Science.gov

Sample records for pairs duplex stability

  1. DNA duplex stability of the thio-iso-guanine•methyl-iso-Cytosine base pair.

    PubMed

    Lee, Dongkye; Switzer, Christopher

    2015-01-01

    We report the synthesis, incorporation into oligonucleotides, and base-pairing properties of the 2-thio-variant of iso-guanine. Iso-guanine is the purine component of a nonstandard base pair with 5-methyl-iso-cytosine. The 2-thio-iso-guanine • 5-methyl-iso-cytosine base pair is found to have similar stability to an adenine • thymine pair.

  2. DNA as membrane-bound ligand-receptor pairs: duplex stability is tuned by intermembrane forces.

    PubMed

    Beales, Paul A; Vanderlick, T Kyle

    2009-02-18

    We use membrane-anchored DNA as model adhesion receptors between lipid vesicles. By studying the thermal stability of DNA duplex formation, which tethers the vesicles into superstructures, we show that the melting temperature of a 10-base DNA sequence is dependent on the lipid composition of the tethered vesicles. We propose a simple model that describes how the intermembrane interactions tilt the free energy landscape for DNA binding. From our model, we estimate the area per DNA in the binding sites between vesicles and also the total area of the adhesion plaques. We find that vesicles containing a small proportion of cationic lipid that are modified with membrane-anchored DNA can be reversibly tethered by specific DNA interactions and that the DNA also induces a small attraction between these membranes, which stabilizes the DNA duplex. By increasing the equilibrium intermembrane distance on binding, we show that intermembrane interactions become negligible for the binding thermodynamics of the DNA and hence the thermal stability of vesicle aggregates becomes independent of lipid composition at large enough intervesicle separations. We discuss the implications of our findings with regards to cell adhesion and fusion receptors, and the programmable self-assembly of nano-structured materials by DNA hybridization.

  3. Thermodynamic stability and Watson-Crick base pairing in the seed duplex are major determinants of the efficiency of the siRNA-based off-target effect.

    PubMed

    Ui-Tei, Kumiko; Naito, Yuki; Nishi, Kenji; Juni, Aya; Saigo, Kaoru

    2008-12-01

    Short interfering RNA (siRNA) may down-regulate many unintended genes whose transcripts possess complementarity to the siRNA seed region, which contains 7 nt. The capability of siRNA to induce this off-target effect was highly correlated with the calculated melting temperature or standard free-energy change for formation of protein-free seed duplex, indicating that thermodynamic stability of seed duplex formed between the seed and target is one of the major factor in determining the degree of off-target effects. Furthermore, unlike intended gene silencing (RNA interference), off-target effect was completely abolished by introduction of a G:U pair into the seed duplex, and this loss in activity was completely recovered by a second mutation regenerating Watson-Crick pairing, indicating that seed duplex Watson-Crick pairing is also essential for off-target gene silencing. The off-target effect was more sensitive to siRNA concentration compared to intended gene silencing, which requires a near perfect sequence match between the siRNA guide strand and target mRNA.

  4. Structural, electronic, and optical properties of metallo base pairs in duplex DNA: a theoretical insight.

    PubMed

    Samanta, Pralok K; Manna, Arun K; Pati, Swapan K

    2012-11-01

    Using density functional theory calculations, we investigated the structural, energetic, electronic, and optical properties of recently synthesized duplex DNA containing metal-mediated base pairs. The studied duplex DNA consists of three imidazole (Im) units linked through metal (Im-M-Im, M = metal) and four flanking A:T base pairs (two on each side). We examined the role of artificial base pairing in the presence of two distinctive metal ions, diamagnetic Ag(+) and magnetic Cu(2+) ions, on the stability of duplex DNA. We found that metal-mediated base pairs form stable duplex DNA by direct metal ion coordination to the Im bases. Our results suggest a higher binding stability of base pairing mediated by Cu(2+) ions than by Ag(+) ions, which is attributed to a larger extent of orbital hybridization. We furthermore found that DNA modified with Im-Ag(+)-Im shows the low-energy optical absorption characteristic of π-π*orbital transition of WC A:T base pairs. On the other hand, we found that the low-energy optical absorption peaks for DNA modified with Im-Cu(2+)-Im originate from spin-spin interactions. Additionally, this complex exhibits weak ferromagnetic coupling between Cu(2+) ions and strong spin polarization, which could be used for memory devices. Moreover, analyzing the role of counter ions (Na(+)) and the presence of explicit water molecules on the structural stability and electronic properties of the DNA duplex modified with Im-Ag(+)-Im, we found that the impact of these two factors is negligible. Our results are fruitful for understanding the experimental data and suggest a potential route for constructing effective metal-mediated base pairs in duplex DNA for optoelectronic applications.

  5. Sequence Recognition in the Pairing of DNA Duplexes

    NASA Astrophysics Data System (ADS)

    Kornyshev, A. A.; Leikin, S.

    2001-04-01

    Pairing of DNA fragments with homologous sequences occurs in gene shuffling, DNA repair, and other vital processes. While chemical individuality of base pairs is hidden inside the double helix, x ray and NMR revealed sequence-dependent modulation of the structure of DNA backbone. Here we show that the resulting modulation of the DNA surface charge pattern enables duplexes longer than ~50 base pairs to recognize sequence homology electrostatically at a distance of up to several water layers. This may explain the local recognition observed in pairing of homologous chromosomes and the observed length dependence of homologous recombination.

  6. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  7. Nucleic Acid Duplexes Incorporating a Dissociable Covalent Base Pair

    NASA Astrophysics Data System (ADS)

    Gao, Kui; Orgel, Leslie E.

    1999-12-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  8. Crystal structure studies of RNA duplexes containing s(2)U:A and s(2)U:U base pairs.

    PubMed

    Sheng, Jia; Larsen, Aaron; Heuberger, Benjamin D; Blain, J Craig; Szostak, Jack W

    2014-10-01

    Structural studies of modified nucleobases in RNA duplexes are critical for developing a full understanding of the stability and specificity of RNA base pairing. 2-Thio-uridine (s(2)U) is a modified nucleobase found in certain tRNAs. Thermodynamic studies have evaluated the effects of s(2)U on base pairing in RNA, where it has been shown to stabilize U:A pairs and destabilize U:G wobble pairs. Surprisingly, no high-resolution crystal structures of s(2)U-containing RNA duplexes have yet been reported. We present here two high-resolution crystal structures of heptamer RNA duplexes (5'-uagcs(2)Ucc-3' paired with 3'-aucgAgg-5' and with 3'-aucgUgg-5') containing s(2)U:A and s(2)U:U pairs, respectively. For comparison, we also present the structures of their native counterparts solved under identical conditions. We found that replacing O2 with S2 stabilizes the U:A base pair without any detectable structural perturbation. In contrast, an s(2)U:U base pair is strongly stabilized in one specific U:U pairing conformation out of four observed for the native U:U base pair. This s(2)U:U stabilization appears to be due at least in part to an unexpected sulfur-mediated hydrogen bond. This work provides additional insights into the effects of 2-thio-uridine on RNA base pairing.

  9. Influence of two bulge loops on the stability of RNA duplexes.

    PubMed

    Crowther, Claire V; Jones, Laura E; Morelli, Jessica N; Mastrogiacomo, Eric M; Porterfield, Claire; Kent, Jessica L; Serra, Martin J

    2017-02-01

    Fifty-three RNA duplexes containing two single nucleotide bulge loops were optically melted in 1 M NaCl in order to determine the thermodynamic parameters ΔH°, ΔS°, ΔG°37, and TM for each duplex. Because of the large number of possible combinations and lack of sequence effects observed previously, we limited our initial investigation to adenosine bulges, the most common naturally occurring bulge. For example, the following duplexes were investigated: 5'GGCAXYAGGC/3'CCG YX CCG, 5'GGCAXY GCC/3'CCG YXACGG, and 5'GGC XYAGCC/3'CCGAYX CGG. The identity of XY (where XY are Watson-Crick base pairs) and the total number of base pairs in the terminal and central stems were varied. As observed for duplexes with a single bulge loop, the effect of the two bulge loops on duplex stability is primarily influenced by non-nearest neighbor interactions. In particular, the stability of the stems influences the destabilization of the duplex by the inserted bulge loops. The model proposed to predict the influence of multiple bulge loops on duplex stability suggests that the destabilization of each bulge is related to the stability of the adjacent stems. A database of RNA secondary structures was examined to determine the naturally occurring abundance of duplexes containing multiple bulge loops. Of the 2000 examples found in the database, over 65% of the two bulge loops occur within 3 base pairs of each other. A database of RNA three-dimensional structures was examined to determine the structure of duplexes containing two single nucleotide bulge loops. The structures of the bulge loops are described.

  10. Formation of sheared G:A base pairs in an RNA duplex modelled after ribozymes, as revealed by NMR.

    PubMed Central

    Katahira, M; Kanagawa, M; Sato, H; Uesugi, S; Fujii, S; Kohno, T; Maeda, T

    1994-01-01

    The thermal stability and structure of an RNA duplex, r(GGACGAGUCC)2, the base sequence of which was modelled after both a hammerhead ribozyme and a lead ribozyme, were studied by CD and NMR. We previously demonstrated that the corresponding DNA duplex, d(GGACGAGTCC)2, formed unique 'sheared' G:A base pairs, where an amino proton, instead of an imino proton, of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head' (Nucleic Acids Res. (1993) 21, 5418-5424). CD melting profiles showed that the RNA duplex is thermally more stable than the corresponding DNA duplex. NMR studies revealed that sheared G:A base pairs are formed in the RNA duplex, too, although the overall structure of the RNA is the A form, which differs from the B form taken on by the corresponding DNA. A model building study confirmed that sheared G:A base pairs can be accommodated in the double helical structure of the A form. A difference between the RNA and DNA duplexes in the stacking interaction involving G:A mismatch bases is also suggested. The demonstration that sheared G:A base pairs can be formed not only in DNA but also in RNA suggests that this base pairing plays an important role regarding the RNA structure. PMID:7519767

  11. Formation of sheared G:A base pairs in an RNA duplex modelled after ribozymes, as revealed by NMR.

    PubMed

    Katahira, M; Kanagawa, M; Sato, H; Uesugi, S; Fujii, S; Kohno, T; Maeda, T

    1994-07-25

    The thermal stability and structure of an RNA duplex, r(GGACGAGUCC)2, the base sequence of which was modelled after both a hammerhead ribozyme and a lead ribozyme, were studied by CD and NMR. We previously demonstrated that the corresponding DNA duplex, d(GGACGAGTCC)2, formed unique 'sheared' G:A base pairs, where an amino proton, instead of an imino proton, of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head' (Nucleic Acids Res. (1993) 21, 5418-5424). CD melting profiles showed that the RNA duplex is thermally more stable than the corresponding DNA duplex. NMR studies revealed that sheared G:A base pairs are formed in the RNA duplex, too, although the overall structure of the RNA is the A form, which differs from the B form taken on by the corresponding DNA. A model building study confirmed that sheared G:A base pairs can be accommodated in the double helical structure of the A form. A difference between the RNA and DNA duplexes in the stacking interaction involving G:A mismatch bases is also suggested. The demonstration that sheared G:A base pairs can be formed not only in DNA but also in RNA suggests that this base pairing plays an important role regarding the RNA structure.

  12. Additional base-pair formation in DNA duplexes by a double-headed nucleotide.

    PubMed

    Madsen, Charlotte S; Witzke, Sarah; Kumar, Pawan; Negi, Kushuma; Sharma, Pawan K; Petersen, Michael; Nielsen, Poul

    2012-06-11

    We have designed and synthesised a double-headed nucleotide that presents two nucleobases in the interior of a dsDNA duplex. This nucleotide recognises and forms Watson-Crick base pairs with two complementary adenosines in a Watson-Crick framework. Furthermore, with judicious positioning in complementary strands, the nucleotide recognises itself through the formation of a T:T base pair. Thus, two novel nucleic acid motifs can be defined by using our double-headed nucleotide. Both motifs were characterised by UV melting experiments, CD and NMR spectroscopy and molecular dynamics simulations. Both motifs leave the thermostability of the native dsDNA duplex largely unaltered. Molecular dynamics calculations showed that the double-headed nucleotides are accommodated in the dsDNA by entirely local perturbations and that the modified duplexes retain an overall B-type geometry with the dsDNA unwound by around 25 or 60°, respectively, in each of the modified motifs. Both motifs can be accommodated twice in a dsDNA duplex without incurring any loss of stability and extrapolating from this observation and the results of modelling, it is conceivable that both can be multiplied several times within a dsDNA duplex. These new motifs extend the DNA recognition repertoire and may form the basis for a complete series of double-headed nucleotides based on all 16 base combinations of the four natural nucleobases. In addition, both motifs can be used in the design of nanoscale DNA structures in which a specific duplex twist is required.

  13. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    PubMed Central

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  14. 6-Pyrazolylpurine as an Artificial Nucleobase for Metal-Mediated Base Pairing in DNA Duplexes

    PubMed Central

    Léon, J. Christian; Sinha, Indranil; Müller, Jens

    2016-01-01

    The artificial nucleobase 6-pyrazol-1-yl-purine (6PP) has been investigated with respect to its usability in metal-mediated base pairing. As was shown by temperature-dependent UV spectroscopy, 6PP may form weakly stabilizing 6PP–Ag(I)–6PP homo base pairs. Interestingly, 6PP can be used to selectively recognize a complementary pyrimidine nucleobase. The addition of Ag(I) to a DNA duplex comprising a central 6PP:C mispair (C = cytosine) leads to a slight destabilization of the duplex. In contrast, a stabilizing 6PP–Ag(I)–T base pair is formed with a complementary thymine (T) residue. It is interesting to note that 6PP is capable of differentiating between the pyrimidine moieties despite the fact that it is not as sterically crowded as 6-(3,5-dimethylpyrazol-1-yl)purine, an artificial nucleobase that had previously been suggested for the recognition of nucleic acid sequences via the formation of a metal-mediated base pair. Hence, the additional methyl groups of 6-(3,5-dimethylpyrazol-1-yl)purine may not be required for the specific recognition of the complementary nucleobase. PMID:27089326

  15. A pyrimidopyrimidine Janus-AT nucleoside with improved base-pairing properties to both A and T within a DNA duplex: the stabilizing effect of a second endocyclic ring nitrogen.

    PubMed

    Largy, Eric; Liu, Wenbo; Hasan, Abid; Perrin, David M

    2014-02-03

    Janus bases are heterocyclic nucleic acid base analogs that present two different faces able to simultaneously hydrogen bond to nucleosides that form Watson-Crick base pairs. The synthesis of a Janus-AT nucleotide analogue, (N)JAT , that has an additional endocyclic ring nitrogen and is thus more capable of efficiently discriminating T/A over G/C bases when base-pairing in a standard duplex-DNA context is described. Conversion to a phosphoramidite ultimately afforded incorporation into an oligonucleotide. In contrast to the first generation of carbocyclic Janus heterocycles, it remains in its unprotonated state at physiological pH and, therefore, forms very stable Watson-Crick base pairs with either A or T bases. Biophysical and computational methods indicate that (N)JAT is an improved candidate for sequence-specific genome targeting.

  16. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    PubMed

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials.

  17. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes.

    PubMed

    Sochacka, Elzbieta; Szczepanowski, Roman H; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-03-11

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon-anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3'-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif.

  18. Stability of DNA duplexes containing GG, CC, AA, and TT mismatches.

    PubMed

    Tikhomirova, Anna; Beletskaya, Irina V; Chalikian, Tigran V

    2006-09-05

    We employed salt-dependent differential scanning calorimetric measurements to characterize the stability of six oligomeric DNA duplexes (5'-GCCGGAXTGCCGG-3'/5'-CCGGCAYTCCGGC-3') that contain in the central XY position the GC, AT, GG, CC, AA, or TT base pair. The heat-induced helix-to-coil transitions of all the duplexes are associated with positive changes in heat capacity, DeltaC(p), ranging from 0.43 to 0.53 kcal/mol. Positive values of DeltaC(p) result in strong temperature dependences of changes in enthalpy, DeltaH degrees, and entropy, DeltaS degrees , accompanying duplex melting and cause melting free energies, DeltaG degrees, to exhibit characteristically curved shapes. These observations suggest that DeltaC(p) needs to be carefully taken into account when the parameters of duplex stability are extrapolated to temperatures distant from the transition temperature, T(M). Comparison of the calorimetric and van't Hoff enthalpies revealed that none of the duplexes studied in this work exhibits two-state melting. Within the context of the central AXT/TYA triplet, the thermal and thermodynamic stabilities of the duplexes in question change in the following order: GC > AT > GG > AA approximately TT > CC. Our estimates revealed that the thermodynamic impact of the GG, AA, and TT mismatches is confined within the central triplet. In contrast, the thermodynamic impact of the CC mismatch propagates into the adjacent helix domains and may involve 7-9 bp. We discuss implications of our results for understanding the origins of initial recognition of mismatched DNA sites by enzymes of the DNA repair machinery.

  19. Deformability Calculation for Estimation of the Relative Stability of Chemically Modified RNA Duplexes.

    PubMed

    Masaki, Yoshiaki; Sekine, Mitsuo; Seio, Kohji

    2017-03-02

    Chemical modification of RNA duplexes alters their stability. We have attempted to develop a computational approach to estimate the thermal stability of chemically modified duplexes. These studies revealed that the deformability of chemically modified RNA duplexes, calculated from molecular dynamics simulations, could be used as a good indicator for estimating the effect of chemical modification on duplex thermal stability. This unit describes how deformability calculation can be applied to estimate the relative stability of chemically modified RNA duplexes. © 2017 by John Wiley & Sons, Inc.

  20. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  1. Hammerhead ribozyme activity and oligonucleotide duplex stability in mixed solutions of water and organic compounds

    PubMed Central

    Nakano, Shu-ichi; Kitagawa, Yuichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2014-01-01

    Nucleic acids are useful for biomedical targeting and sensing applications in which the molecular environment is different from that of a dilute aqueous solution. In this study, the influence of various types of mixed solutions of water and water-soluble organic compounds on RNA was investigated by measuring the catalytic activity of the hammerhead ribozyme and the thermodynamic stability of an oligonucleotide duplex. The compounds with a net neutral charge, such as poly(ethylene glycol), small primary alcohols, amide compounds, and aprotic solvent molecules, added at high concentrations changed the ribozyme-catalyzed RNA cleavage rate, with the magnitude of the effect dependent on the NaCl concentration. These compounds also changed the thermodynamic stability of RNA base pairs of an oligonucleotide duplex and its dependence on the NaCl concentration. Specific interactions with RNA molecules and reduced water activity could account for the inhibiting effects on the ribozyme catalysis and destabilizing effects on the duplex stability. The salt concentration dependence data correlated with the dielectric constant, but not with water activity, viscosity, and the size of organic compounds. This observation suggests the significance of the dielectric constant effects on the RNA reactions under molecular crowding conditions created by organic compounds. PMID:25161873

  2. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

    PubMed Central

    Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-01-01

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

  3. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    PubMed

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences.

  4. New insights into Hoogsteen base pairs in DNA duplexes from a structure-based survey

    PubMed Central

    Zhou, Huiqing; Hintze, Bradley J.; Kimsey, Isaac J.; Sathyamoorthy, Bharathwaj; Yang, Shan; Richardson, Jane S.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen (HG) base pairs (bps) provide an alternative pairing geometry to Watson–Crick (WC) bps and can play unique functional roles in duplex DNA. Here, we use structural features unique to HG bps (syn purine base, HG hydrogen bonds and constricted C1′–C1′ distance across the bp) to search for HG bps in X-ray structures of DNA duplexes in the Protein Data Bank. The survey identifies 106 A•T and 34 G•C HG bps in DNA duplexes, many of which are undocumented in the literature. It also uncovers HG-like bps with syn purines lacking HG hydrogen bonds or constricted C1′–C1′ distances that are analogous to conformations that have been proposed to populate the WC-to-HG transition pathway. The survey reveals HG preferences similar to those observed for transient HG bps in solution by nuclear magnetic resonance, including stronger preferences for A•T versus G•C bps, TA versus GG steps, and also suggests enrichment at terminal ends with a preference for 5′-purine. HG bps induce small local perturbations in neighboring bps and, surprisingly, a small but significant degree of DNA bending (∼14°) directed toward the major groove. The survey provides insights into the preferences and structural consequences of HG bps in duplex DNA. PMID:25813047

  5. Effect of Base-Pairing Partner on the Thermodynamic Stability of the Diastereomeric Spiroiminodihydantoin Lesion.

    PubMed

    Gruessner, Brian; Dwarakanath, Megana; Stewart, Elizabeth; Bae, Yoon; Jamieson, Elizabeth R

    2016-03-21

    Oxidation of guanine by reactive oxygen species and high valent metals produces damaging DNA base lesions like 8-oxo-7,8-dihydroguanine (8-oxoG). 8-oxoG can be further oxidized to form the spiroiminodihydantoin (Sp) lesion, which is even more mutagenic. DNA polymerases preferentially incorporate purines opposite the Sp lesion, and DNA glycosylases excise the Sp lesion from the duplex, although the rate of repair is different for the two Sp diastereomers. To further understand the biological processing of the Sp lesion, differential scanning calorimetry studies were performed on a series of 15-mer DNA duplexes. The thermal and thermodynamic stabilities of each of the Sp diastereomers paired to the four standard DNA bases were investigated. It was found that, regardless of the base-pairing partner, the Sp lesion was always highly destabilizing in terms of DNA melting temperature, enthalpic stability, and overall duplex free energy. We found no significant differences between the two Sp diastereomers, but changing the base-pairing partner of the Sp lesion produced slight differences in stability. Specifically, duplexes with Sp:C pairings were always the most destabilized, whereas pairing the Sp lesion with a purine base modestly increased stability. Overall, these results suggest that, although the stability of the Sp diastereomers cannot explain the differences in the rates of repair by DNA glycosylases, the most stable base-pairing partners do correspond with the nucleotide preference of DNA polymerases.

  6. NMR structure of duplex DNA containing the alpha-OH-PdG.dA base pair: a mutagenic intermediate of acrolein.

    PubMed

    Zaliznyak, Tanya; Lukin, Mark; El-khateeb, Mahmoud; Bonala, Rahda; Johnson, Francis; de los Santos, Carlos

    2010-04-01

    Acrolein, a cell metabolic product and main component of cigarette smoke, reacts with DNA generating alpha-OH-PdG lesions, which have the ability to pair with dATP during replication thereby causing G to T transversions. We describe the solution structure of an 11-mer DNA duplex containing the mutagenic alpha-OH-PdG.dA base pair intermediate, as determined by solution nuclear magnetic resonance (NMR) spectroscopy and retrained molecular dynamics (MD) simulations. The NMR data support a mostly regular right-handed helix that is only perturbed at its center by the presence of the lesion. Undamaged residues of the duplex are in anti orientation, forming standard Watson-Crick base pairs alignments. Duplication of proton signals at and near the damaged base pair reveals the presence of two enantiomeric duplexes, thus establishing the exocyclic nature of the lesion. The alpha-OH-PdG adduct assumes a syn conformation pairing to its partner dA base that is protonated at pH 6.6. The three-dimensional structure obtained by restrained molecular dynamics simulations show hydrogen bond interactions that stabilize alpha-OH-PdG in a syn conformation and across the lesion containing base pair. We discuss the implications of the structures for the mutagenic bypass of acrolein lesions.

  7. Base pair opening kinetics study of the aegPNA:DNA hydrid duplex containing a site-specific GNA-like chiral PNA monomer.

    PubMed

    Seo, Yeo-Jin; Lim, Jisoo; Lee, Eun-Hae; Ok, Taedong; Yoon, Juyoung; Lee, Joon-Hwa; Lee, Hee-Seung

    2011-09-01

    Peptide nucleic acids (PNA) are one of the most widely used synthetic DNA mimics where the four bases are attached to a N-(2-aminoethyl)glycine (aeg) backbone instead of the negative-charged phosphate backbone in DNA. We have developed a chimeric PNA (chiPNA), in which a chiral GNA-like γ(3)T monomer is incorporated into aegPNA backbone. The base pair opening kinetics of the aegPNA:DNA and chiPNA:DNA hybrid duplexes were studied by NMR hydrogen exchange experiments. This study revealed that the aegPNA:DNA hybrid is much more stable duplex and is less dynamic compared to DNA duplex, meaning that base pairs are opened and reclosed much more slowly. The site-specific incorporation of γ(3)T monomer in the aegPNA:DNA hybrid can destabilize a specific base pair and its neighbors, maintaining the thermal stabilities and dynamic properties of other base pairs. Our hydrogen exchange study firstly revealed the unique kinetic features of base pairs in the aegPNA:DNA and chiPNA:DNA hybrids, which will provide an insight into the development of methodology for specific DNA recognition using PNA fragments.

  8. Thermal stability and energetics of 15-mer DNA duplex interstrand crosslinked by trans-diamminedichloroplatinum(II).

    PubMed

    Hofr, Ctirad; Brabec, Viktor

    2005-03-01

    The effect of the location of the interstrand cross-link formed by trans-diamminedichloroplatinum(II) (transplatin) on the thermal stability and energetics of 15-mer DNA duplex has been investigated. The duplex containing single, site-specific cross-link, thermodynamically equivalent model structures (hairpins) and nonmodified duplexes were characterized by differential scanning calorimetry, temperature-dependent uv absorption, and circular dichroism. The results demonstrate that the formation of the interstrand cross-link of transplatin does not affect pronouncedly thermodynamic stability of DNA: the cross-link induces no marked changes not only in enthalpy, but also in "reduced" (concentration independent) monomolecular transition entropy. These results are consistent with the previous observations that interstrand cross-links of transplatin structurally perturb DNA only to a relatively small extent. On the other hand, constraining the duplex with the interstrand cross-link of transplatin results in a significant increase in thermal stability that is primarily due to entropic effects: the cross-link reduces the molecularity of the oligomer system from bimolecular to monomolecular. Importantly, the position of the interstrand cross-link within the duplex modulates cooperativity of the melting transition of the duplex and consequently its thermal stability.

  9. Calorimetric and Spectroscopic Analysis of the Thermal Stability of Short Duplex DNA-Containing Sugar and Base-Modified Nucleotides.

    PubMed

    Fakhfakh, Kareem; Hughesman, Curtis B; Louise Creagh, A; Kao, Vincent; Haynes, Charles

    2016-01-01

    Base- and sugar-modified analogs of DNA and RNA are finding ever expanding use in medicine and biotechnology as tools to better tailor structured oligonucleotides by altering their thermal stability, nuclease resistance, base-pairing specificity, antisense activity, or cellular uptake. Proper deployment of these chemical modifications generally requires knowledge of how each affects base-pairing properties and thermal stabilities. Here, we describe in detail how differential scanning calorimetry and UV spectroscopy may be used to quantify the melting thermodynamics of short dsDNA containing chemically modified nucleosides in one or both strands. Insights are provided into why and how the presence of highly stable base pairs containing modified nucleosides can alter the nature of calorimetry or melting spectroscopy data, and how each experiment must therefore be conducted to ensure high-quality melting thermodynamics data are obtained. Strengths and weaknesses of the two methods when applied to chemically modified duplexes are also addressed.

  10. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Gwinn, Elisabeth G.

    2016-04-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson-Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag+, as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag+-DNA nanostructures. Our studies of Ag+-induced assembly of non-complementary DNA oligomers employ strands of 2-24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag+ can be achieved by optimizing solution conditions. These Ag+-mediated duplexes are stable to at least 60 mM Mg2+, higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag+-mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag+-mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’.

  11. Yeast Pif1 helicase exhibits a one-base-pair stepping mechanism for unwinding duplex DNA.

    PubMed

    Ramanagoudr-Bhojappa, Ramanagouda; Chib, Shubeena; Byrd, Alicia K; Aarattuthodiyil, Suja; Pandey, Manjula; Patel, Smita S; Raney, Kevin D

    2013-05-31

    Kinetic analysis of the DNA unwinding and translocation activities of helicases is necessary for characterization of the biochemical mechanism(s) for this class of enzymes. Saccharomyces cerevisiae Pif1 helicase was characterized using presteady state kinetics to determine rates of DNA unwinding, displacement of streptavidin from biotinylated DNA, translocation on single-stranded DNA (ssDNA), and ATP hydrolysis activities. Unwinding of substrates containing varying duplex lengths was fit globally to a model for stepwise unwinding and resulted in an unwinding rate of ∼75 bp/s and a kinetic step size of 1 base pair. Pif1 is capable of displacing streptavidin from biotinylated oligonucleotides with a linear increase in the rates as the length of the oligonucleotides increased. The rate of translocation on ssDNA was determined by measuring dissociation from varying lengths of ssDNA and is essentially the same as the rate of unwinding of dsDNA, making Pif1 an active helicase. The ATPase activity of Pif1 on ssDNA was determined using fluorescently labeled phosphate-binding protein to measure the rate of phosphate release. The quantity of phosphate released corresponds to a chemical efficiency of 0.84 ATP/nucleotides translocated. Hence, when all of the kinetic data are considered, Pif1 appears to move along DNA in single nucleotide or base pair steps, powered by hydrolysis of 1 molecule of ATP.

  12. Thermodynamic properties of the specific binding between Ag+ ions and C:C mismatched base pairs in duplex DNA.

    PubMed

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2011-02-01

    Metal-mediated base pairs formed by the interaction between metal ions and artificial bases in oligonucleotides have been developed for potential applications in nanotechnology. We recently found that a natural C:C mismatched base pair bound to an Ag(+) ion to generate a novel metal-mediated base pair in duplex DNA. Preparation of the novel C-Ag-C base pair involving natural bases is more convenient than that of metal-mediated base pairs involving artificial bases because time-consuming base synthesis is not required. Here, we examined the thermodynamic properties of the binding between the Ag(+) ion and each of single and double C:C mismatched base pair in duplex DNA by isothermal titration calorimetry. The Ag(+) ion specifically bound to the C:C mismatched base pair at a 1:1 molar ratio with 10(6) M(-1) binding constant, which was significantly larger than those for nonspecific metal ion-DNA interactions. The specific binding between the Ag(+) ion and the single C:C mismatched base pair was mainly driven by the positive dehydration entropy change and the negative binding enthalpy change. In the interaction between the Ag(+) ion and each of the consecutive and interrupted double C:C mismatched base pairs, stoichiometric binding at a 1:1 molar ratio was achieved in each step of the first and second Ag(+) binding. The binding affinity for the second Ag(+) binding was similar to that for the first Ag(+) binding. Stoichiometric binding without interference and negative cooperativity may be favorable for aligning multiple Ag(+) ions in duplex DNA for applications of the metal-mediated base pairs in nanotechnology.

  13. Choline Ions Stabilize A-T Base Pairs by Fitting into Minor Groove

    NASA Astrophysics Data System (ADS)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Sugimoto, Naoki

    In a Watson-Crick base paired DNA duplex, G-C base pairs are more stable than A-T base pairs. However, in solvent containing choline ions, the stabilities of these base pairs are reversed. To elucidate the mechanism through which choline ions exert this effect from a microscopic viewpoint, we performed molecular dynamics simulations. We found that choline ions interact with a DNA duplex through multiple hydrogen bonds. The affinity of choline ion for the minor groove of A-T base pairs was higher than that for the major groove. The binding of choline ions to the minor groove of A-T base pairs supports groove formation without disturbing the formation of hydrogen bonds between the base pairs. In contrast, choline ions inhibit the formation of hydrogen bonds between G-C base pairs by binding to atoms of these bases that are involved in Watson-Crick hydrogen bonding. These findings will help us understand the stabilities of canonical DNA structures under the crowded conditions inside cells.

  14. Vacuum UV CD spectra of homopolymer duplexes and triplexes containing A.T or A.U base pairs.

    PubMed Central

    Johnson, K H; Gray, D M; Sutherland, J C

    1991-01-01

    Vacuum UV circular dichroism (CD) spectra were measured down to 174 nm for five homopolymers, five duplexes, and four triplexes containing adenine, uracil, and thymine. Near 190 nm, the CD bands of poly[d(A)] and poly[r(A)] were larger than the CD bands of the polypyrimidines, poly[d(T)], poly[d(U)], and poly[r(U)]. Little change was observed in the 190 nm region upon formation of the duplexes (poly[d(A).d(T)], poly[d(A).d(U)], poly[r(A).d(T)], poly[r(A).d(U)], and poly[r(A).r(U)]) or upon formation of two of the triplexes (poly[d(T).d(A).d(T)] and poly[d(U).d(A).d(U)]). This showed that the purine strand had the same or a similar structure in these duplexes and triplexes as when free in solution. Both A.U and A.T base pairing induced positive bands at 177 and 202 nm. For three triplexes containing poly[d(A)], the formation of a triplex from a duplex and a free pyrimidine strand induced a negative band centered between 210 and 215 nm. The induction of a band between 210 and 215 nm indicated that these triplexes had aspects of the A conformation. PMID:2041768

  15. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  16. Double proton transfer mechanism in the adenine-uracil base pair and spontaneous mutation in RNA duplex

    NASA Astrophysics Data System (ADS)

    Cerón-Carrasco, José P.; Requena, Alberto; Perpète, Eric A.; Michaux, Catherine; Jacquemin, Denis

    2009-12-01

    We study the mechanism of double proton transfer (DPT) in the adenine-uracil (AU) base pair, both in gas phase and under the influence of surrounding water molecules. According to our ab initio calculations, no stable proton transfer product exists in gas phase, while in solution, the DPT process may occur only through the catalysis of water molecules. Nevertheless, a thermodynamic analysis confirms that AU does not contribute to spontaneous mutation in RNA duplex, and thus guanine-cytosine (GC) would be the only base pair contributing to spontaneous mutation.

  17. Enhanced thermal stability and mismatch discrimination of mutation-carrying DNA duplexes and their kinetic and thermodynamic properties in microchannel laminar flow.

    PubMed

    Nagata, Maria Portia B; Yamashita, Kenichi; Miyazaki, Masaya; Nakamura, Hiroyuki; Maeda, Hideaki

    2009-07-01

    This article reports the enhancement of thermal stability involving normal duplex and mutation-carrying DNA duplexes in microchannel laminar flow. The application of an in-house temperature-controllable microchannel-type flow cell is demonstrated for improved discrimination of mismatch base pairs such as A-G and T-G that are difficult to distinguish due to the rather small thermal destabilizations. Enhancement in thermal stability is reflected by an increased thermal melting temperature achieved in microchannel laminar flow as compared with batch reactions. To examine the kinetics and thermodynamics of duplex-coil equilibrium of DNA oligomers, denaturation-renaturation hysteresis curves were measured. The influence of microchannel laminar flow on DNA base mismatch analysis was described from the kinetic and thermodynamic perspectives. An increasing trend was observed for association rate constant as flow rate increased. In contrast, an apparent decrease in dissociation rate constant was observed with increasing flow rate. The magnitudes of the activation energies of dissociation were nearly constant for both the batch and microchannel laminar flow systems at all flow rates. In contrast, the magnitudes of activation energies of association decreased as flow rate increased. These results clearly show how microchannel laminar flow induces change in reaction rate by effecting change in activation energy. We anticipate, therefore, that this approach based on microchannel laminar flow system holds great promise for improved mismatch discrimination in DNA analyses, particularly on single-base-pair mismatch, by pronouncedly enhancing thermal stability.

  18. Binding specificity and stability of duplexes formed by modified oligonucleotides with a 4096-hexanucleotide microarray

    PubMed Central

    Timofeev, Edward; Mirzabekov, Andrei

    2001-01-01

    The binding of oligodeoxynucleotides modified with adenine 2′-O-methyl riboside, 2,6-diaminopurine 2′-O-methyl riboside, cytosine 2′-O-methyl riboside, 2,6-diaminopurine deoxyriboside or 5-bromodeoxyuridine was studied with a microarray containing all possible (4096) polyacrylamide-bound hexadeoxynucleotides (a generic microchip). The generic microchip was manufactured by using reductive immobilization of aminooligonucleotides in the activated copolymer of acrylamide, bis-acrylamide and N-(2,2-dimethoxyethyl) acrylamide. The binding of the fluorescently labeled modified octanucleotides to the array was analyzed with the use of both melting profiles and the fluorescence distribution at selected temperatures. Up to three substitutions of adenosines in the octamer sequence by adenine 2′-O-methyl ribosides (Am), 2,6-diaminopurine 2′-O-methyl ribosides (Dm) or 2,6-diaminopurine deoxyribosides (D) resulted in increased mismatch discrimination measured at the melting temperature of the corresponding perfect duplex. The stability of complexes formed by 2′-O-methyl-adenosine-modified oligodeoxynucleotides was slightly decreased with every additional substitution, yielding ∼4°C of total loss in melting temperature for three modifications, as followed from microchip thermal denaturation experiments. 2,6-Diaminopurine 2′-O-methyl riboside modifications led to considerable duplex stabilization. The cytosine 2′-O-methyl riboside and 5-bromodeoxyuridine modifications generally did not change either duplex stability or mismatch resolution. Denaturation experiments conducted with selected perfect duplexes on microchips and in solution showed similar results on thermal stabilities. Some hybridization artifacts were observed that might indicate the formation of parallel DNA. PMID:11410672

  19. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    PubMed

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events.

  20. Position-dependent effects on stability in tricyclo-DNA modified oligonucleotide duplexes

    PubMed Central

    Ittig, Damian; Gerber, Anna-Barbara; Leumann, Christian J.

    2011-01-01

    A series of oligodeoxyribonucleotides and oligoribonucleotides containing single and multiple tricyclo(tc)-nucleosides in various arrangements were prepared and the thermal and thermodynamic transition profiles of duplexes with complementary DNA and RNA evaluated. Tc-residues aligned in a non-continuous fashion in an RNA strand significantly decrease affinity to complementary RNA and DNA, mostly as a consequence of a loss of pairing enthalpy ΔH. Arranging the tc-residues in a continuous fashion rescues Tm and leads to higher DNA and RNA affinity. Substitution of oligodeoxyribonucleotides in the same way causes much less differences in Tm when paired to complementary DNA and leads to substantial increases in Tm when paired to complementary RNA. CD-spectroscopic investigations in combination with molecular dynamics simulations of duplexes with single modifications show that tc-residues in the RNA backbone distinctly influence the conformation of the neighboring nucleotides forcing them into higher energy conformations, while tc-residues in the DNA backbone seem to have negligible influence on the nearest neighbor conformations. These results rationalize the observed affinity differences and are of relevance for the design of tc-DNA containing oligonucleotides for applications in antisense or RNAi therapy. PMID:20719742

  1. Ab initio study of the phase stability in paramagnetic duplex steel alloys

    NASA Astrophysics Data System (ADS)

    Pitkänen, H.; Alatalo, M.; Puisto, A.; Ropo, M.; Kokko, K.; Punkkinen, M. P. J.; Olsson, P.; Johansson, B.; Hertzman, S.; Vitos, L.

    2009-01-01

    Duplex stainless steels have many superior properties compared to conventional steels, this being mainly due to their microstructure containing approximately equal amount of ferrite and austenite phases formed by iron, chromium (or Cr equivalent), and nickel (or Ni equivalent). Using computational methods based on first-principles theories, the phase stability of paramagnetic Fe1-c-nCrcNin alloys ( 0.12≤c≤0.32 and 0.04≤n≤0.32 ) at high temperatures (≳1000K) is addressed. It is shown that the stabilization of the ferrite-austenite two-phase field in duplex steels is a result of complex interplay of several competing phenomena. Taking into account only the formation energies yields a complete phase separation, strongly overestimating the two-phase region. The formation energies are calculated to be lower for the austenite than for the ferrite, meaning that the configurational entropy has a more significant impact on the stability field of the austenitic phase. The magnetic and vibrational free energies have opposite effects on the phase stability. Namely, the magnetic entropy favors the ferrite phase, whereas the vibrational free energy stabilizes the austenite phase. Combining the formation energies with the magnetic, vibrational, and configurational free energies, a region of coexistence between the two phases is obtained, in line with former thermodynamic assessments as well as with experimental observations.

  2. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    PubMed

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  3. Effect of flanking bases on quadruplex stability and Watson-Crick duplex competition.

    PubMed

    Arora, Amit; Nair, Divya R; Maiti, Souvik

    2009-07-01

    Guanine-rich DNA sequences have the ability to fold into four-stranded structures called G-quadruplexes, and are considered as promising anticancer targets. Although the G-quadruplex structure is composed of quartets and interspersed loops, in the genome it is also flanked on each side by numerous bases. The effect of loop length and composition on quadruplex conformation and stability has been well investigated in the past, but the effect of flanking bases on quadruplex stability and Watson-Crick duplex competition has not been addressed. We have studied in detail the effect of flanking bases on quadruplex stability and on duplex formation by the G-quadruplex in the presence of complementary strands using the quadruplex-forming sequence located in the promoter region of the c-kit oncogene. The results obtained from CD, thermal difference spectrum and UV melting demonstrated the effect of flanking bases on quadruplex structure and stability. With the increase in flank length, the increase in the more favorable DeltaH(vH) is accompanied by a striking increase in the unfavorable DeltaS(vH), which resulted in a decrease in the overall DeltaG(vH) of quadruplex formation. Furthermore, CD, fluorescence and isothermal titration calorimetry studies demonstrated that the propensity to attain quadruplex structure decreases with increasing flank length.

  4. Process for stabilizing dimensions of duplex stainless steels for service at elevated temperatures

    DOEpatents

    Hull, Frederick C.; Tobin, John C.

    1981-01-01

    Duplex stainless steel materials containing austenite plus delta ferrite, are dimensionally stabilized by heating the material to a reaction temperature between about 1050.degree.-1450.degree. F. (566.degree.-788.degree. C.), holding it at this temperature during transformation of delta ferrite to austenite plus sigma phase, and subsequently heating to a reversion temperature between about 1625.degree.-1750.degree. F. (885.degree.-954.degree. C.), whereby the sigma phase transforms back to ferrite, but the austenite remains dispersed in the ferrite phase. Final controlled cooling permits transformation of ferrite to austenite plus sigma and, later, precipitation of carbides.

  5. Interaction of octahedral ruthenium(II) polypyridyl complex [Ru(bpy)2(PIP)](2+) with poly(U)·poly(A)*poly(U) triplex: Increasing third-strand stabilization of the triplex without affecting the stability of the duplex.

    PubMed

    Zhu, Zhiyuan; Peng, Mengna; Zhang, Jingwen; Tan, Lifeng

    2017-04-01

    Triple-helical RNA are of interest because of possible biological roles as well as the potential therapeutic uses of these structures, while the stability of triplexes is usually weaker than that of the Watson-Crick base pairing duplex strand due to the electrostatic repulsion between three polyanionic strands. Therefore, how to increase the stability of the specific sequences of triplexes are of importance. In this paper the binding of a Ru(II) complex, [Ru(bpy)2(PIP)](2+) (bpy=2.2'-bipyridine, PIP=2-phenyl-1H-imidazo[4,5-f]- [1,10]-phenanthroline), with poly(U)·poly(A)*poly(U) triplex has been investigated by spectrophotometry, spectrofluorometry, viscosimetry and circular dichroism. The results suggest that [Ru(bpy)2(PIP)](2+) as a metallointercalator can stabilize poly(U)·poly(A)*poly(U) triplex (where · denotes the Watson-Crick base pairing and * denotes the Hoogsteen base pairing),while it stabilizes third-strand with no obvious effect on the duplex of poly(U)·poly(A), reflecting the binding of this complex with the triplex is favored by the Hoogsteen paired poly(U) third strand to a great extent.

  6. Thermal stability and conformation of antiparallel duplexes formed by P-stereodefined phosphorothioate DNA/LNA chimeric oligomers with DNA and RNA matrices.

    PubMed

    Jastrzębska, Katarzyna; Maciaszek, Anna; Dolot, Rafał; Bujacz, Grzegorz; Guga, Piotr

    2015-10-21

    3'-O-(2-Thio-4,4-pentamethylene-1,3,2-oxathiaphospholane) derivatives of LNA-type nucleosides (LNA-OTPs, 2a-d; B' = Thy, Ade(Bz), Cyt(Bz), Gua(dmf), respectively) were synthesized and separated into pure P-diastereomers. X-ray analysis allowed for assignment of the absolute configuration of the phosphorus atom in the detritylated, fast-eluting diastereomer 2a. The diastereomerically pure LNA-OTP monomers were used in solid phase synthesis of P-stereodefined chimeric PS-(DNA/LNA) 11-mers containing 2-3 LNA units. Formally, among the phosphorothioate oligomers the biggest enhancement in thermal stability of Watson-Crick paired duplexes was found for [SP-PS]-(DNA/LNA)/RNA duplexes (on average 8.2 °C per LNA nucleotide), followed by [RP-PS]-(DNA/LNA)/RNA (6.3 °C), [RP-PS]-(DNA/LNA)/DNA (3.8 °C) and [SP-PS]-(DNA/LNA)/DNA (2.4 °C per LNA nucleotide). However, detailed analysis of the thermal dissociation data showed that the thermal stability of (PS-LNA)-containing duplexes does not depend on the spatial orientation of the sulfur atoms. This conclusion received support from CD measurements.

  7. Dynamics and relative stabilities of parallel- and antiparallel-stranded DNA duplexes.

    PubMed Central

    Garcia, A E; Soumpasis, D M; Jovin, T M

    1994-01-01

    The dynamics and stability of four DNA duplexes are studied by means of molecular dynamics simulations. The four molecules studied are combinations of 4, 15 bases long, single-stranded oligomers, F1, F2, F3, and F4. The sequence of these single strand oligomers are chosen such that F1-F2 and F3-F4 form parallel (ps) DNA double helices, whereas F1-F4 and F2-F3 form antiparallel-stranded (aps) DNA double helices. Simulations were done at low (100 K) and room (300 K) temperatures. At low temperatures the dynamics are quasi-harmonic and the analysis of the trajectories gives good estimates of the low frequency vibrational modes and density of states. These are used to estimate the linear (harmonic) contribution of local fluctuations to the configurational entropy of the systems. Estimates of the differences in enthalpy between ps and aps duplexes show that aps double helices are more stable than the corresponding ps duplexes, in agreement with experiments. At higher temperatures, the distribution of the fluctuations around the average structures are multimodal and estimates of the configurational entropy cannot be obtained. The multi-basin, nonlinear character of the dynamics at 300 K is established using a novel method which extracts large amplitude nonlinear motions from the molecular dynamics trajectories. Our analysis shows that both ps DNA exhibit much larger fluctuations than the two aps DNA. The large fluctuations of ps DNA are explained in terms of correlated transitions in the beta, epsilon, and zeta backbone dihedral angles. Images FIGURE 1 FIGURE 2 PMID:8075315

  8. Solution structure of RNA duplexes containing alternating CG base pairs: NMR study of r(CGCGCG)2 and 2'-O-Me(CGCGCG)2 under low salt conditions.

    PubMed Central

    Popenda, M; Biala, E; Milecki, J; Adamiak, R W

    1997-01-01

    Structures of r(CGCGCG)2 and 2'-O-Me(CGCGCG)2 have been determined by NMR spectroscopy under low salt conditions. All protons and phosphorus nuclei resonances have been assigned. Signals of H5'/5" have been assigned stereospecifically. All 3JH,H and 3JP,H coupling constants have been measured. The structures were determined and refined using an iterative relaxation matrix procedure (IRMA) and the restrained MD simulation. Both duplexes form half-turn, right-handed helices with several conformational features which deviate significantly from a canonical A-RNA structure. Duplexes are characterised as having C3'-endo sugar pucker, very low base-pair rise and high helical twist and inclination angles. Helices are overwound with <10 bp per turn. There is limited inter-strand guanine stacking for CG steps. Within CG steps of both duplexes, the planes of the inter-strand cytosines are not parallel while guanines are almost parallel. For the GC steps this pattern is reversed. The 2'-O-methyl groups are spatially close to the 5'-hydrogens of neighbouring residues from the 3'-side and are directed towards the minor groove of 2'-O-Me(CGCGCG)2 forming a hydrophobic layer. Solution structures of both duplexes are similar; the effect of 2'-O-methylation on the parent RNA structure is small. This suggests that intrinsic properties imposed by alternating CG base pairs govern the overall conformation of both duplexes. PMID:9358170

  9. Hoogsteen-paired homopurine [RP-PS]-DNA and homopyrimidine RNA strands form a thermally stable parallel duplex.

    PubMed

    Guga, Piotr; Janicka, Magdalena; Maciaszek, Anna; Rebowska, Beata; Nowak, Genowefa

    2007-11-15

    Homopurine deoxyribonucleoside phosphorothioates possessing all internucleotide linkages of R(P) configuration form a duplex with an RNA or 2'-OMe-RNA strand with Hoogsteen complementarity. The duplexes formed with RNA templates are thermally stable at pH 5.3, while those formed with a 2'-OMe-RNA are stable at neutrality. Melting temperature and fluorescence quenching experiments indicate that the strands are parallel. Remarkably, these duplexes are thermally more stable than parallel Hoogsteen duplexes and antiparallel Watson-Crick duplexes formed by unmodified homopurine DNA molecules of the same sequence with corresponding RNA templates.

  10. The Contribution of the Activation Entropy to the Gas-Phase Stability of Modified Nucleic Acid Duplexes.

    PubMed

    Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J; Schürch, Stefan

    2016-07-01

    Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes. Graphical Abstract ᅟ.

  11. The Contribution of the Activation Entropy to the Gas-Phase Stability of Modified Nucleic Acid Duplexes

    NASA Astrophysics Data System (ADS)

    Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J.; Schürch, Stefan

    2016-07-01

    Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes.

  12. 2,6-Diaminopurine to TNA: Effect on Duplex Stabilities and on the Efficiency of Template-Controlled Ligations

    NASA Technical Reports Server (NTRS)

    Wu, Xiaolin; Delgado, Guillermo; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2003-01-01

    Replacement of adenine by 2,6-diaminopurine-two nucleobases to be considered equivalent from an etlological point of view-strongly enhances the stability of TNA/TNA, TNA/RNA, or TNA/DNA duplexes and efficiently accelerates template-directed ligation of TNA ligands.

  13. Structural destabilization of DNA duplexes containing single-base lesions investigated by nanopore measurements.

    PubMed

    Jin, Qian; Fleming, Aaron M; Ding, Yun; Burrows, Cynthia J; White, Henry S

    2013-11-12

    The influence of DNA duplex structural destabilization introduced by a single base-pair modification was investigated by nanopore measurements. A series of 11 modified base pairs were introduced into the context of an otherwise complementary DNA duplex formed by a 17-mer and a 65-mer such that the overhanging ends comprised poly(dT)23 tails, generating a representative set of duplexes that display a range of unzipping mechanistic behaviors and kinetic stabilities. The guanine oxidation products 8-oxo-7,8-dihydroguanine (OG), guanidinohydantoin (Gh), and spiroiminodihydantoin (Sp) were paired with either cytosine (C), adenine (A), or 2,6-diaminopurine (D) to form modified base pairs. The mechanism and kinetic rate constants of duplex dissociation were determined by threading either the 3' or 5' overhangs into an α-hemolysin (α-HL) channel under an electrical field and measuring the distributions of unzipping times at constant force. In order of decreasing thermodynamic stability (as measured by duplex melting points), the rate of duplex dissociation increases, and the mechanism evolves from a first-order reaction to two sequential first-order reactions. These measurements allow us to rank the kinetic stability of lesion-containing duplexes relative to the canonical G:C base pair in which the OG:C, Gh:C, and Sp:C base pairs are, respectively, 3-200 times less stable. The rate constants also depend on whether unzipping was initiated from the 3' versus 5' side of the duplex. The kinetic stability of these duplexes was interpreted in terms of the structural destabilization introduced by the single base-pair modification. Specifically, a large distortion of the duplex backbone introduced by the presence of the highly oxidized guanine products Sp and Gh leads to a rapid two-step unzipping. The number of hydrogen bonds in the modified base pair plays a lesser role in determining the kinetics of duplex dissociation.

  14. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices.

  15. Synthesis and base pairing studies of geranylated 2-thiothymidine, a natural variant of thymidine.

    PubMed

    Wang, Rui; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Shen, Fusheng; Chen, Alan; Sheng, Jia

    2015-11-25

    The synthesis and base pairing of DNA duplexes containing the geranylated 2-thiothymidine have been investigated. This naturally existing hydrophobic modification could grant better base pairing stability to the T-G pair over normal T-A and other mismatched pairs in the duplex context. This study provides a potential explanation for the different codon recognition preferences of the geranylated tRNAs.

  16. Stability and proton transfer in DNA base pairs of AMD473-DNA adduct

    NASA Astrophysics Data System (ADS)

    Sarmah, Pubalee; Deka, Ramesh C.

    2011-05-01

    We investigate the energetics of four different adducts of cisplatin analogue cis-[PtCl 2(NH 3)(2-picoline)] (AMD473) with a duplex DNA using DFT/ONIOM methods to probe their stabilities. Further, we study the possibilities of proton transfer between DNA base pairs of the most stable drug-DNA adduct. The adduct b(2-picoline trans to 3'-G and 2-methyl group directs to the DNA major groove) is found to be the most stable configuration among all the possible adducts. From the proton transfer analysis we found that the single proton transfer between N1 position of guanine (G) and N3 position of cytosine (C) of each GC pair gives a structure energetically as stable as the original one.

  17. Stability and size of particle pairs in complex plasmas

    SciTech Connect

    Nosenko, V.; Ivlev, A. V.; Kompaneets, R.; Morfill, G.

    2014-11-15

    Particle pairing in a complex plasma was experimentally studied with the emphasis on pair spatial extent and stability. Micron-size particles were suspended in the (pre)sheath area above the lower electrode in a capacitively coupled radio-frequency discharge in argon. They formed vertical pairs due to the ion wakes created by the flow of ions past particles. We discuss the confinement mechanism for the lower particle, resulting from a combination of the wake field and the field of non-uniform sheath. A model of particle pairs is proposed, which provides good description for the dependence of pair size and stability on experimental parameters.

  18. Synthesis and studies on the effect of 2-thiouridine and 4-thiouridine on sugar conformation and RNA duplex stability.

    PubMed Central

    Kumar, R K; Davis, D R

    1997-01-01

    In order to understand the effect of 2-thiouridine (s2U) substitution on RNA structure and the potential for stabilization of tRNA codon-anticodon interactions through s2U-34 modification, a pentamer RNA sequence, Gs2UUUC, was synthesized and characterized by NMR spectroscopy. The single strand contains the UUU anticodon sequence of tRNALys with flanking GCs to increase duplex stability. Regiochemical effects of uridine thiolation were determined by comparing the structure and stability of the 2-thiouridine containing oligonucleotide with an identical sequence containing 4-thiouridine (s4U) and also the normal uridine nucleoside. Circular dichroism spectrum indicated an A-form helical conformation for Gs2UUUC which was further confirmed by 2D ROESY NMR experiments. The duplex stability of the three pentamers complexed with a 2'-O-methyl-ribonucleotide complementary strand, GmAmAmAmCm, was determined by UV thermal melting studies and by 1H NMR spectroscopy. The duplex containing s2U has a T m of 30.7 degrees C compared to 19. 0 degrees C for the unmodified control and 14.5 degrees C for the s4U containing duplex. The results from UV experiments were corroborated by imino proton NMR studies that show proton exchange rates, chemical shift differences, and NH proton linewidths indicative of the stability order s2U >U >s4U. The magnitude of the effect of s2U in our model system is comparable to the 20 degrees C stabilization observed by Grosjean and co-workers for 2-thiolation in a codon-anticodon model system composed of two tRNAs with complementary anticodon sequences [Houssier, C., Degee, P., Nicoghosian, K. and Grosjean, H. (1988) J. Biomol. Struct. Dyn., 5, 1259-1266]. PMID:9092639

  19. Stabilizing contributions of sulfur-modified nucleotides: crystal structure of a DNA duplex with 2'-O-[2-(methoxy)ethyl]-2-thiothymidines

    SciTech Connect

    Diop-Frimpong, Benjamin; Prakash, Thazha P.; Rajeev, Kallanthottathil G.; Manoharan, Muthiah; Egli, Martin

    2010-03-05

    Substitution of oxygen atoms by sulfur at various locations in the nucleic acid framework has led to analogs such as the DNA phosphorothioates and 4'-thio RNA. The phosphorothioates are excellent mimics of DNA, exhibit increased resistance to nuclease degradation compared with the natural counterpart, and have been widely used as first-generation antisense nucleic acid analogs for applications in vitro and in vivo. The 4'-thio RNA analog exhibits significantly enhanced RNA affinity compared with RNA, and shows potential for incorporation into siRNAs. 2-Thiouridine (s{sup 2}U) and 5-methyl-2-thiouridine (m{sup 5}s{sup 2}U) are natural nucleotide analogs. s{sup 2}U in tRNA confers greater specificity of codon-anticodon interactions by discriminating more strongly between A and G compared with U. 2-Thio modification preorganizes the ribose and 2'-deoxyribose sugars for a C3'-endo conformation, and stabilizes heteroduplexes composed of modified DNA and complementary RNA. Combination of the 2-thio and sugar 2'-O-modifications has been demonstrated to boost both thermodynamic stability and nuclease resistance. Using the 2'-O-[2-(methoxy)ethyl]-2-thiothymidine (m{sup 5}s{sup 2}Umoe) analog, we have investigated the consequences of the replacement of the 2-oxygen by sulfur for base-pair geometry and duplex conformation. The crystal structure of the A-form DNA duplex with sequence GCGTAT*ACGC (T* = m{sup 5}s{sup 2}Umoe) was determined at high resolution and compared with the structure of the corresponding duplex with T* = m{sup 5}Umoe. Notable changes as a result of the incorporation of sulfur concern the base-pair parameter 'opening', an improvement of stacking in the vicinity of modified nucleotides as measured by base overlap, and a van der Waals interaction between sulfur atoms from adjacent m{sup 5}s{sup 2}Umoe residues in the minor groove. The structural data indicate only minor adjustments in the water structure as a result of the presence of sulfur. The observed

  20. Robust silver-mediated imidazolo-dC base pairs in metal DNA: dinuclear silver bridges with exceptional stability in double helices with parallel and antiparallel strand orientation.

    PubMed

    Jana, Sunit Kumar; Guo, Xiurong; Mei, Hui; Seela, Frank

    2015-12-18

    A new unprecedented metal-mediated base pair was designed that stabilizes reverse Watson-Crick DNA (parallel strand orientation, ps) as well as canonical Watson-Crick DNA (antiparallel strand orientation, aps). This base pair contains two imidazolo-dC units decorated with furan residues. Tm measurements and spectroscopic studies reveal that each silver-mediated furano-imidazolo-dC forms exceptionally stable duplexes with ps and aps chain orientation. This stability increase by a silver-mediated base pair is the highest reported so far for ps and aps DNA helices.

  1. Oligonucleotides with "clickable" sugar residues: synthesis, duplex stability, and terminal versus central interstrand cross-linking of 2'-O-propargylated 2-aminoadenosine with a bifunctional azide.

    PubMed

    Pujari, Suresh S; Leonard, Peter; Seela, Frank

    2014-05-16

    Duplex DNA with terminal and internal sugar cross-links were synthesized by the CuAAC reaction from oligonucleotides containing 2'-O-propargyl-2-aminoadenosine as a clickable site and a bifunctional azide (4). Stepwise click chemistry was employed to introduce cross-links at internal and terminal positions. Copper turnings were used as catalyst, reducing the copper load of the reaction mixture and avoiding complexing agents. For oligonucleotide building block synthesis, a protecting group strategy was developed for 2'-O-propargyl-2-aminoadenosine owing to the rather different reactivities of the two amino groups. Phosphoramidites were synthesized bearing clickable 2'-O-propargyl residues (14 and 18) as well as a 2'-deoxyribofuranosyl residue (10). Hybridization experiments of non-cross-linked oligonucleotides with 2,6-diaminopurine as nucleobase showed no significant thermal stability changes over those containing adenine. Surprisingly, an isobutyryl group protecting the 2-amino function has no negative impact on the stability of DNA-DNA and DNA-RNA duplexes. Oligonucleotide duplexes with cross-linked 2'-O-propargylated 2-aminoadenosine (1) and 2'-O-propargylated adenosine (3) at terminal positions are significantly stabilized (ΔT(m) = +29 °C). The stability results from a molecularity change from duplex to hairpin melting and is influenced by the ligation position. Terminal ligation led to higher melting duplexes than corresponding hairpins, while duplexes with central ligation sites were less stable.

  2. Effects of salt, polyethylene glycol, and locked nucleic acids on the thermodynamic stabilities of consecutive terminal adenosine mismatches in RNA duplexes.

    PubMed

    Gu, Xiaobo; Nguyen, Mai-Thao; Overacre, Abigail; Seaton, Samantha; Schroeder, Susan J

    2013-04-04

    Consecutive terminal mismatches add thermodynamic stability to RNA duplexes and occur frequently in microRNA-mRNA interactions. Accurate thermodynamic stabilities of consecutive terminal mismatches contribute to the development of specific, high-affinity siRNA therapeutics. Consecutive terminal adenosine mismatches (TAMS) are studied at different salt concentrations, with polyethylene glycol cosolutes, and with locked nucleic acid (LNA) substitutions. These measurements provide benchmarks for the application of thermodynamic predictions to different physiological or therapeutic conditions. The salt dependence for RNA duplex stability is similar for TAMS, internal loops, and Watson-Crick duplexes. A unified model for predicting the free energy of an RNA duplex with or without loops and mismatches at lower sodium concentrations is presented. The destabilizing effects of PEG 200 are larger for TAMS than internal loops or Watson-Crick duplexes, which may result from different base stacking conformations, dynamics, and water hydration. In contrast, LNA substitutions stabilize internal loops much more than TAMS. Surprisingly, the average per adenosine increase in stability for LNA substitutions in internal loops is -1.82 kcal/mol and only -0.20 kcal/mol for TAMS. The stabilities of TAMS and internal loops with LNA substitutions have similar favorable free energies. Thus, the unfavorable free energy of adenosine internal loops is largely an entropic effect. The favorable stabilities of TAMS result mainly from base stacking. The ability of RNA duplexes to form extended terminal mismatches in the absence of proteins such as argonaute and identifying the enthalpic contributions to terminal mismatch stabilities provide insight into the physical basis of microRNA-mRNA molecular recognition and specificity.

  3. Differential stability of 2'F-ANA*RNA and ANA*RNA hybrid duplexes: roles of structure, pseudohydrogen bonding, hydration, ion uptake and flexibility.

    PubMed

    Watts, Jonathan K; Martín-Pintado, Nerea; Gómez-Pinto, Irene; Schwartzentruber, Jeremy; Portella, Guillem; Orozco, Modesto; González, Carlos; Damha, Masad J

    2010-04-01

    Hybrids of RNA with arabinonucleic acids 2'F-ANA and ANA have very similar structures but strikingly different thermal stabilities. We now present a thorough study combining NMR and other biophysical methods together with state-of-the-art theoretical calculations on a fully modified 10-mer hybrid duplex. Comparison between the solution structure of 2'F-ANA*RNA and ANA*RNA hybrids indicates that the increased binding affinity of 2'F-ANA is related to several subtle differences, most importantly a favorable pseudohydrogen bond (2'F-purine H8) which contrasts with unfavorable 2'-OH-nucleobase steric interactions in the case of ANA. While both 2'F-ANA and ANA strands maintained conformations in the southern/eastern sugar pucker range, the 2'F-ANA strand's structure was more compatible with the A-like structure of a hybrid duplex. No dramatic differences are found in terms of relative hydration for the two hybrids, but the ANA*RNA duplex showed lower uptake of counterions than its 2'F-ANA*RNA counterpart. Finally, while the two hybrid duplexes are of similar rigidities, 2'F-ANA single strands may be more suitably preorganized for duplex formation. Thus the dramatically increased stability of 2'F-ANA*RNA and ANA*RNA duplexes is caused by differences in at least four areas, of which structure and pseudohydrogen bonding are the most important.

  4. Structure, stability and function of 5-chlorouracil modified A:U and G:U base pairs

    SciTech Connect

    Patra, Amritraj; Harp, Joel; Pallan, Pradeep S.; Zhao, Linlin; Abramov, Mikhail; Herdewijn, Piet; Egli, Martin

    2012-12-28

    The thymine analog 5-chlorouridine, first reported in the 1950s as anti-tumor agent, is known as an effective mutagen, clastogen and toxicant as well as an effective inducer of sister-chromatid exchange. Recently, the first microorganism with a chemically different genome was reported; the selected Escherichia coli strain relies on the four building blocks 5-chloro-2'-deoxyuridine (ClU), A, C and G instead of the standard T, A, C, G alphabet [Marlière,P., Patrouix,J., Döring,V., Herdewijn,P., Tricot,S., Cruveiller,S., Bouzon,M. and Mutzel,R. (2011) Chemical evolution of a bacterium’s genome. Angew. Chem. Int. Ed., 50, 7109–7114]. The residual fraction of T in the DNA of adapted bacteria was <2% and the switch from T to ClU was accompanied by a massive number of mutations, including >1500 A to G or G to A transitions in a culture. The former is most likely due to wobble base pairing between ClU and G, which may be more common for ClU than T. To identify potential changes in the geometries of base pairs and duplexes as a result of replacement of T by ClU, we determined four crystal structures of a B-form DNA dodecamer duplex containing ClU:A or ClU:G base pairs. The structures reveal nearly identical geometries of these pairs compared with T:A or T:G, respectively, and no consequences for stability and cleavage by an endonuclease (EcoRI). The lack of significant changes in the geometry of ClU:A and ClU:G base pairs relative to the corresponding native pairs is consistent with the sustained unlimited self-reproduction of E. coli strains with virtually complete T→ClU genome substitution.

  5. The structure of the human tRNALys3 anticodon bound to the HIV genome is stabilized by modified nucleosides and adjacent mismatch base pairs.

    PubMed

    Bilbille, Yann; Vendeix, Franck A P; Guenther, Richard; Malkiewicz, Andrzej; Ariza, Xavier; Vilarrasa, Jaume; Agris, Paul F

    2009-06-01

    Replication of human immunodeficiency virus (HIV) requires base pairing of the reverse transcriptase primer, human tRNA(Lys3), to the viral RNA. Although the major complementary base pairing occurs between the HIV primer binding sequence (PBS) and the tRNA's 3'-terminus, an important discriminatory, secondary contact occurs between the viral A-rich Loop I, 5'-adjacent to the PBS, and the modified, U-rich anticodon domain of tRNA(Lys3). The importance of individual and combined anticodon modifications to the tRNA/HIV-1 Loop I RNA's interaction was determined. The thermal stabilities of variously modified tRNA anticodon region sequences bound to the Loop I of viral sub(sero)types G and B were analyzed and the structure of one duplex containing two modified nucleosides was determined using NMR spectroscopy and restrained molecular dynamics. The modifications 2-thiouridine, s(2)U(34), and pseudouridine, Psi(39), appreciably stabilized the interaction of the anticodon region with the viral subtype G and B RNAs. The structure of the duplex results in two coaxially stacked A-form RNA stems separated by two mismatched base pairs, U(162)*Psi(39) and G(163)*A(38), that maintained a reasonable A-form helix diameter. The tRNA's s(2)U(34) stabilized the interaction between the A-rich HIV Loop I sequence and the U-rich anticodon, whereas the tRNA's Psi(39) stabilized the adjacent mismatched pairs.

  6. Contribution of the intrinsic mechanical energy of the phosphodiester linkage to the relative stability of the A, BI and BII forms of duplex DNA

    PubMed Central

    MacKerell, Alexander D.

    2009-01-01

    Canonical forms of duplex DNA are known to sample well defined regions of the α, β, γ, ε and ζ dihedral angles that define the conformation of the phosphodiester linkage in the backbone of oligonucleotides. While extensive studies of base composition and base sequence dependent effects on the sampling of the A, BI and BII canonical forms of duplex DNA have been presented, our understanding of the intrinsic contribution of the five dihedral degrees of freedom associated with the phosphodiester linkage to the conformational properties of duplex DNA is still limited. To better understand this contribution ab initio quantum mechanical (QM) calculations were performed on a model compound representative of the phosphodiester backbone to systematically sample the energetics about the α β γ ε and ζ dihedral angles relevant to the conformational properties of duplex DNA. Low energy regions of dihedral potential energy surfaces are shown to correlate with the regions of dihedral space sampled in experimental crystal structures of the canonical forms of DNA, validating the utility of the model compound and emphasizing the contribution of the intrinsic mechanical properties of the phosphodiester backbone to the conformational properties of duplex DNA. Those contributions include the relative stability of the A, BI and BII conformations of duplex DNA, where the gas phase energetics favor the BI form over the A and BII forms. In addition, subtle features of the potential energy surfaces mimic changes in the probability distributions of α, β, γ, ε and ζ dihedral angles in A, BI and BII forms of DNA as well as with conformations sampled in single-stranded DNA. These results show that the intrinsic mechanical properties of the phosphodiester backbone make a significant contribution to conformational properties of duplex DNA observed in the condensed phase and allow for the prediction that single stranded DNA primarly samples folded conformations thereby possibly

  7. Contribution of the intrinsic mechanical energy of the phosphodiester linkage to the relative stability of the A, BI, and BII forms of duplex DNA.

    PubMed

    MacKerell, Alexander D

    2009-03-12

    Canonical forms of duplex DNA are known to sample well-defined regions of the alpha, beta, gamma, epsilon, and zeta dihedral angles that define the conformation of the phosphodiester linkage in the backbone of oligonucleotides. While extensive studies of base composition and base sequence dependent effects on the sampling of the A, B1, and BII canonical forms of duplex DNA have been presented, our understanding of the intrinsic contribution of the five dihedral degrees of freedom associated with the phosphodiester linkage to the conformational properties of duplex DNA is still limited. To better understand this contribution, ab initio quantum mechanical (QM) calculations were performed on a model compound representative of the phosphodiester backbone to systematically sample the energetics about the alpha, beta, gamma, epsilon, and zeta dihedral angles relevant to the conformational properties of duplex DNA. Low-energy regions of dihedral potential energy surfaces are shown to correlate with the regions of dihedral space sampled in experimental crystal structures of the canonical forms of DNA, validating the utility of the model compound and emphasizing the contribution of the intrinsic mechanical properties of the phosphodiester backbone to the conformational properties of duplex DNA. Those contributions include the relative stability of the A, BI, and BII conformations of duplex DNA, where the gas-phase energetics favor the BI form over the A and BII forms. In addition, subtle features of the potential energy surfaces mimic changes in the probability distributions of alpha, beta, gamma, epsilon, and zeta dihedral angles in A, BI, and BII forms of DNA as well as with conformations sampled in single-stranded DNA. These results show that the intrinsic mechanical properties of the phosphodiester backbone make a significant contribution to conformational properties of duplex DNA observed in the condensed phase and allow for the prediction that single-stranded DNA

  8. Pairing Geometry of the Hydrophobic Thymine Analogue 2,4-Difluorotoluene in Duplex DNA as Analyzed by X-ray Crystallography

    SciTech Connect

    Pallan, Pradeep S.; Egli, Martin

    2009-12-01

    Certain DNA polymerases (pols) were found to efficiently insert A opposite the hydrophobic T isostere 2,4-difluorotoluene (F) and vice versa, resulting in the widely held belief that some pols rely on shape rather than H-bonding for accurate replication. Using X-ray crystallography we have analyzed the geometry of F:A pairs in duplex DNA and observed a distance between fluorine and the exocyclic amino group of A that is consistent with a H-bond, thus challenging the assumption that the F analogue is unable to engage in H-bonding as well as the steric hypothesis of DNA replication. Therefore, shape and H-bonding are inherently related, and steric constraints at a pol active site, or conferred by stacking or the DNA backbone conformation, may enable H-bonding by F.

  9. Electrochemiluminescent monomers for solid support syntheses of Ru(II)-PNA bioconjugates: multimodal biosensing tools with enhanced duplex stability.

    PubMed

    Joshi, Tanmaya; Barbante, Gregory J; Francis, Paul S; Hogan, Conor F; Bond, Alan M; Gasser, Gilles; Spiccia, Leone

    2012-03-05

    The feasibility of devising a solid support mediated approach to multimodal Ru(II)-peptide nucleic acid (PNA) oligomers is explored. Three Ru(II)-PNA-like monomers, [Ru(bpy)(2)(Cpp-L-PNA-OH)](2+) (M1), [Ru(phen)(2)(Cpp-L-PNA-OH)](2+) (M2), and [Ru(dppz)(2)(Cpp-L-PNA-OH)](2+) (M3) (bpy = 2,2'-bipyridine, phen = 1,10-phenanthroline, dppz = dipyrido[3,2-a:2',3'-c]phenazine, Cpp-L-PNA-OH = [2-(N-9-fluorenylmethoxycarbonyl)aminoethyl]-N-[6-(2-(pyridin-2yl)pyrimidine-4-carboxamido)hexanoyl]-glycine), have been synthesized as building blocks for Ru(II)-PNA oligomers and characterized by IR and (1)H NMR spectroscopy, mass spectrometry, electrochemistry and elemental analysis. As a proof of principle, M1 was incorporated on the solid phase within the PNA sequences H-g-c-a-a-t-a-a-a-a-Lys-NH(2) (PNA1) and H-P-K-K-K-R-K-V-g-c-a-a-t-a-a-a-a-lys-NH(2) (PNA4) to give PNA2 (H-g-c-a-a-t-a-a-a-a-M1-lys-NH(2)) and PNA3 (H-P-K-K-K-R-K-V-g-c-a-a-t-a-a-a-a-M1-lys-NH(2)), respectively. The two Ru(II)-PNA oligomers, PNA2 and PNA3, displayed a metal to ligand charge transfer (MLCT) transition band centered around 445 nm and an emission maximum at about 680 nm following 450 nm excitation in aqueous solutions (10 mM PBS, pH 7.4). The absorption and emission response of the duplexes formed with the cDNA strand (DNA: 5'-T-T-T-T-T-T-T-A-T-T-G-C-T-T-T-3') showed no major variations, suggesting that the electronic properties of the Ru(II) complexes are largely unaffected by hybridization. The thermal stability of the PNA·DNA duplexes, as evaluated from UV melting experiments, is enhanced compared to the corresponding nonmetalated duplexes. The melting temperature (T(m)) was almost 8 °C higher for PNA2·DNA duplex, and 4 °C for PNA3·DNA duplex, with the stabilization attributed to the electrostatic interaction between the cationic residues (Ru(II) unit and positively charged lysine/arginine) and the polyanionic DNA backbone. In presence of tripropylamine (TPA) as co-reactant, PNA2, PNA3, PNA2

  10. Separation of preferential interaction and excluded volume effects on DNA duplex and hairpin stability

    PubMed Central

    Knowles, D. B.; LaCroix, Andrew S.; Deines, Nickolas F.; Shkel, Irina; Record, M. Thomas

    2011-01-01

    Small solutes affect protein and nucleic acid processes because of favorable or unfavorable chemical interactions of the solute with the biopolymer surface exposed or buried in the process. Large solutes also exclude volume and affect processes where biopolymer molecularity and/or shape changes. Here, we develop an analysis to separate and interpret or predict excluded volume and chemical effects of a flexible coil polymer on a process. We report a study of the concentration-dependent effects of the full series from monomeric to polymeric PEG on intramolecular hairpin and intermolecular duplex formation by 12-nucleotide DNA strands. We find that chemical effects of PEG on these processes increase in proportion to the product of the amount of DNA surface exposed on melting and the amount of PEG surface that is accessible to this DNA, and these effects are completely described by two interaction terms that quantify the interactions between this DNA surface and PEG end and interior groups. We find that excluded volume effects, once separated from these chemical effects, are quantitatively described by the analytical theory of Hermans, which predicts the excluded volume between a flexible polymer and a rigid molecule. From this analysis, we show that at constant concentration of PEG monomer, increasing PEG size increases the excluded volume effect but decreases the chemical interaction effect, because in a large PEG coil a smaller fraction of the monomers are accessible to the DNA. Volume exclusion by PEG has a much larger effect on intermolecular duplex formation than on intramolecular hairpin formation. PMID:21742980

  11. Duplex ultrasound

    MedlinePlus

    Vascular ultrasound; Peripheral vascular ultrasound ... A duplex ultrasound combines: Traditional ultrasound: This uses sound waves that bounce off blood vessels to create pictures. Doppler ultrasound: This ...

  12. Base-pairing behavior of a carbocyclic Janus-AT nucleoside analogue capable of recognizing A and T within a DNA duplex.

    PubMed

    Largy, Eric; Liu, Wenbo; Hasan, Abid; Perrin, David M

    2013-11-04

    Janus-type nucleosides are heterocycles with two faces, each of which is designed to complement the H-bonding interactions of natural nucleosides comprising a canonical Watson-Crick base pair. By intercepting all of the hydrogen bonds contained within the base pair, oligomeric Janus nucleosides are expected to achieve sequence-specific DNA recognition through the formation of J-loops that will be more stable than D-loops, which simply replaces one base-pair with another. Herein, we report the synthesis of a novel Janus-AT nucleoside analogue, JAT , affixed on a carbocyclic analogue of deoxyribose that was converted to the corresponding phosphoramidite. A single JAT was successfully incorporated into a DNA strand by solid phase for targeting both A and T bases, and characterized through biophysical and computational methods. Experimental UV-melting and circular dichroism data demonstrated that within the context of a standard duplex, JAT associates preferentially with T over A, and much more poorly with C and G. Density functional theory calculations confirm that the JAT structure is well suited to associate only with A and T thereby highlighting the importance of the electronic structure in terms of H-bonding. Finally, molecular dynamics simulations validated the observation that JAT can substitute more effectively as an A-analogue than as a T-analogue without substantial distortion of the B-helix. Overall, this new Janus nucleotide is a promising tool for the targeting of A-T base pairs in DNA, and will lead to the development of oligo-Janus-nucleotide strands for sequence-specific DNA recognition.

  13. LNA units present in the (2'-OMe)-RNA strand stabilize parallel duplexes (2'-OMe)-RNA/[All-R(P)-PS]-DNA and parallel triplexes (2'-OMe)-RNA/[All-R(P)-PS]-DNA/RNA. An improved tool for the inhibition of reverse transcription.

    PubMed

    Maciaszek, Anna; Krakowiak, Agnieszka; Janicka, Magdalena; Tomaszewska-Antczak, Agnieszka; Sobczak, Milena; Mikołajczyk, Barbara; Guga, Piotr

    2015-02-28

    Homopurine phosphorothioate analogs of DNA, possessing all phosphorus atoms of RP configuration ([All-RP-PS]-DNA), when interact with appropriate complementary RNA or (2'-OMe)-RNA templates, form parallel triplexes or parallel duplexes of very high thermodynamic stability. The present results show that T-LNA or 5-Me-C-LNA units introduced into the parallel Hoogsteen-paired (2'-OMe)-RNA strands (up to four units in the oligomers of 9 or 12 nt in length) stabilize these parallel complexes. At neutral pH, dodecameric parallel duplexes have Tm values of 62-68 °C, which are by 4-10 °C higher than Tm for the reference duplex (with no LNA units present), while for the corresponding triplexes, Tm values exceeded 85 °C. For nonameric parallel duplexes, melting temperatures of 38-62 °C were found and (2'-OMe)-RNA oligomers containing 5-Me-C-LNA units stabilized the complexes more efficiently than the T-LNA containing congeners. In both series the stability of the parallel complexes increased with an increasing number of LNA units present. The same trend was observed in experiments of reverse transcription RNA→DNA (using AMV RT reverse transcriptase) where the formation of parallel triplexes (consisting of an RNA template, [All-RP-PS]-DNA nonamer and Hoogsteen-paired (2'-OMe)-RNA strands containing the LNA units) led to the efficient inhibition of the process. Under the best conditions checked (four 5-Me-C-LNA units, three-fold excess over the RNA template) the inhibition was 94% effective, compared to 71% inhibition observed in the reference system with the Hoogsteen-paired (2'-OMe)-RNA strand carrying no LNA units. This kind of complexation may "arrest" harmful RNA oligomers (e.g., viral RNA or mRNA of unwanted proteins) and, beneficially, exclude them from enzymatic processes, otherwise leading to viral or genetic diseases.

  14. 2-Amino-alpha-2'-deoxyadenosine increased duplex stability of methoxyethylphosphoramidate alpha-oligodeoxynucleotides with RNA target.

    PubMed

    Naval, Magali; Michel, Thibaut; Vasseur, Jean-Jacques; Debart, Françoise

    2002-06-03

    A new efficient synthesis of 2-amino-alpha-2'-deoxyadenosine and its incorporation into methoxyethylphosphoramidate alpha-oligodeoxynucleotides (ODNs) via H-phosphonate chemistry were reported. Thermal denaturation experiments demonstrated a significant stabilization of the complexes formed between these analogues and their RNA target (+2 degrees C/NH2A) relative to adenosine-containing phosphoramidate alpha-oligonucleotides. Concerning the binding specificity of these modified ODNs, unlike natural ODNs, discrimination against G pairing is higher and against C pairing is lower.

  15. Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

    PubMed

    Patel, D J; Canuel, L L

    1977-07-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

  16. Synthesis and characterization of DNA duplexes containing an N3T-ethyl-N3T interstrand crosslink in opposite orientations.

    PubMed

    Wilds, Christopher J; Noronha, Anne M; Robidoux, Sebastien; Miller, Paul S

    2005-01-01

    DNA duplexes containing an ethyl interstrand crosslink that bridges the N3 atoms of thymidines on the opposite strands have been synthesized using an approach that combines conventional solid phase oligonucleotide synthesis and the selective removal of protecting groups of a crosslinked thymidine dimer. This approach allows for the assembly of a crosslinked duplex directly on the solid support. Duplexes that contain a N3T-ethyl-N3T interstrand crosslink in a staggered orientation at either a -TA- or -AT-step in a duplex have been prepared. When placed in an -AT- step of a duplex the effect was stabilizing relative to the non-crosslinked control duplex (deltaTm= +24 degrees C) and this crosslinked duplex was found to efficiently form multimers in the presence of T4 ligase. In the case of the -TA- crosslinked duplex the stabilizing effect was less pronounced (deltaT.= +6 degrees C) and likewise did not undergo self ligation under identical conditions. Molecular modeling studies suggested that the -AT- containing lesion had little deviation in structure relative to the non-crosslinked duplex DNA control, whereas the -TA- crosslinked duplex exhibited significant buckling of the base pairs flanking the lesion.

  17. Enhancement of gene silencing potency and nuclease stability by chemically modified duplex RNA.

    PubMed

    Kubo, Takanori; Zhelev, Zhivko; Bakalova, Rumiana; Ohba, Hideki

    2007-01-01

    In this study, we describe a development of chemically modified dsRNAs with improved biological properties. These dsRNAs possess an enhanced RNAi activity and a dramatically increased stability in cell cultured medium (containing 10% serum) in comparison with widely used 21nt siRNA. The chemically modified dsRNAs manifested a high longterm gene suppression after one week post-transfection, whereas 21nt siRNA showed a high RNAi activity only after 48 h cell transfection.

  18. Pyrimidine-pyrimidine base pairs stabilized by silver(I) ions.

    PubMed

    Urata, Hidehito; Yamaguchi, Eriko; Nakamura, Yasunari; Wada, Shun-ichi

    2011-01-21

    In the presence of Ag(I) ions, the C-T and m(5)iC (5-methylisocytosine)-T base pairs showed comparable stability to the C-Ag(I)-C base pair, and the m(5)iC-C base pair was highly stabilized by the synergetic effect of Ag(I) coordination and possible hydrogen bonding.

  19. Positional and Neighboring Base Pair Effects on the Thermodynamic Stability of RNA Single Mismatches†

    PubMed Central

    Davis, Amber R.; Znosko, Brent M.

    2010-01-01

    Many naturally occurring RNA structures contain single mismatches, many of which occur near the ends of helices. However, previous thermodynamic studies have focused their efforts on thermodynamically characterizing centrally placed single mismatches. Additionally, algorithms currently used to predict secondary structure from sequence are based on two assumptions to predict stability of RNA duplexes containing this motif. It has been assumed that the thermodynamic contribution of small RNA motifs is independent of both its position in the duplex and identity of the non-nearest neighbors. Thermodynamically characterizing single mismatches three nucleotides from both the 3′ and 5′ ends (i.e., off-center) of an RNA duplex and comparing these results to those of the same single mismatch-nearest neighbor combination centrally located has allowed for the investigation of these effects. The thermodynamic contribution of 13 single mismatch-nearest neighbor combinations are reported but only 9 combinations are studied at all three duplex positions and are used to determine trends and patterns. In general, the 5′ and 3′ shifted single mismatches are relatively similar, on average, and more favorable in free energy than centrally placed single mismatches. However, close examination and comparison shows there are several associated idiosyncrasies with these identified general trends. These peculiarities may be due, in part, to the identities of the single mismatch, the nearest neighbors, and the non-nearest neighbors, along with the effects of single mismatch position in the duplex. The prediction algorithm recently proposed by Davis and Znosko (Biochemistry 47, 10178–10187) is used to predict the thermodynamic parameters of single mismatch contribution and is compared to the measured values presented here. This comparison suggests the proposed model is a good approximation but could be improved by the addition of parameters which account for positional and/or non

  20. Using DNA duplex stability information for transcription factor binding site discovery.

    PubMed

    Gordân, Raluca; Hartemink, Alexander J

    2008-01-01

    Transcription factor (TF) binding site discovery is an important step in understanding transcriptional regulation. Many computational tools have already been developed, but their success in detecting TF motifs is still limited. We believe one of the main reasons for the low accuracy of current methods is that they do not take into account the structural aspects of TF-DNA interaction. We have previously shown that knowledge about the structural class of the TF and information about nucleosome occupancy can be used to improve motif discovery. Here, we demonstrate the benefits of using information about the DNA double-helical stability for motif discovery. We notice that, in general, the energy needed to destabilize the DNA double helix is higher at TF binding sites than at random DNA sites. We use this information to derive informative positional priors that we incorporate into a motif finding algorithm. When applied to yeast ChIP-chip data, the new informative priors improve the performance of the motif finder significantly when compared to priors that do not use the energetic stability information.

  1. Stability and functional effectiveness of phosphorothioate modified duplex DNA and synthetic 'mini-genes'.

    PubMed

    Ciafrè, S A; Rinaldi, M; Gasparini, P; Seripa, D; Bisceglia, L; Zelante, L; Farace, M G; Fazio, V M

    1995-10-25

    Several gene transfer techniques that employ 'naked DNA' molecules have recently been developed and numerous gene therapy protocols that make use of 'naked-DNA' have been proposed. We studied the possibility of enhancing the stability of 'naked DNA vectors' and thus also gene transfer and expression efficiencies, by constructing phosphorothioate (PS-) double strand DNA molecules and functional transcription units. We first synthesized short PS-double strand DNA molecules by the annealing of two complementary, 35 nt long, oligonucleotides. The accessibility of DNA modifying enzymes to this molecule was significantly decreased: T4-ligase and kinase activity were respectively reduced up to 1/2 and to 1/6, as compared to the normal phosphodiester molecule. Nucleolytic stability was increased either to purified enzymes (DNase I and Bal31) or to incubations in fresh serum, cell culture medium or in muscle protein extract. Phosphorothioate end-capped complete eukaryotic transcription units (obtained by Taq polymerase amplification with PS-primers) were not significantly protected from nucleolytic attack. On the contrary, synthetic transcription units, 'mini genes', obtained by Taq amplification with 1, 2 or 3 PS-dNTP substitutions, were resistant to DNase I and Bal31 nucleolytic activity. Transcription efficiency, driven by the T7 promoter, was 96.5, 95 and 33.5% (respectively with 1, 2 or 3 substitutions), as compared to the normal phosphodiester molecules.

  2. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    PubMed

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  3. Spermine Condenses DNA, but Not RNA Duplexes

    SciTech Connect

    Katz, Andrea M.; Tolokh, Igor S.; Pabit, Suzette A.; Baker, Nathan; Onufriev, Alexey V.; Pollack, Lois

    2017-01-01

    Interactions between the polyamine spermine and nucleic acids drive important cellular processes. Spermine condenses DNA, and some RNAs such as poly(rA):poly(rU). A large fraction of the spermine present in cells is bound to RNA, but apparently does not condense it. Here, we study the effect of spermine binding to short duplex RNA and DNA and compare our findings with predictions of molecular dynamics simulations. When small numbers of spermine are introduced, RNA with a designed sequence, containing a mixture of 14 GC pairs and 11 AU pairs, resists condensation relative to DNA of an equivalent sequence or to 25 base pair poly(rA):poly(rU) RNA. Comparison of wide-angle x-ray scattering profiles with simulation suggests that spermine is sequestered deep within the major groove of mixed sequence RNA, preventing condensation by limiting opportunities to bridge to other molecules as well as stabilizing the RNA by locking it into a particular conformation. In contrast, for DNA, simulations suggest that spermine binds external to the duplex, offering opportunities for intermolecular interaction. The goal of this study is to explain how RNA can remain soluble, and available for interaction with other molecules in the cell, despite the presence of spermine at concentrations high enough to precipitate DNA.

  4. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair.

  5. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    SciTech Connect

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  6. Calculation of the stabilization energies of oxidatively damaged guanine base pairs with guanine.

    PubMed

    Suzuki, Masayo; Kino, Katsuhito; Morikawa, Masayuki; Kobayashi, Takanobu; Komori, Rie; Miyazawa, Hiroshi

    2012-06-01

    DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H)-oxazolone (Oz), guanidinohydantoin (Gh)/iminoallantoin (Ia) and spiro-imino-dihydantoin (Sp) are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  7. Hydrophobic, Non-Hydrogen-Bonding Bases and Base Pairs in DNA

    PubMed Central

    Schweitzer, Barbara A.; Kool, Eric T.

    2009-01-01

    We report the properties of hydrophobic isosteres of pyrimidines and purines in synthetic DNA duplexes. Phenyl nucleosides 1 and 2 are nonpolar isosteres of the natural thymidine nucleoside, and indole nucleoside 3 is an analog of the complementary purine 2-aminodeoxyadenosine. The nucleosides were incorporated into synthetic oligodeoxynucleotides and were paired against each other and against the natural bases. Thermal denaturation experiments were used to measure the stabilities of the duplexes at neutral pH. It is found that the hydrophobic base analogs are nonselective in pairing with the four natural bases but selective for pairing with each other rather than with the natural bases. For example, compound 2 selectively pairs with itself rather than with A, T, G, or C; the magnitude of this selectivity is found to be 6.5–9.3 °C in Tm or 1.5–1.8 kcal/mol in free energy (25 °C). All possible hydrophobic pairing combinations of 1, 2, and 3 were examined. Results show that the pairing affinity depends on the nature of the pairs and on position in the duplex. The highest affinity pairs are found to be the 1–1 and 2–2 self-pairs and the 1–2 heteropair. The best stabilization occurs when the pairs are placed at the ends of duplexes rather than internally; the internal pairs may be destabilized by imperfect steric mimicry which leads to non-ideal duplex structure. In some cases the hydrophobic pairs are significantly stabilizing to the DNA duplex; for example, when situated at the end of a duplex, the 1–1 pair is more stabilizing than a T–A pair. When situated internally, the affinity of the 1–1 pair is the same as, or slightly better than, the analogous T–T mismatch pair, which is known to have two hydrogen bonds. The studies raise the possibility that hydrogen bonds may not always be required for the formation of stable duplex DNA-like structure. In addition, the results point out the importance of solvation and desolvation in natural base pairing

  8. Stability, Chaos and Entrapment of Stars in Very Wide Pairs

    DTIC Science & Technology

    2012-01-01

    M., 1970, A&A, 9, 24 Jiang Y.-F., Tremaine S., 2010, MNRAS, 401, 977 King I., Gilmore G., van der Kruit P. C., 1990, The Milky Way as a Galaxy...reflection is necessary, because only retrograde trajectories are stable. A stable trajectory obtained this way for a pair of initially unbound stars

  9. Multi-quasiparticle isomers near stability and reduced pairing

    SciTech Connect

    Dracoulis, G.D.

    1996-12-31

    The proximity of high-{Omega} orbitals near both proton and neutron Fermi surfaces in nuclei near Z = 74 and N = 104 results in high-K states competing with collective rotation of low-seniority configurations to generate the yrast line. In favorable situations it is possible to observe both the intrinsic states and associated rotational bands. The band properties allow characterization of the configurations and evaluation of orbital and seniority-dependent effects, including pairing reduction and consequent loss of nuclear superfluidity.

  10. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    PubMed

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

  11. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials.

  12. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  13. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  14. Double-coding nucleic acids: introduction of a nucleobase sequence in the major groove of the DNA duplex using double-headed nucleotides.

    PubMed

    Kumar, Pawan; Sorinas, Antoni Figueras; Nielsen, Lise J; Slot, Maria; Skytte, Kirstine; Nielsen, Annie S; Jensen, Michael D; Sharma, Pawan K; Vester, Birte; Petersen, Michael; Nielsen, Poul

    2014-09-05

    A series of double-headed nucleosides were synthesized using the Sonogashira cross-coupling reaction. In the reactions, additional nucleobases (thymine, cytosine, adenine, or guanine) were attached to the 5-position of 2'-deoxyuridine or 2'-deoxycytidine through a propyne linker. The modified nucleosides were incorporated into oligonucleotides, and these were combined in different duplexes that were analyzed by thermal denaturation studies. All of the monomers were well tolerated in the DNA duplexes and induced only small changes in the thermal stability. Consecutive incorporations of the monomers led to increases in duplex stability owing to increased stacking interactions. The modified nucleotide monomers maintained the Watson-Crick base pair fidelity. Stable duplexes were observed with heavily modified oligonucleotides featuring 14 consecutive incorporations of different double-headed nucleotide monomers. Thus, modified duplexes with an array of nucleobases on the exterior of the duplex were designed. Molecular dynamics simulations demonstrated that the additional nucleobases could expose their Watson-Crick and/or Hoogsteen faces for recognition in the major groove. This presentation of nucleobases may find applications in providing molecular information without unwinding the duplex.

  15. Structures and Energetics of Four Adjacent G·U Pairs That Stabilize an RNA Helix

    PubMed Central

    Gu, Xiaobo; Mooers, Blaine H.M.; Thomas, Leonard M.; Malone, Joshua; Harris, Steven; Schroeder, Susan J.

    2016-01-01

    Consecutive G·U base pairs inside RNA helices can be destabilizing while those at the ends of helices are thermodynamically stabilizing. To determine if this paradox could be explained by differences in base stacking, we determined the high-resolution (1.32 Å) crystal structure of (5’-GGUGGCUGUU-3')2 and studied three sequences with four consecutive terminal G·U pairs by NMR spectroscopy. In the crystal structure of (5’-GGUGGCUGUU-3')2, the helix is overwound but retains the overall features of A-form RNA. The penultimate base steps at each end of the helix have high base overlap and contribute to the unexpectedly favorable energetic contribution for the 5’-GU-3’/3’-UG-5’ motif in this helix position. The balance of base stacking and helical twist contributes to the positional dependence of G·U pair stabilities. The energetic stabilities and similarity to A-form RNA helices suggest that consecutive G·U pairs would be recognized by RNA helix binding proteins, such as Dicer and Ago. Thus, these results will aid future searches for target sites of small RNAs in gene regulation. PMID:26425937

  16. Watson-Crick-like pairs in CCUG repeats: evidence for tautomeric shifts or protonation.

    PubMed

    Rypniewski, Wojciech; Banaszak, Katarzyna; Kuliński, Tadeusz; Kiliszek, Agnieszka

    2016-01-01

    RNA transcripts that include expanded CCUG repeats are associated with myotonic dystrophy type 2. Crystal structures of two CCUG-containing oligomers show that the RNA strands associate into slipped duplexes that contain noncanonical C-U pairs that have apparently undergone tautomeric transition or protonation resulting in an unusual Watson-Crick-like pairing. The overhanging ends of the duplexes interact forming U-U pairs, which also show tautomerism. Duplexes consisting of CCUG repeats are thermodynamically less stable than the trinucleotide repeats involved in the TRED genetic disorders, but introducing LNA residues increases their stability and raises the melting temperature of the studied oligomers by ∼10°C, allowing detailed crystallographic studies. Quantum mechanical calculations were performed to test the possibility of the tautomeric transitions or protonation within the noncanonical pairs. The results indicate that tautomeric or ionic shifts of nucleobases can manifest themselves in biological systems, supplementing the canonical "rules of engagement."

  17. Watson–Crick-like pairs in CCUG repeats: evidence for tautomeric shifts or protonation

    PubMed Central

    Rypniewski, Wojciech; Banaszak, Katarzyna; Kuliński, Tadeusz; Kiliszek, Agnieszka

    2016-01-01

    RNA transcripts that include expanded CCUG repeats are associated with myotonic dystrophy type 2. Crystal structures of two CCUG-containing oligomers show that the RNA strands associate into slipped duplexes that contain noncanonical C–U pairs that have apparently undergone tautomeric transition or protonation resulting in an unusual Watson–Crick-like pairing. The overhanging ends of the duplexes interact forming U–U pairs, which also show tautomerism. Duplexes consisting of CCUG repeats are thermodynamically less stable than the trinucleotide repeats involved in the TRED genetic disorders, but introducing LNA residues increases their stability and raises the melting temperature of the studied oligomers by ∼10°C, allowing detailed crystallographic studies. Quantum mechanical calculations were performed to test the possibility of the tautomeric transitions or protonation within the noncanonical pairs. The results indicate that tautomeric or ionic shifts of nucleobases can manifest themselves in biological systems, supplementing the canonical “rules of engagement.” PMID:26543073

  18. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  19. RNA chaperones stimulate formation and yield of the U3 snoRNA-pre-rRNA duplexes needed for eukaryotic ribosome biogenesis

    PubMed Central

    Gérczei, Tímea; Shah, Binal N.; Manzo, Anthony J.; Walter, Nils G.; Correll, Carl C.

    2010-01-01

    To satisfy the high demand for ribosome synthesis in rapidly growing eukaryotic cells, short duplexes between the U3 small nucleolar RNA (snoRNA) and the precursor ribosomal RNA (pre-rRNA) must form quickly and with high yield. These interactions, designated the U3-ETS and U3-18S duplexes, are essential to initiate the processing of small subunit rRNA. Previously, we showed in vitro that duplexes corresponding to those in Saccharomyces cerevisiae are only observed after addition of one of two proteins: Imp3p or Imp4p. Here, we used fluorescence-based and other in vitro assays to determine whether these proteins possess RNA chaperone activities and to assess whether these activities are sufficient to satisfy the duplex yield and rate requirements expected in vivo. Assembly of both proteins with the U3 snoRNA into a chaperone complex destabilizes a U3-stem structure, apparently to expose its 18S base-pairing site. As a result, the chaperone complex accelerates formation of the U3-18S duplex from an undetectable rate to one comparable to the intrinsic rate observed for hybridizing short duplexes. The chaperone complex also stabilizes the U3-ETS duplex by 2.7 kcal/mol. These chaperone activities provide high U3-ETS duplex yield and rapid U3-18S duplex formation over a broad concentration range to help ensure that the U3-pre-rRNA interactions limit neither ribosome biogenesis nor rapid cell growth. The thermodynamic and kinetic framework used is general and thus suitable to investigate the mechanism of action of other RNA chaperones. PMID:19482034

  20. Full-duplex optical communication system

    NASA Technical Reports Server (NTRS)

    Shay, Thomas M. (Inventor); Hazzard, David A. (Inventor); Horan, Stephen (Inventor); Payne, Jason A. (Inventor)

    2004-01-01

    A method of full-duplex electromagnetic communication wherein a pair of data modulation formats are selected for the forward and return data links respectively such that the forward data electro-magnetic beam serves as a carrier for the return data. A method of encoding optical information is used wherein right-hand and left-hand circular polarizations are assigned to optical information to represent binary states. An application for an earth to low earth orbit optical communications system is presented which implements the full-duplex communication and circular polarization keying modulation format.

  1. An alternative strategy to synthesize PNA and DNA magnetic conjugates forming nanoparticle assembly based on PNA/DNA duplexes.

    PubMed

    Milano, Giovanna; Musumeci, Domenica; Gaglione, Maria; Messere, Anna

    2010-03-01

    In this paper we report an alternative approach to synthesize PNA and DNA magnetic nanoconjugates. Chemical modifications were introduced on the 130 nm dextran-magnetite particles to obtain poly-functionalized particles containing reversible bonds sensitive to the cellular environment and suitable for the direct introduction of unmodified oligomers. Due to the polyvalent nature of the nanoparticles, when the complementary PNA and DNA nanoconjugates were mixed together, the resulting duplex structures bring to a nanoparticle assembly driven by W-C base pairs. The formation of the nanoparticle assembly was investigated by optical spectroscopy (UV, FTIR), scanning and transmission electron microscopies and by the analysis of the macroscopic behaviour of the nanoparticle-conjugates in aqueous solution with and without magnetic field application. Furthermore, serum stability assays revealed an increased enzymatic resistance in FCS of the PNA/DNA nanoconjugate duplex with respect to the unconjugated duplex. The described nanosystem could be extended to other duplex structures, possibly involving aptameric sequences of biomedical relevance, and could be very useful in order to obtain high local concentration at the target site of both the duplex and the magnetic nanoparticles in biotechnological applications.

  2. Neomycin-neomycin dimer: an all-carbohydrate scaffold with high affinity for AT-rich DNA duplexes.

    PubMed

    Kumar, Sunil; Xue, Liang; Arya, Dev P

    2011-05-18

    A dimeric neomycin-neomycin conjugate 3 with a flexible linker, 2,2'-(ethylenedioxy)bis(ethylamine), has been synthesized and characterized. Dimer 3 can selectively bind to AT-rich DNA duplexes with high affinity. Biophysical studies have been performed between 3 and different nucleic acids with varying base composition and conformation by using ITC (isothermal calorimetry), CD (circular dichroism), FID (fluorescent intercalator displacement), and UV (ultraviolet) thermal denaturation experiments. A few conclusions can be drawn from this study: (1) FID assay with 3 and polynucleotides demonstrates the preference of 3 toward AT-rich sequences over GC-rich sequences. (2) FID assay and UV thermal denaturation experiments show that 3 has a higher affinity for the poly(dA)·poly(dT) DNA duplex than for the poly(dA)·2poly(dT) DNA triplex. Contrary to neomycin, 3 destabilizes poly(dA)·2poly(dT) triplex but stabilizes poly(dA)·poly(dT) duplex, suggesting the major groove as the binding site. (3) UV thermal denaturation studies and ITC experiments show that 3 stabilizes continuous AT-tract DNA better than DNA duplexes with alternating AT bases. (4) CD and FID titration studies show a DNA binding site size of 10-12 base pairs/drug, depending upon the structure/sequence of the duplex for AT-rich DNA duplexes. (5) FID and ITC titration between 3 and an intramolecular DNA duplex [d(5'-A(12)-x-T(12)-3'), x = hexaethylene glycol linker] results in a binding stoichiometry of 1:1 with a binding constant ∼10(8) M(-1) at 100 mM KCl. (6) FID assay using 3 and 512 hairpin DNA sequences that vary in their AT base content and placement also show a higher binding selectivity of 3 toward continuous AT-rich than toward DNA duplexes with alternate AT base pairs. (7) Salt-dependent studies indicate the formation of three ion pairs during binding of the DNA duplex d[5'-A(12)-x-T(12)-3'] and 3. (8) ITC-derived binding constants between 3 and DNA duplexes have the following order: AT

  3. Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

    PubMed

    Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

    2015-03-01

    Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert.

  4. Stability of a pair of co-rotating vortices with axial flow

    NASA Astrophysics Data System (ADS)

    Roy, Clément; Schaeffer, Nathanaël; Le Dizès, Stéphane; Thompson, Mark

    2008-09-01

    The three-dimensional linear temporal stability properties of a flow composed of two corotating q-vortices (also called Batchelor vortices) are predicted by numerical stability analysis. As for the corresponding counter-rotating case, when the axial flow parameter is increased, different instability modes are observed and identified as a combination of resonant Kelvin modes of azimuthal wavenumbers m and m +2 within each vortex. In particular, we show that the sinuous mode, which is the dominant instability mode without axial flow, is stabilized in the presence of a moderate axial flow. Different types of mode with a large amplitude in the critical layer are also identified. For small separation distances (above the merging threshold), unstable eigenmodes, corresponding to axial wavenumbers that cannot be easily identified with simple resonant interactions of Kelvin modes, are also observed. Their growth rate is a substantial fraction of the growth rates of low-order resonant modes. The effects of the Reynolds number and vortex separation distance on the growth rate parameter map are considered. Finally, we analyze the similarities and differences between the stability characteristics of co- and counter-rotating vortex pairs.

  5. Small molecule-mediated duplex formation of nucleic acids with 'incompatible' backbones.

    PubMed

    Cafferty, Brian J; Musetti, Caterina; Kim, Keunsoo; Horowitz, Eric D; Krishnamurthy, Ramanarayanan; Hud, Nicholas V

    2016-04-07

    Proflavine, a known intercalator of DNA and RNA, promotes duplex formation by nucleic acids with natural and non-natural backbones that otherwise form duplexes with low thermal stability, and even some that show no sign of duplex formation in the absence of proflavine. These findings demonstrate the potential for intercalators to be used as cofactors for the assembly of rationally designed nucleic acid structures, and could provide fundamental insights regarding intercalation of natural nucleic acid duplexes.

  6. Mesophase stabilization in ionic liquid crystals through pairing equally shaped mesogenic cations and anions

    SciTech Connect

    Stappert, Kathrin; Lipinski, Gregor; Kopiec, Gabriel; Spielberg, Eike T.; Mudring, Anja -Verena

    2015-07-23

    The synthesis and properties of a set of novel ionic liquid crystals with congruently shaped cations and anions are reported to check whether pairing mesogenic cations with mesogenic anions leads to a stabilization of a liquid crystalline phase. To that avail 1-alkyl-3-methyl-triazolium cations with an alkyl chain length of 10, 12, and 14 carbon atoms have been combined with p-alkyloxy-benzenesulfonate anions with different alkyl chain lengths (n = 10, 12, and 14). The corresponding triazolium iodides have been synthesized as reference compounds where the cation and anion have strong size and shape mismatch. The mesomorphic behavior of all compounds is studied by differential scanning calorimetry and polarizing optical microscopy. All compounds except 1-methyl-3-decyltriazolium iodide, which qualifies as an ionic liquid, are thermotropic ionic liquid crystals. All other compounds adopt smectic A phases. As a result, a comparison of the thermal phase behavior of the 1-methyl-3-decyltriazolium bromides to the corresponding p-alkoxy-benzensulfonates reveals that definitely the mesophase is stabilized by pairing the rod-shaped 1-alkyl-3-methyltriazolium cation with a rod-like anion of similar size.

  7. Mesophase stabilization in ionic liquid crystals through pairing equally shaped mesogenic cations and anions

    DOE PAGES

    Stappert, Kathrin; Lipinski, Gregor; Kopiec, Gabriel; ...

    2015-07-23

    The synthesis and properties of a set of novel ionic liquid crystals with congruently shaped cations and anions are reported to check whether pairing mesogenic cations with mesogenic anions leads to a stabilization of a liquid crystalline phase. To that avail 1-alkyl-3-methyl-triazolium cations with an alkyl chain length of 10, 12, and 14 carbon atoms have been combined with p-alkyloxy-benzenesulfonate anions with different alkyl chain lengths (n = 10, 12, and 14). The corresponding triazolium iodides have been synthesized as reference compounds where the cation and anion have strong size and shape mismatch. The mesomorphic behavior of all compounds ismore » studied by differential scanning calorimetry and polarizing optical microscopy. All compounds except 1-methyl-3-decyltriazolium iodide, which qualifies as an ionic liquid, are thermotropic ionic liquid crystals. All other compounds adopt smectic A phases. As a result, a comparison of the thermal phase behavior of the 1-methyl-3-decyltriazolium bromides to the corresponding p-alkoxy-benzensulfonates reveals that definitely the mesophase is stabilized by pairing the rod-shaped 1-alkyl-3-methyltriazolium cation with a rod-like anion of similar size.« less

  8. Fluorescent C-linked C8-aryl-guanine probe for distinguishing syn from anti structures in duplex DNA.

    PubMed

    Manderville, Richard A; Omumi, Alireza; Rankin née Schlitt, Katherine M; Wilson, Katie A; Millen, Andrea L; Wetmore, Stacey D

    2012-06-18

    The synthesis and optical properties of the carbon (C)-linked C(8)-(2"-benzo[b]thienyl)-2'-deoxyguanosine ((Bth)dG), which acts as a fluorescent reporter of syn versus anti glycosidic conformations in duplex DNA, are described. In the syn-conformation, the probe stabilizes a G:G mismatch, emits at ∼385 nm (excitation ∼285 nm), and shows an induced circular dichroism (ICD) signal at ∼320 nm. Molecular dynamics (MD) simulations predict a wedge (W)-conformation for the mismatched duplex with the C(8)-benzo[b]thienyl moiety residing in the minor groove. In contrast, the probe destabilizes the duplex when base paired with its normal pyrimidine partner C. With flanking purine bases, a major groove B-type duplex is favored with (Bth)dG present in the anti-conformation emitting at ∼413 nm (excitation ∼326 nm) and no ICD signal. However, with flanking pyrimidine bases, (Bth)dG adopts the syn-conformation when base paired with C, and MD simulations predict a base-displaced stacked (S)-conformation, with the opposing C flipped out of the helix. The different duplex (B-, S-, and W-) conformers formed upon incorporation of (Bth)dG are known to play a critical role in the biological activity of N-linked C8-dG adducts formed by arylamine carcinogens. Bulky environment-sensitive fluorescent C(8)-dG adducts that mimic the duplex structures formed by carcinogens may be useful in luminescence-based DNA polymerase assays.

  9. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  10. Wobble Pairs of the HDV Ribozyme Play Specific Roles in Stabilization of Active Site Dynamics

    PubMed Central

    Sripathi, Kamali N.; Banáš, Pavel; Reblova, Kamila; Šponer, Jiři; Otyepka, Michal

    2015-01-01

    The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5′) hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5′) general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5′) hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs. PMID:25631765

  11. Higher order structural effects stabilizing the reverse Watson-Crick Guanine-Cytosine base pair in functional RNAs.

    PubMed

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch.

  12. [Renal duplex: clinical usefulness].

    PubMed

    Miralles, M; Giménez, A; Cairols, M A; Riambau, V; Sáez, A

    1993-01-01

    It is the purpose of this report to focus attention on the clinical usefulness of Renal Duplex for the diagnosis of patients with vasculo-renal diseases in terms of: 1. Accuracy of Duplex/Angiography in the measurement of the renal stenosis degree. 2. Correlationship between Duplex ans Isotopic Renogram with respect to the study of the parenchyma's perfusion. 3. The effect of the inhibitors of the conversor enzyme (Captopril) on the Doppler signal of the parenchyma, comparing it with the results from the captopril test about the peripheral plasmatic renin activity and the isotopic renogram, in patients with vasculo-renal HTA. Results obtains by Duplex and Angiography were compared in 92 renal arteries from 46 patients. For both technics, three degrees of stenosis were established: 0-59%, 60-99% and occlusion. The Duplex technique identified 49/54 stenosis < 60%, 28/33 stenosis > 60% and 5/5 occlusions (Kappa 0.8). Sensibility and specificity of Duplex for the diagnosis of stenosis > 60% were, respectively, 89.5% and 90.7%; with an exactness of 90.2%. The angiographies showed stenosis > 60% in 23 patients with HTA (diastolic pressures > 100 mmHg). In all of the patients, a measurement of the plasmatic renin activity, an isotopic renogram and a Doppler of the interlobar arteries basal and post-captopril, were performed. The correlationship between Duplex and isotopic renogram with respect to the measurement of the relative renal perfusion was statistically significant (r = 0.91; p < 0.0001). The captopril test for renin and isotopic renogram were positives for 5 patients (4 with unilateral stenosis an 1 with bilateral stenosis). All of them showed severe stenosis (> 80%).(ABSTRACT TRUNCATED AT 250 WORDS)

  13. 1. VIEW OF DUPLEX (FEATURE 7). CORNER OF DUPLEX (FEATURE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. VIEW OF DUPLEX (FEATURE 7). CORNER OF DUPLEX (FEATURE 6) IS VISIBLE AT LEFT. MILL SITE IS VISIBLE IN THE BACKGROUND. FACING EAST. - Copper Canyon Camp of the International Smelting & Refining Company, Duplex, Copper Canyon, Battle Mountain, Lander County, NV

  14. Ion pairs and their role in modulating stability of cold- and warm-active uracil DNA glycosylase.

    PubMed

    Olufsen, Magne; Papaleo, Elena; Smalås, Arne Oskar; Brandsdal, Bjørn Olav

    2008-05-15

    MD simulations and continuum electrostatics calculations have been used to study the observed differences in thermostability of cold- and warm-active uracil DNA glycosylase (UDG). The present study focuses on the role of ion pairs and how they affect the thermal stability of the two enzymes. Analysis of the MD generated structural ensembles show that cod UDG (cUDG) and human UDG (hUDG) have 11 and 12 ion pairs which are present in at least 30% of the conformations. The electrostatic contribution of the ion pairs, computed using continuum electrostatics, is slightly more favorable in cUDG at 298 K. This is primarily attributed to more optimized interactions between the ion pairs and nearby dipoles/charges in cUDG. More global salt bridges are found in hUDG and are more stabilizing when compared to cUDG, possibly playing a role in maintaining overall stability and reducing conformational entropy. Both enzymes contain one three-member ionic network, but the one found in hUDG is far more stabilizing. Our results also suggest that care should be taken when performing statistical analysis of crystal structures with respect to ion pairs, and that crystallization conditions must be carefully examined when performing such analysis.

  15. ATP hydrolysis Promotes Duplex DNA Release by the RecA Presynaptic Complex.

    PubMed

    Lee, Ja Yil; Qi, Zhi; Greene, Eric C

    2016-10-14

    Homologous recombination is an important DNA repair pathway that plays key roles in maintaining genome stability. Escherichia coli RecA is an ATP-dependent DNA-binding protein that catalyzes the DNA strand exchange reactions in homologous recombination. RecA assembles into long helical filaments on single-stranded DNA, and these presynaptic complexes are responsible for locating and pairing with a homologous duplex DNA. Recent single molecule studies have provided new insights into RecA behavior, but the potential influence of ATP in the reactions remains poorly understood. Here we examine how ATP influences the ability of the RecA presynaptic complex to interact with homologous dsDNA. We demonstrate that over short time regimes, RecA presynaptic complexes sample heterologous dsDNA similarly in the presence of either ATP or ATPγS, suggesting that initial interactions do not depend on ATP hydrolysis. In addition, RecA stabilizes pairing intermediates in three-base steps, and stepping energetics is seemingly unaltered in the presence of ATP. However, the overall dissociation rate of these paired intermediates with ATP is ∼4-fold higher than with ATPγS. These experiments suggest that ATP plays an unanticipated role in promoting the turnover of captured duplex DNA intermediates as RecA attempts to align homologous sequences during the early stages of recombination.

  16. Duplex unwinding and ATPase activities of the DEAD-box helicase eIF4A are coupled by eIF4G and eIF4B.

    PubMed

    Özeş, Ali R; Feoktistova, Kateryna; Avanzino, Brian C; Fraser, Christopher S

    2011-09-30

    Eukaryotic initiation factor (eIF) 4A is a DEAD-box helicase that stimulates translation initiation by unwinding mRNA secondary structure. The accessory proteins eIF4G, eIF4B, and eIF4H enhance the duplex unwinding activity of eIF4A, but the extent to which they modulate eIF4A activity is poorly understood. Here, we use real-time fluorescence assays to determine the kinetic parameters of duplex unwinding and ATP hydrolysis by these initiation factors. To ensure efficient duplex unwinding, eIF4B and eIF4G cooperatively activate the duplex unwinding activity of eIF4A. Our data reveal that eIF4H is much less efficient at stimulating eIF4A unwinding activity than eIF4B, implying that eIF4H is not able to completely substitute for eIF4B in duplex unwinding. By monitoring unwinding and ATPase assays under identical conditions, we demonstrate that eIF4B couples the ATP hydrolysis cycle of eIF4A with strand separation, thereby minimizing nonproductive unwinding events. Using duplex substrates with altered GC contents but similar predicted thermal stabilities, we further show that the rate of formation of productive unwinding complexes is strongly influenced by the local stability per base pair, in addition to the stability of the entire duplex. This finding explains how a change in the GC content of a hairpin is able to influence translation initiation while maintaining the overall predicted thermal stability.

  17. Protonation of base pairs in RNA: context analysis and quantum chemical investigations of their geometries and stabilities.

    PubMed

    Chawla, Mohit; Sharma, Purshotam; Halder, Sukanya; Bhattacharyya, Dhananjay; Mitra, Abhijit

    2011-02-17

    Base pairs involving protonated nucleobases play important roles in mediating global macromolecular conformational changes and in facilitation of catalysis in a variety of functional RNA molecules. Here we present our attempts at understanding the role of such base pairs by detecting possible protonated base pairs in the available RNA crystal structures using BPFind software, in their specific structural contexts, and by the characterization of their geometries, interaction energies, and stabilities using advanced quantum chemical computations. We report occurrences of 18 distinct protonated base pair combinations from a representative data set of RNA crystal structures and propose a theoretical model for one putative base pair combination. Optimization of base pair geometries was carried out at the B3LYP/cc-pVTZ level, and the BSSE corrected interaction energies were calculated at the MP2/aug-cc-pVDZ level of theory. The geometries for each of the base pairs were characterized in terms of H-bonding patterns observed, rmsd values observed on optimization, and base pair geometrical parameters. In addition, the intermolecular interaction in these complexes was also analyzed using Morokuma energy decomposition. The gas phase interaction energies of the base pairs range from -24 to -49 kcal/mol and reveal the dominance of Hartree-Fock component of interaction energy constituting 73% to 98% of the total interaction energy values. On the basis of our combined bioinformatics and quantum chemical analysis of different protonated base pairs, we suggest resolution of structural ambiguities and correlate their geometric and energetic features with their structural and functional roles. In addition, we also examine the suitability of specific base pairs as key elements in molecular switches and as nucleators for higher order structures such as base triplets and quartets.

  18. Duplex tab exhaust nozzle

    NASA Technical Reports Server (NTRS)

    Gutmark, Ephraim Jeff (Inventor); Martens, Steven (nmn) (Inventor)

    2012-01-01

    An exhaust nozzle includes a conical duct terminating in an annular outlet. A row of vortex generating duplex tabs are mounted in the outlet. The tabs have compound radial and circumferential aft inclination inside the outlet for generating streamwise vortices for attenuating exhaust noise while reducing performance loss.

  19. Theoretical Studies on the Intermolecular Interactions of Potentially Primordial Base-Pair Analogues

    SciTech Connect

    Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri; Sumpter, Bobby G; Fuentes-Cabrera, Miguel A; Vazquez-Mayagoitia, Alvaro

    2010-01-01

    Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the bases and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.

  20. Role of the Closing Base Pair for d(GCA) Hairpin Stability: Free Energy Analysis and Folding Simulations

    SciTech Connect

    Kannan, Srinivasaraghavan; Zacharias, Martin W.

    2011-06-30

    Hairpin loops belong to the most important structural motifs in folded nucleic acids. The d(GNA) sequence in DNA can form very stable trinucleotide hairpin loops depending, however, strongly on the closing base pair. Replica-exchange molecular dynamics (REMD) were employed to study hairpin folding of two DNA sequences, d(gcGCAgc) and d(cgGCAcg), with the same central loop motif but different closing base pairs starting from singlestranded structures. In both cases, conformations of the most populated conformational cluster at the lowest temperature showed close agreement with available experimental structures. For the loop sequence with the less stable G:C closing base pair, an alternative loop topology accumulated as second most populated conformational state indicating a possible loop structural heterogeneity. Comparative-free energy simulations on induced loop unfolding indicated higher stability of the loop with a C:G closing base pair by 3 kcal mol1 (compared to a G:C closing base pair) in very good agreement with experiment. The comparative energetic analysis of sampled unfolded, intermediate and folded conformational states identified electrostatic and packing interactions as the main contributions to the closing base pair dependence of the d(GCA) loop stability.

  1. Nucleic acid unwinding by hepatitis C virus and bacteriophage t7 helicases is sensitive to base pair stability.

    PubMed

    Donmez, Ilker; Rajagopal, Vaishnavi; Jeong, Yong-Joo; Patel, Smita S

    2007-07-20

    Helicases are motor enzymes that convert the chemical energy of NTP hydrolysis into mechanical force for motion and nucleic acid strand separation. Within the cell, helicases process a range of nucleic acid sequences. It is not known whether this composite rate of moving and opening the strands of nucleic acids depends on the base sequence. Our presteady state kinetic studies of helicases from two classes, the ring-shaped T7 helicase and two forms of non-ring-shaped hepatitis C virus (HCV) helicase, show that both the unwinding rate and processivity depend on the sequence and decrease as the nucleic acid stability increases. The DNA unwinding activity of T7 helicase and the RNA unwinding activity of HCV helicases decrease steeply with increasing base pair stability. On the other hand, the DNA unwinding activity of HCV helicases is less sensitive to base pair stability. These results predict that helicases will fall into a spectrum of modest to high sensitivity to base pair stability depending on their biological role in the cell. Modeling of the dependence provided the degree of the active involvement of helicase in base pair destabilization during the unwinding process and distinguished between passive and active mechanisms of unwinding.

  2. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  3. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    PubMed

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  4. Atomistic Simulations on the Thermal Stability of the Antisite Pair in 3C- and 4H-SiC

    SciTech Connect

    Posselt, Matthias; Gao, Fei; Weber, William J.

    2006-03-31

    The thermal stability of the first-neighbor antisite pair configurations in 3C- and 4H-SiC is investigated by a comprehensive atomistic study. At first the structure and energetics of these defects is determined in order to check the accuracy of the Gao-Weber interatomic potential used. The results are comparable with literature data obtained by the density-functional theory. Then, the lifetime of the antisite pair configurations is calculated for temperatures between 800 and 2500 K. Both in 3C- and 4H-SiC the thermal stability of the antisite pairs is rather low. In contrast to previous theoretical interpretations, the antisite pair can be therefore not correlated with the DI photoluminescence center that is stable to above 2000 K. The atomic mechanisms during the recombination of the antisite pair in 3C-SiC and of three antisite pair configurations in 4H-SiC is a modified concerted exchange. Due to the different sizes of the silicon and the carbon atoms, this process is not identical with the concerted exchange in Si. Two intermediate metastable configurations found during the recombination are similar to the bond defect in Si. Since the SiC lattice contains two types of atoms, there are also two different types of bond defects. The two bond defects can be considered as the result of the incomplete recombination of a carbon vacancy and a neighboring mixed dumbbell interstitial. For selected temperatures the thermal stability of the antisite pair in 3C-SiC is investigated by molecular dynamics simulations that are based on the density-functional theory. Their results are very similar to those of the atomistic study, i.e. the Gao-Weber potential describes the antisite pair and its recombination reasonably well. The antisite pair in 4H-SiC with the two atoms on hexagonal sites has a slightly different formation energy than the other three antisite pair configurations in 4H-SiC. Its lifetime shows another dependence on the temperature, and its recombination is

  5. Silver(I)-mediated Hoogsteen-type base pairs.

    PubMed

    Megger, Dominik A; Fonseca Guerra, Célia; Bickelhaupt, F Matthias; Müller, Jens

    2011-11-01

    Metal-mediated Hoogsteen-type base pairs are useful for the construction of DNA duplexes containing contiguous stretches of metal ions along the helical axis. To fine-tune the stability of such base pairs and the selectivity toward different metal ions, the availability of a selection of artificial nucleobases is highly desirable. In this study, we follow a theoretical approach utilizing dispersion-corrected density functional methods to evaluate a variety of artificial nucleobases as candidates for metal-mediated Hoogsteen-type base pairs. We focus on silver(I)-mediated Hoogsteen- and reverse Hoogsteen-type base pairs formed between 1-deaza- and 1,3-dideazapurine-derived nucleobases, respectively, and cytosine. Apart from two coordinative bonds, these base pairs are stabilized by a hydrogen bond. We elucidate the impact of different substituents at the C6 position and the presence or absence of an endocyclic N3 nitrogen atom on the overall stability of a base pair and concomitantly on the strength of the hydrogen and coordinative bonds. All artificial base pairs investigated in this study are less stable than the experimentally established benchmark base pair C-Ag(+)-G. The base pair formed from 1,3-dideaza-6-methoxypurine is isoenergetic to the experimentally observed C-Ag(+)-C base pair. This makes 1,3-dideaza-6-methoxypurine a promising candidate for the use as an artificial nucleobase in DNA.

  6. Alternative DNA base pairing through metal coordination.

    PubMed

    Clever, Guido H; Shionoya, Mitsuhiko

    2012-01-01

    Base-pairing in the naturally occurring DNA and RNA oligonucleotide duplexes is based on π-stacking, hydrogen bonding, and shape complementarity between the nucleobases adenine, thymine, guanine, and cytosine as well as on the hydrophobic-hydrophilic balance in aqueous media. This complex system of multiple supramolecular interactions is the product of a long-term evolutionary process and thus highly optimized to serve its biological functions such as information storage and processing. After the successful implementation of automated DNA synthesis, chemists have begun to introduce artificial modifications inside the core of the DNA double helix in order to study various aspects of base pairing, generate new base pairs orthogonal to the natural ones, and equip the biopolymer with entirely new functions. The idea to replace the hydrogen bonding interactions with metal coordination between ligand-like nucleosides and suitable transition metal ions culminated in the development of a plethora of artificial base-pairing systems termed "metal base-pairs" which were shown to strongly enhance the DNA duplex stability. Furthermore, they show great potential for the use of DNA as a molecular wire in nanoscale electronic architectures. Although single electrons have proven to be transmitted by natural DNA over a distance of several base pairs, the high ohmic resistance of unmodified oligonucleotides was identified as a serious obstacle. By exchanging some or all of the Watson-Crick base pairs in DNA with metal complexes, this problem may be solved. In the future, these research efforts are supposed to lead to DNA-like materials with superior conductivity for nano-electronic applications. Other fields of potential application such as DNA-based supramolecular architecture and catalysis may be strongly influenced by these developments as well. This text is meant to illustrate the basic concepts of metal-base pairing and give an outline over recent developments in this field.

  7. Conformational transitions of duplex and triplex nucleic acid helices: thermodynamic analysis of effects of salt concentration on stability using preferential interaction coefficients.

    PubMed Central

    Bond, J. P.; Anderson, C. F.; Record, M. T.

    1994-01-01

    For order-disorder transitions of double- and triple-stranded nucleic acid helices, the midpoint temperatures Tm depend strongly on a +/-, the mean ionic activity of uniunivalent salt. Experimental determinations of dTm/d ln a +/- and of the enthalpy change (delta H(o)) accompanying the transition in excess salt permit evaluation of delta gamma, the stoichiometrically weighted combination of preferential interaction coefficients, each of which reflects thermodynamic effects of interactions of salt ions with a reactant or product of the conformational transition (formula; see text) Here delta H(o) is defined per mole of nucleotide by analogy to delta gamma. Application of Eq. 1 to experimental values of delta H(o) and Tm yields values of delta gamma for the denaturation of B-DNA over the range of NaCl concentrations 0.01-0.20 M (Privalov et al. (1969), Biopolymers 8,559) and for each of four order-disorder transitions of poly rA.(poly rU)n, n = 1, 2 over the range of NaCl concentrations 0.01-1.0 M (Krakauer and Sturtevant (1968), Biopolymers 6, 491). For denaturation of duplexes and triplexes, delta gamma is negative and not significantly dependent on a +/-, but delta gamma is positive and dependent on a +/- for the disproportionation transition of poly rA.poly rU duplexes. Quantitative interpretations of these trends and magnitudes of delta gamma in terms of coulombic and excluded volume effects are obtained by fitting separately each of the two sets of thermodynamic data using Eq. 1 with delta gamma PB evaluated from the cylindrically symmetric Poisson-Boltzmann (PB) equation for a standard model of salt-polyelectrolyte solutions. The only structural parameters required by this model are: b, the mean axial distance between the projections of adjacent polyion charges onto the cylindrical axis; and a, the mean distance of closest approach between a salt ion center and the cylindrical axis. Fixing bMS and aMS for the multi-stranded (ordered) conformations, we

  8. View of 501 8th St., a sidegable duplex bungalow with ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of 501 8th St., a side-gable duplex bungalow with engaged porch and paired and clustered columns. Built as worker housing for Lanett Cotton Mill - 501 Eighth Street (House), 501 Eighth Street, Lanett, Chambers County, AL

  9. Non-nearest-neighbor dependence of stability for group III RNA single nucleotide bulge loops.

    PubMed

    Kent, Jessica L; McCann, Michael D; Phillips, Daniel; Panaro, Brandon L; Lim, Geoffrey F S; Serra, Martin J

    2014-06-01

    Thirty-five RNA duplexes containing single nucleotide bulge loops were optically melted and the thermodynamic parameters for each duplex determined. The bulge loops were of the group III variety, where the bulged nucleotide is either a AG/U or CU/G, leading to ambiguity to the exact position and identity of the bulge. All possible group III bulge loops with Watson-Crick nearest-neighbors were examined. The data were used to develop a model to predict the free energy of an RNA duplex containing a group III single nucleotide bulge loop. The destabilization of the duplex by the group III bulge could be modeled so that the bulge nucleotide leads to the formation of the Watson-Crick base pair rather than the wobble base pair. The destabilization of an RNA duplex caused by the insertion of a group III bulge is primarily dependent upon non-nearest-neighbor interactions and was shown to be dependent upon the stability of second least stable stem of the duplex. In-line structure probing of group III bulge loops embedded in a hairpin indicated that the bulged nucleotide is the one positioned further from the hairpin loop irrespective of whether the resulting stem formed a Watson-Crick or wobble base pair. Fourteen RNA hairpins containing group III bulge loops, either 3' or 5' of the hairpin loop, were optically melted and the thermodynamic parameters determined. The model developed to predict the influence of group III bulge loops on the stability of duplex formation was extended to predict the influence of bulge loops on hairpin stability.

  10. An extremely stable, self-complementary hydrogen-bonded duplex

    SciTech Connect

    Zeng, Huang; Yang, Xiaowu; Brown, A L.; Martinovic, Suzana; Smith, Richard D.; Gong, Bing

    2003-07-30

    This paper describes the design, synthesis and characterization of a self-complementary six-H-bonded duplex with an association constant greater than 10{sup 9}/M in CHCl3. Numerous unnatural self-assembly systems have been developed in recent years. Most of these previously described systems are case-dependent, i.e., the individual components carry the information that defines only the formation of the specific assembly. An alternative approach involves the design of highly specific and highly stable recognition units (modules)that are compatible with a variety of structural components. Such recognition modules or ''molecular glues'' then direct the assembly of these structural components. In this regard,hydrogen-bonded complexes based on rigid heterocycles with multiple H-bonding donor (D) and acceptor (A) sites have received the most attention in recent years. Other complexes, most based on H-bonding interactions, have also been reported. Highly stable, self-complementary H-bonded complexes are particularly attractive for developing supramolecular homopolymers of very high molecular weights. In spite of the intriguing perspective, only a very small number of self-complementary H-bonded complexes with high stabilities are known. The best known examples involve two pairs of quadruply H-bonded, self-complementary complexes, both based on the AADD-DDAA array, and with association constants greater than 10{sup 7}/M. We report here the design and characterization of our first six-H-bonded, self-complementary duplex that contains the AADADD-DDADAA array.

  11. Computational comparison of oxidation stability: Solvent/salt monomers vs solvent-solvent/salt pairs

    NASA Astrophysics Data System (ADS)

    Kim, Dong Young; Park, Min Sik; Lim, Younhee; Kang, Yoon-Sok; Park, Jin-Hwan; Doo, Seok-Gwang

    2015-08-01

    A fundamental understanding of the anodic stabilities of electrolytes is important for the development of advanced high-voltage electrolytes. In this study, we calculated and systematically compared the oxidation stabilities of monomeric solvents and anions, and bimolecular solvent-solvent and anion-solvent systems that are considered to be high-voltage electrolyte components, using ab initio calculations. Oxidation stabilities of solvent or anion monomers without considering specific solvation molecules cannot represent experimental oxidation stabilities. The oxidation of electrolytes usually forms neutral or cationic radicals, which immediately undergo further reactions stabilizing the products. Oxidatively driven intermolecular reactions are the main reason for the lower oxidation stabilities of electrolytes compared with those of monomeric compounds. Electrolyte components such as tetramethylene sulfone (TMS), ethyl methyl sulfone (EMS), bis(oxalate)borate (BOB-), and bis(trifluoromethane)sulfonamide (TFSI-) that minimize such intermolecular chemical reactions on oxidation can maintain the oxidation stabilities of monomers. In predictions of the theoretical oxidation stabilities of electrolytes, simple comparisons of highest occupied molecular orbital energies can be misleading, even if microsolvation or bulk clusters are considered. Instead, bimolecular solvent complexes with a salt anion should be at least considered in oxidation calculations. This study provides important information on fundamental and applied aspects of the development of electrolytes.

  12. Weakened N3 Hydrogen Bonding by 5-Formylcytosine and 5-Carboxylcytosine Reduces Their Base-Pairing Stability.

    PubMed

    Dai, Qing; Sanstead, Paul J; Peng, Chunte Sam; Han, Dali; He, Chuan; Tokmakoff, Andrei

    2016-02-19

    In the active cytosine demethylation pathway, 5-methylcytosine (5mC) is oxidized sequentially to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC). Thymine DNA glycosylase (TDG) selectively excises 5fC and 5caC but not cytosine (C), 5mC, and 5hmC. We propose that the electron-withdrawing properties of -CHO and -COOH in 5fC and 5caC increase N3 acidity, leading to weakened hydrogen bonding and reduced base pair stability relative to C, 5mC, and 5hmC, thereby facilitating the selective recognition of 5fC and 5caC by TDG. Through (13)C NMR, we measured the pKa at N3 of 5fC as 2.4 and the two pKa's of 5caC as 2.1 and 4.2. We used isotope-edited IR spectroscopy coupled with density functional theory (DFT) calculations to site-specifically assign the more acidic pKa of 5caC to protonation at N3, indicating that N3 acidity is increased in 5fC and 5caC relative to C. IR and UV melting studies of self-complementary DNA oligomers confirm reduced stability for 5fC-G and 5caC-G base pairs. Furthermore, while the 5fC-G base pair stability is insensitive to pH, the 5caC-G stability is reduced as pH decreases and the carboxyl group is increasingly protonated. Despite suggestions that 5fC and 5caC may exist in rare tautomeric structures which form wobble GC base pairs, our two-dimensional infrared (2D IR) spectroscopy of 5fC and 5caC free nucleosides confirms that both bases are predominantly in the canonical amino-keto form. Taken together, these findings support our model that weakened base pairing ability for 5fC and 5caC in dsDNA contributes to their selective recognition by TDG.

  13. Unique base-pair breathing dynamics in PNA-DNA hybrids.

    PubMed

    Leijon, M; Sehlstedt, U; Nielsen, P E; Gräslund, A

    1997-08-22

    Kinetic and thermodynamic parameters, derived from 1H-NMR measurements of the imino proton exchange rates upon titration with the exchange catalyst ammonia, are reported for two mixed-sequence peptide nucleic acid (PNA)-DNA hybrids and their counterpart DNA duplex. The exchange times of the imino protons in the PNA strands extrapolate to very short base-pair lifetimes in the limit of infinite exchange catalyst concentration. This is not due to generally less stable base-pairs in PNA-DNA hybrids, since the lifetimes, apparent dissociation constants and thermodynamic stability (DeltaG degrees ) of the innermost DNA guanine imino protons are similar in the hybrid duplexes and in the DNA duplex. In addition, the apparent dissociation constants determined for PNA bases of the hybrids are of the same order as those of the corresponding bases in the DNA duplex. An exchange process from the closed state was found to be inconsistent with the experimental data. From these results, we conclude that opening and closing rates of the PNA guanine and thymine bases are at least two orders of magnitude higher than those of the corresponding bases in the DNA duplex. Unusual kinetics in the hybrids is also evident from the destabilization of the complementary DNA strand thymine bases, which exhibit base-pair dissociation constants increased by approximately two orders of magnitude compared to what is observed in the DNA duplex, while the DNA strand guanine bases are largely unaffected. The general pattern of the base-pair dynamics in the hybrids obtained when using trimethylamine as an exchange catalyst is the same as when using ammonia. However, the long base-pair lifetimes i. e. those of the DNA duplex and the guanine bases of the DNA strands in the hybrids, are approximately three to five times longer than when using ammonia. Thus, all opening events sensed by ammonia are not accessible to trimethylamine. These observations are discussed in regard to the mechanism of base-pair

  14. Finding the first cosmic explosions. IV. 90–140 $\\;{{M}_{\\odot }}$ pair-stability supernovae

    SciTech Connect

    Smidt, Joseph; Whalen, Daniel J.; Chatzopoulos, E.; Wiggins, Brandon; Chen, Ke-Jung; Kozyreva, Alexandra; Even, Wesley

    2015-05-19

    Population III stars that die as pair-instability supernovae are usually thought to fall in the mass range of 140 - 260 M. However, several lines of work have now shown that rotation can build up the He cores needed to encounter the pair instability at stellar masses as low as 90 M. Depending on the slope of the initial mass function of Population III stars, there could be 4 - 5 times as many stars from 90 - 140 M in the primordial universe than in the usually accepted range. We present numerical simulations of the pair-instability explosions of such stars performed with the MESA, FLASH and RAGE codes. We find that they will be visible to supernova factories such as Pan-STARRS and LSST in the optical out to z ~ 1-2 and JWST and the 30 m-class telescopes in the NIR out to z ~ 7-10. Such explosions will thus probe the stellar populations of the first galaxies and cosmic star formation rates in the era of cosmological reionization. These supernovae are also easily distinguished from more massive pair-instability explosions, underscoring the fact that there is far greater variety to the light curves of these events than previously understood.

  15. Finding the first cosmic explosions. IV. 90–140 $$\\;{{M}_{\\odot }}$$ pair-stability supernovae

    DOE PAGES

    Smidt, Joseph; Whalen, Daniel J.; Chatzopoulos, E.; ...

    2015-05-19

    Population III stars that die as pair-instability supernovae are usually thought to fall in the mass range of 140 - 260 M⊙. However, several lines of work have now shown that rotation can build up the He cores needed to encounter the pair instability at stellar masses as low as 90 M⊙. Depending on the slope of the initial mass function of Population III stars, there could be 4 - 5 times as many stars from 90 - 140 M⊙ in the primordial universe than in the usually accepted range. We present numerical simulations of the pair-instability explosions of suchmore » stars performed with the MESA, FLASH and RAGE codes. We find that they will be visible to supernova factories such as Pan-STARRS and LSST in the optical out to z ~ 1-2 and JWST and the 30 m-class telescopes in the NIR out to z ~ 7-10. Such explosions will thus probe the stellar populations of the first galaxies and cosmic star formation rates in the era of cosmological reionization. These supernovae are also easily distinguished from more massive pair-instability explosions, underscoring the fact that there is far greater variety to the light curves of these events than previously understood.« less

  16. Thermal stability comparison of nanocrystalline Fe-based binary alloy pairs

    DOE PAGES

    Clark, Blythe G.; Hattar, Khalid Mikhiel; Marshall, Michael Thomas; ...

    2016-03-24

    Here, the widely recognized property improvements of nanocrystalline (NC) materials have generated significant interest, yet have been difficult to realize in engineering applications due to the propensity for grain growth in these interface-dense systems. While traditional pathways to thermal stabilization can slow the mobility of grain boundaries, recent theories suggest that solute segregation in NC alloy can reduce the grain boundary energy such that thermodynamic stabilization is achieved. Following the predictions of Murdock et al., here we compare for the first time the thermal stability of a predicted NC stable alloy (Fe-10at.% Mg) with a predicted non-NC stable alloy (Fe-10at.%more » Cu) using the same processing and characterization methodologies. Results indicate improved thermal stability of the Fe-Mg alloy in comparison to the Fe-Cu, and observed microstructures are consistent with those predicted by Monte Carlo simulations.« less

  17. Thermal stability comparison of nanocrystalline Fe-based binary alloy pairs

    SciTech Connect

    Clark, Blythe G.; Hattar, Khalid Mikhiel; Marshall, Michael Thomas; Chookajorn, Tonghai; Boyce, Brad L.; Schuh, Christopher A.

    2016-03-24

    Here, the widely recognized property improvements of nanocrystalline (NC) materials have generated significant interest, yet have been difficult to realize in engineering applications due to the propensity for grain growth in these interface-dense systems. While traditional pathways to thermal stabilization can slow the mobility of grain boundaries, recent theories suggest that solute segregation in NC alloy can reduce the grain boundary energy such that thermodynamic stabilization is achieved. Following the predictions of Murdock et al., here we compare for the first time the thermal stability of a predicted NC stable alloy (Fe-10at.% Mg) with a predicted non-NC stable alloy (Fe-10at.% Cu) using the same processing and characterization methodologies. Results indicate improved thermal stability of the Fe-Mg alloy in comparison to the Fe-Cu, and observed microstructures are consistent with those predicted by Monte Carlo simulations.

  18. Thermal Stability Comparison of Nanocrystalline Fe-Based Binary Alloy Pairs

    NASA Astrophysics Data System (ADS)

    Clark, B. G.; Hattar, K.; Marshall, M. T.; Chookajorn, T.; Boyce, B. L.; Schuh, C. A.

    2016-06-01

    The widely recognized property improvements of nanocrystalline (NC) materials have generated significant interest; yet, they have been difficult to realize in engineering applications due to the propensity for grain growth in these interface-dominated systems. Although traditional pathways to thermal stabilization can slow the mobility of grain boundaries, recent theories suggest that solute segregation in NC alloys can reduce the grain boundary energy such that thermodynamic stabilization is achieved. Following the predictions of Murdoch et al., here we compare for the first time the thermal stability of a predicted NC stable alloy (Fe-10 at.% Mg) with a predicted non-NC stable alloy (Fe-10 at.% Cu) using the same processing and characterization methodologies. Results show improved thermal stability of the Fe-Mg alloy in comparison with the Fe-Cu, and thermally-evolved microstructures that are consistent with those predicted by Monte Carlo simulations.

  19. Surface morphology of CuFeS2: The stability of the polar (112 ) /(112 ¯) surface pair

    NASA Astrophysics Data System (ADS)

    Chen, Vincent H.-Y.; Mallia, Giuseppe; Martínez-Casado, Ruth; Harrison, Nicholas M.

    2015-10-01

    The reconstruction and energetics for a range of chalcopyrite (CuFeS2) surfaces have been investigated using hybrid-exchange density functional theory. The stable nonpolar surfaces in increasing order of surface energy are (110), (102), and (114). In addition, the polar (112 ) /(112 ¯) surface pair was found to be remarkably stable with a surface formation energy that is only slightly higher than that of the (110) surface. The stability of (112 ) /(112 ¯) can be attributed to a combination of geometric and electronic mechanisms that result in the suppression of the electrostatic dipole perpendicular to the surface. Defect formation is a third mechanism that can further stabilize the (112 ) /(112 ¯) surface pair to an extent that it is thermodynamically preferred over the (110) surface. The stability of (112 ) /(112 ¯) means that regardless of the growth conditions, (112) and (112 ¯) facets are expected to have a significant presence in the surface morphology of CuFeS2.

  20. The stabilization effect of dielectric constant and acidic amino acids on arginine-arginine (Arg-Arg) pairings: database survey and computational studies.

    PubMed

    Zhang, Zhengyan; Xu, Zhijian; Yang, Zhuo; Liu, Yingtao; Wang, Jin'an; Shao, Qiang; Li, Shujin; Lu, Yunxiang; Zhu, Weiliang

    2013-05-02

    Database survey in this study revealed that about one-third of the protein structures deposited in the Protein Data Bank (PDB) contain arginine-arginine (Arg-Arg) pairing with a carbon···carbon (CZ···CZ) interaction distance less than 5 Å. All the Arg-Arg pairings were found to bury in a polar environment composed of acidic residues, water molecules, and strong polarizable or negatively charged moieties from binding site or bound ligand. Most of the Arg-Arg pairings are solvent exposed and 68.3% Arg-Arg pairings are stabilized by acidic residues, forming Arg-Arg-Asp/Glu clusters. Density functional theory (DFT) was then employed to study the effect of environment on the pairing structures. It was revealed that Arg-Arg pairings become thermodynamically stable (about -1 kcal/mol) as the dielectric constant increases to 46.8 (DMSO), in good agreement with the results of the PDB survey. DFT calculations also demonstrated that perpendicular Arg-Arg pairing structures are favorable in low dielectric constant environment, while in high dielectric constant environment parallel structures are favorable. Additionally, the acidic residues can stabilize the Arg-Arg pairing structures to a large degree. Energy decomposition analysis of Arg-Arg pairings and Arg-Arg-Asp/Glu clusters showed that both solvation and electrostatic energies contribute significantly to their stability. The results reported herein should be very helpful for understanding Arg-Arg pairing and its application in drug design.

  1. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  2. Role of ion-pair interactions on asphaltene stabilization by alkylbenzenesulfonic acids.

    PubMed

    Goual, Lamia; Sedghi, Mohammad

    2015-02-15

    The dispersion of asphaltenes by dodecylbenzenesulfonic acid (DBSA) has been the subject of several studies in the past. However, it is unclear how these interactions affect the structure of asphaltenes and why asphaltene aggregates are larger in the presence of ionic DBSA. The main goal of this study was to address these points using a combination of high-resolution transmission electron microscopy (HRTEM) and molecular dynamics (MD) simulations. Another objective was to compare ionic DBSA (i.e., dodecylbenzenesulfonate or DBS(-)) to nonionic amphiphiles such as alkylphenols. A striking similarity between dodecylbenzenesulfonate and alkylphenols was that both favored the formation of filamentary rather than globular asphaltene flocculates. However the mechanism by which those filaments formed was very different. Two strong electrostatic interactions between DBSA and asphaltenes were found: (i) those between protonated asphaltenes (i.e., AH(+)) and DBS(-) molecules, which were fifteen times stronger than asphaltene-alkylphenol interactions, and (ii) those between two asphaltene-dispersant pairs (i.e., AH(+)-DBS(-) ion pairs), which did not exist with alkylphenols. These interactions promoted the formation of large and compact asphaltene flocculates, as compared to small and loose ones formed without DBSA. Flocculates with DBSA could further bind to each other through ion-pair interactions. The binding occurred in series (generating long filaments) or in parallel (generating lateral ramifications). However the series configuration was energetically favored due to less steric effects generated by the side aliphatic chains of asphaltenes and DBSA.

  3. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  4. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m(5)dCyd: Implications for the Stability of DNA i-Motif Conformations.

    PubMed

    Yang, Bo; Rodgers, M T

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m(5)dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m(5)dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m(5)dCyd)H(+)(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  5. Effect of base modifications on structure, thermodynamic stability, and gene silencing activity of short interfering RNA

    PubMed Central

    Sipa, Katarzyna; Sochacka, Elzbieta; Kazmierczak-Baranska, Julia; Maszewska, Maria; Janicka, Magdalena; Nowak, Genowefa; Nawrot, Barbara

    2007-01-01

    A series of nucleobase-modified siRNA duplexes containing “rare” nucleosides, 2-thiouridine (s2U), pseudouridine (Ψ), and dihydrouridine (D), were evaluated for their thermodynamic stability and gene silencing activity. The duplexes with modified units at terminal positions exhibited similar stability as the nonmodified reference. Introduction of the s2U or Ψ units into the central part of the antisense strand resulted in duplexes with higher melting temperatures (Tm). In contrary, D unit similarly like wobble base pair led to the less stable duplexes (ΔTm 3.9 and 6.6°C, respectively). Gene-silencing activity of siRNA duplexes directed toward enhanced green fluorescent protein or beta-site APP cleaving enzyme was tested in a dual fluorescence assay. The duplexes with s2U and Ψ units at their 3′-ends and with a D unit at their 5′-ends (with respect to the guide strands) were the most potent gene expression inhibitors. Duplexes with s2U and Ψ units at their 5′-ends were by 50% less active than the nonmodified counterpart. Those containing a D unit or wobble base pair in the central domain had the lowest Tm, disturbed the A-type helical structure, and had more than three times lower activity than their nonmodified congener. Activity of siRNA containing the wobble base pair could be rescued by placing the thio-nucleoside at the position 3′-adjacent to the mutation site. Thermally stable siRNA molecules containing several s2U units in the antisense strand were biologically as potent as their native counterparts. The present results provide a new chemical tool for modulation of siRNA gene-silencing activity. PMID:17585051

  6. NMR spectroscopy of RNA duplexes containing pseudouridine in supercooled water.

    PubMed

    Schroeder, Kersten T; Skalicky, Jack J; Greenbaum, Nancy L

    2005-07-01

    We have performed NMR experiments in supercooled water in order to decrease the temperature-dependent exchange of protons in RNA duplexes. NMR spectra of aqueous samples of RNA in bundles of narrow capillaries that were acquired at temperatures as low as -18 degrees C reveal resonances of exchangeable protons not seen at higher temperatures. In particular, we detected the imino protons of terminal base pairs and the imino proton of a non-base-paired pseudouridine in a duplex representing the eukaryotic pre-mRNA branch site helix. Analysis of the temperature dependence of chemical shift changes (thermal coefficients) for imino protons corroborated hydrogen bonding patterns observed in the NMR-derived structural model of the branch site helix. The ability to observe non-base-paired imino protons of RNA is of significant value in structure determination of RNA motifs containing loop and bulge regions.

  7. [Carotid duplex ultrasonography for neurosurgeons].

    PubMed

    Sadahiro, Hirokazu; Ishihara, Hideyuki; Oka, Fumiaki; Suzuki, Michiyasu

    2011-12-01

    Carotid duplex ultrasonography (CDU) is one of the most well-known imaging methods for arteriosclerosis and ischemic stroke. For neurosurgeons, it is very important for the details of carotid plaque to be thoroughly investigated by CDU. Symptomatic carotid plaque is very fragile and easily changes morphologically, and so requires frequent CDU examination. Furthermore, after carotid endarterectomy (CEA) and carotid artery stenting (CAS), restenosis is evaluated with CDU. CDU facilitates not only morphological imaging in the B mode, but also allows a flow study with color Doppler and duplex imaging. So, CDU can help assess the presence of proximal and intracranial artery lesions in spite of only having a cervical view, and the patency of the extracranial artery to intracranial artery bypass is revealed with CDU, which shows a rich velocity and low pulsatility index (PI) in duplex imaging. For the examiner, it is necessary to ponder on what duplex imaging means in examinations, and to summarize all imaging finding.

  8. The roles of entropy and enthalpy in stabilizing ion-pairs at transition states in zeolite acid catalysis.

    PubMed

    Gounder, Rajamani; Iglesia, Enrique

    2012-02-21

    Acidic zeolites are indispensable catalysts in the petrochemical industry because they select reactants and their chemical pathways based on size and shape. Voids of molecular dimensions confine reactive intermediates and transition states that mediate chemical reactions, stabilizing them by van der Waals interactions. This behavior is reminiscent of the solvation effects prevalent within enzyme pockets and has analogous consequences for catalytic specificity. Voids provide the "right fit" for certain transition states, reflected in their lower free energies, thus extending the catalytic diversity of zeolites well beyond simple size discrimination. This catalytic diversity is even more remarkable because acid strength is essentially unaffected by confinement among known crystalline aluminosilicates. In this Account, we discuss factors that determine the "right fit" for a specific chemical reaction, exploring predictive criteria that extend the prevailing discourse based on size and shape. We link the structures of reactants, transition states, and confining voids to chemical reactivity and selectivity. Confinement mediates enthalpy-entropy compromises that determine the Gibbs free energies of transition states and relevant reactants; these activation free energies determine turnover rates via transition state theory. At low temperatures (400-500 K), dimethyl ether carbonylation occurs with high specificity within small eight-membered ring (8-MR) voids in FER and MOR zeolite structures, but at undetectable rates within larger voids (MFI, BEA, FAU, and SiO(2)-Al(2)O(3)). More effective van der Waals stabilization within 8-MR voids leads to lower ion-pair enthalpies but also lower entropies; taken together, carbonylation activation free energies are lower within 8-MR voids. The "right fit" is a "tight fit" at low temperatures, a consequence of how temperature appears in the defining equation for Gibbs free energy. In contrast, entropy effects dominate in high

  9. Predicting structure and stability for RNA complexes with intermolecular loop–loop base-pairing

    PubMed Central

    Cao, Song; Xu, Xiaojun; Chen, Shi-Jie

    2014-01-01

    RNA loop–loop interactions are essential for genomic RNA dimerization and regulation of gene expression. In this article, a statistical mechanics-based computational method that predicts the structures and thermodynamic stabilities of RNA complexes with loop–loop kissing interactions is described. The method accounts for the entropy changes for the formation of loop–loop interactions, which is a notable advancement that other computational models have neglected. Benchmark tests with several experimentally validated systems show that the inclusion of the entropy parameters can indeed improve predictions for RNA complexes. Furthermore, the method can predict not only the native structures of RNA/RNA complexes but also alternative metastable structures. For instance, the model predicts that the SL1 domain of HIV-1 RNA can form two different dimer structures with similar stabilities. The prediction is consistent with experimental observation. In addition, the model predicts two different binding sites for hTR dimerization: One binding site has been experimentally proposed, and the other structure, which has a higher stability, is structurally feasible and needs further experimental validation. PMID:24751648

  10. The solution structure of double helical arabino nucleic acids (ANA and 2'F-ANA): effect of arabinoses in duplex-hairpin interconversion.

    PubMed

    Martín-Pintado, Nerea; Yahyaee-Anzahaee, Maryam; Campos-Olivas, Ramón; Noronha, Anne M; Wilds, Christopher J; Damha, Masad J; González, Carlos

    2012-10-01

    We report here the first structure of double helical arabino nucleic acid (ANA), the C2'-stereoisomer of RNA, and the 2'-fluoro-ANA analogue (2'F-ANA). A chimeric dodecamer based on the Dickerson sequence, containing a contiguous central segment of arabino nucleotides, flanked by two 2'-deoxy-2'F-ANA wings was studied. Our data show that this chimeric oligonucleotide can adopt two different structures of comparable thermal stabilities. One structure is a monomeric hairpin in which the stem is formed by base paired 2'F-ANA nucleotides and the loop by unpaired ANA nucleotides. The second structure is a bimolecular duplex, with all the nucleotides (2'F-ANA and ANA) forming Watson-Crick base pairs. The duplex structure is canonical B-form, with all arabinoses adopting a pure C2'-endo conformation. In the ANA:ANA segment, steric interactions involving the 2'-OH substituent provoke slight changes in the glycosidic angles and, therefore, in the ANA:ANA base pair geometry. These distortions are not present in the 2'F-ANA:2'F-ANA regions of the duplex, where the -OH substituent is replaced by a smaller fluorine atom. 2'F-ANA nucleotides adopt the C2'-endo sugar pucker and fit very well into the geometry of B-form duplex, allowing for favourable 2'F···H8 interactions. This interaction shares many features of pseudo-hydrogen bonds previously observed in 2'F-ANA:RNA hybrids and in single 2'F-ANA nucleotides.

  11. Stability of 100 homo and heterotypic coiled-coil a-a' pairs for ten amino acids (A, L, I, V, N, K, S, T, E, and R).

    PubMed

    Acharya, Asha; Rishi, Vikas; Vinson, Charles

    2006-09-26

    We present the thermal stability monitored by circular dichroism (CD) spectroscopy at 222 nm of 100 heterodimers that contain all possible coiled-coil a-a' pairs for 10 amino acids (I, V, L, N, A, K S, T, E, and R). This includes the stability of 36 heterodimers for 6 amino acids (I, V, L, N, A, and K) previously described and 64 new heterodimers including the 4 amino acids (S, T, E, and R). We have calculated a double mutant alanine thermodynamic cycle to determine a-a' pair coupling energies to evaluate which a-a' pairs encourage specific dimerization partners. The four new homotypic a-a' pairs (T-T, S-S, R-R, E-E) are repulsive relative to A-A and have destabilizing coupling energies. Among the 90 heterotypic a-a' pairs, the stabilizing coupling energies contain lysine or arginine paired with either an aliphatic or a polar amino acid. The range in coupling energies for each amino acid reveals its potential to regulate dimerization specificity. The a-a' pairs containing isoleucine and asparagine have the greatest range in coupling energies and thus contribute dramatically to dimerization specificity, which is to encourage homodimerization. In contrast, the a-a' pairs containing charged amino acids (K, R, and E) show the least range in coupling energies and promiscuously encourage heterodimerization.

  12. Dda helicase tightly couples translocation on single-stranded DNA to unwinding of duplex DNA: Dda is an optimally active helicase.

    PubMed

    Byrd, Alicia K; Matlock, Dennis L; Bagchi, Debjani; Aarattuthodiyil, Suja; Harrison, David; Croquette, Vincent; Raney, Kevin D

    2012-07-13

    Helicases utilize the energy of ATP hydrolysis to unwind double-stranded DNA while translocating on the DNA. Mechanisms for melting the duplex have been characterized as active or passive, depending on whether the enzyme actively separates the base pairs or simply sequesters single-stranded DNA (ssDNA) that forms due to thermal fraying. Here, we show that Dda translocates unidirectionally on ssDNA at the same rate at which it unwinds double-stranded DNA in both ensemble and single-molecule experiments. Further, the unwinding rate is largely insensitive to the duplex stability and to the applied force. Thus, Dda transduces all of its translocase activity into DNA unwinding activity so that the rate of unwinding is limited by the rate of translocation and that the enzyme actively separates the duplex. Active and passive helicases have been characterized by dividing the velocity of DNA unwinding in base pairs per second (V(un)) by the velocity of translocation on ssDNA in nucleotides per second (V(trans)). If the resulting fraction is 0.25, then a helicase is considered to be at the lower end of the "active" range. In the case of Dda, the average DNA unwinding velocity was 257±42 bp/s, and the average translocation velocity was 267±15 nt/s. The V(un)/V(trans) value of 0.96 places Dda in a unique category of being an essentially "perfectly" active helicase.

  13. Structural basis for duplex RNA recognition and cleavage by Archaeoglobus fulgidus C3PO

    PubMed Central

    Parizotto, Eneida A; Lowe, Edward D; Parker, James S

    2013-01-01

    Oligomeric complexes of Trax and Translin proteins, known as C3POs, participate in a variety of eukaryotic nucleic acid metabolism pathways including RNAi and tRNA processing. In RNAi in humans and Drosophila, C3PO activates pre-RISC by removing the passenger strand of the siRNA precursor duplex using nuclease activity present in Trax. It is not known how C3POs engage with nucleic acid substrates. Here we identify a single protein from Archaeoglobus fulgidus that assembles into an octamer with striking similarity to human C3PO. The structure in complex with duplex RNA reveals that the octamer entirely encapsulates a single thirteen base-pair RNA duplex inside a large inner cavity. Trax-like subunit catalytic sites target opposite strands of the duplex for cleavage, separated by seven base pairs. The structure provides insight into the mechanism of RNA recognition and cleavage by an archaeal C3PO-like complex. PMID:23353787

  14. Synthesis of native-like crosslinked duplex RNA and study of its properties.

    PubMed

    Onizuka, Kazumitsu; Hazemi, Madoka E; Thomas, Justin M; Monteleone, Leanna R; Yamada, Ken; Imoto, Shuhei; Beal, Peter A; Nagatsugi, Fumi

    2017-04-01

    A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in order to carry out its functions. We have endeavored to prepare the covalently crosslinked native-like duplex RNA, which could be useful for biochemical studies and RNA nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in RNA. We measured melting temperatures and CD spectra to identify the properties of the VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic stability without disturbing the natural conformation of dsRNA. In addition, a competitive binding experiment with the duplex RNA binding enzyme, ADAR2, showed the crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural dsRNA, confirming that it has finely preserved the natural traits of duplex RNA.

  15. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex

    PubMed Central

    Ueda, Yu-mi; Zouzumi, Yu-ki; Maruyama, Atsushi; Nakano, Shu-ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    Abstract We systematically investigated effects of molecular crowding with trimethylamine N-oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences. PMID:27933115

  16. Free energy estimation of short DNA duplex hybridizations

    PubMed Central

    2010-01-01

    Background Estimation of DNA duplex hybridization free energy is widely used for predicting cross-hybridizations in DNA computing and microarray experiments. A number of software programs based on different methods and parametrizations are available for the theoretical estimation of duplex free energies. However, significant differences in free energy values are sometimes observed among estimations obtained with various methods, thus being difficult to decide what value is the accurate one. Results We present in this study a quantitative comparison of the similarities and differences among four published DNA/DNA duplex free energy calculation methods and an extended Nearest-Neighbour Model for perfect matches based on triplet interactions. The comparison was performed on a benchmark data set with 695 pairs of short oligos that we collected and manually curated from 29 publications. Sequence lengths range from 4 to 30 nucleotides and span a large GC-content percentage range. For perfect matches, we propose an extension of the Nearest-Neighbour Model that matches or exceeds the performance of the existing ones, both in terms of correlations and root mean squared errors. The proposed model was trained on experimental data with temperature, sodium and sequence concentration characteristics that span a wide range of values, thus conferring the model a higher power of generalization when used for free energy estimations of DNA duplexes under non-standard experimental conditions. Conclusions Based on our preliminary results, we conclude that no statistically significant differences exist among free energy approximations obtained with 4 publicly available and widely used programs, when benchmarked against a collection of 695 pairs of short oligos collected and curated by the authors of this work based on 29 publications. The extended Nearest-Neighbour Model based on triplet interactions presented in this work is capable of performing accurate estimations of free energies

  17. The F box protein partner of paired regulates stability of Drosophila centromeric histone H3, CenH3(CID).

    PubMed

    Moreno-Moreno, Olga; Medina-Giró, Sònia; Torras-Llort, Mònica; Azorín, Fernando

    2011-09-13

    Centromere identity and function is determined by the specific localization of CenH3 (reviewed in [1-7]). Several mechanisms regulate centromeric CenH3 localization, including proteasome-mediated degradation that, both in budding yeast and Drosophila, regulates CenH3 levels and prevents promiscuous misincorporation throughout chromatin [8, 9]. CenH3(CENP-A) proteolysis has also been reported in senescent human cells [10] or upon infection with herpes simplex virus 1 [11]. Little is known, however, about the actual mechanisms that regulate CenH3 proteolysis. Recent work in budding yeast identified Psh1 as an E3-ubiquitin ligase that mediates degradation of CenH3(Cse4p) [12, 13], but E3-ligases regulating CenH3 stability in metazoans are unknown. Here, we report that the F box protein partner of paired (Ppa), which is a variable subunit of the main E3-ligase SCF [14-17], mediates CenH3(CID) stability in Drosophila. Our results show that Ppa depletion results in increased CenH3(CID) levels. Ppa physically interacts with CenH3(CID) through the CATD(CID) that, in the fly, mediates Ppa-dependent CenH3(CID) stability. Altogether, these results strongly suggest that, in Drosophila, SCF(Ppa) regulates CenH3(CID) proteolysis. Interestingly, most known SCF complexes are inactive when, at mitosis, de novo CenH3(CID) deposition takes place at centromeres, suggesting that, in Drosophila, CenH3(CID) deposition and proteolysis are synchronized events.

  18. Dissecting the contributions of β-hairpin tyrosine pairs to the folding and stability of long-lived human γD-crystallins.

    PubMed

    Yang, Zaixing; Xia, Zhen; Huynh, Tien; King, Jonathan A; Zhou, Ruhong

    2014-01-01

    Ultraviolet-radiation-induced damage to and aggregation of human lens crystallin proteins are thought to be a significant pathway to age-related cataract. The aromatic residues within the duplicated Greek key domains of γ- and β-crystallins are the main ultraviolet absorbers and are susceptible to direct and indirect ultraviolet damage. The previous site-directed mutagenesis studies have revealed a striking difference for two highly conserved homologous β-hairpin Tyr pairs, at the N-terminal domain (N-td) and C-terminal domain (C-td), respectively, in their contribution to the overall stability of HγD-Crys, but why they behave so differently still remains a mystery. In this paper, we systematically investigated the underlying molecular mechanism and detailed contributions of these two Tyr pairs with large scale molecular dynamics simulations. A series of different tyrosine-to-alanine pair(s) substitutions were performed in either the N-td, the C-td, or both. Our results suggest that the Y45A/Y50A pair substitution in the N-td mainly affects the stability of the N-td itself, while the Y133A/Y138A pair substitution in the C-td leads to a more cooperative unfolding of both N-td and C-td. The stability of motif 2 in the N-td is mainly determined by the interdomain interface, while motif 1 in the N-td or motifs 3 and 4 in the C-td are mainly stabilized by the intradomain hydrophobic core. The damage to any tyrosine pair(s) can directly introduce some apparent water leakage to the hydrophobic core at the interface, which in turn causes a serious loss in the stability of the N-td. However, for the C-td substitutions, it may further impair the stable "sandwich-like" Y133-R167-Y138 cluster (through cation-π interactions) in the wild-type, thus causing the loop regions near the residue A138 to undergo large fluctuations, which in turn results in the intrusion of water into the hydrophobic core of the C-td and induces the C-td to lose its stability. These findings help

  19. DNA Duplex Engineering for Enantioselective Fluorescent Sensor.

    PubMed

    Hu, Yuehua; Lin, Fan; Wu, Tao; Zhou, Yufeng; Li, Qiusha; Shao, Yong; Xu, Zhiai

    2017-02-21

    The rapid identification of biomacromolecule structure that has a specific association with chiral enantiomers especially from natural sources will be helpful in developing enantioselective sensor and in speeding up drug exploitation. Herein, owing to its existence also in living cells, apurinic/apyrimidinic site (AP site) was first engineered into ds-DNA duplex to explore its competence in enantiomer selectivity. An AP site-specific fluorophore was utilized as an enantioselective discrimination probe to develop a straightforward chiral sensor using natural tetrahydropalmatine (L- and D-THP) as enantiomer representatives. We found that only L-THP can efficiently replace the prebound fluorophore to cause a significant fluorescence increase due to its specific binding with the AP site (two orders magnitude higher in affinity than binding with D-THP). The AP site binding specificity of L-THP over D-THP was assessed via intrinsic fluorescence, isothermal titration calorimetry, and DNA stability. The enantioselective performance can be easily tuned by the sequences near the AP site and the number of AP sites. A single AP site provides a perfect binding pocket to differentiate the chiral atom-induced structure discrepancy. We expect that our work will inspire interest in engineering local structures into a ds-DNA duplex for developing novel enantioselective sensors.

  20. Base-pairing energies of protonated nucleobase pairs and proton affinities of 1-methylated cytosines: model systems for the effects of the sugar moiety on the stability of DNA i-motif conformations.

    PubMed

    Yang, Bo; Moehlig, Aaron R; Frieler, C E; Rodgers, M T

    2015-02-05

    Expansion of (CCG)n·(CGG)n trinucleotide repeats leads to hypermethylation of cytosine residues and results in Fragile X syndrome, the most common cause of inherited intellectual disability in humans. The (CCG)n·(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical protonated nucleobase pairs of cytosine (C(+)·C). Previously, we investigated the effects of 5-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present work, we extend our investigations to include protonated homo- and heteronucleobase pairs of cytosine, 1-methylcytosine, 5-methylcytosine, and 1,5-dimethylcytosine. The 1-methyl substituent prevents most tautomerization processes of cytosine and serves as a mimic for the sugar moiety of DNA nucleotides. In contrast to permethylation of cytosine at the 5-position, 1-methylation is found to exert very little influence on the BPE. All modifications to both nucleobases lead to a small increase in the BPEs, with 5-methylation producing a larger enhancement than either 1-methyl or 1,5-dimethylation. In contrast, modifications to a single nucleobase are found to produce a small decrease in the BPEs, again with 5-methylation producing a larger effect than 1-methylation. However, the BPEs of all of the protonated nucleobase pairs examined here significantly exceed those of canonical G·C and neutral C·C base pairs, and thus should still provide the driving force stabilizing DNA i-motif conformations even in the presence of such modifications. The proton affinities of the methylated cytosines are also obtained from the TCID experiments by competitive analyses of the primary dissociation pathways that occur in parallel for the protonated heteronucleobase pairs.

  1. Oligonucleotide probes containing pyrimidine analogs reveal diminished hydrogen bonding capacity of the DNA adduct O⁶-methyl-G in DNA duplexes.

    PubMed

    Angelov, Todor; Dahlmann, Heidi A; Sturla, Shana J

    2013-10-15

    Oligonucleotide hybridization probes containing nucleoside analogs offer a potential strategy for binding specific DNA sequences that bear pro-mutagenic O(6)-G alkylation adducts. To optimize O(6)-Me-G-targeting probes, an understanding of how base pairs with O(6)-Me-G are stabilized is needed. In this study, we compared the ability of O(6)-Me-G and G to hydrogen bond with three pyrimidine-like nucleobases (Z, 4-thio-U, and 3-deaza-C) bearing varied hydrogen bond donor and acceptor groups. We found that duplexes containing the pyrimidine analog nucleoside:G pairs were more thermodynamically stable than those containing pyrimidine analog nucleoside:O(6)-alkyl-G pairs. Thus, hydrogen bonding alone was not sufficient to impart selectivity to probes that target O(6)-G alkylation adducts in DNA.

  2. Thermodynamic Consequences of the Hyperoxidized Guanine Lesion Guanidinohydantoin in Duplex DNA

    PubMed Central

    Yennie, Craig J.; Delaney, Sarah

    2012-01-01

    Guanidinohydantoin (Gh) is a hyperoxidized DNA lesion produced by oxidation of 8-oxo-7,8-dihydroguanine (8-oxoG). Previous work has shown that Gh is potently mutagenic both in vitro and in vivo coding for G → T and G → C transversion mutations. In this work, analysis by circular dichroism shows that the Gh lesion does not significantly alter the global structure of a 15-mer duplex, and that the DNA remains in the B-form. However, we find that Gh causes a large decrease in the thermal stability, decreasing the duplex melting temperature by ~ 17 °C relative to an unmodified duplex control. Using optical melting analysis and differential scanning calorimetry the thermodynamic parameters describing duplex melting were also determined. We find that the Gh lesion causes a dramatic decrease in the enthalpic stability of the duplex. This enthalpic destabilization is somewhat tempered by entropic stabilization yet Gh results in an overall decrease in thermodynamic stability of the duplex relative to a control which lacks DNA damage, with a ΔΔG° of −7 kcal/mol. These results contribute to our understanding of the consequences of hyperoxidation of G and provide insight into how the thermal and thermodynamic destabilization caused by Gh may influence replication and/or repair of the lesion. PMID:22780843

  3. Duplex evaluation of venous insufficiency.

    PubMed

    Labropoulos, Nicos; Leon, Luis R

    2005-03-01

    Duplex ultrasound is the most useful examination for the evaluation of venous valvular incompetence. Multi-frequency 4 to 7-MHz linear array transducers are typically used for this assessment of superficial and deep reflux. The examination is done with the patient standing and manual compression maneuvers are used to initiate reflux. Automatic rapid inflation and deflation cuffs may be used when a standard stimulus is needed. Cutoff values for reflux have been defined. Perforating veins must be identified and flow direction during compression recorded. When ulcers are present, duplex ultrasound is used to investigate veins of the ulcerated legs. Venous outflow obstruction is also studied by duplex ultrasound and chronic changes in deep and superficial veins following deep venous thrombosis noted. The main drawback in evaluation of chronic obstruction is inability to quantify hemodynamic significance. Anatomic variations in superficial and deep veins are common and their identification is necessary. Reporting results of duplex ultrasound studies must take into consideration the proper classification of venous disease as well as the new anatomic terms that have been accepted.

  4. NMR studies of DNA duplexes singly cross-linked by different synthetic linkers.

    PubMed Central

    Altmann, S; Labhardt, A M; Bur, D; Lehmann, C; Bannwarth, W; Billeter, M; Wüthrich, K; Leupin, W

    1995-01-01

    Molecular modelling studies resulted in the design of a variety of non-nucleotidic covalent linkers to bridge the 3'-end of the (+)-strand and the 5'-end of the (-)-strand in DNA duplexes. Three of these linkers were synthesized and used to prepare singly cross-linked duplexes d(GTGGAATTC)-linker-d(GAATTCCAC). Linker I is an assembly of a propylene-, a phosphate- and a second propylene-group and is thought to mimic the backbone of two nucleotides. Linkers II and III consist of five and six ethyleneglycol units, respectively. The melting temperatures of the cross-linked duplexes are 65 degrees C for I and 73 degrees C for II and III, as compared with 36 degrees C for the corresponding non-linked nonadeoxynucleotide duplex. The three cross-linked duplexes were structurally characterized by nuclear magnetic resonance spectroscopy. The 1H and 31P resonance assignments in the DNA stem were obtained using standard methods. For the resonance assignment of the linker protons, two-dimensional 1H-31P heteronuclear COSY and two-quantum-experiments were used. Distance geometry calculations with NOE-derived distance constraints were performed and the resulting structures were energy-minimized. In duplex I, the nucleotides flanking the propylene-phosphate-propylene-linker do not form a Watson-Crick base pair, whereas in duplexes II and III the entire DNA stem is in a B-type double helix conformation. Images PMID:8532525

  5. Water-evaporation reduction by duplex films: application to the human tear film.

    PubMed

    Cerretani, Colin F; Ho, Nghia H; Radke, C J

    2013-09-01

    Water-evaporation reduction by duplex-oil films is especially important to understand the physiology of the human tear film. Secreted lipids, called meibum, form a duplex film that coats the aqueous tear film and purportedly reduces tear evaporation. Lipid-layer deficiency is correlated with the occurrence of dry-eye disease; however, in-vitro experiments fail to show water-evaporation reduction by tear-lipid duplex films. We review the available literature on water-evaporation reduction by duplex-oil films and outline the theoretical underpinnings of spreading and evaporation kinetics that govern behavior of these systems. A dissolution-diffusion model unifies the data reported in the literature and identifies dewetting of duplex films into lenses as a key challenge to obtaining significant evaporation reduction. We develop an improved apparatus for measuring evaporation reduction by duplex-oil films including simultaneous assessment of film coverage, stability, and temperature, all under controlled external mass transfer. New data reported in this study fit into the larger body of work conducted on water-evaporation reduction by duplex-oil films. Duplex-oil films of oxidized mineral oil/mucin (MOx/BSM), human meibum (HM), and bovine meibum (BM) reduce water evaporation by a dissolution-diffusion mechanism, as confirmed by agreement between measurement and theory. The water permeability of oxidized-mineral-oil duplex films agrees with those reported in the literature, after correction for the presence of mucin. We find that duplex-oil films of bovine and human meibum at physiologic temperature reduce water evaporation only 6-8% for a 100-nm film thickness pertinent to the human tear film. Comparison to in-vivo human tear-evaporation measurements is inconclusive because evaporation from a clean-water surface is not measured and because the mass-transfer resistance is not characterized.

  6. The coupling between stability and ion pair formation in magnesium electrolytes from first-principles quantum mechanics and classical molecular dynamics.

    PubMed

    Rajput, Nav Nidhi; Qu, Xiaohui; Sa, Niya; Burrell, Anthony K; Persson, Kristin A

    2015-03-11

    In this work we uncover a novel effect between concentration dependent ion pair formation and anion stability at reducing potentials, e.g., at the metal anode. Through comprehensive calculations using both first-principles as well as well-benchmarked classical molecular dynamics over a matrix of electrolytes, covering solvents and salt anions with a broad range in chemistry, we elucidate systematic correlations between molecular level interactions and composite electrolyte properties, such as electrochemical stability, solvation structure, and dynamics. We find that Mg electrolytes are highly prone to ion pair formation, even at modest concentrations, for a wide range of solvents with different dielectric constants, which have implications for dynamics as well as charge transfer. Specifically, we observe that, at Mg metal potentials, the ion pair undergoes partial reduction at the Mg cation center (Mg(2+) → Mg(+)), which competes with the charge transfer mechanism and can activate the anion to render it susceptible to decomposition. Specifically, TFSI(-) exhibits a significant bond weakening while paired with the transient, partially reduced Mg(+). In contrast, BH4(-) and BF4(-) are shown to be chemically stable in a reduced ion pair configuration. Furthermore, we observe that higher order glymes as well as DMSO improve the solubility of Mg salts, but only the longer glyme chains reduce the dynamics of the ions in solution. This information provides critical design metrics for future electrolytes as it elucidates a close connection between bulk solvation and cathodic stability as well as the dynamics of the salt.

  7. Dissecting the contributions of β-hairpin tyrosine pairs to the folding and stability of long-lived human γD-crystallins

    NASA Astrophysics Data System (ADS)

    Yang, Zaixing; Xia, Zhen; Huynh, Tien; King, Jonathan A.; Zhou, Ruhong

    2014-01-01

    Ultraviolet-radiation-induced damage to and aggregation of human lens crystallin proteins are thought to be a significant pathway to age-related cataract. The aromatic residues within the duplicated Greek key domains of γ- and β-crystallins are the main ultraviolet absorbers and are susceptible to direct and indirect ultraviolet damage. The previous site-directed mutagenesis studies have revealed a striking difference for two highly conserved homologous β-hairpin Tyr pairs, at the N-terminal domain (N-td) and C-terminal domain (C-td), respectively, in their contribution to the overall stability of HγD-Crys, but why they behave so differently still remains a mystery. In this paper, we systematically investigated the underlying molecular mechanism and detailed contributions of these two Tyr pairs with large scale molecular dynamics simulations. A series of different tyrosine-to-alanine pair(s) substitutions were performed in either the N-td, the C-td, or both. Our results suggest that the Y45A/Y50A pair substitution in the N-td mainly affects the stability of the N-td itself, while the Y133A/Y138A pair substitution in the C-td leads to a more cooperative unfolding of both N-td and C-td. The stability of motif 2 in the N-td is mainly determined by the interdomain interface, while motif 1 in the N-td or motifs 3 and 4 in the C-td are mainly stabilized by the intradomain hydrophobic core. The damage to any tyrosine pair(s) can directly introduce some apparent water leakage to the hydrophobic core at the interface, which in turn causes a serious loss in the stability of the N-td. However, for the C-td substitutions, it may further impair the stable ``sandwich-like'' Y133-R167-Y138 cluster (through cation-π interactions) in the wild-type, thus causing the loop regions near the residue A138 to undergo large fluctuations, which in turn results in the intrusion of water into the hydrophobic core of the C-td and induces the C-td to lose its stability. These findings help

  8. Cavitation erosion of duplex and super duplex stainless steels

    SciTech Connect

    Kwok, C.T.; Man, H.C.; Cheng, F.T.

    1998-10-05

    Owing to their excellent corrosion resistance, stainless steels are widely used both in the marine, urban water, chemical and food industries. In addition to the corrosive environment, high fluid flow speeds are always encountered for components used in these industries. The cavitation characteristics of S30400 and S31600 austenitic stainless steels and duplex stainless steels were studied in detail by a number of authors. It was generally agreed that S30400 has higher cavitation erosion resistance than that of S31600 due to higher tendency of strain induced martensitic transformation under high impulse of stress. A considerable number of results on stress corrosion cracking characteristics of SDSS and duplex stainless steels have been published but data concerning their cavitation erosion property are extremely rare.

  9. A model for parallel triple helix formation by RecA: single-single association with a homologous duplex via the minor groove.

    PubMed

    Bertucat, G; Lavery, R; Prévost, C

    1998-12-01

    The nucleoproteic filaments of RecA polymerized on single stranded DNA are able to integrate double stranded DNA in a coaxial arrangement (with DNA stretched by a factor 1.5), to recognize homologous sequences in the duplex and to perform strand exchange between the single stranded and double stranded molecules. While experimental results favor the hypothesis of an invasion of the minor groove of the duplex by the single strand, parallel minor groove triple helices have never been isolated or even modeled, the minor groove offering little space for a third strand to interact. Based on an internal coordinate modeling study, we show here that such a structure is perfectly conceivable when the two interacting oligomers are stretched by a factor 1.5, in order to open the minor groove of the duplex. The model helix presents characteristics that coincide with known experimental data on unwinding, base pair inclination and inter-proton distances. Moreover, we show that extension and unwinding stabilize the triple helix. New patterns of triplet interaction via the minor groove are presented.

  10. Laser Safety Method For Duplex Open Loop Parallel Optical Link

    DOEpatents

    Baumgartner, Steven John; Hedin, Daniel Scott; Paschal, Matthew James

    2003-12-02

    A method and apparatus are provided to ensure that laser optical power does not exceed a "safe" level in an open loop parallel optical link in the event that a fiber optic ribbon cable is broken or otherwise severed. A duplex parallel optical link includes a transmitter and receiver pair and a fiber optic ribbon that includes a designated number of channels that cannot be split. The duplex transceiver includes a corresponding transmitter and receiver that are physically attached to each other and cannot be detached therefrom, so as to ensure safe, laser optical power in the event that the fiber optic ribbon cable is broken or severed. Safe optical power is ensured by redundant current and voltage safety checks.

  11. Thermodynamic profiles and nuclear magnetic resonance studies of oligonucleotide duplexes containing single diastereomeric spiroiminodihydantoin lesions.

    PubMed

    Khutsishvili, Irine; Zhang, Na; Marky, Luis A; Crean, Conor; Patel, Dinshaw J; Geacintov, Nicholas E; Shafirovich, Vladimir

    2013-02-26

    The spiroiminodihydantoins (Sp) are highly mutagenic oxidation products of guanine and 8-oxo-7,8-dihydroguanine in DNA. The Sp lesions have recently been detected in the liver and colon of mice infected with Helicobacter hepaticus that induces inflammation and the development of liver and colon cancers in murine model systems [Mangerich, A., et al. (2012) Proc. Natl. Acad. Sci. U.S.A. 109, E1820-E1829]. The impact of Sp lesions on the thermodynamic characteristics and the effects of the diastereomeric Sp-R and Sp-S lesions on the conformational features of double-stranded 11-mer oligonucleotide duplexes have been studied by a combination of microcalorimetric methods, analysis of DNA melting curves, and two-dimensional nuclear magnetic resonance methods. The nonplanar, propeller-like shapes of the Sp residues strongly diminish the extent of local base stacking interactions that destabilize the DNA duplexes characterized by unfavorable enthalpy contributions. Relative to that of an unmodified duplex, the thermally induced unfolding of the duplexes with centrally positioned Sp-R and Sp-S lesions into single strands is accompanied by a smaller release of cationic counterions (Δn(Na⁺) = 0.6 mol of Na⁺/mol of duplex) and water molecules (Δn(w) = 17 mol of H₂O/mol of duplex). The unfolding parameters are similar for the Sp-R and Sp-S lesions, although their orientations in the duplexes are different. The structural disturbances radiate one base pair beyond the flanking C:G pair, although Watson-Crick hydrogen bonding is maintained at all flanking base pairs. The observed relatively strong destabilization of B-form DNA by the physically small Sp lesions is expected to have a significant impact on the processing of these lesions in biological environments.

  12. ESI-MS Investigation of an Equilibrium between a Bimolecular Quadruplex DNA and a Duplex DNA/RNA Hybrid

    NASA Astrophysics Data System (ADS)

    Birrento, Monica L.; Bryan, Tracy M.; Samosorn, Siritron; Beck, Jennifer L.

    2015-07-01

    Electrospray ionization mass spectrometry (ESI-MS) conditions were optimized for simultaneous observation of a bimolecular qDNA and a Watson-Crick base-paired duplex DNA/RNA hybrid. The DNA sequence used was telomeric DNA, and the RNA contained the template for telomerase-mediated telomeric DNA synthesis. Addition of RNA to the quadruplex DNA (qDNA) resulted in formation of the duplex DNA/RNA hybrid. Melting profiles obtained using circular dichroism spectroscopy confirmed that the DNA/RNA hybrid exhibited greater thermal stability than the bimolecular qDNA in solution. Binding of a 13-substituted berberine ( 1) derivative to the bimolecular qDNA stabilized its structure as evidenced by an increase in its stability in the mass spectrometer, and an increase in its circular dichroism (CD) melting temperature of 10°C. The DNA/RNA hybrid did not bind the ligand extensively and its thermal stability was unchanged in the presence of ( 1). The qDNA-ligand complex resisted unfolding in the presence of excess RNA, limiting the formation of the DNA/RNA hybrid. Previously, it has been proposed that DNA secondary structures, such as qDNA, may be involved in the telomerase mechanism. DNA/RNA hybrid structures occur at the active site of telomerase. The results presented in the current work show that if telomeric DNA was folded into a qDNA structure, it is possible for a DNA/RNA hybrid to form as is required during template alignment. The discrimination of ligand ( 1) for binding to the bimolecular qDNA over the DNA/RNA hybrid positions it as a useful compound for probing the role(s), if any, of antiparallel qDNA in the telomerase mechanism.

  13. Imp3p and Imp4p mediate formation of essential U3–precursor rRNA (pre-rRNA) duplexes, possibly to recruit the small subunit processome to the pre-rRNA

    PubMed Central

    Gérczei, Tímea; Correll, Carl C.

    2004-01-01

    In eukaryotes, formation of short duplexes between the U3 small nucleolar RNA (snoRNA) and the precursor rRNA (pre-rRNA) at multiple sites is a prerequisite for three endonucleolytic cleavages that initiate small subunit biogenesis by releasing the 18S rRNA precursor from the pre-rRNA. The most likely role of these RNA duplexes is to guide the U3 snoRNA and its associated proteins, designated the small subunit processome, to the target cleavage sites on the pre-rRNA. Studies by others in Saccharomyces cerevisiae have identified the proteins Mpp10p, Imp3p, and Imp4p as candidates to mediate U3–pre-rRNA interactions. We report here that Imp3p and Imp4p appear to stabilize an otherwise unstable duplex between the U3 snoRNA hinge region and complementary bases in the external transcribed spacer of the pre-rRNA. In addition, Imp4p, but not Imp3p, seems to rearrange the U3 box A stem structure to expose the site that base-pairs with the 5′ end of the 18S rRNA, thereby mediating duplex formation at a second site. By mediating formation of both essential U3–pre-rRNA duplexes, Imp3p and Imp4p may help the small subunit processome to dock onto the pre-rRNA, an event indispensable for ribosome biogenesis and hence for cell growth. PMID:15489263

  14. The coupling between stability and ion pair formation in magnesium electrolytes from first-principles quantum mechanics and classical molecular dynamics

    DOE PAGES

    Rajput, Nav Nidhi; Qu, Xiaohuui; Sa, Niya; ...

    2015-02-10

    Here in this work we uncover a novel effect between concentration dependent ion pair formation and anion stability at reducing potentials, e.g., at the metal anode. Through comprehensive calculations using both first-principles as well as well-benchmarked classical molecular dynamics over a matrix of electrolytes, covering solvents and salt anions with a broad range in chemistry, we elucidate systematic correlations between molecular level interactions and composite electrolyte properties, such as electrochemical stability, solvation structure, and dynamics. We find that Mg electrolytes are highly prone to ion pair formation, even at modest concentrations, for a wide range of solvents with different dielectricmore » constants, which have implications for dynamics as well as charge transfer. Specifically, we observe that, at Mg metal potentials, the ion pair undergoes partial reduction at the Mg cation center (Mg2+ -> Mg+), which competes with the charge transfer mechanism and can activate the anion to render it susceptible to decomposition. Specifically, TFSI exhibits a significant bond weakening while paired with the transient, partially reduced Mg+. In contrast, BH4$-$ and BF4$-$ are shown to be chemically stable in a reduced ion pair configuration. Furthermore, we observe that higher order glymes as well as DMSO improve the solubility of Mg salts, but only the longer glyme chains reduce the dynamics of the ions in solution. This information provides critical design metrics for future electrolytes as it elucidates a close connection between bulk solvation and cathodic stability as well as the dynamics of the salt.« less

  15. The coupling between stability and ion pair formation in magnesium electrolytes from first-principles quantum mechanics and classical molecular dynamics

    SciTech Connect

    Rajput, Nav Nidhi; Qu, Xiaohuui; Sa, Niya; Burrell, Anthony K.; Persson, Kristin A.

    2015-02-10

    Here in this work we uncover a novel effect between concentration dependent ion pair formation and anion stability at reducing potentials, e.g., at the metal anode. Through comprehensive calculations using both first-principles as well as well-benchmarked classical molecular dynamics over a matrix of electrolytes, covering solvents and salt anions with a broad range in chemistry, we elucidate systematic correlations between molecular level interactions and composite electrolyte properties, such as electrochemical stability, solvation structure, and dynamics. We find that Mg electrolytes are highly prone to ion pair formation, even at modest concentrations, for a wide range of solvents with different dielectric constants, which have implications for dynamics as well as charge transfer. Specifically, we observe that, at Mg metal potentials, the ion pair undergoes partial reduction at the Mg cation center (Mg2+ -> Mg+), which competes with the charge transfer mechanism and can activate the anion to render it susceptible to decomposition. Specifically, TFSI exhibits a significant bond weakening while paired with the transient, partially reduced Mg+. In contrast, BH4$-$ and BF4$-$ are shown to be chemically stable in a reduced ion pair configuration. Furthermore, we observe that higher order glymes as well as DMSO improve the solubility of Mg salts, but only the longer glyme chains reduce the dynamics of the ions in solution. This information provides critical design metrics for future electrolytes as it elucidates a close connection between bulk solvation and cathodic stability as well as the dynamics of the salt.

  16. Smectic phase in suspensions of gapped DNA duplexes

    NASA Astrophysics Data System (ADS)

    Salamonczyk, Miroslaw; Zhang, Jing; Portale, Giuseppe; Zhu, Chenhui; Kentzinger, Emmanuel; Gleeson, James T.; Jakli, Antal; de Michele, Cristiano; Dhont, Jan K. G.; Sprunt, Samuel; Stiakakis, Emmanuel

    2016-11-01

    Smectic ordering in aqueous solutions of monodisperse stiff double-stranded DNA fragments is known not to occur, despite the fact that these systems exhibit both chiral nematic and columnar mesophases. Here, we show, unambiguously, that a smectic-A type of phase is formed by increasing the DNA's flexibility through the introduction of an unpaired single-stranded DNA spacer in the middle of each duplex. This is unusual for a lyotropic system, where flexibility typically destabilizes the smectic phase. We also report on simulations suggesting that the gapped duplexes (resembling chain-sticks) attain a folded conformation in the smectic layers, and argue that this layer structure, which we designate as smectic-fA phase, is thermodynamically stabilized by both entropic and energetic contributions to the system's free energy. Our results demonstrate that DNA as a building block offers an exquisitely tunable means to engineer a potentially rich assortment of lyotropic liquid crystals.

  17. Smectic phase in suspensions of gapped DNA duplexes

    PubMed Central

    Salamonczyk, Miroslaw; Zhang, Jing; Portale, Giuseppe; Zhu, Chenhui; Kentzinger, Emmanuel; Gleeson, James T.; Jakli, Antal; De Michele, Cristiano; Dhont, Jan K. G.; Sprunt, Samuel; Stiakakis, Emmanuel

    2016-01-01

    Smectic ordering in aqueous solutions of monodisperse stiff double-stranded DNA fragments is known not to occur, despite the fact that these systems exhibit both chiral nematic and columnar mesophases. Here, we show, unambiguously, that a smectic-A type of phase is formed by increasing the DNA's flexibility through the introduction of an unpaired single-stranded DNA spacer in the middle of each duplex. This is unusual for a lyotropic system, where flexibility typically destabilizes the smectic phase. We also report on simulations suggesting that the gapped duplexes (resembling chain-sticks) attain a folded conformation in the smectic layers, and argue that this layer structure, which we designate as smectic-fA phase, is thermodynamically stabilized by both entropic and energetic contributions to the system's free energy. Our results demonstrate that DNA as a building block offers an exquisitely tunable means to engineer a potentially rich assortment of lyotropic liquid crystals. PMID:27845332

  18. Experience with duplex bearings in narrow angle oscillating applications

    NASA Technical Reports Server (NTRS)

    Phinney, D. D.; Pollard, C. L.; Hinricks, J. T.

    1988-01-01

    Duplex ball bearings are matched pairs on which the abutting faces of the rings have been accurately ground so that when the rings are clamped together, a controlled amount of interference (preload) exists across the balls. These bearings are vulnerable to radial temperature gradients, blocking in oscillation and increased sensitivity to contamination. These conditions decrease the service life of these bearings. It was decided that an accelerated thermal vacuum life test should be conducted. The test apparatus and results are described and the rationale is presented for reducing a multiyear life test on oil lubricated bearings to less than a year.

  19. A crystallographic study of the binding of 13 metal ions to two related RNA duplexes

    PubMed Central

    Ennifar, Eric; Walter, Philippe; Dumas, Philippe

    2003-01-01

    Metal ions, and magnesium in particular, are known to be involved in RNA folding by stabilizing secondary and tertiary structures, and, as cofactors, in RNA enzymatic activity. We have conducted a systematic crystallographic analysis of cation binding to the duplex form of the HIV-1 RNA dimerization initiation site for the subtype-A and -B natural sequences. Eleven ions (K+, Pb2+, Mn2+, Ba2+, Ca2+, Cd2+, Sr2+, Zn2+, Co2+, Au3+ and Pt4+) and two hexammines [Co (NH3)6]3+ and [Ru (NH3)6]3+ were found to bind to the DIS duplex structure. Although the two sequences are very similar, strong differences were found in their cation binding properties. Divalent cations bind almost exclusively, as Mg2+, at ‘Hoogsteen’ sites of guanine residues, with a cation-dependent affinity for each site. Notably, a given cation can have very different affinities for a priori equivalent sites within the same molecule. Surprisingly, none of the two hexammines used were able to efficiently replace hexahydrated magnesium. Instead, [Co (NH3)4]3+ was seen bound by inner-sphere coordination to the RNA. This raises some questions about the practical use of [Co (NH3)6]3+ as a [Mg (H2O)6]2+ mimetic. Also very unexpected was the binding of the small Au3+ cation exactly between the Watson–Crick sites of a G-C base pair after an obligatory deprotonation of N1 of the guanine base. This extensive study of metal ion binding using X-ray crystallography significantly enriches our knowledge on the binding of middleweight or heavy metal ions to RNA, particularly compared with magnesium. PMID:12736317

  20. Base pairing between hepatitis C virus RNA and microRNA 122 3' of its seed sequence is essential for genome stabilization and production of infectious virus.

    PubMed

    Shimakami, Tetsuro; Yamane, Daisuke; Welsch, Christoph; Hensley, Lucinda; Jangra, Rohit K; Lemon, Stanley M

    2012-07-01

    MicroRNA 122 (miR-122) facilitates hepatitis C virus (HCV) replication by recruiting an RNA-induced silencing complex (RISC)-like complex containing argonaute 2 (Ago2) to the 5' end of the HCV genome, thereby stabilizing the viral RNA. This requires base pairing between the miR-122 "seed sequence" (nucleotides [nt] 2 to 8) and two sequences near the 5' end of the HCV RNA: S1 (nt 22 to 28) and S2 (nt 38 to 43). However, recent reports suggest that additional base pair interactions occur between HCV RNA and miR-122. We searched 606 sequences from a public database (genotypes 1 to 6) and identified two conserved, putatively single-stranded RNA segments, upstream of S1 (nt 2 and 3) and S2 (nt 30 to 34), with potential for base pairing to miR-122 (nt 15 and 16 and nt 13 to 16, respectively). Mutagenesis and genetic complementation experiments confirmed that HCV nt 2 and 3 pair with nt 15 and 16 of miR-122 bound to S1, while HCV nt 30 to 33 pair with nt 13 to 16 of miR-122 at S2. In genotype 1 and 6 HCV, nt 4 also base pairs with nt 14 of miR-122. These 3' supplementary base pair interactions of miR-122 are functionally important and are required for Ago2 recruitment to HCV RNA by miR-122, miR-122-mediated stabilization of HCV RNA, and production of infectious virus. However, while complementary mutations at HCV nt 30 and 31 efficiently rescued the activity of a 15C,16C miR-122 mutant targeting S2, similar mutations at nt 2 and 3 failed to rescue Ago2 recruitment at S1. These data add to the current understanding of miR-122 interactions with HCV RNA but indicate that base pairing between miR-122 and the 5' 43 nt of the HCV genome is more complex than suggested by existing models.

  1. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  2. Phase Transformations in Cast Duplex Stainless Steels

    SciTech Connect

    Kim, Yoon-Jun

    2004-01-01

    Duplex stainless steels (DSS) constitute both ferrite and austenite as a matrix. Such a microstructure confers a high corrosion resistance with favorable mechanical properties. However, intermetallic phases such as σ and χ can also form during casting or high-temperature processing and can degrade the properties of the DSS. This research was initiated to develop time-temperature-transformation (TTT) and continuous-cooling-transformation (CCT) diagrams of two types of cast duplex stainless steels, CD3MN (Fe-22Cr-5Ni-Mo-N) and CD3MWCuN (Fe-25Cr-7Ni-Mo-W-Cu-N), in order to understand the time and temperature ranges for intermetallic phase formation. The alloys were heat treated isothermally or under controlled cooling conditions and then characterized using conventional metallographic methods that included tint etching, and also using electron microscopy (SEM, TEM) and wavelength dispersive spectroscopy (WDS). The kinetics of intermetallic-phase (σ + χ) formation were analyzed using the Johnson-Mehl-Avrami (MA) equation in the case of isothermal transformations and a modified form of this equation in the case of continuous cooling transformations. The rate of intermetallic-phase formation was found to be much faster in CD3MWCuN than CD3MN due mainly to differences in the major alloying contents such as Cr, Ni and Mo. To examine in more detail the effects of these elements of the phase stabilities; a series of eight steel castings was designed with the Cr, Ni and Mo contents systematically varied with respect to the nominal composition of CD3MN. The effects of varying the contents of alloying additions on the formation of intermetallic phases were also studied computationally using the commercial thermodynamic software package, Thermo-Calc. In general, σ was stabilized with increasing Cr addition and χ by increasing Mo addition. However, a delicate balance among Ni and other minor elements such as N and Si also exists. Phase equilibria in DSS can be affected by

  3. Alternative strategy for adjusting the association specificity of hydrogen-bonded duplexes.

    PubMed

    Zhang, Penghui; Chu, Hongzhu; Li, Xianghui; Feng, Wen; Deng, Pengchi; Yuan, Lihua; Gong, Bing

    2011-01-07

    A strategy for creating new association specificity of hydrogen-bonded duplexes by varying the spacings between neighboring hydrogen bonds is described. Incorporation of naphthalene-based residues has provided oligoamide strands that pair into duplexes sharing the same H-bonding sequences (e.g., DDAA) but differing in the spacings between their intermolecular hydrogen bonds, leading to homo- or heteroduplexes. The ability to manipulate association-specificity as demonstrated by this work may be extended to other multiple hydrogen bonded systems, thereby further enhancing the diversity of multiple hydrogen-bonded association units for constructing supramolecular structures.

  4. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    PubMed

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  5. Duplex Direct Data Distribution System

    NASA Technical Reports Server (NTRS)

    Greenfield, Israel (Technical Monitor)

    2001-01-01

    The NASA Glenn Research Center (GRC) is developing and demonstrating communications and network technologies that are helping to enable the near-Earth space Internet. GRC envisions several service categories. The first of these categories is direct data distribution or D3 (pronounced "D-cubed"). Commercially provided D3 will make it possible to download a data set from a spacecraft, like the International Space Station. as easily as one can extract a file from a remote server today, using a file transfer protocol. In a second category, NASA spacecraft will make use of commercial satellite communication (SATCOM) systems. Some of those services will come from purchasing time on unused transponders that cover landmasses. While it is likely there will be gaps in service coverage, Internet services should be available using these systems. This report addresses alternative methods of implementing a full duplex enhancement of the GRC developed experimental Ka-Band Direct Data Distribution (D3) space-to-ground communication link. The resulting duplex version is called the Duplex Direct Data Distribution (D4) system. The D4 system is intended to provide high-data-rate commercial direct or internet-based communications service between the NASA spacecraft in low earth orbit (LEO) and the respective principal investigators associated with these spacecraft. Candidate commercial services were assessed regarding their near-term potential to meet NASA requirements. Candidates included Ka-band and V-band geostationary orbit and non-geostationary orbit satellite relay services and direct downlink ("LEO teleport") services. End-to-end systems concepts were examined and characterized in terms of alternative link layer architectures. Alternatives included a Direct Link, a Relay Link, a Hybrid Link, and a Dual Mode Link. The direct link assessment examined sample ground terminal placements and antenna angle issues. The SATCOM-based alternatives examined existing or proposed commercial

  6. Structural, Dynamical, and Electronic Transport Properties of Modified DNA Duplexes Containing Size-Expanded Nucleobases

    SciTech Connect

    Fuentes-Cabrera, Miguel A; Orozco, Modesto; Luque, Javier; Sumpter, Bobby G; Blas, Jose; Ordejon, Pablo J; Huertas, Oscar; Tabares, Carolina

    2011-01-01

    Among the distinct strategies proposed to expand the genetic alphabet, sizeexpanded nucleobases are promising for the development of modified DNA duplexes with improved biotechnological properties. In particular, duplexes built up by replacing canonical bases with the corresponding benzo-fused counterparts could be valuable as molecular nanowires. In this context, this study reports the results of classical molecular dynamics simulations carried out to examine the structural and dynamical features of size-expanded DNAs, including both hybrid duplexes containing mixed pairs of natural and benzo-fused bases (xDNA) and pure size-expanded (xxDNA) duplexes. Furthermore, the electronic structure of both natural and size-expanded duplexes is examined by means of density functional computations. The results confirm that the structural and flexibility properties of the canonical DNA are globally little affected by the presence of benzo-fused bases. Themost relevant differences are found in the enhanced size of the grooves, and the reduction in the twist. However, the analysis also reveals subtle structural effects related to the nature and sequence of benzo-fused bases in the duplex. On the other hand, electronic structure calculations performed for xxDNAs confirm the reduction in the HOMOLUMO gap predicted from the analysis of the natural bases and their size-expanded counterparts, which suggests that pure size-expanded DNAs can be good conductors. A more complex situation is found for xDNAs, where fluctuations in the electrostatic interaction between base pairs exerts a decisive influence on the modulation of the energy gap.

  7. Fluorescence Turn-On Sensing of DNA Duplex Formation by a Tricyclic Cytidine Analogue.

    PubMed

    Burns, Dillon D; Teppang, Kristine L; Lee, Raymond W; Lokensgard, Melissa E; Purse, Byron W

    2017-02-01

    Most fluorescent nucleoside analogues are quenched when base stacked and some maintain their brightness, but there has been little progress toward developing nucleoside analogues that markedly increase their fluorescence upon duplex formation. Here, we report on the design and synthesis of a new tricyclic cytidine analogue, 8-diethylamino-tC (8-DEA-tC), that responds to DNA duplex formation with up to a 20-fold increase in fluorescent quantum yield as compared with the free nucleoside, depending on neighboring bases. This turn-on response to duplex formation is the greatest of any reported nucleoside analogue that can participate in Watson-Crick base pairing. Measurements of the quantum yield of 8-DEA-tC mispaired with adenosine and, separately, opposite an abasic site show that there is almost no fluorescence increase without the formation of correct Watson-Crick hydrogen bonds. Kinetic isotope effects from the use of deuterated buffer show that the duplex protects 8-DEA-tC against quenching by excited state proton transfer. These results, supported by DFT calculations, suggest a rationale for the observed photophysical properties that is dependent on duplex integrity and the electronic structure of the analogue.

  8. Fluorescence Turn-On Sensing of DNA Duplex Formation by a Tricyclic Cytidine Analogue

    PubMed Central

    Burns, Dillon D.; Teppang, Kristine L.; Lee, Raymond W.; Lokensgard, Melissa E.; Purse, Byron W.

    2017-01-01

    Most fluorescent nucleoside analogues are quenched when base stacked and some maintain their brightness, but there has been little progress toward developing nucleoside analogues that markedly increase their fluorescence upon duplex formation. Here, we report on the design and synthesis of a new tricyclic cytidine analogue, 8-diethylamino-tC (8-DEA-tC), that responds to DNA duplex formation with up to a 20-fold increase in fluorescent quantum yield as compared with the free nucleoside, depending on neighboring bases. This turn-on response to duplex formation is the greatest of any reported nucleoside analogue that can participate in Watson–Crick base pairing. Measurements of the quantum yield of 8-DEA-tC mispaired with adenosine and, separately, opposite an abasic site show that there is almost no fluorescence increase without the formation of correct Watson–Crick hydrogen bonds. Kinetic isotope effects from the use of deuterated buffer show that the duplex protects 8-DEA-tC against quenching by excited state proton transfer. These results, supported by DFT calculations, suggest a rationale for the observed photophysical properties that is dependent on duplex integrity and the electronic structure of the analogue. PMID:28080035

  9. Contiguous metal-mediated base pairs comprising two Ag(I) ions.

    PubMed

    Megger, Dominik A; Guerra, Célia Fonseca; Hoffmann, Jan; Brutschy, Bernhard; Bickelhaupt, F Matthias; Müller, Jens

    2011-05-27

    The incorporation of transition-metal ions into nucleic acids by using metal-mediated base pairs has proved to be a promising strategy for the site-specific functionalization of these biomolecules. We report herein the formation of Ag(+)-mediated Hoogsteen-type base pairs comprising 1,3-dideaza-2'-deoxyadenosine and thymidine. By defunctionalizing the Watson-Crick edge of adenine, the formation of regular base pairs is prohibited. The additional substitution of the N3 nitrogen atom of adenine by a methine moiety increases the basicity of the exocyclic amino group. Hence, 1,3-dideazaadenine and thymine are able to incorporate two Ag(+) ions into their Hoogsteen-type base pair (as compared with one Ag(+) ion in base pairs with 1-deazaadenine and thymine). We show by using a combination of experimental techniques (UV and circular dichroism (CD) spectroscopies, dynamic light scattering, and mass spectrometry) that this type of base pair is compatible with different sequence contexts and can be used contiguously in DNA double helices. The most stable duplexes were observed when using a sequence containing alternating purine and pyrimidine nucleosides. Dispersion-corrected density functional theory calculations have been performed to provide insight into the structure, formation and stabilization of the twofold metalated base pair. They revealed that the metal ions within a base pair are separated by an Ag···Ag distance of about 2.88 Å. The Ag-Ag interaction contributes some 16 kcal mol(-1) to the overall stability of the doubly metal-mediated base pair, with the dominant contribution to the Ag-Ag bonding resulting from a donor-acceptor interaction between silver 4d-type and 4s orbitals. These Hoogsteen-type base pairs enable a higher functionalization of nucleic acids with metal ions than previously reported metal-mediated base pairs, thereby increasing the potential of DNA-based nanotechnology.

  10. Influence of buffer species on the thermodynamics of short DNA duplex melting: sodium phosphate versus sodium cacodylate.

    PubMed

    Alemayehu, Saba; Fish, Daniel J; Brewood, Greg P; Horne, M Todd; Manyanga, Fidelis; Dickman, Rebekah; Yates, Ian; Benight, Albert S

    2009-03-05

    Thermodynamic parameters of the melting transitions of 53 short duplex DNAs were experimentally evaluated by differential scanning calorimetry melting curve analysis. Solvents for the DNA solutions contained approximately 1 M Na+ and either 10 mM cacodylate or phosphate buffer. Thermodynamic parameters obtained in the two solvent environments were compared and quantitatively assessed. Thermodynamic stabilities (deltaG(o) (25 degrees C)) of the duplexes studied ranged from quite stable perfect match duplexes (approximately -30 kcal/mol) to relatively unstable mismatch duplexes (approximately -9 kcal/mol) and ranged in length from 18 to 22 basepairs. A significant difference in stability (average free energy difference of approximately 3 kcal/mol) was found for all duplexes melted in phosphate (greater stability) versus cacodylate buffers. Measured effects of buffer species appear to be relatively unaffected by duplex length or sequence content. The popular sets of published nearest-neighbor (n-n) stability parameters for Watson-Crick (w/c) and single-base mismatches were evaluated from melting studies performed in cacodylate buffer (SantaLucia and Hicks, Annu. Rev. Biophys. Biomol. Struct. 2004, 33, 415). Thus, when using these parameters to make predictions of sequence dependent stability of DNA oligomers in buffers other than cacodylate (e.g., phosphate) one should be mindful that in addition to sodium ion concentration, the type of buffer species also provides a minor but significant contribution to duplex stability. Such considerations could potentially influence results of sequence dependent analysis using published n-n parameters and impact results of thermodynamic calculations. Such calculations and analyses are typically employed in the design and interpretation of DNA multiplex hybridization experiments.

  11. PCR hot-start using duplex primers.

    PubMed

    Kong, Deming; Shen, Hanxi; Huang, Yanping; Mi, Huaifeng

    2004-02-01

    A new technique of PCR hot-start using duplex primers has been developed which can decrease the undesirable products arising throughout PCR amplification thereby giving better results than a manual hot-start method.

  12. A new general model for predicting melting thermodynamics of complementary and mismatched B-form duplexes containing locked nucleic acids: application to probe design for digital PCR detection of somatic mutations.

    PubMed

    Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles

    2015-02-17

    Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a

  13. Kinetic Monte Carlo Investigation of the Effects of Vacancy Pairing on Oxygen Diffusivity in Yttria-Stabilized Zirconia

    NASA Technical Reports Server (NTRS)

    Good, Brian S.

    2011-01-01

    Yttria-stabilized zirconia s high oxygen diffusivity and corresponding high ionic conductivity, and its structural stability over a broad range of temperatures, have made the material of interest for use in a number of applications, for example, as solid electrolytes in fuel cells. At low concentrations, the stabilizing yttria also serves to increase the oxygen diffusivity through the presence of corresponding oxygen vacancies, needed to maintain charge neutrality. At higher yttria concentration, however, diffusivity is impeded by the larger number of relatively high energy migration barriers associated with yttrium cations. In addition, there is evidence that oxygen vacancies preferentially occupy nearest-neighbor sites around either dopant or Zr cations, further affecting vacancy diffusion. We present the results of ab initio calculations that indicate that it is energetically favorable for oxygen vacancies to occupy nearest-neighbor sites adjacent to Y ions, and that the presence of vacancies near either species of cation lowers the migration barriers. Kinetic Monte Carlo results from simulations incorporating this effect are presented and compared with results from simulations in which the effect is not present.

  14. Base-pairing energies of proton-bound heterodimers of cytosine and modified cytosines: implications for the stability of DNA i-motif conformations.

    PubMed

    Yang, Bo; Rodgers, M T

    2014-01-08

    The DNA i-motif conformation was discovered in (CCG)•(CGG)n trinucleotide repeats, which are associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The DNA i-motif is a four-stranded structure whose strands are held together by proton-bound dimers of cytosine (C(+)•C). The stronger base-pairing interactions in C(+)•C proton-bound dimers as compared to Watson-Crick G•C base pairs are the major forces responsible for stabilization of i-motif conformations. Methylation of cytosine results in silencing of the FMR1 gene and causes fragile X syndrome. However, the influence of methylation or other modifications such as halogenation of cytosine on the base-pairing energies (BPEs) in the i-motif remains elusive. To address this, proton-bound heterodimers of cytosine and 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, and 5-iodocytosine are probed in detail. Experimentally, the BPEs of proton-bound heterodimers of cytosine and modified cytosines are determined using threshold collision-induced dissociation (TCID) techniques. All modifications at the 5-position of cytosine are found to lower the BPE and therefore would tend to destabilize DNA i-motif conformations. However, the BPEs in these proton-bound heterodimers still significantly exceed those of the Watson-Crick G•C and neutral C•C base pairs, suggesting that C(+)•C mismatches are still energetically favored such that i-motif conformations are preserved. Excellent agreement between TCID measured BPEs and B3LYP calculated values is found with the def2-TZVPPD and 6-311+G(2d,2p) basis sets, suggesting that calculations at these levels of theory can be employed to provide reliable energetic predictions for related systems.

  15. Duplex sampling apparatus and method

    DOEpatents

    Brown, Paul E.; Lloyd, Robert

    1992-01-01

    An improved apparatus is provided for sampling a gaseous mixture and for measuring mixture components. The apparatus includes two sampling containers connected in series serving as a duplex sampling apparatus. The apparatus is adapted to independently determine the amounts of condensable and noncondensable gases in admixture from a single sample. More specifically, a first container includes a first port capable of selectively connecting to and disconnecting from a sample source and a second port capable of selectively connecting to and disconnecting from a second container. A second container also includes a first port capable of selectively connecting to and disconnecting from the second port of the first container and a second port capable of either selectively connecting to and disconnecting from a differential pressure source. By cooling a mixture sample in the first container, the condensable vapors form a liquid, leaving noncondensable gases either as free gases or dissolved in the liquid. The condensed liquid is heated to drive out dissolved noncondensable gases, and all the noncondensable gases are transferred to the second container. Then the first and second containers are separated from one another in order to separately determine the amount of noncondensable gases and the amount of condensable gases in the sample.

  16. A macrocyclic bis-acridine shifts the equilibrium from duplexes towards DNA hairpins.

    PubMed Central

    Slama-Schwok, A; Peronnet, F; Hantz-Brachet, E; Taillandier, E; Teulade-Fichou, M P; Vigneron, J P; Best-Belpomme, M; Lehn, J M

    1997-01-01

    Nucleic acids can undergo dynamic conformational changes associated with the regulation of biological processes. A molecule presenting larger affinities for alternative structures relative to a duplex is expected to modify such conformational equilibria. We have previously reported that macrocyclic bis-acridine binds preferentially to single-stranded regions, especially DNA hairpins, due to steric effects. Here, we show, using gel electrophoresis, fluorescence and melting temperature experiments, that the macrocycle bis-acridine shifts an equilibrium from a duplex towards the corresponding hairpins. Competition experiments enlighten the higher affinity of the macrocycle for hairpins compared with double-stranded DNA. The macrocycle bis-acridine destabilizes a synthetic polynucleotide, by the formation of premelted areas. By extrapolation, the macrocycle bis-acridine should be able to disrupt, at least locally, genomic DNA duplexes and to stabilize unpaired areas, especially palindromic ones forming hairpins. Such macrocyclic compounds may have potential applications in the therapy of diseases involving hairpins. PMID:9185566

  17. Different duplex/quadruplex junctions determine the properties of anti-thrombin aptamers with mixed folding.

    PubMed

    Russo Krauss, Irene; Spiridonova, Vera; Pica, Andrea; Napolitano, Valeria; Sica, Filomena

    2016-01-29

    Mixed duplex/quadruplex oligonucleotides have attracted great interest as therapeutic targets as well as effective biomedical aptamers. In the case of thrombin-binding aptamer (TBA), the addition of a duplex motif to the G-quadruplex module improves the aptamer resistance to biodegradation and the affinity for thrombin. In particular, the mixed oligonucleotide RE31 is significantly more effective than TBA in anticoagulation experiments and shows a slower disappearance rate in human plasma and blood. In the crystal structure of the complex with thrombin, RE31 adopts an elongated structure in which the duplex and quadruplex regions are perfectly stacked on top of each other, firmly connected by a well-structured junction. The lock-and-key shape complementarity between the TT loops of the G-quadruplex and the protein exosite I gives rise to the basic interaction that stabilizes the complex. However, our data suggest that the duplex motif may have an active role in determining the greater anti-thrombin activity in biological fluids with respect to TBA. This work gives new information on mixed oligonucleotides and highlights the importance of structural data on duplex/quadruplex junctions, which appear to be varied, unpredictable, and fundamental in determining the aptamer functional properties.

  18. pH might play a role in regulating the function of paired amphipathic helices domains of human Sin3B by altering structure and thermodynamic stability.

    PubMed

    Hasan, Tauheed; Ali, Mashook; Saluja, Daman; Singh, Laishram Rajendrakumar

    2015-04-01

    Human Sin3B (hSin3B), a transcription regulator, is a scaffold protein that binds to different transcription factors and regulates transcription. It consists of six conserved domains that include four paired amphipathic helices (PAH 1-4), histone deacetylase interaction domain (HID), and highly conserved region (HCR). Interestingly, the PAH domains of hSin3B are significantly homologous to each other, yet each one interacts with a specific set of unique transcription factors. Though various partners interacting with hSin3B PAH domains have been characterized, there is no structural information available on the individual PAH domains of hSin3B. Here we characterize the structure and stability of different PAH domains of hSin3B at both nuclear and physiological pH values by using different optical probes. We found that the native state structure and stability of different PAH domains are different at nuclear pH where hSin3B performs its biological function. We also found that PAH2 and PAH3 behave differently at both nuclear and physiological pH in terms of native state structure and thermodynamic stability, while the structural identity of PAH1 remains unaltered at both pH values. The study indicates that the structural heterogeneity of different PAH domains might be responsible for having a unique set of interacting transcription factors.

  19. m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

    PubMed Central

    Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

    2016-01-01

    The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

  20. Reduced-stringency DNA reassociation: sequence specific duplex formation.

    PubMed Central

    Burr, H E; Schimke, R T

    1982-01-01

    Reduced-stringency DNA reassociation conditions allow low stability duplexes to be detected in prokaryotic, plant, fish, avian, mammalian, and primate genomes. Highly diverged families of sequences can be detected in avian, mouse, and human unique sequence dNAs. Such a family has been described among twelve species of birds; based on species specific melting profiles and fractionation of sequences belonging to this family, it was concluded that permissive reassociation conditions did not artifactually produce low stability structures (1). We report S1 nuclease and optical melting experiments, and further fractionation of the diverged family to confirm sequence specific DNA reassociation at 50 degrees in 0.5 M phosphate buffer. PMID:6278429

  1. New method of solving the optimized paired-phonon analysis equations and stability of thin films of liquid 4He at T=0 K

    NASA Astrophysics Data System (ADS)

    Szybisz, L.; Ristig, M. L.

    1989-09-01

    We propose a novel numerical method to solve the two-body Euler-Lagrange equation derived by Krotscheck, Qian, and Kohn in the paired-phonon analysis for an inhomogeneous Bose liquid at zero temperature. The new algorithm is applied to thin films of liquid 4He supported by an external potential. Numerical results are reported for density profiles, chemical potentials, binding energies, and corrective Jastrow correlation factors as a function of the particle number of the film and the strength of the external potential. The stability of this kind of film is discussed in detail. Some evidence for a long-wavelength instability of free thin films is provided. In addition, in order to unify results obtained from different derivations, it is proved that the expression for the Hartree potential reported by Krotscheck et al. is equal, within the framework of the hypernetted-chain theory, to a previously published one by Saarela, Pietiläinen, and Kallio.

  2. Aromatic oligomers that form hetero duplexes in aqueous solution.

    PubMed

    Gabriel, Gregory J; Iverson, Brent L

    2002-12-25

    The electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (Ndi) and electron-rich 1,5-dialkoxynaphthalene (Dan) have been shown to complex strongly with each other in water due to the hydrophobic effect as modulated through the electrostatic complementarity of the stacked dimer. Previously, oligomers of alternating Ndi and Dan units, termed aedamers, were the first foldamers to employ intramolecular aromatic stacking to effect the formation of secondary structure of nonnatural chains in aqueous solution. Described here is the use of this aromatic-aromatic (or pi-pi) interaction, this time in an intermolecular format, to demonstrate the self-assembly of stable hetero duplexes from a set of molecular strands (1a-4a) and (1b-4b) incorporating Ndi and Dan units, respectively. A 1-to-1 binding stoichiometry was determined from NMR and isothermal titration calorimetry (ITC) investigations, and these experiments indicated that association is enthalpically favored with the tetra-Ndi (4a) and tetra-Dan (4b) strands forming hetero duplexes (4a:4b) with a stability constant of 350 000 M-1 at T = 318 K. Polyacrylamide gel electrophoresis (PAGE) also illustrated the strong interaction between 4a and 4b and support a 1-to-1 binding mode even when one component is in slight excess. Overall, this system is the first to utilize complementary aromatic units to drive discrete self-assembly in aqueous solution. This new approach for designing assemblies is encouraging for future development of duplex systems with highly programmable modes of binding in solution or on surfaces.

  3. Genetic Analysis of the Role of the Transfer Gene, traN, of the F and R100-1 Plasmids in Mating Pair Stabilization during Conjugation

    PubMed Central

    Klimke, William A.; Frost, Laura S.

    1998-01-01

    Mating pair stabilization occurs during conjugative DNA transfer whereby the donor and recipient cells form a tight junction which requires pili as well as TraN and TraG in the donor cell. The role of the outer membrane protein, TraN, during conjugative transfer was examined by introduction of a chloramphenicol resistance cassette into the traN gene on an F plasmid derivative, pOX38, to produce pOX38N1::CAT. pOX38N1::CAT was greatly reduced in its ability to transfer DNA, indicating that TraN plays a greater role in conjugation than previously thought. F and R100-1 traN were capable of complementing pOX38N1::CAT transfer equally well when wild-type recipients were used. F traN, but not R100-1 traN, supported a much lower level of transfer when there was an ompA mutation or lipopolysaccharide (LPS) deficiency in the recipient cell, suggesting receptor specificity. The R100-1 traN gene was sequenced, and the gene product was found to exhibit 82.3% overall similarity with F TraN. The differences were mainly located within a central region of the proteins (amino acids 162 to 333 of F and 162 to 348 of R100-1). Deletion analysis of F traN suggested that this central portion might be responsible for the receptor specificity displayed by TraN. TraN was not responsible for TraT-dependent surface exclusion. Thus, TraN, and not the F pilus, appears to interact with OmpA and LPS moieties during conjugation, resulting in mating pair stabilization, the first step in efficient mobilization of DNA. PMID:9696748

  4. The cardiac muscle duplex as a method to study myocardial heterogeneity

    PubMed Central

    Solovyova, O.; Katsnelson, L.B.; Konovalov, P.V.; Kursanov, A.G.; Vikulova, N.A.; Kohl, P.; Markhasin, V.S.

    2014-01-01

    This paper reviews the development and application of paired muscle preparations, called duplex, for the investigation of mechanisms and consequences of intra-myocardial electro-mechanical heterogeneity. We illustrate the utility of the underlying combined experimental and computational approach for conceptual development and integration of basic science insight with clinically relevant settings, using previously published and new data. Directions for further study are identified. PMID:25106702

  5. FACILITY 810, REAR OF DUPLEX SHOWING COURTYARD BETWEEN WINGS, OBLIQUE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    FACILITY 810, REAR OF DUPLEX SHOWING COURTYARD BETWEEN WINGS, OBLIQUE VIEW FACING EAST. - Schofield Barracks Military Reservation, Duplex Housing Type with Corner Entries, Between Hamilton & Tidball Streets near Williston Avenue, Wahiawa, Honolulu County, HI

  6. 3. VIEW OF DUPLEX (FEATURE 7), FACING NORTH. OFFICE (FEATURE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. VIEW OF DUPLEX (FEATURE 7), FACING NORTH. OFFICE (FEATURE 11) VISIBLE IN BACKGROUND. - Copper Canyon Camp of the International Smelting & Refining Company, Duplex, Copper Canyon, Battle Mountain, Lander County, NV

  7. 1. VIEW OF DUPLEX (FEATURE 9), FACING NORTHEAST. MILL SITE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. VIEW OF DUPLEX (FEATURE 9), FACING NORTHEAST. MILL SITE IS SHOWN IN UPPER RIGHT CORNER OF PHOTOGRAPH. - Copper Canyon Camp of the International Smelting & Refining Company, Duplex, Copper Canyon, Battle Mountain, Lander County, NV

  8. Extensional duplex in the Purcell Mountains of southeastern British Columbia

    SciTech Connect

    Root, K.G. )

    1990-05-01

    An extensional duplex consisting of fault-bounded blocks (horses) located between how-angle normal faults is exposed in Proterozoic strata in the Purcell Mountains of British Columbia, Canada. This is one of the first documented extensional duplexes, and it is geometrically and kinematically analogous to duplexes developed in contractional and strike-slip fault systems. The duplex formed within an extensional fault with a ramp and flat geometry when horses were sliced from the ramp and transported within the fault system.

  9. A stability-indicating, ion-pairing, reversed-phase liquid chromatography method for studies of daunorubicin degradation in i.v. infusion fluids.

    PubMed

    Respaud, R; Quenum, L; Plichon, C; Tournamille, J F; Gyan, E; Antier, D; Viaud-Massuard, M C

    2013-09-01

    A new stability-indicating method based on high-performance liquid chromatography coupled to ultraviolet and evaporative light scattering detection (HPLC-UV-ELSD) was developed for the quantification of daunorubicin. This is an ion-pairing, reversed-phase method. The column was a Synergi MAX-RP C12 4 μm (150 mm × 4.6 mm). The mobile phase was 6.2mM nonafluoropentanoic acid in aqueous solution and acetonitrile under isocratic elution mode. The drug was subjected to oxidation, basic and acid hydrolysis to apply stress conditions. Good resolution was achieved between daunorubicin, related products and all degradation products in an overall analytical run time of approximately 16 min with the parent compound daunorubicin eluting at approximately 8 min. The method was fully validated according to ICH guidelines and SFSTP protocols in terms of accuracy, precision, specificity and linearity. For daunorubicin, the decision criteria selected consisted of the acceptability limits (±3%) and the proportion of results within the calculated tolerance intervals (95%). In conclusion, the proposed analytical procedures were validated over the selected validation domains daunorubicin (0.25-0.45 mg/mL) and shown to provide a very effective method. Physical and chemical stability study was carried out on daunorubicin preparation in our hospital centralized pharmacy unit.

  10. Overstretching of a 30 bp DNA duplex studied with steered molecular dynamics simulation: Effects of structural defects on structure and force-extension relation

    NASA Astrophysics Data System (ADS)

    Li, H.; Gisler, T.

    2009-11-01

    Single-molecule experiments on polymeric DNA show that the molecule can be overstretched at nearly constant force by about 70% beyond its relaxed contour length. In this publication we use steered molecular dynamics (MD) simulation to study the effect of structural defects on force-extension curves and structures at high elongation in a 30 base pair duplex pulled by its torsionally unconstrained 5' -5' ends. The defect-free duplex shows a plateau in the force-extension curve at 120pN in which large segments with inclined and paired bases (“S-DNA”) near both ends of the duplex coexist with a central B-type segment separated from the former by small denaturation bubbles. In the presence of a base mismatch or a nick, force-extension curves are very similar to the ones of the defect-free duplex. For the duplex with a base mismatch, S-type segments with highly inclined base pairs are not observed; rather, the overstretched duplex consists of B-type segments separated by denaturation bubbles. The nicked duplex evolves, via a two-step transition, into a two-domain structure characterized by a large S-type segment coexisting with several short S-type segments which are separated by short denaturation bubbles. Our results suggest that in the presence of nicks the force-extension curve of highly elongated duplex DNA might reflect locally highly inhomogeneous stretching. Supplementary material in the form of a PDF file available from the Journal web page at 10.1140/epje/i2009-10524-5 and is accessible for authorised users.

  11. How Mg(2+) ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    PubMed

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2016-08-02

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg(2+) ions through water-mediated interaction. It is important to know the synergic role of Mg(2+) and the water network surrounding Mg(2+) in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg(2+) is pulled from RNA, which causes disturbance of the water network. It was found that Mg(2+) remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg(2+) interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg(2+) and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg(2+) is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  12. Stereodefined phosphorothioate analogues of DNA: relative thermodynamic stability of the model PS-DNA/DNA and PS-DNA/RNA complexes.

    PubMed

    Boczkowska, Małgorzata; Guga, Piotr; Stec, Wojciech J

    2002-10-15

    Thermodynamic data regarding the influence of P-chirality on stability of duplexes formed between phosphorothioate DNA oligonucleotides (of either stereo-defined all-R(P) or all-S(P) or random configuration at the P atoms) and complementary DNA or RNA strands are presented. Measured melting temperatures and calculated DeltaG(37)(o) values showed that duplexes formed by PS-DNA oligomers with DNA strands are less stable than their unmodified counterparts. However, relative stability of the duplexes ([all-R(P)]-PS-DNA/DNA vs [all-S(P)]-PS-DNA/DNA) depends on their sequential composition rather than on the absolute configuration of PS-oligos, contrary to the results of theoretical considerations and molecular modeling reported in the literature. On the other hand, for all six analyzed pairs of diastereomers, the [all-R(P)]-PS isomers form more stable duplexes with RNA templates, but the origin of stereodifferentiation depends on the sequence with more favorable entropy and enthalpy factors which correlated with dT-rich and dA/dG-rich PS-oligomers, respectively.

  13. Defusing Complexity in Intermetallics: How Covalently Shared Electron Pairs Stabilize the FCC Variant Mo2Cu(x)Ga(6-x) (x ≈ 0.9).

    PubMed

    Kilduff, Brandon J; Yannello, Vincent J; Fredrickson, Daniel C

    2015-08-17

    Simple sphere packings of metallic atoms are generally assumed to exhibit highly delocalized bonding, often visualized in terms of a lattice of metal cations immersed in an electron gas. In this Article, we present a compound that demonstrates how covalently shared electron pairs can, in fact, play a key role in the stability of such structures: Mo2Cu(x)Ga(6-x) (x ≈ 0.9). Mo2Cu(x)Ga(6-x) adopts a variant of the common TiAl3 structure type, which itself is a binary coloring of the fcc lattice. Electronic structure calculations trace the formation of this compound to a magic electron count of 14 electrons/T atom (T = transition metal) for the TiAl3 type, for which the Fermi energy coincides with an electronic pseudogap. This count is one electron/T atom lower than the electron concentration for a hypothetical MoGa3 phase, making this structure less competitive relative to more complex alternatives. The favorable 14 electron count can be reached, however, through the partial substitution of Ga with Cu. Using DFT-calibrated Hückel calculations and the reversed approximation Molecular Orbital (raMO) method, we show that the favorability of the 14 electron count has a simple structural origin in terms of the 18 - n rule of T-E intermetallics (E = main group element): the T atoms of the TiAl3 type are arranged into square nets whose edges are bridged by E atoms. The presence of shared electron pairs along these T-T contacts allows for 18 electron configurations to be achieved on the T atoms despite possessing only 18 - 4 = 14 electrons/T atom. This bonding scheme provides a rationale for the observed stability range of TiAl3 type TE3 phases of ca. 13-14 electrons/T atom, and demonstrates how the concept of the covalent bond can extend even to the most metallic of structure types.

  14. Helical molecular duplex strands: multiple hydrogen-bond-mediated assembly of self-complementary oligomeric hydrazide derivatives.

    PubMed

    Yang, Yong; Yang, Zhi-Yong; Yi, Yuan-Ping; Xiang, Jun-Feng; Chen, Chuan-Feng; Wan, Li-Jun; Shuai, Zhi-Gang

    2007-06-22

    Careful examination of the X-ray structure of a ditopic hydrazide derivative 7 led to the concept that with malonyl groups as interhydrazide linkers hydrogen-bonding-mediated molecular duplex strands might be obtained. Complexation studies between 7, 8, and 9 confirmed this hypothesis. Two quadruple hydrogen-bonded heterodimers formed, in which spectator repulsive secondary electrostatic interaction was found to play an important role in determining the stability of the complexes. Extensive studies on 1-4 indicated that the hydrogen-bonding mode could persist in longer oligomeric hydrazide derivatives with chain extension from monomer to tetramer. Molecular duplex strands via two to fourteen interstrand hydrogen bonds were obtained. In addition to affecting the stability of the duplex strands, spectator repulsive secondary electrostatic interaction also played an important role in determining dynamic behavior of the duplex strands as exemplified by variable temperature (1)H NMR experiments. IR studies confirmed stronger hydrogen bonding in the longer oligomers. The assemblies of 1-4 on HOPG were also studied by STM technology. Molecular mechanical calculations further revealed double-helical structures for the longer oligomers. The results provide new opportunities for development of polymeric helical duplexes with well-defined structures.

  15. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures.

  16. NMR studies of G:A mismatches in oligodeoxyribonucleotide duplexes modelled after ribozymes.

    PubMed Central

    Katahira, M; Sato, H; Mishima, K; Uesugi, S; Fujii, S

    1993-01-01

    The structures of two oligodeoxyribonucleotide duplexes, the base sequences of which were modelled after both a hammerhead ribozyme and a small metalloribozyme, were studied by NMR. Both duplexes contain adjacent G:A mismatches; one has a PyGAPu:PyGAPu sequence and the other a PyGAPy:PuGAPu sequence. It is concluded on the basis of many characteristic NOEs that in both duplexes G:A base pairs are formed in the unique 'sheared' form, where an amino proton instead of an imino proton of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head'. A photo-CIDNP experiment, which gives unique and independent information on the solvent accessibility of nucleotide bases, also supports G:A base pairing rather than a bulged-out structure of G and A residues. This is the first demonstration that not only the PyGAPu:PyGAPu sequence but also the PyGAPy:PuGAPu sequence can form the unique sheared G:A base pairs. Taking the previous studies on G:A mismatches into account, the idea is suggested that a PyGA:GAPu sequence is a minimum and essential element for the formation of the sheared G:A base pairs. The sheared G:A base pairs in the PyGAPu:PyGAPu sequence are suggested to be more stable than those in the PyGAPy:PuGAPu sequence. This is explained rationally by the idea proposed above. PMID:8265358

  17. G-quadruplexes significantly stimulate Pif1 helicase-catalyzed duplex DNA unwinding.

    PubMed

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-03-20

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation.

  18. Assessment of reactive synovitis in rotating-platform posterior-stabilized design: a 10-year prospective matched-pair MRI study.

    PubMed

    Meftah, Morteza; Potter, Hollis G; Gold, Stephanie; Ranawat, Anil S; Ranawat, Amar S; Ranawat, Chitranjan S

    2013-10-01

    This is the first long-term (mean 11.6 years), prospective, matched-pair study (based on age, gender, BMI and UCLA scores) using MAVRIC (multi-acquisition variable-resonance image combination) magnetic resonance imaging to analyze reactive synovitis and osteolysis between rotating-platform posterior-stabilized (RP-PS), fixed-bearing metal-back (FB-MB), and all-polyethylene tibial (APT) in active patients (24 total, 8 in each group, mean age of 64 years, mean UCLA of 8.5) with identical femoral component and polyethylene. Reactive synovitis was observed in 6 RP-PS (75%), all 8 FB-MB (100%), and 6 APT (75%). There was a significant difference between the RP-PS and FB-MB knees in volumetric synovitis (P=0.023). Osteolysis with bone loss more than 4mm was seen in 3 FB-MB, 2 APT and none for RP-PS. These were not statistically significant.

  19. Development of a stability-indicating RP-LC method for the separation of a critical pair of impurities and their degradants in zafirlukast.

    PubMed

    Thiyagarajan, Thilak Kumar; Abdul Hakeem, Jamal Abdul Nasser; Baksam, Vijayakumar

    2012-01-01

    A high-throughput reverse-phase liquid chromatographic (RP-LC) method is developed for the quantification of zafirlukast and its related impurities in drug substance. The separation of known impurities is accomplished using a short (50 mm) LC column with sub-2-µm particle size in a relatively short run-time. A linear gradient elution involves ammonium formate and acetonitrile as mobile phase. The critical impurity pair is the meta and para isomers of zafirlukast, which are known to be potential impurities of zafirlukast, whose resolution is sensitive to pH. The stability-indicating capability of the developed method is demonstrated using forced degradation samples from stress conditions such as hydrolysis, oxidation, thermal and photolytic degradation. The developed RP-LC method is validated in accordance with International Conference on Harmonization requirements. The results from the validation study indicate that this RP-LC method can be used for the determination of synthetic and degradation impurities in regular quality control analysis for the drug substance.

  20. Thermodynamics of Oligonucleotide Duplex Melting

    NASA Astrophysics Data System (ADS)

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-05-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply rigorous thermodynamic analysis to an important biochemical problem. Because the stacking of base pairs on top of one another is a significant factor in the energetics of oligonucleotide melting, several investigators have applied van't Hoff analysis to melting temperature data using a nearest-neighbor model and have obtained entropies and enthalpies for the stacking of bases. The present article explains how the equilibrium constant for the dissociation of strands from double-stranded oligonucleotides can be expressed in terms of the total strand concentration and thus how the total strand concentration influences the melting temperature. It also presents a simplified analysis based on the entropies and enthalpies of stacking that is manually tractable so that students can work examples to help them understand the thermodynamics of oligonucleotide melting.

  1. Dislocation substructure in fatigued duplex stainless steel

    SciTech Connect

    Polak, J. . Lab. de Mecanique de Lille Inst. of Physical Metallurgy, Brno . Academy of Sciences); Degallaix, S. . Lab. de Mecanique de Lille); Kruml, T. . Academy of Sciences)

    1993-12-15

    Cyclic plastic straining of crystalline materials results in the formation of specific dislocation structures. Considerable progress in mapping and understanding internal dislocation structures has been achieved by studying single crystal behavior: however, most structural materials have a polycrystalline structure and investigations of polycrystals in comparison to single crystal behavior of simple metals prove to be very useful in understanding more complex materials. There are some classes of materials, however, with complicated structure which do not have a direct equivalent in single crystalline form. Moreover, the specific dimensions and shapes of individual crystallites play an important role both in the cyclic stress-strain response of these materials and in the formation of their interior structure in cyclic straining. Austenitic-ferritic duplex stainless steel, which is a kind of a natural composite, is a material of this type. The widespread interest in the application of duplex steels is caused by approximately doubled mechanical properties and equal corrosion properties, when compared with classical austenitic stainless steels. Fatigue resistance of these steels as well as the surface damage evolution in cyclic straining have been studied; however, much less is known about the internal substructure development in cyclic straining. In this study the dislocation arrangement in ferritic and austenitic grains of the austenitic-ferritic duplex steel alloyed with nitrogen and cyclically strained with two strain amplitudes, is reported and compared to the dislocation arrangement found in single and polycrystals of austenitic and ferritic materials of a similar composition and with the surface relief produced in cyclic plastic straining.

  2. Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase.

    PubMed

    Aarattuthodiyil, Suja; Byrd, Alicia K; Raney, Kevin D

    2014-10-01

    Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding.

  3. Conformational influence of the ribose 2'-hydroxyl group: crystal structures of DNA-RNA chimeric duplexes

    NASA Technical Reports Server (NTRS)

    Egli, M.; Usman, N.; Rich, A.

    1993-01-01

    We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.

  4. Characterization of thermal aging of duplex stainless steel by SQUID

    SciTech Connect

    Isobe, Y.; Kamimura, A.; Aoki, K.; Nakayasu, F.

    1995-08-01

    Thermal aging is a growing concern for long-term-aged duplex stainless steel piping in nuclear power plants. Superconducting QUantum Interference Device (SQUID) was used for the detection of thermal aging of SUS329 rolled duplex stainless steel and SCS16 cast duplex stainless steel. It was found that the SQUID output signal pattern in the presence of AC magnetic field applied to the specimen was sensitive to the changes in electromagnetic properties due to thermal aging.

  5. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.

  6. Unprecedented dinuclear silver(I)-mediated base pair involving the DNA lesion 1,N(6)-ethenoadenine.

    PubMed

    Mandal, Soham; Hepp, Alexander; Müller, Jens

    2015-02-28

    The DNA lesion 1,N(6)-ethenoadenine (εA) has been investigated with respect to its metal-binding properties. A synthetic DNA duplex comprising an εA : εA mispair readily forms doubly silver(I)-mediated base pairs εA-Ag(I)2-εA, representing the first example for a dinuclear metal-mediated homo base pair of a purine derivative. It also constitutes the first example for a Hoogsteen-type metal-mediated homo base pair within a B-DNA duplex.

  7. Quantitative analysis of the ion-dependent folding stability of DNA triplexes

    NASA Astrophysics Data System (ADS)

    Chen, Gengsheng; Chen, Shi-Jie

    2011-12-01

    A DNA triplex is formed through binding of a third strand to the major groove of a duplex. Due to the high charge density of a DNA triplex, metal ions are critical for its stability. We recently developed the tightly bound ion (TBI) model for ion-nucleic acids interactions. The model accounts for the potential correlation and fluctuations of the ion distribution. We now apply the TBI model to analyze the ion dependence of the thermodynamic stability for DNA triplexes. We focus on two experimentally studied systems: a 24-base DNA triplex and a pair of interacting 14-base triplexes. Our theoretical calculations for the number of bound ions indicate that the TBI model provides improved predictions for the number of bound ions than the classical Poisson-Boltzmann (PB) equation. The improvement is more significant for a triplex, which has a higher charge density than a duplex. This is possibly due to the higher ion concentration around the triplex and hence a stronger ion correlation effect for a triplex. In addition, our analysis for the free energy landscape for a pair of 14-mer triplexes immersed in an ionic solution shows that divalent ions could induce an attractive force between the triplexes. Furthermore, we investigate how the protonated cytosines in the triplexes affect the stability of the triplex helices.

  8. Quantitative analysis of the ion-dependent folding stability of DNA triplexes.

    PubMed

    Chen, Gengsheng; Chen, Shi-Jie

    2011-12-01

    A DNA triplex is formed through binding of a third strand to the major groove of a duplex. Due to the high charge density of a DNA triplex, metal ions are critical for its stability. We recently developed the tightly bound ion (TBI) model for ion-nucleic acids interactions. The model accounts for the potential correlation and fluctuations of the ion distribution. We now apply the TBI model to analyze the ion dependence of the thermodynamic stability for DNA triplexes. We focus on two experimentally studied systems: a 24-base DNA triplex and a pair of interacting 14-base triplexes. Our theoretical calculations for the number of bound ions indicate that the TBI model provides improved predictions for the number of bound ions than the classical Poisson-Boltzmann (PB) equation. The improvement is more significant for a triplex, which has a higher charge density than a duplex. This is possibly due to the higher ion concentration around the triplex and hence a stronger ion correlation effect for a triplex. In addition, our analysis for the free energy landscape for a pair of 14-mer triplexes immersed in an ionic solution shows that divalent ions could induce an attractive force between the triplexes. Furthermore, we investigate how the protonated cytosines in the triplexes affect the stability of the triplex helices.

  9. Pick a Pair. Pancake Pairs

    ERIC Educational Resources Information Center

    Miller, Pat

    2005-01-01

    Cold February weather and pancakes are a traditional pairing. Pancake Day began as a way to eat up the foods that were abstained from in Lent--traditionally meat, fat, eggs and dairy products. The best-known pancake event is The Pancake Day Race in Buckinghamshire, England, which has been run since 1445. This column describes pairs of books that…

  10. Real-time fluorescence assays to monitor duplex unwinding and ATPase activities of helicases.

    PubMed

    Özeş, Ali R; Feoktistova, Kateryna; Avanzino, Brian C; Baldwin, Enoch P; Fraser, Christopher S

    2014-07-01

    Many physiological functions of helicases are dependent on their ability to unwind nucleic acid duplexes in an ATP-dependent fashion. Determining the kinetic frameworks of these processes is crucial to understanding how these proteins function. We recently developed a fluorescence assay to monitor RNA duplex unwinding by DEAD-box helicases in real time. In this assay, two fluorescently modified short reporter oligonucleotides are annealed to an unmodified RNA loading strand of any length so that the fluorescent moieties of the two reporters find themselves in close proximity to each other and fluorescence is quenched. One reporter is modified with cyanine 3 (Cy3), whereas the other is modified with a spectrally paired black-hole quencher (BHQ). As the helicase unwinds the loading strand, the enzyme displaces the Cy3-modified reporter, which will bind to a capture or competitor DNA strand, permanently separating it from the BHQ-modified reporter. Complete separation of the Cy3-modified reporter strand is thus detected as an increase in total fluorescence. This assay is compatible with reagentless biosensors to monitor ATPase activity so that the coupling between ATP hydrolysis and duplex unwinding can be determined. With the protocol described, obtaining data and analyzing results of unwinding and ATPase assays takes ∼4 h.

  11. Full Duplex, Spread Spectrum Radio System

    NASA Technical Reports Server (NTRS)

    Harvey, Bruce A.

    2000-01-01

    The goal of this project was to support the development of a full duplex, spread spectrum voice communications system. The assembly and testing of a prototype system consisting of a Harris PRISM spread spectrum radio, a TMS320C54x signal processing development board and a Zilog Z80180 microprocessor was underway at the start of this project. The efforts under this project were the development of multiple access schemes, analysis of full duplex voice feedback delays, and the development and analysis of forward error correction (FEC) algorithms. The multiple access analysis involved the selection between code division multiple access (CDMA), frequency division multiple access (FDMA) and time division multiple access (TDMA). Full duplex voice feedback analysis involved the analysis of packet size and delays associated with full loop voice feedback for confirmation of radio system performance. FEC analysis included studies of the performance under the expected burst error scenario with the relatively short packet lengths, and analysis of implementation in the TMS320C54x digital signal processor. When the capabilities and the limitations of the components used were considered, the multiple access scheme chosen was a combination TDMA/FDMA scheme that will provide up to eight users on each of three separate frequencies. Packets to and from each user will consist of 16 samples at a rate of 8,000 samples per second for a total of 2 ms of voice information. The resulting voice feedback delay will therefore be 4 - 6 ms. The most practical FEC algorithm for implementation was a convolutional code with a Viterbi decoder. Interleaving of the bits of each packet will be required to offset the effects of burst errors.

  12. Duplex unwinding with DEAD-box proteins.

    PubMed

    Jankowsky, Eckhard; Putnam, Andrea

    2010-01-01

    DEAD-box proteins, which comprise the largest helicase family, are involved in virtually all aspects of RNA metabolism. DEAD-box proteins catalyze diverse ATP-driven functions including the unwinding of RNA secondary structures. In contrast to many well-studied DNA and viral RNA helicases, DEAD-box proteins do not rely on translocation on one of the nucleic acid strands for duplex unwinding, but directly load onto helical regions and then locally pry the strands apart in an ATP-dependent fashion. In this chapter, we outline substrate design and unwinding protocols for DEAD-box proteins and focus on the quantitative evaluation of their unwinding activity.

  13. A Density Functional Theory Examination of the Local Conformational Energetics of Normal and Epigenetically Modified Duplex DNA

    NASA Astrophysics Data System (ADS)

    Yusufaly, Tahir; Olson, Wilma

    2013-03-01

    We report density functional theory calculations of various local regions of duplex DNA, including hydrogen bonded base pairs, stacked nearest-neighbor bases, and sugar-phosphate backbones. Special attention is given to the methylation of 5-cytosine, an epigenetic modification believed to play a key role in eukaryotic gene regulation. Energetically stable molecular conformations are identified and their elastic properties analyzed. Our results are compared with previous ab initio studies and high-resolution crystalline structural data.

  14. Solution structure, mechanism of replication, and optimization of an unnatural base pair.

    PubMed

    Malyshev, Denis A; Pfaff, Danielle A; Ippoliti, Shannon I; Hwang, Gil Tae; Dwyer, Tammy J; Romesberg, Floyd E

    2010-11-08

    As part of an ongoing effort to expand the genetic alphabet for in vitro and eventual in vivo applications, we have synthesized a wide variety of predominantly hydrophobic unnatural base pairs and evaluated their replication in DNA. Collectively, the results have led us to propose that these base pairs, which lack stabilizing edge-on interactions, are replicated by means of a unique intercalative mechanism. Here, we report the synthesis and characterization of three novel derivatives of the nucleotide analogue dMMO2, which forms an unnatural base pair with the nucleotide analogue d5SICS. Replacing the para-methyl substituent of dMMO2 with an annulated furan ring (yielding dFMO) has a dramatically negative effect on replication, while replacing it with a methoxy (dDMO) or with a thiomethyl group (dTMO) improves replication in both steady-state assays and during PCR amplification. Thus, dTMO-d5SICS, and especially dDMO-d5SICS, represent significant progress toward the expansion of the genetic alphabet. To elucidate the structure-activity relationships governing unnatural base pair replication, we determined the solution structure of duplex DNA containing the parental dMMO2-d5SICS pair, and also used this structure to generate models of the derivative base pairs. The results strongly support the intercalative mechanism of replication, reveal a surprisingly high level of specificity that may be achieved by optimizing packing interactions, and should prove invaluable for the further optimization of the unnatural base pair.

  15. Criteria for the Segmentation of Vowels on Duplex Oscillograms.

    ERIC Educational Resources Information Center

    Naeser, Margaret A.

    This paper develops criteria for the segmentation of vowels on duplex oscillograms. Previous vowel duration studies have primarily used sound spectrograms. The use of duplex oscillograms, rather than sound spectrograms, permits faster production (real time) at less expense (adding machine paper may be used). The speech signal can be more spread…

  16. 52. Photocopy of copy of original Officers' Duplex Quarters drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    52. Photocopy of copy of original Officers' Duplex Quarters drawing by Copeland, 7 April 1932 (Original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Heating - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  17. 53. Photocopy of copy of original Officers' Duplex Quarters drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. Photocopy of copy of original Officers' Duplex Quarters drawing by A.G.D., 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Electrical - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  18. Methods And Devices For Characterizing Duplex Nucleic Acid Molecules

    DOEpatents

    Akeson, Mark; Vercoutere, Wenonah; Haussler, David; Winters-Hilt, Stephen

    2005-08-30

    Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.

  19. Helix-Dependent Spin Filtering through the DNA Duplex.

    PubMed

    Zwang, Theodore J; Hürlimann, Sylvia; Hill, Michael G; Barton, Jacqueline K

    2016-12-07

    Recent work suggests that electrons can travel through DNA and other chiral molecules in a spin-selective manner, but little is known about the origin of this spin selectivity. Here we describe experiments on magnetized DNA-modified electrodes to explore spin-selective electron transport through hydrated duplex DNA. Our results show that the two spins migrate through duplex DNA with a different yield and that spin selectivity requires charge transport through the DNA duplex. Significantly, shifting the same duplex DNA between right-handed B- and left-handed Z-forms leads to a diode-like switch in spin selectivity; which spin moves more efficiently through the duplex depends upon the DNA helicity. With DNA, the supramolecular organization of chiral moieties, rather than the chirality of the individual monomers, determines the selectivity in spin, and thus a conformational change can switch the spin selectivity.

  20. Eddy Current Assessment of Duplex Metallic Coatings

    NASA Astrophysics Data System (ADS)

    Krzywosz, K. J.

    2004-02-01

    EPRI is involved in a multi-year program with the Department of Energy to test, evaluate, and develop a field-deployable eddy current NDE system for life assessment of blade coatings for advanced gas turbines. The coatings evaluated from these advanced GE engines include CoCrAlY (GT 29) and NiCoCrAlY (GT 33) bond coats followed by top aluminide overlay coatings. These duplex metallic coatings commonly referred to as GT 29+ and GT 33+ coatings, respectively. In general, during cycling and continuous operation at higher operating temperature, coatings fail due to spallation of protective oxide layers, leading to consumption of protective coating by oxidation and to eventual failure of blades. To extend service life of these critical rotating components, an inspection-based condition assessment program has been initiated to help establish more optimum inspection intervals that are not dependent on time-in-service maintenance approach. This paper summarizes the latest results obtained to date using the state-of-the-art frequency-scanning eddy current tester with a built-in three-layer inversion analysis algorithm. Significant progress has been made in assessing and discriminating the duplex metallic coatings as normal, degraded, and/or cracked. In addition, quantitative assessment was conducted by estimating various coating and substrate conductivity values.

  1. Identification of a pKa-regulating motif stabilizing imidazole-modified double-stranded DNA

    PubMed Central

    Buyst, Dieter; Gheerardijn, Vicky; Fehér, Krisztina; Van Gasse, Bjorn; Van Den Begin, Jos; Martins, José C.; Madder, Annemieke

    2015-01-01

    The predictable 3D structure of double-stranded DNA renders it ideally suited as a template for the bottom-up design of functionalized nucleic acid-based active sites. We here explore the use of a 14mer DNA duplex as a scaffold for the precise and predictable positioning of catalytic functionalities. Given the ubiquitous participation of the histidine-based imidazole group in protein recognition and catalysis events, single histidine-like modified duplexes were investigated. Tethering histamine to the C5 of the thymine base via an amide bond, allows the flexible positioning of the imidazole function in the major groove. The mutual interactions between the imidazole and the duplex and its influence on the imidazolium pKaH are investigated by placing a single modified thymine at four different positions in the center of the 14mer double helix. Using NMR and unrestrained molecular dynamics, a structural motif involving the formation of a hydrogen bond between the imidazole and the Hoogsteen side of the guanine bases of two neighboring GC base pairs is established. The motif contributes to a stabilization against thermal melting of 6°C and is key in modulating the pKaH of the imidazolium group. The general features, prerequisites and generic character of the new pKaH-regulating motif are described. PMID:25520197

  2. A Structural Transition in Duplex DNA Induced by Ethylene Glycol

    PubMed Central

    Brewood, Greg P.; Aliwarga, Theresa; Schurr, J. Michael

    2010-01-01

    The twist energy parameter (ET) that governs the supercoiling free energy, and the linking difference (Δl) are measured for p30 δ DNA in solutions containing 0 to 40 w/v% ethylene glycol (EG). A plot of ET vs. −ln aw, where aw is the water activity, displays the full (reverse) sigmoidal profile of a discrete structural transition. A general theory for the effect of added osmolyte on a cooperative structural transition between two duplex states, 1□ 2, is formulated in terms of parameters applicable to individual base-pairs subunits. The resulting fraction of base-pairs in the 2-state ( f20), is incorporated into expressions for the effective torsion and bending elastic constants, the effective twist energy parameter ( ETeff), and the change in intrinsic twist (δl0). Fitting the expression for ETeff to the measured ET -values yields reasonably unambiguous estimates of ET1and ET2, the midpoint value (ln aw)1/2, and midpoint slope (∂ET/∂ln aw)1/2, but does not yield unambiguous estimates of the equilibrium constant ( K0), the difference in DNA-water preferential interaction coefficient (ΔΓ), or the inverse cooperativity parameter, J. Fitting a non-cooperative model (assumed J=1.0) to the data yields, K0 = 0.067, and ΔΓ = − 30.0 per base-pair (bp). Essentially equivalent fits are provided by models with a wide range of correlated J, ΔΓ, and K0 values. Other results favor ΔΓ in the range − 1.0 to 0, which then requires K0 ≥ 0.914, and a cooperativity parameter, 1/J ≥ 30.0 bp. The measured δl0 and circular dichroism (CD) at 272 nm are found to be compatible with curves predicted using the same f20-values that best-fit the ET -data. At least 7 to 10 % of the base-pairs are inferred to exist in the 2-state in 0.1 M NaCl in the complete absence of added osmolyte. Compared with the 1-state, the 2-state has a ~2.0- to 2.1-fold greater torsion elastic constant, a ~0.70-fold smaller bending elastic constant, a ~0.91-fold smaller ET -value, a ~0

  3. A nanoscale duplex precipitation approach for improving the properties of Fe-base alloys

    SciTech Connect

    Zhang, Zhongwu; Liu, C T; Wang, Xun-Li; Wen, Y. R.; Fujita, T.; Hirata, A.; Chen, M.W.; Miller, Michael K; Chen, Guang; Chin, Bryan

    2013-01-01

    The precipitate size and number density are important factors for tailoring the mechanical behaviors of nanoscale precipitate-hardened alloys. However during thermal aging, the precipitate size and number density change leading to either poor strength or high strength but significantly reduced ductility. Here we demonstrate, by producing nanoprecipitates with unusual duplex structures in a composition-optimized multicomponent precipitation-hardened alloy, a unique approach to improve the stability of the alloy against the effects of thermal aging and consequently change in the mechanical properties. Our study provides compelling experimental evidence that these nanoscale precipitates consist of a duplex structures with a Cu-enriched bcc core that is partially encased by a B2-ordered Ni(Mn,Al) phase. This duplex structure enables the precipitate size and number density to be independently optimized, provides a more complex obstacle for dislocation movement due to the ordering and an additional interphase interface, and yields a high yield strength alloy without sacrificing the ductility.

  4. Hybrid recursive active filters for duplexing in RF transmitter front-ends

    NASA Astrophysics Data System (ADS)

    Gottardo, Giuseppe; Donati, Giovanni; Musolff, Christian; Fischer, Georg; Felgentreff, Tilman

    2016-08-01

    Duplex filters in modern base transceiver stations shape the channel in order to perform common frequency division duplex operations. Usually, they are designed as cavity filters, which are expensive and have large dimensions. Thanks to the emerging digital technology and fast digital converters, it is possible to transfer the efforts of designing analog duplex filters into digital numeric algorithms applied to feedback structures, operating on power. This solution provides the shaping of the signal spectrum directly at the output of the radio frequency (RF) power amplifiers (PAs) relaxing the transmitter design especially in the duplexer and in the antenna sections. The design of a digital baseband feedback applied to the analog power RF amplifiers (hybrid filter) is presented and verified by measurements. A model to describe the hybrid system is investigated, and the relation between phase and resonance peaks of the resulting periodic band-pass transfer function is described. The stability condition of the system is analyzed using Nyquist criterion. A solution involving a number of digital feedback and forward branches is investigated defining the parameters of the recursive structure. This solution allows the closed loop system to show a periodic band pass with up to 500 kHz bandwidth at the output of the RF amplifier. The band-pass magnitude reaches up to 17 dB selectivity. The rejection of the PA noise in the out-of-band frequencies is verified by measurements. The filter is tested with a modulated LTE (Long Term Evolution) signal showing an ACPR (Adjacent Channel Power Ratio) enhancement of 10 dB of the transmitted signal.

  5. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

    SciTech Connect

    Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

    2012-02-15

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.

  6. Altering the electrostatic potential in the major groove: thermodynamic and structural characterization of 7-deaza-2'-deoxyadenosine:dT base pairing in DNA.

    PubMed

    Kowal, Ewa A; Ganguly, Manjori; Pallan, Pradeep S; Marky, Luis A; Gold, Barry; Egli, Martin; Stone, Michael P

    2011-12-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg(2+). The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.

  7. Reliability analysis of a repairable duplex system

    NASA Astrophysics Data System (ADS)

    Vanderperre, E. J.; Makhanov, S. S.

    2014-09-01

    We analyse the survival time of a repairable duplex system characterised by cold standby and by a pre-emptive priority rule. We allow general probability distributions for failure and repair. Moreover, an important realistic feature of the system is the general assumption that the non-priority unit has a memory. This combination of features has not been analysed in the previous literature. Our (new) methodology is based on a concatenation of a Cauchy-type integral representation of the modified Heaviside unit-step function and a two-sided stochastic inequality. Finally, we introduce a security interval related to a security level and a suitable risk-criterion based on the survival function of the system. As a practical application, we analyse some particular cases of the survival function jointly with the security interval corresponding to a security level of 90.

  8. π-π orbital resonance in twisting duplex DNA: Dynamical phyllotaxis and electronic structure effects

    NASA Astrophysics Data System (ADS)

    Maciá, Enrique

    2009-09-01

    The presence of synchronized, collective twist motions of the Watson-Crick base pairs in DNA duplexes (helicoidal standing waves) can efficiently enhance the π-π orbital overlapping between nonconsecutive base pairs via a long-range, phonon-correlated tunneling effect. The resulting structural patterns are described within the framework of dynamical phyllotaxis, providing a realistic treatment which takes into account both the intrinsic three-dimensional, helicoidal geometry of DNA, and the coupling between the electronic degrees of freedom and double-helix DNA molecular dynamics at low frequencies. The main features of the resulting electronic band structures are discussed for several resonance frequencies of interest, highlighting the possible biophysical implications of the obtained results.

  9. Pathway of ATP utilization and duplex rRNA unwinding by the DEAD-box helicase, DbpA.

    PubMed

    Henn, Arnon; Cao, Wenxiang; Licciardello, Nicholas; Heitkamp, Sara E; Hackney, David D; De La Cruz, Enrique M

    2010-03-02

    DEAD-box RNA helicase proteins use the energy of ATP hydrolysis to drive the unwinding of duplex RNA. However, the mechanism that couples ATP utilization to duplex RNA unwinding is unknown. We measured ATP utilization and duplex RNA unwinding by DbpA, a non-processive bacterial DEAD-box RNA helicase specifically activated by the peptidyl transferase center (PTC) of 23S rRNA. Consumption of a single ATP molecule is sufficient to unwind and displace an 8 base pair rRNA strand annealed to a 32 base pair PTC-RNA "mother strand" fragment. Strand displacement occurs after ATP binding and hydrolysis but before P(i) product release. P(i) release weakens binding to rRNA, thereby facilitating the release of the unwound rRNA mother strand and the recycling of DbpA for additional rounds of unwinding. This work explains how ATPase activity of DEAD-box helicases is linked to RNA unwinding.

  10. The Formation of Martensitic Austenite During Nitridation of Martensitic and Duplex Stainless Steels

    NASA Astrophysics Data System (ADS)

    Zangiabadi, Amirali; Dalton, John C.; Wang, Danqi; Ernst, Frank; Heuer, Arthur H.

    2017-01-01

    Isothermal martensite/ferrite-to-austenite phase transformations have been observed after low-temperature nitridation in the martensite and δ-ferrite phases in 15-5 PH (precipitation hardening), 17-7 PH, and 2205 (duplex) stainless steels. These transformations, in the region with nitrogen concentrations of 8 to 16 at. pct, are consistent with the notion that nitrogen is a strong austenite stabilizer and substitutional diffusion is effectively frozen at the paraequilibrium temperatures of our experiments. Our microstructural and diffraction analyses provide conclusive evidence for the martensitic nature of these phase transformations.

  11. Force measurements reveal how small binders perturb the dissociation mechanisms of DNA duplex sequences

    NASA Astrophysics Data System (ADS)

    Burmistrova, Anastasia; Fresch, Barbara; Sluysmans, Damien; de Pauw, Edwin; Remacle, Françoise; Duwez, Anne-Sophie

    2016-06-01

    The force-driven separation of double-stranded DNA is crucial to the accomplishment of cellular processes like genome transactions. Ligands binding to short DNA sequences can have a local stabilizing or destabilizing effect and thus severely affect these processes. Although the design of ligands that bind to specific sequences is a field of intense research with promising biomedical applications, so far, their effect on the force-induced strand separation has remained elusive. Here, by means of AFM-based single molecule force spectroscopy, we show the co-existence of two different mechanisms for the separation of a short DNA duplex and demonstrate how they are perturbed by small binders. With the support of Molecular Dynamics simulations, we evidence that above a critical pulling rate one of the dissociation pathways becomes dominant, with a dramatic effect on the rupture forces. Around the critical threshold, we observe a drop of the most probable rupture forces for ligand-stabilized duplexes. Our results offer a deep understanding of how a stable DNA-ligand complex behaves under force-driven strand separation.The force-driven separation of double-stranded DNA is crucial to the accomplishment of cellular processes like genome transactions. Ligands binding to short DNA sequences can have a local stabilizing or destabilizing effect and thus severely affect these processes. Although the design of ligands that bind to specific sequences is a field of intense research with promising biomedical applications, so far, their effect on the force-induced strand separation has remained elusive. Here, by means of AFM-based single molecule force spectroscopy, we show the co-existence of two different mechanisms for the separation of a short DNA duplex and demonstrate how they are perturbed by small binders. With the support of Molecular Dynamics simulations, we evidence that above a critical pulling rate one of the dissociation pathways becomes dominant, with a dramatic effect

  12. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    PubMed

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

  13. Thermoacoustic Duplex Technology for Cooling and Powering a Venus Lander

    NASA Astrophysics Data System (ADS)

    Walker, A. R.; Haberbusch, M. S.; Sasson, J.

    2015-04-01

    A Thermoacoustic Stirling Heat Engine (TASHE) is directly coupled to a Pulse Tube Refrigerator (PTR) in a duplex configuration, providing simultaneous cooling and electrical power, thereby suiting the needs of a long-lived Venus lander.

  14. 43. View of station from southwest side with duplex keepers' ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    43. View of station from southwest side with duplex keepers' dwelling to the left. USLHB photo by Herbert Bamber, June 9, 1893. - Bodie Island Light Station, Off Highway 12, Nags Head, Dare County, NC

  15. 1. VIEW OF STAFF HOUSE (FEATURE 10), FACING SOUTHWEST. DUPLEX ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. VIEW OF STAFF HOUSE (FEATURE 10), FACING SOUTHWEST. DUPLEX (FEATURE 7) IS VISIBLE IN THE BACKGROUND AT RIGHT. - Copper Canyon Camp of the International Smelting & Refining Company, Staff House, Copper Canyon, Battle Mountain, Lander County, NV

  16. 1. VIEW OF RESIDENCE (FEATURE 12), FACING SOUTHWEST. DUPLEX (FEATURE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. VIEW OF RESIDENCE (FEATURE 12), FACING SOUTHWEST. DUPLEX (FEATURE 9) IS VISIBLE IN THE BACKGROUND. - Copper Canyon Camp of the International Smelting & Refining Company, Residence, Copper Canyon, Battle Mountain, Lander County, NV

  17. Duplex ultrasound assessment of femorodistal grafts: correlation with angiography.

    PubMed

    McShane, M D; Gazzard, V M; Clifford, P C; Hacking, C N; Fairhurst, J J; Humphries, K N; Birch, S J; Webster, J H; Chant, A D

    1987-12-01

    Fifty-eight grafts have been assessed using duplex scanning and ankle brachial pressure indices. This assessment is compared with the findings by angiography. Eighteen grafts were occluded and 40 patent. Duplex scanning defined graft status with a greater accuracy than pressure indices. Pressure indices alone would not differentiate "satisfactory" grafts from those with localised, haemodynamically significant disease. Only 55% of those grafts with localised stenoses demonstrated a fall of greater than 0.2 in ankle brachial pressure index after exercise. When the information obtained using pressure indices and duplex scanning was combined non-invasive assessment had a sensitivity of 86% and specificity of 94% for detection of localised, haemodynamically significant disease in patent grafts. Haemodynamically significant disease, as defined by angiography, can be detected and localised with duplex scanning complementing the use of pressure indices in graft assessment.

  18. The Origins of Microtexture in Duplex Ti Alloys (Preprint)

    DTIC Science & Technology

    2008-06-01

    To) June 2008 Journal Article Preprint 4 . TITLE AND SUBTITLE THE ORIGINS OF MICROTEXTURE IN DUPLEX Ti ALLOYS (PREPRINT) 5a. CONTRACT NUMBER In...house 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 62102F 6 . AUTHOR(S) M.G. Glavic (UES, Inc.) B.B. Bartha (United Technologies Corporation...applicable to duplex alpha/beta titanium microstructures. The crystallographic coherency of the primary and secondary alpha phase with the prior beta

  19. Three in one: prototropy-free highly stable AADD-type self-complementary quadruple hydrogen-bonded molecular duplexes with a built-in fluorophore.

    PubMed

    Kheria, Sanjeev; Rayavarapu, Suresh; Kotmale, Amol S; Sanjayan, Gangadhar J

    2017-02-15

    This communication reports an effective approach for addressing the prototropy-related problems in heterocycle-based AADD-type self-assembling systems by freezing their hydrogen-bonding codes, by utilizing intramolecular bifurcated hydrogen bonding interactions. Using this strategy, we have also developed a hydroquinone-conjugated AADD-type self-assembling system adorned with three valuable features such as prototropy-free dimerization yielding single duplexes, high duplex stability and a built-in fluorophore, which would augment its application potential. The rational approach used herein to arrest prototropic shift may also find application elsewhere, wherein proton shift-mediated structural changes become a detrimental factor.

  20. Watson-Crick base pairing controls excited-state decay in natural DNA.

    PubMed

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states.

  1. Structure determination of DNA methylation lesions N1-meA and N3-meC in duplex DNA using a cross-linked protein-DNA system.

    PubMed

    Lu, Lianghua; Yi, Chengqi; Jian, Xing; Zheng, Guanqun; He, Chuan

    2010-07-01

    N(1)-meA and N(3)-meC are cytotoxic DNA base methylation lesions that can accumulate in the genomes of various organisms in the presence of S(N)2 type methylating agents. We report here the structural characterization of these base lesions in duplex DNA using a cross-linked protein-DNA crystallization system. The crystal structure of N(1)-meA:T pair shows an unambiguous Hoogsteen base pair with a syn conformation adopted by N(1)-meA, which exhibits significant changes in the opening, roll and twist angles as compared to the normal A:T base pair. Unlike N(1)-meA, N(3)-meC does not establish any interaction with the opposite G, but remains partially intrahelical. Also, structurally characterized is the N(6)-meA base modification that forms a normal base pair with the opposite T in duplex DNA. Structural characterization of these base methylation modifications provides molecular level information on how they affect the overall structure of duplex DNA. In addition, the base pairs containing N(1)-meA or N(3)-meC do not share any specific characteristic properties except that both lesions create thermodynamically unstable regions in a duplex DNA, a property that may be explored by the repair proteins to locate these lesions.

  2. Potential dependence of cuprous/cupric duplex film growth on copper electrode in alkaline media

    NASA Astrophysics Data System (ADS)

    He, Jian-Bo; Lu, Dao-Yong; Jin, Guan-Ping

    2006-11-01

    The duplex oxide film potentiostatically formed on copper in concentrated alkaline media has been investigated by XRD, XPS, negative-going voltammetry and cathodic chronopotentiometry. The interfacial capacity was also measured using fast triangular voltage method under quasi-stationary condition. The obvious differences in the thickness, composition, passivation degree and capacitance behavior were observed between the duplex film formed in lower potential region (-0.13 to 0.18 V versus Hg|HgO electrode with the same solution as the electrolyte) and that formed in higher potential region (0.18-0.60 V). Cuprous oxides could be formed and exist stably in the inner layer in the both potential regions, and three cupric species, soluble ions and Cu(OH) 2 and CuO, could be independently produced from the direct oxidation of metal copper, as indicated by three pairs of redox voltammetric peaks. One of the oxidation peaks appeared only after the scan was reversed from high potential and could be attributed to CuO formation upon the pre-accumulation of O 2- ions within the film under high anodic potentials. A new mechanism for the film growth on the investigated time scale from 1 to 30 min is proposed, that is, the growth of the duplex film in the lower potential region takes place at the film|solution interface to form a thick Cu(OH) 2 outer layer by field-assisted transfer of Cu 2+ ions through the film to solution, whereas the film in the higher potential region grows depressingly and slowly at the metal|film interface to form Cu 2O and less CuO by the transfer of O 2- ions through the film to electrode.

  3. Terahertz absorption of DNA decamer duplex.

    PubMed

    Li, Xiaowei; Globus, Tatiana; Gelmont, Boris; Salay, Luiz C; Bykhovski, Alexei

    2008-11-27

    This work combines experimental and theoretical approaches to investigate terahertz absorption spectra of the DNA formed by the sequence oligomer 5'-CCGGCGCCGG-3'. The three-dimensional structure of this self-complimentary DNA decamer has been well-studied, permitting us to perform direct identification of the low-frequency phonon modes associated with specific conformation and to conduct comprehensive computer simulations. Two modeling techniques, normal-mode analysis and nanosecond molecular dynamics with explicit solvent molecules, were employed to extract the low-frequency vibrational modes based on which the absorption spectra were calculated. The absorption spectra of the DNA decamer in aqueous solution were measured in the frequency range 10-25 cm(-1) using the terahertz Fourier transform infrared spectroscopy. Multiple well-resolved and reproducible resonance modes were observed. When calculated and experimental spectra were compared, the spectrum based on molecular dynamics simulations showed a better correlation with the experimental spectra than the one based on normal-mode analysis. These results demonstrate that there exist a considerable number of active low-frequency phonon modes in this short DNA duplex.

  4. Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif.

    PubMed

    Yang, Bo; Wu, R R; Rodgers, M T

    2015-09-01

    (CCG)(n)•(CGG)(n) trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)(n)•(CGG)(n) repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C(+)•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

  5. Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Wu, R. R.; Rodgers, M. T.

    2015-09-01

    (CCG)n•(CGG)n trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C+•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

  6. ES and H-compatible lubrication for duplex bearings

    SciTech Connect

    Steinhoff, R.G.

    1997-10-01

    Two ES and H-compatible lubricants (environment, safety, and health) for duplex bearing applications and one hybrid material duplex bearing were evaluated and compared against duplex bearings with trichlorotrifluoroethane (Freon) deposition of low molecular weight polytetrafluoroethylene (PTFE) bearing lubricant extracted from Vydax{trademark}. Vydax is a product manufactured by DuPont consisting of various molecular weights of PTFE suspended in trichlorotrifluoroethane (Freon), which is an ozone-depleting solvent. Vydax has been used as a bearing lubricant in strong link mechanisms since 1974. Hybrid duplex bearings with silicon nitride balls and molded glass-nylon-Teflon retainers, duplex bearings lubricated with sputtered MoS{sub 2} on races and retainers, and duplex bearings lubricated with electrophoretic deposited MoS{sub 2} were evaluated. Bearings with electrophoretic deposited MoS{sub 2} performed as well as bearings with Freon deposition of PTFE from Freon-based Vydax. Hybrid bearings with silicon nitride balls performed worse than bearings lubricated with Vydax, but their performance would still be acceptable for most applications. Bearings lubricated with sputtered MoS{sub 2} on the races and retainers had varying amounts of film on the bearings. This affected the performance of the bearings. Bearings with a uniform coating performed to acceptable levels, but bearings with no visible MoS{sub 2} on the races and retainers did not perform as well as bearings with the other coatings. Unless process controls are incorporated in the sputtering process or the bearings are screened, they do not appear to be acceptable for duplex bearing applications.

  7. Kinematic model for out-of-sequence thrusting: Motion of two ramp-flat faults and the production of upper plate duplex systems

    NASA Astrophysics Data System (ADS)

    Pavlis, Terry L.

    2013-06-01

    Kinematic models developed here suggest a bewildering array of structural styles can be generated during out-of-sequence thrusting. Many of these structures would be difficult to distinguish from a normally stacked thrust sequence and the process can produce younger-on-older faults that could easily be misinterpreted as normal faults. This paper considers a small subset of this problem within a large model space by considering structures that develop along a pair of ramp-flat faults that are moving simultaneously, or sequentially. Motion on the lower ramp warps the structurally higher fault due to fault-bend folding and when the fault ruptures through the warp it transfers a horse to the upper hanging wall. Continuity of the process generates what is referred to here as an "upper plate duplex" to distinguish the structure from a conventional duplex. Kinematic parameters are developed for two models within this general problem: 1) a system with a fixed ramp in the lower thrust, overridden by an upper thrust; and 2) a double-duplex system where a conventional duplex develops along the lower fault at the same time as an upper plate duplex is formed along the upper fault. The theory is tested with forward models using 2D Move software and these tests indicate different families of structural styles form in association with relative scaling of ramp systems, slip-ratio between faults, and aspect ratios of horse blocks formed in the upper-plate duplex. A first-order result of the analysis is that an upper plate duplex can be virtually indistinguishable from a conventional duplex unless the trailing branch lines of the horses are exposed or imaged; a condition seldom met in natural exposures. Restoration of an upper-plate duplex produces counterintuitive fault geometry in the restored state, and thus, restorations of upper plate duplexes that erroneously assume a conventional duplex model would produce restored states that are seriously in error. In addition, in most of

  8. Initiation of the microgene polymerization reaction with non-repetitive homo-duplexes

    SciTech Connect

    Itsko, Mark Zaritsky, Arieh; Rabinovitch, Avinoam; Ben-Dov, Eitan

    2008-04-11

    Microgene Polymerization Reaction (MPR) is used as an experimental system to artificially simulate evolution of short, non-repetitive homo-duplex DNA into multiply-repetitive products that can code for functional proteins. Blunt-end ligation by DNA polymerase is crucial in expansion of homo-duplexes (HDs) into head-to-tail multiple repeats in MPR. The propagation mechanism is known, but formation of the initial doublet (ID) by juxtaposing two HDs and polymerization through the gap has been ambiguous. Initiation events with pairs of HDs using Real-Time PCR were more frequent at higher HD concentrations and slightly below the melting temperature. A process molecularity of about 3.1, calculated from the amplification efficiency and the difference in PCR cycles at which propagation was detected at varying HD concentrations, led to a simple mechanism for ID formation: the gap between two HDs is bridged by a third. Considering thermodynamic aspects of the presumed intermediate 'nucleation complex' can predict relative propensity for the process with other HDs.

  9. Hardware Impairments Aware Transceiver for Full-Duplex Massive MIMO Relaying

    NASA Astrophysics Data System (ADS)

    Xia, Xiaochen; Zhang, Dongmei; Xu, Kui; Ma, Wenfeng; Xu, Youyun

    2015-12-01

    This paper studies the massive MIMO full-duplex relaying (MM-FDR), where multiple source-destination pairs communicate simultaneously with the help of a common full-duplex relay equipped with very large antenna arrays. Different from the traditional MM-FDR protocol, a general model where sources/destinations are allowed to equip with multiple antennas is considered. In contrast to the conventional MIMO system, massive MIMO must be built with low-cost components which are prone to hardware impairments. In this paper, the effect of hardware impairments is taken into consideration, and is modeled using transmit/receive distortion noises. We propose a low complexity hardware impairments aware transceiver scheme (named as HIA scheme) to mitigate the distortion noises by exploiting the statistical knowledge of channels and antenna arrays at sources and destinations. A joint degree of freedom and power optimization algorithm is presented to further optimize the spectral efficiency of HIA based MM-FDR. The results show that the HIA scheme can mitigate the "ceiling effect" appears in traditional MM-FDR protocol, if the numbers of antennas at sources and destinations can scale with that at the relay.

  10. Targeting duplex DNA with chimeric α,β-triplex-forming oligonucleotides

    PubMed Central

    Kolganova, N. A.; Shchyolkina, A. K.; Chudinov, A. V.; Zasedatelev, A. S.; Florentiev, V. L.; Timofeev, E. N.

    2012-01-01

    Triplex-directed DNA recognition is strictly limited by polypurine sequences. In an attempt to address this problem with synthetic biology tools, we designed a panel of short chimeric α,β-triplex-forming oligonucleotides (TFOs) and studied their interaction with fluorescently labelled duplex hairpins using various techniques. The hybridization of hairpin with an array of chimeric probes suggests that recognition of double-stranded DNA follows complicated rules combining reversed Hoogsteen and non-canonical homologous hydrogen bonding. In the presence of magnesium ions, chimeric TFOs are able to form highly stable α,β-triplexes, as indicated by native gel-electrophoresis, on-array thermal denaturation and fluorescence-quenching experiments. CD spectra of chimeric triplexes exhibited features typically observed for anti-parallel purine triplexes with a GA or GT third strand. The high potential of chimeric α,β-TFOs in targeting double-stranded DNA was demonstrated in the EcoRI endonuclease protection assay. In this paper, we report, for the first time, the recognition of base pair inversions in a duplex by chimeric TFOs containing α-thymidine and α-deoxyguanosine. PMID:22641847

  11. Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

    2001-04-01

    Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

  12. A single-tube duplex and multiplex PCR for simultaneous detection of four cassava mosaic begomovirus species in cassava plants.

    PubMed

    Aloyce, R C; Tairo, F; Sseruwagi, P; Rey, M E C; Ndunguru, J

    2013-04-01

    A single-tube duplex and multiplex PCR was developed for the simultaneous detection of African cassava mosaic virus (ACMV), East African cassava mosaic Cameroon virus (EACMCV), East African cassava mosaic Malawi virus (EACMMV) and East African cassava mosaic Zanzibar virus (EACMZV), four cassava mosaic begomoviruses (CMBs) affecting cassava in sub-Saharan Africa. Co-occurrence of the CMBs in cassava synergistically enhances disease symptoms and complicates their detection and diagnostics. Four primer pairs were designed to target DNA-A component sequences of cassava begomoviruses in a single tube PCR amplification using DNA extracted from dry-stored cassava leaves. Duplex and multiplex PCR enabled the simultaneous detection and differentiation of the four CMBs, namely ACMV (940bp), EACMCV (435bp), EACMMV (504bp) and EACMZV (260bp) in single and mixed infections, and sequencing results confirmed virus identities according to the respective published sequences of begomovirus species. In addition, we report here a modified Dellapotra et al. (1983) protocol, which was used to extract DNA from dry and fresh cassava leaves with comparable results. Using the duplex and multiplex techniques, time was saved and amount of reagents used were reduced, which translated into reduced cost of the diagnostics. This tool can be used by cassava breeders screening for disease resistance; scientists doing virus diagnostic studies; phytosanitary officers checking movement of diseased planting materials, and seed certification and multipliers for virus indexing.

  13. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  14. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    PubMed

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  15. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  16. Cavitation Erosion of Sensitized UNS S31803 Duplex Stainless Steels

    NASA Astrophysics Data System (ADS)

    Mitelea, Ion; Micu, Lavinia Mădălina; Bordeaşu, Ilare; Crăciunescu, Corneliu Marius

    2016-05-01

    During processing or use, duplex steels can be subjected to heating at high temperatures that can affect their behavior. This work aims to correlate the influence of the sensitization treatment on the ultrasonic cavitation erosion behavior of a UNS S31803 (X2CrNiMoN22-5-3) duplex stainless steel. Duplex stainless steels, formed as a result of rapid cooling after solution annealing, are sensitized at temperatures of 475 and 850 °C, respectively, leading to hardening and embrittlement due to the spinodal decomposition of the ferrite and the precipitation of secondary phases. The ultrasonic cavitation erosion experiments showed that the sensitization at 850 °C reduced the mean depth of erosion by about 11% and the mean depth of erosion rate by 28%. By contrast, the sensitization at 475 °C deteriorates the cavitation erosion resistance, increasing the erosion parameters by up to 22%, compared to the solution annealed state.

  17. Defined presentation of carbohydrates on a duplex DNA scaffold.

    PubMed

    Schlegel, Mark K; Hütter, Julia; Eriksson, Magdalena; Lepenies, Bernd; Seeberger, Peter H

    2011-12-16

    A new method for the spatially defined alignment of carbohydrates on a duplex DNA scaffold is presented. The use of an N-hydroxysuccinimide (NHS)-ester phosphoramidite along with carbohydrates containing an alkylamine linker allows for on-column labeling during solid-phase oligonucleotide synthesis. This modification method during solid-phase synthesis only requires the use of minimal amounts of complex carbohydrates. The covalently attached carbohydrates are presented in the major groove of the B-form duplex DNA as potential substrates for murine type II C-type lectin receptors mMGL1 and mMGL2. CD spectroscopy and thermal melting revealed only minimal disturbance of the overall helical structure. Surface plasmon resonance and cellular uptake studies with bone-marrow-derived dendritic cells were used to assess the capability of these carbohydrate-modified duplexes to bind to mMGL receptors.

  18. CMOS serial link for fully duplexed data communication

    NASA Astrophysics Data System (ADS)

    Lee, Kyeongho; Kim, Sungjoon; Ahn, Gijung; Jeong, Deog-Kyoon

    1995-04-01

    This paper describes a CMOS serial link allowing fully duplexed 500 Mbaud serial data communication. The CMOS serial link is a robust and low-cost solution to high data rate requirements. A central charge pump PLL for generating multiphase clocks for oversampling is shared by several serial link channels. Fully duplexed serial data communication is realized in the bidirectional bridge by separating incoming data from the mixed signal on the cable end. The digital PLL accomplishes process-independent data recovery by using a low-ratio oversampling, a majority voting, and a parallel data recovery scheme. Mostly, digital approach could extend its bandwidth further with scaled CMOS technology. A single channel serial link and a charge pump PLL are integrated in a test chip using 1.2 micron CMOS process technology. The test chip confirms upto 500 Mbaud unidirectional mode operation and 320 Mbaud fully duplexed mode operation with pseudo random data patterns.

  19. Pairing Learners in Pair Work Activity

    ERIC Educational Resources Information Center

    Storch, Neomy; Aldosari, Ali

    2013-01-01

    Although pair work is advocated by major theories of second language (L2) learning and research findings suggest that pair work facilitates L2 learning, what is unclear is how to best pair students in L2 classes of mixed L2 proficiency. This study investigated the nature of pair work in an English as a Foreign Language (EFL) class in a college in…

  20. On the thermomechanical deformation behavior of duplex-type materials

    NASA Astrophysics Data System (ADS)

    Siegmund, T.; Werner, E.; Fischer, F. D.

    1995-04-01

    Two-phase duplex-type materials possess microstructures containing roughly the same amounts of the constituent phases whose grains form interwoven networks. Duplex stainless steels are typical representatives of this material group. In these steels the constituent phases austenite and ferrite have different coefficients of thermal expansion. On pure thermal loading or thermomechanical loading the yield strength of the phases can be exceeded. Specimens of a forged duplex steel with a uniaxially anisotropic micro-structure deform irreversibly even under pure thermal cycling conditions with a monotonic accumulation of strain. The results of a systematic finite element based micromechanical analysis of the thermomechanical deformation behavior of duplex steels are presented and discussed. The analysis is based on a quantitative characterization of both the real and model microstructures. Additionally, an extended constitutive material law for the thermomechanical loading of the duplex steel is proposed. For dual-phase materials this description incorporates an additional thermomechanical strain increment as a very important contribution to the total strain increment. Both the micromechanical model and the analytical model are used to analyse the experimental findings from dilatometer tests. The micromechanical approach allows the evolution of the irreversible strains in the two phases generated in a thermal cycle to be modeled. It is shown that the matrix-phase is always more deformed than the inclusion-phase, irrespective of which of the two phases (austenite or ferrite) forms the matrix. This prediction is confirmed by electron microscopic observations of a thermally cycled duplex steel. Based on these results a mechanism driving the ratchet effect is proposed.

  1. Several Cis-regulatory Elements Control mRNA Stability, Translation Efficiency, and Expression Pattern of Prrxl1 (Paired Related Homeobox Protein-like 1)*

    PubMed Central

    Regadas, Isabel; Matos, Mariana Raimundo; Monteiro, Filipe Almeida; Gómez-Skarmeta, José Luis; Lima, Deolinda; Bessa, José; Casares, Fernando; Reguenga, Carlos

    2013-01-01

    The homeodomain transcription factor Prrxl1/DRG11 has emerged as a crucial molecule in the establishment of the pain circuitry, in particular spinal cord targeting of dorsal root ganglia (DRG) axons and differentiation of nociceptive glutamatergic spinal cord neurons. Despite Prrxl1 importance in the establishment of the DRG-spinal nociceptive circuit, the molecular mechanisms that regulate its expression along development remain largely unknown. Here, we show that Prrxl1 transcription is regulated by three alternative promoters (named P1, P2, and P3), which control the expression of three distinct Prrxl1 5′-UTR variants, named 5′-UTR-A, 5′-UTR-B, and 5′-UTR-C. These 5′-UTR sequences confer distinct mRNA stability and translation efficiency to the Prrxl1 transcript. The most conserved promoter (P3) contains a TATA-box and displays in vivo enhancer activity in a pattern that overlaps with the zebrafish Prrxl1 homologue, drgx. Regulatory modules present in this sequence were identified and characterized, including a binding site for Phox2b. Concomitantly, we demonstrate that zebrafish Phox2b is required for the expression of drgx in the facial, glossopharyngeal, and vagal cranial ganglia. PMID:24214975

  2. Chemical structure and properties of interstrand cross-links formed by reaction of guanine residues with abasic sites in duplex DNA.

    PubMed

    Catalano, Michael J; Liu, Shuo; Andersen, Nisana; Yang, Zhiyu; Johnson, Kevin M; Price, Nathan E; Wang, Yinsheng; Gates, Kent S

    2015-03-25

    A new type of interstrand cross-link resulting from the reaction of a DNA abasic site with a guanine residue on the opposing strand of the double helix was recently identified, but the chemical connectivity of the cross-link was not rigorously established. The work described here was designed to characterize the chemical structure and properties of dG-AP cross-links generated in duplex DNA. The approach involved characterization of the nucleoside cross-link "remnant" released by enzymatic digestion of DNA duplexes containing the dG-AP cross-link. We first carried out a chemical synthesis and complete spectroscopic structure determination of the putative cross-link remnant 9b composed of a 2-deoxyribose adduct attached to the exocyclic N(2)-amino group of dG. A reduced analogue of the cross-link remnant was also prepared (11b). Liquid chromatography-tandem mass spectrometric (LC-MS/MS) analysis revealed that the retention times and mass spectral properties of synthetic standards 9b and 11b matched those of the authentic cross-link remnants released by enzymatic digestion of duplexes containing the native and reduced dG-AP cross-link, respectively. These results establish the chemical connectivity of the dG-AP cross-link released from duplex DNA and provide a foundation for detection of this lesion in biological samples. The dG-AP cross-link in duplex DNA was remarkably stable, decomposing with a half-life of 22 days at pH 7 and 23 °C. The intrinsic chemical stability of the dG-AP cross-link suggests that this lesion in duplex DNA may have the power to block DNA-processing enzymes involved in transcription and replication.

  3. Specific DNA duplex formation at an artificial lipid bilayer: fluorescence microscopy after Sybr Green I staining.

    PubMed

    Werz, Emma; Rosemeyer, Helmut

    2014-01-01

    The article describes the immobilization of different probe oligonucleotides (4, 7, 10) carrying each a racemic mixture of 2,3-bis(hexadecyloxy)propan-1-ol (1a) at the 5'-terminus on a stable artificial lipid bilayer composed of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC). The bilayer separates two compartments (cis/trans channel) of an optical transparent microfluidic sample carrier with perfusion capabilities. Injection of unlabeled target DNA sequences (6, 8, or 9), differing in sequence and length, leads in the case of complementarity to the formation of stable DNA duplexes at the bilayer surface. This could be verified by Sybr Green I double strand staining, followed by incubation periods and thorough perfusions, and was visualized by single molecule fluorescence spectroscopy and microscopy. The different bilayer-immobilized complexes consisting of various DNA duplexes and the fluorescent dye were studied with respect to the kinetics of their formation as well as to their stability against perfusion.

  4. An experimental and analytical study of the stability of counter-rotating vortex pairs with applications for aircraft wake turbulence control

    NASA Astrophysics Data System (ADS)

    Babie, Brian Matthew

    Aircraft trailing vortex wakes are commonly referred to as `wake turbulence' and may pose a flight safety hazard to other aircraft that may encounter the wake. This hazard is of critical interest during the take-off and landing stages of flight, where aircraft are in the closest proximity to one another. During these flight stages, it is common for transport aircraft to be in a high-lift, or flaps down, configuration. In an effort to study these wakes a generic four-vortex wake is generated experimentally, such that the results are independent of a specific wing loading condition. Three principle objectives served to focus the research project that is presented in this dissertation. The first two objectives were to develop an improved understanding of the wake configurations that were conducive to large instability growth rates and to subsequently use quantitative methods to identify the instability modes that dominate the far-field wake dynamic. With a clear understanding of the physics of an unstable aircraft wake, the third objective of the research project was to use this newly attained information to recommend methods for a reliable wake control strategy. A compilation of flow visualization results shows a design space of counter-rotating wake configurations, defined by the circulation and span ratios, where rapidly amplifying instabilities are consistently seen to exist. This design space is also seen to encompass rigidly-translating wake systems. A combination of quantitative flow visualization estimates, hot-wire anemometry and an analytical stability analysis was successful in identifying two forms of bending wave instability, namely the long and short-wavelength modes. Having identified two bending instability modes in the experimental wake, it was possible to suggest a strategy by which these modes could be exploited for the control of aircraft wakes.

  5. Synthesis of specific diastereomers of a DNA methylphosphonate heptamer, d(CpCpApApApCpA), and stability of base pairing with the normal DNA octamer d(TPGPTPTPTPGPGPC).

    PubMed Central

    Vyazovkina, E V; Savchenko, E V; Lokhov, S G; Engels, J W; Wickstrom, E; Lebedev, A V

    1994-01-01

    DNA methylphosphonates are candidate derivatives for use in antisense DNA therapy. Their efficacy is limited by weak hybridization. One hypothesis to explain this phenomenon holds that one configuration of the chiral methylphosphonate linkage, Rp, permits stronger base pairing than the other configuration, Sp. To test this hypothesis, four specific pairs of Rp and Sp diastereomers of the DNA methylphosphonate heptamer d(CpCpApApApCpA) were prepared by block coupling of different combinations of individual diastereomers of d(CpCpApA) and d(ApCpA). Each pair of the diastereomers of the heptamer was separated into individual diastereomes using affinity chromatography on a Lichrosorb-NH2 silica column with a covalently attached complementary normal DNA octamer, d(pTpGpTpTpTpGpGpC). The stabilities of complementary complexes of phosphodiester d(TpGpTpTpTpGpGpC) with 8 individual diastereomers of methylphosphonate d(CpCpApApApCpA) were studied by measuring their melting temperatures (Tm). A direct correlation of Tm values with the number of Rp methylphosphonate centers in the heptamer was found: the more Rp centers, the higher the stability of the complex. Tm values for the diastereomers with 6 all-Rp or all-Sp methylphosphonate centers were found to be 30.5 degrees and 12.5 degrees C, respectively, in 100 mM NaCl, 10 mM Na2HPO4, 1 mM EDTA, pH 7.0 with 15 microM of each oligomer. On the average, each substitution of one Rp-center to an Sp-center in the heptamer decreased the Tm by 3 degrees C. Under the same conditions, the Tm of the normal DNA heptamer with its complement was 21 degrees C. These results are consistent with the model that all-Rp methylphosphonate DNAs hybridize much more tightly to complementary normal DNA than do racemic methylphosphonate DNAs, and may therefore exhibit greater potency as antisense inhibitors. PMID:8036171

  6. Homologous pairing and the role of pairing centers in meiosis.

    PubMed

    Tsai, Jui-He; McKee, Bruce D

    2011-06-15

    Homologous pairing establishes the foundation for accurate reductional segregation during meiosis I in sexual organisms. This Commentary summarizes recent progress in our understanding of homologous pairing in meiosis, and will focus on the characteristics and mechanisms of specialized chromosome sites, called pairing centers (PCs), in Caenorhabditis elegans and Drosophila melanogaster. In C. elegans, each chromosome contains a single PC that stabilizes chromosome pairing and initiates synapsis of homologous chromosomes. Specific zinc-finger proteins recruited to PCs link chromosomes to nuclear envelope proteins--and through them to the microtubule cytoskeleton--thereby stimulating chromosome movements in early prophase, which are thought to be important for homolog sorting. This mechanism appears to be a variant of the 'telomere bouquet' process, in which telomeres cluster on the nuclear envelope, connect chromosomes through nuclear envelope proteins to the cytoskeleton and lead chromosome movements that promote homologous synapsis. In Drosophila males, which undergo meiosis without recombination, pairing of the largely non-homologous X and Y chromosomes occurs at specific repetitive sequences in the ribosomal DNA. Although no other clear examples of PC-based pairing mechanisms have been described, there is evidence for special roles of telomeres and centromeres in aspects of chromosome pairing, synapsis and segregation; these roles are in some cases similar to those of PCs.

  7. Chirality- and sequence-selective successive self-sorting via specific homo- and complementary-duplex formations

    PubMed Central

    Makiguchi, Wataru; Tanabe, Junki; Yamada, Hidekazu; Iida, Hiroki; Taura, Daisuke; Ousaka, Naoki; Yashima, Eiji

    2015-01-01

    Self-recognition and self-discrimination within complex mixtures are of fundamental importance in biological systems, which entirely rely on the preprogrammed monomer sequences and homochirality of biological macromolecules. Here we report artificial chirality- and sequence-selective successive self-sorting of chiral dimeric strands bearing carboxylic acid or amidine groups joined by chiral amide linkers with different sequences through homo- and complementary-duplex formations. A mixture of carboxylic acid dimers linked by racemic-1,2-cyclohexane bis-amides with different amide sequences (NHCO or CONH) self-associate to form homoduplexes in a completely sequence-selective way, the structures of which are different from each other depending on the linker amide sequences. The further addition of an enantiopure amide-linked amidine dimer to a mixture of the racemic carboxylic acid dimers resulted in the formation of a single optically pure complementary duplex with a 100% diastereoselectivity and complete sequence specificity stabilized by the amidinium–carboxylate salt bridges, leading to the perfect chirality- and sequence-selective duplex formation. PMID:26051291

  8. A duplex recombinant viral nucleoprotein microbead immunoassay for simultaneous detection of seroresponses to human respiratory syncytial virus and metapneumovirus infections.

    PubMed

    Zhang, Yange; Brooks, W Abdullah; Goswami, Doli; Rahman, Mustafizur; Luby, Stephen P; Erdman, Dean D

    2014-09-01

    Serologic diagnosis of human respiratory syncytial virus (hRSV) and human metapneumovirus (hMPV) infections has been shown to complement virus detection methods in epidemiologic studies. Enzyme immunoassays (EIAs) using cultured virus lysate antigens are often used to diagnose infection by demonstration of a ≥4-fold rises in antibody titer between acute and convalescent serum pairs. In this study, hRSV and hMPV nucleocapsid (recN) proteins were expressed in a baculovirus system and their performance compared with virus culture lysate antigen in EIAs using paired serum specimens collected from symptomatic children. The recN proteins were also used to develop a duplex assay based on the Luminex microbead-based suspension array technology, where diagnostic rises in antibody levels could be determined simultaneously at a single serum dilution. Antibody levels measured by the recN and viral lysate EIAs correlated moderately (hRSV, r(2)=0.72; hMPV, r(2)=0.76); the recN EIAs identified correctly 35 of 37 (94.6%) and 48 of 50 (96%) serum pairs showing diagnostic antibody rises by viral lysate EIAs. Purified recN proteins were then coupled to microbeads and serum pairs were tested at a single dilution on a Luminex MAGPIX(®) analyzer. The duplex recN assay identified correctly 33 of 39 (85%) and 41 of 47 (86.7%) serum pairs showing diagnostic rises to hRSV and hMPV, respectively. The recN assay permits simultaneous testing for acute hRSV and hMPV infections and offers a platform for expanded multiplexing of other respiratory virus assays.

  9. Computer Maintenance Operations Center (CMOC), showing duplexed cyber 170174 computers ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Computer Maintenance Operations Center (CMOC), showing duplexed cyber 170-174 computers - Beale Air Force Base, Perimeter Acquisition Vehicle Entry Phased-Array Warning System, Techinical Equipment Building, End of Spencer Paul Road, north of Warren Shingle Road (14th Street), Marysville, Yuba County, CA

  10. FRONT VIEW OF FACILITY 561, WHICH WAS ORIGINALLY A DUPLEX. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    FRONT VIEW OF FACILITY 561, WHICH WAS ORIGINALLY A DUPLEX. PHOTO SHOWS THE ONLY UNIT REMAINING, UNIT B (UNIT A WAS DEMOLISHED AFTER A FIRE). VIEW FACING NORTH - Camp H.M. Smith and Navy Public Works Center Manana Title VII (Capehart) Housing, Intersection of Acacia Road and Brich Circle, Pearl City, Honolulu County, HI

  11. [Interaction of Dystamycin Dimeric Analog with Poly(dA) x poly(dT), Poly[d(A-T)] x poly[d(A-T)] and Duplex O23 at Origin of Replication of the Herpes Simplex Virus].

    PubMed

    Surovaya, A N; Bazhulina, N P; Lepehina, S Yu; Andronova, V L; Galegov, G A; Moiseeva, E D; Grokhovsky, S L; Gursky, G V

    2016-01-01

    The binding of distamycin dimeric analog (Pt-bis-Dst) to poly[d(A-T)] x poly[d(A-T)1, poly(dA) x poly(dT) and duplex O23 with the sequence 5'-GCCAATATATATATATTATTAGG-3' which is present at the origin of replication of herpes simplex virus OriS is investigated with the use of UV and CD spectroscopy. The distinction of the synthetic polyamide from a natural antibiotic lies in the fact that in the synthetic polyamide there are two distamycin moieties bound via a glycine cis-diamino platinum group. It was shown that the binding of Pt-bis-Dst to poly[d(A-T)] x poly[d(A-T)] and poly(dA) x poly(dT) reaches saturation if one molecule of the ligand occurs at approximately every 8 bp. With further increase in the ratio of the added ligand to the base pairs in CD spectra of complexes with poly[d(A-T)] x poly[d(A-T)], we observed that the maximum wavelength band tend to be shifted towards longer wavelengths, while in the spectral region of 290-310 nm a "shoulder", that was absent in the spectra of the complexes obtained at low polymer coverages by the ligand, appeared. At high molar concentration ratios of ligand to oligonucleotide Pt-bis-Dst can bind to poly[d(A-T)] x poly[d(A-T)] in the form of hairpins or may form associates by the interaction between the distamycin moieties of neighboring molecules of Pt-bis-Dst. The structure of the complexes is stabilized by interactions between pirrolcarboxamide moieties of two molecules of Pt-bis-Dst adsorbed on adjacent overlapping binding sites. These interactions are probably also responsible for the concentration-dependent spectral changes observed during the formation of a complex between Pt-bis-Dst and poly[d(A-T)] x poly[d(A-T)]. Spectral changes are almost absent in binding of Pt-bis-Dst to poly(dA) x poly(dT). Binding of Pt-bis-Dst to duplex O23 reaches saturation if two ligand molecules occur in a duplex that contains a cluster of 18 AT pairs. With increasing the molar concentration ratio of the ligand to the duplex CD

  12. Mapping structurally defined guanine oxidation products along DNA duplexes: influence of local sequence context and endogenous cytosine methylation.

    PubMed

    Ming, Xun; Matter, Brock; Song, Matthew; Veliath, Elizabeth; Shanley, Ryan; Jones, Roger; Tretyakova, Natalia

    2014-03-19

    DNA oxidation by reactive oxygen species is nonrandom, potentially leading to accumulation of nucleobase damage and mutations at specific sites within the genome. We now present the first quantitative data for sequence-dependent formation of structurally defined oxidative nucleobase adducts along p53 gene-derived DNA duplexes using a novel isotope labeling-based approach. Our results reveal that local nucleobase sequence context differentially alters the yields of 2,2,4-triamino-2H-oxal-5-one (Z) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (OG) in double stranded DNA. While both lesions are overproduced within endogenously methylated (Me)CG dinucleotides and at 5' Gs in runs of several guanines, the formation of Z (but not OG) is strongly preferred at solvent-exposed guanine nucleobases at duplex ends. Targeted oxidation of (Me)CG sequences may be caused by a lowered ionization potential of guanine bases paired with (Me)C and the preferential intercalation of riboflavin photosensitizer adjacent to (Me)C:G base pairs. Importantly, some of the most frequently oxidized positions coincide with the known p53 lung cancer mutational "hotspots" at codons 245 (GGC), 248 (CGG), and 158 (CGC) respectively, supporting a possible role of oxidative degradation of DNA in the initiation of lung cancer.

  13. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    PubMed

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  14. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes

    NASA Astrophysics Data System (ADS)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-03-01

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10-3 to 10-5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  15. Development and evaluation of a single-step duplex PCR for simultaneous detection of Fasciola hepatica and Fasciola gigantica (family Fasciolidae, class Trematoda, phylum Platyhelminthes).

    PubMed

    Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

    2012-08-01

    A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.

  16. The physical determinants of the DNA conformational landscape: an analysis of the potential energy surface of single-strand dinucleotides in the conformational space of duplex DNA

    PubMed Central

    Elsawy, Karim M.; Hodgson, Michael K.; Caves, Leo S. D.

    2005-01-01

    A multivariate analysis of the backbone and sugar torsion angles of dinucleotide fragments was used to construct a 3D principal conformational subspace (PCS) of DNA duplex crystal structures. The potential energy surface (PES) within the PCS was mapped for a single-strand dinucleotide model using an empirical energy function. The low energy regions of the surface encompass known DNA forms and also identify previously unclassified conformers. The physical determinants of the conformational landscape are found to be predominantly steric interactions within the dinucleotide backbone, with medium-dependent backbone-base electrostatic interactions serving to tune the relative stability of the different local energy minima. The fidelity of the PES to duplex DNA properties is validated through a correspondence to the conformational distribution of duplex DNA crystal structures and the reproduction of observed sequence specific propensities for the formation of A-form DNA. The utility of the PES is demonstrated through its succinct and accurate description of complex conformational processes in simulations of duplex DNA. The study suggests that stereochemical considerations of the nucleic acid backbone play a role in determining conformational preferences of DNA which is analogous to the role of local steric interactions in determining polypeptide secondary structure. PMID:16214808

  17. Assessment of thermal embrittlement in duplex stainless steels 2003 and 2205 for nuclear power applications

    DOE PAGES

    Tucker, J. D.; Miller, M. K.; Young, G. A.

    2015-04-01

    Duplex stainless steels are desirable for use in power generation systems due to their attractive combination of strength, corrosion resistance, and cost. However, thermal embrittlement at intermediate homologous temperatures of ~887°F (475°C) and below, via spinodal decomposition, limits upper service temperatures for many applications. New lean grade duplex alloys have improved thermal stability over standard grades and potentially increase the upper service temperature or the lifetime at a given temperature for this class of material. The present work compares the thermal stability of lean grade, alloy 2003 to standard grade, alloy 2205, through a series of isothermal agings between 500°Fmore » (260°C) and 900°F (482°C) for times between 1 and 10,000 hours. Aged samples were characterized by changes in microhardness and impact toughness. Additionally, atom probe tomography was performed to illustrate the evolution of the α-α' phase separation in both alloys at select conditions. Atom probe tomography confirmed that phase separation occurs via spinodal decomposition for both alloys and identified the formation of Ni-Cu-Si-Mn-P clusters in alloy 2205 that may contribute to embrittlement of this alloy. The impact toughness model predictions for upper service temperature show that alloy 2003 can be considered for use in 550°F applications for 80 year service lifetimes based on a Charpy V-notch criteria of 35 ft-lbs at 70°F. Alloy 2205 should be limited to 500°F applications.« less

  18. Assessment of thermal embrittlement in duplex stainless steels 2003 and 2205 for nuclear power applications

    SciTech Connect

    Tucker, J. D.; Miller, M. K.; Young, G. A.

    2015-04-01

    Duplex stainless steels are desirable for use in power generation systems due to their attractive combination of strength, corrosion resistance, and cost. However, thermal embrittlement at intermediate homologous temperatures of ~887°F (475°C) and below, via spinodal decomposition, limits upper service temperatures for many applications. New lean grade duplex alloys have improved thermal stability over standard grades and potentially increase the upper service temperature or the lifetime at a given temperature for this class of material. The present work compares the thermal stability of lean grade, alloy 2003 to standard grade, alloy 2205, through a series of isothermal agings between 500°F (260°C) and 900°F (482°C) for times between 1 and 10,000 hours. Aged samples were characterized by changes in microhardness and impact toughness. Additionally, atom probe tomography was performed to illustrate the evolution of the α-α' phase separation in both alloys at select conditions. Atom probe tomography confirmed that phase separation occurs via spinodal decomposition for both alloys and identified the formation of Ni-Cu-Si-Mn-P clusters in alloy 2205 that may contribute to embrittlement of this alloy. The impact toughness model predictions for upper service temperature show that alloy 2003 can be considered for use in 550°F applications for 80 year service lifetimes based on a Charpy V-notch criteria of 35 ft-lbs at 70°F. Alloy 2205 should be limited to 500°F applications.

  19. Electron interaction with a DNA duplex: dCpdC:dGpdG.

    PubMed

    Gu, Jiande; Wang, Jing; Leszczynski, Jerzy

    2016-05-21

    Electron attachment to double-stranded cytosine-rich DNA, dCpdC:dGpdG, has been studied by density functional theory. This system represents a minimal descriptive unit of a cytosine-rich double-stranded DNA helix. A significant electron affinity for the formation of a cytosine-centered radical anion is revealed to be about 2.2 eV. The excess electron may reside on the nucleobase at the 5' position (dC˙(-)pdC:dGpdG) or at the 3' position (dCpdC˙(-):dGpdG). The inter-strand proton transfer between the radical anion centered cytosine (N3) and the paired guanine (HN1) results in the formation of radical anion center separated complexes dC1H˙pdC:dG2-H(-)pdG and dCpdC2H˙:dGpdG1-H(-). These distonic radical anions are found to be approximately 1 to 4 kcal mol(-1) more stable than the normal radical anions. Intra-strand cytosine π→π transition energies are below the electron detachment energy. Inter-strand π→π transitions of the excess electron from C to G are predicted to be less than 2.79 eV. Electron transfer might also be possible through the inter-strand base-jumping mode. An analysis of absorption visible spectra reveals the absorption bands ranging from 500 nm to 700 nm for the cytosine-rich radical anions of the DNA duplex. Electron attachment to cytidine oligomers might add color to the DNA duplex.

  20. Homologous recombination intermediates between two duplex DNA catalysed by human cell extracts.

    PubMed Central

    Lopez, B; Rousset, S; Coppey, J

    1987-01-01

    Using as substrates, 1: the replicative form (RF) of phage M13 mp8 in which the reading frame of the lac Z' gene was disrupted by insertion of an octonucleotide, and 2: a restriction fragment one kb long, containing the functional lac Z' gene (isolated from wild type M13 mp8), we show that nuclear extracts from human cells (3 lines tested) promote the targeted replacement of the altered sequence by the functional one. Following incubation with the extracts, the DNA's were introduced in JM 109 bacteria (rec A- and lac Z'-) which were grown in presence of a colorimetric indicator of beta-galactosidase activity. Homologous recombination gives rise to the genotypical modification: lac Z'+ instead of lac Z'- in the bacteriophage DNA. This is revealed by phenotypical expression of the lac Z' gene product in replicating bacteriophage, i.e. the formation of blue instead of white plaques. The frequency of recombination (blue/total plaques) is increased by a factor of 50-80 as a function of protein concentration and of incubation time. The maximal frequency observed is 5 X 10(-5). There is no increase over the background when extracts are boiled. Electrophoresis and electron microscopy of DNA's incubated with the extracts show the formation of recombination intermediates with single strand exchange. Restriction analysis of recombined DNA confirms that the process corresponds to targeted sequence exchange. These data allow to propose three steps for homologous recombination between two duplex DNA's: i) unpairing of the two duplexes; ii) single-strand exchange and synaptic pairing; iii) resolution of the cross-junctions. The three steps correspond to those predicted by the gene conversion model of Holliday. Images PMID:3302944

  1. Stability of Electron Pairs--A Myth.

    ERIC Educational Resources Information Center

    Duke, B. J.

    1978-01-01

    This article discusses errors in the presentation of valence theory in undergraduate chemistry textbooks, and the resulting misunderstandings in the minds of many students. Particular emphasis is given to the explanation of the trend in ionization energies along the first row of the periodic table. (BB)

  2. Target-controlled formation of silver nanoclusters in abasic site-incorporated duplex DNA for label-free fluorescence detection of theophylline

    NASA Astrophysics Data System (ADS)

    Park, Ki Soo; Oh, Seung Soo; Soh, H. Tom; Park, Hyun Gyu

    2014-08-01

    A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to the cytosine nucleobase is prevented. Consequently, fluorescent silver nanoclusters are not formed causing a significant reduction of the fluorescence signal. By employing this new sensor, theophylline can be highly selectively detected at a concentration as low as 1.8 μM. Finally, the diagnostic capability and practical application of this sensor were demonstrated by its use in detecting theophylline in human blood serum.A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to

  3. Crystal structure of a model branchpoint-U2 snRNA duplex containing bulged adenosines.

    PubMed Central

    Berglund, J A; Rosbash, M; Schultz, S C

    2001-01-01

    Bulged nucleotides play a variety of important roles in RNA structure and function, frequently forming tertiary interactions and sometimes even participating in RNA catalysis. In pre-mRNA splicing, the U2 snRNA base pairs with the intron branchpoint sequence (BPS) to form a short RNA duplex that contains a bulged adenosine that ultimately serves as the nucleophile that attacks the 5' splice site. We have determined a 2.18-A resolution crystal structure of a self-complementary RNA designed to mimic the highly conserved yeast (Saccharomyces cerevisiae) branchpoint sequence (5'-UACUAACGUAGUA with the BPS italicized and the branchsite adenosine underlined) base paired with its complementary sequence from U2 snRNA. The structure shows a nearly ideal A-form helix from which two unpaired adenosines flip out. Although the adenosine adjacent to the branchsite adenosine is the one bulged out in the structure described here, either of these adenosines can serve as the nucleophile in mammalian but not in yeast pre-mRNA splicing. In addition, the packing of the bulged RNA helices within the crystal reveals a novel RNA tertiary interaction in which three RNA helices interact through bulged adenosines in the absence of any divalent metal ions. PMID:11350032

  4. DNA hairpins destabilize duplexes primarily by promoting melting rather than by inhibiting hybridization

    PubMed Central

    Schreck, John S.; Ouldridge, Thomas E.; Romano, Flavio; Šulc, Petr; Shaw, Liam P.; Louis, Ard A.; Doye, Jonathan P.K.

    2015-01-01

    The effect of secondary structure on DNA duplex formation is poorly understood. Using oxDNA, a nucleotide level coarse-grained model of DNA, we study how hairpins influence the rate and reaction pathways of DNA hybridzation. We compare to experimental systems studied by Gao et al. (1) and find that 3-base pair hairpins reduce the hybridization rate by a factor of 2, and 4-base pair hairpins by a factor of 10, compared to DNA with limited secondary structure, which is in good agreement with experiments. By contrast, melting rates are accelerated by factors of ∼100 and ∼2000. This surprisingly large speed-up occurs because hairpins form during the melting process, and significantly lower the free energy barrier for dissociation. These results should assist experimentalists in designing sequences to be used in DNA nanotechnology, by putting limits on the suppression of hybridization reaction rates through the use of hairpins and offering the possibility of deliberately increasing dissociation rates by incorporating hairpins into single strands. PMID:26056172

  5. Microstructure, Properties and Weldability of Duplex Stainless Steel 2101

    NASA Astrophysics Data System (ADS)

    Ma, Li; Hu, Shengsun; Shen, Junqi

    2017-01-01

    The continuous development of duplex stainless steels (DSSs) is due to their excellent corrosion resistance in aggressive environments and their mechanical strength, which is usually twice of conventional austenitic stainless steels (ASSs). In this paper, a designed lean duplex stainless steel 2101, with the alloy design of reduced nickel content and increased additions of manganese and nitrogen, is studied by being partly compared with typical ASS 304L steels. The microstructure, mechanical properties, impact toughness, corrosion resistance and weldability of the designed DSS 2101 were conducted. The results demonstrated that both 2101 steel and its weldment show excellent mechanical properties, impact toughness and corrosion resistance, so DSS 2101 exhibits good comprehensive properties and can be used to replace 304L in numerous applications.

  6. Investigation of plastic deformation heterogeneities in duplex steel by EBSD

    SciTech Connect

    Wronski, S.; Tarasiuk, J.; Bacroix, B.; Baczmanski, A.; Braham, C.

    2012-11-15

    An EBSD analysis of a duplex steel (austeno-ferritic) deformed in tension up to fracture is presented. The main purpose of the paper is to describe, qualitatively and quantitatively, the differences in the behavior of the two phases during plastic deformation. In order to do so, several topological maps are measured on the deformed state using the electron backscatter diffraction technique. Distributions of grain size, misorientation, image quality factor and texture are then analyzed in detail. - Highlights: Black-Right-Pointing-Pointer Heterogeneities in duplex steel is studied. Black-Right-Pointing-Pointer The behavior of the two phases during plastic deformation is studied. Black-Right-Pointing-Pointer IQ factor distribution and misorientation characteristics are examined using EBSD.

  7. Direct surface-enhanced Raman scattering analysis of DNA duplexes.

    PubMed

    Guerrini, Luca; Krpetić, Željka; van Lierop, Danny; Alvarez-Puebla, Ramon A; Graham, Duncan

    2015-01-19

    The exploration of the genetic information carried by DNA has become a major scientific challenge. Routine DNA analysis, such as PCR, still suffers from important intrinsic limitations. Surface-enhanced Raman spectroscopy (SERS) has emerged as an outstanding opportunity for the development of DNA analysis, but its application to duplexes (dsDNA) has been largely hampered by reproducibility and/or sensitivity issues. A simple strategy is presented to perform ultrasensitive direct label-free analysis of unmodified dsDNA with the means of SERS by using positively charged silver colloids. Electrostatic adhesion of DNA promotes nanoparticle aggregation into stable clusters yielding intense and reproducible SERS spectra at nanogram level. As potential applications, we report the quantitative recognition of hybridization events as well as the first examples of SERS recognition of single base mismatches and base methylations (5-methylated cytosine and N6-methylated Adenine) in duplexes.

  8. Herpes Zoster Duplex Unilateralis: Two Cases and Brief Literature Review

    PubMed Central

    Son, Jee Hee; Chung, Bo Young; Kim, Hye One; Cho, Hee Jin

    2016-01-01

    Cases involving dermatomal herpes zoster in two or more locations are rare, especially in immunocompetent patients. When two noncontiguous dermatomes are involved, if affected unilaterally, it is called herpes zoster duplex unilateralis; if bilaterally, bilateralis. Here, we report two cases of herpes zoster duplex unilateralis. A 66-year-old man presented with painful erythematous grouped vesicles on his left scalp, forehead, trunk, and back (left [Lt.] V1, Lt. T8). Histologic findings were consistent with herpetic infection. A 33-year-old woman presented with painful erythematous grouped vesicles and crust on her left forehead and neck (Lt. V1, Lt. C5). Both patients were treated with oral administration of famcyclovir 750 mg/day for seven days. PMID:27904277

  9. Compact, precision duplex bearing mount for high vibration environments

    NASA Technical Reports Server (NTRS)

    Bouzakis, George Elias (Inventor); Bowman, James Edward (Inventor); Devine, Edward J. (Inventor); Joffe, Benjamin (Inventor); Segal, Kenneth Neal (Inventor); Webb, Merritt J. (Inventor)

    2002-01-01

    A duplex bearing mount including at least one duplex bearing having an inner race and an outer race, the inner race disposed within the outer race and being rotatable relative to the outer race about an axis, the inner race having substantially no relative movement relative to the outer race in at least one direction along the axis, the inner and outer races each having first and second axial faces which are respectively located at the same axial end of the duplex bearing. The duplex bearing is radially supported by a housing, and a shaft extends through the inner race, the shaft radially and axially supported by the inner race. A first retainer is connected to the housing and engages the first axial surface of a bearing race, the movement of which race in a first direction along the axis being constrained by the first retainer. A second, resilient retainer is connected to the housing or the shaft and is deflected through engagement with the second axial face of a bearing race, the movement of which race in a second direction along the axis, opposite to the first direction, being constrained by the deflected second retainer. The bearing is preloaded by its being clamped between the first and second retainers, and the second retainer forms at least a portion of a spring having the characteristic of a substantially constant force value correlating to a range of various deflection values, whereby the preload of the bearing is substantially unaffected by variations in the deflection of the second retainer.

  10. View from east to west of family housing unit (duplex; ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View from east to west of family housing unit (duplex; either #27 or #87, as only the 7 is visible). Unit #27 was three-bedroom and located on 9th Street south. Unit #87 was a two-bedroom located on 4th Street north. These housing units have been removed - Stanley R. Mickelsen Safeguard Complex, Family Housing Units, In area bounded by Tenth Street North, Avenue A, & Avenue J, Nekoma, Cavalier County, ND

  11. Integrated optic broadband duplexer made by ion exchange

    NASA Astrophysics Data System (ADS)

    Ghibaudo, E.; Broquin, J.-E.; Benech, P.

    2003-02-01

    The development of optical amplification and bidirectional traffic in local and wide area networks requires broadband multiplexers which are able to treat the signal of an entire telecommunication window. A device made by ion exchange and answering to these needs is proposed in this letter. Its working principle, based on a leaky structure is first explained. An experimental result confirming a good broadband spectral behavior is then presented. Its spectral response displays two duplexing bands of at least 100 nm.

  12. Investigation of hot cracking resistance of 2205 duplex steel

    NASA Astrophysics Data System (ADS)

    Adamiec, J.; Ścibisz, B.

    2010-02-01

    Austenitic duplex steel of the brand 2205 according to Avesta Sheffield is used for welded constructions (pipelines, tanks) in the petrol industry, chemical industry and food industry. It is important to know the range of high-temperature brittleness in designing welding technology for constructions made of this steel type. There is no data in literature concerning this issue. High-temperature brittleness tests using the simulator of heat flow device Gleeble 3800 were performed. The tests results allowed the evaluation of the characteristic temperatures in the brittleness temperature range during the joining of duplex steels, specifically the nil-strength temperature (NST) and nil-ductility temperatures (NDT) during heating, the strength and ductility recovery temperatures (DRT) during cooling, the Rfparameter (Rf = (Tliquidus - NDT)/NDT) describing the duplex steel inclination for hot cracking, and the brittleness temperature range (BTR). It has been stated that, for the examined steel, this range is wide and amounts to ca. 90 °C. The joining of duplex steels with the help of welding techniques creates a significant risk of hot cracks. After analysis of the DTA curves a liquidus temperature of TL = 1465 °C and a solidus temperature of TS = 1454 °C were observed. For NST a mean value was assumed, in which the cracks appeared for six samples; the temperature was 1381 °C. As the value of the NDT temperature 1367 °C was applied while for DRT the assumed temperature was 1375 °C. The microstructure of the fractures was observed using a Hitachi S-3400N scanning electron microscope (SEM). The analyses of the chemical composition were performed using an energy-dispersive X-ray spectrometer (EDS), Noran System Six of Thermo Fisher Scientific. Essential differences of fracture morphology type over the brittle temperature range were observed and described.

  13. All-atom crystal simulations of DNA and RNA duplexes

    PubMed Central

    Liu, Chunmei; Janowski, Pawel A.; Case, David A.

    2014-01-01

    Background Molecular dynamics simulations can complement experimental measures of structure and dynamics of biomolecules. The quality of such simulations can be tested by comparisons to models refined against experimental crystallographic data. Methods We report simulations of a DNA and RNA duplex in their crystalline environment. The calculations mimic the conditions for PDB entries 1D23 [d(CGATCGATCG)2] and 1RNA [(UUAUAUAUAUAUAA)2], and contain 8 unit cells, each with 4 copies of the Watson-Crick duplex; this yields in aggregate 64 µs of duplex sampling for DNA and 16 µs for RNA. Results The duplex structures conform much more closely to the average structure seen in the crystal than do structures extracted from a solution simulation with the same force field. Sequence-dependent variations in helical parameters, and in groove widths, are largely maintained in the crystal structure, but are smoothed out in solution. However, the integrity of the crystal lattice is slowly degraded in both simulations, with the result that the interfaces between chains become heterogeneous. This problem is more severe for the DNA crystal, which has fewer inter-chain hydrogen bond contacts than does the RNA crystal. Conclusions Crystal simulations using current force fields reproduce many features of observed crystal structures, but suffer from a gradual degradation of the integrity of the crystal lattice. General significance The results offer insights into force-field simulations that tests their ability to preserve weak interactions between chains, which will be of importance also in non-crystalline applications that involve binding and recognition. PMID:25255706

  14. Kinetics of DNA duplex formation: A-tracts versus AT-tracts.

    PubMed

    Wyer, Jean Ann; Kristensen, Mads Bejder; Jones, Nykola C; Hoffmann, Søren Vrønning; Nielsen, Steen Brøndsted

    2014-09-21

    The hybridisation and melting of DNA strands are critical steps in many biological processes, but still a deeper understanding of the kinetics is lacking. This is evident from the absence of a clear correlation between rate constants for duplex formation and the number of bases in the strand or the sequence. Here we have probed differences between formation times of A-tracts and AT-tracts by studying complementary model strands mainly comprised of adenine (A) and thymine (T) in stopped-flow (SF) experiments. These strands are relevant as DNA replication begins in regions with a large number of AT base pairs. Interpretation of our results is aided by secondary-structure modelling where both the fractions of the different types of structures and the number of paired bases in the lowest-energy ones are determined. The model is based on calculation of free energies using fixed values for enthalpies and entropies associated with base pairing and a stochastic sampling of the possible structures. We find that the strand length affects rates: the activation energy for the formation of short (16-base pairs) A-tracts is larger than that for longer ones (20-base pairs). Activation energies for the formation of AT-tracts are an order of magnitude larger, and larger for shorter strands than for long ones. These higher activation energies are in agreement with the fact that the fraction of unpaired bases in the constituent AT-tract strands is less than in those which comprise the A-tracts. That the pre-structures of the single strands significantly affect rates is also used to rationalise the results obtained for two pairs of complementary 12-mer strands that have the same bases but in a different sequence; we report here similar activation energies as reported earlier and that these are strongly sequence dependent. Finally, we demonstrate that SF can be coupled with the measurement of circular dichroism (CD) in the vacuum ultraviolet (VUV) region, taking advantage of a

  15. Binding of tobamovirus replication protein with small RNA duplexes.

    PubMed

    Kurihara, Yukio; Inaba, Naoko; Kutsuna, Natsumaro; Takeda, Atsushi; Tagami, Yuko; Watanabe, Yuichiro

    2007-08-01

    The sequence profiles of small interfering RNAs (siRNAs) in Arabidopsis infected with the crucifer tobamovirus tobacco mosaic virus (TMV)-Cg were determined by using a small RNA cloning technique. The majority of TMV-derived siRNAs were 21 nt in length. The size of the most abundant endogenous small RNAs in TMV-infected plants was 21 nt, whilst in mock-inoculated plants, it was 24 nt. Northern blot analysis revealed that some microRNAs (miRNAs) accumulated more in TMV-infected plants than in mock-inoculated plants. The question of whether the TMV-Cg-encoded 126K replication protein, an RNA-silencing suppressor, caused small RNA enrichment was examined. Transient expression of the replication protein did not change the pattern of miRNA processing. However, miRNA, miRNA* (the opposite strand of the miRNA duplex) and hairpin-derived siRNA all co-immunoprecipitated with the replication protein. Gel mobility-shift assays indicated that the replication protein binds small RNA duplexes. These results suggest that the tobamovirus replication protein functions as a silencing suppressor by binding small RNA duplexes, changing the small RNA profile in infected plants.

  16. Duplex-Selective Ruthenium-based DNA Intercalators

    PubMed Central

    Shade, Chad M.; Kennedy, Robert D.; Rouge, Jessica L.; Rosen, Mari S.; Wang, Mary X.; Seo, Soyoung E.; Clingerman, Daniel J.

    2016-01-01

    We report the design and synthesis of small molecules that exhibit enhanced luminescence in the presence of duplex rather than single-stranded DNA. The local environment presented by a well-known [Ru(dipyrido[2,3-a:3',2'-c]phenazine)L2]2+-based DNA intercalator was modified by functionalizing the bipyridine ligands with esters and carboxylic acids. By systematically varying the number and charge of the pendant groups, it was determined that decreasing the electrostatic interaction between the intercalator and the anionic DNA backbone reduced single-strand interactions and translated to better duplex specificity. In studying this class of complexes, a single RuII complex emerged that selectively luminesces in the presence of duplex DNA with little to no background from interacting with single stranded DNA. This complex shows promise as a new dye capable of selectively staining double versus single-stranded DNA in gel electrophoresis, which cannot be done with conventional SYBR dyes. PMID:26119581

  17. Role of helical constraints of the EBS1-IBS1 duplex of a group II intron on demarcation of the 5' splice site.

    PubMed

    Popovic, Milena; Greenbaum, Nancy L

    2014-01-01

    Recognition of the 5' splice site by group II introns involves pairing between an exon binding sequence (EBS) 1 within the ID3 stem-loop of domain 1 and a complementary sequence at the 3' end of exon 1 (IBS1). To identify the molecular basis for splice site definition of a group IIB ai5γ intron, we probed the solution structure of the ID3 stem-loop alone and upon binding of its IBS1 target by solution NMR. The ID3 stem was structured. The base of the ID3 loop was stacked but displayed a highly flexible EBS1 region. The flexibility of EBS1 appears to be a general feature of the ai5γ and the smaller Oceanobacillus iheyensis (O.i.) intron and may help in effective search of conformational space and prevent errors in splicing as a result of fortuitous base-pairing. Binding of IBS1 results in formation of a structured seven base pair duplex that terminates at the 5' splice site in spite of the potential for additional A-U and G•U pairs. Comparison of these data with conformational features of EBS1-IBS1 duplexes extracted from published structures suggests that termination of the duplex and definition of the splice site are governed by constraints of the helical geometry within the ID3 loop. This feature and flexibility of the uncomplexed ID3 loop appear to be common for both the ai5γ and O.i. introns and may help to fine-tune elements of recognition in group II introns.

  18. The N domain of Argonaute drives duplex unwinding during RISC assembly.

    PubMed

    Kwak, Pieter Bas; Tomari, Yukihide

    2012-01-10

    Small RNAs, such as microRNAs and small interfering RNAs, act through Argonaute (Ago) proteins as a part of RNA-induced silencing complexes (RISCs). To make RISCs, Ago proteins bind and subsequently unwind small RNA duplexes, finally leaving one strand stably incorporated. Here we identified the N domain of human AGO2 as the initiator of duplex unwinding during RISC assembly. We discovered that a functional N domain is strictly required for small RNA duplex unwinding but not for precedent duplex loading or subsequent target cleavage. We postulate that RISC assembly is tripartite, comprising (i) RISC loading, whereby Ago undergoes conformational opening and loads a small RNA duplex, forming pre-RISC; (ii) wedging, whereby the end of the duplex is pried open through active wedging by the N domain, in preparation for unwinding; and (iii) unwinding, whereby the passenger strand is removed through slicer-dependent or slicer-independent unwinding, forming mature RISC.

  19. Characterization of microstructure and texture across dissimilar super duplex/austenitic stainless steel weldment joint by super duplex filler metal

    SciTech Connect

    Eghlimi, Abbas; Shamanian, Morteza; Eskandarian, Masoomeh; Zabolian, Azam; Szpunar, Jerzy A.

    2015-08-15

    In the present paper, microstructural changes across an as-welded dissimilar austenitic/duplex stainless steel couple welded by a super duplex stainless steel filler metal using gas tungsten arc welding process is characterized with optical microscopy and electron back-scattered diffraction techniques. Accordingly, variations of microstructure, texture, and grain boundary character distribution of base metals, heat affected zones, and weld metal were investigated. The results showed that the weld metal, which was composed of Widmanstätten austenite side-plates and allotriomorphic grain boundary austenite morphologies, had the weakest texture and was dominated by low angle boundaries. The welding process increased the ferrite content but decreased the texture intensity at the heat affected zone of the super duplex stainless steel base metal. In addition, through partial ferritization, it changed the morphology of elongated grains of the rolled microstructure to twinned partially transformed austenite plateaus scattered between ferrite textured colonies. However, the texture of the austenitic stainless steel heat affected zone was strengthened via encouraging recrystallization and formation of annealing twins. At both interfaces, an increase in the special character coincident site lattice boundaries of the primary phase as well as a strong texture with <100> orientation, mainly of Goss component, was observed. - Graphical abstract: Display Omitted - Highlights: • Weld metal showed local orientation at microscale but random texture at macroscale. • Intensification of <100> orientated grains was observed adjacent to the fusion lines. • The austenite texture was weaker than that of the ferrite in all duplex regions. • Welding caused twinned partially transformed austenites to form at SDSS HAZ. • At both interfaces, the ratio of special CSL boundaries of the primary phase increased.

  20. The solution structure of a 3'-phenazinium (Pzn) tethered DNA-RNA duplex with a dangling adenosine: r(5'G-AUUGAA3'):d(5'TCAATC3'-Pzn).

    PubMed Central

    Maltseva, T V; Agback, P; Repkova, M N; Venyaminova, A G; Ivanova, E M; Sandström, A; Zarytova, V F; Chattopadhyaya, J

    1994-01-01

    The 3'-Pzn group tethered to an oligo-DNA stabilizes a DNA-RNA hybrid duplex structure by 13 degrees C compared to the natural counterpart. This report constitutes the first full study of the conformational features of a hybrid DNA-RNA duplex, which has been possible because of the unique stabilization of this rather small duplex by the tethered 3'-Pzn moiety (Tm approximately 40 degrees C from NMR). In this study, a total of 252 inter- and intra-strand torsional and distance constraints along with the full NOE relaxation matrix, taking into account the exchange process of imino and amino protons with water, have been used. The 3'-Pzn-promoted stabilization of the DNA-RNA hybrid duplex results in detailed local conformational characteristics such as the torsion angles of the backbone and sugar moieties that are close to the features of the other natural DNA-RNA hybrids (i.e. sugars of the RNA strand are 3'-endo, but the sugars of the DNA strand are intermediate between A- and B-forms of DNA, 72 degrees < P < 180 degrees; note however, that the sugars of our DNA strand have a C1-exo conformation: 131 degrees < P < 154 degrees). This study suggests that 3'-Pzn-tethered smaller oligo-DNA should serve the same purpose as a larger oligo-DNA as a antisense inhibitor of the viral mRNA. Additionally, these types of tethered oligos have been found to be relatively more resistant to the cellular nuclease. Moreover, they are taken up quite readily through the cellular membrane (14) compared to the natural counterparts. PMID:7838711

  1. Ladderphanes: a new type of duplex polymers.

    PubMed

    Luh, Tien-Yau

    2013-02-19

    A polymeric ladderphane is a step-like structure comprising multiple layers of linkers covalently connected to two or more polymeric backbones. The linkers can be planar aromatic, macrocyclic metal complexes, or three-dimensional organic or organometallic moieties. Structurally, a DNA molecule is a special kind of ladderphane, where the cofacially aligned base-pair pendants are linked through hydrogen bonding. A greater understanding of this class of molecules could help researchers develop new synthetic molecules capable of a similar transfer of chemical information. In this Account, we summarize our studies of the strategy, design, synthesis, characterization, replications, chemical and photophysical properties, and assembly of a range of double-stranded ladderphanes with many fascinating structures. We employed two norbornene moieties fused with N-arylpyrrolidine to connect covalently with a range of relatively rigid linkers. Ring opening metathesis polymerizations (ROMP) of these bis-norbornenes using the first-generation Grubbs ruthenium-benzylidene catalyst produced the corresponding symmetrical double-stranded ladderphanes. The N-arylpyrrolidene moiety in the linker controls the isotactic selectivity and the trans configuration for all double bonds in both single- and double-stranded polynorbornenes. The π-π interactions between these aryl pendants may contribute to the high stereoselectivity in the ROMP of these substrates. We synthesized chiral helical ladderphanes by incorporating asymmetric center(s) in the linkers. Replication protocols and sequential polymerization of a monomer that includes two different polymerizable groups offer methods for producing unsymmetical ladderphanes. These routes furnish template synthesis of daughter polymers with well-controlled chain lengths and polydispersities. The linkers in these ladderphanes are well aligned in the center along the longitudinal axis of the polymer. Fluorescence quenching, excimer formation, or

  2. Structure determination of DNA methylation lesions N1-meA and N3-meC in duplex DNA using a cross-linked protein-DNA system

    SciTech Connect

    Lu, Lianghua; Yi, Chengqi; Jian, Xing; Zheng, Guanqun; He, Chuan

    2010-08-13

    N1-meA and N3-meC are cytotoxic DNA base methylation lesions that can accumulate in the genomes of various organisms in the presence of SN2 type methylating agents. We report here the structural characterization of these base lesions in duplex DNA using a cross-linked protein-DNA crystallization system. The crystal structure of N1-meA:T pair shows an unambiguous Hoogsteen base pair with a syn conformation adopted by N1-meA, which exhibits significant changes in the opening, roll and twist angles as compared to the normal A:T base pair. Unlike N1-meA, N3-meC does not establish any interaction with the opposite G, but remains partially intrahelical. Also, structurally characterized is the N6-meA base modification that forms a normal base pair with the opposite T in duplex DNA. Structural characterization of these base methylation modifications provides molecular level information on how they affect the overall structure of duplex DNA. In addition, the base pairs containing N1-meA or N3-meC do not share any specific characteristic properties except that both lesions create thermodynamically unstable regions in a duplex DNA, a property that may be explored by the repair proteins to locate these lesions.

  3. Effect of ultrafine grain on tensile behaviour and corrosion resistance of the duplex stainless steel.

    PubMed

    Jinlong, Lv; Tongxiang, Liang; Chen, Wang; Limin, Dong

    2016-05-01

    The ultrafine grained 2205 duplex stainless steel was obtained by cold rolling and annealing. The tensile properties were investigated at room temperature. Comparing with coarse grained stainless steel, ultrafine grained sample showed higher strength and plasticity. In addition, grain size changed deformation orientation. The strain induced α'-martensite was observed in coarse grained 2205 duplex stainless steel with large strain. However, the grain refinement inhibited the transformation of α'-martensite;nevertheless, more deformation twins improved the strength and plasticity of ultrafine grained 2205 duplex stainless steel. In addition, the grain refinement improved corrosion resistance of the 2205 duplex stainless steel in sodium chloride solution.

  4. The early melting of closed duplex DNA: analysis by banding in buoyant neutral rubidium trichloroacetate.

    PubMed Central

    Burke, R L; Bauer, W R

    1980-01-01

    Aqueous RbTCA permits the buoyant banding of both native and denatured DNA at room temperature and neutral pH. A unique property of this solvent is the bouyant resolution of closed circular, underwound DNA (I) from the corresponding nicked (II) species. Conditions are reported here in which PM-2 DNA I is physically resolved from native PM-2 DNA II, the buoyant separation being 1.27 mq/ml in 3.3 M RbTCA at 25 degrees C. The separation between nicked and closed DNAs increases with temperature up to 35.5 degrees C, at which PM-2 DNA II cooperatively melts and subsequently pellets. The isothermal buoyant density of a cloed DNA increases linearly as the linking number (Lk) of the closed DNA decreases. The early melting of closed DNA may be monitored with high precision by buoyant banding in RbTCA, it being possible to detect the disruption of as few as 40 base pairs in PM-2 DNA (10,000 base pairs). The constraint that the linking number be conserved in closed DNA requires that a change in duplex winding be accompanied by a compensating change in supercoiling. We estimate the linking number deficiency of PM-2 DNA I to be 0.094 turns per decibase pair. This result permits the estimation of the EtdBr unwinding angle, phi, by comparison with alternative determinations of the linking number deficiency which depend upom the value of phi. The result obtained here is that phi = 27.7 degrees +/- 0.5 degrees and is approximately independent of temperature over the range 15 degrees-35 degrees. PMID:7443544

  5. Natural versus artificial creation of base pairs in DNA: origin of nucleobases from the perspectives of unnatural base pair studies.

    PubMed

    Hirao, Ichiro; Kimoto, Michiko; Yamashige, Rie

    2012-12-18

    Since life began on Earth, the four types of bases (A, G, C, and T(U)) that form two sets of base pairs have remained unchanged as the components of nucleic acids that replicate and transfer genetic information. Throughout evolution, except for the U to T modification, the four base structures have not changed. This constancy within the genetic code raises the question of how these complicated nucleotides were generated from the molecules in a primordial soup on the early Earth. At some prebiotic stage, the complementarity of base pairs might have accelerated the generation and accumulation of nucleotides or oligonucleotides. We have no clues whether one pair of nucleobases initially appeared on the early Earth during this process or a set of two base pairs appeared simultaneously. Recently, researchers have developed new artificial pairs of nucleobases (unnatural base pairs) that function alongside the natural base pairs. Some unnatural base pairs in duplex DNA can be efficiently and faithfully amplified in a polymerase chain reaction (PCR) using thermostable DNA polymerases. The addition of unnatural base pair systems could expand the genetic alphabet of DNA, thus providing a new mechanism for the generation novel biopolymers by the site-specific incorporation of functional components into nucleic acids and proteins. Furthermore, the process of unnatural base pair development might provide clues to the origin of the natural base pairs in a primordial soup on the early Earth. In this Account, we describe the development of three representative types of unnatural base pairs that function as a third pair of nucleobases in PCR and reconsider the origin of the natural nucleic acids. As researchers developing unnatural base pairs, they use repeated "proof of concept" experiments. As researchers design new base pairs, they improve the structures that function in PCR and eliminate those that do not. We expect that this process is similar to the one functioning in the

  6. Evaluation of the Gibbs Free Energy Changes and Melting Temperatures of DNA/DNA Duplexes Using Hybridization Enthalpy Calculated by Molecular Dynamics Simulation.

    PubMed

    Lomzov, Alexander A; Vorobjev, Yury N; Pyshnyi, Dmitrii V

    2015-12-10

    A molecular dynamics simulation approach was applied for the prediction of the thermal stability of oligonucleotide duplexes. It was shown that the enthalpy of the DNA/DNA complex formation could be calculated using this approach. We have studied the influence of various simulation parameters on the secondary structure and the hybridization enthalpy value of Dickerson-Drew dodecamer. The optimal simulation parameters for the most reliable prediction of the enthalpy values were determined. The thermodynamic parameters (enthalpy and entropy changes) of a duplex formation were obtained experimentally for 305 oligonucleotides of various lengths and GC-content. The resulting database was studied with molecular dynamics (MD) simulation using the optimized simulation parameters. Gibbs free energy changes and the melting temperatures were evaluated using the experimental correlation between enthalpy and entropy changes of the duplex formation and the enthalpy values calculated by the MD simulation. The average errors in the predictions of enthalpy, the Gibbs free energy change, and the melting temperature of oligonucleotide complexes were 11%, 10%, and 4.4 °C, respectively. We have shown that the molecular dynamics simulation gives a possibility to calculate the thermal stability of native DNA/DNA complexes a priori with an unexpectedly high accuracy.

  7. Effect of 5-methylcytosine on the structure and stability of DNA. Formation of triple-stranded concatenamers by overlapping oligonucleotides.

    PubMed

    Xodo, L E; Alunni-Fabbroni, M; Manzini, G

    1994-02-01

    A triple helix can be formed upon binding of a pyrimidine oligonucleotide to the major groove of a homopurine-homopyrimidine (R.Y) double-stranded DNA target site. Here, we report that this reaction can be influenced by base methylation. The pyrimidine strand 5'-TmCTmCTmCTmCTTmCT (mY12), whose cytosine residues are methylated at C5, does not bind the duplex 5'-AGAGAGAGAAGA.3'-TCTCTCTCTTCT (R12.Y12) to yield a 12-triad triplex, as would be expected from these DNA sequences. Rather, a complex of overlapping oligonucleotides, which we define concatenamer, is formed. The concatenamer is clearly evidenced by polyacrylamide gel electrophoresis (PAGE) since it migrates with a smeared band of very low mobility. The stoichiometry of the concatenamer, determined by both UV mixing curves and electrophoresis, is surprisingly found to be (R12.2mY12)n, thus showing that the unmethylated Y12 strand is excluded from the complex. Denaturation experiments performed by ultraviolet absorbance (UV) and differential scanning calorimetry (DSC) show that the concatenamers melt with a single and highly cooperative transition whose Tm strongly depends on pH. Overall, the data point to the conclusion that the concatenamers are in triple helix, where the methylated mY12 strand is engaged in both Watson-Crick and Hoogsteen base pairings, thus displacing the Y12 strand from the R12.Y12 duplex. A possible mechanism of concatenamer formation is proposed. The results presented in this paper show that 5-methylcytosine brings about a strong stabilizing effect on both double and triple DNA helices, and that pyrimidine oligonucleotides containing 5-methylcytosine can displace from R.Y duplexes the analogous non-methylated strand. The advantage of using methylated oligonucleotides in antisense technology is discussed.

  8. Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

    2002-01-01

    The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

  9. Diagnostic value of three-dimensional transcranial contrast duplex sonography.

    PubMed

    Delcker, A; Turowski, B

    1997-07-01

    This study evaluated intracranial cerebral arteries using a new data acquisition system for transcranial three-dimensional (3D) ultrasonography with and without an echo contrast agent, with confirmation by cerebral angiography. Ten patients, studied with diagnostic cerebral angiography, were examined without knowledge of the angiographic results. Data acquisition through the transtemporal acoustic window was performed using a magnetic sensor system to track the spatial orientation of the ultrasound probe while scanning the volume of interest. A color transcranial duplex system with a power Doppler mode was used, and 3D data sets were acquired before and after the injection of transpulmonary-stable ultrasound contrast medium. Ipsilateral to the transducer, the anterior cerebral artery (ACA) in 90%, middle cerebral artery (MCA) in 60%, all three or more branches of the MCA in 60%, posterior cerebral artery (PCA) in 60%, and posterior communicating artery (PCoA) in 60% were successfully imaged without the echo contrast agent. With the contrast agent, the ACA, MCA, three or more branches of the MCA, PCA, and PCoA were visible in 100%. The anterior communicating artery was visualized in 40% without contrast enhancement and in 90% with contrast enhancement. Contralateral to the transducer, the ACA (60%), MCA (30%), all three or more branches of the MCA (10%), PCA (20%), and PCoA (20%) were successfully imaged without contrast. Contrast enhancement improved the imaging success rate for the ACA (90%), MCA (80%), three or more branches of the MCA (80%), PCA (100%), and PCoA (100%). A transpulmonary-stable ultrasound contrast agent used in combination with 3D transcranial duplex ultrasonography can significantly improve the success rate for transcranial color duplex imaging of intracranial arteries.

  10. Use of duplex stainless steel castings in control valves

    SciTech Connect

    Gossett, J.L.

    1996-07-01

    Duplex stainless steels have enjoyed rapidly increasing popularity in recent years. For numerous reasons the availability of these alloys in the cast form has lagged behind the availability of the wrought form. Commercial demand for control valves in these alloys has driven development of needed information to move into production. A systematic approach was used to develop specifications, suppliers and weld procedures. Corrosion, stress corrosion cracking (SCC), sulfide stress cracking (SSC) and hardness results are also presented for several alloys including; CD3MN (UNS J92205), CD4MCu (UNS J93370) and CD7MCuN (cast UNS S32550).

  11. Phosphorus-31 NMR spectra of ethidium, quinacrine, and daunomycin complexes with poly(adenylic acid)ter dot poly(uridylic acid) RNA duplex and calf thymus DNA

    SciTech Connect

    Gorenstein, D.G.; Lai, K. )

    1989-04-04

    {sup 31}P NMR provides a convenient monitor of the phosphate ester backbone conformational changes upon binding of the intercalating drugs ethidium, quinacrine, and daunomycin to sonicated poly(A){center dot}poly(U) and calf thymus DNA. {sup 31}P chemical shifts can also be used to assess differences in the duplex unwinding angles in the presence of the drug. Thus a new {sup 31}P signal, 1.8-2.2 ppm downfield from the double-stranded helix signals, is observed in the ethidium ion-poly(A){center dot}poly(U) complex. This signal arises from phosphates which are in perturbed environments due to intercalation of the drug. This is in keeping with the hypothesis that the P-O ester torsional angle in phosphates linking the intercalated base pairs is more trans-like. Similar though smaller deshielding of the {sup 31}P signals is observed in sonicated poly(A){center dot}poly(U)-quinacrine complexes as well as in the daunomycin complexes. The effect of added ethidium ion, quinacrine, and daunomycin on the {sup 31}P spectra of sonicated calf thymus DNA is consistent with Wilson and Jones' (1982) earlier study. In these drug-DNA complexes the drug produces a gradual downfield shift in the DNA {sup 31}P signal without the appearance of a separate downfield peak. These differences are attributed to differences in the rate of chemical exchange of the drug between free and bound duplex states. The previous correlation of {sup 31}P chemical shift with drug duplex unwinding angle is confirmed for both the RNA and DNA duplexes.

  12. Development of a genome-wide multiple duplex-SSR protocol and its applications for the identification of selfed progeny in switchgrass

    PubMed Central

    2012-01-01

    Background Switchgrass (Panicum virgatum) is a herbaceous crop for the cellulosic biofuel feedstock development in the USA and Europe. As switchgrass is a naturally outcrossing species, accurate identification of selfed progeny is important to producing inbreds, which can be used in the production of heterotic hybrids. Development of a technically reliable, time-saving and easily used marker system is needed to quantify and characterize breeding origin of progeny plants of targeted parents. Results Genome-wide screening of 915 mapped microsatellite (simple sequence repeat, SSR) markers was conducted, and 842 (92.0%) produced clear and scorable bands on a pooled DNA sample of eight switchgrass varieties. A total of 166 primer pairs were selected on the basis of their relatively even distribution in switchgrass genome and PCR amplification quality on 16 tetraploid genotypes. Mean polymorphic information content value for the 166 markers was 0.810 ranging from 0.116 to 0.959. From them, a core set of 48 loci, which had been mapped on 17 linkage groups, was further tested and optimized to develop 24 sets of duplex markers. Most of (up to 87.5%) targeted, but non-allelic amplicons within each duplex were separated by more than 10-bp. Using the established duplex PCR protocol, selfing ratio (i.e., selfed/all progeny x100%) was identified as 0% for a randomly selected open-pollinated ‘Kanlow’ genotype grown in the field, 15.4% for 22 field-grown plants of bagged inflorescences, and 77.3% for a selected plant grown in a growth chamber. Conclusions The study developed a duplex SSR-based PCR protocol consisting of 48 markers, providing ample choices of non-tightly-linked loci in switchgrass whole genome, and representing a powerful, time-saving and easily used method for the identification of selfed progeny in switchgrass. The protocol should be a valuable tool in switchgrass breeding efforts. PMID:23031617

  13. Ion pair receptors†

    PubMed Central

    Kim, Sung Kuk

    2010-01-01

    Compared with simple ion receptors, which are able to bind either a cation or an anion, ion pair receptors bearing both a cation and an anion recognition site offer the promise of binding ion pairs or pairs of ions strongly as the result of direct or indirect cooperative interactions between co-bound ions. This critical review focuses on the recent progress in the design of ion pair receptors and summarizes the various binding modes that have been used to accommodate ion pairs (110 references). PMID:20737073

  14. Comparison of duplex ultrasonography and venography in the diagnosis of deep venous thrombosis.

    PubMed

    Mitchell, D C; Grasty, M S; Stebbings, W S; Nockler, I B; Lewars, M D; Levison, R A; Wood, R F

    1991-05-01

    Sixty-five patients with suspected deep venous thrombosis (DVT) in 68 limbs were entered consecutively into a study to compare venography with duplex ultrasonography scanning. Both tests were performed on 64 limbs, venography being contraindicated in four. Overall, duplex scanning correctly identified 86 per cent of DVTs diagnosed on venography and correctly excluded 80 per cent with negative venograms. Nearly all errors arose in the diagnosis of calf DVT. In the femoral vein duplex scanning had a specificity of 100 per cent and a sensitivity of 95 per cent. In addition, duplex scanning provided data on the limb not undergoing venography. Of 55 limbs that underwent bilateral duplex scanning, five had thrombus in the femoropopliteal segment and a negative contralateral venogram. In addition, three Baker's cysts were diagnosed. Duplex scanning can be used in patients in whom venography is contraindicated and may also provide information about the contralateral limb. We regard femoropopliteal duplex scanning as sufficiently accurate that treatment can be initiated on the basis of the scan. Duplex scanning should replace venography as the standard method of diagnosing femoropopliteal DVT; radiographic studies should now be required only when the scan result is in doubt.

  15. Human coronavirus 229E nonstructural protein 13: characterization of duplex-unwinding, nucleoside triphosphatase, and RNA 5'-triphosphatase activities.

    PubMed

    Ivanov, Konstantin A; Ziebuhr, John

    2004-07-01

    The human coronavirus 229E (HCoV-229E) replicase gene-encoded nonstructural protein 13 (nsp13) contains an N-terminal zinc-binding domain and a C-terminal superfamily 1 helicase domain. A histidine-tagged form of nsp13, which was expressed in insect cells and purified, is reported to unwind efficiently both partial-duplex RNA and DNA of up to several hundred base pairs. Characterization of the nsp13-associated nucleoside triphosphatase (NTPase) activities revealed that all natural ribonucleotides and nucleotides are substrates of nsp13, with ATP, dATP, and GTP being hydrolyzed most efficiently. Using the NTPase active site, HCoV-229E nsp13 also mediates RNA 5'-triphosphatase activity, which may be involved in the capping of viral RNAs.

  16. Residual dipolar coupling constants and structure determination of large DNA duplexes.

    PubMed

    Mauffret, Olivier; Tevanian, Georges; Fermandjian, Serge

    2002-12-01

    Several NMR works have shown that long-range information provided by residual dipolar couplings (RDCs) significantly improve the global structure definition of RNAs and DNAs. Most of these are based on the use of a large set of RDCs, the collect of which requires samples labeled with (13)C, (15)N, and sometimes, (2)H. Here, we carried out torsion-angle dynamics simulations on a non-self complementary DNA fragment of 17 base-pairs, d(GGAAAATATCTAGCAGT).(ACTGCTAGAGATTTTCC). This reproduces the U5 LTR distal end of the HIV-1 cDNA that contains the enzyme integrase binding site. Simulations aimed at evaluating the impact of RDCs on the structure definition of long oligonucleotides, were performed in incorporating (i) nOe-distances at both < 4.5 A and < 5 A; (ii) a small set of (13)C-(1)H RDCs, easily detectable at the natural abundance, and (iii) a larger set of RDCs only accessible through the (13)C labeling of DNAs. Agreement between a target structure and a simulated structure was measured in terms of precision and accuracy. Results allowed to define conditions in which accurate DNA structures can be determined. We confirmed the strong impact of RDCs on the structure determination, and, above all, we found that a small set of RDC constraints (ca. 50) detectable at the natural abundance is sufficient to accurately derive the global and local DNA duplex structures when used in conjunction with nOe-distances < 5 A.

  17. 'A' forms of RNAs in single strands, duplexes and RNA-DNA hybrids.

    PubMed Central

    Broyde, S; Hingerty, B

    1978-01-01

    Helical parameters have been calculated for the 'A' form minimum energy conformations of ApA, CpC, GpG, UpU, GpC and UpA. The helix geometries are base sequence dependent. The single strands are narrower and more tightly wound than that duplex RNA-11 form. 9-12 kcal./mole are needed to convert these single strands to the RNA-11 conformation. However, in some sequences other 'A' type conformers capable of complementary base pairing may be formed at lower energetic cost. There is substantially more base stacking in the calculated single strands than in the RNA-11 conformation. Calculated intrastrand base stacking energies reflect these differences, and also are sequence dependent. The 'A' form RNA subunits differ from the analogous DNAs in possessing a larger rise per residue, needed to accomodate the 2'-OH. RNA-DNA hybrids are consequently more likely to be in the 'A-RNA than in the 'A'-DNA conformation, although the base sequence determines the extent of the preference. PMID:693318

  18. Hole Transport in A-form DNA/RNA Hybrid Duplexes

    PubMed Central

    Wong, Jiun Ru; Shao, Fangwei

    2017-01-01

    DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations. PMID:28084308

  19. Hole Transport in A-form DNA/RNA Hybrid Duplexes

    NASA Astrophysics Data System (ADS)

    Wong, Jiun Ru; Shao, Fangwei

    2017-01-01

    DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations.

  20. Unusual Presentation of Duplex Kidneys: Ureteropelvic Junction Obstruction

    PubMed Central

    Başdaş, Cemile; Özaydın, Seyithan; Karaaslan, Birgül; Alim, Elmas Reyhan; Güvenç, Ünal; Sander, Serdar

    2016-01-01

    Aim. Ureteropelvic junction obstruction (UPJO) is rarely associated with a duplex collecting system. We review this unusual anomaly in terms of presentation, diagnostic evaluation, and surgical management. Method. We retrospectively reviewed the medical records of patients diagnosed with a duplex system with UPJO. Result. Sixteen patients (6 girls, 10 boys) with 18 moieties were treated surgically and four patients were treated conservatively. The median age at surgery was two years (range, 2 months to 7 years). The lower pole and upper moiety were affected in 12 and two kidneys, respectively, and both were affected in two patients. The anomaly was right-sided in 12 moieties and left-sided in six. The duplication was incomplete in seven patients and complete in nine. The mean renal pelvis diameter at the time of surgery was 25.6 (range 11–48 mm) mm by USG. The mean renal function of the involved moiety was 28.3% before surgery. Management included pyelopyelostomy or ureteropyelostomy in six moieties, dismembered pyeloplasty in eight moieties, heminephrectomy in four cases, and simultaneous upper heminephrectomy and lower pole ureteropyelostomy in one patient. Conclusion. There is no standard approach for these patients and treatment should be individualized according to physical presentation, detailed anatomy, and severity of obstruction. PMID:27829833

  1. Sex determination in 6 bovid species by duplex PCR.

    PubMed

    Prashant; Gour, Digpal S; Dubey, Prem P; Jain, Anubhav; Gupta, Subhash C; Joshi, Balwinder K; Kumar, Dinesh

    2008-01-01

    Sex determination in domestic animals is of potential value to livestock breeding programs. The aim of this study was to develop a simple and accurate PCR-based sex determination protocol, which can be applicable to 6 major domesticated species of the family Bovidae, viz. Bos frontalis, B. grunniens, B. indicus, Bubalus bubalis, Capra hircus, and Ovis aries. In silico analysis was done to identify conserved DNA sequence in the HMG box region of the sex-determining region of the Y-chromosome (SRY gene) across the bovids. Duplex PCR assay, including the SRY gene and the GAPDH housekeeping gene, was optimized by using genomic DNA extracted from blood samples of known sex. It was possible to identify the sex of animals by amplifying both gender-specific (SRY) and autosomal (GAPDH) genes simultaneously in the duplex reaction, with the male yielding two bands and the female one band. The protocol was subjected to a blind test that showed a 100 percent specificity and accuracy, thus it can be used in sex determination in livestock breeding programs.

  2. Moessbauer measurements of microstructural change in aged duplex stainless steel

    SciTech Connect

    Kirihigashi, A.; Sakamoto, N.; Yamaoka, T.; Nasu, S.

    1995-08-01

    A duplex stainless steel (ASME SA351 CF8M) has usually been manufactured by a continuous casting technique. It consists of a paramagnetic austenite phase and a ferromagnetic ferrite phase. It has been known that the ferrite phase decomposition occurs in this steel after aging between 300 and 450 C. As a result of phase decomposition, a Fe-rich phase and a Cr-rich phase are produced in the ferrite phase. It is difficult to detect the phase decomposition even by not only optical microscopy but also transmission electron microscopy, since the decomposed structure is very fine. However, Moessbauer measurements that can detect the magnetic hyperfine field of magnetic substance may detect the microstructural change. An averaged magnetic hyperfine field increases in the ferrite phase, due to the production of the Fe-rich phase which has high magnetic hyperfine field. Therefore, the authors investigated the phase decomposition of the duplex stainless steel caused by aging, utilization Moessbauer spectroscopy which has capability of detecting this structural change in the atomic level quantitatively. The authors also investigated the potential of backscattering Moessbauer method for NDE technique.

  3. Thermal Aging Phenomena in Cast Duplex Stainless Steels

    SciTech Connect

    Byun, T. S.; Yang, Y.; Overman, N. R.; Busby, J. T.

    2015-11-12

    We used cast stainless steels (CASSs)for the large components of light water reactor (LWR) power plants such as primary coolant piping and pump casing. The thermal embrittlement of CASS components is one of the most serious concerns related to the extended-term operation of nuclear power plants. Many past researches have concluded that the formation of Cr-rich alpha-phase by Spinodal decomposition of delta-ferrite phase is the primary mechanism for the thermal embrittlement. Cracking mechanism in the thermally-embrittled duplex stainless steels consists of the formation of cleavage at ferrite and its propagation via separation of ferrite-austenite interphase. This article intends to provide an introductory overview on the thermal aging phenomena in LWR-relevant conditions. Firstly, the thermal aging effect on toughness is discussed in terms of the cause of embrittlement and influential parameters. Moreover, an approximate analysis of thermal reaction using Arrhenius equation was carried out to scope the aging temperatures for the accelerated aging experiments to simulate the 60 and 80 years of services. Further, an equilibrium precipitation calculation was performed for model CASS alloys using the CALPHAD program, and the results are used to describe the precipitation behaviors in duplex stainless steels. Our results are also to be used to guide an on-going research aiming to provide knowledge-based conclusive prediction for the integrity of the CASS components of LWR power plants during the service life extended up to and beyond 60 years.

  4. Thermal Aging Phenomena in Cast Duplex Stainless Steels

    SciTech Connect

    Byun, T. S.; Yang, Y.; Overman, N. R.; Busby, J. T.

    2016-02-28

    Cast stainless steels (CASSs) have been extensively used for the large components of light water reactor (LWR) power plants such as primary coolant piping and pump casing. The thermal embrittlement of CASS components is one of the most serious concerns related to the extended-term operation of nuclear power plants. Many past researches have concluded that the formation of Cr–rich α'-phase by Spinodal decomposition of δ-ferrite phase is the primary mechanism for the thermal embrittlement. Cracking mechanism in the thermally-embrittled duplex stainless steels consists of the formation of cleavage at ferrite and its propagation via separation of ferrite-austenite interphase. This article intends to provide an introductory overview on the thermal aging phenomena in LWR relevant conditions. Firstly, the thermal aging effect on toughness is discussed in terms of the cause of embrittlement and influential parameters. An approximate analysis of thermal reaction using Arrhenius equation was carried out to scope the aging temperatures for the accelerated aging experiments to simulate the 60 and 80 years of services. Further, equilibrium precipitation calculation was performed for model CASS alloys using the CALPHAD program and the results are used to describe the precipitation behaviors in duplex stainless steels. These results are also to be used to guide an on-going research aiming to provide knowledge-based conclusive prediction for the integrity of the CASS components of LWR power plants during the service life extended up to and beyond 60 years.

  5. Thermal Aging Phenomena in Cast Duplex Stainless Steels

    NASA Astrophysics Data System (ADS)

    Byun, T. S.; Yang, Y.; Overman, N. R.; Busby, J. T.

    2016-02-01

    Cast stainless steels (CASSs) have been extensively used for the large components of light water reactor (LWR) power plants such as primary coolant piping and pump casing. The thermal embrittlement of CASS components is one of the most serious concerns related to the extended-term operation of nuclear power plants. Many past researches have concluded that the formation of Cr-rich α'-phase by Spinodal decomposition of δ-ferrite phase is the primary mechanism for the thermal embrittlement. Cracking mechanism in the thermally-embrittled duplex stainless steels consists of the formation of cleavage at ferrite and its propagation via separation of ferrite-austenite interphase. This article intends to provide an introductory overview on the thermal aging phenomena in LWR-relevant conditions. Firstly, the thermal aging effect on toughness is discussed in terms of the cause of embrittlement and influential parameters. An approximate analysis of thermal reaction using Arrhenius equation was carried out to scope the aging temperatures for the accelerated aging experiments to simulate the 60 and 80 years of services. Further, an equilibrium precipitation calculation was performed for model CASS alloys using the CALPHAD program, and the results are used to describe the precipitation behaviors in duplex stainless steels. These results are also to be used to guide an on-going research aiming to provide knowledge-based conclusive prediction for the integrity of the CASS components of LWR power plants during the service life extended up to and beyond 60 years.

  6. Dual origin of pairing in nuclei

    NASA Astrophysics Data System (ADS)

    Idini, A.; Potel, G.; Barranco, F.; Vigezzi, E.; Broglia, R. A.

    2016-11-01

    The pairing correlations of the nucleus 120Sn are calculated by solving the Nambu-Gor'kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong 1 S 0 short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- ( v p bare) and long-range ( v p ind) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

  7. Stress corrosion cracking of duplex stainless steels in caustic solutions

    NASA Astrophysics Data System (ADS)

    Bhattacharya, Ananya

    Duplex stainless steels (DSS) with roughly equal amount of austenite and ferrite phases are being used in industries such as petrochemical, nuclear, pulp and paper mills, de-salination plants, marine environments, and others. However, many DSS grades have been reported to undergo corrosion and stress corrosion cracking in some aggressive environments such as chlorides and sulfide-containing caustic solutions. Although stress corrosion cracking of duplex stainless steels in chloride solution has been investigated and well documented in the literature but the SCC mechanisms for DSS in caustic solutions were not known. Microstructural changes during fabrication processes affect the overall SCC susceptibility of these steels in caustic solutions. Other environmental factors, like pH of the solution, temperature, and resulting electrochemical potential also influence the SCC susceptibility of duplex stainless steels. In this study, the role of material and environmental parameters on corrosion and stress corrosion cracking of duplex stainless steels in caustic solutions were investigated. Changes in the DSS microstructure by different annealing and aging treatments were characterized in terms of changes in the ratio of austenite and ferrite phases, phase morphology and intermetallic precipitation using optical micrography, SEM, EDS, XRD, nano-indentation and microhardness methods. These samples were then tested for general and localized corrosion susceptibility and SCC to understand the underlying mechanisms of crack initiation and propagation in DSS in the above-mentioned environments. Results showed that the austenite phase in the DSS is more susceptible to crack initiation and propagation in caustic solutions, which is different from that in the low pH chloride environment where the ferrite phase is the more susceptible phase. This study also showed that microstructural changes in duplex stainless steels due to different heat treatments could affect their SCC

  8. Clean cast steel technology. Determination of transformation diagrams for duplex stainless steel

    SciTech Connect

    Chumbley, S. L.

    2005-09-01

    Duplex stainless steels (DSS) constitute both ferrite and austenite as a matrix. Such a microstructure confers a high corrosion resistance with favorable mechanical properties. However, intermetallic phases such as sigma ( can also form during casting or high-temperature processing and can degrade the properties of the DSS. This research was initiated to develop time-temperature-transformation (TTT) and continuous-cooling- transformation (CCT) diagrams of two types of cast duplex stainless steels, CD3MN (Fe 22Cr-5Ni-Mo-N) and CD3MWCuN (Fe-25Cr-7Ni-Mo-W-Cu-N), in order to understand the time and temperature ranges for intermetallic phase formation. The alloys were heat treated isothermally or under controlled cooling conditions and then characterized using conventional metallographic methods that included tint etching, and also using electron microscopy (SEM, TEM) and wavelength dispersive spectroscopy (WDS). The kinetics of intermetallic-phase ( formation were analyzed using the Johnson-Mehl-Avrami (JMA) equation in the case of isothermal transformations and a modified form of this equation in the case of continuous cooling transformations, The rate of intermetallic-phase formation was found to be much faster in CD3MWCuN than CD3MN due mainly to differences in the major alloying contents such as Cr, Ni and Mo. To examine in more detail the effects of these elements of the phase stabilities, a series of eight steel castings was designed with the Cr, Ni and Mo contents systematically varied with respect to the nominal composition of CD3MN. The effects of varying the contents of alloying additions on the formation of intermetallic phases were also studied computationally using the commercial thermodynamic software package, Thermo-Calc. In general, was stabilized with increasing Cr addition and by increasing Mo addition. However, a delicate balance among Ni and other minor elements such as N and Si also exists. Phase equilibria in DSS can be affected by local

  9. DNA terminal base pairs have weaker hydrogen bonds especially for AT under low salt concentration

    NASA Astrophysics Data System (ADS)

    Ferreira, Izabela; Amarante, Tauanne D.; Weber, Gerald

    2015-11-01

    DNA base pairs are known to open more easily at the helix terminal, a process usually called end fraying, the details of which are still poorly understood. Here, we present a mesoscopic model calculation based on available experimental data where we consider separately the terminal base pairs of a DNA duplex. Our results show an important reduction of hydrogen bond strength for terminal cytosine-guanine (CG) base pairs which is uniform over the whole range of salt concentrations, while for AT base pairs, we obtain a nearly 1/3 reduction but only at low salt concentrations. At higher salt concentrations, terminal adenine-thymine (AT) pair has almost the same hydrogen bond strength than interior bases. The calculated terminal stacking interaction parameters display some peculiarly contrasting behavior. While there is mostly no perceptible difference to internal stacking, for some cases, we observe an unusually strong dependence with salt concentration which does not appear follow any pattern or trend.

  10. High-Temperature Phase Equilibria of Duplex Stainless Steels Assessed with a Novel In-Situ Neutron Scattering Approach

    NASA Astrophysics Data System (ADS)

    Pettersson, Niklas; Wessman, Sten; Hertzman, Staffan; Studer, Andrew

    2017-04-01

    Duplex stainless steels are designed to solidify with ferrite as the parent phase, with subsequent austenite formation occurring in the solid state, implying that, thermodynamically, a fully ferritic range should exist at high temperatures. However, computational thermodynamic tools appear currently to overestimate the austenite stability of these systems, and contradictory data exist in the literature. In the present work, the high-temperature phase equilibria of four commercial duplex stainless steel grades, denoted 2304, 2101, 2507, and 3207, with varying alloying levels were assessed by measurements of the austenite-to-ferrite transformation at temperatures approaching 1673 K (1400 °C) using a novel in-situ neutron scattering approach. All grades became fully ferritic at some point during progressive heating. Higher austenite dissolution temperatures were measured for the higher alloyed grades, and for 3207, the temperature range for a single-phase ferritic structure approached zero. The influence of temperatures in the region of austenite dissolution was further evaluated by microstructural characterization using electron backscattered diffraction of isothermally heat-treated and quenched samples. The new experimental data are compared to thermodynamic calculations, and the precision of databases is discussed.

  11. A Novel Pretreatment-Free Duplex Chamber Digital PCR Detection System for the Absolute Quantitation of GMO Samples

    PubMed Central

    Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2016-01-01

    Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems. PMID:26999129

  12. A Novel Pretreatment-Free Duplex Chamber Digital PCR Detection System for the Absolute Quantitation of GMO Samples.

    PubMed

    Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2016-03-18

    Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems.

  13. High-Temperature Phase Equilibria of Duplex Stainless Steels Assessed with a Novel In-Situ Neutron Scattering Approach

    NASA Astrophysics Data System (ADS)

    Pettersson, Niklas; Wessman, Sten; Hertzman, Staffan; Studer, Andrew

    2017-01-01

    Duplex stainless steels are designed to solidify with ferrite as the parent phase, with subsequent austenite formation occurring in the solid state, implying that, thermodynamically, a fully ferritic range should exist at high temperatures. However, computational thermodynamic tools appear currently to overestimate the austenite stability of these systems, and contradictory data exist in the literature. In the present work, the high-temperature phase equilibria of four commercial duplex stainless steel grades, denoted 2304, 2101, 2507, and 3207, with varying alloying levels were assessed by measurements of the austenite-to-ferrite transformation at temperatures approaching 1673 K (1400 °C) using a novel in-situ neutron scattering approach. All grades became fully ferritic at some point during progressive heating. Higher austenite dissolution temperatures were measured for the higher alloyed grades, and for 3207, the temperature range for a single-phase ferritic structure approached zero. The influence of temperatures in the region of austenite dissolution was further evaluated by microstructural characterization using electron backscattered diffraction of isothermally heat-treated and quenched samples. The new experimental data are compared to thermodynamic calculations, and the precision of databases is discussed.

  14. Matched-pair classification

    SciTech Connect

    Theiler, James P

    2009-01-01

    Following an analogous distinction in statistical hypothesis testing, we investigate variants of machine learning where the training set comes in matched pairs. We demonstrate that even conventional classifiers can exhibit improved performance when the input data has a matched-pair structure. Online algorithms, in particular, converge quicker when the data is presented in pairs. In some scenarios (such as the weak signal detection problem), matched pairs can be generated from independent samples, with the effect not only doubling the nominal size of the training set, but of providing the structure that leads to better learning. A family of 'dipole' algorithms is introduced that explicitly takes advantage of matched-pair structure in the input data and leads to further performance gains. Finally, we illustrate the application of matched-pair learning to chemical plume detection in hyperspectral imagery.

  15. Vortex pairs on surfaces

    SciTech Connect

    Koiller, Jair

    2009-05-06

    A pair of infinitesimally close opposite vortices moving on a curved surface moves along a geodesic, according to a conjecture by Kimura. We outline a proof. Numerical simulations are presented for a pair of opposite vortices at a close but nonzero distance on a surface of revolution, the catenoid. We conjecture that the vortex pair system on a triaxial ellipsoid is a KAM perturbation of Jacobi's geodesic problem. We outline some preliminary calculations required for this study. Finding the surfaces for which the vortex pair system is integrable is in order.

  16. Cooperative translocation enhances the unwinding of duplex DNA by SARS coronavirus helicase nsP13.

    PubMed

    Lee, Na-Ra; Kwon, Hyun-Mi; Park, Kkothanahreum; Oh, Sangtaek; Jeong, Yong-Joo; Kim, Dong-Eun

    2010-11-01

    SARS coronavirus encodes non-structural protein 13 (nsP13), a nucleic acid helicase/NTPase belonging to superfamily 1 helicase, which efficiently unwinds both partial-duplex RNA and DNA. In this study, unwinding of DNA substrates that had different duplex lengths and 5'-overhangs was examined under single-turnover reaction conditions in the presence of excess enzyme. The amount of DNA unwound decreased significantly as the length of the duplex increased, indicating a poor in vitro processivity. However, the quantity of duplex DNA unwound increased as the length of the single-stranded 5'-tail increased for the 50-bp duplex. This enhanced processivity was also observed for duplex DNA that had a longer single-stranded gap in between. These results demonstrate that nsP13 requires the presence of a long 5'-overhang to unwind longer DNA duplexes. In addition, enhanced DNA unwinding was observed for gapped DNA substrates that had a 5'-overhang, indicating that the translocated nsP13 molecules pile up and the preceding helicase facilitate DNA unwinding. Together with the propensity of oligomer formation of nsP13 molecules, we propose that the cooperative translocation by the functionally interacting oligomers of the helicase molecules loaded onto the 5'-overhang account for the observed enhanced processivity of DNA unwinding.

  17. Preparation and property of duplex Ni-B-TiO2/Ni nano-composite coatings

    NASA Astrophysics Data System (ADS)

    Wang, Shu-Jen; Wang, Yuxin; Shu, Xin; Tay, Seeleng; Gao, Wei; Shakoor, R. A.; Kahraman, Ramazan

    2015-03-01

    The duplex Nickel-Boron-Titania/Nickel (Ni-B-TiO2/Ni) coatings were deposited on mild steel by using two baths with Ni as the inner layer. TiO2 nanoparticles were incorporated into the Ni-B coatings as the outer layer by using solid particle mixing method. The microstructure, morphology and corrosion resistance of the duplex Ni-B-TiO2/Ni nanocomposite coatings were systemically investigated. The results show that the duplex interface was uniform and the adhesion between two layers was very good. The microhardness of duplex Ni-B-TiO2/Ni coating was much higher than the Ni coating due to the outer layer of Ni-B-TiO2 coating. The corrosion resistance of the duplex Ni-B-TiO2/Ni coating was also significantly improved comparing with single Ni-B coating. The Ni-B-10 g/L TiO2/Ni coating was found to have the best corrosion resistance among these duplex coatings. This type of duplex Ni-B-TiO2/Ni coating, with high hardness and good corrosion resistance properties, should be able to find broad applications under adverse environmental conditions.

  18. Cooper pairs and bipolarons

    NASA Astrophysics Data System (ADS)

    Lakhno, Victor

    2016-11-01

    It is shown that Cooper pairs are a solution of the bipolaron problem for model Fröhlich Hamiltonian. The total energy of a pair for the initial Fröhlich Hamiltonian is found. Differences between the solutions for the model and initial two-particle problems are discussed.

  19. Efficiency of coaxial stacking depends on the DNA duplex structure.

    PubMed

    Pyshnyi, Dmitrii V; Goldberg, Eugenii L; Ivanova, Eugenia M

    2003-12-01

    Thermodynamic parameters of coaxial stacking at complementary helix-helix interfaces GX*pYG/CZVC (X,Y=A,C,T,G;*-nick) created by contiguous oligonucleotide hybridization were determined. The data obtained were compared to the thermodynamic parameters of coaxial stacking at the interfaces CX*pYC/GZVG. Multiple linear regression analysis has revealed that the free-energy increments of interaction for the contacts GX*pYG/CZVC and CX*pYC/GZVG can be described by a set of uniform Delta G degrees(X*pY/ZV) values. The difference in the observed free-energy of the coaxial stacking between the two sets is defined by the contribution from the factors reflecting structural differences between compared DNA duplexes.

  20. Fault Injection Campaign for a Fault Tolerant Duplex Framework

    NASA Technical Reports Server (NTRS)

    Sacco, Gian Franco; Ferraro, Robert D.; von llmen, Paul; Rennels, Dave A.

    2007-01-01

    Fault tolerance is an efficient approach adopted to avoid or reduce the damage of a system failure. In this work we present the results of a fault injection campaign we conducted on the Duplex Framework (DF). The DF is a software developed by the UCLA group [1, 2] that uses a fault tolerant approach and allows to run two replicas of the same process on two different nodes of a commercial off-the-shelf (COTS) computer cluster. A third process running on a different node, constantly monitors the results computed by the two replicas, and eventually restarts the two replica processes if an inconsistency in their computation is detected. This approach is very cost efficient and can be adopted to control processes on spacecrafts where the fault rate produced by cosmic rays is not very high.

  1. Cooper Pairs in Insulators?!

    ScienceCinema

    James Valles

    2016-07-12

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions. 

  2. Thermal Aging Phenomena in Cast Duplex Stainless Steels

    DOE PAGES

    Byun, T. S.; Yang, Y.; Overman, N. R.; ...

    2015-11-12

    We used cast stainless steels (CASSs)for the large components of light water reactor (LWR) power plants such as primary coolant piping and pump casing. The thermal embrittlement of CASS components is one of the most serious concerns related to the extended-term operation of nuclear power plants. Many past researches have concluded that the formation of Cr-rich alpha-phase by Spinodal decomposition of delta-ferrite phase is the primary mechanism for the thermal embrittlement. Cracking mechanism in the thermally-embrittled duplex stainless steels consists of the formation of cleavage at ferrite and its propagation via separation of ferrite-austenite interphase. This article intends to providemore » an introductory overview on the thermal aging phenomena in LWR-relevant conditions. Firstly, the thermal aging effect on toughness is discussed in terms of the cause of embrittlement and influential parameters. Moreover, an approximate analysis of thermal reaction using Arrhenius equation was carried out to scope the aging temperatures for the accelerated aging experiments to simulate the 60 and 80 years of services. Further, an equilibrium precipitation calculation was performed for model CASS alloys using the CALPHAD program, and the results are used to describe the precipitation behaviors in duplex stainless steels. Our results are also to be used to guide an on-going research aiming to provide knowledge-based conclusive prediction for the integrity of the CASS components of LWR power plants during the service life extended up to and beyond 60 years.« less

  3. Duplex Doppler ultrasound study of the temporomandibular joint.

    PubMed

    Stagnitti, A; Marini, A; Impara, L; Drudi, F M; Lo Mele, L; Lillo Odoardi, G

    2012-06-01

    Sommario INTRODUZIONE: La fisiologia articolare dell’articolazione temporo-mandibolare (ATM) può essere esaminata sia dal punto di vista clinico che strumentale. La diagnostica per immagini ha da tempo contribuito con la risonanza magnetica (RM) e anche con la radiografia (Rx) e la tomografia computerizzata (TC) all’analisi della morfologia dei capi articolari e della cinetica condilare. L’esame duplex-ecodoppler è una metodica di largo impiego nello studio delle strutture in movimento in particolar modo a livello delle strutture del sistema vascolare. MATERIALI E METODI: È stata utilizzata un’apparecchiatura Toshiba APLIO SSA-770A, con l’uso di tecnica duplex-ecodoppler multi display, che consente la visualizzazione contemporanea dell’immagine ecografica e dei segnali Doppler utilizzando una sonda lineare del tipo phased array con cristalli trasduttori funzionanti ad una frequenza fondamentale di 6 MHz per gli spettri Doppler pulsati e 7.5 MHz per l’imaging ecografico. Sono stati esaminati nel Dipartimento di Scienze Radiologiche, Oncologiche e Anatomo-patologiche dell’Università “Sapienza” di Roma, 30 pazienti del reparto di Ortognatodonzia dell’Istituto di Odontoiatria della stessa Università. RISULTATI: Nei pazienti normali si è ottenuta un’alternanza regolare degli spettri Doppler, mentre nei soggetti con disfunzioni del complesso condilo-meniscale, si è persa la regolarità della sommatoria degli spettri di Fourier, con altezze incostanti in relazione a spostamenti irregolari del complesso condilo-meniscale. CONCLUSIONI: L’esame ecodoppler si è dimostrato, in tutti i pazienti, capace di discriminare quelli normali dai patologici e tra questi ultimi ha permesso di identificare gli aspetti più significativi delle patologie disfunzionali.

  4. Duplex microfluidic SERS detection of pathogen antigens with nanoyeast single-chain variable fragments.

    PubMed

    Wang, Yuling; Rauf, Sakandar; Grewal, Yadveer S; Spadafora, Lauren J; Shiddiky, Muhammad J A; Cangelosi, Gerard A; Schlücker, Sebastian; Trau, Matt

    2014-10-07

    Quantitative and accurate detection of multiple biomarkers would allow for the rapid diagnosis and treatment of diseases induced by pathogens. Monoclonal antibodies are standard affinity reagents applied for biomarkers detection; however, their production is expensive and labor-intensive. Herein, we report on newly developed nanoyeast single-chain variable fragments (NYscFv) as an attractive alternative to monoclonal antibodies, which offers the unique advantage of a cost-effective production, stability in solution, and target-specificity. By combination of surface-enhanced Raman scattering (SERS) microspectroscopy using glass-coated, highly purified SERS nanoparticle clusters as labels, with a microfluidic device comprising multiple channels, a robust platform for the sensitive duplex detection of pathogen antigens has been developed. Highly sensitive detection for individual Entamoeba histolytica antigen EHI_115350 (limit of detection = 1 pg/mL, corresponding to 58.8 fM) and EHI_182030 (10 pg/mL, corresponding 453 fM) with high specificity has been achieved, employing the newly developed corresponding NYscFv as probe in combination with SERS microspectroscopy at a single laser excitation wavelength. Our first report on SERS-based immunoassays using the novel NYscFv affinity reagent demonstrates the flexibility of NYscFv fragments as viable alternatives to monoclonal antibodies in a range of bioassay platforms and paves the way for further applications.

  5. Geometry of an outcrop-scale duplex in Devonian flysch, Maine

    USGS Publications Warehouse

    Bradley, D.C.; Bradley, L.M.

    1994-01-01

    We describe an outcrop-scale duplex consisting of 211 exposed repetitions of a single bed. The duplex marks an early Acadian (Middle Devonian) oblique thrust zone in the Lower Devonian flysch of northern Maine. Detailed mapping at a scale of 1:8 has enabled us to measure accurately parameters such as horse length and thickness, ramp angles and displacements; we compare these and derivative values with those of published descriptions of duplexes, and with theoretical models. Shortening estimates based on line balancing are consistently smaller than two methods of area balancing, suggesting that layer-parallel shortening preceded thrusting. ?? 1994.

  6. Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function.

    PubMed

    Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Jia, Lei; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2015-01-01

    The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue-DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision

  7. Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function

    PubMed Central

    Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2015-01-01

    The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide

  8. An innate twist between Crick's wobble and Watson-Crick base pairs.

    PubMed

    Ananth, Prakash; Goldsmith, Gunaseelan; Yathindra, Narayanarao

    2013-08-01

    Non-Watson-Crick pairs like the G·U wobble are frequent in RNA duplexes. Their geometric dissimilarity (nonisostericity) with the Watson-Crick base pairs and among themselves imparts structural variations decisive for biological functions. Through a novel circular representation of base pairs, a simple and general metric scheme for quantification of base-pair nonisostericity, in terms of residual twist and radial difference that can also envisage its mechanistic effect, is proposed. The scheme is exemplified by G·U and U·G wobble pairs, and their predicable local effects on helical twist angle are validated by MD simulations. New insights into a possible rationale for contextual occurrence of G·U and other non-WC pairs, as well as the influence of a G·U pair on other non-Watson-Crick pair neighborhood and RNA-protein interactions are obtained from analysis of crystal structure data. A few instances of RNA-protein interactions along the major groove are documented in addition to the well-recognized interaction of the G·U pair along the minor groove. The nonisostericity-mediated influence of wobble pairs for facilitating helical packing through long-range interactions in ribosomal RNAs is also reviewed.

  9. Anyon pairing via phonon-mediated interaction

    NASA Astrophysics Data System (ADS)

    Kandemir, B. S.

    2006-08-01

    In this paper, we study the pairing of anyons subjected to an external uniform magnetic field and confined in a two-dimensional parabolic quantum dot within the framework of Fröhlich large bipolaron theory, motivated by the Wilczek’s prescription that treats anyons as composites having both charges and fictitious flux tubes. In this model, electrons bound to Aharanov-Bohm type flux tubes and surrounded by a cloud of virtual LO phonons interact with each other through the long range Coulomb and statistical potentials. In order to discuss the effects of both spatial confinement potential and external uniform magnetic field on the boundaries of the stability region of such a pairing in real space, we perform a self-consistent treatment of the ground-state energies of both an interacting anyon pair and two noninteracting anyons. Our results suggest that two interacting anyons can be bound into a condensate anyon pair through a phonon-mediated interaction.

  10. Two-flux transfer matrix model for predicting the reflectance and transmittance of duplex halftone prints.

    PubMed

    Mazauric, Serge; Hébert, Mathieu; Simonot, Lionel; Fournel, Thierry

    2014-12-01

    We introduce a model allowing convenient calculation of the spectral reflectance and transmittance of duplex prints. It is based on flux transfer matrices and enables retrieving classical Kubelka-Munk formulas, as well as extended formulas for nonsymmetric layers. By making different assumptions on the flux transfers, we obtain two predictive models for the duplex halftone prints: the "duplex Clapper-Yule model," which is an extension of the classical Clapper-Yule model, and the "duplex primary reflectance-transmittance model." The two models can be calibrated from either reflectance or transmittance measurements; only the second model can be calibrated from both measurements, thus giving optimal accuracy for both reflectance and transmittance predictions. The conceptual differences between the two models are deeply analyzed, as well as their advantages and drawbacks in terms of calibration. According to the test carried out in this study with paper printed in inkjet, their predictive performances are good provided appropriate calibration options are selected.

  11. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

    1999-01-19

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

  12. Paired Straight Hearth Furnace

    SciTech Connect

    2009-04-01

    This factsheet describes a research project whose goals are to design, develop, and evaluate the scalability and commercial feasibility of the PSH Paired Straight Hearth Furnace alternative ironmaking process.

  13. Synthesis, base pairing and structure studies of geranylated RNA

    PubMed Central

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-01-01

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

  14. Reversibly locked thionucleobase pairs in DNA to study base flipping enzymes.

    PubMed

    Beuck, Christine; Weinhold, Elmar

    2014-01-01

    Covalently interstrand cross-linked DNA is an interesting tool to study DNA binding proteins that locally open up the DNA duplex by flipping single bases out of the DNA helix or melting whole stretches of base pairs to perform their function. The ideal DNA cross-link to study protein-DNA interactions should be specific and easy to synthesize, be stable during protein binding experiments, have a short covalent linker to avoid steric hindrance of protein binding, and should be available as a mimic for both A/T and G/C base pairs to cover all possible binding specificities. Several covalent interstrand cross-links have been described in the literature, but most of them fall short of at least one of the above criteria. We developed an efficient method to site-specifically and reversibly cross-link thionucleoside base pairs in synthetic duplex oligodeoxynucleotides by bisalkylation with 1,2-diiodoethane resulting in an ethylene-bridged base pair. Both linked A/T and G/C base pair analogs can conveniently be prepared which allows studying any base pair-opening enzyme regardless of its sequence specificity. The cross-link is stable in the absence of reducing agents but the linker can be quickly and tracelessly removed by the addition of thiol reagents like dithiothreitol. This property makes the cross-linking reaction fully reversible and allows for a switching of the linked base pair from locked to unlocked during biochemical experiments. Using the DNA methyltransferase from Thermus aquaticus (M.TaqI) as example, we demonstrate that the presented cross-linked DNA with an ethylene-linked A/T base pair analog at the target position is a useful tool to determine the base-flipping equilibrium constant of a base-flipping enzyme which lies mostly on the extrahelical side for M.TaqI.

  15. Cooper Pair Insulators

    NASA Astrophysics Data System (ADS)

    Valles, James

    One of the recent advances in the field of the Superconductor to Insulator Transition (SIT) has been the discovery and characterization of the Cooper Pair Insulator phase. This bosonic insulator, which consists of localized Cooper pairs, exhibits activated transport and a giant magneto-resistance peak. These features differ markedly from the weakly localized transport that emerges as pairs break at a ``fermionic'' SIT. I will describe how our experiments on films nano-patterned with a nearly triangular array of holes have enabled us to 1) distinguish bosonic insulators from fermionic insulators, 2) show that Cooper pairs, rather than quasi-particles dominate the transport in the Cooper Pair insulator phase, 3) demonstrate that very weak, sub nano-meter thickness inhomogeneities control whether a bosonic or fermionic insulator forms at an SIT and 4) reveal that Cooper pairs disintegrate rather than becoming more tightly bound deep in the localized phase. We have also developed a method, using a magnetic field, to tune flux disorder reversibly in these films. I will present our latest results on the influence of magnetic flux disorder and random gauge fields on phenomena near bosonic SITs. This work was performed in collaboration with M. D. Stewart, Jr., Hung Q. Nguyen, Shawna M. Hollen, Jimmy Joy, Xue Zhang, Gustavo Fernandez, Jeffrey Shainline and Jimmy Xu. It was supported by NSF Grants DMR 1307290 and DMR-0907357.

  16. Heat Capacity Changes Associated with DNA Duplex Formation: Salt- and Sequence-Dependent Effects†

    PubMed Central

    Mikulecky, Peter J.; Feig, Andrew L.

    2008-01-01

    Duplexes are the most fundamental elements of nucleic acid folding. Although it has become increasingly clear that duplex formation can be associated with a significant change in heat capacity (ΔCp), this parameter is typically overlooked in thermodynamic studies of nucleic acid folding. Analogy to protein folding suggests that base stacking events coupled to duplex formation should give rise to a ΔCp due to the release of waters solvating aromatic surfaces of nucleotide bases. In previous work, we showed that the ΔCp observed by isothermal titration calorimetry (ITC) for RNA duplex formation depended on salt and sequence. In the present work, we apply calorimetric and spectroscopic techniques to a series of designed DNA duplexes to demonstrate that both the salt dependence and sequence dependence of ΔCps observed by ITC reflect perturbations to the same fundamental phenomenon: stacking in the single-stranded state. By measuring the thermodynamics of single strand melting, one can accurately predict the ΔCps observed for duplex formation by ITC at high and low ionic strength. We discuss our results in light of the larger issue of contributions to ΔCp from coupled equilibria and conclude that observed ΔCps can be useful indicators of intermediate states in nucleic acid folding phenomena. PMID:16401089

  17. Duplex ultrasound in the assessment of peripheral arterial disease

    NASA Astrophysics Data System (ADS)

    Aly, Sayed A. A. F.

    Arteriography plays a central role in the assessment of peripheral arterial disease. Arteriography is associated with the risk of damage to the artery, peripheral embolisation, hazards of intra-arterial injection and exposure to ionising radiation. Arteriography provides an anatomical assessment of arterial stenosis but does not measure the functional results of the stenosis. Modern high resolution ultrasound imaging technology enables non-invasive assessment of vascular diseases and allows functional assessment of blood flow. This investigation is of proven value in studying carotid disease. The aim of the study was to determine the accuracy of duplex ultrasonography (DUS) in assessment of lower limb arterial disease in comparison with arteriography (IA DSA). A technical comparison has been made between the description of arterial lesion as indicated by DUS and IA DSA. In addition, the sensitivity of DUS in assessing multisegmental arterial disease has been determined. The clinical decision has been investigated in a further study in which five surgeons were asked to determine patient management based on IA DSA and DUS data in the same patient group. Concordance between management strategies was assessed. DUS was used as the primary method of investigation in further series of patients. Criteria were established to determine which patients would require angiography. The computer-assisted image analysis was used to study the ultrasound images of arterial stenosis and a method of analysing such images objectively was established. Two studies have been included in this section. These assess the technical accuracy of ultrasound image analysis compared with histological examination of plaque. The reproducibility of the image analysis has also been tested. I have developed a classification for peripheral arterial disease to be used to facilitate the communication between vascular laboratory staff who perform the duplex ultrasonography and surgeons who use this

  18. Power-Aware Asynchronous Peer-to-Peer Duplex Communication System Based on Multiple-Valued One-Phase Signaling

    NASA Astrophysics Data System (ADS)

    Mizusawa, Kazuyasu; Onizawa, Naoya; Hanyu, Takahiro

    This paper presents a design of an asynchronous peer-to-peer half-duplex/full-duplex-selectable data-transfer system on-chip interconnected. The data-transfer method between channels is based on a 1-phase signaling scheme realized by using multiple-valued current-mode (MVCM) circuits and encoding, which performs high-speed communication. A data transmission is selectable by adding a mode-detection circuit that observes data-transmission modes; full-duplex, half duplex and standby modes. Especially, since current sources are completely cut off during the standby mode, the power dissipation can be greatly reduced. Moreover, both half-duplex and full-duplex communication can be realized by sharing a common circuit except a signal-level conversion circuit. The proposed interface is implemented using 0.18-μm CMOS, and its performance improvement is discussed in comparison with those of the other ordinary asynchronous methods.

  19. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    PubMed

    Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  20. Reaction-diffusion processes and metapopulation models on duplex networks

    NASA Astrophysics Data System (ADS)

    Xuan, Qi; Du, Fang; Yu, Li; Chen, Guanrong

    2013-03-01

    Reaction-diffusion processes, used to model various spatially distributed dynamics such as epidemics, have been studied mostly on regular lattices or complex networks with simplex links that are identical and invariant in transferring different kinds of particles. However, in many self-organized systems, different particles may have their own private channels to keep their purities. Such division of links often significantly influences the underlying reaction-diffusion dynamics and thus needs to be carefully investigated. This article studies a special reaction-diffusion process, named susceptible-infected-susceptible (SIS) dynamics, given by the reaction steps β→α and α+β→2β, on duplex networks where links are classified into two groups: α and β links used to transfer α and β particles, which, along with the corresponding nodes, consist of an α subnetwork and a β subnetwork, respectively. It is found that the critical point of particle density to sustain reaction activity is independent of the network topology if there is no correlation between the degree sequences of the two subnetworks, and this critical value is suppressed or extended if the two degree sequences are positively or negatively correlated, respectively. Based on the obtained results, it is predicted that epidemic spreading may be promoted on positive correlated traffic networks but may be suppressed on networks with modules composed of different types of diffusion links.

  1. Diagnosing erectile dysfunction: the penile dynamic colour duplex ultrasound revisited.

    PubMed

    Aversa, A; Bruzziches, R; Spera, G

    2005-12-01

    A number of disease processes of the penis including Peyronie's disease, priapism, penile fractures and tumors are clearly visualized with ultrasound. Diagnostic evaluation of erectile dysfunction (ED) by penile dynamic colour-duplex Doppler ultrasonography (D-CDDU) is actually considered a second level approach to ED patients because of the fact that intracavernous injections test IV with prostaglandin-E(1) may provide important information about the patients' erectile capacity. However, no direct vascular imaging and a high percentage of false negative diagnoses of vasculogenic ED are its major pitfalls and subsequent treatment decisions remain quite limited. The occurrence of ED and its sentinel relationship to cardiovascular disease has prompted more accurate vascular screening in all patients even in the absence of cardiovascular risk factors. The sonographic evaluation of the intima-media thickness of the carotid arteries may sometimes represent an early manifestation of diffuse atherosclerotic disease and endothelial damage. This latter finding is often the cause of failure to oral agents, i.e. phosphodiesterase inhibitors, because of inability of the dysfunctional endothelium to release nitric oxide. D-CDDU represents an accurate tool to investigate cavernous artery inflow and venous leakage when compared with more invasive diagnostic techniques i.e. selective arteriography and dynamic infusion cavernosometry along with cavernosography.

  2. Phase Separation in Lean Grade Duplex Stainless Steel 2101

    SciTech Connect

    Garfinkel, D.; Poplawsky, Jonathan D.; Guo, Wei; Young, Jr., George A.; Tucker, Julie

    2015-08-19

    The use of duplex stainless steels (DSS) in nuclear power generation systems is limited by thermal instability that leads to embrittlement in the temperature range of 204°C - 538°C. New lean grade alloys, such as 2101, offer the potential to mitigate these effects. Thermal embrittlement was quantified through impact toughness and hardness testing on samples of alloy 2101 after aging at 427°C for various durations (1-10,000 hours). Additionally, atom probe tomography (APT) was utilized in order to observe the kinetics of α-α’ separation and G-phase formation. Mechanical testing and APT data for two other DSS alloys, 2003 and 2205 were used as a reference to 2101. The results show that alloy 2101 exhibits superior performance compared to the standard grade DSS alloy, 2205, but inferior to the lean grade alloy, 2003, in mechanical testing. APT data demonstrates that the degree of α-α’ separation found in alloy 2101 closely resembles that of 2205, and greatly exceeds 2003. Additionally, contrary to what was observed in 2003, 2101 demonstrated G-phase like precipitates after long aging times, though precipitates were not as abundant as was observed in 2205.

  3. Aging of cast duplex stainless steels in LWR systems

    SciTech Connect

    Chopra, O.K.; Chung, H.M.

    1984-10-01

    A program is being conducted to investigate the significance of in-service embrittlement of cast duplex stainless steels under light-water reactor operating conditions. The existing data are evaluated to determine the expected embrittlement of cast components during the operating lifetime of reactors and to define the objectives and scope of the investigation. This presentation describes the status of the program. Data for the metallurgical characterization of the various cast stainless steels used in the investigation are presented. Charpy impact tests on short-term aged material indicate that CF-3 stainless steels are less susceptible to embrittlement than CF-8 or CF-8M stainless steels. Microstructural characterization of cast stainless steels that were obtained from Georg Fischer Co. and aged for up to 70,000 h at 300, 350, and 400/sup 0/C reveals the formation of four different types of precipitates that are not ..cap alpha..'. Embrittlement of the ferrite phase is primarily due to pinning of the dislocations by two of these precipitates, designated as Type M and Type X. The ferrite phase is embrittled after approx. 8 y at 300/sup 0/C and shows cleavage fracture. Examination of the fracture surfaces of the impact-test specimens indicates that the toughness of the long-term aged material is determined by the austenite phase. 8 figures, 3 tables.

  4. Superplastic Forming of Duplex Stainless Steel for Aerospace Part

    NASA Astrophysics Data System (ADS)

    Lee, Ho-Sung; Yoon, Jong-Hoon; Yoo, Joon-Tae; Yi, Young-Moo

    2011-08-01

    In this study, the high temperature forming behavior of duplex stainless steel has been characterized and the outer shell of a combustion chamber was fabricated with pressure difference of hot gas. It consists of two parts which are the outer skin made of stainless steel to sustain the internal pressure and the inner shell made of copper alloy for regenerative cooling channels. Two outer skins partitioned to half with respect to the symmetric axis was prepared by hot gas forming process with a maximum pressure of 7 MPa following to FEM analysis. For inner layer, copper alloy was machined for cooling channels and then placed in the gas pressure welding fixture. It is shown that the optimum condition of gas pressure welding is 7 MPa at 890 °C, for one hour. EDX analysis and scanning electron microscope micrograph confirm the atomic diffusion process is observed at the interface and copper atoms diffuse into steel, while iron and chrome atoms diffuse into copper. The result shows that the manufacturing method with superplastic forming and gas pressure welding of steel and copper alloy has been successful for near net shape manufacturing of scaled combustion chamber of launch vehicle.

  5. Carburizing of Duplex Stainless Steel (DSS) Under Compression Superplastic Deformation

    NASA Astrophysics Data System (ADS)

    Ahamad, Nor Wahida; Jauhari, Iswadi

    2012-12-01

    A new surface carburizing technique which combines superplastic deformation with superplastic carburizing (SPC) is introduced. SPC was conducted on duplex stainless steel under compression mode at a fixed 0.5 height reduction strain rates ranging from 6.25 × 10-5 to 1 × 10-3 s-1 and temperature ranging from 1173 K to 1248 K (900 °C to 975 °C). The results are compared with those from conventional and non-superplastic carburizing. The results show that thick hard carburized layers are formed at a much faster rate compared with the other two processes. A more gradual hardness transition from the surface to the substrate is also obtained. The highest carburized layer thickness and surface hardness are attained under SPC process at 1248 K (975 °C) and 6.25 × 10-5 s-1 with a value of (218.3 ± 0.5) μm and (1581.0 ± 5.0) HV respectively. Other than that, SPC also has the highest scratch resistance.

  6. Eddy current techniques for super duplex stainless steel characterization

    NASA Astrophysics Data System (ADS)

    Camerini, C.; Sacramento, R.; Areiza, M. C.; Rocha, A.; Santos, R.; Rebello, J. M.; Pereira, G.

    2015-08-01

    Super duplex stainless steel (SDSS) is a two-phase material where the microstructure consists of grains of ferrite (δ) and austenite (γ). SDSS exhibit an attractive combination of properties, such as: strength, toughness and stress corrosion cracking resistance. Nevertheless, SDSS attain these properties after a controlled solution heat treatment, leading to a similar volumetric fraction of δ and γ. Any further heat treatment, welding operation for example, can change the balance of the original phases, or may also lead to precipitation of a deleterious phase, such as sigma (σ). For these situations, the material corrosion resistance is severely impaired. In the present study, several SDSS samples with low σ phase content and non-balanced microstructure were intentionally obtained by thermally treating SDSS specimens. Electromagnetic techniques, conventional Eddy Current Testing (ECT) and Saturated Low Frequency Eddy Current (SLOFEC), were employed to characterize the SDSS samples. The results showed that ECT and SLOFEC are reliable techniques to evaluate σ phase presence in SDSS and can provide an estimation of the δ content.

  7. Phase Separation in Lean Grade Duplex Stainless Steel 2101

    DOE PAGES

    Garfinkel, D.; Poplawsky, Jonathan D.; Guo, Wei; ...

    2015-08-19

    The use of duplex stainless steels (DSS) in nuclear power generation systems is limited by thermal instability that leads to embrittlement in the temperature range of 204°C - 538°C. New lean grade alloys, such as 2101, offer the potential to mitigate these effects. Thermal embrittlement was quantified through impact toughness and hardness testing on samples of alloy 2101 after aging at 427°C for various durations (1-10,000 hours). Additionally, atom probe tomography (APT) was utilized in order to observe the kinetics of α-α’ separation and G-phase formation. Mechanical testing and APT data for two other DSS alloys, 2003 and 2205 weremore » used as a reference to 2101. The results show that alloy 2101 exhibits superior performance compared to the standard grade DSS alloy, 2205, but inferior to the lean grade alloy, 2003, in mechanical testing. APT data demonstrates that the degree of α-α’ separation found in alloy 2101 closely resembles that of 2205, and greatly exceeds 2003. Additionally, contrary to what was observed in 2003, 2101 demonstrated G-phase like precipitates after long aging times, though precipitates were not as abundant as was observed in 2205.« less

  8. Beamforming Based Full-Duplex for Millimeter-Wave Communication.

    PubMed

    Liu, Xiao; Xiao, Zhenyu; Bai, Lin; Choi, Jinho; Xia, Pengfei; Xia, Xiang-Gen

    2016-07-21

    In this paper, we study beamforming based full-duplex (FD) systems in millimeter-wave (mmWave) communications. A joint transmission and reception (Tx/Rx) beamforming problem is formulated to maximize the achievable rate by mitigating self-interference (SI). Since the optimal solution is difficult to find due to the non-convexity of the objective function, suboptimal schemes are proposed in this paper. A low-complexity algorithm, which iteratively maximizes signal power while suppressing SI, is proposed and its convergence is proven. Moreover, two closed-form solutions, which do not require iterations, are also derived under minimum-mean-square-error (MMSE), zero-forcing (ZF), and maximum-ratio transmission (MRT) criteria. Performance evaluations show that the proposed iterative scheme converges fast (within only two iterations on average) and approaches an upper-bound performance, while the two closed-form solutions also achieve appealing performances, although there are noticeable differences from the upper bound depending on channel conditions. Interestingly, these three schemes show different robustness against the geometry of Tx/Rx antenna arrays and channel estimation errors.

  9. Beamforming Based Full-Duplex for Millimeter-Wave Communication

    PubMed Central

    Liu, Xiao; Xiao, Zhenyu; Bai, Lin; Choi, Jinho; Xia, Pengfei; Xia, Xiang-Gen

    2016-01-01

    In this paper, we study beamforming based full-duplex (FD) systems in millimeter-wave (mmWave) communications. A joint transmission and reception (Tx/Rx) beamforming problem is formulated to maximize the achievable rate by mitigating self-interference (SI). Since the optimal solution is difficult to find due to the non-convexity of the objective function, suboptimal schemes are proposed in this paper. A low-complexity algorithm, which iteratively maximizes signal power while suppressing SI, is proposed and its convergence is proven. Moreover, two closed-form solutions, which do not require iterations, are also derived under minimum-mean-square-error (MMSE), zero-forcing (ZF), and maximum-ratio transmission (MRT) criteria. Performance evaluations show that the proposed iterative scheme converges fast (within only two iterations on average) and approaches an upper-bound performance, while the two closed-form solutions also achieve appealing performances, although there are noticeable differences from the upper bound depending on channel conditions. Interestingly, these three schemes show different robustness against the geometry of Tx/Rx antenna arrays and channel estimation errors. PMID:27455256

  10. Cavitation corrosion behavior of cast duplex stainless steel in seawater

    SciTech Connect

    Shalaby, H.M.; Al-Hashem, A.

    1996-10-01

    The cavitation corrosion behavior of a commercial cast duplex stainless steel was studied in seawater using an ultrasonically induced cavitation facility at a frequency of 20 kHz and an amplitude of 25 {micro}m. The work included measurements of the free corrosion potential and mass loss in addition to microscopic examinations. Cavitation caused an active shift in the free corrosion potential. The rate of mass loss was negligible in quiescent seawater, while it significantly increased in the presence of cavitation. The application of cathodic protection reduced the rate of mass loss by 19%. Microscopic examinations revealed that the first signs of cavitation damage were in the form of slip bands and small cavities in the austenite islands and at the ferrite/austenite boundaries. With the progress of cavitation, material loss became mainly at the austenite phase and spread to the ferrite phase at a later stage. Cathodic protection decreased slightly the number of cavities. Cross-sectional examinations revealed the presence of microcracks in the bulk of the material. The microcracks initiated at the surface in the ferrite matrix. Crack propagation was impeded by the austenite islands and branched along parallel slip systems.

  11. Superplastic Forming of Duplex Stainless Steel for Aerospace Part

    SciTech Connect

    Lee, Ho-Sung; Yoon, Jong-Hoon; Yoo, Joon-Tae; Yi, Young-Moo

    2011-08-22

    In this study, the high temperature forming behavior of duplex stainless steel has been characterized and the outer shell of a combustion chamber was fabricated with pressure difference of hot gas. It consists of two parts which are the outer skin made of stainless steel to sustain the internal pressure and the inner shell made of copper alloy for regenerative cooling channels. Two outer skins partitioned to half with respect to the symmetric axis was prepared by hot gas forming process with a maximum pressure of 7 MPa following to FEM analysis. For inner layer, copper alloy was machined for cooling channels and then placed in the gas pressure welding fixture. It is shown that the optimum condition of gas pressure welding is 7 MPa at 890 deg. C, for one hour. EDX analysis and scanning electron microscope micrograph confirm the atomic diffusion process is observed at the interface and copper atoms diffuse into steel, while iron and chrome atoms diffuse into copper. The result shows that the manufacturing method with superplastic forming and gas pressure welding of steel and copper alloy has been successful for near net shape manufacturing of scaled combustion chamber of launch vehicle.

  12. Computational evaluation of intermolecular interactions of a universal base 3-nitropyrrole in stacked dimers and DNA duplexes.

    PubMed

    Seio, Kohji; Ukawa, Hisashi; Shohda, Koh-ichiro; Sekine, Mitsuo

    2005-06-01

    The stacking interactions between a universal base of 3-nitropyrrole (3NP) and four canonical nucleobases were studied by means of ab initio molecular orbital calculations. The stabilities of the complexes are comparable to those of the stacked dimers of canonical bases reported previously. The detailed analysis of the interaction energies revealed the importance of the dipole-dipole interaction included in the Hartree-Fock terms to determine the geometry dependence of the stacking energies. It was also clarified that the dispersion energies included in the electron-correlation terms were essential to obtain adequate stabilities. The contribution of the nitro group was evaluated by the comparative studies of pyrrole and 3NP. The increased molecular dipole moment and surface are expected to account for the enhancement of the stability of the stacked dimers containing 3NP. The force field parameters required for calculation of the molecular mechanics of 3NP were obtained for 3NP on the basis of these molecular orbital calculations. The energy-minimized structures obtained by the molecular mechanics calculations of 3NP accorded with those obtained by the molecular orbital calculations described above. A DNA duplex structure containing 3NP-A, 3NP-T, or 3NP-C was calculated by use of these force field parameters. In the case of 3NP-A, the computationally calculated structure was in good agreement with that previously determined by use of (1)H-NMR except for the orientation of the nitro group.

  13. On Adiabatic Pair Creation

    NASA Astrophysics Data System (ADS)

    Pickl, Peter; Dürr, Detlef

    2008-08-01

    We give here a rigorous proof of the well known prediction of pair creation as it arises from the Dirac equation with an external time dependent potential. Pair creation happens with probability one if the potential changes adiabatically in time and becomes overcritical, which means that an eigenvalue curve (as a function of time) bridges the gap between the negative and positive spectral continuum. The potential can be thought of as being zero at large negative and large positive times. The rigorous treatment of this effect has been lacking since the pioneering work of Beck, Steinwedel and Süßmann [1] in 1963 and Gershtein and Zeldovich [8] in 1970.

  14. Synergistic effects in the melting of DNA hydration shell: melting of the minor groove hydration spine in poly(dA).poly(dT) and its effect on base pair stability.

    PubMed Central

    Chen, Y Z; Prohofsky, E W

    1993-01-01

    We propose that water of hydration in contact with the double helix can exist in several states. One state, found in the narrow groove of poly(dA).poly(dT), should be considered as frozen to the helix, i.e., an integral part of the double helix. We find that this enhanced helix greatly effects the stability of that helix against base separation melting. Most water surrounding the helix is, however, melted or disassociated with respect to being an integral part of helix and plays a much less significant role in stabilizing the helix dynamically, although these water molecules play an important role in stabilizing the helix conformation statically. We study the temperature dependence of the melting of the hydration spine and find that narrow groove nonbonded interactions are necessary to stabilize the spine above room temperature and to show the broad transition observed experimentally. This calculation requires that synergistic effects of nonbonded interactions between DNA and its hydration shell affect the state of water-base atom hydrogen bonds. The attraction of waters into narrow groove tends to retain waters in the groove and compress or strain these hydrogen bonds. PMID:8324179

  15. G-quadruplex hinders translocation of BLM helicase on DNA: a real-time fluorescence spectroscopic unwinding study and comparison with duplex substrates.

    PubMed

    Liu, Jia-quan; Chen, Chang-yue; Xue, Yong; Hao, Yu-hua; Tan, Zheng

    2010-08-04

    Sequences with the potential to form G-quadruplex structures are spread throughout genomic DNA. G-quadruplexes in promoter regions can play regulatory roles in gene expression. Expression of protein-encoding genes involves processing of DNA and RNA molecules at the level of transcription and translation, respectively. In order to examine how the G-quadruplex affects processing of nucleic acids, we established a real-time fluorescent assay and studied the unwinding of intramolecular G-quadruplex formed by the human telomere, ILPR and PSMA4 sequences by the BLM helicase. Through comparison with their corresponding duplex substrates, we found that the unwinding of intramolecular G-quadruplex structures was much less efficient than that of the duplexes. This result is in contrast to previous reports that multistranded intermolecular G-quadruplexes are far better substrates for the BLM and other RecQ family helicases. In addition, the unwinding efficiency varied significantly among the G-quadruplex structures, which correlated with the stability of the structures. These facts suggest that G-quadruplex has the capability to modulate the processing of DNA and RNA molecules in a stability-dependent manner and, as a consequence, may provide a mechanism to play regulatory roles in events such as gene expression.

  16. Modeling stopped-flow data for nucleic acid duplex formation reactions: the importance of off-path intermediates.

    PubMed

    Sikora, Jacqueline R; Rauzan, Brittany; Stegemann, Rachel; Deckert, Alice

    2013-08-01

    Evidence for unexpected off-path intermediates to DNA duplex formation is presented. These off-path intermediates are shown to involve unimolecular and, in one case, bimolecular structure in one of the single strands of complementary DNA. Three models are developed to account for the observed single-stranded structures that are formed in parallel with duplex formation. These models are applied to the analysis of stopped-flow data for eight different nonself-complementary duplex formation reactions in order to extract the elementary rate constant for formation of the duplex from the complementary random coil single-stranded DNA. The free energy of activation (at 25 °C) for the denaturation of each duplex is calculated from these data and is shown to have a linear correlation to the overall standard free energy for duplex formation (also at 25 °C). Duplexes that contain mismatches obey a parallel linear free-energy (LFE) relationship with a y-intercept that is greater than that of duplexes without mismatches. Slopes near unity for the LFE relationships indicate that all duplexes go through an early, unstructured transition state.

  17. Effects of non-CpG site methylation on DNA thermal stability: a fluorescence study

    PubMed Central

    Nardo, Luca; Lamperti, Marco; Salerno, Domenico; Cassina, Valeria; Missana, Natalia; Bondani, Maria; Tempestini, Alessia; Mantegazza, Francesco

    2015-01-01

    Cytosine methylation is a widespread epigenetic regulation mechanism. In healthy mature cells, methylation occurs at CpG dinucleotides within promoters, where it primarily silences gene expression by modifying the binding affinity of transcription factors to the promoters. Conversely, a recent study showed that in stem cells and cancer cell precursors, methylation also occurs at non-CpG pairs and involves introns and even gene bodies. The epigenetic role of such methylations and the molecular mechanisms by which they induce gene regulation remain elusive. The topology of both physiological and aberrant non-CpG methylation patterns still has to be detailed and could be revealed by using the differential stability of the duplexes formed between site-specific oligonucleotide probes and the corresponding methylated regions of genomic DNA. Here, we present a systematic study of the thermal stability of a DNA oligonucleotide sequence as a function of the number and position of non-CpG methylation sites. The melting temperatures were determined by monitoring the fluorescence of donor-acceptor dual-labelled oligonucleotides at various temperatures. An empirical model that estimates the methylation-induced variations in the standard values of hybridization entropy and enthalpy was developed. PMID:26354864

  18. Minimal Pairs: Minimal Importance?

    ERIC Educational Resources Information Center

    Brown, Adam

    1995-01-01

    This article argues that minimal pairs do not merit as much attention as they receive in pronunciation instruction. There are other aspects of pronunciation that are of greater importance, and there are other ways of teaching vowel and consonant pronunciation. (13 references) (VWL)

  19. Base pairing enhances fluorescence and favors cyclobutane dimer formation induced upon absorption of UVA radiation by DNA.

    PubMed

    Banyasz, Akos; Vayá, Ignacio; Changenet-Barret, Pascale; Gustavsson, Thomas; Douki, Thierry; Markovitsi, Dimitra

    2011-04-13

    The photochemical properties of the DNA duplex (dA)(20)·(dT)(20) are compared with those of the parent single strands. It is shown that base pairing increases the probability of absorbing UVA photons, probably due to the formation of charge-transfer states. UVA excitation induces fluorescence peaking at ∼420 nm and decaying on the nanosecond time scale. The fluorescence quantum yield, the fluorescence lifetime, and the quantum yield for cyclobutane dimer formation increase upon base pairing. Such behavior contrasts with that of the UVC-induced processes.

  20. Synthesis, thermal stability and reactivity towards 9-aminoellipticine of double-stranded oligonucleotides containing a true abasic site.

    PubMed Central

    Bertrand, J R; Vasseur, J J; Rayner, B; Imbach, J L; Paoletti, J; Paoletti, C; Malvy, C

    1989-01-01

    A 13 mers abasic oligonucleotide was synthetized. It was therefore possible to compare thermal stability and reactivity of duplex oligonucleotides either with an apurinic/apyrimidinic site or without any lesion. An important decrease in the melting temperature appeared for duplexes with an abasic site. The chemical reaction of these modified oligonucleotides with the intercalating agent 9-aminoellipticine was studied by gel electrophoresis and by fluorescence. The formation of a Schiff base between 9-aminoellipticine and abasic sites was rapid and complete with duplexes at 11 degrees C. Schiff base related fluorescence and beta-elimination cleavage were more important with the apyrimidinic sites than with the apurinic ones. When compared to previous results obtained with the model d(TprpT) some unexpected behaviours appeared with longer and duplex oligonucleotides. For instance only partial beta-elimination cleavage was observed. It is likely that stacking parameters in the double helix play a great role in the studied reaction. Images PMID:2602153

  1. Evaluation of Oxidation and Hydrogen Permeation of Al Containing Duplex Stainless Steels

    SciTech Connect

    Adams, Thad M.; Korinko, Paul; Duncan, Andrew

    2005-06-17

    As the National Hydrogen Economy continues to develop and evolve the need for structural materials that can resist hydrogen assisted degradation will become critical. To date austenitic stainless steel materials have been shown to be mildly susceptible to hydrogen attack which results in lower mechanical and fracture strengths. As a result, hydrogen permeation barrier coatings are typically applied to these steel to retard hydrogen ingress. The focal point of the reported work was to evaluate the potential for intentional alloying of commercial 300-series stainless steels to promote hydrogen permeation resistant oxide scales. Previous research on the Cr- and Fe-oxide scales inherent to 300-series stainless steels has proven to be inconsistent in effecting permeation resistance. The approach undertaken in this research was to add aluminum to the 300-series stainless steels in an attempt to promote a pure Al-oxide or and Al-rich oxide scale. Aloxide had been previously demonstrated to be an effective hydrogen permeation barrier. Results for 304L and 347H alloys doped with Al in concentration from 0.5-3.0 wt% with respect to oxidation kinetic studies, cyclic oxidation and characterization of the oxide scale chemistry are reported herein. Gaseous hydrogen permeation testing of the Al-doped alloys in both the unoxidized and oxidized (600 C, 30 mins) conditions are reported. A critical finding from this work is that at concentration as low as 0.5 wt% Al, the Al stabilizes the ferrite phase in these steels thus producing duplex austenitic-ferritic microstructures. As the Al-content increases the amount of measured ferrite increases thus resulting in hydrogen permeabilities more closely resembling ferritic steels.

  2. Electronic coupling between base pair dimers of LNA:DNA oligomers.

    PubMed

    Ivanova, Anela; Jezierski, Grzegorz; Rösch, Notker

    2008-01-21

    We calculated ab initio electronic coupling elements between neighboring base-pair dimers in a set of LNA:DNA oligomers with different numbers of locked nucleotides and compared them by averaging the values over ensembles of snapshots from molecular dynamics trajectories. Averaging was based on coupling elements for various ensembles comprising of 33,000 structures. The known pronounced variations of coupling elements on the nanosecond timescale due to thermal fluctuations of the DNA structure were confirmed. We found significant differences in electronic coupling at the dimer level between a non-modified DNA:DNA duplex and the corresponding duplex containing one fully LNA-substituted strand. We rationalized these differences by very dissimilar overlap in the pi-stack as a consequence of the LNA-modified system approximating an A-DNA-type helix. The calculated coupling elements for the non-modified reference duplex were similar to those of standard B-DNA and those for the fully modified oligomer resembled the matrix elements estimated for standard A-DNA.

  3. Exposure of the Lesser Himalayan Duplex in Central Nepal

    NASA Astrophysics Data System (ADS)

    Robinson, Delores; Martin, Aaron

    2013-04-01

    In central Nepal, between the Main Central thrust and the Main Boundary thrust, only Lesser Himalayan rock is exposed in structurally complex relationships; whereas in other regions of Nepal, Lesser Himalayan rocks are buried under klippen of Greater Himalayan rock. Thus, central Nepal along the Modi Khola south through the Kali Gandaki River and the village of Tansen is one of the few locations along the Himalayan thrust belt where the entire Lesser Himalayan duplex is exposed. This location is critical to determining the kinematics of the thrust belt. The purpose of this study is to determine the structural architecture of central Nepal using the collected structural data, incorporating available age data, drawing and balancing cross sections and testing variations in shortening given different stratigraphic assumptions. The two balanced cross sections are constructed from the same topography but have different underlying assumptions and decisions made during the development. We tested whether major changes in the stratigraphy and simplifications regarding the evolution of the Lesser Himalayan duplex affected the amount of shortening. Cross section 1 has a shortening estimate from the Main Central thrust to the Main Boundary thrust, including motion on the Main Central thrust, of 359 km or 77.8%. Cross section 2 has a shortening estimate of 371 km or 78.4% over the same region. These shortening estimates do not include meso-scale and micro-scale shortening in the Lesser and Greater Himalayan rocks nor do they include intra-Greater Himalayan faults. The percentage of shortening between the two cross sections is the same and the amount of shortening is not significantly different. These are striking outcomes given the different choices made when constructing the cross sections especially with regards to the stratigraphy. This suggests that the different choices made when drawing a cross section may be fairly unimportant for the estimate of shortening and percentage

  4. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  5. Design and development of three-dimensional DNA crystals utilizing CGAA parallel base paired motifs

    NASA Astrophysics Data System (ADS)

    Muser, Stephanie Elizabeth

    Three-dimensional (3D) DNA crystals hold great potential for various applications such as the development of molecular scaffolds for use in protein structure determination by x-ray crystallography. The programmability and predictability of DNA make it a powerful tool for self-assembly but it is hindered by the linearity of the duplex structure. Predictable noncanonical base pairs and motifs have the potential to connect linear double-helical DNA segments into complex 3D structures. The sequence d(GCGAAAGCT) has been observed to form 3D crystals containing both noncanonical parallel pairs and canonical Watson-Crick pairs. This provided a template structure that we used in expanding the design and development of 3D DNA crystals along with exploring the use of predictable noncanonical motifs. The structures we determined contained all but one or two of the designed secondary structure interactions, depending on pH.

  6. Pairing dynamics and the origin of species

    PubMed Central

    Puebla, Oscar; Bermingham, Eldredge; Guichard, Frédéric

    2012-01-01

    Whether sexual selection alone can drive the evolution of assortative mating in the presence of gene flow is a long-standing question in evolutionary biology. Here, we report a role for pairing dynamics of individuals when mate choice is mutual, which is sufficient for the evolution of assortative mating by sexual selection alone in the presence of gene flow. Through behavioural observation, individual-based simulation and population genetic analysis, we evaluate the pairing dynamics of coral reef fish in the genus Hypoplectrus (Serranidae), and the role these dynamics can play for the evolution of assortative mating. When mate choice is mutual and the stability of mating pairs is critical for reproductive success, the evolution of assortative mating in the presence of gene flow is not only possible, but is also a robust evolutionary outcome. PMID:21937496

  7. Pairing dynamics and the origin of species.

    PubMed

    Puebla, Oscar; Bermingham, Eldredge; Guichard, Frédéric

    2012-03-22

    Whether sexual selection alone can drive the evolution of assortative mating in the presence of gene flow is a long-standing question in evolutionary biology. Here, we report a role for pairing dynamics of individuals when mate choice is mutual, which is sufficient for the evolution of assortative mating by sexual selection alone in the presence of gene flow. Through behavioural observation, individual-based simulation and population genetic analysis, we evaluate the pairing dynamics of coral reef fish in the genus Hypoplectrus (Serranidae), and the role these dynamics can play for the evolution of assortative mating. When mate choice is mutual and the stability of mating pairs is critical for reproductive success, the evolution of assortative mating in the presence of gene flow is not only possible, but is also a robust evolutionary outcome.

  8. Thermodynamics of HMGB1 interaction with duplex DNA.

    PubMed

    Müller, S; Bianchi, M E; Knapp, S

    2001-08-28

    The high mobility group protein HMGB1 is a small, highly abundant protein that binds to DNA in a non-sequence-specific manner. HMGB1 consists of 2 DNA binding domains, the HMG boxes A and B, followed by a short basic region and a continuous stretch of 30 glutamate or aspartate residues. Isothermal titration calorimetry was used to characterize the binding of HMGB1 to the double-stranded model DNAs poly(dAdT).(dTdA) and poly(dGdC).(dCdG). To elucidate the contribution of the different structural motifs to DNA binding, calorimetric measurements were performed comparing the single boxes A and B, the two boxes plus or minus the basic sequence stretch (AB(bt) and AB), and the full-length HMGB1 protein. Thermodynamically, binding of HMGB1 and all truncated constructs to duplex DNA was characterized by a positive enthalpy change at 15 degrees C. From the slopes of the temperature dependence of the binding enthalpies, heat capacity changes of -0.129 +/- 0.02 and -0.105 +/- 0.05 kcal mol(-1) K(-1) were determined for box A and full-length HMGB1, respectively. Significant differences in the binding characteristics were observed using full-length HMGB1, suggesting an important role for the acid tail in modulating DNA binding. Moreover, full-length HMGB1 binds differently these two DNA templates: binding to poly(dAdT).(dTdA) was cooperative, had a larger apparent binding site size, and proceeded with a much larger unfavorable binding enthalpy than binding to poly(dGdC).(dCdG).

  9. The Usefulness of Duplex Ultrasound for Hemodialysis Access Selection

    PubMed Central

    Choi, Jeong Won; Joh, Jin Hyun; Park, Ho-Chul

    2017-01-01

    Purpose A native vessel is preferable to an artificial graft for dialysis access. Duplex ultrasound (DUS) is noninvasive, cost-effective modality to evaluate the vessels for dialysis. The purpose of this study was to compare the rates of utilization of native vessels after preoperative imaging with DUS and contrast venography (CV). Materials and Methods A retrospective review was performed on patients who received an arteriovenous fistula (AVF) or arteriovenous graft (AVG) between June 2006 and July 2010. Patients were classified into 3 groups. In group 1, CV was used to evaluate the vessel. Both DUS and CV were used in group 2. In group 3, only DUS was used. The frequency of utilization of a native vessel was analyzed in each group. The chi-square test was used for statistical analysis. Results During the study period, 173 patients received an AVF or AVG. Eighty-nine patients were male. The mean age was 60.6±14.6 years. A native vessel was used in 56/81 patients (69.1%) and 74/81 patients (91.4%) in groups 1 and 3, respectively (P<0.001). In group 2, all patients underwent access procedures using native vessels. AVG was initially planned for 2 patients in group 2 after vessel evaluation using CV, but a native vessel was successfully used because DUS identified optimal vessels for AVF. The 1-year primary patency rate was similar in 3 groups. Conclusion Preoperative DUS is safe and easy to use for vessel evaluation, and can be used as a primary imaging modality for creation of access. PMID:28377908

  10. Use of Symmetry in Calibration of Looped Duplex DTS Measurements

    NASA Astrophysics Data System (ADS)

    Van De Giesen, N.; van der Spek, A.

    2014-12-01

    A looped duplex Distributed Temperature Sensing (DTS) deployment uses a bifilar arrangement of two optical fibres in the same cable or conduit. On one end of the cable the ends of the fibres are spliced together. The other ends are connected to a (double ended) DTS system or one end is connected to a (single ended) DTS system. A light pulse shot from one end will eventually emerge from the other end and vice versa. Back scattered Raman-shifted photons will thus be detected twice for each posistion along the cable or conduit but delayed in time by twice the distance from the symmetry point (turn around sub) divided by the speed of light in the fibre.Calibration of a DTS system requires, first and foremost that differential loss; i.e. the difference in optical attenuation between Stokes and anti-Stokes backscattered signals, is compensated for. It will be shown that residual errors due to uncompensated differential loss can only be due to the uneven part of the (non-uniform) differential loss distribution. A bifilar deployment is therefore highly insensitive to uncompensated differential loss because ageing, chemical or mechanical damage to the cable as well as thermal or mechanical strain may vary over the length of the cable but remain symmetrical and therefore even with respect to the turn around sub.By writing the (non-)uniform differential loss as the sum of an even and an uneven part it is possible to derive an equation for the residual error of a DTS temperature measurement expressed as an integral over the uneven part of the differential loss distribution only. Thus it is possible to estimate any residual temperature error under field conditions. Such a capability is especially useful where no access to one end of the cable is possible, such as is the case in borehole applications.

  11. Full-Duplex Digital Communication on a Single Laser Beam

    NASA Technical Reports Server (NTRS)

    Hazzard, D. A.; MacCannell, J. A.; Lee, G.; Selves, E. R.; Moore, D.; Payne, J. A.; Garrett, C. D.; Dahlstrom, N.; Shay, T. M.

    2006-01-01

    A proposed free-space optical communication system would operate in a full-duplex mode, using a single constant-power laser beam for transmission and reception of binary signals at both ends of the free-space optical path. The system was conceived for two-way data communication between a ground station and a spacecraft in a low orbit around the Earth. It has been estimated that in this application, a data rate of 10 kb/s could be achieved at a ground-station-to-spacecraft distance of 320 km, using a laser power of only 100 mW. The basic system concept is also applicable to terrestrial free-space optical communications. The system (see figure) would include a diode laser at one end of the link (originally, the ground station) and a liquid-crystal- based retroreflecting modulator at the other end of the link (originally, the spacecraft). At the laser end, the beam to be transmitted would be made to pass through a quarter-wave plate, which would convert its linear polarization to right circular polarization. For transmission of data from the laser end to the retroreflector end, the laser beam would be modulated with subcarrier phase-shift keying (SC-PSK). The transmitted beam would then pass through an aperture- sharing element (ASE) - basically, a mirror with a hole in it, used to separate the paths of the transmitted and received light beams. The transmitted beam would continue outward through a telescope (which, in the original application, would be equipped with a spacecraft-tracking system) that would launch the transmitted beam along the free-space optical path to the retroreflector end.

  12. Preoperative duplex ultrasound parameters predicting male fertility after successful varicocelectomy

    PubMed Central

    Alshehri, Fahad M.; Akbar, Mahboob H.; Altwairgi, Adel K.; AlThaqufi, Omar J.

    2015-01-01

    Objectives: To assess duplex ultrasound (DUS) parameters, and predicti the outcome of varicocele ligation in male infertility. Methods: This retrospective and follow up study was conducted at Dr. Sulaiman Al Habib Hospital, AlQassim, Saudi Arabia between January 2011 and December 2012. Eighty-two patients were selected, who presented with clinical/subclinical varicocele and male infertility. All these patients had DUS of the scrotum and underwent for low ligation varicocelectomy. These patients were followed for a period of 12-24 months after surgery for the occurrence of paternity. We reviewed pre-operative scrotal DUS of these 82 patients for the testicular size and volume, pampiniform veins caliber and duration of reflux in the dilated veins at rest, and after valsalva maneuver. These DUS parameters were correlated with the postoperative paternity rate. Results: Postoperative paternity was achieved in 18 patients (31.6%) with normal-sized testes, and in 3 patients (12%) with small size testes. The positive paternity rate was higher (38.5%) in patients with clinically detected varicocele, compared with only 16.7% of patients with subclinical varicocele (detected by ultrasound only). In addition, postoperative paternity was significantly higher in patients with bilateral varicocele (70.6%), with shunt-type varicocele (71.4%), and patients with a permanent grade of venous reflux (62.5%). Conclusion: Selection of patients for the successful paternity after varicocele repair depends mainly on DUS parameters, which includes normal size testicles with shunt type of bilateral varicocele and continuous reflux. PMID:26620986

  13. Duplex ultrasound of the superior mesenteric artery in chronic pancreatitis.

    PubMed

    Hornum, M; Larsen, S; Olsen, O; Pedersen, J F

    2006-10-01

    Blood flow in the superior mesenteric artery (SMA) increases after a meal due to a vasoactive effect of the decomposed food. In exocrine pancreatic insufficiency, the digestion of food is compromised. We used duplex ultrasound to test the hypothesis that blood flow in the SMA after a meal increases less in patients with pancreatic insufficiency than in control persons. We studied 16 patients with chronic pancreatitis, eight of them with exocrine insufficiency, and eight healthy volunteers. The resistive index (RI) in the SMA was determined before and after a liquid meal. The RI reflects the downstream circulatory resistance, giving a precise description of mesenteric hyperaemia. Both groups of patients with chronic pancreatitis unexpectedly had lower fasting RI than controls, 0.818 and 0.815 vs 0.851, p = 0.028 and p = 0.0030, respectively. Postprandialy there was significantly less decrease in RI (less increase in flow) in patients with exocrine insufficiency than in controls, 0.055 vs 0.099, p = 0.0047. There was a significant trend for a less pronounced postprandial decrease in RI with more impaired pancreatic function (p = 0.0036). Our study thus demonstrates a reduced postprandial increase in SMA flow in patients with exocrine pancreatic insufficiency, and suggests an increased fasting SMA flow in chronic pancreatitis. Further studies are needed to evaluate the possible role of the test-meal-induced shift in RI in the SMA and of a lower-than-normal fasting RI in the diagnosis and monitoring of chronic pancreatitis.

  14. Pharmaco Penile Duplex Ultrasonography in the Evaluation of Erectile Dysfunction

    PubMed Central

    Ramanjaneyulu, Harshavardhana Kuruba; Susarla, Rammurti; Yarlagadda, Jyotsna; Devraj, Rahul; Palanisamy, Prabakaran

    2017-01-01

    Introduction The National Institute of Health defined ‘erectile dysfunction’ as the persistent inability to achieve and/or to maintain an erection for a satisfactory sexual performance. In last few years, the concept of erectile dysfunction has evolved from that of a disorder referred to as ‘impotence’ which used to be considered predominantly psychogenic to that of ‘Erectile Dysfunction’ (ED), a well understood physiologic result of multiple risk factors, both psychological and organic. The most common cause of organic erectile dysfunction is vasculogenic causes. Doppler evaluation of cavernosal arteries after intracavernosal injection of Papaverine is particularly useful in the evaluation of vasculogenic causes. Aim To define the role of intracavernosal injection of Papaverine in the evaluation of vasculogenic causes of erectile dysfunction that includes arterial insufficiency and veno occlusive nature. Materials and Methods Pharmaco Penile Duplex Ultrasonography (PPDU) was done using a linear broadband phased array transducer (7–12 MHz) on a E-Saote MyLab 60 ultrasound colour Doppler system on 73 patients over a period of three years. Informed consent was taken from all patients. Visual grading score for erection, Cavernosal Artery Diameter (CAD), PSV (Peak Systolic Velocity), EDV (End Diastolic Velocity), RI (Resistive Index), AT (Acceleration Time) and dorsal vein changes were obtained in all patients following intracavernosal injection of Papaverine. Results Visual grading for erectile response was E0 in one patient, E1 in 11 patients, E2 in 9 patients, E3 in 7 patients, E4 in 4 patients and E5 in 41 patients. Eighteen patients were diagnosed as having arterial insufficiency, three patients were diagnosed as having venous insufficiency and two patients showed indeterminate results. Conclusion In our study, Papaverine induced PPDU proved to be highly accurate and excellent method for assessing patients with erectile dysfunction. PMID:28274021

  15. The use of hairpin DNA duplexes as HIV-1 fusion inhibitors: synthesis, characterization, and activity evaluation.

    PubMed

    Xu, Liang; Jiang, Xifeng; Xu, Xiaoyu; Zheng, Baohua; Chen, Xueliang; Zhang, Tao; Gao, Fang; Cai, Lifeng; Cheng, Maosheng; Keliang Liu

    2014-07-23

    Discovery of new drugs for the treatment of AIDS that possess unique structures associated with novel mechanisms of action are of great importance due the rapidity with which drug-resistant HIV-1 strains evolve. Recently we reported on a novel class of DNA duplex-based HIV-1 fusion inhibitors modified with hydrophobic groups. The present study describes a new category of hairpin fusion inhibitor DNA duplexes bearing a 3 nucleotide loop located at either the hydrophobic or hydrophilic end. The new loop structures were designed to link 2 separate duplex-forming oligodeoxynucleotides (ODNs) to make helix-assembly easier and more thermally stable resulting in a more compact form of DNA duplex based HIV-1 fusion inhibitors. A series of new hairpin duplexes were tested for anti-HIV-1 cell-cell membrane fusion activity. In addition, Tm, CD, fluorescent resonance energy transfer assays, and molecular modeling analyses were carried out to define their structural activity relationships and possible mechanisms of action.

  16. Venous thromboembolic disease after hybrid hip arthroplasty with negative duplex screening.

    PubMed

    Beuhler, K O; D'Lima, D D; Colwell, C W; Otis, S M; Walker, R H

    1999-04-01

    Postoperative duplex ultrasonography screening after total hip arthroplasty has been shown to identify patients who may require treatment or additional monitoring for venous thromboembolic disease. The potential for manifestation of venous thromboembolic disease subsequent to screening remains a concern. The objective of this study was to determine the prevalence of symptomatic venous thromboembolic disease after total hip arthroplasty and after inhospital prophylaxis, inhospital screening with negative results for proximal deep venous thrombosis, and no posthospitalization venous thromboembolic disease prophylaxis. One hundred fifty patients undergoing primary hybrid total hip arthroplasty and using pneumatic compression stockings and aspirin as prophylaxis against venous thromboembolic disease were screened for deep venous thrombosis with duplex ultrasonography on the fourth day after surgery. Duplex ultrasonography screening revealed 17 (11.3%) patients with asymptomatic proximal deep venous thrombosis. In response to duplex ultrasonography screening, these patients with proximal deep venous thrombosis received therapeutic anticoagulation. Of 133 patients with a duplex screen with negative results for proximal deep venous thrombosis, 131 (98.5%) continued to have no symptoms of venous thromboembolic disease and two (1.5%) began to have symptoms for venous thromboembolic disease (one with proximal deep venous thrombosis, one with nonfatal pulmonary embolism) during 12 months of clinical followup after total hip arthroplasty. The overall prevalence of venous thromboembolic disease requiring anticoagulation was 19 of 150 (12.6%) patients. The remaining 131 (87.4%) were not exposed to the risks of postoperative anticoagulation and did not have subsequent symptomatic venous thromboembolic disease.

  17. Localization of duplex thrust-ramps by buckling: analog and numerical modelling

    NASA Astrophysics Data System (ADS)

    Liu, Shumin; Dixon, John M.

    1995-06-01

    Duplex structures in natural fold-thrust belts occur over a wide range of geometric scales. Duplex thrust ramps exhibit a regular spacing linearly related to the thickness of strata involved in the duplex. We suggest that buckling instability in layered systems can produce local stress concentrations which localize thrust ramps with regular spacing. This mechanism is demonstrated through analog (centrifuge) and numerical (finite element) modelling. Centrifuge models containing finely-laminated multilayers composed of plasticine and silicone putty (simulating rocks such as limestone and shale) are compressed from one edge; folds propagate from hinterland to foreland. As shortening continues, the lowest competent unit is thrust into a blind duplex structure by breakthrusting. The duplex develops by serial nucleation of faults from hinterland to foreland; the ramp locations are inherited from the initial buckling instability. Finite-element models based on the analog models and their natural prototypes demonstrate that stress concentrations develop in fore-limbs of anticlines within competent stratigraphie units. Models containing thrust discontinuities (at sites of calculated stress concentration) display additional stress concentrations in the forelimbs of unfaulted folds closer to the foreland. The locus of stress concentration thus propagates towards the foreland, consistent with foreland thrust propagation in nature. The location and regular spacing of ramps are inherited from early (possibly even incipient) buckle folds.

  18. Heat treatment temperature influence on ASTM A890 GR 6A super duplex stainless steel microstructure

    SciTech Connect

    Martins, Marcelo; E-mail: marcelo.martins@sulzer.com; Casteletti, Luiz Carlos

    2005-09-15

    Duplex and super duplex stainless steels are ferrous alloys with up to 26% chromium, 8% nickel, 5% molybdenum and 0.3% nitrogen, which are largely used in applications in media containing ions from the halogen family, mainly the chloride ion (Cl{sup -}). The emergence of this material aimed at substituting Copper-Nickel alloys (Cupro-Nickel) that despite presenting good corrosion resistance, has mechanical properties quite inferior to steel properties. The metallurgy of duplex and super duplex stainless steel is complex due to high sensitiveness to sigma phase precipitation that becomes apparent, due to the temperatures they are exposed on cooling from solidification as well as from heat treatment processes. The objective of this study was to verify the influence of heat treating temperatures on the microstructure and hardness of ASTM A890/A890M Gr 6A super duplex stainless steel type. Microstructure control is of extreme importance for castings, as the chemical composition and cooling during solidification inevitably provide conditions for precipitation of sigma phase. Higher hardness in these materials is directly associated to high sigma phase concentration in the microstructure, precipitated in the ferrite/austenite interface. While heat treatment temperature during solution treatment increases, the sigma phase content in the microstructure decreases and consequently, the material hardness diminishes. When the sigma phase was completely dissolved by the heat treatment, the material hardness was influenced only due to ferrite and austenite contents in the microstructure.

  19. Unlocked nucleic acids with a pyrene-modified uracil: synthesis, hybridization studies, fluorescent properties and i-motif stability.

    PubMed

    Perlíková, Pavla; Karlsen, Kasper K; Pedersen, Erik B; Wengel, Jesper

    2014-01-03

    The synthesis of two new phosphoramidite building blocks for the incorporation of 5-(pyren-1-yl)uracilyl unlocked nucleic acid (UNA) monomers into oligonucleotides has been developed. Monomers containing a pyrene-modified nucleobase component were found to destabilize an i-motif structure at pH 5.2, both under molecular crowding and noncrowding conditions. The presence of the pyrene-modified UNA monomers in DNA strands led to decreases in the thermal stabilities of DNA*/DNA and DNA*/RNA duplexes, but these duplexes' thermal stabilities were better than those of duplexes containing unmodified UNA monomers. Pyrene-modified UNA monomers incorporated in bulges were able to stabilize DNA*/DNA duplexes due to intercalation of the pyrene moiety into the duplexes. Steady-state fluorescence emission studies of oligonucleotides containing pyrene-modified UNA monomers revealed decreases in fluorescence intensities upon hybridization to DNA or RNA. Efficient quenching of fluorescence of pyrene-modified UNA monomers was observed after formation of i-motif structures at pH 5.2. The stabilizing/destabilizing effect of pyrene-modified nucleic acids might be useful for designing antisense oligonucleotides and hybridization probes.

  20. Protected Flux Pairing Qubit

    NASA Astrophysics Data System (ADS)

    Bell, Matthew; Zhang, Wenyuan; Ioffe, Lev; Gershenson, Michael

    2014-03-01

    We have studied the coherent flux tunneling in a qubit containing two submicron Josephson junctions shunted by a superinductor (a dissipationless inductor with an impedance much greater than the resistance quantum). The two low energy quantum states of this device, 0 and 1, are represented by even and odd number of fluxes in the loop, respectively. This device is dual to the charge pairing Josephson rhombi qubit. The spectrum of the device, studied by microwave spectroscopy, reflects the interference between coherent quantum phase slips in the two junctions (the Aharonov-Casher effect). The time domain measurements demonstrate the suppression of the qubit's energy relaxation in the protected regime, which illustrates the potential of this flux pairing device as a protected quantum circuit. Templeton Foundation, NSF, and ARO.

  1. Junctionless Cooper pair transistor

    NASA Astrophysics Data System (ADS)

    Arutyunov, K. Yu.; Lehtinen, J. S.

    2017-02-01

    Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current-voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  2. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

    1999-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  3. Final Report, Volume 3, Guidance Document for the Evaluation of Cast Super Duplex Stainless Steel

    SciTech Connect

    Hariharan, Vasudevan; Lundin, Carl, W.

    2005-09-30

    Volume 3 is comprised of the Development of Qualification Standards for Cast Super Duplex Stainless Steel (A890-5A) which is equivalent to wrought 2507. The objective of this work was to determine the suitability of ASTM A923 Standard Test methods for Detecting Detrimental Intermetallic Phase in Duplex Austenitic-Ferritic Stainless Steels for 25 Cr Cast Super Duplex Stainless Steels (ASTM A890-5A). The various tests which were carried out were ASTM A923 Test Method A, B and C (Sodium Hydroxide Etch Test, Charpy Impact Test and Ferric Chloride Corrosion Test), ferrite measurement using Feritscope®, ASTM E562 Manual Point Count Method and X-Ray Diffraction, hardness measurement using Rockwell B and C and microstructural analysis using SEM and EDS.

  4. Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

    PubMed

    Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

    2012-02-01

    A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface.

  5. Positive-intrinsic-negative diode-based duplexer for microcoil nuclear magnetic resonance

    NASA Astrophysics Data System (ADS)

    Seeber, D. A.; Hoftiezer, J. H.; Pennington, C. H.

    2000-07-01

    Microcoil nuclear magnetic resonance (NMR), using receiver coils of diameters of order 100 μm, is increasingly employed to observe very small (˜0.3 nl) samples with high sensitivity. However, many experimental aspects of microcoil NMR differ greatly from conventional NMR. In particular, the duplexer is a device used to switch between the transmit and receive phases of the experiment. The conventional duplexer is a passive device employing crossed diodes, that switch automatically to transmit mode when high rf power is present. In microcoil NMR, however, the transmitter power is necessarily quite low, with voltages that do not greatly exceed characteristic diode voltage drops. Here we present the complete design and construction methods for a duplexer well suited to the special demands of microcoil NMR.

  6. Signal processors in duplex sonography: in vitro comparison between analog and digital methods.

    PubMed

    Zoller, W G; Wierscher, C; Wagner, D R

    1993-01-01

    Using a new flow-test phantom, which respects the acoustic properties of real blood as well as the proximal and distal impedances of body circulation, we assessed the performance of two duplex sonography signal processors on blood-flow measurements. With both the analog and the dynamic signal processor (Fast Fourier Transform), the correlation between duplex sonography and quantitative flow measurements was high (0.96-0.99) for different dynamic conditions (steady or pulsatile blood flow, varying heart rate, blood pressure, and hematocrit) and for different mechanical conditions (silicon tube or animal vessel). The real blood flow was overestimated by duplex sonography; the over-estimation was more pronounced with the analog processor (factor 1.87-4.20) than with the digital processor (factor 1.22-1.64, P < 0.05). Applied to the study of asymmetric stenoses, the digital processor was not superior to the analog processors described in the literature.

  7. Experimental Analysis and Modelling of Fe-Mn-Al-C Duplex Steel Mechanical Behaviour

    SciTech Connect

    Shiekhelsouk, M. N.; Favier, V.; Cherkaoui, M.; Inal, K.; Bouaziz, O.

    2007-04-07

    A new variety of duplex steels with high content of manganese and aluminum has been elaborated in Arcelor Research. These steels contain two phases: austenite and ferrite combining the best features of austenitic and ferritic steels. In this work, four duplex steels with different chemical composition and phase volume fraction are studied. The evolution of internal stresses for the two phases has been determined by X-ray diffraction during an in situ tensile test. These measurements results were used to determine the mechanical behaviour of the duplex steel using a micromechanical approach by scale transition for tensile tests. Though a good agreement between experiments and simulations is found at the macroscopic level, the calculated internal stresses of the austenitic phase do not match experimental results. These discrepancies are attributed to (i) a bad estimation of the austenite yield stress or (ii) the presence of kinematic hardening in the austenitic phase. A new step is then proposed to test these two hypotheses.

  8. Using hiCLIP to identify RNA duplexes that interact with a specific RNA-binding protein.

    PubMed

    Sugimoto, Yoichiro; Chakrabarti, Anob M; Luscombe, Nicholas M; Ule, Jernej

    2017-03-01

    The structure of RNA molecules has a critical role in regulating gene expression, largely through influencing their interactions with RNA-binding proteins (RBPs). RNA hybrid and individual-nucleotide resolution UV cross-linking and immunoprecipitation (hiCLIP) is a transcriptome-wide method of monitoring these interactions by identifying RNA duplexes bound by a specific RBP. The hiCLIP protocol consists of the following steps: in vivo cross-linking of RBPs to their bound RNAs; partial RNA digestion and purification of RNA duplexes interacting with the specific RBP using immunoprecipitation; ligation of the two arms of RNA duplexes via a linker; reverse transcription; cDNA library amplification; and finally high-throughput DNA sequencing. Mapping of the sequenced arms to a reference transcriptome identifies the exact locations of duplexes. hiCLIP data can directly identify all types of RNA duplexes bound by RBPs, including those that are challenging to predict computationally, such as intermolecular and long-range intramolecular duplexes. Moreover, the use of an adaptor that links the two arms of the RNA duplex permits hiCLIP to unambiguously identify the duplexes. Here we describe in detail the procedure for a hiCLIP experiment and the subsequent streamlined data analysis with an R package, 'hiclipr' (https://github.com/luslab/hiclipr/). Preparation of the library for high-throughput DNA sequencing takes ∼7 d and the basic bioinformatic pipeline takes 1 d.

  9. A Commentary on "Updating the Duplex Design for Test-Based Accountability in the Twenty-First Century"

    ERIC Educational Resources Information Center

    Brandt, Steffen

    2010-01-01

    This article presents the author's commentary on "Updating the Duplex Design for Test-Based Accountability in the Twenty-First Century," in which Isaac I. Bejar and E. Aurora Graf propose the application of a test design--the duplex design (which was proposed in 1988 by Bock and Mislevy) for application in current accountability assessments.…

  10. A case report of laparoscopic ipsilateral ureteroureterostomy in children with renal duplex

    PubMed Central

    Wong, Yuen Shan; Tam, Yuk Him; Pang, Kristine Kit Yi

    2016-01-01

    We report on two children aged 2 and 6 years, who underwent laparoscopic ipsilateral ureteroureterostomy for their renal duplex anomalies. Both patients had complete duplex and were investigated by ultrasound, micturating cystourethrogram, magnetic resonance urography, and radioisotope scan. One patient had high-grade vesicoureteral reflux to lower moiety complicated with recurrent urinary tract infections, while the other had obstruction to upper moiety due to ectopic ureter. The pathological moieties of both patients were functional. Both patients underwent laparoscopic ipsilateral ureteroureterostomy uneventfully without any intraoperative complications. Postoperative imagings confirmed successful outcomes after surgery. PMID:27014651

  11. Herpes Zoster Duplex Bilateralis in Immuno-Competent Patients: Report of Two Cases.

    PubMed

    Vijay, Atul; Dalela, Gaurav

    2015-12-01

    Herpes Zoster is a common viral disorder, occurs due to reactivation of latent Varicella Zoster Virus (VZV) usually in adults or elderly patients, usually confined to a single dermatome. Herpes zoster duplex is a rare but well established entity which is simultaneous, occurring of herpes zoster at two different non contiguous dermatomes, can be unilateralis or bilateralis. Here we are reporting two cases of herpes zoster duplex bilateralis, in case-1 lesions occurs in two different distant dermatomes while in case-2 it appeared in a single dermatome but both sides were involved. Both the patients were healthy immuno-competent male.

  12. The microstructure and formation of duplex and black plessite in iron meteorites

    NASA Technical Reports Server (NTRS)

    Zhang, J.; Williams, D. B.; Goldstein, J. I.

    1993-01-01

    Two of the most common plessite structures, duplex and black plessite, in the taenite region of the Windmanstatten pattern of two iron meteorites (Grant and Carlton) are characterized using high-resolution electron microscopy and microanalysis techniques. Two types of gamma precipitates, found in the duplex plessite and black plessite regions, respectively, are identified, and their morphologies are described. The formation of the plessite structure is discussed using the information obtained in this study and results of a parallel investigation of decomposed martensitic Fe-Ni laboratory alloys.

  13. Congenital Giant Hydroureteric Cistern in a Duplex System of an Infant

    PubMed Central

    Awolaran, O. T.; Abdur-Rahman, L. O.; Bamigbola, K. T.; Adesiyun, O. M.; Nasir, A. A.

    2013-01-01

    Duplex collecting system is a congenital genitourinary anomaly commonly found incidentally. Our experience with a duplex system associated with giant hydroureter presenting as mobile abdominal swelling that was noticed from birth, constipation, and failure to thrive is described. Ultrasound and IVU did not assist in making the diagnosis, while a barium enema suggested a colonic duplication. Congenital giant hydroureter should be considered as a differential diagnosis in infants with cystic abdominal swelling. A preserved renal moiety attributed to a dilated ureteric cistern was a unique theory in this case. PMID:24171132

  14. A one-step duplex rRT-PCR assay for the simultaneous detection of duck hepatitis A virus genotypes 1 and 3.

    PubMed

    Hu, Qin; Zhu, Dekang; Ma, Guangpeng; Cheng, Anchun; Wang, Mingshu; Chen, Shun; Jia, Renyong; Liu, Mafeng; Sun, Kunfeng; Yang, Qiao; Wu, Ying; Chen, Xiaoyue

    2016-10-01

    Duck hepatitis A virus (DHAV) is a highly infectious pathogen that causes significant bleeding lesions in the viscera of ducklings less than 3 weeks old. There are three serotypes of DHAV: serotype 1 (DHAV-1), serotype 2 (DHAV-2) and serotype 3 (DHAV-3). These serotypes have no cross-antigenicity with each other. To establish an rRT-PCR assay for the rapid detection of a mixed infection of DHAV-1 and DHAV-3, two pairs of primers and a pair of matching TaqMan probes were designed based on conserved regions of DHAV-1 VP0 and DHAV-3 VP3. Finally, we established a one-step duplex rRT-PCR assay with high specificity and sensitivity for the simultaneous detection of DHAV-1 and DHAV-3. This method showed no cross-antigenicity with the other pathogens tested, including duck plague virus, Muscovy duck parvovirus, Riemerella anatipestifer, and pathogenic E. coli from ducks. Sensitivity tests identified the minimum detection limits of this method as 98 (DHAV-1) and 10 (DHAV-3) copies/reaction. To validate the method, thirty-eight clinical samples and thirty artificially infected samples collected from dead duck embryos were studied. Thirty-seven samples were positive for DHAV-1, seventeen samples were positive for DHAV-3, and fourteen samples were positive for a mixed infection using the duplex rRT-PCR method. The method established in this study is specific, sensitive, convenient and timesaving and is a powerful tool for detecting DHAV-1, DHAV-3, and their mixed infection and for conducting surveys of pandemic virus strains.

  15. Pair of Craters

    NASA Technical Reports Server (NTRS)

    2005-01-01

    14 July 2005 This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows a 1.5 meters per pixel (5 ft/pixel) view of a pair of small meteor impact craters in the Arena Colles region of Mars, located north of Isidis Planitia.

    Location near: 22.7oN, 278.5oW Image width: width: 3 km (1.9 mi) Illumination from: lower left Season: Northern Autumn

  16. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract.

  17. Type III burst pair

    NASA Astrophysics Data System (ADS)

    Ning, Zongjun; Fu, Qijun; Lu, Quankang

    2000-05-01

    We present a special solar radio burst detected on 5 January 1994 using the multi-channel (50) spectrometer (1.0-2.0 GHz) of the Beijing Astronomical Observatory (BAO). Sadly, the whole event could not be recorded since it had a broader bandwidth than the limit range of the instrument. The important part was obtained, however. The event is composed of a normal drift type III burst on the lower frequency side and a reverse drift type III burst appearing almost simultaneously on the high side. We call the burst type III a burst pair. It is a typical characteristic of two type III bursts that they are morphologically symmetric about some frequency from 1.64 GHz to 1.78 GHz on the dynamic spectra records, which indicates that there are two different electron beams from the same acceleration region travelling simultaneously in opposite directions (upward and downward). A magnetic reconnection mode is a nice interpretation of type III burst pair since the plasma beta β~=0.01 is much less than 1 and the beams have velocity of about 1.07×10^8 cm s^-1 after leaving the reconnection region if we assume that the ambient magnetic field strength is about 100 G.

  18. Type III burst pair.

    NASA Astrophysics Data System (ADS)

    Zongjun, Ning; Fu, Qijun; Quankang, Lu

    2000-05-01

    Presents a special solar radio burst detected on 5 January 1994 using the multi-channel (50) spectrometer (1.0 - 2.0 GHz) of the Beijing Astronomical Observatory. Sadly, the whole event could not be recorded since it had a broader bandwidth than the limit range of the instrument. The important part was obtained, however. The event is composed of a normal drift type III burst on the lower frequency side and a reverse drift type III burst appearing almost simultaneously on the high side. The authors call the burst type III a burst pair. It is a typical characteristic of two type III bursts that they are morphologically symmetric about some frequency from 1.64 GHz to 1.78 GHz on the dynamic spectra records, which indicates that there are two different electron beams from the same acceleration region travelling simultaneously in opposite directions (upward and downward). A magnetic reconnection mode is an interpretation of type III burst pair.

  19. Theoretical study of pair density wave superconductors

    NASA Astrophysics Data System (ADS)

    Zheng, Zhichao

    FFLO phase when singlet pairing interactions and triplet pairing interactions coexist. We formalize microscopic theory to find that the spin-triplet component increases the stability of the FFLO phase. We show how our results can be explained phenomenologically by studying Ginzburg-Landau free energy. We discuss our results in the context of organic superconductors.

  20. STABILIZED OSCILLATOR

    DOEpatents

    Jessen, P.L.; Price, H.J.

    1958-03-18

    This patent relates to sine-wave generators and in particular describes a generator with a novel feedback circuit resulting in improved frequency stability. The generator comprises two triodes having a common cathode circuit connected to oscillate at a frequency and amplitude at which the loop galn of the circutt ls unity, and another pair of triodes having a common cathode circuit arranged as a conventional amplifier. A signal is conducted from the osciliator through a frequency selective network to the amplifier and fed back to the osciliator. The unique feature of the feedback circuit is the amplifier operates in the nonlinear portion of its tube characteristics thereby providing a relatively constant feedback voltage to the oscillator irrespective of the amplitude of its input signal.

  1. Efficient wire-grid duplexer-polarized for CO2 lasers

    NASA Technical Reports Server (NTRS)

    Cheo, P. K.; Bass, C. D.

    1972-01-01

    Chromium wire grid duplexer-polarizer for 10 micrometer carbon dioxide laser communication system is produced by depositing photo-resist film onto silicon substrate, grating by two collimated cadmium helium laser beams, covering of surface with thin chromium layer, and subsequent stripping of uncoated portion to expose etched wires.

  2. Transceiver Design to Maximize the Weighted Sum Secrecy Rate in Full-Duplex SWIPT Systems

    NASA Astrophysics Data System (ADS)

    Wang, Ying; Sun, Ruijin; Wang, Xinshui

    2016-06-01

    This letter considers secrecy simultaneous wireless information and power transfer (SWIPT) in full duplex systems. In such a system, full duplex capable base station (FD-BS) is designed to transmit data to one downlink user and concurrently receive data from one uplink user, while one idle user harvests the radio-frequency (RF) signals energy to extend its lifetime. Moreover, to prevent eavesdropping, artificial noise (AN) is exploited by FD-BS to degrade the channel of the idle user, as well as to provide energy supply to the idle user. To maximize the sum of downlink secrecy rate and uplink secrecy rate, we jointly optimize the information covariance matrix, AN covariance matrix and receiver vector, under the constraints of the sum transmission power of FD-BS and the minimum harvested energy of the idle user. Since the problem is non-convex, the log-exponential reformulation and sequential parametric convex approximation (SPCA) method are used. Extensive simulation results are provided and demonstrate that our proposed full duplex scheme extremely outperforms the half duplex scheme.

  3. Congenital duplex gallbladder and biliary mucocele associated with partial hepatic cholestasis and cholelithiasis in a cat

    PubMed Central

    Woods, Katharine S.; Brisson, Brigitte A.; Defarges, Alice M.N.; Oblak, Michelle L.

    2012-01-01

    A 6-year-old neutered male domestic shorthair cat was presented for acute onset of vomiting. Exploratory laparotomy identified a duplex gallbladder and left cholecystectomy was performed. Histopathology confirmed biliary mucocele and hepatic cholestasis. While rare, biliary mucoceles should be considered as a differential diagnosis for feline extrahepatic bile duct obstruction. PMID:22942442

  4. Influence of Duplex Treatment on Structural and Tribological Properties of Commercially Pure Titanium

    NASA Astrophysics Data System (ADS)

    Çelik, Ilhan

    2017-01-01

    Titanium and its alloys are widely used in many fields, including aerospace and the chemical and biomedical industries. This is due to their mechanical properties, excellent corrosion resistance, and biocompatibility although they do have poor wear resistance. In this study, a duplex layer was successfully formed on the commercially pure titanium surface by duplex treatments (plasma nitriding and physical vapor deposition (PVD)). In the initial treatment, plasma nitriding was performed on the pure titanium samples and in the second treatment, the nitrided samples were coated with CrN by PVD. The friction and wear properties of the duplex-treated samples were investigated for tribological applications. Surface morphology and microstructure of the duplex-treated samples were analyzed by X-ray diffraction (XRD) and scanning electron microscopy (SEM). In addition, the tribological properties were investigated using pin-on-disc tribometer. A compound layer composed of ɛ-Ti2N and δ-TiN phases and a diffusion layer formed under the compound layer were obtained on the surface of pure titanium after the nitriding treatments. CrN coated on the nitrided surface provided an increase in the surface hardness and in the wear resistance.

  5. Sigma phase morphologies in cast and aged super duplex stainless steel

    SciTech Connect

    Martins, Marcelo; Casteletti, Luiz Carlos

    2009-08-15

    Solution annealed and water quenched duplex and super duplex stainless steels are thermodynamically metastable systems at room temperature. These systems do not migrate spontaneously to a thermodynamically stable condition because an energy barrier separates the metastable and stable states. However, any heat input they receive, for example through isothermal treatment or through prolonged exposure to a voltaic arc in the welding process, cause them to reach a condition of stable equilibrium which, for super duplex stainless steels, means precipitation of intermetallic and carbide phases. These phases include the sigma phase, which is easily identified from its morphology, and its influence on the material's impact strength. The purpose of this work was to ascertain how 2-hour isothermal heat treatments at 920 deg. C and 980 deg. C affect the microstructure of ASTM A890/A890M GR 6A super duplex stainless steel. The sigma phase morphologies were found to be influenced by these two aging temperatures, with the material showing a predominantly lacy microstructure when heat treated at 920 deg. C and block-shaped when heat treated at 980 deg. C.

  6. DNA CTG triplet repeats involved in dynamic mutations of neurologically related gene sequences form stable duplexes

    NASA Technical Reports Server (NTRS)

    Smith, G. K.; Jie, J.; Fox, G. E.; Gao, X.

    1995-01-01

    DNA triplet repeats, 5'-d(CTG)n and 5'-d(CAG)n, are present in genes which have been implicated in several neurodegenerative disorders. To investigate possible stable structures formed by these repeating sequences, we have examined d(CTG)n, d(CAG)n and d(CTG).d(CAG)n (n = 2 and 3) using NMR and UV optical spectroscopy. These studies reveal that single stranded (CTG)n (n > 2) forms stable, antiparallel helical duplexes, while the single stranded (CAG)n requires at least three repeating units to form a duplex. NMR and UV melting experiments show that the Tm increases in the order of [(CAG)3]2 < [(CTG)3]2 << (CAG)3.(CTG)3. The (CTG)3 duplex is stable and exhibits similar NMR spectra in solutions containing 0.1-4 M NaCl and at a pH range from 4.6 to 8.8. The (CTG)3 duplex, which contains multiple-T.T mismatches, displays many NMR spectral characteristics similar to those of B-form DNA. However, unique NOE and 1H-31P coupling patterns associated with the repetitive T.T mismatches in the CTG repeats are discerned. These results, in conjunction with recent in vitro studies suggest that longer CTG repeats may form hairpin structures, which can potentially cause interruption in replication, leading to dynamic expansion or deletion of triplet repeats.

  7. DNA CTG triplet repeats involved in dynamic mutations of neurologically related gene sequences form stable duplexes.

    PubMed Central

    Smith, G K; Jie, J; Fox, G E; Gao, X

    1995-01-01

    DNA triplet repeats, 5'-d(CTG)n and 5'-d(CAG)n, are present in genes which have been implicated in several neurodegenerative disorders. To investigate possible stable structures formed by these repeating sequences, we have examined d(CTG)n, d(CAG)n and d(CTG).d(CAG)n (n = 2 and 3) using NMR and UV optical spectroscopy. These studies reveal that single stranded (CTG)n (n > 2) forms stable, antiparallel helical duplexes, while the single stranded (CAG)n requires at least three repeating units to form a duplex. NMR and UV melting experiments show that the Tm increases in the order of [(CAG)3]2 < [(CTG)3]2 << (CAG)3.(CTG)3. The (CTG)3 duplex is stable and exhibits similar NMR spectra in solutions containing 0.1-4 M NaCl and at a pH range from 4.6 to 8.8. The (CTG)3 duplex, which contains multiple-T.T mismatches, displays many NMR spectral characteristics similar to those of B-form DNA. However, unique NOE and 1H-31P coupling patterns associated with the repetitive T.T mismatches in the CTG repeats are discerned. These results, in conjunction with recent in vitro studies suggest that longer CTG repeats may form hairpin structures, which can potentially cause interruption in replication, leading to dynamic expansion or deletion of triplet repeats. PMID:7501450

  8. Real-time duplex PCR for simultaneous HPV 16 and HPV 18 DNA quantitation.

    PubMed

    Jacquin, Elise; Saunier, Maëlle; Mauny, Frédéric; Schwarz, Elisabeth; Mougin, Christiane; Prétet, Jean-Luc

    2013-11-01

    HPV 16 and HPV 18 are responsible for more than 75% of cervical cancers and high HPV 16 loads are associated with both prevalent and incident lesions. The objective of the present study was to develop a method allowing the detection and quantitation of HPV 16 and 18 DNA to improve future strategies for cervical cancer screening. A duplex real-time PCR allowing the simultaneous quantitation of both HPV 16 and HPV 18 was carried out. Mixes of HPV 16 and HPV 18 whole genome plasmids were prepared to test a wide range of viral DNA concentrations. The values obtained for each mix of plasmids with the simplex and the duplex PCR were very close to the theoretical values except when a HPV type represented only 1:1000 genome equivalent or lower than the concurrent type. Cervical samples harboring HPV 16, HPV 18 or both types were tested by comparing the results with simplex and duplex real-time PCR assays. HPV 16 and HPV 18 genome titers were similar with the two assays. In conclusion, the real-time duplex PCR proved to be robust for HPV 16 and HPV 18 DNA quantitation.

  9. Duplex (or quadruplet) CH domain containing human multidomain proteins: an inventory.

    PubMed

    Friedberg, Felix

    2010-04-01

    In this paper, the inventory presented for singlet CH (calponin homology/actin binding) domain containing human multidomain proteins is extended to several duplex and one quadruplet CH containing forms. Invariably, the duplexes are located at the begin of the molecules. The regions connecting the two CH units suggest amino acid conservations which allows the placing of 18 duplex containing molecules into six groups wherein the gene for one member in each group created the others more recently by gene duplication. The ancient multidomain proteins, possibly, were primarily the result of an exon shuffling (transposition) mechanism that also guided the placing of the CH singlet or duplex domain at the amino end of the newly created proteins. A mechanism that creates pseudogenes could conceivably produce genes that encode multi-domain proteins. Intragenomic duplications (slippage) might have facilitated the occurrence of encoding repeats, thus allowing for the creation of multiple identical domains within one molecule. Gene duplication with subsequent modification and small domain gene recombination which formed multidomain proteins are important forces driving evolution.

  10. Development of duplex PCR assay for detection and differentiation of typical and atypical Melissococcus plutonius strains.

    PubMed

    Arai, Rie; Miyoshi-Akiyama, Tohru; Okumura, Kayo; Morinaga, Yuiko; Wu, Meihua; Sugimura, Yuya; Yoshiyama, Mikio; Okura, Masatoshi; Kirikae, Teruo; Takamatsu, Daisuke

    2014-04-01

    Melissococcus plutonius is the causative agent of an important honeybee disease, European foulbrood (EFB). In addition to M. plutonius strains with typical characteristics (typical M. plutonius), we recently reported the presence of atypical M. plutonius, which are phenotypically and genetically distinguished from typical M. plutonius. Because typical and atypical M. plutonius may have different pathogenic mechanisms, differentiation of these two types is very important for diagnosis and more effective control of EFB. In this study, therefore, a duplex PCR assay was developed to detect and differentiate typical and atypical M. plutonius rapidly and easily. On the basis of the results of comparative genomic analyses, we selected Na(+)/H(+) antiporter gene and Fur family transcriptional regulator gene as targets for detection of typical and atypical strains, respectively, by PCR. Under optimized conditions, the duplex PCR system using the designed primers successfully detected and differentiated all typical and atypical M. plutonius strain/isolates tested, while no product was generated from any other bacterial strains/isolates used in this study, including those isolated from healthy honeybee larval guts. Detection limits of the PCR were 50 copies of chromosome/reaction for both types, and it could detect typical and atypical M. plutonius directly from diseased honeybee larvae. Moreover, the duplex PCR diagnosed mixed infections with both M. plutonius types more precisely than standard culture methods. These results indicate that the duplex PCR assay developed in this study is extremely useful for precise diagnosis and epidemiological study of EFB.

  11. Development of Duplex PCR Assay for Detection and Differentiation of Typical and Atypical Melissococcus plutonius strains

    PubMed Central

    ARAI, Rie; MIYOSHI-AKIYAMA, Tohru; OKUMURA, Kayo; MORINAGA, Yuiko; WU, Meihua; SUGIMURA, Yuya; YOSHIYAMA, Mikio; OKURA, Masatoshi; KIRIKAE, Teruo; TAKAMATSU, Daisuke

    2013-01-01

    ABSTRACT Melissococcus plutonius is the causative agent of an important honeybee disease, European foulbrood (EFB). In addition to M. plutonius strains with typical characteristics (typical M. plutonius), we recently reported the presence of atypical M. plutonius, which are phenotypically and genetically distinguished from typical M. plutonius. Because typical and atypical M. plutonius may have different pathogenic mechanisms, differentiation of these two types is very important for diagnosis and more effective control of EFB. In this study, therefore, a duplex PCR assay was developed to detect and differentiate typical and atypical M. plutonius rapidly and easily. On the basis of the results of comparative genomic analyses, we selected Na+/H+ antiporter gene and Fur family transcriptional regulator gene as targets for detection of typical and atypical strains, respectively, by PCR. Under optimized conditions, the duplex PCR system using the designed primers successfully detected and differentiated all typical and atypical M. plutonius strain/isolates tested, while no product was generated from any other bacterial strains/isolates used in this study, including those isolated from healthy honeybee larval guts. Detection limits of the PCR were 50 copies of chromosome/reaction for both types, and it could detect typical and atypical M. plutonius directly from diseased honeybee larvae. Moreover, the duplex PCR diagnosed mixed infections with both M. plutonius types more precisely than standard culture methods. These results indicate that the duplex PCR assay developed in this study is extremely useful for precise diagnosis and epidemiological study of EFB. PMID:24334815

  12. Duplex PCR for detection of Salmonella and Shigella spp in cockle samples.

    PubMed

    Senachai, Pachara; Chomvarin, Chariya; Wongboot, Warawan; Boonyanugomol, Wongwarut; Tangkanakul, Waraluk

    2013-09-01

    Salmonella and Shigella spp are important causative agents of foodborne diseases. A sensitive, specific and rapid method is essential for detection of these pathogens. In this study, a duplex PCR method was developed for simultaneous detection of Salmonella and Shigella spp in cockle samples and compared with the traditional culture method. Enrichment broths for Salmonella spp recovery were also compared. Sensitivity of the duplex PCR for simultaneous detection of Salmonella and Shigella spp from pure culture was 10(3) CFU/ml (40 CFU/PCR reaction), and that of sterile cockle samples spiked with these two pathogens was 1 CFU/10 g of cockle tissue after 9 hours enrichment [3 hours in buffered peptone water (BPW), followed by 6 hours in Rappaport Vasiliadis (RV) broth or tetrathionate (TT) broth for Salmonella spp and 6 hours enrichment in Shigella broth (SB) for Shigella spp]. There was no significant difference in detection sensitivity between enrichment in RV and TT broths. Salmonella spp detected in cockles in Khon Kaen, Thailand by duplex PCR and culture method was 17% and 13%, respectively but Shigella spp was not detected. The duplex PCR technique developed for simultaneous detection of Salmonella and Shigella spp in cockle samples was highly sensitive, specific and rapid and could serve as a suitable method for food safety assessment.

  13. Dislocation of the third ventricle due to space-occupying stroke evaluated by transcranial duplex sonography.

    PubMed

    Seidel, G; Gerriets, T; Kaps, M; Missler, U

    1996-10-01

    Transcranial color-coded duplex sonography is a recently introduced method for visualizing (1) the blood flow velocity of the basal cerebral arteries and (2) the brain parenchyma as an acoustic impedance image. Dislocation of the third ventricle due to space-occupying stroke is an important clinical marker. This study evaluated the dislocation of the third ventricle from the brain midline by transcranial duplex sonography in 10 healthy volunteers. The mean dislocation was 0.2 +/- 0.3 mm. Eighteen stroke patients were investigated within 12 hours by both duplex sonography and computed tomography (CT) and the dislocation of the third ventricle was measured. Correlation between the two methods was high (r = 0.87, N = 27). Twelve stroke patients divided into three subgroups according to the extent of the space-occupying effects of the lesion were followed for 3 weeks. The increase and decrease of the dislocation of the third ventricle over the time were monitored. In conclusion, transcranial duplex sonography is a reliable tool to monitor dislocation of the third ventricle due to space-occupying stroke.

  14. Bilayer Protograph Codes for Half-Duplex Relay Channels

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush; VanNguyen, Thuy; Nosratinia, Aria

    2013-01-01

    re-optimization. The main problem of half-duplex relay coding can be reduced to the simultaneous design of two codes at two rates and two SNRs (signal-to-noise ratios), such that one is a subset of the other. This problem can be addressed by forceful optimization, but a clever method of addressing this problem is via the bilayer lengthened (BL) LDPC structure. This method uses a bilayer Tanner graph to make the two codes while using a concept of "parity forwarding" with subsequent successive decoding that removes the need to directly address the issue of uneven SNRs among the symbols of a given codeword. This method is attractive in that it addresses some of the main issues in the design of relay codes, but it does not by itself give rise to highly structured codes with simple encoding, nor does it give rate-compatible codes. The main contribution of this work is to construct a class of codes that simultaneously possess a bilayer parity- forwarding mechanism, while also benefiting from the properties of protograph codes having an easy encoding, a modular design, and being a rate-compatible code.

  15. Final Report, Volume 1, Metallurgical Evaluation of Cast Duplex Stainless Steels and their Weldments

    SciTech Connect

    Wen, Songqing; Lundin, Carl, W.; Batten, Greg, W.

    2005-09-30

    Duplex stainless steels (DSS) are being specified for chloride containing environments due to their enhanced pitting and stress corrosion cracking resistance. They exhibit improved corrosion performance over the austenitic stainless steels. Duplex stainless steels also offer improved strength properties and are available in various wrought and cast forms. Selected grades of duplex stainless steel castings and their welds, in comparison with their wrought counterparts, were evaluated, regarding corrosion performance and mechanical properties and weldability. Multiple heats of cast duplex stainless steel were evaluated in the as-cast, solution annealed (SA) static cast and SA centrifugal cast conditions, while their wrought counterparts were characterized in the SA condition and in the form of as-rolled plate. Welding, including extensive assessment of autogenous welds and a preliminary study of composite welds (shielded metal arc weld (SMAW)), was performed. The evaluations included critical pitting temperature (CPT) testing, intergranular corrosion (IGC) testing, ASTM A923 (Methods A, B and C), Charpy impact testing, weldability testing (ASTM A494), ferrite measurement and microstructural evaluations. In the study, the corrosion performances of DSS castings were characterized and assessed, including the wrought counterparts for comparison. The evaluation filled the pore of lack of data for cast duplex stainless steels compared to wrought materials. A database of the pitting corrosion and IGC behavior of cast and wrought materials was generated for a greater depth of understanding for the behavior of cast duplex stainless steel. In addition, improved evaluation methods for DSS castings were developed according to ASTM A923, A262, G48 and A494. The study revealed that when properly heat treated according to the specification, (1) DSS castings have equal or better pitting and intergranular corrosion resistance than their wrought counterparts; (2) Welding reduces the

  16. Final Report, Volume 1, Metallurgical Evaluation of Cast Duplex Stainless Steels and their Weldments

    SciTech Connect

    Wen, Songqing; Lundin, Carl, W.; Batten, Greg, W.

    2005-09-30

    Duplex stainless steels (DSS) are being specified for chloride containing environments due to their enhanced pitting and stress corrosion cracking resistance. They exhibit improved corrosion performance over the austenitic stainless steels. Duplex stainless steels also offer improved strength properties and are available in various wrought and cast forms. Selected grades of duplex stainless steel castings and their welds, in comparison with their wrought counterparts, were evaluated, regarding corrosion performance and mechanical properties and weldability. Multiple heats of cast duplex stainless steel were evaluated in the as-cast, solution annealed (SA) static cast and SA centrifugal cast conditions, while their wrought counterparts were characterized in the SA condition and in the form of as-rolled plate. Welding, including extensive assessment of autogenous welds and a preliminary study of composite welds (shielded metal arc weld (SMAW)), was performed. The evaluations included critical pitting temperature (CPT) testing, intergranular corrosion (IGC) testing, ASTM A923 (Methods A, B and C), Charpy impact testing, weldability testing (ASTM A494), ferrite measurement and microstructural evaluations. In the study, the corrosion performances of DSS castings were characterized and assessed, including the wrought counterparts for comparison. The evaluation filled the pore of lack of data for cast duplex stainless steels compared to wrought materials. A database of the pitting corrosion and IGC behavior of cast and wrought materials was generated for a greater depth of understanding for the behavior of cast duplex stainless steel. In addition, improved evaluation methods for DSS castings were developed according to ASTM A923, A262, G48 and A494. The study revealed that when properly heat treated according to the specification, (1) DSS castings have equal or better pitting and intergranular corrosion resistance than their wrought counterparts; (2) Welding reduces the

  17. Similia similibus: pairing of homologous chromosomes driven by the physicochemical properties of DNA

    PubMed Central

    Falaschi, Arturo

    2008-01-01

    Genetic recombination in eukaryotes requires the pairing of homologous chromosomes to allow precise molecular exchanges between chromosome pairs at intertwined structures called Holliday junctions, the formation of which requires the action of the RecA protein. The mechanism behind the precise pairing of structures as long as chromosomes remains mysterious. In yeast, during the initial phases of meiosis, chromosomes are paired at approximately 65 kilobase intervals via paranemic interactions that do not involve strand breakage nor the intervention of analogs of the RecA protein. It has been proposed that these paranemic interactions could occur between G-rich chromosomal regions, but putting in register stretches of homologous sequences hundreds of kb long remains challenging. Recent developments on the theory of the physicochemical properties of DNA in aqueous solutions, in presence of di- or multivalent counterions, leads to the prediction that molecules with the same sequence tend to pair spontaneously by paranemic interactions depending on the electrostatic properties of DNA. Experimental support for this prediction has now been provided in vitro with naked DNA. This newly discovered property of DNA duplexes may thus provide a clue to solve the puzzle of the premeiotic pairing. PMID:19404436

  18. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  19. Multiprocessor switch with selective pairing

    DOEpatents

    Gara, Alan; Gschwind, Michael K; Salapura, Valentina

    2014-03-11

    System, method and computer program product for a multiprocessing system to offer selective pairing of processor cores for increased processing reliability. A selective pairing facility is provided that selectively connects, i.e., pairs, multiple microprocessor or processor cores to provide one highly reliable thread (or thread group). Each paired microprocessor or processor cores that provide one highly reliable thread for high-reliability connect with a system components such as a memory "nest" (or memory hierarchy), an optional system controller, and optional interrupt controller, optional I/O or peripheral devices, etc. The memory nest is attached to a selective pairing facility via a switch or a bus

  20. Development of nano-structured duplex and ferritic stainless steels by pulverisette planetary milling followed by pressureless sintering

    SciTech Connect

    R, Shashanka Chaira, D.

    2015-01-15

    Nano-structured duplex and ferritic stainless steel powders are prepared by planetary milling of elemental Fe, Cr and Ni powder for 40 h and then consolidated by conventional pressureless sintering. The progress of milling and the continuous refinement of stainless steel powders have been confirmed by means of X-ray diffraction and scanning electron microscopy. Activation energy for the formation of duplex and ferritic stainless steels is calculated by Kissinger method using differential scanning calorimetry and is found to be 159.24 and 90.17 KJ/mol respectively. Both duplex and ferritic stainless steel powders are consolidated at 1000, 1200 and 1400 °C in argon atmosphere to study microstructure, density and hardness. Maximum sintered density of 90% and Vickers microhardness of 550 HV are achieved for duplex stainless steel sintered at 1400 °C for 1 h. Similarly, 92% sintered density and 263 HV microhardness are achieved for ferritic stainless steel sintered at 1400 °C. - Highlights: • Synthesized duplex and ferritic stainless steels by pulverisette planetary milling • Calculated activation energy for the formation of duplex and ferritic stainless steels • Studied the effect of sintering temperature on density, hardness and microstructure • Duplex stainless steel exhibits 90% sintered density and microhardness of 550 HV. • Ferritic stainless steel shows 92% sintered density and 263 HV microhardness.

  1. Multistory duplexes with forward dipping roofs, north central Brooks Range, Alaska

    USGS Publications Warehouse

    Wallace, W.K.; Moore, T.E.; Plafker, G.

    1997-01-01

    The Endicott Mountains allochthon has been thrust far northward over the North Slope parautochthon in the northern Brooks Range. Progressively younger units are exposed northward within the allochthon. To the south, the incompetent Hunt Fork Shale has thickened internally by asymmetric folds and thrust faults. Northward, the competent Kanayut Conglomerate forms a duplex between a floor thrust in Hunt Fork and a roof thrust in the Kayak Shale. To the north, the competent Lisburne Group forms a duplex between a floor thrust in Kayak and a roof thrust in the Siksikpuk Formation. Both duplexes formed from north vergent detachment folds whose steep limbs were later truncated by south dipping thrust faults that only locally breach immediately overlying roof thrusts. Within the parautochthon, the Kayak, Lisburne, and Siksikpuk-equivalent Echooka Formation form a duplex identical to that in the allochthon. This duplex is succeeded abruptly northward by detachment folds in Lisburne. These folds are parasitic to an anticlinorium interpreted to reflect a fault-bend folded horse in North Slope "basement," with a roof thrust in Kayak and a floor thrust at depth. These structures constitute two northward tapered, internally deformed wedges that are juxtaposed at the base of the allochthon. Within each wedge, competent units have been shortened independently between detachments, located mainly in incompetent units. The basal detachment of each wedge cuts upsection forward (northward) to define a wedge geometry within which units dip regionally forward. These dips reflect forward decrease in internal structural thickening by forward vergent folds and hindward dipping thrust faults. Copyright 1997 by the American Geophysical Union.

  2. Multistory duplexes with forward dipping roofs, north central Brooks Range, Alaska

    NASA Astrophysics Data System (ADS)

    Wallace, Wesley K.; Moore, Thomas E.; Plafker, George

    1997-01-01

    The Endicott Mountains allochthon has been thrust far northward over the North Slope parautochthon in the northern Brooks Range. Progressively younger units are exposed northward within the allochthon. To the south, the incompetent Hunt Fork Shale has thickened internally by asymmetric folds and thrust faults. Northward, the competent Kanayut Conglomerate forms a duplex between a floor thrust in Hunt Fork and a roof thrust in the Kayak Shale. To the north, the competent Lisburne Group forms a duplex between a floor thrust in Kayak and a roof thrust in the Siksikpuk Formation. Both duplexes formed from north vergent detachment folds whose steep limbs were later truncated by south dipping thrust faults that only locally breach immediately overlying roof thrusts. Within the parautochthon, the Kayak, Lisburne, and Siksikpuk-equivalent Echooka Formation form a duplex identical to that in the allochthon. This duplex is succeeded abruptly northward by detachment folds in Lisburne. These folds are parasitic to an anticlinorium interpreted to reflect a fault-bend folded horse in North Slope "basement," with a roof thrust in Kayak and a floor thrust at depth/These structures constitute two northward tapered, internally deformed wedges that are juxtaposed at the base of the allochthon. Within each wedge, competent units have been shortened independently between detachments, located mainly in incompetent units. The basal detachment of each wedge cuts upsection forward (northward) to define a wedge geometry within which units dip regionally forward. These dips reflect forward decrease in internal structural thickening by forward vergent folds and hindward dipping thrust faults.

  3. Architecture Studies Done for High-Rate Duplex Direct Data Distribution (D4) Services

    NASA Technical Reports Server (NTRS)

    2002-01-01

    A study was sponsored to investigate a set of end-to-end system concepts for implementing a high-rate duplex direct data distribution (D4) space-to-ground communications link. The NASA Glenn Research Center is investigating these systems (both commercial and Government) as a possible method of providing a D4 communications service between NASA spacecraft in low Earth orbit and the respective principal investigators using or monitoring instruments aboard these spacecraft. Candidate commercial services were assessed regarding their near-term potential to provide a D4 type of service. The candidates included K-band and V-band geostationary orbit and nongeostationary orbit satellite relay services and direct downlink (D3) services. Internet protocol (IP) networking technologies were evaluated to enable the user-directed distribution and delivery of science data. Four realistic, near-future concepts were analyzed: 1) A duplex direct link (uplink plus downlink communication paths) between a low-Earth-orbit spacecraft and a principal-investigator-based autonomous Earth station; 2) A space-based relay using a future K-band nongeosynchronous-orbit system to handle both the uplink and downlink communication paths; 3) A hybrid link using both direct and relay services to achieve full duplex capability; 4) A dual-mode concept consisting of both a duplex direct link and a space relay duplex link operating independently. The concepts were analyzed in terms of contact time between the NASA spacecraft and the communications service and the achievable data throughput. Throughput estimates for the D4 systems were based on the infusion of advanced communications technology products (single and multibeam K-band phased-arrays and digital modems) being developed by Glenn. Cost estimates were also performed using extrapolated information from both terrestrial and current satellite communications providers. The throughput and cost estimates were used to compare the concepts.

  4. A bridging water anchors the tethered 5-(3-aminopropyl)-2'-deoxyuridine amine in the DNA major groove proximate to the N+2 C.G base pair: implications for formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards.

    PubMed

    Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A; Gold, Barry; Egli, Martin; Stone, Michael P

    2008-07-08

    Site-specific insertion of 5-(3-aminopropyl)-2'-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5'-d(C (1)G (2)C (3)G (4)A (5)A (6)T (7)T (8)C (9) Z (10)C (11)G (12))-3'.5'-d(C (13)G (14)C (15)G (16)A (17)A (18)T (19)T (20)C (21) Z (22)C (23)G (24))-3' (named DDD (Z10)) and 5'-d(C (1)G (2)C (3)G (4)A (5)A (6)T (7) X (8)C (9) Z (10)C (11)G (12))-3'.5'-d(C (13)G (14)C (15)G (16)A (17)A (18)T (19) X (20)C (21) Z (22)C (23)G (24))-3' (named DDD (2+Z10)) (X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD (2+Z10) duplex reveals that the tethered cations at base pairs A (5).X (20) and X (8).A (17) extend within the major groove in the 3'-direction, toward conserved Mg (2+) binding sites located adjacent to N+2 base pairs C (3).Z (22) and Z (10).C (15). Bridging waters located between the tethered amines and either Z (10) or Z (22) O (6) stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD (2+Z10) duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z (10) O (6) and Z (22) O (6). The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C.G base pair, facilitating interstrand cross-linking.

  5. Stabilization of i-motif structures by 2′-β-fluorination of DNA

    PubMed Central

    Assi, Hala Abou; Harkness, Robert W.; Martin-Pintado, Nerea; Wilds, Christopher J.; Campos-Olivas, Ramón; Mittermaier, Anthony K.; González, Carlos; Damha, Masad J.

    2016-01-01

    i-Motifs are four-stranded DNA structures consisting of two parallel DNA duplexes held together by hemi-protonated and intercalated cytosine base pairs (C:CH+). They have attracted considerable research interest for their potential role in gene regulation and their use as pH responsive switches and building blocks in macromolecular assemblies. At neutral and basic pH values, the cytosine bases deprotonate and the structure unfolds into single strands. To avoid this limitation and expand the range of environmental conditions supporting i-motif folding, we replaced the sugar in DNA by 2-deoxy-2-fluoroarabinose. We demonstrate that such a modification significantly stabilizes i-motif formation over a wide pH range, including pH 7. Nuclear magnetic resonance experiments reveal that 2-deoxy-2-fluoroarabinose adopts a C2′-endo conformation, instead of the C3′-endo conformation usually found in unmodified i-motifs. Nevertheless, this substitution does not alter the overall i-motif structure. This conformational change, together with the changes in charge distribution in the sugar caused by the electronegative fluorine atoms, leads to a number of favorable sequential and inter-strand electrostatic interactions. The availability of folded i-motifs at neutral pH will aid investigations into the biological function of i-motifs in vitro, and will expand i-motif applications in nanotechnology. PMID:27166371

  6. Development of a duplex PCR for rapid detection and differentiation of Erysipelothrix rhusiopathiae vaccine strains and wild type strains.

    PubMed

    Zhu, Weifeng; Wu, Chao; Kang, Chao; Cai, Chengzhi; Jin, Meilin

    2017-02-01

    The differentiation of vaccine strains from wild type strains is important for disease control. A duplex PCR for rapid detection and differentiation of Erysipelothrix rhusiopathiae vaccine strains and wild type strains was developed based on the DNA polymerase IV gene. This duplex PCR was sensitive and specific. The detection results were coincident with that of a single nucleotide polymorphisms based PCR but the detection process was more rapid. In conclusion, this duplex PCR was a useful tool for Erysipelothrix rhusiopathiae infections' differential diagnosis in China.

  7. The three-dimensional context of a double helix determines the fluorescence of the internucleoside-tethered pair of fluorophores.

    PubMed

    Metelev, Valeri; Zhang, Surong; Tabatadze, David; Kumar, Anand T N; Bogdanov, Alexei

    2013-10-01

    We report a general phenomenon of the formation of either a fluorescent or an entirely quenched oligodeoxynucleotide (ODN) duplex system by hybridizing pairs of complementary ODNs with identical chemical composition. The ODNs carried internucleoside tether-linked cyanines, where the cyanines were chosen to form a Förster's resonance energy transfer (FRET) donor-acceptor pair. The fluorescent and quenched ODN duplex systems differed only in that the cyanines linked to the respective ODNs were linked either closer to the 5'- or 3'-ends of the molecule. In either case, however, the dyes were separated by an identical number (7 or 8) of base pairs. Characterization by molecular modeling and energy minimization using a conformational search algorithm in a molecular operating environment (MOE) revealed that linking of the dyes closer to the 5'-ends resulted in their reciprocal orientation across the major groove which allowed a closely interacting dye pair to be formed. This overlap between the donor and acceptor dye molecules resulted in changes in absorbance spectra consistent with the formation of H-aggregates. Conversely, dyes linked closer to 3'-ends exhibited emissive FRET and formed a pair of dyes that interacted with the DNA helix only weakly. Induced CD spectra analysis suggested that interaction with the double helix was weaker than in the case of the closely interacting cyanine dye pair. Linking the dyes such that the base pair separation was 10 or 0 favored energy transfer with subsequent acceptor emission. Our results suggest that when interpreting FRET measurements from nucleic acids, the use of a "spectroscopic ruler" principle which takes into account the 3D helical context of the double helix will allow more accurate interpretation of fluorescence emission.

  8. The three-dimensional context of a double helix determines fluorescence of the internucleoside-tethered pair of fluorophores

    PubMed Central

    Metelev, Valeri; Zhang, Surong; Tabatadze, David; Kumar, Anand T.N.

    2014-01-01

    We report a general phenomenon of the formation of either a fluorescent, or of an entirely quenched oligodeoxynucleotide (ODN) duplex system by hybridizing pairs of complementary ODNs with identical chemical composition. The ODNs carried internucleoside tether-linked cyanines, where the cyanines were chosen to form a Förster's resonance energy transfer (FRET) doner/acceptor pair. The fluorescent and quenched ODN duplex systems differed only in that the cyanines linked to the respective ODNs s were linked either closer to the 5′-, or closer to the 3′-ends of the molecule. In either case however, the dyes were separated by an identical number (7 or 8) of base pairs. Characterization by molecular modeling and energy minimization using a conformational search algorithm in a molecular operating environment (MOE) revealed that linking of the dyes closer to the 5′-ends resulted in their reciprocal orientation across the major groove which allowed a closely interacting dye pair to be formed. This overlap between the donor and acceptor dye molecules resulted in changes of absorbance spectra consistent with the formation of H-aggregates. Conversly, dyes linked closer to 3′-ends exhibited emissive FRET and formed a pair of dyes that interacted with the DNA helix only weakly. Induced CD spectra analysis suggested that interaction with the double helix was weaker than in the case of the closely interacting cyanine dye pair. Linking the dyes such that the base pair separation was 10 or 0 favored energy transfer with subsequent acceptor emission. Our results suggest that when interpreting FRET measurements from nucleic acids, the use of a “spectroscopic ruler” principle which takes into account the 3D helical context of the double helix will allow more accurate interpretation of fluorescence emission. PMID:23925269

  9. Stereo Pair, Pasadena, California

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This stereoscopic image pair is a perspective view that shows the western part of the city of Pasadena, California, looking north toward the San Gabriel Mountains. Portions of the cities of Altadena and La Canada Flintridge are also shown. The cluster of large buildings left of center, at the base of the mountains, is the Jet Propulsion Laboratory. This image shows the power of combining data from different sources to create planning tools to study problems that affect large urban areas. In addition to the well-known earthquake hazards, Southern California is affected by a natural cycle of fire and mudflows. Data shown in this image can be used to predict both how wildfires spread over the terrain and how mudflows are channeled down the canyons.

    The image was created from three datasets: the Shuttle Radar Topography Mission (SRTM) supplied the elevation, U. S. Geological Survey digital aerial photography provided the image detail, and the Landsat Thematic Mapper provided the color. The United States Geological Survey's Earth Resources Observations Systems (EROS) Data Center, Sioux Falls, South Dakota, provided the Landsat data and the aerial photography. The image can be viewed in 3-D by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing), or by downloading and printing the image pair, and viewing them with a stereoscope.

    The Shuttle Radar Topography Mission (SRTM), launched on February 11, 2000, used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. The mission was designed to collect three-dimensional measurements of the Earth's surface. To collect the 3-D data, engineers added a 60-meter-long (200-foot) mast, an additional C-band imaging antenna and improved tracking and navigation devices. The mission is a cooperative project between the National Aeronautics and Space Administration

  10. On the Formation and Properties of Interstrand DNA-DNA Cross-links Forged by Reaction of an Abasic Site With the Opposing Guanine Residue of 5′-CAp Sequences in Duplex DNA

    PubMed Central

    Johnson, Kevin M.; Price, Nathan E.; Wang, Jin; Fekry, Mostafa I.; Dutta, Sanjay; Seiner, Derrick R.; Wang, Yinsheng; Gates, Kent S.

    2014-01-01

    We recently reported that the aldehyde residue of an abasic (Ap) site in duplex DNA can generate an interstrand cross-link via reaction with a guanine residue on the opposing strand. This finding is intriguing because the highly deleterious nature of interstrand cross-links suggests that even small amounts of Ap-derived cross-links could make a significant contribution to the biological consequences stemming from the generation of Ap sites in cellular DNA. Incubation of 21-bp duplexes containing a central 5′-CAp sequence under conditions of reductive amination (NaCNBH3, pH 5.2) generated much higher yields of cross-linked DNA than reported previously. At pH 7, in the absence of reducing agents, these Ap-containing duplexes also produced cross-linked duplexes that were readily detected on denaturing polyacrylamide gels. Cross-link formation was not highly sensitive to reaction conditions and, once formed, the cross-link was stable to a variety of work-up conditions. Results of multiple experiments including MALDI-TOF mass spectrometry, gel mobility, methoxyamine capping of the Ap aldehyde, inosine-for-guanine replacement, hydroxyl radical footprinting, and LCMS/MS were consistent with a cross-linking mechanism involving reversible reaction of the Ap aldehyde residue with the N2-amino group of the opposing guanine residue in 5′-CAp sequences to generate hemiaminal, imine, or cyclic hemiaminal cross-links (7-10) that were irreversibly converted under conditions of reductive amination (NaCNBH3/pH 5.2) to a stable amine linkage. Further support for the importance of the exocyclic N2-amino group in this reaction was provided by an experiment showing that installation of a 2-aminopurine-thymine base pair at the cross-linking site produced high yields (15-30%) of a cross-linked duplex at neutral pH, in the absence of NaCNBH3. PMID:23215239

  11. Electron backscatter diffraction study of deformation and recrystallization textures of individual phases in a cross-rolled duplex steel

    SciTech Connect

    Zaid, Md; Bhattacharjee, P.P.

    2014-10-15

    The evolution of microstructure and texture during cross-rolling and annealing was investigated by electron backscatter diffraction in a ferritic–austenitic duplex stainless steel. For this purpose an alloy with nearly equal volume fraction of the two phases was deformed by multi-pass cross-rolling process up to 90% reduction in thickness. The rolling and transverse directions were mutually interchanged in each pass by rotating the sample by 90° around the normal direction. In order to avoid deformation induced phase transformation and dynamic strain aging, the rolling was carried out at an optimized temperature of 898 K (625 °C) at the warm-deformation range. The microstructure after cross warm-rolling revealed a lamellar structure with alternate arrangement of the bands of two phases. Strong brass and rotated brass components were observed in austenite in the steel after processing by cross warm-rolling. The ferrite in the cross warm-rolling processed steel showed remarkably strong RD-fiber (RD//< 011 >) component (001)< 011 >. The development of texture in the two phases after processing by cross warm-rolling could be explained by the stability of the texture components. During isothermal annealing of the 90% cross warm-rolling processed material the lamellar morphology was retained before collapse of the lamellar structure to the mutual interpenetration of the phase bands. Ferrite showed recovery resulting in annealing texture similar to the deformation texture. In contrast, the austenite showed primary recrystallization without preferential orientation selection leading to the retention of deformation texture. The evolution of deformation and annealing texture in the two phases of the steel was independent of one another. - Highlights: • Effect of cross warm-rolling on texture formation is studied in duplex steel. • Brass texture in austenite and (001)<110 > in ferrite are developed. • Ferrite shows recovery during annealing retaining the (001

  12. Pygmy stars: first pair.

    PubMed

    Zwicky, F

    1966-07-01

    The binary LP 101-15/16 having the proper motion of 1.62 seconds of arc per year has been studied with the prime-focus spectrograph of the 200-inch (508 cm) telescope. Indications are that LP 101-15/16 is the first pair of pygmy stars ever discovered. One of its components, LP 101-16, is probably a blue pygmy star which is at least four magnitudes fainter than the ordinary white dwarfs. Also, two of the Balmer lines in absorption appear to be displaced toward the red by amounts which indicate the existence of an Einstein gravitational red shift corresponding to about 1000 km sec-1. On the other hand LP 101-15 is red and shows an entirely new type of spectrum, which suggests that it may be a first representative of a type of red pygmy star which is 2.5 magnitudes fainter than the M-type dwarf stars of the main sequence.

  13. Dynamical evolution of comet pairs

    NASA Astrophysics Data System (ADS)

    Sosa, Andrea; Fernández, Julio A.

    2016-10-01

    Some Jupiter family comets in near-Earth orbits (thereafter NEJFCs) show a remarkable similarity in their present orbits, like for instance 169P/NEAT and P/2003 T12 (SOHO), or 252P/LINEAR and P/2016 BA14 (PANSTARRS). By means of numerical integrations we studied the dynamical evolution of these objects. In particular, for each pair of presumably related objects, we are interested in assessing the stability of the orbital parameters for several thousand years, and to find a minimum of their relative spatial distance, coincident with a low value of their relative velocity. For those cases for which we find a well defined minimum of their relative orbital separation, we are trying to reproduce the actual orbit of the hypothetical fragment by modeling a fragmentation of the parent body. Some model parameters are the relative ejection velocity (a few m/s), the orbital point at which the fragmentation could have happened (e.g. perihelion), and the elapsed time since fragmentation. In addition, some possible fragmentation mechanisms, like thermal stress, rotational instability, or collisions, could be explored. According to Fernández J.A and Sosa A. 2015 (Planetary and Space Science 118,pp.14-24), some NEJFCs might come from the outer asteroid belt, and then they would have a more consolidated structure and a higher mineral content than that of comets coming from the trans-Neptunian belt or the Oort cloud. Therefore, such objects would have a much longer physical lifetime in the near-Earth region, and could become potential candidates to produce visible meteor showers (as for example 169P/NEAT which has been identified as the parent body of the alpha-Capricornid meteoroid stream, according to Jenniskens, P., Vaubaillon, J., 2010 (Astron. J. 139), and Kasuga, T., Balam, D.D., Wiegert, P.A., 2010 (Astron. J. 139).

  14. Evaluation of binding selectivity of a polyamide probe to single base-pair different DNA in A.T-rich region by electrospray ionization mass spectrometry.

    PubMed

    Li, Huihui; Yuan, Gu

    2006-12-01

    In this study, electrospray ionization mass spectrometry (ESI-MS) was used for the evaluation of the binding selectivity of a polyamide probe to single-base pair different DNA in an A.T-rich region. In this procedure, DeltaIr(dsn) was introduced as a parameter to compare the binding affinities of the polyamides with the duplex DNA. The results show that ESI-MS is a very useful tool for analysis of binding selectivity of a polyamide probe to single-base pair different DNA.

  15. Development of self-similar duplex systems. Atacama Fault System, Chile

    NASA Astrophysics Data System (ADS)

    Jensen, E.; Cembrano, J. M.; Veloso, E. E.

    2009-12-01

    Fault development models are very important to predict geometry and distribution of fractures at all scales. However, models based on structures from microns to km are relatively scarce due to the lack of well-exposed structures. We present structures related to the development of the Bolfín fault in the Atacama Fault System (AFS), covering a scale range of 9 orders of magnitude. The AFS is a 1000 km-long trench-parallel fault system located in the Andean Forearc. The Bolfín fault is a first-order fault of the Caleta Coloso Duplex; it has a trend ~170° and a length >45 km (Fig 1A). It cuts meta-diorites and exhibits a 100-200m wide core of subvertical bands of altered fractured host rock and of foliated cataclasites. Foliation is made of trend-parallel cm-wide shear bands composed of plagioclase fragments (>0,1mm) surrounded by epidote. Around the bands there are many micro fractures oriented within the P-diedra. In the compressive quadrant around a tip point of Bolfín fault, the lower strain faults exhibit an unusual internal structure consisting of fractures arranged in a multi-duplex pattern. This pattern can be seen from metric- (Parulo fault, fig 1C) to mm-scale (Palmera fault fig 1B). Fractures in the pattern can be separated in 2 types: Main Faults: Trend-parallel, longer and with larger offsets. Secondary Fractures: sigmoid-shape fractures distributed in the regions between main faults, all oriented between 15° and 75° with respect to the main faults, meassured in the shear-sense (i.e. in P-diedra). On the basis of the distribution of the 2 types of fractures, the generation sequence can be inferred. The main faults are more widely distributed, and were propagated earlier. The secondary fractures are distributed in smaller areas between larger displacement main faults, and propagated later as linking fractures. The duplex pattern is thus self-similar: faults with multiple-duplex internal structure (Parulo and Palmera fault)are in turn secondary faults

  16. Detection of 12 respiratory viruses by duplex real time PCR assays in respiratory samples.

    PubMed

    Arvia, Rosaria; Corcioli, Fabiana; Ciccone, Nunziata; Della Malva, Nunzia; Azzi, Alberta

    2015-12-01

    Different viruses can be responsible for similar clinical manifestations of respiratory infections. Thus, the etiological diagnosis of respiratory viral diseases requires the detection of a large number of viruses. In this study, 6 duplex real-time PCR assays, using EvaGreen intercalating dye, were developed to detect 12 major viruses responsible for respiratory diseases: influenza A and B viruses, enteroviruses (including enterovirus spp, and rhinovirus spp), respiratory syncytial virus, human metapneumovirus, coronaviruses group I (of which CoV 229E and CoV NL63 are part) and II (including CoV OC43 and CoV HKU1), parainfluenza viruses type 1, 2, 3 and 4, human adenoviruses and human bocaviruses. The 2 target viruses of each duplex reaction were distinguishable by the melting temperatures of their amplicons. The 6 duplex real time PCR assays were applied for diagnostic purpose on 202 respiratory samples from 157 patients. One hundred fifty-seven samples were throat swabs and 45 were bronchoalveolar lavages. The results of the duplex PCR assays were confirmed by comparison with a commercial, validated, assay; in addition, the positive results were confirmed by sequencing. The analytical sensitivity of the duplex PCR assays varied from 10(3) copies/ml to 10(4) copies/ml. For parainfluenza virus 2 only it was 10(5) copies/ml. Seventy clinical samples (35%) from 55 patients (30 children and 25 adults) were positive for 1 or more viruses. In adult patients, influenza A virus was the most frequently detected respiratory virus followed by rhinoviruses. In contrast, respiratory syncytial virus was the most common virus in children, followed by enteroviruses, influenza A virus and coronavirus NL63. The small number of samples/patients does not allow us to draw any epidemiological conclusion. Altogether, the results of this study indicate that the 6 duplex PCR assays described in this study are sensitive, specific and cost-effective. Thus, this assay could be

  17. SDSS DR2 Merging pairs

    NASA Astrophysics Data System (ADS)

    Allam, S. S.; Tucker, D. L.; SDSS Collaboration

    2004-05-01

    We present and analyze a catalog of 9,000 Merging pairs candidates to g=21 from the imaging data of the Sloan Digital Sky Survey (SDSS) Second Data Release (DR2). Candidates were selected using an automated algorithm (Allam et al. 2004) that is efficient in its selection of galaxy pairs. We highlight possible science applications of such a large photometric sample of merging pais and discuss future improvements, including incorporating magnitudes and pushing to higher redshifts and fainter pairs.

  18. Controversies in kidney paired donation.

    PubMed

    Gentry, Sommer E; Montgomery, Robert A; Segev, Dorry L

    2012-07-01

    Kidney paired donation represented 10% of living kidney donation in the United States in 2011. National registries around the world and several separate registries in the United States arrange paired donations, although with significant variations in their practices. Concerns about ethical considerations, clinical advisability, and the quantitative effectiveness of these approaches in paired donation result in these variations. For instance, although donor travel can be burdensome and might discourage paired donation, it was nearly universal until convincing analysis showed that living donor kidneys can sustain many hours of cold ischemia time without adverse consequences. Opinions also differ about whether the last donor in a chain of paired donation transplants initiated by a nondirected donor should donate immediately to someone on the deceased donor wait-list (a domino or closed chain) or should be asked to wait some length of time and donate to start another sequence of paired donations later (an open chain); some argue that asking the donor to donate later may be coercive, and others focus on balancing the probability that the waiting donor withdraws versus the number of additional transplants if the chain can be continued. Other controversies in paired donation include simultaneous versus nonsimultaneous donor operations, whether to enroll compatible pairs, and interactions with desensitization protocols. Efforts to expand public awareness of and participation in paired donation are needed to generate more transplant opportunities.

  19. Full-duplex bidirectional data transmission link using twisted lights multiplexing over 1.1-km orbital angular momentum fiber

    NASA Astrophysics Data System (ADS)

    Chen, Shi; Liu, Jun; Zhao, Yifan; Zhu, Long; Wang, Andong; Li, Shuhui; Du, Jing; Du, Cheng; Mo, Qi; Wang, Jian

    2016-11-01

    We present a full-duplex bidirectional data transmission link using twisted lights multiplexing over 1.1-km orbital angular momentum (OAM) fiber. OAM+1 and OAM-1 modes carrying 20-Gbit/s quadrature phase-shift keying (QPSK) signals are employed in the downlink and uplink transmission experiments. The observed mode crosstalks are less than -15.2 dB, and the full-duplex crosstalks are less than -12.7 dB. The measured full-duplex optical signal-to-noise ratio (OSNR) penalties at a bit-error rate (BER) of 2 × 10-3 are ~2.4 dB in the downlink transmission and ~2.3 dB in the uplink transmission. The obtained results show favorable full-duplex twisted lights multiplexing data transmission performance in a km-scale OAM fiber link.

  20. Full-duplex bidirectional data transmission link using twisted lights multiplexing over 1.1-km orbital angular momentum fiber

    PubMed Central

    Chen, Shi; Liu, Jun; Zhao, Yifan; Zhu, Long; Wang, Andong; Li, Shuhui; Du, Jing; Du, Cheng; Mo, Qi; Wang, Jian

    2016-01-01

    We present a full-duplex bidirectional data transmission link using twisted lights multiplexing over 1.1-km orbital angular momentum (OAM) fiber. OAM+1 and OAM−1 modes carrying 20-Gbit/s quadrature phase-shift keying (QPSK) signals are employed in the downlink and uplink transmission experiments. The observed mode crosstalks are less than −15.2 dB, and the full-duplex crosstalks are less than −12.7 dB. The measured full-duplex optical signal-to-noise ratio (OSNR) penalties at a bit-error rate (BER) of 2 × 10−3 are ~2.4 dB in the downlink transmission and ~2.3 dB in the uplink transmission. The obtained results show favorable full-duplex twisted lights multiplexing data transmission performance in a km-scale OAM fiber link. PMID:27901082

  1. Ab initio Study of the Structural, Tautomeric, Pairing and Electronic Properties of Seleno-Derivatives of Thymine

    SciTech Connect

    Vazquez-Mayagoitia, Alvaro; Fuentes-Cabrera, Miguel A; Sumpter, Bobby G; Luque, Javier; Huertas, Oscar; Orozco, Modesto; Felice, Rosa; Brancolini, Giorgia; Migliore, Agostino

    2009-01-01

    The structural, tautomeric, hydrogen-bonding, stacking and electronic properties of a seleno-derivative of thymine (T), denoted here as 4SeT and created by replacing O4 in T with Se, are investigated by means of ab initio computational techniques. The structural properties of T and 4SeT are very similar and the geometrical differences are mainly limited to the adjacent environment of the C-Se bond. The canonical keto form is the most stable tautomer, in gas phase and in aqueous solution, for both T and 4SeT. It is argued that the competition between two opposite trends, i.e. a decrease in the base-pairing ability and an increase of the stacking interaction upon incorporation of 4SeT into a duplex, likely explains the similar experimental melting points of a seleno-derivative duplex (Se-DNA) and its native counterpart. Interestingly, the underlying electronic structure shows that replacement of O4 with Se promotes a reduction in the HOMO-LUMO gap and an increase in inter-plane coupling, which suggests that Se-DNA could be potentially useful for nanodevice applications. This finding is further supported by the fact that transfer integrals between 4SeT---A stacked base pairs are larger than those determined for similarly stacked natural T---A pairs.

  2. Adult Pacific Lamprey Migration in the Lower Columbia River: 2007 Radiotelemetry and Half-duplex Pit Tag Studies

    DTIC Science & Technology

    2009-01-01

    ADULT PACIFIC LAMPREY MIGRATION IN THE LOWER COLUMBIA RIVER: 2007 RADIOTELEMETRY AND HALF-DUPLEX PIT TAG STUDIES A Report for Study Code ADS-P-00-8...TITLE AND SUBTITLE Adult Pacific Lamprey Migration in the Lower Columbia River: 2007 Radiotelemetry and Half-duplex Pit Tag Studies 5a. CONTRACT NUMBER...Monitoring Pacific lamprey (Lampetra tridentata) run size and migration behaviors in the Columbia River basin is difficult given their cryptic and photo

  3. Progress Towards the Development of a Long-Lived Venus Lander Duplex System

    NASA Technical Reports Server (NTRS)

    Dyson, Roger W.; Bruder, Geoffrey A.

    2010-01-01

    NASA has begun the development of a combined Stirling cycle power and cooling system (duplex) to enable the long-lived surface exploration of Venus and other harsh environments in the solar system. The duplex system will operate from the heat provided by decaying radioisotope plutonium-238 or its substitute. Since the surface of Venus has a thick, hot, and corrosive atmosphere, it is a challenging proposition to maintain sensitive lander electronics under survivable conditions. This development effort requires the integration of: a radioisotope or fission heat source; heat pipes; high-temperature, corrosion-resistant material; multistage cooling; a novel free-displacer Stirling convertor for the lander; and a minimal vibration thermoacoustic Stirling convertor for the seismometer. The first year effort includes conceptual system design and control studies, materials development, and prototype hardware testing. A summary of these findings and test results is presented in this report.

  4. Vertebral artery dissection with compelling evidence on duplex ultrasound presenting only with neck pain

    PubMed Central

    Siepmann, Timo; Borchert, Monique; Barlinn, Kristian

    2016-01-01

    Vertebral artery dissection (VAD) is among the most common identifiable etiologies of stroke in young adults and poses a diagnostic challenge due to nonspecific symptoms and substantial variability of imaging results. Here, we present a case of unspecific neck pain as isolated symptom of VAD with unusually compelling evidence on duplex ultrasound. This observation has clinical relevance as the absence of any neurological symptoms in our patient highlights the necessity of considering cervical artery dissection in patients presenting with unspecific symptoms such as neck pain, even if isolated. Furthermore, our image of intramural hematoma on duplex ultrasound has been captured in an unusual, clear and distinct fashion and might therefore be a useful reference image in the clinical assessment of patients with a suspicion of cervical artery dissection. PMID:27843318

  5. E. coli recA protein possesses a strand separating activity on short duplex DNAs.

    PubMed Central

    Bianchi, M; Riboli, B; Magni, G

    1985-01-01

    RecA protein was found to catalyze the dissociation of the strands of a DNA substrate consisting of a 20-nucleotide primer annealed to circular single-stranded M13mp DNA. The strand separation reaction requires ATP hydrolysis and the presence of single-stranded DNA flanking the duplex DNA region to be unwound. RecA-catalyzed strand separation is effective only for very short duplexes, not exceeding 30 bp, and is not stimulated by single-stranded DNA-binding protein. These results are consistent with the ability of recA protein to disrupt regions of secondary structure in single-stranded DNA and to incorporate large non-homologies into heteroduplex DNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 3. PMID:3905387

  6. [Evaluation of portal circulation in healthy subjects with duplex scanning before and after meal].

    PubMed

    Kuntsevich, G I; Belolapotko, E A; Kokova, N I

    1994-01-01

    Duplex scanning was used to functionally assess the arterial and venous vascular bed in the portal circulatory system in 11 healthy persons aged 17 to 22 years before and after taking the food containing normal levels of calories. A circulatory response was studied in the celiac trunk, superior mesenteric artery, splenic and portal veins. The normal values of the diameter, linear and volumetric blood flow velocities of the vessels under study were defined. There was their increased velocity of arterial and venous flows. A nevous response to a meal was ahead of an arterial one and the increase in blood flow in the celiac trunk occurred more rapidly than in the superior mesenteric artery. It is concluded that duplex scanning is an informative and reliable tool in the study of blood flow in the portal circulatory system.

  7. Progress Towards the Development of a Long-Lived Venus Lander Duplex System

    NASA Technical Reports Server (NTRS)

    Dyson, Rodger, W.; Bruder, Geoffrey A.

    2011-01-01

    NASA has begun the development of a combined Stirling cycle power and cooling system (duplex) to enable the long-lived surface exploration of Venus and other harsh environments in the solar system. The duplex system will operate from the heat provided by decaying radioisotope plutonium-238 or its substitute. Since the surface of Venus has a thick, hot, and corrosive atmosphere, it is a challenging proposition to maintain sensitive lander electronics under survivable conditions. This development effort requires the integration of: a radioisotope or fission heat source; heat pipes; high-temperature, corrosion-resistant material; multistage cooling; a novel free-displacer Stirling convertor for the lander; and a minimal vibration thermoacoustic Stirling convertor for the seismometer. The first year effort includes conceptual system design and control studies, materials development, and prototype hardware testing. A summary of these findings and test results is presented in this report.

  8. Ethidium and proflavine binding to a 2',5'-linked RNA duplex.

    PubMed

    Horowitz, Eric D; Hud, Nicholas V

    2006-12-06

    Despite over 40 years of physical investigations, fundamental questions persist regarding the energetics of RNA and DNA intercalation. The dramatic unwinding of a nucleic acid duplex upon intercalation immediately suggests that the nucleic acid backbone should play a significant role in dictating the free energy of intercalation. However, the contribution of the backbone to intercalation free energy is difficult to appreciate given the intertwined energetics associated with intercalation (e.g., pi-pi stacking and solvent effects). Fluorescence titrations were used to determine the association constants of two known intercalators, proflavine and ethidium, for duplex 2',5'-linked RNA. Proflavine was found to bind 2',5' RNA with an association constant 25-fold greater than that measured for standard, 3',5'-linked RNA. In contrast, ethidium binds 2',5' RNA less favorably than standard RNA.

  9. Vacuum-ultraviolet circular dichroism reveals DNA duplex formation between short strands of adenine and thymine.

    PubMed

    Nielsen, Lisbeth Munksgaard; Hoffmann, Søren Vrønning; Brøndsted Nielsen, Steen

    2012-11-21

    Absorbance spectroscopy is used extensively to tell when two DNA single strands come together and form a double strand. Here we show that circular dichroism in the vacuum ultraviolet region provides an even stronger indication for duplex formation in the case of short strands of adenine and thymine (4 to 16 bases in each strand). Indeed, our results show that a strong positive CD band appears at 179 nm when double strands are formed. Melting experiments were done in aqueous solution with and without added Na(+) counter ions. With additional salt present a huge increase in the 179 nm CD band was observed when lowering the temperature. A 179 nm CD marker band for duplex formation can be used to measure the kinetics for the association of two single strands. Such experiments rely on large changes at one particular wavelength since it is too time-consuming to record a full-wavelength spectrum.

  10. Sites of Predicted Stress-Induced DNA Duplex Destabilization Occur Preferentially at Regulatory Loci

    NASA Astrophysics Data System (ADS)

    Benham, Craig J.

    1993-04-01

    This paper describes a computational method to predict the sites on a DNA molecule where imposed superhelical stresses destabilize the duplex. Several DNA sequences are analyzed in this way, including the pBR322 and ColE1 plasmids, bacteriophage f1, and the polyoma and bovine papilloma virus genomes. Superhelical destabilization in these molecules is predicted to occur at small numbers of discrete sites, most of which are within regulatory regions. The most destabilized sites include the terminator and promoter regions of specific plasmid operons, the LexA binding sites of genes under SOS control, the intergenic control region of bacteriophage f1, and the polyadenylylation sites in eukaryotic viruses. These results demonstrate the existence of close correspondences between sites of predicted superhelical duplex destabilization and specific types of regulatory regions. The use of these correspondences to supplement string-matching techniques in the search for regulatory loci is discussed.

  11. [Value of duplex ultrasound in diagnosis of ergotism of the legs].

    PubMed

    Martinet, O; Vuilleumier, H; Fournier, D; Jayet, A; Genton, A; Chapuis, G

    1995-01-01

    Ergot's derivatives are widely used in the treatment of migraine and in the prophylaxy of deep venous thrombosis in association with heparin. Clinical ergotism is rarely observed and can affect all the arteries, especially of the inferior limbs. Vasospasm of the peripheral arteries and collateral formation are specific findings on angiography. We report the illustrative case of a 38 years old woman hospitalized for a small bowel occlusion. She suffers from chronic migraine treated by ergotamine tartrate. During her hospitalization, she develops an acute ischemia of the lower limbs. An ergotism was clinically suspected and confirmed by Duplex sonography which demonstrate multiple vasospasm. Under iv sodium nitroprusside and peridural analgesia the spasm resolved in 24 hours. The control Duplex sonography confirm the normality of the lower limb arteries. This examination modality allow a non-invasive diagnosis and evolution control of arteriospasm.

  12. Alternative RISC assembly: Binding and repression of microRNA–mRNA duplexes by human Ago proteins

    PubMed Central

    Janas, Maja M.; Wang, Bingbing; Harris, Abigail S.; Aguiar, Mike; Shaffer, Jonathan M.; Subrahmanyam, Yerramilli V.B.K.; Behlke, Mark A.; Wucherpfennig, Kai W.; Gygi, Steven P.; Gagnon, Etienne; Novina, Carl D.

    2012-01-01

    MicroRNAs (miRNAs) are small noncoding RNAs that post-transcriptionally regulate protein output from the majority of human mRNAs. In contrast to the consensus view that all miRNAs are associated with Argonaute (Ago) proteins, we determine that miRNAs are expressed in a 13-fold excess relative to Agos in HeLa cells and that miRNAs are bound to mRNAs in a sevenfold excess relative to Agos, implying the existence of miRNA–mRNA duplexes not stoichiometrically bound by Agos. We show that all four human Agos can repress miRNA–mRNA duplexes, but only Ago2 can cleave small interfering RNA–mRNA duplexes in vitro. We visualize direct Ago binding to miRNA–mRNA duplexes in live cells using fluorescence lifetime imaging microscopy. In contrast to the consensus view that Agos bind miRNA duplexes, these data demonstrate that Agos can bind and repress miRNA–mRNA duplexes and support a model of catalytic Ago function in translational repression. PMID:23019594

  13. Electronic pairing in exotic superconductors

    SciTech Connect

    Cox, D.L. ); Maple, M.B. )

    1995-02-01

    Superconductivity in heavy-fermion materials and high T[sub c] cuprates may involve electronic pairing with unconventional symmetries and mechanisms. Although there has been no smoking-gun proof, numerous pieces of circumstantial evidence combined with heuristic theoretical arguments make a compelling case that these materials have pairs with exotic symmetry bound by nonphonon glue. 20 refs., 5 figs.

  14. Is Duplex-Ultrasound a useful tool in defining rejection episodes in composite tissue allograft transplants?

    PubMed

    Loizides, Alexander; Kronberger, Irmgard-Elisabeth; Plaikner, Michaela; Gruber, Hannes

    2015-12-01

    Immunologic reactions in transplanted organs are in more or less all allograft patients detectable: clear parameters exist as e.g. in renal transplants where the clearance power reduces by rejection. On the contrary, in composite tissue allografts clear and objective indicators stating a rejection episode lack. We present the case of a hand-transplanted subject with signs of acute transplant rejection diagnosed by means of Duplex Ultrasound and confirmed by biopsy.

  15. Diagnosis of gastric cryptosporidiosis in birds using a duplex real-time PCR assay.

    PubMed

    Nakamura, Alex A; Homem, Camila G; da Silva, Adriana M J; Meireles, Marcelo V

    2014-09-15

    Three species and several genotypes of Cryptosporidium can infect the epithelial surface of the bursa of Fabricius, the respiratory tract, the proventriculus, the intestine, and the urinary tract in birds. There is reason to believe that gastric cryptosporidiosis in birds is caused by Cryptosporidium galli and Cryptosporidium avian genotype III, resulting in a chronic illness of the proventriculus that can lead to a debilitating and fatal clinical condition in birds of the orders Passeriformes and Psittaciformes. The objectives of the present study were to develop a duplex real-time polymerase chain reaction (PCR) that targets the 18S rRNA gene to simultaneously detect C. galli and Cryptosporidium avian genotype III DNA and to compare the duplex real-time PCR results to those of nested PCR targeting a partial fragment of the 18S rRNA gene, followed by sequencing of the amplified products (nPCR/S). A total of 1027 fecal samples were collected from birds of the orders Psittaciformes and Passeriformes originating either from captivity or the wild. Duplex real-time PCR results were positive in 580 (56.47%) and 21 (2.04%) samples, respectively, for C. galli and Cryptosporidium avian genotype III, whereas nPCR/S was positive in 28 (2.73%) and three (0.29%) samples, respectively, for C. galli and Cryptosporidium avian genotype III. Novel host birds were identified for both of the above gastric species, and it was also possible to identify Cryptosporidium baileyi and, for the first time in Brazil, Cryptosporidium avian genotype V. The duplex real-time PCR assay developed in the present study represents a sensitive and specific method for the detection of C. galli and Cryptosporidium avian genotype III in bird fecal samples. Moreover, this method may serve as an alternative to nPCR/S as a gold standard for the diagnosis of gastric cryptosporidiosis in birds.

  16. Influence of the Martensitic Transformation on the Microscale Plastic Strain Heterogeneities in a Duplex Stainless Steel

    NASA Astrophysics Data System (ADS)

    Lechartier, Audrey; Martin, Guilhem; Comby, Solène; Roussel-Dherbey, Francine; Deschamps, Alexis; Mantel, Marc; Meyer, Nicolas; Verdier, Marc; Veron, Muriel

    2017-01-01

    The influence of the martensitic transformation on microscale plastic strain heterogeneity of a duplex stainless steel has been investigated. Microscale strain heterogeneities were measured by digital image correlation during an in situ tensile test within the SEM. The martensitic transformation was monitored in situ during tensile testing by high-energy synchrotron X-ray diffraction. A clear correlation is shown between the plasticity-induced transformation of austenite to martensite and the development of plastic strain heterogeneities at the phase level.

  17. Characterization of polycrystals with elongated duplex microstructure by inversion of ultrasonic backscattering data

    SciTech Connect

    Lobkis, O. I.; Rokhlin, S. I.

    2010-04-19

    In this letter a simple analytical ultrasonic backscattering model is proposed for determination of characteristic microstructural scales in polycrystalline materials with elongated grains. The inversion methodology for microstructural parameters is based on backscattering coefficient ratios measured in different propagation directions. The ultrasonic backscattering measurements were performed on a Ti alloy sample with a duplex microstructure and the model was applied to experimental data inversion to size the material microtexture.

  18. Imidazolium salt ion pairs in solution.

    PubMed

    Stassen, Hubert K; Ludwig, Ralf; Wulf, Alexander; Dupont, Jairton

    2015-06-01

    The formation, stabilisation and reactivity of contact ion pairs of non-protic imidazolium ionic liquids (ILs) in solution are conceptualized in light of selected experimental evidence as well theoretical calculations reported mainly in the last ten years. Electric conductivity, NMR, ESI-MS and IR data as well as theoretical calculations support not only the formation of contact ion pairs in solution, but also the presence of larger ionic and neutral aggregates even when dissolved in solvents with relatively high dielectric constants, such as acetonitrile and DMSO. The presence of larger imidazolium supramolecular aggregates is favoured at higher salt concentrations in solvents of low dielectric constant for ILs that contain shorter N-alkyl side chains associated with anions of low coordination ability. The stability and reactivity of neutral contact species are also dependent on the nature of the anion, imidazolium substituents, and are more abundant in ILs containing strong coordinating anions, in particular those that can form charge transfer complexes with the imidazolium cation. Finally, some ILs display reactivities as contact ion pairs rather than solvent-separated ions.

  19. Stacking with the unnatural DNA base 6-ethynylpyridone

    NASA Astrophysics Data System (ADS)

    Gibson, Douglas J.; van Mourik, Tanja

    2017-01-01

    It was previously reported that the incorporation of 6-ethynylpyridone (E) into a DNA duplex (replacing T in a T:A base pair) leads to DNA duplexes that are more stable than the T:A-containing duplexes. DFT calculations at the M06-2X/6-31+G(d) and BLYP-D3/6-31+G(d) levels on various base pairs, stacked bases and stacked base pairs in continuum solvation water suggest that the observed increased stability of E:A-containing duplexes is due to the combined effects of stronger base pairing and enhanced stacking of the E:A base pair.

  20. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.