in archaeal proteins.
New Approaches Towards Recognition of Nucleic Acid Triple Helices
Arya, Dev P.
2012-01-01
We show that groove recognition of nucleic acid triple helices can be achieved with aminosugars. Among these aminosugars, neomycin is the most effective aminoglycoside (groove binder) for stabilizing a DNA triple helix. It stabilizes both the T·A·T triplex and mixed-base DNA triplexes better than known DNA minor groove binders (which usually destabilize the triplex) and polyamines. Neomycin selectively stabilizes the triplex (T·A·T and mixed base) without any effect on the DNA duplex. The selectivity of neomycin likely originates from its potential and shape complementarity to the triplex Watson–Hoogsteen groove, making it the first molecule that selectively recognizes a triplex groove over a duplex groove. The groove recognition of aminoglycosides is not limited to DNA triplexes, but also extends to RNA and hybrid triple helical structures. Intercalator–neomycin conjugates are shown to simultaneously probe the base stacking and groove surface in the DNA triplex. Calorimetric and spectrosocopic studies allow the quantification of the effect of surface area of the intercalating moiety on binding to the triplex. These studies outline a novel approach to the recognition of DNA triplexes that incorporates the use of non-competing binding sites. These principles of dual recognition should be applicable to the design of ligands that can bind any given nucleic acid target with nanomolar affinities and with high selectivity. PMID:21073199
Kanakis, C D; Tarantilis, P A; Polissiou, M G; Diamantoglou, S; Tajmir-Riahi, H A
2005-06-01
Flavonoids are strong antioxidants that prevent DNA damage. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. However, there has been no information on the interactions of these antioxidants with individual DNA at molecular level. This study was designed to examine the interaction of quercetin (que), kaempferol (kae), and delphinidin (del) with calf-thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.5 mmol) and various drug/DNA(phosphate) ratios of 1/65 to 1. FTIR and UV-Visible difference spectroscopic methods are used to determine the drug binding sites, the binding constants and the effects of drug complexation on the stability and conformation of DNA duplex. Structural analysis showed quercetin, kaempferol, and delphinidin bind weakly to adenine, guanine (major groove), and thymine (minor groove) bases, as well as to the backbone phosphate group with overall binding constants K(que) = 7.25 x 10(4)M(-1), K(kae) = 3.60 x 10(4)M(-1), and K(del) = 1.66 x 10(4)M(-1). The stability of adduct formation is in the order of que>kae>del. Delphinidin with a positive charge induces more stabilizing effect on DNA duplex than quercetin and kaempferol. A partial B to A-DNA transition occurs at high drug concentrations.
Effect of Urea on G-Quadruplex Stability.
Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V
2017-07-13
G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the G-quadruplex and duplex conformations is a step toward elucidation of the modulating influence of different types of cosolvents on duplex-G-quadruplex molecular switches triggering genomic events.
Interaction between the helicases genetically linked to Fanconi anemia group J and Bloom's syndrome
Suhasini, Avvaru N; Rawtani, Nina A; Wu, Yuliang; Sommers, Joshua A; Sharma, Sudha; Mosedale, Georgina; North, Phillip S; Cantor, Sharon B; Hickson, Ian D; Brosh, Robert M
2011-01-01
Bloom's syndrome (BS) and Fanconi anemia (FA) are autosomal recessive disorders characterized by cancer and chromosomal instability. BS and FA group J arise from mutations in the BLM and FANCJ genes, respectively, which encode DNA helicases. In this work, FANCJ and BLM were found to interact physically and functionally in human cells and co-localize to nuclear foci in response to replication stress. The cellular level of BLM is strongly dependent upon FANCJ, and BLM is degraded by a proteasome-mediated pathway when FANCJ is depleted. FANCJ-deficient cells display increased sister chromatid exchange and sensitivity to replication stress. Expression of a FANCJ C-terminal fragment that interacts with BLM exerted a dominant negative effect on hydroxyurea resistance by interfering with the FANCJ–BLM interaction. FANCJ and BLM synergistically unwound a DNA duplex substrate with sugar phosphate backbone discontinuity, but not an ‘undamaged' duplex. Collectively, the results suggest that FANCJ catalytic activity and its effect on BLM protein stability contribute to preservation of genomic stability and a normal response to replication stress. PMID:21240188
Cilli, Piera; Minoprio, Anna; Bossa, Cecilia; Bignami, Margherita; Mazzei, Filomena
2015-10-23
The cellular pool of ribonucleotide triphosphates (rNTPs) is higher than that of deoxyribonucleotide triphosphates. To ensure genome stability, DNA polymerases must discriminate against rNTPs and incorporated ribonucleotides must be removed by ribonucleotide excision repair (RER). We investigated DNA polymerase β (POL β) capacity to incorporate ribonucleotides into trinucleotide repeated DNA sequences and the efficiency of base excision repair (BER) and RER enzymes (OGG1, MUTYH, and RNase H2) when presented with an incorrect sugar and an oxidized base. POL β incorporated rAMP and rCMP opposite 7,8-dihydro-8-oxoguanine (8-oxodG) and extended both mispairs. In addition, POL β was able to insert and elongate an oxidized rGMP when paired with dA. We show that RNase H2 always preserves the capacity to remove a single ribonucleotide when paired to an oxidized base or to incise an oxidized ribonucleotide in a DNA duplex. In contrast, BER activity is affected by the presence of a ribonucleotide opposite an 8-oxodG. In particular, MUTYH activity on 8-oxodG:rA mispairs is fully inhibited, although its binding capacity is retained. This results in the reduction of RNase H2 incision capability of this substrate. Thus complex mispairs formed by an oxidized base and a ribonucleotide can compromise BER and RER in repeated sequences. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Okutsu, N.; Shimamura, K.; Shimizu, E.
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-Cmore » base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.« less
Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel
2004-12-01
Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.
Kaushik, Mahima; Kukreti, Shrikant
2015-01-01
Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.
Tucker, J. D.; Miller, M. K.; Young, G. A.
2015-04-01
Duplex stainless steels are desirable for use in power generation systems due to their attractive combination of strength, corrosion resistance, and cost. However, thermal embrittlement at intermediate homologous temperatures of ~887°F (475°C) and below, via spinodal decomposition, limits upper service temperatures for many applications. New lean grade duplex alloys have improved thermal stability over standard grades and potentially increase the upper service temperature or the lifetime at a given temperature for this class of material. The present work compares the thermal stability of lean grade, alloy 2003 to standard grade, alloy 2205, through a series of isothermal agings between 500°Fmore » (260°C) and 900°F (482°C) for times between 1 and 10,000 hours. Aged samples were characterized by changes in microhardness and impact toughness. Additionally, atom probe tomography was performed to illustrate the evolution of the α-α' phase separation in both alloys at select conditions. Atom probe tomography confirmed that phase separation occurs via spinodal decomposition for both alloys and identified the formation of Ni-Cu-Si-Mn-P clusters in alloy 2205 that may contribute to embrittlement of this alloy. The impact toughness model predictions for upper service temperature show that alloy 2003 can be considered for use in 550°F applications for 80 year service lifetimes based on a Charpy V-notch criteria of 35 ft-lbs at 70°F. Alloy 2205 should be limited to 500°F applications.« less
Evidence of Liquid Crystal-Assisted Abiotic Ligation of Nucleic Acids
NASA Astrophysics Data System (ADS)
Fraccia, Tommaso P.; Zanchetta, Giuliano; Rimoldi, Valeria; Clark, Noel A.; Bellini, Tommaso
2015-06-01
The emergence of early life must have been marked by the appearance in the prebiotic era of complex molecular structures and systems, motivating the investigation of conditions that could not only facilitate appropriate chemical synthesis, but also provide the mechanisms of molecular selection and structural templating necessary to pilot the complexification toward specific molecular patterns. We recently proposed and demonstrated that these functions could be afforded by the spontaneous ordering of ultrashort nucleic acids oligomers into Liquid Crystal (LC) phases. In such supramolecular assemblies, duplex-forming oligomers are held in average end-to-end contact to form chemically discontinuous but physically continuous double helices. Using blunt ended duplexes, we found that LC formation could both provide molecular selection mechanisms and boost inter-oligomer ligation. This paper provides an essential extension to this notion by investigating the catalytic effects of LC ordering in duplexes with mutually interacting overhangs. Specifically, we studied the influence of LC ordering of 5'-hydroxy-3'-phosphate partially self-complementary DNA 14mers with 3'-CG sticky-ends, on the efficiency of non-enzymatic ligation reaction induced by water-soluble carbodiimide EDC as condensing agent. We investigated the ligation products in mixtures of DNA with poly-ethylene glycol (PEG) at three PEG concentrations at which the system phase separates creating DNA-rich droplets that organize into isotropic, nematic LC and columnar LC phases. We observe remarkable LC-enhanced chain lengthening, and we demonstrate that such lengthening effectively promotes and stabilizes LC domains, providing the kernel of a positive feedback cycle by which LC ordering promotes elongation, in turn stabilizing the LC ordering.
A curved RNA helix incorporating an internal loop with G·A and A·A non-Watson–Crick base pairing
Baeyens, Katrien J.; De Bondt, Hendrik L.; Pardi, Arthur; Holbrook, Stephen R.
1996-01-01
The crystal structure of the RNA dodecamer 5′-GGCC(GAAA)GGCC-3′ has been determined from x-ray diffraction data to 2.3-Å resolution. In the crystal, these oligomers form double helices around twofold symmetry axes. Four consecutive non-Watson–Crick base pairs make up an internal loop in the middle of the duplex, including sheared G·A pairs and novel asymmetric A·A pairs. This internal loop sequence produces a significant curvature and narrowing of the double helix. The helix is curved by 34° from end to end and the diameter is narrowed by 24% in the internal loop. A Mn2+ ion is bound directly to the N7 of the first guanine in the Watson–Crick region following the internal loop and the phosphate of the preceding residue. This Mn2+ location corresponds to a metal binding site observed in the hammerhead catalytic RNA. PMID:8917508
Ellipilli, Satheesh; Ganesh, Krishna N
2015-09-18
Fluorous PNA analogues possessing fluorine as inherent part of aminopropylglycine (apg) backbone (γ-CF2-apg PNA) have been synthesized and evaluated for biophysical and cell penetrating properties. These form duplexes of higher thermal stability with cRNA than cDNA, although destabilized compared to duplexes of standard aeg-PNA. Cellular uptake of the fluorinated γ-CF2-apg PNAs in NIH 3T3 and HeLa cells was 2-3-fold higher compared to that of nonfluorinated apg PNA, with NIH 3T3 cells showing better permeability compared to HeLa cells. The backbone fluorinated PNAs, which are first in this class, when combined with other chemical modifications may have potential for future PNA-based antisense agents.
Thermal-barrier coatings for utility gas turbines
NASA Technical Reports Server (NTRS)
Levine, S. R.; Miller, R. A.
1982-01-01
The potential of thermal barrier coatings for use in utility gas turbines was assessed. Pressurized passage and ambient pressure doped fuel burner rig tests revealed that thermal barrier coatings are not resistant to dirty combustion environments. However, present thermal barrier coatings, such as duplex partially stabilized zirconia and duplex Ca2SiO4 have ample resistance to the thermo-mechanical stress and temperature levels anticipated for heavy duty gas turbines firing clean fuel as revealed by clean fuel pressurized passage and ambient pressure burner rig tests. Thus, it is appropriate to evaluate such coatings on blades, vanes and combustors in the field. However, such field tests should be backed up with adequate effort in the areas of coating application technology and design analysis so that the field tests yield unequivocal results.
Beran, Rudolf K F; Bruno, Michael M; Bowers, Heath A; Jankowsky, Eckhard; Pyle, Anna Marie
2006-05-12
The NS3 helicase is essential for replication of the hepatitis C virus. This multifunctional Superfamily 2 helicase protein unwinds nucleic acid duplexes in a stepwise, ATP-dependent manner. Although kinetic features of its mechanism are beginning to emerge, little is known about the physical determinants for NS3 translocation along a strand of nucleic acid. For example, it is not known whether NS3 can traverse covalent or physical discontinuities on the tracking strand. Here we provide evidence that NS3 translocates with a mechanism that is different from its well-studied relative, the Vaccinia helicase NPH-II. Like NPH-II, NS3 translocates along the loading strand (the strand bearing the 3'-overhang) and it fails to unwind substrates that contain nicks, or covalent discontinuities in the loading strand. However, unlike NPH-II, NS3 readily unwinds RNA duplexes that contain long stretches of polyglycol, which are moieties that bear no resemblance to nucleic acid. Whether located on the tracking strand, the top strand, or both, long polyglycol regions fail to disrupt the function of NS3. This suggests that NS3 does not require the continuous formation of specific contacts with the ribose-phosphate backbone as it translocates along an RNA duplex, which is an observation consistent with the large NS3 kinetic step size (18 base-pairs). Rather, once NS3 loads onto a substrate, the helicase can translocate along the loading strand of an RNA duplex like a monorail train following a track. Bumps in the track do not significantly disturb NS3 unwinding, but a break in the track de-rails the helicase.
Effect of Radiofrequency Radiation on DNA Duplex Stability and Replication.
1983-08-01
Ando, T. A nuclease specific for heat-denatured DNA isolated from a product of Aspergillus oryzae . Biochim Biophys Acta 114:158-168 (1966). Blakeley...metabolic acti- vation. Mutation Res 64:315-328 (1979). Vogt,. V.M. Purification and further properties of single-strand-specific nuclease from Aspergillus oryzae . Eur J Biochem 33:192-200 (1973). 42
2013-01-01
Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545
Atomic-scale imaging of DNA using scanning tunnelling microscopy.
Driscoll, R J; Youngquist, M G; Baldeschwieler, J D
1990-07-19
The scanning tunnelling microscope (STM) has been used to visualize DNA under water, under oil and in air. Images of single-stranded DNA have shown that submolecular resolution is possible. Here we describe atomic-resolution imaging of duplex DNA. Topographic STM images of uncoated duplex DNA on a graphite substrate obtained in ultra-high vacuum are presented that show double-helical structure, base pairs, and atomic-scale substructure. Experimental STM profiles show excellent correlation with atomic contours of the van der Waals surface of A-form DNA derived from X-ray crystallography. A comparison of variations in the barrier to quantum mechanical tunnelling (barrier-height) with atomic-scale topography shows correlation over the phosphate-sugar backbone but anticorrelation over the base pairs. This relationship may be due to the different chemical characteristics of parts of the molecule. Further investigation of this phenomenon should lead to a better understanding of the physics of imaging adsorbates with the STM and may prove useful in sequencing DNA. The improved resolution compared with previously published STM images of DNA may be attributable to ultra-high vacuum, high data-pixel density, slow scan rate, a fortuitously clean and sharp tip and/or a relatively dilute and extremely clean sample solution. This work demonstrates the potential of the STM for characterization of large biomolecular structures, but additional development will be required to make such high resolution imaging of DNA and other large molecules routine.
Broda, Magdalena; Kierzek, Elzbieta; Gdaniec, Zofia; Kulinski, Tadeusz; Kierzek, Ryszard
2005-08-16
Trinucleotide repeat expansion diseases (TREDs) are correlated with elongation of CNG DNA and RNA repeats to pathological level. This paper shows, for the first time, complete data concerning thermodynamic stabilities of RNA with CNG trinucleotide repeats. Our studies include the stability of oligoribonucleotides composed of two to seven of CAG, CCG, CGG, and CUG repeats. The thermodynamic parameters of helix propagation correlated with the presence of multiple N-N mismatches within CNG RNA duplexes were also determined. Moreover, the total stability of CNG RNA hairpins, as well as the contribution of trinucleotide repeats placed only in the stem or loop regions, was evaluated. The improved thermodynamic parameters allow to predict much more accurately the thermodynamic stabilities and structures of CNG RNAs.
Johnson, Robert P; Fleming, Aaron M; Jin, Qian; Burrows, Cynthia J; White, Henry S
2014-08-19
The latch region of the wild-type protein pore α-hemolysin (α-HL) constitutes a sensing zone for individual abasic sites (and furan analogs) in double-stranded DNA (dsDNA). The presence of an abasic site or furan within a DNA duplex, electrophoretically captured in the α-HL vestibule and positioned at the latch region, can be detected based on the current blockage prior to duplex unzipping. We investigated variations in blockage current as a function of temperature (12-35°C) and KCl concentration (0.15-1.0 M) to understand the origin of the current signature and to optimize conditions for identifying the base modification. In 1 M KCl solution, substitution of a furan for a cytosine base in the latch region results in an ∼ 8 kJ mol(-1) decrease in the activation energy for ion transport through the protein pore. This corresponds to a readily measured ∼ 2 pA increase in current at room temperature. Optimal resolution for detecting the presence of a furan in the latch region is achieved at lower KCl concentrations, where the noise in the measured blockage current is significantly lower. The noise associated with the blockage current also depends on the stability of the duplex (as measured from the melting temperature), where a greater noise in the measured blockage current is observed for less stable duplexes. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.
A device that operates within a self-assembled 3D DNA crystal
NASA Astrophysics Data System (ADS)
Hao, Yudong; Kristiansen, Martin; Sha, Ruojie; Birktoft, Jens J.; Hernandez, Carina; Mao, Chengde; Seeman, Nadrian C.
2017-08-01
Structural DNA nanotechnology finds applications in numerous areas, but the construction of objects, 2D and 3D crystalline lattices and devices is prominent among them. Each of these components has been developed individually, and most of them have been combined in pairs. However, to date there are no reports of independent devices contained within 3D crystals. Here we report a three-state 3D device whereby we change the colour of the crystals by diffusing strands that contain dyes in or out of the crystals through the mother-liquor component of the system. Each colouring strand is designed to pair with an extended triangle strand by Watson-Crick base pairing. The arm that contains the dyes is quite flexible, but it is possible to establish the presence of the duplex proximal to the triangle by X-ray crystallography. We modelled the transition between the red and blue states through a simple kinetic model.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha
An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less
NASA Astrophysics Data System (ADS)
Mandal, Arka; Patra, Sudipta; Chakrabarti, Debalay; Singh, Shiv Brat
2017-12-01
A lean duplex stainless steel (LDSS) has been prepared with low-N content and processed by different thermo-mechanical schedules, similar to the industrial processing that comprised hot-rolling, cold-rolling, and annealing treatments. The microstructure developed in the present study on low-N LDSS has been compared to that of high-N LDSS as reported in the literature. As N is an austenite stabilizer, lower-N content reduced the stability of austenite and the austenite content in low-N LDSS with respect to the conventional LDSS. Due to low stability of austenite in low-N LDSS, cold rolling resulted in strain-induced martensitic transformation and the reversion of martensite to austenite during subsequent annealing contributed to significant grain refinement within the austenite regions. δ-ferrite grains in low-N LDSS, on the other hand, are refined by extended recovery mechanism. Initial solidification texture (mainly cube texture) within the δ-ferrite region finally converted into gamma-fiber texture after cold rolling and annealing. Although MS-brass component dominated the austenite texture in low-N LDSS after hot rolling and cold rolling, that even transformed into alpha-fiber texture after the final annealing. Due to the significant grain refinement and formation of beneficial texture within both austenite and ferrite, good combination of strength and ductility has been achieved in cold-rolled and annealed sample of low-N LDSS steel.
Pan, Feng; Man, Viet Hoang; Roland, Christopher; Sagui, Celeste
2018-04-26
Expansions of both GGC and CCG sequences lead to a number of expandable, trinucleotide repeat (TR) neurodegenerative diseases. Understanding of these diseases involves, among other things, the structural characterization of the atypical DNA and RNA secondary structures. We have performed molecular dynamics simulations of (GCC) n and (GGC) n homoduplexes in order to characterize their conformations, stability, and dynamics. Each TR has two reading frames, which results in eight nonequivalent RNA/DNA homoduplexes, characterized by CpG or GpC steps between the Watson-Crick base pairs. Free energy maps for the eight homoduplexes indicate that the C-mismatches prefer anti-anti conformations, while G-mismatches prefer anti-syn conformations. Comparison between three modifications of the DNA AMBER force field shows good agreement for the mismatch free energy maps. The mismatches in DNA-GCC (but not CCG) are extrahelical, forming an extended e-motif. The mismatched duplexes exhibit characteristic sequence-dependent step twist, with strong variations in the G-rich sequences and the e-motif. The distribution of Na + is highly localized around the mismatches, especially G-mismatches. In the e-motif, there is strong Na + binding by two G(N7) atoms belonging to the pseudo GpC step created when cytosines are extruded and by extrahelical cytosines. Finally, we used a novel technique based on fast melting by means of an infrared laser pulse to classify the relative stability of the different DNA-CCG and -GGC homoduplexes.
Novel DNA lesions generated by the interaction between therapeutic thiopurines and UVA light.
Zhang, Xiaohong; Jeffs, Graham; Ren, Xiaolin; O'Donovan, Peter; Montaner, Beatriz; Perrett, Conal M; Karran, Peter; Xu, Yao-Zhong
2007-03-01
The therapeutic effect of the thiopurines, 6-thioguanine (6-TG), 6-mercaptopurine, and its prodrug azathioprine, depends on the incorporation of 6-TG into cellular DNA. Unlike normal DNA bases, 6-TG absorbs UVA radiation, and UVA-mediated photochemical damage of DNA 6-TG has potentially harmful side effects. When free 6-TG is UVA irradiated in solution in the presence of molecular oxygen, reactive oxygen species are generated and 6-TG is oxidized to guanine-6-sulfonate (G(SO3)) and guanine-6-thioguanine in reactions involving singlet oxygen. This conversion is prevented by antioxidants, including the dietary vitamin ascorbate. DNA G(SO3) is also the major photoproduct of 6-TG in DNA and it can be selectively introduced into DNA or oligonucleotides in vitro by mild chemical oxidation. Thermal stability measurements indicate that G(SO3) does not form stable base pairs with any of the normal DNA bases in duplex oligonucleotides and is a powerful block for elongation by Klenow DNA polymerase in primer extension experiments. In cultured human cells, DNA damage produced by 6-TG and UVA treatment is associated with replication inhibition and provokes a p53-dependent DNA damage response.
Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.
Kimoto, Michiko; Hirao, Ichiro
2017-10-20
Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.
Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard
2013-01-01
Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce. PMID:23409088
Structural basis for the recognition of guide RNA and target DNA heteroduplex by Argonaute
Miyoshi, Tomohiro; Ito, Kosuke; Murakami, Ryo; Uchiumi, Toshio
2016-01-01
Argonaute proteins are key players in the gene silencing mechanisms mediated by small nucleic acids in all domains of life from bacteria to eukaryotes. However, little is known about the Argonaute protein that recognizes guide RNA/target DNA. Here, we determine the 2 Å crystal structure of Rhodobacter sphaeroides Argonaute (RsAgo) in a complex with 18-nucleotide guide RNA and its complementary target DNA. The heteroduplex maintains Watson–Crick base-pairing even in the 3′-region of the guide RNA between the N-terminal and PIWI domains, suggesting a recognition mode by RsAgo for stable interaction with the target strand. In addition, the MID/PIWI interface of RsAgo has a system that specifically recognizes the 5′ base-U of the guide RNA, and the duplex-recognition loop of the PAZ domain is important for the DNA silencing activity. Furthermore, we show that Argonaute discriminates the nucleic acid type (RNA/DNA) by recognition of the duplex structure of the seed region. PMID:27325485
Structural basis for the recognition of guide RNA and target DNA heteroduplex by Argonaute.
Miyoshi, Tomohiro; Ito, Kosuke; Murakami, Ryo; Uchiumi, Toshio
2016-06-21
Argonaute proteins are key players in the gene silencing mechanisms mediated by small nucleic acids in all domains of life from bacteria to eukaryotes. However, little is known about the Argonaute protein that recognizes guide RNA/target DNA. Here, we determine the 2 Å crystal structure of Rhodobacter sphaeroides Argonaute (RsAgo) in a complex with 18-nucleotide guide RNA and its complementary target DNA. The heteroduplex maintains Watson-Crick base-pairing even in the 3'-region of the guide RNA between the N-terminal and PIWI domains, suggesting a recognition mode by RsAgo for stable interaction with the target strand. In addition, the MID/PIWI interface of RsAgo has a system that specifically recognizes the 5' base-U of the guide RNA, and the duplex-recognition loop of the PAZ domain is important for the DNA silencing activity. Furthermore, we show that Argonaute discriminates the nucleic acid type (RNA/DNA) by recognition of the duplex structure of the seed region.
Matvienko, Marta; Kozik, Alexander; Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard
2013-01-01
Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce.
Ensuring an exit strategy: RTEL1 restricts rogue recombination.
Villeneuve, Anne M
2008-10-17
Success of homologous recombination-based DNA repair depends not only on recombinases, which promote invasion of the homologous DNA duplex that serves as a template for repair, but also on antirecombinases, which dismantle recombination intermediates to allow completion of repair. In this issue, Barber et al. (2008) identify a previously elusive antirecombinase activity important for maintaining genome stability in animals.
Yeh, Joanne I; Shivachev, Boris; Rapireddy, Srinivas; Crawford, Matthew J; Gil, Roberto R; Du, Shoucheng; Madrid, Marcela; Ly, Danith H
2010-08-11
We have determined the structure of a PNA-DNA duplex to 1.7 A resolution by multiple-wavelength anomalous diffraction phasing method on a zinc derivative. This structure represents the first high-resolution 3D view of a hybrid duplex containing a contiguous chiral PNA strand with complete gamma-backbone modification ("gammaPNA"). Unlike the achiral counterpart, which adopts a random-fold, this particular gammaPNA is already preorganized into a right-handed helix as a single strand. The new structure illustrates the unique characteristics of this modified PNA, possessing conformational flexibility while maintaining sufficient structural integrity to ultimately adopt the preferred P-helical conformation upon hybridization with DNA. The unusual structural adaptability found in the gammaPNA strand is crucial for enabling the accommodation of backbone modifications while constraining conformational states. In conjunction with NMR analysis characterizing the structures and substructures of the individual building blocks, these results provide unprecedented insights into how this new class of chiral gammaPNA is preorganized and stabilized, before and after hybridization with a cDNA strand. Such knowledge is crucial for the future design and development of PNA for applications in biology, biotechnology, and medicine.
Hydrogen effects in duplex stainless steel welded joints - electrochemical studies
NASA Astrophysics Data System (ADS)
Michalska, J.; Łabanowski, J.; Ćwiek, J.
2012-05-01
In this work results on the influence of hydrogen on passivity and corrosion resistance of 2205 duplex stainless steel (DSS) welded joints are described. The results were discussed by taking into account three different areas on the welded joint: weld metal (WM), heat-affected zone (HAZ) and parent metal. The corrosion resistance was qualified with the polarization curves registered in a synthetic sea water. The conclusion is that, hydrogen may seriously deteriorate the passive film stability and corrosion resistance to pitting of 2205 DSS welded joints. The presence of hydrogen in passive films increases corrosion current density and decreases the potential of the film breakdown. It was also found that degree of susceptibility to hydrogen degradation was dependent on the hydrogen charging conditions. WM region has been revealed as the most sensitive to hydrogen action.
Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.
Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M
2015-03-19
Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.
Kostjukov, V V; Lantushenko, A O; Davies, D B; Evstigneev, M P
2007-08-01
Molecular dynamics simulations of drug-DNA complexes have been carried out in order to explain the experimentally observed decrease in thermal stability of the DNA hairpin d(GCGAAGC) on binding the aromatic drug molecules, daunomycin, ethidium bromide, novantrone and proflavine. This complexation behavior is in contrast to the stabilizing effect of the same aromatic drug molecules on DNA duplexes. Analysis of the energy parameters and the hydration properties of the complexes shows that the main factor correlating with the decrease in melting temperatures of the drug-hairpin complexes is the number of water bridges, with a reduction of at least 40% on ligand binding.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Topping, R.J.; Stone, M.P.; Brush, C.K.
The {sup 1}H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25{degree}C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25{degree}C, the various conformational state in the mixture are in rapid exchange on the NMR time scale.more » Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5{degree}C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C{sup +}:G base pairs.« less
Mg2+ Effect on Argonaute and RNA Duplex by Molecular Dynamics and Bioinformatics Implications
Nam, Seungyoon; Ryu, Hyojung; Son, Won-joon; Kim, Yon Hui; Kim, Kyung Tae; Balch, Curt; Nephew, Kenneth P.; Lee, Jinhyuk
2014-01-01
RNA interference (RNAi), mediated by small non-coding RNAs (e.g., miRNAs, siRNAs), influences diverse cellular functions. Highly complementary miRNA-target RNA (or siRNA-target RNA) duplexes are recognized by an Argonaute family protein (Ago2), and recent observations indicate that the concentration of Mg2+ ions influences miRNA targeting of specific mRNAs, thereby modulating miRNA-mRNA networks. In the present report, we studied the thermodynamic effects of differential [Mg2+] on slicing (RNA silencing cycle) through molecular dynamics simulation analysis, and its subsequent statistical analysis. Those analyses revealed different structural conformations of the RNA duplex in Ago2, depending on Mg2+ concentration. We also demonstrate that cation effects on Ago2 structural flexibility are critical to its catalytic/functional activity, with low [Mg2+] favoring greater Ago2 flexibility (e.g., greater entropy) and less miRNA/mRNA duplex stability, thus favoring slicing. The latter finding was supported by a negative correlation between expression of an Mg2+ influx channel, TRPM7, and one miRNA’s (miR-378) ability to downregulate its mRNA target, TMEM245. These results imply that thermodynamics could be applied to siRNA-based therapeutic strategies, using highly complementary binding targets, because Ago2 is also involved in RNAi slicing by exogenous siRNAs. However, the efficacy of a siRNA-based approach will differ, to some extent, based on the Mg2+ concentration even within the same disease type; therefore, different siRNA-based approaches might be considered for patient-to-patient needs. PMID:25330448
DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.
Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L
2017-09-01
Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.
de La Harpe, Kimberly; Kohl, Forrest R; Zhang, Yuyuan; Kohler, Bern
2018-03-08
To better understand how the solvent influences excited-state deactivation in DNA strands, femtosecond time-resolved IR (fs-TRIR) pump-probe measurements were performed on a d(AT) 9 ·d(AT) 9 duplex dissolved in a deep eutectic solvent (DES) made from choline chloride and ethylene glycol in a 1:2 mol ratio. This solvent, known as ethaline, is a member of a class of ionic liquids capable of solubilizing DNA with minimal disruption to its secondary structure. UV melting analysis reveals that the duplex studied here melts at 18 °C in ethaline compared to 50 °C in aqueous solution. Ethaline has an excellent transparency window that facilitates TRIR measurements in the double-bond stretching region. Transient spectra recorded in deuterated ethaline at room temperature indicate that photoinduced intrastrand charge transfer occurs from A to T, yielding the same exciplex state previously detected in aqueous solution. This state decays via charge recombination with a lifetime of 380 ± 10 ps compared to the 300 ± 10 ps lifetime measured earlier in D 2 O solution. The TRIR data strongly suggest that the long-lived exciplex forms exclusively in the solvated duplex, and not in the denatured single strands, which appear to have little, if any, base stacking. The longer lifetime of the exciplex state in the DES compared to aqueous solution is suggested to arise from reduced stabilization of the charge transfer state, resulting in slower charge recombination on account of Marcus inverted behavior.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-01
The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194
NASA Astrophysics Data System (ADS)
Brancolini, Giorgia; Di Felice, Rosa
2011-05-01
Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kouchakdjian, M.; Patel, D.J.; Bodepudi, V.
1991-02-05
Proton NMR studies are reported on the complementary d(C1-C2-A3-C4-T5-A6-oxo-G7-T8-C9-A10-C11-C12){center dot}d(G13-G14-T15-G16-A17-A18-T19-A20-G21-T22-G23-G24) dodecanucleotide duplex (designated 8-oxo-7H-dG{center dot}dA 12-mer), which contains a centrally located 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) residue, a group commonly found in DNA that has been exposed to ionizing radiation or oxidizing free radicals. From the NMR spectra it can be deduced that this moiety exists as two tautomers, or gives rise to two DNA conformations, that are in equilibrium and that exchange slowly. The present study focuses on the major component of the equilibrium that originates in the 6,8-dioxo tautomer of 8-oxo-7H-dG. The authors have assigned the exchangeable NH1, NH7, and NH{submore » 2}-2 base protons located on the Watson-Crick and Hoogsteen edges of 8-oxo-7H-dG7 in the 8-oxo-7H-dG{center dot}dA 12-mer duplex, using an analysis of one- and two-dimensional nuclear Overhauser enhancement (NOE) data in H{sub 2}O solution. They were able to detect a set of intra- and interstrand NOEs between protons (exchangeable and nonexchangeable) on adjacent residues in the d(A6-oxo-G7-T8){center dot}d(A17-A18-T19) trinucleotide segment centered about the lesion site that establishes stacking of the oxo-dG7(syn){center dot}dA(anti) pair between stable Watson-Crick dA6{center dot}dT19 and dT8{center dot}A17 base pairs with minimal perturbation of the helix. The structural studies demonstrate that 8-oxo-7H-dG(syn){center dot}dA(anti) forms a stable pair in the interior of the helix, providing a basis for the observed incorporation of dA opposite 8-oxo-7H-dG when readthrough occurs past this oxidized nucleoside base.« less
A 2',2'-disulfide-bridged dinucleotide conformationally locks RNA hairpins.
Gauthier, Florian; Beltran, Frédéric; Biscans, Annabelle; Debart, Françoise; Dupouy, Christelle; Vasseur, Jean-Jacques
2018-05-02
The synthesis and the impact of a disulfide bridge between 2'-O-positions of two adjacent nucleotides in an RNA duplex and in the loop of RNA hairpins are reported. The incorporation of this 2',2'-disulfide (S-S) bridge enabled thermal and enzymatic stabilization of the hairpin depending on its position in the loop. The influence of the disulfide bridge on RNA folding was studied at the HIV Dimerization Initiation Site (DIS) as an RNA sequence model. We have shown that this S-S bridge locked the hairpin form, whereas the extended duplex form was generated after the reduction of the disulfide bond in the presence of tris(2-carboxyethyl)phosphine or glutathione. Thus, the S-S bridge can be useful for understanding RNA folding; an RNA molecular beacon locked by an S-S bridge was also investigated as a sensor for the detection of glutathione.
Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes
Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.
2015-01-01
Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137
Nucleic Acid Chaperone Activity of the ORF1 Protein from the Mouse LINE-1 Retrotransposon
Martin, Sandra L.; Bushman, Frederic D.
2001-01-01
Non-LTR retrotransposons such as L1 elements are major components of the mammalian genome, but their mechanism of replication is incompletely understood. Like retroviruses and LTR-containing retrotransposons, non-LTR retrotransposons replicate by reverse transcription of an RNA intermediate. The details of cDNA priming and integration, however, differ between these two classes. In retroviruses, the nucleocapsid (NC) protein has been shown to assist reverse transcription by acting as a “nucleic acid chaperone,” promoting the formation of the most stable duplexes between nucleic acid molecules. A protein-coding region with an NC-like sequence is present in most non-LTR retrotransposons, but no such sequence is evident in mammalian L1 elements or other members of its class. Here we investigated the ORF1 protein from mouse L1 and found that it does in fact display nucleic acid chaperone activities in vitro. L1 ORF1p (i) promoted annealing of complementary DNA strands, (ii) facilitated strand exchange to form the most stable hybrids in competitive displacement assays, and (iii) facilitated melting of an imperfect duplex but stabilized perfect duplexes. These findings suggest a role for L1 ORF1p in mediating nucleic acid strand transfer steps during L1 reverse transcription. PMID:11134335
Muraiso, T; Nomoto, S; Yamazaki, H; Mishima, Y; Kominami, R
1992-01-01
A protein that binds to a synthetic oligonucleotide of (CCT)12 has been purified from Ehrlich ascites tumor cells by a (CCT)12 affinity chromatography. The protein (p70) has an apparent molecular mass of 70 kDa, as assayed by Southwestern analysis. A competition experiment revealed that p70 binds to (CCT)12, (CCCT)8 and (CCTCCCT)6, but not to (CTT)12, (CT)16 and (CCTGCCT)6, suggesting that p70 has a sequence-specificity. The complementary (AGG)12 and the double stranded DNA did not show the binding. It is also confirmed by S1 nuclease analysis that the (AGG:CCT)12 duplex takes a single-stranded conformation in the absence of the protein. This raises a possibility that the duplex forms two single-stranded loops in chromosomes, the C-rich strand being bound to p70. Structural analysis of the resulting (AGG)12 strand by non-denaturing polyacrylamide gel electrophoresis demonstrated the presence of slower and faster migrated conformers in a neutral pH buffer containing 50 mM NaCl at 5 degrees C. The ratio was dependent on the DNA concentration. Both conformers disappeared in the absence of NaCl. This suggests that (AGG)12 can form intra- and inter-molecular complexes by non-Watson-Crick, guanine:guanine base-pairing. The possible biological function of the (AGG:CCT)n duplex and the p70 is discussed. Images PMID:1480484
Kowal, Ewa A.; Lad, Rahul R.; Pallan, Pradeep S.; Dhummakupt, Elizabeth; Wawrzak, Zdzislaw; Egli, Martin; Sturla, Shana J.; Stone, Michael P.
2013-01-01
The 2′-deoxynucleoside containing the synthetic base 1-[(2R,4S,5R)-4-hydroxy-5-(hydroxymethyl)-tetrahydrofuran-2-yl)-1H-perimidin-2(3H)-one] (dPer) recognizes in DNA the O6-benzyl-2′-deoxyguanosine nucleoside (O6-Bn-dG), formed by exposure to N-benzylmethylnitrosamine. Herein, we show how dPer distinguishes between O6-Bn-dG and dG in DNA. The structure of the modified Dickerson–Drew dodecamer (DDD) in which guanine at position G4 has been replaced by O6-Bn-dG and cytosine C9 has been replaced with dPer to form the modified O6-Bn-dG:dPer (DDD-XY) duplex [5′-d(C1G2C3X4A5A6T7T8Y9G10C11G12)-3′]2 (X = O6-Bn-dG, Y = dPer) reveals that dPer intercalates into the duplex and adopts the syn conformation about the glycosyl bond. This provides a binding pocket that allows the benzyl group of O6-Bn-dG to intercalate between Per and thymine of the 3′-neighbor A:T base pair. Nuclear magnetic resonance data suggest that a similar intercalative recognition mechanism applies in this sequence in solution. However, in solution, the benzyl ring of O6-Bn-dG undergoes rotation on the nuclear magnetic resonance time scale. In contrast, the structure of the modified DDD in which cytosine at position C9 is replaced with dPer to form the dG:dPer (DDD-GY) [5′-d(C1G2C3G4A5A6T7T8Y9G10C11G12)-3′]2 duplex (Y = dPer) reveals that dPer adopts the anti conformation about the glycosyl bond and forms a less stable wobble pairing interaction with guanine. PMID:23748954
Janwan, Penchom; Intapan, Pewpan M; Thanchomnang, Tongjit; Lulitanond, Viraphong; Anamnart, Witthaya; Maleewong, Wanchai
2011-12-01
Human opisthorchiasis caused by the liver fluke Opisthorchis viverrini is an endemic disease in Southeast Asian countries including the Lao People's Democratic Republic, Cambodia, Vietnam, and Thailand. Infection with the soil-transmitted roundworm Strongyloides stercoralis is an important problem worldwide. In some areas, both parasitic infections are reported as co-infections. A duplex real-time fluorescence resonance energy transfer (FRET) PCR merged with melting curve analysis was developed for the rapid detection of O. viverrini and S. stercoralis in human fecal samples. Duplex real-time FRET PCR is based on fluorescence melting curve analysis of a hybrid of amplicons generated from two genera of DNA elements: the 162 bp pOV-A6 DNA sequence specific to O. viverrini and the 244 bp 18S rRNA sequence specific to S. stercoralis, and two pairs of specific fluorophore-labeled probes. Both O. viverrini and S. stercoralis can be differentially detected in infected human fecal samples by this process through their different fluorescence channels and melting temperatures. Detection limit of the method was as little as two O. viverrini eggs and four S. stercoralis larvae in 100 mg of fecal sample. The assay could distinguish the DNA of both parasites from the DNA of negative fecal samples and fecal samples with other parasite materials, as well as from the DNA of human leukocytes and other control parasites. The technique showed 100% sensitivity and specificity. The introduced duplex real-time FRET PCR can reduce labor time and reagent costs and is not prone to carry over contamination. The method is important for simultaneous detection especially in areas where both parasites overlap incidence and is useful as the screening tool in the returning travelers and immigrants to industrialized countries where number of samples in the diagnostic units will become increasing.
Stazic, Damir; Lindell, Debbie; Steglich, Claudia
2011-01-01
The ecologically important cyanobacterium Prochlorococcus possesses the smallest genome among oxyphototrophs, with a reduced suite of protein regulators and a disproportionately high number of regulatory RNAs. Many of these are asRNAs, raising the question whether they modulate gene expression through the protection of mRNA from RNase E degradation. To address this question, we produced recombinant RNase E from Prochlorococcus sp. MED4, which functions optimally at 12 mM Mg2+, pH 9 and 35°C. RNase E cleavage assays were performed with this recombinant protein to assess enzyme activity in the presence of single- or double-stranded RNA substrates. We found that extraordinarily long asRNAs of 3.5 and 7 kb protect a set of mRNAs from RNase E degradation that accumulate during phage infection. These asRNA–mRNA duplex formations mask single-stranded recognition sites of RNase E, leading to increased stability of the mRNAs. Such interactions directly modulate RNA stability and provide an explanation for enhanced transcript abundance of certain mRNAs during phage infection. Protection from RNase E-triggered RNA decay may constitute a hitherto unknown regulatory function of bacterial cis-asRNAs, impacting gene expression. PMID:21325266
Stazic, Damir; Lindell, Debbie; Steglich, Claudia
2011-06-01
The ecologically important cyanobacterium Prochlorococcus possesses the smallest genome among oxyphototrophs, with a reduced suite of protein regulators and a disproportionately high number of regulatory RNAs. Many of these are asRNAs, raising the question whether they modulate gene expression through the protection of mRNA from RNase E degradation. To address this question, we produced recombinant RNase E from Prochlorococcus sp. MED4, which functions optimally at 12 mM Mg(2+), pH 9 and 35°C. RNase E cleavage assays were performed with this recombinant protein to assess enzyme activity in the presence of single- or double-stranded RNA substrates. We found that extraordinarily long asRNAs of 3.5 and 7 kb protect a set of mRNAs from RNase E degradation that accumulate during phage infection. These asRNA-mRNA duplex formations mask single-stranded recognition sites of RNase E, leading to increased stability of the mRNAs. Such interactions directly modulate RNA stability and provide an explanation for enhanced transcript abundance of certain mRNAs during phage infection. Protection from RNase E-triggered RNA decay may constitute a hitherto unknown regulatory function of bacterial cis-asRNAs, impacting gene expression.
Zhao, Yong; Kan, Zhong-yuan; Zeng, Zhi-xiong; Hao, Yu-hua; Chen, Hua; Tan, Zheng
2004-10-20
Nucleic acid molecules may fold into secondary structures, and the formation of such structures is involved in many biological processes and technical applications. The folding and unfolding rate constants define the kinetics of conformation interconversion and the stability of these structures and is important in realizing their functions. We developed a method to determine these kinetic parameters using an optical biosensor based on surface plasmon resonance. The folding and unfolding of a nucleic acid is coupled with a hybridization reaction by immobilization of the target nucleic acid on a sensor chip surface and injection of a complementary probe nucleic acid over the sensor chip surface. By monitoring the time course of duplex formation, both the folding and unfolding rate constants for the target nucleic acid and the association and dissociation rate constants for the target-probe duplex can all be derived from the same measurement. We applied this method to determine the folding and unfolding rate constants of the G-quadruplex of human telomere sequence (TTAGGG)(4) and its association and dissociation rate constants with the complementary strand (CCCTAA)(4). The results show that both the folding and unfolding occur on the time scale of minutes at physiological concentration of K(+). We speculate that this property might be important for telomere elongation. A complete set of the kinetic parameters for both of the structures allows us to study the competition between the formation of the quadruplex and the duplex. Calculations indicate that the formation of both the quadruplex and the duplex is strand concentration-dependent, and the quadruplex can be efficiently formed at low strand concentration. This property may provide the basis for the formation of the quadruplex in vivo in the presence of a complementary strand.
Sheng, Gang; Gogakos, Tasos; Wang, Jiuyu; Zhao, Hongtu; Serganov, Artem; Juranek, Stefan
2017-01-01
Abstract We have undertaken a systematic structural study of Thermus thermophilus Argonaute (TtAgo) ternary complexes containing single-base bulges positioned either within the seed segment of the guide or target strands and at the cleavage site. Our studies establish that single-base bulges 7T8, 5A6 and 4A5 on the guide strand are stacked-into the duplex, with conformational changes localized to the bulge site, thereby having minimal impact on the cleavage site. By contrast, single-base bulges 6’U7’ and 6’A7’ on the target strand are looped-out of the duplex, with the resulting conformational transitions shifting the cleavable phosphate by one step. We observe a stable alignment for the looped-out 6’N7’ bulge base, which stacks on the unpaired first base of the guide strand, with the looped-out alignment facilitated by weakened Watson–Crick and reversed non-canonical flanking pairs. These structural studies are complemented by cleavage assays that independently monitor the impact of bulges on TtAgo-mediated cleavage reaction. PMID:28911094
Terminal structures of West Nile virus genomic RNA and their interactions with viral NS5 protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dong Hongping; Zhang Bo; Shi Peiyong
2008-11-10
Genome cyclization is essential for flavivirus replication. We used RNases to probe the structures formed by the 5'-terminal 190 nucleotides and the 3'-terminal 111 nucleotides of the West Nile virus (WNV) genomic RNA. When analyzed individually, the two RNAs adopt stem-loop structures as predicted by the thermodynamic-folding program. However, when mixed together, the two RNAs form a duplex that is mediated through base-pairings of two sets of RNA elements (5'CS/3'CSI and 5'UAR/3'UAR). Formation of the RNA duplex facilitates a conformational change that leaves the 3'-terminal nucleotides of the genome (position - 8 to - 16) to be single-stranded. Viral NS5more » binds specifically to the 5'-terminal stem-loop (SL1) of the genomic RNA. The 5'SL1 RNA structure is essential for WNV replication. The study has provided further evidence to suggest that flavivirus genome cyclization and NS5/5'SL1 RNA interaction facilitate NS5 binding to the 3' end of the genome for the initiation of viral minus-strand RNA synthesis.« less
Sharma, Nidhi; Hoshika, Shuichi; Hutter, Daniel; Bradley, Kevin M; Benner, Steven A
2014-10-13
Recombinase polymerase amplification (RPA) is an isothermal method to amplify nucleic acid sequences without the temperature cycling that classical PCR uses. Instead of using heat to denature the DNA duplex, RPA uses recombination enzymes to swap single-stranded primers into the duplex DNA product; these are then extended using a strand-displacing polymerase to complete the cycle. Because RPA runs at low temperatures, it never forces the system to recreate base-pairs following Watson-Crick rules, and therefore it produces undesired products that impede the amplification of the desired product, complicating downstream analysis. Herein, we show that most of these undesired side products can be avoided if the primers contain components of a self-avoiding molecular recognition system (SAMRS). Given the precision that is necessary in the recombination systems for them to function biologically, it is surprising that they accept SAMRS. SAMRS-RPA is expected to be a powerful tool within the range of amplification techniques available to scientists. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Li, Jing; Wang, Xingyu; Liang, Xingguo
2014-12-01
Azobenzene has been widely used as a photoregulator due to its reversible photoisomerization, large structural change between E and Z isomers, high photoisomerization yield, and high chemical stability. On the other hand, some azobenzene derivatives can be used as universal quenchers for many fluorophores. Nucleic acid is a good candidate to be modified because it is not only the template of gene expression but also widely used for building well-organized nanostructures and nanodevices. Because the size and polarity distribution of the azobenzene molecule is similar to a nucleobase pair, the introduction of azobenzene into nucleic acids has been shown to be an ingenious molecular design for constructing light-switching biosystems or light-driven nanomachines. Here we review recent advances in azobenzene-modified nucleic acids and their applications for artificial regulation of gene expression and enzymatic reactions, construction of photoresponsive nanostructures and nanodevices, molecular beacons, as well as obtaining structural information using the introduced azobenzene as an internal probe. In particular, nucleic acids bearing multiple azobenzenes can be used as a novel artificial nanomaterial with merits of high sequence specificity, regular duplex structure, and high photoregulation efficiency. The combination of functional groups with biomolecules may further advance the development of chemical biotechnology and biomolecular engineering. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Single-Molecule Counting of Point Mutations by Transient DNA Binding
NASA Astrophysics Data System (ADS)
Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan
2017-03-01
High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.
Spink, N; Brown, D G; Skelly, J V; Neidle, S
1994-01-01
The bis-benzimidazole drug Hoechst 33258 has been co-crystallized with the dodecanucleotide sequence d(CGCAAATTTGCG)2. The structure has been solved by molecular replacement and refined to an R factor of 18.5% for 2125 reflections collected on a Xentronics area detector. The drug is bound in the minor groove, at the five base-pair site 5'-ATTTG and is in a unique orientation. This is displaced by one base pair in the 5' direction compared to previously-determined structures of this drug with the sequence d(CGCGAATTCGCG)2. Reasons for this difference in behaviour are discussed in terms of several sequence-dependent structural features of the DNA, with particular reference to differences in propeller twist and minor-groove width. Images PMID:7515488
Molecular switching behavior in isosteric DNA base pairs.
Jissy, A K; Konar, Sukanya; Datta, Ayan
2013-04-15
The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ruminski, Dana J; Watson, Peter Y; Mahen, Elisabeth M; Fedor, Martha J
2016-03-01
RNAs must assemble into specific structures in order to carry out their biological functions, but in vitro RNA folding reactions produce multiple misfolded structures that fail to exchange with functional structures on biological time scales. We used carefully designed self-cleaving mRNAs that assemble through well-defined folding pathways to identify factors that differentiate intracellular and in vitro folding reactions. Our previous work showed that simple base-paired RNA helices form and dissociate with the same rate and equilibrium constants in vivo and in vitro. However, exchange between adjacent secondary structures occurs much faster in vivo, enabling RNAs to quickly adopt structures with the lowest free energy. We have now used this approach to probe the effects of an extensively characterized DEAD-box RNA helicase, Mss116p, on a series of well-defined RNA folding steps in yeast. Mss116p overexpression had no detectable effect on helix formation or dissociation kinetics or on the stability of interdomain tertiary interactions, consistent with previous evidence that intracellular factors do not affect these folding parameters. However, Mss116p overexpression did accelerate exchange between adjacent helices. The nonprocessive nature of RNA duplex unwinding by DEAD-box RNA helicases is consistent with a branch migration mechanism in which Mss116p lowers barriers to exchange between otherwise stable helices by the melting and annealing of one or two base pairs at interhelical junctions. These results suggest that the helicase activity of DEAD-box proteins like Mss116p distinguish intracellular RNA folding pathways from nonproductive RNA folding reactions in vitro and allow RNA structures to overcome kinetic barriers to thermodynamic equilibration in vivo. © 2016 Ruminski et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Zhang, Ziping; Tao, Cancan; Yin, Jungang; Wang, Yunhui; Li, Yanshen
2018-04-30
Electrochemical aptamer (EA) sensors based on aptamer-cDNA duplex probes (cDNA: complementary DNA) and target induced strand displacement (TISD) recognition are sensitive, selective and capable of detecting a wide variety of target analytes. While substantial research efforts have focused on engineering of new signaling mechanisms for the improvement of sensor sensitivity, little attention was paid to the enhancement of sensor response rate. Typically, the previous TISD based EA sensors exhibited relatively long response times larger than 30min, which mainly resulted from the suboptimal aptamer-cDNA probe structure in which most of aptamer bases were paired to the cDNA bases. In an effort to improve the response rate of this type of sensors, we report here the rational engineering of a quickly responsive and sensitive aptamer-cDNA probe by employing the conception of bivalent interaction in supramolecular chemistry. We design a bivalent cDNA strand through linking two short monovalent cDNA sequences, and it is simultaneously hybridized to two electrode-immobilized aptamer probes to form a bivalent binding (BB) aptamer-cDNA probe. This class of BB probe possesses the advantages of less aptamer bases paired to the cDNA bases for quick response rate and good structural stability for high sensor sensitivity. By use of the rationally designed BB aptamer-cDNA probe, a TISD based EA sensor against ATP with significantly enhanced response rate (with a displacement equilibrium time of 4min) and high sensitivity was successfully constructed. We believe that our BB probe conception will help guide future designs and applications of TISD based EA sensors. Copyright © 2017 Elsevier B.V. All rights reserved.
Renal pelvis urothelial carcinoma of the upper moiety in complete right renal duplex: a case report.
Zhang, Yiran; Yu, Quanfeng; Zhang, Zhihong; Liu, Ranlu; Xu, Yong
2015-01-01
Urothelial carcinoma (UC) originated from renal pelvis is the common tumor of the urinary system, however, neoplasia of the renal pelvis in duplex kidneys is extremely rare, especially in the complete renal and ureteral duplex cases. We present the first case of renal pelvis UC of the upper moiety in a complete right renal duplex. This male patient has bilateral complete renal and ureteral duplex. To the best of our knowledge, this is the first reported case of renal pelvis UC in a complete renal duplex system. After this experience we feel that the diagnosis of renal pelvis UC in duplex kidneys is not so easy, and once the diagnosis is determined, the whole renal duplex units and bladder cuff or ectopic orifice should be excised radically.
Synthesis, base pairing and structure studies of geranylated RNA
Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia
2016-01-01
Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao
2016-03-18
Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems.
Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao
2016-01-01
Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems. PMID:26999129
NASA Astrophysics Data System (ADS)
Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.
2005-09-01
The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.
Zanchetta, Giuliano; Giavazzi, Fabio; Nakata, Michi; Buscaglia, Marco; Cerbino, Roberto; Clark, Noel A.; Bellini, Tommaso
2010-01-01
Concentrated solutions of duplex-forming DNA oligomers organize into various mesophases among which is the nematic (N∗), which exhibits a macroscopic chiral helical precession of molecular orientation because of the chirality of the DNA molecule. Using a quantitative analysis of the transmission spectra in polarized optical microscopy, we have determined the handedness and pitch of this chiral nematic helix for a large number of sequences ranging from 8 to 20 bases. The B-DNA molecule exhibits a right-handed molecular double-helix structure that, for long molecules, always yields N∗ phases with left-handed pitch in the μm range. We report here that ultrashort oligomeric duplexes show an extremely diverse behavior, with both left- and right-handed N∗ helices and pitches ranging from macroscopic down to 0.3 μm. The behavior depends on the length and the sequence of the oligomers, and on the nature of the end-to-end interactions between helices. In particular, the N∗ handedness strongly correlates with the oligomer length and concentration. Right-handed phases are found only for oligomers shorter than 14 base pairs, and for the sequences having the transition to the N∗ phase at concentration larger than 620 mg/mL. Our findings indicate that in short DNA, the intermolecular double-helical interactions switch the preferred liquid crystal handedness when the columns of stacked duplexes are forced at high concentrations to separations comparable to the DNA double-helix pitch, a regime still to be theoretically described. PMID:20876125
NASA Astrophysics Data System (ADS)
Kang, Y.; Zhang, L.; Zhang, H.; Wu, T.; Du, Y.
2017-05-01
A sensitive and selective surface-enhanced Raman scattering (SERS) sensor for mercury(II) was fabricated based on the target-mediated displacement of a T-rich oligonucleotide strand. A DNA/aptamer duplex was prepared by the hybridization between a tetramethylrhodamine(TMR)-labeled thymine(T)-rich Hg2+-specific aptamer (denoted as TMR-aptamer) and a thiolated adenine-rich capturing DNA. The duplex can be immobilized onto the SERS substrate of the Ag-moiety modified glycidyl methacrylate-ethylene dimethacrylate (denoted as Ag-GMA-EDMA) via self-assembly by the thiol anchor, in which the TMR-aptamer exists in a double-stranded chain. In this case, the label of the TMR moiety approaches the substrate surface and produces a strong SERS signal. Upon the addition of the target, a pair of TMR-aptamers could cooperatively coordinate with Hg2+ to form a stable duplex-like structure mediated by the T-Hg2+-T complex between two adjacent strands, which triggers the release of the TMR-aptamer from the SERS substrate surface, thus drawing the TMR tags away from the substrate with a significant decrease in the SERS signal. This optical sensor shows a sensitive response to Hg2+ in a concentration from 5 nM to 2.0 μM with a detection limit of 2.5 nM. The prepared sensor is negligibly responsive to other metal ions, can be easily regenerated, and shows good performance in real sample analysis.
Gleghorn, Michael L.; Zhao, Jianbo; Turner, Douglas H.; ...
2016-06-10
We have solved at 1.07 Å resolution the X-ray crystal structure of a polyriboadenylic acid (poly(rA)) parallel and continuous double helix. Fifty-nine years ago, double helices of poly(rA) were first proposed to form at acidic pH. Here, we show that 7-mer oligo(rA), i.e. rA 7, hybridizes and overlaps in all registers at pH 3.5 to form stacked double helices that span the crystal. Under these conditions, rA 7 forms well-ordered crystals, whereas rA 6 forms fragile crystalline-like structures, and rA 5, rA 8 and rA 11 fail to crystallize. Our findings support studies from ~50 years ago: one showed usingmore » spectroscopic methods that duplex formation at pH 4.5 largely starts with rA 7 and begins to plateau with rA 8; another proposed a so-called ‘staggered zipper’ model in which oligo(rA) strands overlap in multiple registers to extend the helical duplex. While never shown, protonation of adenines at position N1 has been hypothesized to be critical for helix formation. Bond angles in our structure suggest that N1 is protonated on the adenines of every other rAMP–rAMP helix base pair. Lastly, our data offer new insights into poly(rA) duplex formation that may be useful in developing a pH sensor.« less
Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J
2005-09-22
The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gleghorn, Michael L.; Zhao, Jianbo; Turner, Douglas H.
We have solved at 1.07 Å resolution the X-ray crystal structure of a polyriboadenylic acid (poly(rA)) parallel and continuous double helix. Fifty-nine years ago, double helices of poly(rA) were first proposed to form at acidic pH. Here, we show that 7-mer oligo(rA), i.e. rA 7, hybridizes and overlaps in all registers at pH 3.5 to form stacked double helices that span the crystal. Under these conditions, rA 7 forms well-ordered crystals, whereas rA 6 forms fragile crystalline-like structures, and rA 5, rA 8 and rA 11 fail to crystallize. Our findings support studies from ~50 years ago: one showed usingmore » spectroscopic methods that duplex formation at pH 4.5 largely starts with rA 7 and begins to plateau with rA 8; another proposed a so-called ‘staggered zipper’ model in which oligo(rA) strands overlap in multiple registers to extend the helical duplex. While never shown, protonation of adenines at position N1 has been hypothesized to be critical for helix formation. Bond angles in our structure suggest that N1 is protonated on the adenines of every other rAMP–rAMP helix base pair. Lastly, our data offer new insights into poly(rA) duplex formation that may be useful in developing a pH sensor.« less
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Multi-shell model of ion-induced nucleic acid condensation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois
2016-04-21
We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes in- duced by tri-valent cobalt hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. The duplex aggregation free energy is de- composed into attraction and repulsion components represented by simple analytic expressions. The source of the short-range attraction between NA duplexes in the aggregated phase is the in- teraction of CoHex ions in the overlapping regions of the “external” shells with the oppositely chargedmore » duplexes. The attraction depends on CoHex binding affinity to the “external” shell of nearly neutralized duplex and the number of ions in the shell overlapping volume. For a given NA duplex sequence and structure, these parameters are estimated from molecular dynamics simula- tion. The attraction is opposed by the residual repulsion of nearly neutralized duplexes as well as duplex configurational entropy loss upon aggregation. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA conden- sation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. The model also predicts that longer NA fragments will condense easier than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation, lends support to proposed NA condensation picture based on the multivalent “ion binding shells”.« less
Vira, Shaleen; Ramme, Austin J; Alaia, Michael J; Steiger, David; Vigdorchik, Jonathan M; Jaffe, Frederick
2016-07-01
Duplex ultrasound is routinely used to evaluate suspected deep venous thrombosis after total joint arthroplasty. When there is a clinical suspicion for a pulmonary embolism, a chest angiogram (chest CTA) is concomitantly obtained. Two questions were addressed: First, for the population of patients who receive duplex ultrasound after total joint arthroplasty, what is the rate of positive results? Second, for these patients, how many of these also undergo chest CTA for clinical suspicion of pulmonary embolus and how many of these tests are positive? Furthermore, what is the correlation between duplex ultrasound results and chest CTA results? A retrospective chart review was conducted of total joint replacement patients in 2011 at a single institution. Inclusion criteria were adult patients who underwent a postoperative duplex ultrasonography for clinical suspicion of deep venous thrombosis (DVT). Demographic data, result of duplex scan, clinical indications for obtaining the duplex scan, and DVT prophylaxis used were recorded. Additionally, if a chest CTA was obtained for clinical suspicion for pulmonary embolus, results and clinical indication for obtaining the test were recorded. The rate of positive results for duplex ultrasonography and chest CTA was computed and correlated based on clinical indications. Two hundred ninety-five patients underwent duplex ultrasonography of which only 0.7% were positive for a DVT. One hundred three patients underwent a chest CTA for clinical suspicion of a pulmonary embolism (PE) of which 26 revealed a pulmonary embolus, none of which had a positive duplex ultrasound. Postoperative duplex scans have a low rate of positive results. A substantial number of patients with negative duplex results subsequently underwent chest CTA for clinical suspicion for which a pulmonary embolus was found, presumably resulting from a DVT despite negative duplex ultrasound result. A negative duplex ultrasonography should not rule out the presence of a DVT which can embolize to the lungs and thus should not preclude further workup when clinical suspicion exists for a pulmonary embolus.
Stabilizing windings for tilting and shifting modes
Jardin, Stephen C.; Christensen, Uffe R.
1984-01-01
This invention relates to passive conducting loops for stabilizing a plasma ring against unstable tilting and/or shifting modes. To this end, for example, plasma ring in a spheromak is stabilized by a set of four figure-8 shaped loops having one pair on one side of the plasma and one pair on the other side with each pair comprising two loops whose axes are transverse to each other.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Philip, Vivek M; Harris, Jason B; Adams, Rachel M
Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242 8249]. To study the role of anion interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused onmore » identification of Phe Asp or Glu pairs separated by less than 7 in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura Morokuma energy calculations were performed on roughly 19000 benzene formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (2 to 7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion pairs are found throughout protein structures, in helices as well as strands. Numerous pairs also had nearby cation interactions as well as potential stacking. While more than 1000 structures did not contain an anion pair, the 3134 remaining structures contained approximately 2.6 anion pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Philip, Vivek M; Harris, Jason B; Adams, Rachel M
Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion-{pi} pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion-quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242-8249]. To study the role of anion-{pi} interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification ofmore » Phe-Asp or -Glu pairs separated by less than 7 {angstrom} in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura-Morokuma energy calculations were performed on roughly 19000 benzene-formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (-2 to -7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion-{pi} pairs are found throughout protein structures, in helices as well as {beta} strands. Numerous pairs also had nearby cation-{pi} interactions as well as potential {pi}-{pi} stacking. While more than 1000 structures did not contain an anion-{pi} pair, the 3134 remaining structures contained approximately 2.6 anion-{pi} pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.« less
Philip, Vivek; Harris, Jason; Adams, Rachel; Nguyen, Don; Spiers, Jeremy; Baudry, Jerome; Howell, Elizabeth E; Hinde, Robert J
2011-04-12
Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion-π pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion-quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242-8249]. To study the role of anion-π interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification of Phe-Asp or -Glu pairs separated by less than 7 Å in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura-Morokuma energy calculations were performed on roughly 19000 benzene-formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (-2 to -7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion-π pairs are found throughout protein structures, in helices as well as β strands. Numerous pairs also had nearby cation-π interactions as well as potential π-π stacking. While more than 1000 structures did not contain an anion-π pair, the 3134 remaining structures contained approximately 2.6 anion-π pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.
Genetic Homologies Among Streptomyces violaceoruber Strains
Monson, A. M.; Bradley, S. G.; Enquist, L. W.; Cruces, Griselda
1969-01-01
Most of the genetic studies on streptomycetes have been done with cultures erroneously designated as Streptomyces coelicolor. To determine whether these cultures are genetically homologous with the S. violaceoruber nominifer, their deoxyribonucleic acids (DNA) were analyzed, and selected pairs of mutants were crossed. The four cultures used in genetic studies, and called S. coelicolor in the literature, were found to constitute a genospecies, based upon DNA hybridization and recombination tests. In addition, DNA from Actinopycnidium caeruleum formed extensive duplexes with S. violaceoruber DNA. S. violaceoruber cultures and A. caeruleum were distinctly different from the S. coelicolor nominifer. PMID:5370275
Electronic properties of long DNA nanowires in dry and wet conditions
NASA Astrophysics Data System (ADS)
Mousavi, Hamze; Khodadadi, Jabbar; Grabowski, Marek
2015-11-01
The electronic behavior of the long disordered DNA nanowires in both dry and wet conditions is investigated through the band structure and density of states of a tight-binding Hamiltonian model for π-electrons of the backbone, using Green's functions approach. For a chosen set of parameters in the dry case, semiconducting behavior is reproduced. It is also shown that for sufficiently long strands, the order of the base pairs has no noticeable effect on the energy band-gap. Moreover, this semiconducting duplex shows metallic tendencies when interacting with the environment of polar molecules.
AGT Activity Towards Intrastrand Crosslinked DNA is Modulated by the Alkylene Linker.
O'Flaherty, Derek K; Wilds, Christopher J
2017-12-05
DNA oligomers containing dimethylene and trimethylene intrastrand crosslinks (IaCLs) between the O4 and O6 atoms of neighboring thymidine (T) and 2'-deoxyguanosine (dG) residues were prepared by solid-phase synthesis. UV thermal denaturation (T m ) experiments revealed that these IaCLs had a destabilizing effect on the DNA duplex relative to the control. Circular dichroism spectroscopy suggested these IaCLs induced minimal structural distortions. Susceptibility to dealkylation by reaction with various O 6 -alkylguanine DNA alkyltransferases (AGTs) from human and Escherichia coli was evaluated. It was revealed that only human AGT displayed activity towards the IaCL DNA, with reduced efficiency as the IaCL shortened (from four to two methylene linkages). Changing the site of attachment of the ethylene linkage at the 5'-end of the IaCL to the N3 atom of T had minimal influence on duplex stability and structure, and was refractory to AGT activity. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
He, Christine; Gállego, Isaac; Laughlin, Brandon; Grover, Martha A.; Hud, Nicholas V.
2017-04-01
Many hypotheses concerning the nature of early life assume that genetic information was once transferred through the template-directed synthesis of RNA, before the emergence of coded enzymes. However, attempts to demonstrate enzyme-free, template-directed synthesis of nucleic acids have been limited by 'strand inhibition', whereby transferring information from a template strand in the presence of its complementary strand is inhibited by the stability of the template duplex. Here, we use solvent viscosity to circumvent strand inhibition, demonstrating information transfer from a gene-length template (>300 nt) within a longer (545 bp or 3 kb) duplex. These results suggest that viscous environments on the prebiotic Earth, generated periodically by water evaporation, could have facilitated nucleic acid replication—particularly of long, structured sequences such as ribozymes. Our approach works with DNA and RNA, suggesting that viscosity-mediated replication is possible for a range of genetic polymers, perhaps even for informational polymers that may have preceded RNA.
Barnes, Christopher O.; Calero, Monica; Malik, Indranil; Graham, Brian W.; Spahr, Henrik; Lin, Guowu; Cohen, Aina; Brown, Ian S.; Zhang, Qiangmin; Pullara, Filippo; Trakselis, Michael A.; Kaplan, Craig D.; Calero, Guillermo
2015-01-01
Summary Notwithstanding numerous published structures of RNA Polymerase II (Pol II), structural details of Pol II engaging a complete nucleic acid scaffold have been lacking. Here, we report the structures of TFIIF stabilized transcribing Pol II complexes, revealing the upstream duplex and full transcription bubble. The upstream duplex lies over a wedge-shaped loop from Rpb2 that engages its minor groove, providing part of the structural framework for DNA tracking during elongation. At the upstream transcription bubble fork, rudder and fork loop-1 residues spatially coordinate strand annealing and the nascent RNA transcript. At the downstream fork, a network of Pol II interactions with the non-template strand forms a rigid domain with the Trigger Loop (TL), allowing visualization of its open state. Overall, our observations suggest that “open/closed” conformational transitions of the TL may be linked to interactions with the non-template strand, possibly in a synchronized ratcheting manner conducive to polymerase translocation. PMID:26186291
Zoster duplex: a clinical report and etiologic analysis.
Zhang, Feng; Zhou, Jin
2015-01-01
Herpes zoster (HZ) duplex is a rare disease presentation. The mechanisms of varicella zoster virus (VZV) reactivation in multiple dermal regions are unknown. To present a HZ duplex case occurring in an immunocompetent woman and to analyze the possible underlying causes of HZ duplex. We present a HZ duplex case in an immunocompetent woman and analyzed the possible contributing factors in 36 HZ duplex cases. Continuously distributed variables were categorized by numbers and percentages. In our study, 24 cases (66.7%) were from Asia, 16 cases (44.4%) were in individuals ≥ 50 years of age, and 17 cases (47.2%) occurred in immunocompromised patients. Of the 36 cases, 23 involved women (63.9%) and 13 involved men. Eighteen patients suffering from HZ duplex, 13 of which were women (72.2%), did not suffer from any chronic systemic disease or have a long history of taking drugs. HZ duplex is a rare event that can occur in both immunocompetent and immunosuppressed individuals. HZ duplex might be associated with the Asia region, advanced age, immunosuppression, and being female.
Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân
2017-09-20
Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.
Mokhir, A A; Connors, W H; Richert, C
2001-09-01
A total of 16 oligodeoxyribonucleotides of general sequence 5'-TCTTCTZTCTTTCT-3', where Z denotes an N-acyl-N-(2-hydroxyethyl)glycine residue, were prepared via solid phase synthesis. The ability of these oligonucleotides to form triplexes with the duplex 5'-AGAAGATAGAAAGA-HEG-TCTTTCTATCTTCT-3', where HEG is a hexaethylene glycol linker, was tested. In these triplexes, an 'interrupting' T:A base pair faces the Z residue in the third strand. Among the acyl moieties of Z tested, an anthraquinone carboxylic acid residue linked via a glycinyl group gave the most stable triplex, whose UV melting point was 8.4 degrees C higher than that of the triplex with 5'-TCTTCTGTCTTTCT-3' as the third strand. The results from exploratory nuclease selection experiments suggest that a combinatorial search for strands capable of recognizing mixed sequences by triple helix formation is feasible.
Triple Helix Formation in a Topologically Controlled DNA Nanosystem.
Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki
2016-04-11
In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kaushik, Mahima; Kukreti, Shrikant
2006-01-01
Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of beta-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A --> B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.
Moriguchi, Tomohisa; Azam, A T M Zafrul; Shinozuka, Kazuo
2011-06-15
Two types of anthraquinone conjugates were synthesized as non-nucleosidic oligonucleotide components. These include an anthraquinone derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid and an anthraquinone--polyamine derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid. The conjugates were successfully incorporated into the "linking-region" of the α-β chimeric oligonucleotides via phosphoramidite method as non-nucleosidic backbone units. The resultant novel α-β chimeric oligonucleotides possessed two diastereomers that were generated by the introduction of the anthraquinone conjugate with a stereogenic carbon atom. The isomers were successfully separated by a reversed-phase HPLC. UV-melting experiments revealed that both stereoisomers formed a substantially stable alternate-strand triple helix, irrespective of the stereochemistry of the incorporated non-nucleosidic backbone unit. However, the enhancing effect on thermal stability depended on the length of the alkyl linker connecting anthraquinone moiety and the propionic acid moiety. The sequence discrimination ability of the chimeric oligonucleotides toward mismatch target duplex was also examined. The T(m) values of the triplexes containing the mismatch target were substantially lower than the T(m) values of those containing the full-match target. The thermodynamic parameters (ΔH°, ΔS°, and ΔG°) required for the dissociation of the triplexes into the third strand and target duplex were also measured.
A nucleobase-centered coarse-grained representation for structure prediction of RNA motifs.
Poblete, Simón; Bottaro, Sandro; Bussi, Giovanni
2018-02-28
We introduce the SPlit-and-conQueR (SPQR) model, a coarse-grained (CG) representation of RNA designed for structure prediction and refinement. In our approach, the representation of a nucleotide consists of a point particle for the phosphate group and an anisotropic particle for the nucleoside. The interactions are, in principle, knowledge-based potentials inspired by the $\\mathcal {E}$SCORE function, a base-centered scoring function. However, a special treatment is given to base-pairing interactions and certain geometrical conformations which are lost in a raw knowledge-based model. This results in a representation able to describe planar canonical and non-canonical base pairs and base-phosphate interactions and to distinguish sugar puckers and glycosidic torsion conformations. The model is applied to the folding of several structures, including duplexes with internal loops of non-canonical base pairs, tetraloops, junctions and a pseudoknot. For the majority of these systems, experimental structures are correctly predicted at the level of individual contacts. We also propose a method for efficiently reintroducing atomistic detail from the CG representation.
Click nucleic acid ligation: applications in biology and nanotechnology.
El-Sagheer, Afaf H; Brown, Tom
2012-08-21
Biochemical strategies that use a combination of synthetic oligonucleotides, thermostable DNA polymerases, and DNA ligases can produce large DNA constructs up to 1 megabase in length. Although these ambitious targets are feasible biochemically, comparable technologies for the chemical synthesis of long DNA strands lag far behind. The best available chemical approach is the solid-phase phosphoramidite method, which can be used to assemble DNA strands up to 150 bases in length. Beyond this point, deficiencies in the chemistry make it impossible to produce pure DNA. A possible alternative approach to the chemical synthesis of large DNA strands is to join together carefully purified synthetic oligonucleotides by chemical methods. Click ligation by the copper-catalyzed azide-alkyne (CuAAC) reaction could facilitate this process. In this Account, we describe the synthesis, characterization, and applications of oligonucleotides prepared by click ligation. The alkyne and azide oligonucleotide strands can be prepared by standard protocols, and the ligation reaction is compatible with a wide range of chemical modifications to DNA and RNA. We have employed click ligation to synthesize DNA constructs up to 300 bases in length and much longer sequences are feasible. When the resulting triazole linkage is placed in a PCR template, various DNA polymerases correctly copy the entire base sequence. We have also successfully demonstrated both in vitro transcription and rolling circle amplification through the modified linkage. This linkage has shown in vivo biocompatibility: an antibiotic resistance gene containing triazole linkages functions in E. coli . Using click ligation, we have synthesized hairpin ribozymes up to 100 nucleotides in length and a hammerhead ribozyme with the triazole linkage located at the substrate cleavage site. At the opposite end of the length scale, click-ligated, cyclic mini-DNA duplexes have been used as models to study base pairing. Cyclic duplexes have potential therapeutic applications. They have extremely high thermodynamic stability, have increased resistance to enzymatic degradation, and have been investigated as decoys for regulatory proteins. For potential nanotechnology applications, we have synthesized double stranded DNA catenanes by click ligation. Other researchers have studied covalently fixed multistranded DNA constructs including triplexes and quadruplexes.
García, Begoña; Leal, José M; Paiotta, Vittorio; Ruiz, Rebeca; Secco, Fernando; Venturini, Marcella
2008-06-12
The interactions of triple strands of poly(rA).2poly(rU) with proflavine (PR) and the proflavine cis-platinum derivative [{PtCl (tmen)} 2{NC 13H 7(NCH 2CH 2) 2}] (+) (PRPt) are examined at pH 7.0, T = 25 degrees C, and 0.2 M ionic strength by spectrophotometry, spectrofluorometry, circular dichroism, viscosimetry, stopped-flow, and T-jump relaxation techniques. The melting experiments demonstrate that both drugs tend to destabilize the triplex structure, although the PRPt effect is more relevant. By contrast, both drugs tend to slightly stabilize the duplex structure. The viscosity and circular dichroism measurements show that, at a low dye-to-polymer ratio ( C D/ C P), the binding is intercalative, whereas at high C D/ C P values, the external binding dominates. The binding kinetics and equilibria have been investigated over the C D/ C P region, where intercalation is operative. Both drugs bind to the RNA triplex according to the excluded site model. With PR, two kinetic effects have been observed, whereas with PRPt, only one has been observed. The results are interpreted according to the reaction schemes D + S right arrow over left arrow DS I, with PRPt, and D + S right arrow over left arrow DS I right arrow over left arrow DS II, with PR. The electrostatic contribution to the formation activation energy for DS I is similar (40%) for both systems. The results suggest that DS I is a partially intercalated species. Absence of the second step with PRPt is put down to groove interaction of the Pt-containing moiety, which prevents the PR residue from further penetration through the base pairs to form the fully intercalated complex, DS II. Comparison with the binding of the same drugs to the duplex reveals that the occupation of the major groove in poly(rA).2poly(rU) by the third strand plays a critical role in the kinetic behavior.
Multi-shell model of ion-induced nucleic acid condensation
NASA Astrophysics Data System (ADS)
Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois; Baker, Nathan A.; Onufriev, Alexey V.
2016-04-01
We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(iii) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into "external" and "internal" ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derived from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the "external" shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the "internal" shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent "ion binding shells."
Methods And Devices For Characterizing Duplex Nucleic Acid Molecules
Akeson, Mark; Vercoutere, Wenonah; Haussler, David; Winters-Hilt, Stephen
2005-08-30
Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.
Why double-stranded RNA resists condensation
Tolokh, Igor S.; Pabit, Suzette A.; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V.
2014-01-01
The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes—internal and external—distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode. PMID:25123663
Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.
Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara
2017-02-20
The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.
Mu, Hong; Geacintov, Nicholas E; Min, Jung-Hyun; Zhang, Yingkai; Broyde, Suse
2017-06-19
The xeroderma pigmentosum C protein complex (XPC) recognizes a variety of environmentally induced DNA lesions and is the key in initiating their repair by the nucleotide excision repair (NER) pathway. When bound to a lesion, XPC flips two nucleotide pairs that include the lesion out of the DNA duplex, yielding a productively bound complex that can lead to successful lesion excision. Interestingly, the efficiencies of NER vary greatly among different lesions, influencing their toxicity and mutagenicity in cells. Though differences in XPC binding may influence NER efficiency, it is not understood whether XPC utilizes different mechanisms to achieve productive binding with different lesions. Here, we investigated the well-repaired 10R-(+)-cis-anti-benzo[a]pyrene-N 2 -dG (cis-B[a]P-dG) DNA adduct in a duplex containing normal partner C opposite the lesion. This adduct is derived from the environmental pro-carcinogen benzo[a]pyrene and is likely to be encountered by NER in the cell. We have extensively investigated its binding to the yeast XPC orthologue, Rad4, using umbrella sampling with restrained molecular dynamics simulations and free energy calculations. The NMR solution structure of this lesion in duplex DNA has shown that the dC complementary to the adducted dG is flipped out of the DNA duplex in the absence of XPC. However, it is not known whether the "pre-flipped" base would play a role in its recognition by XPC. Our results show that Rad4 first captures the displaced dC, which is followed by a tightly coupled lesion-extruding pathway for productive binding. This binding path differs significantly from the one deduced for the small cis-syn cyclobutane pyrimidine dimer lesion opposite mismatched thymines [ Mu , H. , ( 2015 ) Biochemistry , 54 ( 34 ), 5263 - 7 ]. The possibility of multiple paths that lead to productive binding to XPC is consistent with the versatile lesion recognition by XPC that is required for successful NER.
2017-01-01
The xeroderma pigmentosum C protein complex (XPC) recognizes a variety of environmentally induced DNA lesions and is the key in initiating their repair by the nucleotide excision repair (NER) pathway. When bound to a lesion, XPC flips two nucleotide pairs that include the lesion out of the DNA duplex, yielding a productively bound complex that can lead to successful lesion excision. Interestingly, the efficiencies of NER vary greatly among different lesions, influencing their toxicity and mutagenicity in cells. Though differences in XPC binding may influence NER efficiency, it is not understood whether XPC utilizes different mechanisms to achieve productive binding with different lesions. Here, we investigated the well-repaired 10R-(+)-cis-anti-benzo[a]pyrene-N2-dG (cis-B[a]P-dG) DNA adduct in a duplex containing normal partner C opposite the lesion. This adduct is derived from the environmental pro-carcinogen benzo[a]pyrene and is likely to be encountered by NER in the cell. We have extensively investigated its binding to the yeast XPC orthologue, Rad4, using umbrella sampling with restrained molecular dynamics simulations and free energy calculations. The NMR solution structure of this lesion in duplex DNA has shown that the dC complementary to the adducted dG is flipped out of the DNA duplex in the absence of XPC. However, it is not known whether the “pre-flipped” base would play a role in its recognition by XPC. Our results show that Rad4 first captures the displaced dC, which is followed by a tightly coupled lesion-extruding pathway for productive binding. This binding path differs significantly from the one deduced for the small cis-syn cyclobutane pyrimidine dimer lesion opposite mismatched thymines [MuH., (2015) Biochemistry, 54(34), 5263−726270861]. The possibility of multiple paths that lead to productive binding to XPC is consistent with the versatile lesion recognition by XPC that is required for successful NER. PMID:28460163
From a structural average to the conformational ensemble of a DNA bulge
Shi, Xuesong; Beauchamp, Kyle A.; Harbury, Pehr B.; Herschlag, Daniel
2014-01-01
Direct experimental measurements of conformational ensembles are critical for understanding macromolecular function, but traditional biophysical methods do not directly report the solution ensemble of a macromolecule. Small-angle X-ray scattering interferometry has the potential to overcome this limitation by providing the instantaneous distance distribution between pairs of gold-nanocrystal probes conjugated to a macromolecule in solution. Our X-ray interferometry experiments reveal an increasing bend angle of DNA duplexes with bulges of one, three, and five adenosine residues, consistent with previous FRET measurements, and further reveal an increasingly broad conformational ensemble with increasing bulge length. The distance distributions for the AAA bulge duplex (3A-DNA) with six different Au-Au pairs provide strong evidence against a simple elastic model in which fluctuations occur about a single conformational state. Instead, the measured distance distributions suggest a 3A-DNA ensemble with multiple conformational states predominantly across a region of conformational space with bend angles between 24 and 85 degrees and characteristic bend directions and helical twists and displacements. Additional X-ray interferometry experiments revealed perturbations to the ensemble from changes in ionic conditions and the bulge sequence, effects that can be understood in terms of electrostatic and stacking contributions to the ensemble and that demonstrate the sensitivity of X-ray interferometry. Combining X-ray interferometry ensemble data with molecular dynamics simulations gave atomic-level models of representative conformational states and of the molecular interactions that may shape the ensemble, and fluorescence measurements with 2-aminopurine-substituted 3A-DNA provided initial tests of these atomistic models. More generally, X-ray interferometry will provide powerful benchmarks for testing and developing computational methods. PMID:24706812
Cattalani, Andrea; Grasso, Vincenzo Maria; Vitali, Matteo; Gallesio, Ivan; Magrassi, Lorenzo; Barbanera, Andrea
2017-11-01
The incidence of chronic Subdural hematoma (cSDH) is increasing and its rate of recurrence varies from 5 to 33%. A postoperative brain midline-shift (MLS) on computed tomography (CT) equal or larger than 5mm is a risk factor for recurrence. Transcranial color-coded duplex sonography (TCCDS) is a noninvasive bedside reproducible technique useful to detect MLS. The aim of our study was to compare in patients affected by cSDH, the values of MLS obtained pre- and post-operatively by TCCDS and brain CT. 32 patients affected by cSDH entered the study between July 2016 and January 2017. MLS values obtained by TCCDS and brain CT were compared using Bland-Altman plot and linear regression analysis. Using the same techniques we also explored if the agreement between the two imaging modes was comparable in pre- and post-operative data pairs. 64 data pairs of MLS values obtained by TCCDS and CT were analysed. Bland-Altman diagrams did not show any systematic bias of the data and linear regression indicated a significant correlation between the two measures both before and after hematoma evacuation. In patients affected by cSDH, MLS values obtained before and after surgery by TCCDS are comparable to those obtained by CT; TCCDS might be considered an alternative to CT scan in the management of patients after cSDH evacuation. We suggest that close clinical bedside examination and TCCDS might be appropriate for the post-operative management of cSDH, reserving CT scan only to patients with overt clinical deterioration and/or increasing MLS. Copyright © 2017 Elsevier B.V. All rights reserved.
Excited-state dynamics of mononucleotides and DNA strands in a deep eutectic solvent.
Zhang, Yuyuan; de La Harpe, Kimberly; Hariharan, Mahesh; Kohler, Bern
2018-04-17
The photophysics of several mono- and oligonucleotides were investigated in a deep eutectic solvent for the first time. The solvent glyceline, prepared as a 1 : 2 mole ratio mixture of choline chloride and glycerol, was used to study excited-state deactivation in a non-aqueous solvent by the use of steady-state and time-resolved spectroscopy. DNA strands in glyceline retain the secondary structures that are present in aqueous solution to some degree, thus enabling a study of the effects of solvent properties on the excited states of stacked bases and stacked base pairs. The excited-state lifetime of the mononucleotide 5'-AMP in glyceline is 630 fs, or twice as long as in aqueous solution. Even slower relaxation is seen for 5'-TMP in glyceline, and a possible triplet state with a lifetime greater than 3 ns is observed. Circular dichroism spectra show that the single strand (dA)18 and the duplex d(AT)9·d(AT)9 adopt similar structures in glyceline and in aqueous solution. Despite having similar conformations in both solvents, femtosecond transient absorption experiments reveal striking changes in the dynamics. Excited-state decay and vibrational cooling generally take place more slowly in glyceline than in water. Additionally, the fraction of long-lived excited states in both oligonucleotide systems is lower in glyceline than in aqueous solution. For a DNA duplex, water is suggested to favor decay pathways involving intrastrand charge separation, while the deep eutectic solvent favors interstrand deactivation channels involving neutral species. Slower solvation dynamics in the viscous deep eutectic solvent may also play a role. These results demonstrate that the dynamics of excitations in stacked bases and stacked base pairs depend not only on conformation, but are also highly sensitive to the solvent.
Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi
2014-01-01
The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683
Synthesis, base pairing and structure studies of geranylated RNA.
Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia
2016-07-27
Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M
1981-01-01
In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931
Plchova, Helena; Hartung, Frank; Puchta, Holger
2003-11-07
The human Werner syndrome protein (hWRN-p) possessing DNA helicase and exonuclease activities is essential for genome stability. Plants have no homologue of this bifunctional protein, but surprisingly the Arabidopsis genome contains a small open reading frame (ORF) (AtWRNexo) with homology to the exonuclease domain of hWRN-p. Expression of this ORF in Escherichia coli revealed an exonuclease activity for AtWRN-exo-p with similarities but also some significant differences to hWRN-p. The protein digests recessed strands of DNA duplexes in the 3' --> 5' direction but hardly single-stranded DNA or blunt-ended duplexes. In contrast to the Werner exonuclease, AtWRNexo-p is also able to digest 3'-protruding strands. DNA with recessed 3'-PO4 and 3'-OH termini is degraded to a similar extent. AtWRNexo-p hydrolyzes the 3'-recessed strand termini of duplexes containing mismatched bases. AtWRNexo-p needs the divalent cation Mg2+ for activity, which can be replaced by Mn2+. Apurinic sites, cholesterol adducts, and oxidative DNA damage (such as 8-oxoadenine and 8-oxoguanine) inhibit or block the enzyme. Other DNA modifications, including uracil, hypoxanthine and ethenoadenine, did not inhibit AtWRNexo-p. A mutation of a conserved residue within the exonuclease domain (E135A) completely abolished the exonucleolytic activity. Our results indicate that a type of WRN-like exonuclease activity seems to be a common feature of the DNA metabolism of animals and plants.
Analysis of features of stainless steels in dissimilar welded joints in chloride inducted corrosion
NASA Astrophysics Data System (ADS)
Topolska, S.; Łabanowski, J.
2017-08-01
Stainless steels of femtic-austenitic microstructure that means the duplex Cr-Ni-Mo steels, in comparison with austenitic steel includes less expensive nickel and has much better mechanical properties with good formability and corrosion resistance, even in environments containing chloride ions. Similar share of high chromium ferrite and austenite, which is characterized by high ductility, determines that the duplex steels have good crack resistance at temperatures up to approximately -40°C. The steels containing approximately 22% Cr, 5% Ni, 3% Mo and 0.2% N crystallizes as a solid solution δ, partially transforming from the temperature of about 1200°C to 850°C into the phase α. The stable structure of considered steels, at temperatures above 850°C, is ferrite, and at lower temperatures the mixture of phase γ+α +σ. The two-phase structure α+γ the duplex steel obtains after hyperquenching at the temperature of stability of the mixture of α+γ phases, and the share of the phases depends on the hyper quenching attributes. Hyperquenching in water, with a temperature close to 1200°C, ensures the instance in the microstructure of the steel a large share of ferrite and a small share of the high chromium austenite. This causes the increase of strength properties and reducing the plasticity of the steel and its resistance ability to cracking and corrosion. Slower cooling from the mentioned temperature, for example in the air, enables the partial transformation of the a phase into the γ one (α → γ) and increasing the share of austenite in the steel structure. It leads to improvement of plasticity properties. In the paper are presented the results of investigations of heteronymous welded joints of duplex steel and austenitic one. The results include the relation between the chemical composition of steels and their weldability.
Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.
Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P
1997-05-16
The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.
Cho, Young-Jin; Wang, Hao; Kozekov, Ivan D.; Kurtz, Andrew J.; Jacob, Jaison; Voehler, Markus; Smith, Jarrod; Harris, Thomas M.; Lloyd, R. Stephen; Rizzo, Carmelo J.; Stone, Michael P.
2008-01-01
The crotonaldehyde- and acetaldehyde-derived R- and S-α-CH3-γ-OH-1,N2-propanodeoxyguanosine adducts were monitored in single-stranded and duplex oligodeoxynucleotides using NMR spectroscopy. In both instances the cis and trans diastereomers of the α-CH3 and γ-OH groups underwent slow exchange, with the trans diastereomers being favored. In single-stranded oligodeoxynucleotides, the aldehyde intermediates were not detected spectroscopically, but their presence was revealed through the formation of N-terminal conjugates with the tetrapeptide KWKK. When annealed into 5′-d(GCTAGCXAGTCC)-3′•5′-d(GGACTCYCTAGC)-3′ containing the 5′-CpG-3′ sequence context (X=R- or S-α-CH3-γ-13C-OH-PdG; Y=15N2-dG), at pH 7, partial opening of the R- or S-α-CH3-γ-13C-OH-PdG adducts to the corresponding N2-(3-oxo-1-methyl-propyl)-dG aldehydes was observed at temperatures below the Tm of the duplexes. These aldehydes equilibrated with their geminal diol hydrates; higher temperatures favored the aldehydes. When annealed opposite to T, the S-α-CH3-γ-13C-OH-PdG adduct was stable. At 37 °C, an interstrand DNA crosslink was observed spectroscopically only for the R-α-CH3-γ-OH-PdG adduct. Molecular modeling predicted that the interstrand crosslink formed by the R-α-CH3-γ-OH-PdG adduct introduced less disruption into the duplex structure than did the crosslink arising from the S-α-CH3-γ-OH-PdG adduct, due to differing orientations of the R- and S-CH3 groups. Modeling also predicted that the α-methyl group of the aldehyde arising from the R-α-CH3-γ-OH-PdG adduct oriented in the 3′ direction in the minor groove, facilitating crosslinking. In contrast, the α-methyl group of the aldehyde arising from the S-α-CH3-γ-OH-PdG adduct oriented in the 5′ direction within the minor groove potentially hindering crosslinking. NMR revealed that for the R-α-CH3-γ-OH-PdG adduct, the carbinolamine form of the crosslink was favored in duplex DNA, in situ, with the imine or Schiff base form of the crosslink remaining below the level of spectroscopic detection. Molecular modeling predicted that the carbinolamine linkage maintained Watson-Crick hydrogen bonding at both of the tandem C•G base pairs. Dehydration of the carbinolamine crosslink to an imine, or cyclization of the latter to form a pyrimidopurinone crosslink, required disruption of Watson-Crick hydrogen bonding at one or both of the crosslinked base pairs. PMID:16485895
Xie, Ping
2015-10-09
Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.
Xie, Ping
2015-01-01
Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by “hungry” codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel. PMID:26473825
Multi-shell model of ion-induced nucleic acid condensation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois
We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(III) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derivedmore » from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the “external” shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the “internal” shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent “ion binding shells.”.« less
Multi-shell model of ion-induced nucleic acid condensation
Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois; Onufriev, Alexey V.
2016-01-01
We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(iii) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derived from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the “external” shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the “internal” shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent “ion binding shells.” PMID:27389241
Nguyen, Thuy Vy; Riou, Lydia
2014-01-01
Fanconi anemia is a rare genetic disorder that can lead to bone marrow failure, congenital abnormalities, and increased risk for leukemia and cancer. Cells with loss-of-function mutations in the FANC pathway are characterized by chromosome fragility, altered mutability, and abnormal regulation of the nonhomologous end-joining (NHEJ) pathway. Somatic hypermutation (SHM) and immunoglobulin (Ig) class switch recombination (CSR) enable B cells to produce high-affinity antibodies of various isotypes. Both processes are initiated after the generation of dG:dU mismatches by activation-induced cytidine deaminase. Whereas SHM involves an error-prone repair process that introduces novel point mutations into the Ig gene, the mismatches generated during CSR are processed to create double-stranded breaks (DSBs) in DNA, which are then repaired by the NHEJ pathway. As several lines of evidence suggest a possible role for the FANC pathway in SHM and CSR, we analyzed both processes in B cells derived from Fanca−/− mice. Here we show that Fanca is required for the induction of transition mutations at A/T residues during SHM and that despite globally normal CSR function in splenic B cells, Fanca is required during CSR to stabilize duplexes between pairs of short microhomology regions, thereby impeding short-range recombination downstream of DSB formation. PMID:24799500
Nguyen, Thuy Vy; Riou, Lydia; Aoufouchi, Saïd; Rosselli, Filippo
2014-06-02
Fanconi anemia is a rare genetic disorder that can lead to bone marrow failure, congenital abnormalities, and increased risk for leukemia and cancer. Cells with loss-of-function mutations in the FANC pathway are characterized by chromosome fragility, altered mutability, and abnormal regulation of the nonhomologous end-joining (NHEJ) pathway. Somatic hypermutation (SHM) and immunoglobulin (Ig) class switch recombination (CSR) enable B cells to produce high-affinity antibodies of various isotypes. Both processes are initiated after the generation of dG:dU mismatches by activation-induced cytidine deaminase. Whereas SHM involves an error-prone repair process that introduces novel point mutations into the Ig gene, the mismatches generated during CSR are processed to create double-stranded breaks (DSBs) in DNA, which are then repaired by the NHEJ pathway. As several lines of evidence suggest a possible role for the FANC pathway in SHM and CSR, we analyzed both processes in B cells derived from Fanca(-/-) mice. Here we show that Fanca is required for the induction of transition mutations at A/T residues during SHM and that despite globally normal CSR function in splenic B cells, Fanca is required during CSR to stabilize duplexes between pairs of short microhomology regions, thereby impeding short-range recombination downstream of DSB formation. © 2014 Nguyen et al.
Khrapunov, Sergei; Brenowitz, Michael
2011-01-01
MfpA from Mycobacterium tuberculosis is a founding member of the pentapeptide repeat class of proteins (PRP) that is believed to confer bacterial resistance to the drug fluoroquinolone by mimicking the size, shape and surface charge of duplex DNA. We show that phenylalanine side chain stacking stabilizes the N-terminus of MfpA’s pentapeptide thus extending the DNA mimicry analogy. The Lumry-Eyring model was applied to multiple spectral measures of MfpA denaturation revealing that the MfpA dimer dissociates to monomers which undergo a structural transition that leads to aggregation. MfpA retains high secondary and tertiary structure content under denaturing conditions. Dimerization stabilizes MfpA’s pentapeptide repeat fold. The high Arrhenius activation energy of the barrier to aggregate formation rationalizes its stability. The mechanism of MfpA denaturation and refolding is a ‘double funnel’ energy landscape where the ‘native’ and ‘aggregate’ funnels are separated by the high barrier that is not overcome during in vitro refolding. PMID:21605934
Duplex gall bladder: bystander or culprit.
Kumar, Jogender; Yadav, Arushi
2017-08-30
Gall bladder (GB) duplication is a rare anatomical malformation, which can be detected by preoperative imaging study. We present a case of duplex gall bladder in a 14-year-old boy who presented with abdominal pain. On ultrasound, he had right nephrolithiasis and duplex gall bladder. Duplex gall bladder was confirmed on MR cholangiopancreatography. There was a dilemma for surgical management of duplex gall bladder; however, he became asymptomatic after conservative treatment. Prophylactic surgery is not recommended for asymptomatic incidentally detected duplex gall bladder. Radiologists and paediatric surgeons should be sensitised about the exact anatomy of this entity. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
NASA Astrophysics Data System (ADS)
Jinlong, Lv; Zhuqing, Wang; Tongxiang, Liang; Ken, Suzuki; Hideo, Miura
Surface molybdenum enrichment on 2205 duplex stainless steel was obtained by the ball milling technique. The electrochemical results showed molybdenum enrichment on the surface of 2205 duplex stainless steel improved its corrosion resistance in a typical proton exchange membrane fuel cell environment. This was mainly attributed to higher molybdenum content in the passive film formed on 2205 duplex stainless steel after ball milling. The decreased donor and acceptor concentrations improved significantly the corrosion resistance of surface molybdenum-enriched 2205 duplex stainless steel bipolar plates in the simulated cathodic proton exchange membrane fuel cells environment. In addition, the interfacial contact resistance of the 2205 duplex stainless steel bipolar plates slightly decreased due to surface molybdenum enrichment.
Stability and kinetics of G-quadruplex structures
Lane, Andrew N.; Chaires, J. Brad; Gray, Robert D.; Trent, John O.
2008-01-01
In this review, we give an overview of recent literature on the structure and stability of unimolecular G-rich quadruplex structures that are relevant to drug design and for in vivo function. The unifying theme in this review is energetics. The thermodynamic stability of quadruplexes has not been studied in the same detail as DNA and RNA duplexes, and there are important differences in the balance of forces between these classes of folded oligonucleotides. We provide an overview of the principles of stability and where available the experimental data that report on these principles. Significant gaps in the literature have been identified, that should be filled by a systematic study of well-defined quadruplexes not only to provide the basic understanding of stability both for design purposes, but also as it relates to in vivo occurrence of quadruplexes. Techniques that are commonly applied to the determination of the structure, stability and folding are discussed in terms of information content and limitations. Quadruplex structures fold and unfold comparatively slowly, and DNA unwinding events associated with transcription and replication may be operating far from equilibrium. The kinetics of formation and resolution of quadruplexes, and methodologies are discussed in the context of stability and their possible biological occurrence. PMID:18718931
Assembly and analysis of eukaryotic Argonaute–RNA complexes in microRNA-target recognition
Gan, Hin Hark; Gunsalus, Kristin C.
2015-01-01
Experimental studies have uncovered a variety of microRNA (miRNA)–target duplex structures that include perfect, imperfect and seedless duplexes. However, non-canonical binding modes from imperfect/seedless duplexes are not well predicted by computational approaches, which rely primarily on sequence and secondary structural features, nor have their tertiary structures been characterized because solved structures to date are limited to near perfect, straight duplexes in Argonautes (Agos). Here, we use structural modeling to examine the role of Ago dynamics in assembling viable eukaryotic miRNA-induced silencing complexes (miRISCs). We show that combinations of low-frequency, global modes of motion of Ago domains are required to accommodate RNA duplexes in model human and C. elegans Ago structures. Models of viable miRISCs imply that Ago adopts variable conformations at distinct target sites that generate distorted, imperfect miRNA-target duplexes. Ago's ability to accommodate a duplex is dependent on the region where structural distortions occur: distortions in solvent-exposed seed and 3′-end regions are less likely to produce steric clashes than those in the central duplex region. Energetic analyses of assembled miRISCs indicate that target recognition is also driven by favorable Ago-duplex interactions. Such structural insights into Ago loading and target recognition mechanisms may provide a more accurate assessment of miRNA function. PMID:26432829
Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi
2013-07-30
Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.
Jaffer, U; Singh, P; Pandey, V A; Aslam, M; Standfield, N J
2014-01-01
Duplex ultrasound facilitates bedside diagnosis and hence timely patient care. Its uptake has been hampered by training and accreditation issues. We have developed an assessment tool for Duplex arterial stenosis measurement for both simulator and patient based training. A novel assessment tool: duplex ultrasound assessment of technical skills was developed. A modified duplex ultrasound assessment of technical skills was used for simulator training. Novice, intermediate experience and expert users of duplex ultrasound were invited to participate. Participants viewed an instructional video and were allowed ample time to familiarize with the equipment. Participants' attempts were recorded and independently assessed by four experts using the modified duplex ultrasound assessment of technical skills. 'Global' assessment was also done on a four point Likert scale. Content, construct and concurrent validity as well as reliability were evaluated. Content and construct validity as well as reliability were demonstrated. The simulator had good satisfaction rating from participants: median 4; range 3-5. Receiver operator characteristic analysis has established a cut point of 22/ 34 and 25/ 40 were most appropriate for simulator and patient based assessment respectively. We have validated a novel assessment tool for duplex arterial stenosis detection. Further work is underway to establish transference validity of simulator training to improved skill in scanning patients. We have developed and validated duplex ultrasound assessment of technical skills for simulator training.
Aircraft Configured for Flight in an Atmosphere Having Low Density
NASA Technical Reports Server (NTRS)
Teter, Jr., John E. (Inventor); Croom, Mark A. (Inventor); Smith, Stephen C. (Inventor); Gelhausen, Paul A. (Inventor); Hunter, Craig A. (Inventor); Riddick, Steven E. (Inventor); Guynn, Mark D. (Inventor); Paddock, David A. (Inventor)
2012-01-01
An aircraft is configured for flight in an atmosphere having a low density. The aircraft includes a fuselage, a pair of wings, and a rear stabilizer. The pair of wings extends from the fuselage in opposition to one another. The rear stabilizer extends from the fuselage in spaced relationship to the pair of wings. The fuselage, the wings, and the rear stabilizer each present an upper surface opposing a lower surface. The upper and lower surfaces have X, Y, and Z coordinates that are configured for flight in an atmosphere having low density.
Cogoi, Susanna; Paramasivam, Manikandan; Membrino, Alexandro; Yokoyama, Kazunari K.; Xodo, Luigi E.
2010-01-01
The murine KRAS promoter contains a G-rich nuclease hypersensitive element (GA-element) upstream of the transcription start site that is essential for transcription. Pulldown and chromatin immunoprecipitation assays demonstrate that this GA-element is bound by the Myc-associated zinc finger (MAZ) and poly(ADP-ribose) polymerase 1 (PARP-1) proteins. These proteins are crucial for transcription, because when they are knocked down by short hairpin RNA, transcription is down-regulated. This is also the case when the poly(ADP-ribosyl)ation activity of PARP-1 is inhibited by 3,4-dihydro-5-[4-(1-piperidinyl) butoxyl]-1(2H) isoquinolinone. We found that MAZ specifically binds to the duplex and quadruplex conformations of the GA-element, whereas PARP-1 shows specificity only for the G-quadruplex. On the basis of fluorescence resonance energy transfer melting and polymerase stop assays we saw that MAZ stabilizes the KRAS quadruplex. When the capacity of folding in the GA-element is abrogated by specific G → T or G → A point mutations, KRAS transcription is down-regulated. Conversely, guanidine-modified phthalocyanines, which specifically interact with and stabilize the KRAS G-quadruplex, push the promoter activity up to more than double. Collectively, our data support a transcription mechanism for murine KRAS that involves MAZ, PARP-1 and duplex-quadruplex conformational changes in the promoter GA-element. PMID:20457603
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tucker, J. D.; Miller, M. K.; Young, G. A.
Duplex stainless steels are desirable for use in power generation systems due to their attractive combination of strength, corrosion resistance, and cost. However, thermal embrittlement at intermediate homologous temperatures of ~887°F (475°C) and below, via spinodal decomposition, limits upper service temperatures for many applications. New lean grade duplex alloys have improved thermal stability over standard grades and potentially increase the upper service temperature or the lifetime at a given temperature for this class of material. The present work compares the thermal stability of lean grade, alloy 2003 to standard grade, alloy 2205, through a series of isothermal agings between 500°Fmore » (260°C) and 900°F (482°C) for times between 1 and 10,000 hours. Aged samples were characterized by changes in microhardness and impact toughness. Additionally, atom probe tomography was performed to illustrate the evolution of the α-α' phase separation in both alloys at select conditions. Atom probe tomography confirmed that phase separation occurs via spinodal decomposition for both alloys and identified the formation of Ni-Cu-Si-Mn-P clusters in alloy 2205 that may contribute to embrittlement of this alloy. The impact toughness model predictions for upper service temperature show that alloy 2003 can be considered for use in 550°F applications for 80 year service lifetimes based on a Charpy V-notch criteria of 35 ft-lbs at 70°F. Alloy 2205 should be limited to 500°F applications.« less
Quinazoline derivative from indigenous isolate, Nocardiopsis alba inhibits human telomerase enzyme.
Kiran, K G; Thandeeswaran, M; Ayub Nawaz, K A; Easwaran, M; Jayagopi, K K; Ebrahimi, L; Palaniswamy, M; Mahendran, R; Angayarkanni, J
2016-12-01
Aim of this study was isolation and screening of various secondary metabolites produced by indigenous isolates of soil Actinomycetes for human telomerase inhibitory activity. Extracellular extract from culture suspension of various soil Actinomycetes species were tested for telomerase inhibitory activity. The organism which produced telomerase inhibitor was identified by 16S rRNA gene sequencing. The active fraction was purified by HPLC and analysed by GC-MS to identify the compound. In GC-MS analysis, the active principle was identified as 3-[4'-(2″-chlorophenyl)-2'-thiazolyl]-2,4-dioxo-1,2,3,4-tetrahydro quinazoline. The G-quadruplex stabilizing ability of the compound was checked by molecular docking and simulation experiments with G-quadruplex model (PDB ID-1L1H). The selective binding ability of the compound with G-quadruplex over Dickerson-Drew dodecamer DNA structures showed that the compound possess high selectivity towards G-quadruplex. Quinazoline derivative isolated from an indigenous strain of Nocardiopsis alba inhibited telomerase. Molecular docking and simulation studies predicted that this compound is a strong stabilizer of G-quadruplex conformation. It also showed a preferable binding to G-quadruplex DNA over normal DNA duplex. This particular compound can be suggested as a suitable compound for developing a future anticancer drug. The selectivity towards G-quadruplex over normal DNA duplex gives a clue that it is likely to show lower cytotoxicity in normal cells. © 2016 The Society for Applied Microbiology.
Phase transformations in cast duplex stainless steels
NASA Astrophysics Data System (ADS)
Kim, Yoon-Jun
Duplex stainless steels (DSS) constitute both ferrite and austenite as a matrix. Such a microstructure confers a high corrosion resistance with favorable mechanical properties. However, intermetallic phases such as sigma (sigma) and chi (chi) can also form during casting or high-temperature processing and can degrade the properties of the DSS. This research was initiated to develop time-temperature-transformation (TTT) and continuous-cooling-transformation (CCT) diagrams of two types of cast duplex stainless steels, CD3MN (Fe-22Cr-5Ni-Mo-N) and CD3MWCuN (Fe-25Cr-7Ni-Mo-W-Cu-N), in order to understand the time and temperature ranges for intermetallic phase formation. The alloys were heat treated isothermally or under controlled cooling conditions and then characterized using conventional metallographic methods that included tint etching, and also using electron microscopy (SEM, TEM) and wavelength dispersive spectroscopy (WDS). The kinetics of intermetallic-phase (sigma + chi) formation were analyzed using the Johnson-Mehl-Avrami (JMA) equation in the case of isothermal transformations and a modified form of this equation in the case of continuous cooling transformations. The rate of intermetallic-phase formation was found to be much faster in CD3MWCuN than CD3MN due mainly to differences in the major alloying contents such as Cr, Ni and Mo. To examine in more detail the effects of these elements of the phase stabilities, a series of eight steel castings was designed with the Cr, Ni and Mo contents systematically varied with respect to the nominal composition of CD3MN. The effects of varying the contents of alloying additions on the formation of intermetallic phases were also studied computationally using the commercial thermodynamic software package, Thermo-Calc. In general, a was stabilized with increasing Cr addition and chi by increasing Mo addition. However, a delicate balance among Ni and other minor elements such as N and Si also exists. Phase equilibria in DSS can be affected by local composition fluctuations in the cast alloy. This may cause discrepancy between thermodynamic prediction and experimental observation.
Han, Ahram; Min, Seung-Kee; Kim, Mi-Sook; Joo, Kwon Wook; Kim, Jungsun; Ha, Jongwon; Lee, Joongyub; Min, Sang-Il
2016-10-07
Use of arteriovenous fistulas, the most preferred type of access for hemodialysis, is limited by their high maturation failure rate. The aim of this study was to assess whether aggressive surveillance with routine duplex ultrasound and intervention can decrease the maturation failure rate of arteriovenous fistulas. We conducted a single-center, parallel-group, randomized, controlled trial of patients undergoing autogenous arteriovenous fistula. Patients were randomly assigned (1:1) to either the routine duplex or selective duplex group. In the routine duplex group, duplex ultrasound and physical examination were performed 2, 4, and 8 weeks postoperatively. In the selective duplex group, duplex examination was performed only when physical examination detected an abnormality. The primary end point was the maturation failure rate 8 weeks after fistula creation. Maturation failure was defined as the inability to achieve clinical maturation ( i.e. , a successful first use) and failure to achieve sonographic maturation (fistula flow >500 ml/min and diameter >6 mm) within 8 weeks. Between June 14, 2012, and June 25, 2014, 150 patients were enrolled (75 patients in each group), and 118 of those were included in the final analysis. The maturation failure rate was lower in the routine duplex group (8 of 59; 13.6%) than in the selective duplex group (15 of 59; 25.4%), but the difference was not statistically significant (odds ratio, 0.46; 95% confidence interval, 0.18 to 1.19; P =0.10). Factors associated with maturation failure were women (odds ratio, 3.84; 95% confidence interval, 1.05 to 14.06; P =0.04), coronary artery disease (odds ratio, 6.36; 95% confidence interval, 1.62 to 24.95; P <0.01), diabetes (odds ratio, 6.10; 95% confidence interval, 1.76 to 21.19; P <0.01), and the preoperative cephalic vein diameter (odds ratio, 0.30; 95% confidence interval, 0.13 to 0.71; P <0.01). Postoperative routine duplex surveillance failed to prove superiority compared with selective duplex after physical examination for reducing arteriovenous fistula maturation failure. However, the wide 95% confidence interval for the effect of intervention precludes a firm conclusion that routine duplex surveillance was not beneficial. Copyright © 2016 by the American Society of Nephrology.
Benefits of Automatic Duplexing Fact Sheet
This resource provides a how-to duplex guide, informs the reader on the benefits and cost savings from automatic duplexing, and several off the shelf print management software options for your facility.
Electron Beam Welding of Duplex Steels with using Heat Treatment
NASA Astrophysics Data System (ADS)
Schwarz, Ladislav; Vrtochová, Tatiana; Ulrich, Koloman
2010-01-01
This contribution presents characteristics, metallurgy and weldability of duplex steels with using concentrated energy source. The first part of the article describes metallurgy of duplex steels and the influence of nitrogen on their solidification. The second part focuses on weldability of duplex steels with using electron beam aimed on acceptable structure and corrosion resistance performed by multiple runs of defocused beam over the penetration weld.
Sohn, Seok Su; Song, Hyejin; Jo, Min Chul; Song, Taejin; Kim, Hyoung Seop; Lee, Sunghak
2017-04-28
Needs for steel designs of ultra-high strength and excellent ductility have been an important issue in worldwide automotive industries to achieve energy conservation, improvement of safety, and crashworthiness qualities. Because of various drawbacks in existing 1.5-GPa-grade steels, new development of formable cold-rolled ultra-high-strength steels is essentially needed. Here we show a plausible method to achieve ultra-high strengths of 1.0~1.5 GPa together with excellent ductility above 50% by actively utilizing non-recrystallization region and TRansformation-Induced Plasticity (TRIP) mechanism in a cold-rolled and annealed Fe-Mn-Al-C-based steel. We adopt a duplex microstructure composed of austenite and ultra-fine ferrite in order to overcome low-yield-strength characteristics of austenite. Persistent elongation up to 50% as well as ultra-high yield strength over 1.4 GPa are attributed to well-balanced mechanical stability of non-crystallized austenite with critical strain for TRIP. Our results demonstrate how the non-recrystallized austenite can be a metamorphosis in 1.5-GPa-grade steel sheet design.
Yang, Haozhe; Seela, Frank
2016-01-22
A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay
Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen
2015-01-01
Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710
Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.
Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen
2015-01-01
Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.
NASA Astrophysics Data System (ADS)
Yin, An; Kelty, Thomas K.; Davis, Gregory A.
1989-09-01
Geologic mapping in southern Glacier National Park, Montana, reveals the presence of two duplexes sharing the same floor thrust fault, the Lewis thrust. The westernmost duplex (Brave Dog Mountain) includes the low-angle Brave Dog roof fault and Elk Mountain imbricate system, and the easternmost (Rising Wolf Mountain) duplex includes the low-angle Rockwell roof fault and Mt. Henry imbricate system. The geometry of these duplexes suggests that they differ from previously described geometric-kinematic models for duplex development. Their low-angle roof faults were preexisting structures that were locally utilized as roof faults during the formation of the imbricate systems. Crosscutting of the Brave Dog fault by the Mt. Henry imbricate system indicates that the two duplexes formed at different times. The younger Rockwell-Mt. Henry duplex developed 20 km east of the older Brave Dog-Elk Mountain duplex; the roof fault of the former is at a higher structural level. Field relations confirm that the low-angle Rockwell fault existed across the southern Glacier Park area prior to localized formation of the Mt. Henry imbricate thrusts beneath it. These thrusts kinematically link the Rockwell and Lewis faults and may be analogous to P shears that form between two synchronously active faults bounding a simple shear system. The abandonment of one duplex and its replacement by another with a new and higher roof fault may have been caused by (1) warping of the older and lower Brave Dog roof fault during the formation of the imbricate system (Elk Mountain) beneath it, (2) an upward shifting of the highest level of a simple shear system in the Lewis plate to a new decollement level in subhorizontal belt strata (= the Rockwell fault) that lay above inclined strata within the first duplex, and (3) a reinitiation of P-shear development (= Mt. Henry imbricate faults) between the Lewis thrust and the subparallel, synkinematic Rockwell fault.
Conformations of stereoisomeric base adducts to 4-hydroxyequilenin.
Ding, Shuang; Shapiro, Robert; Geacintov, Nicholas E; Broyde, Suse
2003-06-01
Exposure to estrogen through estrogen replacement therapy increases the risk of women developing cancer in hormone sensitive tissues. Premarin (Wyeth), which has been the most frequent choice for estrogen replacement therapy in the United States, contains the equine estrogens equilin and equilenin as major components. 4-Hydroxyequilenin (4-OHEN) is a phase I metabolite of both of these substances. This catechol estrogen autoxidizes to potent cytotoxic quinoids that can react with dG, dA, and dC to form unusual stereoisomeric cyclic adducts (Bolton, J. L., et al. (1998) Chem. Res. Toxicol. 11, 1113-1127). Like other bulky DNA adducts, these lesions may exhibit different susceptibilities to DNA repair and mutagenic potential, if not repaired in a structure-dependent manner. To ultimately gain insights into structure-function relationships, we computed conformations of stereoisomeric guanine, adenine, and cytosine base adducts using density functional theory. We find near mirror image conformations in stereoisomer adduct pairs for each modified base, suggesting opposite orientations with respect to the 5' --> 3' direction of the modified strand when the stereoisomer pairs are incorporated into duplex DNA. Such opposite orientations could cause stereoisomer pairs of lesions to respond differently to DNA replication and repair enzymes.
A nucleobase-centered coarse-grained representation for structure prediction of RNA motifs
Poblete, Simón; Bottaro, Sandro; Bussi, Giovanni
2018-01-01
Abstract We introduce the SPlit-and-conQueR (SPQR) model, a coarse-grained (CG) representation of RNA designed for structure prediction and refinement. In our approach, the representation of a nucleotide consists of a point particle for the phosphate group and an anisotropic particle for the nucleoside. The interactions are, in principle, knowledge-based potentials inspired by the \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}$\\mathcal {E}$\\end{document}SCORE function, a base-centered scoring function. However, a special treatment is given to base-pairing interactions and certain geometrical conformations which are lost in a raw knowledge-based model. This results in a representation able to describe planar canonical and non-canonical base pairs and base–phosphate interactions and to distinguish sugar puckers and glycosidic torsion conformations. The model is applied to the folding of several structures, including duplexes with internal loops of non-canonical base pairs, tetraloops, junctions and a pseudoknot. For the majority of these systems, experimental structures are correctly predicted at the level of individual contacts. We also propose a method for efficiently reintroducing atomistic detail from the CG representation. PMID:29272539
Hole Transport in A-form DNA/RNA Hybrid Duplexes
NASA Astrophysics Data System (ADS)
Wong, Jiun Ru; Shao, Fangwei
2017-01-01
DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations.
Hole Transport in A-form DNA/RNA Hybrid Duplexes
Wong, Jiun Ru; Shao, Fangwei
2017-01-01
DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations. PMID:28084308
Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun
2011-07-01
This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.
Structure, stability and behaviour of nucleic acids in ionic liquids
Tateishi-Karimata, Hisae; Sugimoto, Naoki
2014-01-01
Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178
Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI
Shen, Betty; Heiter, Daniel F.; Chan, Siu-Hong; Wang, Hua; Xu, Shuang-Yong; Morgan, Richard D.; Wilson, Geoffrey G.; Stoddard, Barry L.
2010-01-01
The crystal structure of the rare-cutting HNH restriction endonuclease PacI in complex with its eight base pair target recognition sequence 5'-TTAATTAA-3' has been determined to 1.9 Å resolution. The enzyme forms an extended homodimer, with each subunit containing two zinc-bound motifs surrounding a ββα-metal catalytic site. The latter is unusual in that a tyrosine residue likely initiates strand-cleavage. PacI dramatically distorts its target sequence from Watson-Crick duplex DNA basepairing, with every base separated from its original partner. Two bases on each strand are unpaired, four are engaged in non-canonical A:A and T:T base pairs, and the remaining two bases are matched with new Watson-Crick partners. This represents a highly unusual DNA binding mechanism for a restriction endonuclease, and implies that initial recognition of the target site might involve significantly different contacts from those visualized in the DNA-bound cocrystal structures. PMID:20541511
Observation of Dust Particle Gyromotion in a Magnetized Dusty Plasma
NASA Astrophysics Data System (ADS)
Compton, C. S.; Amatucci, W. E.; Gatling, G.; Tejero, E.
2008-11-01
In dusty plasma research, gyromotion of the dust has been difficult to observe experimentally. Previous experiments by Amatucci et al. have shown gyromotion of a single dust particle [1]. This early work was performed with alumina dust that had a size distribution and non-uniformly shaped particles. In the current experiment, evidence of spherical, monodispersed, dust particles exhibiting gyromotion has been observed. Silica particles 0.97 micrometers in diameter are suspended in a DC glow discharge argon plasma. The experiment is performed in the Naval Research Laboratory's DUsty PLasma EXperiment (DUPLEX Jr.). DUPLEX is a 61-cm tall by 46-cm diameter acrylic chamber allowing full 360 degree optical access for diagnostics. The neutral pressure for the experiment is 230 mTorr with a 275 V bias between the circular electrodes. The electrodes have a separation of 4 cm. A strong magnetic field is created by 2 pairs of neodymium iron boride magnets placed above and below the anode and cathode respectively. The resulting field is 1.4 kG. The dust particles are illuminated with a 25 mW, 672 nm laser. Images are captured using an intensified CCD camera and a consumer digital video cassette recorder. Recent evidence of gyromotion of spherical, monodispersed, dust particles will be presented. [1] Amatucci, W.E., et al., Phys. Plasmas, 11, 2097 (2004)
Adjacent bin stability evaluating for feature description
NASA Astrophysics Data System (ADS)
Nie, Dongdong; Ma, Qinyong
2018-04-01
Recent study improves descriptor performance by accumulating stability votes for all scale pairs to compose the local descriptor. We argue that the stability of a bin depends on the differences across adjacent pairs more than the differences across all scale pairs, and a new local descriptor is composed based on the hypothesis. A series of SIFT descriptors are extracted from multiple scales firstly. Then the difference value of the bin across adjacent scales is calculated, and the stability value of a bin is calculated based on it and accumulated to compose the final descriptor. The performance of the proposed method is evaluated with two popular matching datasets, and compared with other state-of-the-art works. Experimental results show that the proposed method performs satisfactorily.
NASA Astrophysics Data System (ADS)
Banks, C. J.; Warburton, J.
Exploration for hydrocarbons over the past few years has greatly improved our understanding of the geometry of frontal mountain belt structures. In this study we introduce and discuss the concept of the 'Passive-roof duplex', using as the main example the Kirthar and Sulaiman Ranges in the Baluchistan Province of Pakistan. Structures similar to those described here have been recognized previously in other mountain belts, and they appear to exist as a common feature in many more frontal regions of mountain belts. Our example of a Passive-roof duplex which we describe from Pakistan is compared briefly with similar structures reported by others. The Passive-roof duplex is here defined as a duplex whose roof thrust has backthrust sense ( Passive-roof thrust) and whose roof sequence (those rocks lying above the roof thrust) remains relatively 'stationary' during foreland directed piggy-back style propagation of horses within the duplex.
NASA Astrophysics Data System (ADS)
Ramaiah, Danaboyina; Kan, Yongzhi; Koch, Troels; Orum, Henrik; Schuster, Gary B.
1998-10-01
Peptide nucleic acids (PNA) are mimics with normal bases connected to a pseudopeptide chain that obey Watson--Crick rules to form stable duplexes with itself and natural nucleic acids. This has focused attention on PNA as therapeutic or diagnostic reagents. Duplexes formed with PNA mirror some but not all properties of DNA. One fascinating aspect of PNA biochemistry is their reaction with enzymes. Here we show an enzyme reaction that operates effectively on a PNA/DNA hybrid duplex. A DNA oligonucleotide containing a cis, syn-thymine [2+2] dimer forms a stable duplex with PNA. The hybrid duplex is recognized by photolyase, and irradiation of the complex leads to the repair of the thymine dimer. This finding provides insight into the enzyme mechanism and provides a means for the selective repair of thymine photodimers.
Impact of Duplex arterial mapping on decision making in non-acute ischemic limb patients.
Elbadawy, A; Aly, H; Ibrahim, M; Bakr, H
2015-12-01
The aim of this study was to demonstrate the impact of Duplex arterial mapping on decision making in non-acute ischemic limb patient group reporting pain onset between 15 days and 3 months. We prospectively evaluated patients presented with critical limb ischemia who reported pain onset of duration between 15 days and 3 months in one-year period. Our series included thirty cases (mean age=61.3 years old), as Duplex arterial mapping was the sole preoperative imaging tool performed in all of them. All patients, in whom duplex indicated thrombosis in long occluded segments, were candidates for fluoroscopically guided thrombectomy. When Duplex defined chronic arterial occlusions, patients underwent endovascular or bypass revascularisation procedures. Impact of Duplex wall interrogation on decision-making between the two groups (subacute and chronic) was measured. Duplex arterial mapping categorized correctly all 30 patients into either subacute ischemia with removable clot (N.=14) or chronic ischemia (N.=16). Fluoroscopic guided thrombectomy was performed in 14 cases when Duplex advised long occluded arterial segments as indicted by intact intima with echogenic thrombus inside. Bypass surgery was performed in 8 patients. Percutaneous transluminal angioplasty (PTA) was done in 7 cases and thrombendartrectomy of common femoral artery in a single case. One-year patency rate in our series was 86.6%. It was 71.4% in thrombosis group. Limb salvage rate was 93.3%. Duplex arterial mapping could be used to differentiate the subacute ischemia with removable thrombus and chronic arterial occlusions guiding for the best revascularization procedure accordingly.
Makkar, Preeti; Kang, Hoe Jin; Padalhin, Andrew R; Park, Ihho; Moon, Byoung-Gi; Lee, Byong Taek
2018-01-01
The present work addresses the performance of polycaprolactone (PCL) coating on fluoride treated (MgF2) biodegradable ZK60 magnesium alloy (Mg) for biomedical application. MgF2 conversion layer was first produced by immersing Mg alloy substrate in hydrofluoric acid solution. The outer PCL coating was then prepared using dip coating technique. Morphology, elements profile, phase structure, roughness, mechanical properties, invitro corrosion, and biocompatibility of duplex MgF2/PCL coating were then characterized and compared to those of fluoride coated and uncoated Mg samples. The invivo degradation behavior and biocompatibility of duplex MgF2/PCL coating with respect to ZK60 Mg alloy were also studied using rabbit model for 2 weeks. SEM and TEM analysis showed that the duplex coating was uniform and comprised of porous PCL film (~3.3 μm) as upper layer with compact MgF2 (~2.2 μm) as inner layer. No significant change in microhardness was found on duplex coating compared with uncoated ZK60 Mg alloy. The duplex coating showed improved invitro corrosion resistance than single layered MgF2 or uncoated alloy samples. The duplex coating also resulted in better cell viability, cell adhesion, and cell proliferation compared to fluoride coated or uncoated alloy. Preliminary invivo studies indicated that duplex MgF2/PCL coating reduced the degradation rate of ZK60 Mg alloy and exhibited good biocompatibility. These results suggested that duplex MgF2/PCL coating on magnesium alloy might have great potential for orthopedic applications.
Makkar, Preeti; Kang, Hoe Jin; Padalhin, Andrew R.; Park, Ihho; Moon, Byoung-Gi
2018-01-01
The present work addresses the performance of polycaprolactone (PCL) coating on fluoride treated (MgF2) biodegradable ZK60 magnesium alloy (Mg) for biomedical application. MgF2 conversion layer was first produced by immersing Mg alloy substrate in hydrofluoric acid solution. The outer PCL coating was then prepared using dip coating technique. Morphology, elements profile, phase structure, roughness, mechanical properties, invitro corrosion, and biocompatibility of duplex MgF2/PCL coating were then characterized and compared to those of fluoride coated and uncoated Mg samples. The invivo degradation behavior and biocompatibility of duplex MgF2/PCL coating with respect to ZK60 Mg alloy were also studied using rabbit model for 2 weeks. SEM and TEM analysis showed that the duplex coating was uniform and comprised of porous PCL film (~3.3 μm) as upper layer with compact MgF2 (~2.2 μm) as inner layer. No significant change in microhardness was found on duplex coating compared with uncoated ZK60 Mg alloy. The duplex coating showed improved invitro corrosion resistance than single layered MgF2 or uncoated alloy samples. The duplex coating also resulted in better cell viability, cell adhesion, and cell proliferation compared to fluoride coated or uncoated alloy. Preliminary invivo studies indicated that duplex MgF2/PCL coating reduced the degradation rate of ZK60 Mg alloy and exhibited good biocompatibility. These results suggested that duplex MgF2/PCL coating on magnesium alloy might have great potential for orthopedic applications. PMID:29608572
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes
2007-10-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)
2007-01-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
Prolonged CT urography in duplex kidney.
Gong, Honghan; Gao, Lei; Dai, Xi-Jian; Zhou, Fuqing; Zhang, Ning; Zeng, Xianjun; Jiang, Jian; He, Laichang
2016-05-13
Duplex kidney is a common anomaly that is frequently associated with multiple complications. Typical computed tomography urography (CTU) includes four phases (unenhanced, arterial, parenchymal and excretory) and has been suggested to considerably aid in the duplex kidney diagnosi. Unfortunately, regarding duplex kidney with prolonged dilatation, the affected parenchyma and tortuous ureters demonstrate a lack of or delayed excretory opacification. We used prolonged-delay CTU, which consists of another prolonged-delay phase (1- to 72-h delay; mean delay: 24 h) to opacify the duplicated ureters and affected parenchyma. Seventeen patients (9 males and 8 females; age range: 2.5-56 y; mean age: 40.4 y) with duplex kidney were included in this study. Unenhanced scans did not find typical characteristics of duplex kidney, except for irregular perirenal morphology. Duplex kidney could not be confirmed on typical four-phase CTU, whereas it could be easily diagnosed in axial and CT-3D reconstruction using prolonged CTU (prolonged-delay phase). Between January 2005 and October 2010, in this review board-approved study (with waived informed consent), 17 patients (9 males and 8 females; age range: 2.5 ~ 56 y; mean age: 40.4 y) with suspicious duplex kidney underwent prolonged CTU to opacify the duplicated ureters and confirm the diagnosis. Our results suggest the validity of prolonged CTU to aid in the evaluation of the function of the affected parenchyma and in the demonstration of urinary tract malformations.
l-Proline and RNA Duplex m-Value Temperature Dependence.
Schwinefus, Jeffrey J; Baka, Nadia L; Modi, Kalpit; Billmeyer, Kaylyn N; Lu, Shutian; Haase, Lucas R; Menssen, Ryan J
2017-08-03
The temperature dependence of l-proline interactions with the RNA dodecamer duplex surface exposed after unfolding was quantified using thermal and isothermal titration denaturation monitored by uv-absorbance. The m-value quantifying proline interactions with the RNA duplex surface area exposed after unfolding was measured using RNA duplexes with GC content ranging between 17 and 83%. The m-values from thermal denaturation decreased with increasing GC content signifying increasingly favorable proline interactions with the exposed RNA surface area. However, m-values from isothermal titration denaturation at 25.0 °C were independent of GC content and less negative than those from thermal denaturation. The m-value from isothermal titration denaturation for a 50% GC RNA duplex decreased (became more negative) as the temperature increased and was in nearly exact agreement with the m-value from thermal denaturation. Since RNA duplex transition temperatures increased with GC content, the more favorable proline interactions with the high GC content duplex surface area observed from thermal denaturation resulted from the temperature dependence of proline interactions rather than the RNA surface chemical composition. The enthalpy contribution to the m-value was positive and small (indicating a slight increase in duplex unfolding enthalpy with proline) while the entropic contribution to the m-value was positive and increased with temperature. Our results will facilitate proline's use as a probe of solvent accessible surface area changes during biochemical reactions at different reaction temperatures.
DOE Office of Scientific and Technical Information (OSTI.GOV)
R, Shashanka, E-mail: shashankaic@gmail.com; Chaira, D., E-mail: chaira.debasis@gmail.com
Nano-structured duplex and ferritic stainless steel powders are prepared by planetary milling of elemental Fe, Cr and Ni powder for 40 h and then consolidated by conventional pressureless sintering. The progress of milling and the continuous refinement of stainless steel powders have been confirmed by means of X-ray diffraction and scanning electron microscopy. Activation energy for the formation of duplex and ferritic stainless steels is calculated by Kissinger method using differential scanning calorimetry and is found to be 159.24 and 90.17 KJ/mol respectively. Both duplex and ferritic stainless steel powders are consolidated at 1000, 1200 and 1400 °C in argonmore » atmosphere to study microstructure, density and hardness. Maximum sintered density of 90% and Vickers microhardness of 550 HV are achieved for duplex stainless steel sintered at 1400 °C for 1 h. Similarly, 92% sintered density and 263 HV microhardness are achieved for ferritic stainless steel sintered at 1400 °C. - Highlights: • Synthesized duplex and ferritic stainless steels by pulverisette planetary milling • Calculated activation energy for the formation of duplex and ferritic stainless steels • Studied the effect of sintering temperature on density, hardness and microstructure • Duplex stainless steel exhibits 90% sintered density and microhardness of 550 HV. • Ferritic stainless steel shows 92% sintered density and 263 HV microhardness.« less
Shieh, H S; Berman, H M; Dabrow, M; Neidle, S
1980-01-01
A 2:2 complex of proflavine and deoxycytidylyl-3', 5'-guanosine has been crystallized and its structure determined by x-ray crystallography. The two dinucleoside phosphate strands form self complementary duplexes with Watson Crick hydrogen bonds. One proflavin is asymmetrically intercalated between the base pairs and the other is stacked above them. The conformations of the nucleotides are unusual in that one strand has C3',C2'endomixed sugar puckering and the other has C3',C3' endo deoxyribose sugars. These results show that the conformation of the 3'sugar is of secondary importance to the intercalated geometry. PMID:7355129
Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa
2016-03-21
Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.
Mizowaki, Takashi; Fujita, Atsushi; Imahori, Taichiro; Uyama, Atsushi; Inoue, Satoshi; Kohta, Masaaki; Hamaguchi, Hirotoshi; Sasayama, Takashi; Hosoda, Kohkichi; Kohmura, Eiji
2016-07-01
We aimed to investigate the safety and feasibility of duplex-assisted carotid artery stenting (CAS) without administration of contrast medium for the prevention of adverse reactions. Fifteen patients (9 % of all CASs) with severe carotid stenosis (≥70 %) associated with chronic kidney disease (CKD) (stage ≥3) or allergy to contrast medium underwent duplex-assisted CAS without administration of contrast medium over 4 years. The procedural success rate and perioperative complication rates were compared between the duplex-assisted CAS (n = 15) and conventional CAS (n = 153) groups. The technical success rate was 100 % in both groups. Combined stroke or death rates during the post-procedural period did not differ significantly between the duplex-assisted CAS group (0/15, 0 %) and conventional CAS group (4/153, 2.6 %). None of the 14 patients with CKD in the duplex-assisted CAS group experienced further deterioration of renal function. The mean surface radiation dose of participants in the duplex-assisted CAS group (n = 13, 312 ± 131 mGy) was significantly lower than that of the conventional CAS group (n = 31, 1036 ± 571 mGy) (p < 0.001). The mean duration of CAS procedure was not significantly different between the duplex-assisted CAS group (156 ± 39.7 min) and the conventional CAS group (156 ± 37.4 min). Duplex-assisted CAS without administration of contrast medium could be an alternative option in selected patients deemed to be at high risk for renal failure from nephrotoxic contrast medium or who have an allergy to contrast medium.
Transcranial Duplex Sonography Predicts Outcome following an Intracerebral Hemorrhage.
Camps-Renom, P; Méndez, J; Granell, E; Casoni, F; Prats-Sánchez, L; Martínez-Domeño, A; Guisado-Alonso, D; Martí-Fàbregas, J; Delgado-Mederos, R
2017-08-01
Several radiologic features such as hematoma volume are related to poor outcome following an intracerebral hemorrhage and can be measured with transcranial duplex sonography. We sought to determine the prognostic value of transcranial duplex sonography in patients with intracerebral hemorrhage. We conducted a prospective study of patients diagnosed with spontaneous intracerebral hemorrhage. Transcranial duplex sonography examinations were performed within 2 hours of baseline CT, and we recorded the following variables: hematoma volume, midline shift, third ventricle and lateral ventricle diameters, and the pulsatility index in both MCAs. We correlated these data with the CT scans and assessed the prognostic value of the transcranial duplex sonography measurements. We assessed early neurologic deterioration during hospitalization and mortality at 1-month follow-up. We included 35 patients with a mean age of 72.2 ± 12.8 years. Median baseline hematoma volume was 9.85 mL (interquartile range, 2.74-68.29 mL). We found good agreement and excellent correlation between transcranial duplex sonography and CT when measuring hematoma volume ( r = 0.791; P < .001) and midline shift ( r = 0.827; P < .001). The logistic regression analysis with transcranial duplex sonography measurements showed that hematoma volume was an independent predictor of early neurologic deterioration (OR, 1.078; 95% CI, 1.023-1.135) and mortality (OR, 1.089; 95% CI, 1.020-1.160). A second regression analysis with CT variables also demonstrated that hematoma volume was associated with early neurologic deterioration and mortality. When we compared the rating operation curves of both models, their predictive power was similar. Transcranial duplex sonography showed an excellent correlation with CT in assessing hematoma volume and midline shift in patients with intracerebral hemorrhage. Hematoma volume measured with transcranial duplex sonography was an independent predictor of poor outcome. © 2017 by American Journal of Neuroradiology.
Jinlong, Lv; Tongxiang, Liang; Chen, Wang; Limin, Dong
2016-05-01
The ultrafine grained 2205 duplex stainless steel was obtained by cold rolling and annealing. The tensile properties were investigated at room temperature. Comparing with coarse grained stainless steel, ultrafine grained sample showed higher strength and plasticity. In addition, grain size changed deformation orientation. The strain induced α'-martensite was observed in coarse grained 2205 duplex stainless steel with large strain. However, the grain refinement inhibited the transformation of α'-martensite;nevertheless, more deformation twins improved the strength and plasticity of ultrafine grained 2205 duplex stainless steel. In addition, the grain refinement improved corrosion resistance of the 2205 duplex stainless steel in sodium chloride solution. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Rahmani, Mehdi; Eghlimi, Abbas; Shamanian, Morteza
2014-10-01
To study the effect of chemical composition on microstructural features and mechanical properties of dissimilar joints between super duplex and austenitic stainless steels, welding was attempted by gas tungsten arc welding process with a super duplex (ER2594) and an austenitic (ER309LMo) stainless steel filler metal. While the austenitic weld metal had vermicular delta ferrite within austenitic matrix, super duplex stainless steel was mainly comprised of allotriomorphic grain boundary and Widmanstätten side plate austenite morphologies in the ferrite matrix. Also the heat-affected zone of austenitic base metal comprised of large austenite grains with little amounts of ferrite, whereas a coarse-grained ferritic region was observed in the heat-affected zone of super duplex base metal. Although both welded joints showed acceptable mechanical properties, the hardness and impact strength of the weld metal produced using super duplex filler metal were found to be better than that obtained by austenitic filler metal.
NASA Astrophysics Data System (ADS)
Takenaka, Shigeori
2017-07-01
It is known that naphthalene diimide carrying two substituents binds to DNA duplex with threading intercalation. Naphthalene diimide carrying ferrocene moieties, ferrocenylnaphthalene diimide (FND), formed a stable complex with DNA duplex and an electrochemical gene detection was achieved with current signal generated from FND bound to the DNA duplex between target DNA and DNA probe immobilized electrode. FND couldn't bind to the mismatched and its surrounding region of DNA duplex and thus FND was applied to the precision detection of single nucleotide polymorphisms (SNPs) using the improved discrimination ability between fully matched and mismatched DNA hybrids and multi-electrode chip. Some of FND derivatives bound to telomere DNA tetraplex stronger than to DNA duplex and was applied to cancer diagnosis as a measure of the elongated telomere DNA with telomerase as a suitable maker of cancer. Furthermore, cyclic naphthalene diimides realized the extremely high preference for DNA tetraplex over DNA duplex. Such molecules will open an effective anti-cancer drug based on telomerase specific inhibitor.
Tucker-Drob, Elliot M.; Briley, Daniel A.
2014-01-01
The longitudinal rank-order stability of cognitive ability increases dramatically over the lifespan. Multiple theoretical perspectives have proposed that genetic and/or environmental mechanisms underlie the longitudinal stability of cognition, and developmental trends therein. However, the patterns of stability of genetic and environmental influences on cognition over the lifespan largely remain poorly understood. We searched for longitudinal studies of cognition that reported raw genetically-informative longitudinal correlations or parameter estimates from longitudinal behavior genetic models. We identified 150 combinations of time points and measures from 15 independent longitudinal samples. In total, longitudinal data came from 4,538 monozygotic twin pairs raised together, 7,777 dizygotic twin pairs raised together, 34 monozygotic twin pairs raised apart, 78 dizygotic twin pairs raised apart, 141 adoptive sibling pairs, and 143 non-adoptive sibling pairs, ranging in age from infancy through late adulthood. At all ages, cross-time genetic correlations and shared environmental correlations were substantially larger than cross-time nonshared environmental correlations. Cross-time correlations for genetic and shared environmental components were low during early childhood, increased sharply over child development, and remained relatively high from adolescence through late adulthood. Cross-time correlations for nonshared environmental components were low across childhood and increased gradually to moderate magnitudes in adulthood. Increasing phenotypic stability over child development was almost entirely mediated by genetic factors. Time-based decay of genetic and shared environmental stability was more pronounced earlier in child development. Results are interpreted in reference to theories of gene-environment interaction and correlation. PMID:24611582
Shanker, Sudhanshu; Bandyopadhyay, Pradipta
2017-08-01
The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.
Grambow, E; Heller, T; Wieneke, P; Weiß, C; Klar, E; Weinrich, M
2018-01-01
Duplex ultrasound is the first choice in diagnostics and surveillance of stenoses of the internal carotid arteries before and even after surgery. Therefore, the quality of duplex ultrasound is crucial to investigate these vascular pathologies. Aim of this study was the evaluation whether different surgical techniques affect the postoperative quality of duplex ultrasound. In a time period from January to May 2015 duplex ultrasound of the cervical vessels was performed in 75 patients after unilateral endarterectomy of the internal carotid artery at our department between 2006 and 2012. Thereby, the non-operated contralateral side served as a control. Study groups were defined by the surgical techniques of eversion- or thrombendarterectomy with patch plasty using different patch materials and/or a haemostatic sealant. Duplex ultrasound analysis included acoustic impedance, extinction of ultrasound, thickness of skin and individual anatomic aspects of the patients. Carotid endarterectomy itself reduced intravascular grey levels, skin thickness and increased extinction of duplex ultrasound when compared to the non-operated side of the neck. In contrast, neither the kind of chosen operative technique nor the use of different patch materials or the application of a haemostatic sealant showed an effect in this regards. Whereas carotid endarterectomy per se worsens the quality of postoperative duplex ultrasound, the different analysed surgical techniques as well as used patches and the application of a haemostatic sealant can be assumed to be equal regarding the quality of postoperative ultrasound.
Evidence of a sewer vapor transport pathway at the USEPA ...
The role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into the duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. These test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope. Highlights • The sewer line is an important pathway for VOC transport at the USEPA duplex. • The importance of this pathway was not identified during prior study of the duplex. • Sewer lines should be routinely evaluated
Photoswitching of DNA Hybridization Using a Molecular Motor.
Lubbe, Anouk S; Liu, Qing; Smith, Sanne J; de Vries, Jan Willem; Kistemaker, Jos C M; de Vries, Alex H; Faustino, Ignacio; Meng, Zhuojun; Szymanski, Wiktor; Herrmann, Andreas; Feringa, Ben L
2018-04-18
Reversible control over the functionality of biological systems via external triggers may be used in future medicine to reduce the need for invasive procedures. Additionally, externally regulated biomacromolecules are now considered as particularly attractive tools in nanoscience and the design of smart materials, due to their highly programmable nature and complex functionality. Incorporation of photoswitches into biomolecules, such as peptides, antibiotics, and nucleic acids, has generated exciting results in the past few years. Molecular motors offer the potential for new and more precise methods of photoregulation, due to their multistate switching cycle, unidirectionality of rotation, and helicity inversion during the rotational steps. Aided by computational studies, we designed and synthesized a photoswitchable DNA hairpin, in which a molecular motor serves as the bridgehead unit. After it was determined that motor function was not affected by the rigid arms of the linker, solid-phase synthesis was employed to incorporate the motor into an 8-base-pair self-complementary DNA strand. With the photoswitchable bridgehead in place, hairpin formation was unimpaired, while the motor part of this advanced biohybrid system retains excellent photochemical properties. Rotation of the motor generates large changes in structure, and as a consequence the duplex stability of the oligonucleotide could be regulated by UV light irradiation. Additionally, Molecular Dynamics computations were employed to rationalize the observed behavior of the motor-DNA hybrid. The results presented herein establish molecular motors as powerful multistate switches for application in biological environments.
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D.
2011-01-01
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5′CUG/3′GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures are disclosed of a model DM1 triplet repeating construct, 5′r(UUGGGC(CUG)3GUCC)2, refined to 2.20 Å and 1.52 Å resolution. Here, differences in orientation of the 5′ dangling UU end between the two structures induce changes in the backbone groove width, which reveals that non-canonical 1×1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5′UU forms one hydrogen-bonded pairs with a 5′UU of a neighboring helix in the unit cell to form a pseudo-infinite helix. The central 1×1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1×1 nucleotide UU internal loops each form a one hydrogen-bonded pair. In the 1.52 Å structure, CUGb, the 5′ UU dangling end is tucked into the major groove of the duplex. While the canonical paired bases show no change in base pairing, in CUGb the terminal 1×1 nucleotide UU internal loops form now two hydrogen-bonded pairs. Thus, the shift in major groove induced by the 5′UU dangling end alters non-canonical base patterns. Collectively, these structures indicate that 1×1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands. PMID:21988728
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W; Disney, Matthew D
2011-11-15
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[UUGGGC(CUG)(3)GUCC](2), refined to 2.20 and 1.52 Å resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 × 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 × 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 × 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 Å structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 × 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 × 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Amit; Park, HaJeung; Fang, Pengfei
2012-03-27
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations.more » In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.« less
The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate
Mooers, Blaine H.M.; Singh, Amritanshu
2011-01-01
Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548
Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses
2002-01-01
An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638
Highly Dynamic Anion-Quadrupole Networks in Proteins.
Kapoor, Karan; Duff, Michael R; Upadhyay, Amit; Bucci, Joel C; Saxton, Arnold M; Hinde, Robert J; Howell, Elizabeth E; Baudry, Jerome
2016-11-01
The dynamics of anion-quadrupole (or anion-π) interactions formed between negatively charged (Asp/Glu) and aromatic (Phe) side chains are for the first time computationally characterized in RmlC (Protein Data Bank entry 1EP0 ), a homodimeric epimerase. Empirical force field-based molecular dynamics simulations predict anion-quadrupole pairs and triplets (anion-anion-π and anion-π-π) are formed by the protein during the simulated trajectory, which suggests that the anion-quadrupole interactions may provide a significant contribution to the overall stability of the protein, with an average of -1.6 kcal/mol per pair. Some anion-π interactions are predicted to form during the trajectory, extending the number of anion-quadrupole interactions beyond those predicted from crystal structure analysis. At the same time, some anion-π pairs observed in the crystal structure exhibit marginal stability. Overall, most anion-π interactions alternate between an "on" state, with significantly stabilizing energies, and an "off" state, with marginal or null stabilizing energies. The way proteins possibly compensate for transient loss of anion-quadrupole interactions is characterized in the RmlC aspartate 84-phenylalanine 112 anion-quadrupole pair observed in the crystal structure. A double-mutant cycle analysis of the thermal stability suggests a possible loss of anion-π interactions compensated by variations of hydration of the residues and formation of compensating electrostatic interactions. These results suggest that near-planar anion-quadrupole pairs can exist, sometimes transiently, which may play a role in maintaining the structural stability and function of the protein, in an otherwise very dynamic interplay of a nonbonded interaction network as well as solvent effects.
Relationship between ion pair geometries and electrostatic strengths in proteins.
Kumar, Sandeep; Nussinov, Ruth
2002-01-01
The electrostatic free energy contribution of an ion pair in a protein depends on two factors, geometrical orientation of the side-chain charged groups with respect to each other and the structural context of the ion pair in the protein. Conformers in NMR ensembles enable studies of the relationship between geometry and electrostatic strengths of ion pairs, because the protein structural contexts are highly similar across different conformers. We have studied this relationship using a dataset of 22 unique ion pairs in 14 NMR conformer ensembles for 11 nonhomologous proteins. In different NMR conformers, the ion pairs are classified as salt bridges, nitrogen-oxygen (N-O) bridges and longer-range ion pairs on the basis of geometrical criteria. In salt bridges, centroids of the side-chain charged groups and at least a pair of side-chain nitrogen and oxygen atoms of the ion-pairing residues are within a 4 A distance. In N-O bridges, at least a pair of the side-chain nitrogen and oxygen atoms of the ion-pairing residues are within 4 A distance, but the distance between the side-chain charged group centroids is greater than 4 A. In the longer-range ion pairs, the side-chain charged group centroids as well as the side-chain nitrogen and oxygen atoms are more than 4 A apart. Continuum electrostatic calculations indicate that most of the ion pairs have stabilizing electrostatic contributions when their side-chain charged group centroids are within 5 A distance. Hence, most (approximately 92%) of the salt bridges and a majority (68%) of the N-O bridges are stabilizing. Most (approximately 89%) of the destabilizing ion pairs are the longer-range ion pairs. In the NMR conformer ensembles, the electrostatic interaction between side-chain charged groups of the ion-pairing residues is the strongest for salt bridges, considerably weaker for N-O bridges, and the weakest for longer-range ion pairs. These results suggest empirical rules for stabilizing electrostatic interactions in proteins. PMID:12202384
Tribocorrosion Failure Mechanism of TiN/SiOx Duplex Coating Deposited on AISI304 Stainless Steel.
Chen, Qiang; Xie, Zhiwen; Chen, Tian; Gong, Feng
2016-11-26
TiN/SiO x duplex coatings were synthesized on AISI304 stainless steel by plasma immersion ion implantation and deposition (PIIID) followed by radio frequency magnetron sputtering (RFMS). The microstructure and tribocorrosion failure behaviors of the duplex coatings were investigated by X-ray diffraction, X-ray photoelectron spectroscopy, scanning electron microscopy, atomic force microscopy, reciprocating-sliding tribometer, and electrochemical tests. The as-deposited duplex coating had a two-layered columnar growth structure consisting of face-centered cubic TiN and amorphous SiO x . Sliding tests showed that the TiN interlayer had good adhesion with the substrate, but the SiO x layer suffered from severe delamination failure. Friction force induced a number of micro-cracks in the coating, which provided channels for the diffusion of NaCl solution. The tribocorrosion test showed that the duplex coating exhibited a lower wear-performance in NaCl solution than in ambient atmosphere. Multi-scale chloride ion corrosion occurred simultaneously and substantially degraded the bonding strength of the columnar crystals or neighboring layers. Force-corrosion synergy damage eventually led to multi-degradation failure of the duplex coating. The presented results provide a comprehensive understanding of the tribocorrosion failure mechanism in coatings with duplex architecture.
Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex.
McHugh, Thomas; Beckley, Lila; Sullivan, Terry; Lutes, Chris; Truesdale, Robert; Uppencamp, Rob; Cosky, Brian; Zimmerman, John; Schumacher, Brian
2017-11-15
The role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into the duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. These test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope. Copyright © 2017 Elsevier B.V. All rights reserved.
Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex
McHugh, Thomas; Beckley, Lila; Sullivan, Terry; ...
2017-04-26
We report the role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into themore » duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. Finally, these test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope.« less
Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex
DOE Office of Scientific and Technical Information (OSTI.GOV)
McHugh, Thomas; Beckley, Lila; Sullivan, Terry
We report the role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into themore » duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. Finally, these test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope.« less
Lattimer, C R; Azzam, M; Kalodiki, E; Geroulakos, G
2014-03-01
Venous filling time (VFT90) is the time taken to reach 90% of the venous volume in the calf. It is recorded by air-plethysmography (APG(®)) and is assumed to measure global venous reflux duration. However, this has never been confirmed by duplex. The aim of the study was to compare VFT on APG to venous reflux time/duration (RT) measured simultaneously with duplex on the same patients. Twenty-six consecutive patients, M:F = 16:10, age (25-78), C1 = 1, C2 = 4, C3 = 8, C4a = 6, C4b = 4, C5 = 2, C6 = 1, underwent simultaneous APG with duplex. The venous filling index (VFI, mL/second), VFT90 (seconds), great saphenous vein (GSV) RT on duplex, averaged thigh GSV diameter and thigh length (length) between the APG sensor air-cuff and duplex transducer were recorded. The VFT100 was calculated by VFT90/0.9. The additional time taken to fill the thigh was achieved using the VFI, length and deep vein diameter (d), to determine the corrected reflux duration: CRD = VFT100 + (length × πd(2)/4 (1/VFI)). Twenty-five patients are presented. One patient with very mild reflux (VFT90 = 55.9 seconds) had an indeterminate endpoint on duplex and was excluded. The median (range) VFI and GSV diameter was 4.9(1.3-15.5) mL/second and 7(4-17) mm, respectively. The VFT90 and VFT100 both correlated with RT on duplex (Spearman, P < 0.0005) at: r = 0.933, r(2) linear = 0.72 and r = 0.933, r(2) linear = 0.68, respectively. The median (interquartile range) filling time with VFT90 was less than the duplex RT at 24 (16.9) versus 28 (20) seconds respectively, P < 0.0005 (Wilcoxon). The median percentage underestimation improved from 24% to 16% and then 4% using the VFT90, VFT100 and CRD, respectively. This is the first study to compare APG parameters with duplex by performing simultaneous measurements. There was an excellent correlation between the VFT90 versus duplex RT, thereby comparing reverse flow in a single superficial vein against the legs overall venous haemodynamic status. These tests can both be used in the quantification of reflux.
Development of duplex real-time PCR for the detection of WSSV and PstDV1 in cultivated shrimp.
Leal, Carlos A G; Carvalho, Alex F; Leite, Rômulo C; Figueiredo, Henrique C P
2014-07-05
The White spot syndrome virus (WSSV) and Penaeus stylirostris penstyldensovirus 1 (previously named Infectious hypodermal and hematopoietic necrosis virus-IHHNV) are two of the most important viral pathogens of penaeid shrimp. Different methods have been applied for diagnosis of these viruses, including Real-time PCR (qPCR) assays. A duplex qPCR method allows the simultaneous detection of two viruses in the same sample, which is more cost-effective than assaying for each virus separately. Currently, an assay for the simultaneous detection of the WSSV and the PstDV1 in shrimp is unavailable. The aim of this study was to develop and standardize a duplex qPCR assay for the simultaneous detection of the WSSV and the PstDV1 in clinical samples of diseased L. vannamei. In addition, to evaluate the performance of two qPCR master mixes with regard to the clinical sensitivity of the qPCR assay, as well as, different methods for qPCR results evaluation. The duplex qPCR assay for detecting WSSV and PstDV1 in clinical samples was successfully standardized. No difference in the amplification of the standard curves was observed between the duplex and singleplex assays. Specificities and sensitivities similar to those of the singleplex assays were obtained using the optimized duplex qPCR. The analytical sensitivities of duplex qPCR were two copies of WSSV control plasmid and 20 copies of PstDV1 control plasmid. The standardized duplex qPCR confirmed the presence of viral DNA in 28 from 43 samples tested. There was no difference for WSSV detection using the two kits and the distinct methods for qPCR results evaluation. High clinical sensitivity for PstDV1 was obtained with TaqMan Universal Master Mix associated with relative threshold evaluation. Three cases of simultaneous infection by the WSSV and the PstDV1 were identified with duplex qPCR. The standardized duplex qPCR was shown to be a robust, highly sensitive, and feasible diagnostic tool for the simultaneous detection of the WSSV and the PstDV1 in whiteleg shrimp. The use of the TaqMan Universal Master Mix and the relative threshold method of data analysis in our duplex qPCR method provided optimal levels of sensitivity and specificity.
Zhang, Na; Ding, Shuang; Kolbanovskiy, Alexander; Shastry, Anant; Kuzmin, Vladimir A; Bolton, Judy L; Patel, Dinshaw J; Broyde, Suse; Geacintov, Nicholas E
2009-08-04
The equine estrogens equilin (EQ) and equilenin (EN) are the active components in the widely prescribed hormone replacement therapy formulation Premarin. Metabolic activation of EQ and EN generates the catechol 4-hydroxyequilenin (4-OHEN) that autoxidizes to the reactive o-quinone form in aerated aqueous solutions. The o-quinones react predominantly with C, and to a lesser extent with A and G, to form premutagenic cyclic covalent DNA adducts in vitro and in vivo. To obtain insights into the structural properties of these biologically important DNA lesions, we have synthesized site-specifically modified oligonucleotides containing the stereoisomeric 1'S,2'R,3'R-4-OHEN-C3 and 1'R,2'S,3'S-4-OHEN-C4 adducts derived from the reaction of 4-OHEN with the C in the oligonucleotide 5'-GGTAGCGATGG in aqueous solution. A combined NMR and computational approach was utilized to determine the conformational characteristics of the two major 4-OHEN-C3 and 4-OHEN-C4 stereoisomeric adducts formed in this oligonucleotide hybridized with its complementary strand. In both cases, the modified C adopts an anti glycosidic bond conformation; the equilenin distal ring protrudes into the minor groove while its two proximal hydroxyl groups are exposed on the major groove side of the DNA duplex. The bulky 4-OHEN-C adduct distorts the duplex within the central GC*G portion, but Watson-Crick pairing is maintained adjacent to C* in both stereoisomeric adducts. For the 4-OHEN-C3 adduct, the equilenin rings are oriented toward the 5'-end of the modified strand, while in 4-OHEN-C4 the equilenin is 3'-directed. Correspondingly, the distortions of the double-helical structures are more pronounced on the 5'- or the 3'-side of the lesion, respectively. These differences in stereoisomeric adduct conformations may play a role in the processing of these lesions in cellular environments.