Science.gov

Sample records for pairs duplex stability

  1. DNA as membrane-bound ligand-receptor pairs: duplex stability is tuned by intermembrane forces.

    PubMed

    Beales, Paul A; Vanderlick, T Kyle

    2009-02-18

    We use membrane-anchored DNA as model adhesion receptors between lipid vesicles. By studying the thermal stability of DNA duplex formation, which tethers the vesicles into superstructures, we show that the melting temperature of a 10-base DNA sequence is dependent on the lipid composition of the tethered vesicles. We propose a simple model that describes how the intermembrane interactions tilt the free energy landscape for DNA binding. From our model, we estimate the area per DNA in the binding sites between vesicles and also the total area of the adhesion plaques. We find that vesicles containing a small proportion of cationic lipid that are modified with membrane-anchored DNA can be reversibly tethered by specific DNA interactions and that the DNA also induces a small attraction between these membranes, which stabilizes the DNA duplex. By increasing the equilibrium intermembrane distance on binding, we show that intermembrane interactions become negligible for the binding thermodynamics of the DNA and hence the thermal stability of vesicle aggregates becomes independent of lipid composition at large enough intervesicle separations. We discuss the implications of our findings with regards to cell adhesion and fusion receptors, and the programmable self-assembly of nano-structured materials by DNA hybridization.

  2. DNA duplex stability of the thio-iso-guanine•methyl-iso-Cytosine base pair.

    PubMed

    Lee, Dongkye; Switzer, Christopher

    2015-01-01

    We report the synthesis, incorporation into oligonucleotides, and base-pairing properties of the 2-thio-variant of iso-guanine. Iso-guanine is the purine component of a nonstandard base pair with 5-methyl-iso-cytosine. The 2-thio-iso-guanine • 5-methyl-iso-cytosine base pair is found to have similar stability to an adenine • thymine pair.

  3. Choline ion interactions with DNA atoms explain unique stabilization of A-T base pairs in DNA duplexes: a microscopic view.

    PubMed

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Sugimoto, Naoki

    2014-01-16

    Under physiological conditions, G-C base pairs are more stable than A-T base pairs. In a previous study, we showed that in the hydrated ionic liquid of choline dihydrogen phosphate, the stabilities of these base pairs are reversed. In the present study, we elucidated the unique binding interactions of choline ions with DNA atoms from a microscopic viewpoint using molecular dynamics simulations. Three times more choline ions bind to the DNA duplex than sodium ions. Sodium ions bind closely but not stably; in contrast, the choline ions bind through multiple hydrogen bonding networks with DNA atoms stably. The affinity of choline ion for the minor groove of A-T base pairs is more than 2 times that for other groove areas. In the narrow A-T minor groove, choline ion has high affinity for the ribose atoms of thymine. Choline ions also destabilize the formation of hydrogen bonds between G-C base pairs by binding to base atoms preferentially for both of duplex and single-strand DNA, which are associated with the bonds between G-C base pairs. Our new finding will not only lead to better control of DNA stability for use in DNA nanodevices, but also provide new insight into the stability of DNA duplexes under crowding conditions found in living cells.

  4. Thermodynamic stability and Watson-Crick base pairing in the seed duplex are major determinants of the efficiency of the siRNA-based off-target effect.

    PubMed

    Ui-Tei, Kumiko; Naito, Yuki; Nishi, Kenji; Juni, Aya; Saigo, Kaoru

    2008-12-01

    Short interfering RNA (siRNA) may down-regulate many unintended genes whose transcripts possess complementarity to the siRNA seed region, which contains 7 nt. The capability of siRNA to induce this off-target effect was highly correlated with the calculated melting temperature or standard free-energy change for formation of protein-free seed duplex, indicating that thermodynamic stability of seed duplex formed between the seed and target is one of the major factor in determining the degree of off-target effects. Furthermore, unlike intended gene silencing (RNA interference), off-target effect was completely abolished by introduction of a G:U pair into the seed duplex, and this loss in activity was completely recovered by a second mutation regenerating Watson-Crick pairing, indicating that seed duplex Watson-Crick pairing is also essential for off-target gene silencing. The off-target effect was more sensitive to siRNA concentration compared to intended gene silencing, which requires a near perfect sequence match between the siRNA guide strand and target mRNA.

  5. Micromechanics of base pair unzipping in the DNA duplex.

    PubMed

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov'yov, Andrey V

    2012-01-25

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G·C content and rather distinct for the parts with A·T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork.

  6. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    PubMed Central

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  7. Base pair opening in a deoxynucleotide duplex containing a cis-syn thymine cyclobutane dimer lesion.

    PubMed

    Wenke, Belinda B; Huiting, Leah N; Frankel, Elisa B; Lane, Benjamin F; Núñez, Megan E

    2013-12-23

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair K(op). In the normal duplex K(op) decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a K(op) of 8 × 10⁻⁷. In contrast, base pair opening at the 5'T of the thymine dimer is facile. The 5'T of the dimer has the largest equilibrium constant (K(op) = 3 × 10⁻⁴) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3'T of the dimer is much more stable than by the 5'T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5' side more than on the 3' side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions.

  8. Nearest-neighbor parameters for 7-deaza-adenosine·uridine base pairs in RNA duplexes.

    PubMed

    Richardson, Katherine E; Znosko, Brent M

    2016-06-01

    One of the major limitations in RNA structure prediction is the lack of information about the effect of nonstandard nucleotides on stability. The nonstandard nucleotide 7-deaza-adenosine (7DA) is a naturally occurring analog of adenosine that has been studied for medicinal purposes and is commonly referred to as tubercidin. In 7DA, the nitrogen in the 7 position of adenosine is replaced by a carbon. Differences in RNA duplex stability due to the removal of this nitrogen can be attributed to a possible change in hydration and a difference in base stacking interactions resulting from changes in the electrostatics of the ring. In order to determine how 7DA affects the stability of RNA, optical melting experiments were conducted on RNA duplexes that contain either internal or terminal 7DA·U pairs with all possible nearest-neighbor combinations. On average, duplexes containing 7DA·U pairs are 0.43 and 0.07 kcal/mol less stable than what is predicted for the same duplex containing internal and terminal A-U pairs, respectively. Thermodynamic parameters for all nearest-neighbor combinations of 7DA·U pairs were derived from the data. These parameters can be used to more accurately predict the secondary structure and stability of RNA duplexes containing 7DA·U pairs. © 2016 Richardson and Znosko; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  9. Extraordinary thermal stability of an oligodeoxynucleotide octamer constructed from alternating 7-deaza-7-iodo guanine and 5-Iodocytosine base pairs - DNA duplex stabilization by halogen bonds?

    PubMed

    Ramzaeva, Natalya; Eickmeier, Henning; Rosemeyer, Helmut

    2014-04-01

    A reinvestigation of the published X-ray crystal-structure analyses of 7-halogenated (Br, I) 8-aza-7-deaza-2'-deoxyguanosines Br(7) c(7) z(8) Gd ; 1a and I(7) c(7) z(8) Gd , 1b, as well as of the structurally related 7-deaza-7-iodo-2'-deoxy-β-D-ribofuranosyladenine (β-I(7) c(7) Ad ; 2=6e in Table 1) and its α-D-anomer (α-I(7) c(7) Ad ; 3) clearly revealed the existence of halogen bonds between corresponding halogen substituents and the adjacent N(3)-atoms of neighboring nucleoside molecules within the single crystals. These halogen bonds can be rationalized by the presence of a region of positive electrostatic potential, the σ-hole, on the outermost portion the halogen's surface, while the three unshared pairs of electrons produce a belt of negative electrostatic potential around the central part of the halogen substituent. The N(3) atoms of the halogenated nucleosides carry a partial negative charge. This novel type of bonding between nucleosides was tentatively used to explain the extraordinary high stability of oligodeoxynucleotides constructed from halogenated nucleotide building blocks. Copyright © 2014 Verlag Helvetica Chimica Acta AG, Zürich.

  10. Structural, electronic, and optical properties of metallo base pairs in duplex DNA: a theoretical insight.

    PubMed

    Samanta, Pralok K; Manna, Arun K; Pati, Swapan K

    2012-11-01

    Using density functional theory calculations, we investigated the structural, energetic, electronic, and optical properties of recently synthesized duplex DNA containing metal-mediated base pairs. The studied duplex DNA consists of three imidazole (Im) units linked through metal (Im-M-Im, M = metal) and four flanking A:T base pairs (two on each side). We examined the role of artificial base pairing in the presence of two distinctive metal ions, diamagnetic Ag(+) and magnetic Cu(2+) ions, on the stability of duplex DNA. We found that metal-mediated base pairs form stable duplex DNA by direct metal ion coordination to the Im bases. Our results suggest a higher binding stability of base pairing mediated by Cu(2+) ions than by Ag(+) ions, which is attributed to a larger extent of orbital hybridization. We furthermore found that DNA modified with Im-Ag(+)-Im shows the low-energy optical absorption characteristic of π-π*orbital transition of WC A:T base pairs. On the other hand, we found that the low-energy optical absorption peaks for DNA modified with Im-Cu(2+)-Im originate from spin-spin interactions. Additionally, this complex exhibits weak ferromagnetic coupling between Cu(2+) ions and strong spin polarization, which could be used for memory devices. Moreover, analyzing the role of counter ions (Na(+)) and the presence of explicit water molecules on the structural stability and electronic properties of the DNA duplex modified with Im-Ag(+)-Im, we found that the impact of these two factors is negligible. Our results are fruitful for understanding the experimental data and suggest a potential route for constructing effective metal-mediated base pairs in duplex DNA for optoelectronic applications.

  11. Sequence Recognition in the Pairing of DNA Duplexes

    NASA Astrophysics Data System (ADS)

    Kornyshev, A. A.; Leikin, S.

    2001-04-01

    Pairing of DNA fragments with homologous sequences occurs in gene shuffling, DNA repair, and other vital processes. While chemical individuality of base pairs is hidden inside the double helix, x ray and NMR revealed sequence-dependent modulation of the structure of DNA backbone. Here we show that the resulting modulation of the DNA surface charge pattern enables duplexes longer than ~50 base pairs to recognize sequence homology electrostatically at a distance of up to several water layers. This may explain the local recognition observed in pairing of homologous chromosomes and the observed length dependence of homologous recombination.

  12. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  13. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  14. Nucleic Acid Duplexes Incorporating a Dissociable Covalent Base Pair

    NASA Astrophysics Data System (ADS)

    Gao, Kui; Orgel, Leslie E.

    1999-12-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  15. Crystal structure studies of RNA duplexes containing s(2)U:A and s(2)U:U base pairs.

    PubMed

    Sheng, Jia; Larsen, Aaron; Heuberger, Benjamin D; Blain, J Craig; Szostak, Jack W

    2014-10-01

    Structural studies of modified nucleobases in RNA duplexes are critical for developing a full understanding of the stability and specificity of RNA base pairing. 2-Thio-uridine (s(2)U) is a modified nucleobase found in certain tRNAs. Thermodynamic studies have evaluated the effects of s(2)U on base pairing in RNA, where it has been shown to stabilize U:A pairs and destabilize U:G wobble pairs. Surprisingly, no high-resolution crystal structures of s(2)U-containing RNA duplexes have yet been reported. We present here two high-resolution crystal structures of heptamer RNA duplexes (5'-uagcs(2)Ucc-3' paired with 3'-aucgAgg-5' and with 3'-aucgUgg-5') containing s(2)U:A and s(2)U:U pairs, respectively. For comparison, we also present the structures of their native counterparts solved under identical conditions. We found that replacing O2 with S2 stabilizes the U:A base pair without any detectable structural perturbation. In contrast, an s(2)U:U base pair is strongly stabilized in one specific U:U pairing conformation out of four observed for the native U:U base pair. This s(2)U:U stabilization appears to be due at least in part to an unexpected sulfur-mediated hydrogen bond. This work provides additional insights into the effects of 2-thio-uridine on RNA base pairing.

  16. Influence of two bulge loops on the stability of RNA duplexes.

    PubMed

    Crowther, Claire V; Jones, Laura E; Morelli, Jessica N; Mastrogiacomo, Eric M; Porterfield, Claire; Kent, Jessica L; Serra, Martin J

    2017-02-01

    Fifty-three RNA duplexes containing two single nucleotide bulge loops were optically melted in 1 M NaCl in order to determine the thermodynamic parameters ΔH°, ΔS°, ΔG°37, and TM for each duplex. Because of the large number of possible combinations and lack of sequence effects observed previously, we limited our initial investigation to adenosine bulges, the most common naturally occurring bulge. For example, the following duplexes were investigated: 5'GGCAXYAGGC/3'CCG YX CCG, 5'GGCAXY GCC/3'CCG YXACGG, and 5'GGC XYAGCC/3'CCGAYX CGG. The identity of XY (where XY are Watson-Crick base pairs) and the total number of base pairs in the terminal and central stems were varied. As observed for duplexes with a single bulge loop, the effect of the two bulge loops on duplex stability is primarily influenced by non-nearest neighbor interactions. In particular, the stability of the stems influences the destabilization of the duplex by the inserted bulge loops. The model proposed to predict the influence of multiple bulge loops on duplex stability suggests that the destabilization of each bulge is related to the stability of the adjacent stems. A database of RNA secondary structures was examined to determine the naturally occurring abundance of duplexes containing multiple bulge loops. Of the 2000 examples found in the database, over 65% of the two bulge loops occur within 3 base pairs of each other. A database of RNA three-dimensional structures was examined to determine the structure of duplexes containing two single nucleotide bulge loops. The structures of the bulge loops are described.

  17. Additional base-pair formation in DNA duplexes by a double-headed nucleotide.

    PubMed

    Madsen, Charlotte S; Witzke, Sarah; Kumar, Pawan; Negi, Kushuma; Sharma, Pawan K; Petersen, Michael; Nielsen, Poul

    2012-06-11

    We have designed and synthesised a double-headed nucleotide that presents two nucleobases in the interior of a dsDNA duplex. This nucleotide recognises and forms Watson-Crick base pairs with two complementary adenosines in a Watson-Crick framework. Furthermore, with judicious positioning in complementary strands, the nucleotide recognises itself through the formation of a T:T base pair. Thus, two novel nucleic acid motifs can be defined by using our double-headed nucleotide. Both motifs were characterised by UV melting experiments, CD and NMR spectroscopy and molecular dynamics simulations. Both motifs leave the thermostability of the native dsDNA duplex largely unaltered. Molecular dynamics calculations showed that the double-headed nucleotides are accommodated in the dsDNA by entirely local perturbations and that the modified duplexes retain an overall B-type geometry with the dsDNA unwound by around 25 or 60°, respectively, in each of the modified motifs. Both motifs can be accommodated twice in a dsDNA duplex without incurring any loss of stability and extrapolating from this observation and the results of modelling, it is conceivable that both can be multiplied several times within a dsDNA duplex. These new motifs extend the DNA recognition repertoire and may form the basis for a complete series of double-headed nucleotides based on all 16 base combinations of the four natural nucleobases. In addition, both motifs can be used in the design of nanoscale DNA structures in which a specific duplex twist is required.

  18. Formation of sheared G:A base pairs in an RNA duplex modelled after ribozymes, as revealed by NMR.

    PubMed Central

    Katahira, M; Kanagawa, M; Sato, H; Uesugi, S; Fujii, S; Kohno, T; Maeda, T

    1994-01-01

    The thermal stability and structure of an RNA duplex, r(GGACGAGUCC)2, the base sequence of which was modelled after both a hammerhead ribozyme and a lead ribozyme, were studied by CD and NMR. We previously demonstrated that the corresponding DNA duplex, d(GGACGAGTCC)2, formed unique 'sheared' G:A base pairs, where an amino proton, instead of an imino proton, of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head' (Nucleic Acids Res. (1993) 21, 5418-5424). CD melting profiles showed that the RNA duplex is thermally more stable than the corresponding DNA duplex. NMR studies revealed that sheared G:A base pairs are formed in the RNA duplex, too, although the overall structure of the RNA is the A form, which differs from the B form taken on by the corresponding DNA. A model building study confirmed that sheared G:A base pairs can be accommodated in the double helical structure of the A form. A difference between the RNA and DNA duplexes in the stacking interaction involving G:A mismatch bases is also suggested. The demonstration that sheared G:A base pairs can be formed not only in DNA but also in RNA suggests that this base pairing plays an important role regarding the RNA structure. PMID:7519767

  19. Formation of sheared G:A base pairs in an RNA duplex modelled after ribozymes, as revealed by NMR.

    PubMed

    Katahira, M; Kanagawa, M; Sato, H; Uesugi, S; Fujii, S; Kohno, T; Maeda, T

    1994-07-25

    The thermal stability and structure of an RNA duplex, r(GGACGAGUCC)2, the base sequence of which was modelled after both a hammerhead ribozyme and a lead ribozyme, were studied by CD and NMR. We previously demonstrated that the corresponding DNA duplex, d(GGACGAGTCC)2, formed unique 'sheared' G:A base pairs, where an amino proton, instead of an imino proton, of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head' (Nucleic Acids Res. (1993) 21, 5418-5424). CD melting profiles showed that the RNA duplex is thermally more stable than the corresponding DNA duplex. NMR studies revealed that sheared G:A base pairs are formed in the RNA duplex, too, although the overall structure of the RNA is the A form, which differs from the B form taken on by the corresponding DNA. A model building study confirmed that sheared G:A base pairs can be accommodated in the double helical structure of the A form. A difference between the RNA and DNA duplexes in the stacking interaction involving G:A mismatch bases is also suggested. The demonstration that sheared G:A base pairs can be formed not only in DNA but also in RNA suggests that this base pairing plays an important role regarding the RNA structure.

  20. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    PubMed Central

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  1. NMR and molecular modeling evidence for a Gter dot A mismatch base pair in a purine-rich DNA duplex

    SciTech Connect

    Li, Ying; Wilson, W.D. ); Zon, G. )

    1991-01-01

    {sup 1}H NMR experiments indicate that the oligomer 5{prime}-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G{center dot}A base pairs and a 3{prime} unpaired adenosine. NMR results indicate that guanoxine imino protons of the F{center dot}A mismatches are not hydrogen bonded but are stacked in the helix. A G{r arrow} I substitution in either G{center dot}A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1{prime} of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G{center dot}A base pairs containing A-NH{sub 2} to GN3 and G-NH{sub 2} to AN7 hydrogen bonds and B-form base pairs on both sides of the G{center dot}A pairs (5{prime}-d(ATGAGC)). The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH{sub 2} of the mismatch to a phosphate oxygen is predicted.

  2. Effects of N[superscript 2],N[superscript 2]-dimethylguanosine on RNA structure and stability: Crystal structure of an RNA duplex with tandem m[superscript 2 subscript 2]G:A pairs

    SciTech Connect

    Pallan, Pradeep S.; Kreutz, Christoph; Bosio, Silvia; Micura, Ronald; Egli, Martin

    2008-12-15

    Methylation of the exocyclic amino group of guanine is a relatively common modification in rRNA and tRNA. Single methylation (N(2)-methylguanosine, m(2)G) is the second most frequently encountered nucleoside analog in Escherichia coli rRNAs. The most prominent case of dual methylation (N(2),N(2)-dimethylguanosine, m(2) (2)G) is found in the majority of eukaryotic tRNAs at base pair m(2) (2)G26:A44. The latter modification eliminates the ability of the N(2) function to donate in hydrogen bonds and alters its pairing behavior, notably vis-a-vis C. Perhaps a less obvious consequence of the N(2),N(2)-dimethyl modification is its role in controlling the pairing modes between G and A. We have determined the crystal structure of a 13-mer RNA duplex with central tandem m(2) (2)G:A pairs. In the structure both pairs adopt an imino-hydrogen bonded, pseudo-Watson-Crick conformation. Thus, the sheared conformation frequently seen in tandem G:A pairs is avoided due to a potential steric clash between an N(2)-methyl group and the major groove edge of A. Additionally, for a series of G:A containing self-complementary RNAs we investigated how methylation affects competitive hairpin versus duplex formation based on UV melting profile analysis.

  3. 6-Pyrazolylpurine as an Artificial Nucleobase for Metal-Mediated Base Pairing in DNA Duplexes

    PubMed Central

    Léon, J. Christian; Sinha, Indranil; Müller, Jens

    2016-01-01

    The artificial nucleobase 6-pyrazol-1-yl-purine (6PP) has been investigated with respect to its usability in metal-mediated base pairing. As was shown by temperature-dependent UV spectroscopy, 6PP may form weakly stabilizing 6PP–Ag(I)–6PP homo base pairs. Interestingly, 6PP can be used to selectively recognize a complementary pyrimidine nucleobase. The addition of Ag(I) to a DNA duplex comprising a central 6PP:C mispair (C = cytosine) leads to a slight destabilization of the duplex. In contrast, a stabilizing 6PP–Ag(I)–T base pair is formed with a complementary thymine (T) residue. It is interesting to note that 6PP is capable of differentiating between the pyrimidine moieties despite the fact that it is not as sterically crowded as 6-(3,5-dimethylpyrazol-1-yl)purine, an artificial nucleobase that had previously been suggested for the recognition of nucleic acid sequences via the formation of a metal-mediated base pair. Hence, the additional methyl groups of 6-(3,5-dimethylpyrazol-1-yl)purine may not be required for the specific recognition of the complementary nucleobase. PMID:27089326

  4. A pyrimidopyrimidine Janus-AT nucleoside with improved base-pairing properties to both A and T within a DNA duplex: the stabilizing effect of a second endocyclic ring nitrogen.

    PubMed

    Largy, Eric; Liu, Wenbo; Hasan, Abid; Perrin, David M

    2014-02-03

    Janus bases are heterocyclic nucleic acid base analogs that present two different faces able to simultaneously hydrogen bond to nucleosides that form Watson-Crick base pairs. The synthesis of a Janus-AT nucleotide analogue, (N)JAT , that has an additional endocyclic ring nitrogen and is thus more capable of efficiently discriminating T/A over G/C bases when base-pairing in a standard duplex-DNA context is described. Conversion to a phosphoramidite ultimately afforded incorporation into an oligonucleotide. In contrast to the first generation of carbocyclic Janus heterocycles, it remains in its unprotonated state at physiological pH and, therefore, forms very stable Watson-Crick base pairs with either A or T bases. Biophysical and computational methods indicate that (N)JAT is an improved candidate for sequence-specific genome targeting.

  5. Effect of Radiofrequency Radiation on DNA Duplex Stability and Replication.

    DTIC Science & Technology

    1983-08-01

    CHART NATIONAL BUREAU OF STANDARDS-1963-A Report USAFSAM-TR. 83-20 *--EFFECT OF RADIOFREQUENCY RADIATION ON DNA K’*DUPLEX STABILITY AND REPLICATION ...photons affect the stability and/or replication of mammalian DNA . Two of the approaches involved experiments with female CD-l mice, including...analyses of RF effects on sister chromatid exchanges (SCE) in bone marrow as one index of DNA stability and RF effects on replication of the animals’ marrow

  6. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    PubMed

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials.

  7. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes.

    PubMed

    Sochacka, Elzbieta; Szczepanowski, Roman H; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-03-11

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon-anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3'-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif.

  8. Stability of DNA duplexes containing GG, CC, AA, and TT mismatches.

    PubMed

    Tikhomirova, Anna; Beletskaya, Irina V; Chalikian, Tigran V

    2006-09-05

    We employed salt-dependent differential scanning calorimetric measurements to characterize the stability of six oligomeric DNA duplexes (5'-GCCGGAXTGCCGG-3'/5'-CCGGCAYTCCGGC-3') that contain in the central XY position the GC, AT, GG, CC, AA, or TT base pair. The heat-induced helix-to-coil transitions of all the duplexes are associated with positive changes in heat capacity, DeltaC(p), ranging from 0.43 to 0.53 kcal/mol. Positive values of DeltaC(p) result in strong temperature dependences of changes in enthalpy, DeltaH degrees, and entropy, DeltaS degrees , accompanying duplex melting and cause melting free energies, DeltaG degrees, to exhibit characteristically curved shapes. These observations suggest that DeltaC(p) needs to be carefully taken into account when the parameters of duplex stability are extrapolated to temperatures distant from the transition temperature, T(M). Comparison of the calorimetric and van't Hoff enthalpies revealed that none of the duplexes studied in this work exhibits two-state melting. Within the context of the central AXT/TYA triplet, the thermal and thermodynamic stabilities of the duplexes in question change in the following order: GC > AT > GG > AA approximately TT > CC. Our estimates revealed that the thermodynamic impact of the GG, AA, and TT mismatches is confined within the central triplet. In contrast, the thermodynamic impact of the CC mismatch propagates into the adjacent helix domains and may involve 7-9 bp. We discuss implications of our results for understanding the origins of initial recognition of mismatched DNA sites by enzymes of the DNA repair machinery.

  9. Stability and Mismatch Discrimination of Locked Nucleic Acid–DNA Duplexes

    PubMed Central

    2011-01-01

    Locked nucleic acids (LNA; symbols of bases, +A, +C, +G, and +T) are introduced into chemically synthesized oligonucleotides to increase duplex stability and specificity. To understand these effects, we have determined thermodynamic parameters of consecutive LNA nucleotides. We present guidelines for the design of LNA oligonucleotides and introduce free online software that predicts the stability of any LNA duplex oligomer. Thermodynamic analysis shows that the single strand–duplex transition is characterized by a favorable enthalpic change and by an unfavorable loss of entropy. A single LNA modification confines the local conformation of nucleotides, causing a smaller, less unfavorable entropic loss when the single strand is restricted to the rigid duplex structure. Additional LNAs adjacent to the initial modification appear to enhance stacking and H-bonding interactions because they increase the enthalpic contributions to duplex stabilization. New nearest-neighbor parameters correctly forecast the positive and negative effects of LNAs on mismatch discrimination. Specificity is enhanced in a majority of sequences and is dependent on mismatch type and adjacent base pairs; the largest discriminatory boost occurs for the central +C·C mismatch within the +T+C+C sequence and the +A·G mismatch within the +T+A+G sequence. LNAs do not affect specificity in some sequences and even impair it for many +G·T and +C·A mismatches. The level of mismatch discrimination decreases the most for the central +G·T mismatch within the +G+G+C sequence and the +C·A mismatch within the +G+C+G sequence. We hypothesize that these discrimination changes are not unique features of LNAs but originate from the shift of the duplex conformation from B-form to A-form. PMID:21928795

  10. Thermodynamics and kinetics for base pair opening in the DNA decamer duplexes containing cyclobutane pyrimidine dimer.

    PubMed

    Bang, Jongchul; Kang, Young-Min; Park, Chin-Ju; Lee, Joon-Hwa; Choi, Byong-Seok

    2009-06-18

    The cyclobutane pyrimidine dimer (CPD) is one of the major classes of cytotoxic and carcinogenic DNA photoproducts induced by UV light. Hydrogen exchange rates of the imino protons were measured for various CPD-containing DNA duplexes to better understand the mechanism for CPD recognition by XPC-hHR23B. The results here revealed that double T.G mismatches in a CPD lesion significantly destabilized six consecutive base pairs compared to other DNA duplexes. This flexibility in a DNA duplex caused at the CPD lesions with double T.G mismatches might be the key factor for damage recognition by XPC-hHR23B.

  11. Deformability Calculation for Estimation of the Relative Stability of Chemically Modified RNA Duplexes.

    PubMed

    Masaki, Yoshiaki; Sekine, Mitsuo; Seio, Kohji

    2017-03-02

    Chemical modification of RNA duplexes alters their stability. We have attempted to develop a computational approach to estimate the thermal stability of chemically modified duplexes. These studies revealed that the deformability of chemically modified RNA duplexes, calculated from molecular dynamics simulations, could be used as a good indicator for estimating the effect of chemical modification on duplex thermal stability. This unit describes how deformability calculation can be applied to estimate the relative stability of chemically modified RNA duplexes. © 2017 by John Wiley & Sons, Inc.

  12. Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

    PubMed Central

    Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

    2013-01-01

    Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

  13. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  14. Hammerhead ribozyme activity and oligonucleotide duplex stability in mixed solutions of water and organic compounds

    PubMed Central

    Nakano, Shu-ichi; Kitagawa, Yuichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2014-01-01

    Nucleic acids are useful for biomedical targeting and sensing applications in which the molecular environment is different from that of a dilute aqueous solution. In this study, the influence of various types of mixed solutions of water and water-soluble organic compounds on RNA was investigated by measuring the catalytic activity of the hammerhead ribozyme and the thermodynamic stability of an oligonucleotide duplex. The compounds with a net neutral charge, such as poly(ethylene glycol), small primary alcohols, amide compounds, and aprotic solvent molecules, added at high concentrations changed the ribozyme-catalyzed RNA cleavage rate, with the magnitude of the effect dependent on the NaCl concentration. These compounds also changed the thermodynamic stability of RNA base pairs of an oligonucleotide duplex and its dependence on the NaCl concentration. Specific interactions with RNA molecules and reduced water activity could account for the inhibiting effects on the ribozyme catalysis and destabilizing effects on the duplex stability. The salt concentration dependence data correlated with the dielectric constant, but not with water activity, viscosity, and the size of organic compounds. This observation suggests the significance of the dielectric constant effects on the RNA reactions under molecular crowding conditions created by organic compounds. PMID:25161873

  15. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

    PubMed Central

    Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-01-01

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

  16. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    SciTech Connect

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J. )

    1989-05-01

    The bisintercalation complex present between the DNA octamer (d(ACGTACGT)){sub 2} and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C{center dot}G and A{center dot}T base pairs. At low temperatures, the A{center dot}T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A{center dot}T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45{degree}C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed.

  17. New insights into Hoogsteen base pairs in DNA duplexes from a structure-based survey

    PubMed Central

    Zhou, Huiqing; Hintze, Bradley J.; Kimsey, Isaac J.; Sathyamoorthy, Bharathwaj; Yang, Shan; Richardson, Jane S.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen (HG) base pairs (bps) provide an alternative pairing geometry to Watson–Crick (WC) bps and can play unique functional roles in duplex DNA. Here, we use structural features unique to HG bps (syn purine base, HG hydrogen bonds and constricted C1′–C1′ distance across the bp) to search for HG bps in X-ray structures of DNA duplexes in the Protein Data Bank. The survey identifies 106 A•T and 34 G•C HG bps in DNA duplexes, many of which are undocumented in the literature. It also uncovers HG-like bps with syn purines lacking HG hydrogen bonds or constricted C1′–C1′ distances that are analogous to conformations that have been proposed to populate the WC-to-HG transition pathway. The survey reveals HG preferences similar to those observed for transient HG bps in solution by nuclear magnetic resonance, including stronger preferences for A•T versus G•C bps, TA versus GG steps, and also suggests enrichment at terminal ends with a preference for 5′-purine. HG bps induce small local perturbations in neighboring bps and, surprisingly, a small but significant degree of DNA bending (∼14°) directed toward the major groove. The survey provides insights into the preferences and structural consequences of HG bps in duplex DNA. PMID:25813047

  18. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    PubMed

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences.

  19. Effect of Base-Pairing Partner on the Thermodynamic Stability of the Diastereomeric Spiroiminodihydantoin Lesion.

    PubMed

    Gruessner, Brian; Dwarakanath, Megana; Stewart, Elizabeth; Bae, Yoon; Jamieson, Elizabeth R

    2016-03-21

    Oxidation of guanine by reactive oxygen species and high valent metals produces damaging DNA base lesions like 8-oxo-7,8-dihydroguanine (8-oxoG). 8-oxoG can be further oxidized to form the spiroiminodihydantoin (Sp) lesion, which is even more mutagenic. DNA polymerases preferentially incorporate purines opposite the Sp lesion, and DNA glycosylases excise the Sp lesion from the duplex, although the rate of repair is different for the two Sp diastereomers. To further understand the biological processing of the Sp lesion, differential scanning calorimetry studies were performed on a series of 15-mer DNA duplexes. The thermal and thermodynamic stabilities of each of the Sp diastereomers paired to the four standard DNA bases were investigated. It was found that, regardless of the base-pairing partner, the Sp lesion was always highly destabilizing in terms of DNA melting temperature, enthalpic stability, and overall duplex free energy. We found no significant differences between the two Sp diastereomers, but changing the base-pairing partner of the Sp lesion produced slight differences in stability. Specifically, duplexes with Sp:C pairings were always the most destabilized, whereas pairing the Sp lesion with a purine base modestly increased stability. Overall, these results suggest that, although the stability of the Sp diastereomers cannot explain the differences in the rates of repair by DNA glycosylases, the most stable base-pairing partners do correspond with the nucleotide preference of DNA polymerases.

  20. NMR structure of duplex DNA containing the alpha-OH-PdG.dA base pair: a mutagenic intermediate of acrolein.

    PubMed

    Zaliznyak, Tanya; Lukin, Mark; El-khateeb, Mahmoud; Bonala, Rahda; Johnson, Francis; de los Santos, Carlos

    2010-04-01

    Acrolein, a cell metabolic product and main component of cigarette smoke, reacts with DNA generating alpha-OH-PdG lesions, which have the ability to pair with dATP during replication thereby causing G to T transversions. We describe the solution structure of an 11-mer DNA duplex containing the mutagenic alpha-OH-PdG.dA base pair intermediate, as determined by solution nuclear magnetic resonance (NMR) spectroscopy and retrained molecular dynamics (MD) simulations. The NMR data support a mostly regular right-handed helix that is only perturbed at its center by the presence of the lesion. Undamaged residues of the duplex are in anti orientation, forming standard Watson-Crick base pairs alignments. Duplication of proton signals at and near the damaged base pair reveals the presence of two enantiomeric duplexes, thus establishing the exocyclic nature of the lesion. The alpha-OH-PdG adduct assumes a syn conformation pairing to its partner dA base that is protonated at pH 6.6. The three-dimensional structure obtained by restrained molecular dynamics simulations show hydrogen bond interactions that stabilize alpha-OH-PdG in a syn conformation and across the lesion containing base pair. We discuss the implications of the structures for the mutagenic bypass of acrolein lesions.

  1. Understanding the role of base stacking in nucleic acids. MD and QM analysis of tandem GA base pairs in RNA duplexes.

    PubMed

    Morgado, Claudio A; Svozil, Daniel; Turner, Douglas H; Šponer, Jiří

    2012-09-28

    Preceding NMR experiments show that the conformation of tandem GA base pairs, an important recurrent non-canonical building block in RNA duplexes, is context dependent. The GA base pairs adopt "sheared" N3(G)-N6(A), N2(G)-N7(A) geometry in the r(CGAG)(2) and r(iGGAiC)(2) contexts while switching to "imino" N1(G)-N1(A), O6(G)-N6(A) geometry in the r(GGAC)(2) and r(iCGAiG)(2) contexts (iC and iG stand for isocytosine and isoguanine, respectively). As base stacking is likely to be one of the key sources of the context dependence of the conformation of GA base pairs, we calculated base stacking energies in duplexes containing such base pairs, to see if this dependence can be predicted by stacking energy calculations. When investigating the context dependence of the GA geometry two different conformations of the same duplex were compared (imino vs. sheared). The geometries were generated via explicit solvent MD simulations of the respective RNA duplexes, while the subsequent QM energy calculations focused on base stacking interactions of the four internal base pairs. Geometrical relaxation of nucleobase atoms prior to the stacking energy computations has a non-negligible effect on the results. The stacking energies were derived at the DFT-D/6-311++G(3df,3pd) level. We show a rather good correspondence between the intrinsic gas-phase stacking energies and the NMR-determined GA geometries. The conformation with more favorable gas-phase stacking is in most cases the one observed in experiments. This correlation is not improved when including solvent effects via the COSMO method. On the other side, the stacking calculations do not predict the relative thermodynamic stability of duplex formation for different sequences.

  2. Base pair opening kinetics study of the aegPNA:DNA hydrid duplex containing a site-specific GNA-like chiral PNA monomer.

    PubMed

    Seo, Yeo-Jin; Lim, Jisoo; Lee, Eun-Hae; Ok, Taedong; Yoon, Juyoung; Lee, Joon-Hwa; Lee, Hee-Seung

    2011-09-01

    Peptide nucleic acids (PNA) are one of the most widely used synthetic DNA mimics where the four bases are attached to a N-(2-aminoethyl)glycine (aeg) backbone instead of the negative-charged phosphate backbone in DNA. We have developed a chimeric PNA (chiPNA), in which a chiral GNA-like γ(3)T monomer is incorporated into aegPNA backbone. The base pair opening kinetics of the aegPNA:DNA and chiPNA:DNA hybrid duplexes were studied by NMR hydrogen exchange experiments. This study revealed that the aegPNA:DNA hybrid is much more stable duplex and is less dynamic compared to DNA duplex, meaning that base pairs are opened and reclosed much more slowly. The site-specific incorporation of γ(3)T monomer in the aegPNA:DNA hybrid can destabilize a specific base pair and its neighbors, maintaining the thermal stabilities and dynamic properties of other base pairs. Our hydrogen exchange study firstly revealed the unique kinetic features of base pairs in the aegPNA:DNA and chiPNA:DNA hybrids, which will provide an insight into the development of methodology for specific DNA recognition using PNA fragments.

  3. Intercalating nucleic acids: the influence of linker length and intercalator type on their duplex stabilities.

    PubMed

    Christensen, Ulf B; Wamberg, Michael; El-Essawy, Farag A G; Ismail, Abd El-Hamid; Nielsen, Christina B; Filichev, Vyacheslav V; Jessen, Carsten H; Petersen, Michael; Pedersen, Erik B

    2004-01-01

    Six new examples of intercalating nucleic acids were synthesized in order to evaluate the dependence of the length of the linker between oligo and intercalator on the thermal stability of their corresponding duplexes and triplexes.

  4. Use of duplex rigidity for stability and specificity in RNA tertiary structure.

    PubMed

    Narlikar, G J; Bartley, L E; Herschlag, D

    2000-05-23

    The Tetrahymena group I ribozyme's oligonucleotide substrate, CCCUCUA(5), forms six base pairs with the ribozyme's internal guide sequence (IGS, 5'GGAGGG) to give the P1 duplex, and this duplex then docks into the active site via tertiary interactions. Shortening the substrate by three residues to give UCUA(5) reduces the equilibrium constant for P1 docking by approximately 200-fold even though UCUA(5) retains all the functional groups known to be involved in tertiary interactions [Narlikar, G. J., Bartley, L. E., Khosla, M., and Herschlag, D. (1999) Biochemistry 38, 14192-14204]. Here we show that the P1 duplex formed with UCUA(5) engages in all of the major tertiary interactions made by the standard P1 duplex. This suggests that the destabilization is not due to disruption of specific tertiary interactions. It therefore appears that the weaker docking of UCUA(5) arises from the increased conformational freedom of the undocked P1 duplex, which has three unpaired IGS residues and thus a larger entropic cost for docking. Further, a 2'-methoxy substitution at an IGS residue that is base-paired in the standard P1 duplex with CCCUCUA(5) but unpaired in the P1 duplex with UCUA(5) destabilizes docking of the standard P1 duplex approximately 300-fold more than it destabilizes docking of the P1 duplex formed with UCUA(5). These results suggest that fixation of groups in the context of a rigid duplex may be a general strategy used by RNA to substantially increase interaction specificity, both by aiding binding of the desired functional groups and by increasing the energetic cost of forming alternative interactions.

  5. Molecular dynamics simulation reveals conformational switching of water-mediated uracil-cytosine base-pairs in an RNA duplex.

    PubMed

    Schneider, C; Brandl, M; Sühnel, J

    2001-01-26

    A 4 ns molecular dynamics simulation of an RNA duplex (r-GGACUUCGGUCC)(2 )in solution with Na+ and Cl- as counterions was performed. The X-ray structure of this duplex includes two water-mediated uracil-cytosine pairs. In contrast to the other base-pairs in the duplex the water-mediated pairs switch between different conformations. One conformation corresponds to the geometry of the water-mediated UC pairs in the duplex X-ray structure with water acting both as hydrogen-bond donor and acceptor. Another conformation is close to that of a water-mediated UC base-pair found in the X-ray structure of the 23 S rRNA sarcin/ricin domain. In this case the oxygen of the water molecule is linked to two-base donor sites. For a very short time also a direct UC base-pair and a further conformation that is similar to the one found in the RNA duplex structure but exhibits an increased H3(U)...N3(C) distance is observed. Water molecules with unusually long residence times are involved in the water-mediated conformations. These results indicate that the dynamic behaviour of the water-mediated UC base-pairs differs from that of the duplex Watson-Crick and non-canonical guanine-uracil pairs with two or three direct hydrogen bonds. The conformational variability and increased flexibility has to be taken into account when considering these base-pairs as RNA building blocks and as recognition motifs. Copyright 2001 Academic Press.

  6. Thermal stability and energetics of 15-mer DNA duplex interstrand crosslinked by trans-diamminedichloroplatinum(II).

    PubMed

    Hofr, Ctirad; Brabec, Viktor

    2005-03-01

    The effect of the location of the interstrand cross-link formed by trans-diamminedichloroplatinum(II) (transplatin) on the thermal stability and energetics of 15-mer DNA duplex has been investigated. The duplex containing single, site-specific cross-link, thermodynamically equivalent model structures (hairpins) and nonmodified duplexes were characterized by differential scanning calorimetry, temperature-dependent uv absorption, and circular dichroism. The results demonstrate that the formation of the interstrand cross-link of transplatin does not affect pronouncedly thermodynamic stability of DNA: the cross-link induces no marked changes not only in enthalpy, but also in "reduced" (concentration independent) monomolecular transition entropy. These results are consistent with the previous observations that interstrand cross-links of transplatin structurally perturb DNA only to a relatively small extent. On the other hand, constraining the duplex with the interstrand cross-link of transplatin results in a significant increase in thermal stability that is primarily due to entropic effects: the cross-link reduces the molecularity of the oligomer system from bimolecular to monomolecular. Importantly, the position of the interstrand cross-link within the duplex modulates cooperativity of the melting transition of the duplex and consequently its thermal stability.

  7. Calorimetric and Spectroscopic Analysis of the Thermal Stability of Short Duplex DNA-Containing Sugar and Base-Modified Nucleotides.

    PubMed

    Fakhfakh, Kareem; Hughesman, Curtis B; Louise Creagh, A; Kao, Vincent; Haynes, Charles

    2016-01-01

    Base- and sugar-modified analogs of DNA and RNA are finding ever expanding use in medicine and biotechnology as tools to better tailor structured oligonucleotides by altering their thermal stability, nuclease resistance, base-pairing specificity, antisense activity, or cellular uptake. Proper deployment of these chemical modifications generally requires knowledge of how each affects base-pairing properties and thermal stabilities. Here, we describe in detail how differential scanning calorimetry and UV spectroscopy may be used to quantify the melting thermodynamics of short dsDNA containing chemically modified nucleosides in one or both strands. Insights are provided into why and how the presence of highly stable base pairs containing modified nucleosides can alter the nature of calorimetry or melting spectroscopy data, and how each experiment must therefore be conducted to ensure high-quality melting thermodynamics data are obtained. Strengths and weaknesses of the two methods when applied to chemically modified duplexes are also addressed.

  8. Influence of the absolute configuration of npe-caged cytosine on DNA single base pair stability.

    PubMed

    Steinert, Hannah S; Schäfer, Florian; Jonker, Hendrik R A; Heckel, Alexander; Schwalbe, Harald

    2014-01-20

    Photolabile protecting groups are a versatile tool to trigger reactions by light irradiation. In this study, we have investigated the influence of the absolute configuration of the 1-(2-nitrophenyl)ethyl (NPE) cage group on a 15-base-pair duplex DNA. Using UV melting, we determined the global stability of the unmodified and the selectively (S)- and (R)-NPE-modified DNA sequences, respectively. We observe a differently destabilizing effect for the two NPE stereoisomers on the global stability. Analysis of the temperature dependence of imino proton exchange rates measured by NMR spectroscopy reveals that this effect can be attributed to decreased base pair stabilities of the caged and the 3'-neighbouring base pair, respectively. Furthermore, our NMR based structural models of the modified duplexes provide a structural basis for the distinct effect of the (S)- and the (R)-NPE group. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Effect of Methyl Group on Acyclic Serinol Scaffold for Tethering Dyes on the DNA Duplex Stability.

    PubMed

    Murayama, Keiji; Asanuma, Hiroyuki

    2017-01-03

    Acyclic serinol derivatives are useful scaffolds for tethering dyes within DNA duplexes. Here we synthesised an inverse l-threoninol (il-threoninol) scaffold and compared its effect on DNA duplex stability to other acyclic artificial nucleic acid scaffolds that are based on d-threoninol, l-threoninol, and serinol. When planar trans-azobenzene was incorporated into the DNA duplex through a single bulge-like motif (the wedge), the il-threoninol scaffold stabilised the duplex most efficiently. When scaffolds were incorporated in complementary positions (dimer motif) or in three adjacent positions (cluster motif), d-threoninol was the most stabilising. CD spectra indicated that the effect of scaffold on the duplex stability was closely related to the winding induced by each scaffold. When trans-azobenzene was photo-isomerised to non-planar cis-azobenzene, il-threoninol destabilised the duplex most strongly, irrespective of the number of artificial residues incorporated. The properties of the il-threoninol scaffold make it a useful tether for dyes or other functionalities. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Gwinn, Elisabeth G.

    2016-04-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson-Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag+, as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag+-DNA nanostructures. Our studies of Ag+-induced assembly of non-complementary DNA oligomers employ strands of 2-24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag+ can be achieved by optimizing solution conditions. These Ag+-mediated duplexes are stable to at least 60 mM Mg2+, higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag+-mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag+-mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’.

  11. The ups and downs of nucleic acid duplex stability: structure-stability studies on chemically-modified DNA:RNA duplexes.

    PubMed Central

    Freier, S M; Altmann, K H

    1997-01-01

    In an effort to discover novel oligonucleotide modifications for antisense therapeutics, we have prepared oligodeoxyribonucleotides containing more than 200 different modifications and measured their affinities for complementary RNA. These include modifications to the heterocyclic bases, the deoxy-ribose sugar and the phosphodiester linkage. From these results, we have been able to determine structure-activity relationships that correlate hybridization affinity with changes in oligonucleotide structure. Data for oligonucleotides containing modified pyrimidine nucleotides are presented. In general, modifications that resulted in the most stable duplexes contained a heteroatom at the 2'-position of the sugar. Other sugar modifications usually led to diminished hybrid stability. Most backbone modifications that led to improved hybridization restricted backbone mobility and resulted in an A-type sugar pucker for the residue 5'to the modified internucleotide linkage. Among the heterocycles, C-5-substituted pyrimidines stood out as substantially increasing duplex stability. PMID:9358149

  12. Yeast Pif1 helicase exhibits a one-base-pair stepping mechanism for unwinding duplex DNA.

    PubMed

    Ramanagoudr-Bhojappa, Ramanagouda; Chib, Shubeena; Byrd, Alicia K; Aarattuthodiyil, Suja; Pandey, Manjula; Patel, Smita S; Raney, Kevin D

    2013-05-31

    Kinetic analysis of the DNA unwinding and translocation activities of helicases is necessary for characterization of the biochemical mechanism(s) for this class of enzymes. Saccharomyces cerevisiae Pif1 helicase was characterized using presteady state kinetics to determine rates of DNA unwinding, displacement of streptavidin from biotinylated DNA, translocation on single-stranded DNA (ssDNA), and ATP hydrolysis activities. Unwinding of substrates containing varying duplex lengths was fit globally to a model for stepwise unwinding and resulted in an unwinding rate of ∼75 bp/s and a kinetic step size of 1 base pair. Pif1 is capable of displacing streptavidin from biotinylated oligonucleotides with a linear increase in the rates as the length of the oligonucleotides increased. The rate of translocation on ssDNA was determined by measuring dissociation from varying lengths of ssDNA and is essentially the same as the rate of unwinding of dsDNA, making Pif1 an active helicase. The ATPase activity of Pif1 on ssDNA was determined using fluorescently labeled phosphate-binding protein to measure the rate of phosphate release. The quantity of phosphate released corresponds to a chemical efficiency of 0.84 ATP/nucleotides translocated. Hence, when all of the kinetic data are considered, Pif1 appears to move along DNA in single nucleotide or base pair steps, powered by hydrolysis of 1 molecule of ATP.

  13. Structure of the 1,N2-Ethenodeoxyguanosine Adduct Opposite Cytosine in Duplex DNA: Hoogsteen Base Pairing at pH 5.2†

    PubMed Central

    2008-01-01

    The exocyclic 1,N2-ethenodeoxyguanosine (1,N2-ϵdG) adduct, arising from the reaction of vinyl halides and other vinyl monomers, including chloroacetaldehyde, and lipid peroxidation products with dG, was examined at pH 5.2 in the oligodeoxynucleotide duplex 5′-d(CGCATXGAATCC)-3′·5′-d(GGATTCCATGCG)-3′ (X = 1,N2-ϵdG). Previously, X(anti)·C(anti) pairing was established in this duplex, containing the 5′-TXG-3′ sequence context, at pH 8.6 [ShanmugamG., GoodenoughA. K., KozekovI. D., HarrisT. M., GuengerichF. P., RizzoC. J., and StoneM. P. (2007) Chem. Res. Toxicol.21, 1601−161117941687]. At pH 5.2, the 1,N2-ϵdG adduct decreased the thermal stability of the duplex by ∼13 °C. The 1,N2-ϵdG adduct rotated about the glycosyl bond from the anti to the syn conformation. This resulted in the observation of a strong nuclear Overhauser effect (NOE) between the imidazole proton of 1,N2-ϵdG and the anomeric proton of the attached deoxyribose, accompanied by an NOE to the minor groove A20 H2 proton from the complementary strand. The syn conformation of the glycosyl bond at 1,N2-ϵdG placed the exocyclic etheno moiety into the major groove. This resulted in the observation of NOEs between the etheno protons and the major groove protons of the 5′-neighboring thymine. The 1,N2-ϵdG adduct formed a Hoogsteen pair with the complementary cytosine, characterized by downfield shifts of the amino protons of the cytosine complementary to the exocyclic adduct. The pattern of chemical shift perturbations indicated that the lesion introduced a localized structural perturbation involving the modified base pair and its 3′- and 5′-neighbor base pairs. A second conformational equilibrium was observed, in which both the modified base pair and its 3′-neighboring G·C base pair formed tandem Hoogsteen pairs. The results support the conclusion that at neutral pH, in the 5′-TXG-3′ sequence, the 1,N2-ϵdG adduct exists as a blend of conformations in duplex DNA. These

  14. Thermodynamic properties of the specific binding between Ag+ ions and C:C mismatched base pairs in duplex DNA.

    PubMed

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2011-02-01

    Metal-mediated base pairs formed by the interaction between metal ions and artificial bases in oligonucleotides have been developed for potential applications in nanotechnology. We recently found that a natural C:C mismatched base pair bound to an Ag(+) ion to generate a novel metal-mediated base pair in duplex DNA. Preparation of the novel C-Ag-C base pair involving natural bases is more convenient than that of metal-mediated base pairs involving artificial bases because time-consuming base synthesis is not required. Here, we examined the thermodynamic properties of the binding between the Ag(+) ion and each of single and double C:C mismatched base pair in duplex DNA by isothermal titration calorimetry. The Ag(+) ion specifically bound to the C:C mismatched base pair at a 1:1 molar ratio with 10(6) M(-1) binding constant, which was significantly larger than those for nonspecific metal ion-DNA interactions. The specific binding between the Ag(+) ion and the single C:C mismatched base pair was mainly driven by the positive dehydration entropy change and the negative binding enthalpy change. In the interaction between the Ag(+) ion and each of the consecutive and interrupted double C:C mismatched base pairs, stoichiometric binding at a 1:1 molar ratio was achieved in each step of the first and second Ag(+) binding. The binding affinity for the second Ag(+) binding was similar to that for the first Ag(+) binding. Stoichiometric binding without interference and negative cooperativity may be favorable for aligning multiple Ag(+) ions in duplex DNA for applications of the metal-mediated base pairs in nanotechnology.

  15. Nucleobase azide-ethynylribose click chemistry contributes to stabilizing oligonucleotide duplexes and stem-loop structures.

    PubMed

    Kitamura, Yoshiaki; Asakura, Ryo; Terazawa, Koki; Shibata, Aya; Ikeda, Masato; Kitade, Yukio

    2017-06-15

    The formation of 1,4-disubstituted 1,2,3-triazoles through copper-catalyzed azide-alkyne cycloaddition (CuAAC) in oligonucleotides bearing 1-deoxy-1-ethynyl-β-d-ribofuranose (R(E)) can have a positive impact on the stability of oligonucleotide duplexes and stem-loop structures. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Does the DNA methylase Eco dam pair nucleotide sequences to form site-specific duplexes?

    PubMed

    Buryanov YaI; Zinoviev, V V; Vienozhinskis, M T; Malygin, E G; Nesterenko, V F; Popov, S G; Gorbunov YuA

    1984-03-12

    The Eco dam methylase is active on denatured DNA and single-stranded synthetic oligonucleotides containing GATC sites. The results suggest that on interaction with single-stranded oligonucleotides the Eco dam methylase is able to form a duplex structure within the GATC site, and that this duplex site is a substrate for enzyme.

  17. Robust IR-based detection of stable and fractionally populated G-C(+) and A-T Hoogsteen base pairs in duplex DNA.

    PubMed

    Stelling, Allison L; Xu, Yu; Zhou, Huiqing; Choi, Seung H; Clay, Mary C; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-06-01

    Noncanonical G-C(+) and A-T Hoogsteen base pairs can form in duplex DNA and play roles in recognition, damage repair, and replication. Identifying Hoogsteen base pairs in DNA duplexes remains challenging due to difficulties in resolving syn versus antipurine bases with X-ray crystallography; and size limitations and line broadening can make them difficult to characterize by NMR spectroscopy. Here, we show how infrared (IR) spectroscopy can identify G-C(+) and A-T Hoogsteen base pairs in duplex DNA across a range of different structural contexts. The utility of IR-based detection of Hoogsteen base pairs is demonstrated by characterizing the first example of adjacent A-T and G-C(+) Hoogsteen base pairs in a DNA duplex where severe broadening complicates detection with NMR. © 2017 Federation of European Biochemical Societies.

  18. Pyrazolo[3,4-d]pyrimidine nucleic acids: adjustment of the dA-dT to the dG-dC base pair stability.

    PubMed

    He, J; Becher, G; Budow, S; Seela, F

    2003-01-01

    The pyrazolo[3,4-d]pyrimidine-4,6-diamine nucleosides 2b-d stabilize the dA-dT base pair significantly when the dA-residue is replaced. Oligonucleotide duplexes incorporating 2b-d show a 4-6 degrees C Tm increase per modification. The 7-bromo compound 2b harmonizes the stability of the dA-dT vs. the dG-dC pair. According to this the stability of such duplexes depends no longer on the base pair composition of a DNA molecule.

  19. Vacuum UV CD spectra of homopolymer duplexes and triplexes containing A.T or A.U base pairs.

    PubMed Central

    Johnson, K H; Gray, D M; Sutherland, J C

    1991-01-01

    Vacuum UV circular dichroism (CD) spectra were measured down to 174 nm for five homopolymers, five duplexes, and four triplexes containing adenine, uracil, and thymine. Near 190 nm, the CD bands of poly[d(A)] and poly[r(A)] were larger than the CD bands of the polypyrimidines, poly[d(T)], poly[d(U)], and poly[r(U)]. Little change was observed in the 190 nm region upon formation of the duplexes (poly[d(A).d(T)], poly[d(A).d(U)], poly[r(A).d(T)], poly[r(A).d(U)], and poly[r(A).r(U)]) or upon formation of two of the triplexes (poly[d(T).d(A).d(T)] and poly[d(U).d(A).d(U)]). This showed that the purine strand had the same or a similar structure in these duplexes and triplexes as when free in solution. Both A.U and A.T base pairing induced positive bands at 177 and 202 nm. For three triplexes containing poly[d(A)], the formation of a triplex from a duplex and a free pyrimidine strand induced a negative band centered between 210 and 215 nm. The induction of a band between 210 and 215 nm indicated that these triplexes had aspects of the A conformation. PMID:2041768

  20. Choline Ions Stabilize A-T Base Pairs by Fitting into Minor Groove

    NASA Astrophysics Data System (ADS)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Sugimoto, Naoki

    In a Watson-Crick base paired DNA duplex, G-C base pairs are more stable than A-T base pairs. However, in solvent containing choline ions, the stabilities of these base pairs are reversed. To elucidate the mechanism through which choline ions exert this effect from a microscopic viewpoint, we performed molecular dynamics simulations. We found that choline ions interact with a DNA duplex through multiple hydrogen bonds. The affinity of choline ion for the minor groove of A-T base pairs was higher than that for the major groove. The binding of choline ions to the minor groove of A-T base pairs supports groove formation without disturbing the formation of hydrogen bonds between the base pairs. In contrast, choline ions inhibit the formation of hydrogen bonds between G-C base pairs by binding to atoms of these bases that are involved in Watson-Crick hydrogen bonding. These findings will help us understand the stabilities of canonical DNA structures under the crowded conditions inside cells.

  1. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  2. Double proton transfer mechanism in the adenine-uracil base pair and spontaneous mutation in RNA duplex

    NASA Astrophysics Data System (ADS)

    Cerón-Carrasco, José P.; Requena, Alberto; Perpète, Eric A.; Michaux, Catherine; Jacquemin, Denis

    2009-12-01

    We study the mechanism of double proton transfer (DPT) in the adenine-uracil (AU) base pair, both in gas phase and under the influence of surrounding water molecules. According to our ab initio calculations, no stable proton transfer product exists in gas phase, while in solution, the DPT process may occur only through the catalysis of water molecules. Nevertheless, a thermodynamic analysis confirms that AU does not contribute to spontaneous mutation in RNA duplex, and thus guanine-cytosine (GC) would be the only base pair contributing to spontaneous mutation.

  3. Binding specificity and stability of duplexes formed by modified oligonucleotides with a 4096-hexanucleotide microarray

    PubMed Central

    Timofeev, Edward; Mirzabekov, Andrei

    2001-01-01

    The binding of oligodeoxynucleotides modified with adenine 2′-O-methyl riboside, 2,6-diaminopurine 2′-O-methyl riboside, cytosine 2′-O-methyl riboside, 2,6-diaminopurine deoxyriboside or 5-bromodeoxyuridine was studied with a microarray containing all possible (4096) polyacrylamide-bound hexadeoxynucleotides (a generic microchip). The generic microchip was manufactured by using reductive immobilization of aminooligonucleotides in the activated copolymer of acrylamide, bis-acrylamide and N-(2,2-dimethoxyethyl) acrylamide. The binding of the fluorescently labeled modified octanucleotides to the array was analyzed with the use of both melting profiles and the fluorescence distribution at selected temperatures. Up to three substitutions of adenosines in the octamer sequence by adenine 2′-O-methyl ribosides (Am), 2,6-diaminopurine 2′-O-methyl ribosides (Dm) or 2,6-diaminopurine deoxyribosides (D) resulted in increased mismatch discrimination measured at the melting temperature of the corresponding perfect duplex. The stability of complexes formed by 2′-O-methyl-adenosine-modified oligodeoxynucleotides was slightly decreased with every additional substitution, yielding ∼4°C of total loss in melting temperature for three modifications, as followed from microchip thermal denaturation experiments. 2,6-Diaminopurine 2′-O-methyl riboside modifications led to considerable duplex stabilization. The cytosine 2′-O-methyl riboside and 5-bromodeoxyuridine modifications generally did not change either duplex stability or mismatch resolution. Denaturation experiments conducted with selected perfect duplexes on microchips and in solution showed similar results on thermal stabilities. Some hybridization artifacts were observed that might indicate the formation of parallel DNA. PMID:11410672

  4. Enhanced thermal stability and mismatch discrimination of mutation-carrying DNA duplexes and their kinetic and thermodynamic properties in microchannel laminar flow.

    PubMed

    Nagata, Maria Portia B; Yamashita, Kenichi; Miyazaki, Masaya; Nakamura, Hiroyuki; Maeda, Hideaki

    2009-07-01

    This article reports the enhancement of thermal stability involving normal duplex and mutation-carrying DNA duplexes in microchannel laminar flow. The application of an in-house temperature-controllable microchannel-type flow cell is demonstrated for improved discrimination of mismatch base pairs such as A-G and T-G that are difficult to distinguish due to the rather small thermal destabilizations. Enhancement in thermal stability is reflected by an increased thermal melting temperature achieved in microchannel laminar flow as compared with batch reactions. To examine the kinetics and thermodynamics of duplex-coil equilibrium of DNA oligomers, denaturation-renaturation hysteresis curves were measured. The influence of microchannel laminar flow on DNA base mismatch analysis was described from the kinetic and thermodynamic perspectives. An increasing trend was observed for association rate constant as flow rate increased. In contrast, an apparent decrease in dissociation rate constant was observed with increasing flow rate. The magnitudes of the activation energies of dissociation were nearly constant for both the batch and microchannel laminar flow systems at all flow rates. In contrast, the magnitudes of activation energies of association decreased as flow rate increased. These results clearly show how microchannel laminar flow induces change in reaction rate by effecting change in activation energy. We anticipate, therefore, that this approach based on microchannel laminar flow system holds great promise for improved mismatch discrimination in DNA analyses, particularly on single-base-pair mismatch, by pronouncedly enhancing thermal stability.

  5. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    PubMed

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events.

  6. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    PubMed Central

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  7. Position-dependent effects on stability in tricyclo-DNA modified oligonucleotide duplexes

    PubMed Central

    Ittig, Damian; Gerber, Anna-Barbara; Leumann, Christian J.

    2011-01-01

    A series of oligodeoxyribonucleotides and oligoribonucleotides containing single and multiple tricyclo(tc)-nucleosides in various arrangements were prepared and the thermal and thermodynamic transition profiles of duplexes with complementary DNA and RNA evaluated. Tc-residues aligned in a non-continuous fashion in an RNA strand significantly decrease affinity to complementary RNA and DNA, mostly as a consequence of a loss of pairing enthalpy ΔH. Arranging the tc-residues in a continuous fashion rescues Tm and leads to higher DNA and RNA affinity. Substitution of oligodeoxyribonucleotides in the same way causes much less differences in Tm when paired to complementary DNA and leads to substantial increases in Tm when paired to complementary RNA. CD-spectroscopic investigations in combination with molecular dynamics simulations of duplexes with single modifications show that tc-residues in the RNA backbone distinctly influence the conformation of the neighboring nucleotides forcing them into higher energy conformations, while tc-residues in the DNA backbone seem to have negligible influence on the nearest neighbor conformations. These results rationalize the observed affinity differences and are of relevance for the design of tc-DNA containing oligonucleotides for applications in antisense or RNAi therapy. PMID:20719742

  8. Ab initio study of the phase stability in paramagnetic duplex steel alloys

    NASA Astrophysics Data System (ADS)

    Pitkänen, H.; Alatalo, M.; Puisto, A.; Ropo, M.; Kokko, K.; Punkkinen, M. P. J.; Olsson, P.; Johansson, B.; Hertzman, S.; Vitos, L.

    2009-01-01

    Duplex stainless steels have many superior properties compared to conventional steels, this being mainly due to their microstructure containing approximately equal amount of ferrite and austenite phases formed by iron, chromium (or Cr equivalent), and nickel (or Ni equivalent). Using computational methods based on first-principles theories, the phase stability of paramagnetic Fe1-c-nCrcNin alloys ( 0.12≤c≤0.32 and 0.04≤n≤0.32 ) at high temperatures (≳1000K) is addressed. It is shown that the stabilization of the ferrite-austenite two-phase field in duplex steels is a result of complex interplay of several competing phenomena. Taking into account only the formation energies yields a complete phase separation, strongly overestimating the two-phase region. The formation energies are calculated to be lower for the austenite than for the ferrite, meaning that the configurational entropy has a more significant impact on the stability field of the austenitic phase. The magnetic and vibrational free energies have opposite effects on the phase stability. Namely, the magnetic entropy favors the ferrite phase, whereas the vibrational free energy stabilizes the austenite phase. Combining the formation energies with the magnetic, vibrational, and configurational free energies, a region of coexistence between the two phases is obtained, in line with former thermodynamic assessments as well as with experimental observations.

  9. O sup 6 -ethylguanine carcinogenic lesions in DNA: An NMR study of O sup 6 etGter dot C pairing in dodecanucleotide duplexes

    SciTech Connect

    Kalnik, M.W.; Li, B.F.L.; Swann, P.F.; Patel, D.J. )

    1989-07-25

    The pairing of O{sup 6}etG with C located four base pairs in from either end of the self-complementary d(C1-G2-C3-{und O{sup 6}etG4}-A5-G6-C7-T8-{und C9}-G10-C11-G12) duplex (designated O{sup 6}etG{center dot}C 12-mer) has been investigated from an analysis of proton and phosphorus two-dimensional NMR experiments. The structural consequences of increasing the alkyl group size were elucidated from a comparative study of the pairing of O{sup 6}meG4 with C9 in a related sequence (designated O{sup 6}meG{center dot}C 12-mer). The NMR parameters for both O{sup 6}alkG-containing dodecanucleotides are also compared with those of the control sequence containing G4{center dot}C9 base pairs (designated G{center dot}C 12-mer). The NOE cross-peaks detected in the two-dimensional NOESY spectra of the O{sup 6}alkG{center dot}C 12-mer duplexes in H{sub 2}O solution establish that the O{sup 6}etG4/O{sup 6}meG4 and C9 bases at the lesion site stack into the helix between the flanking C3{center dot}G10 and A5{center dot}T8 Watson-Crick base pairs. The observed NOEs between the amino protons of C9 and the CH{sub 3} protons of O{sup 6}alkG4 establish a syn orientation of the O{sup 6}-alkyl group with respect to the N{sup 1} of alkylated guanine. A wobble alignment of the O{sup 6}alkG4{center dot}C9 base pair stabilized by two hydrogen bonds, one between the amino group of C9 and N{sup 1} of O{sup 6}alkG and the other between the amino group of O{sup 6}alkG and N{sup 3} of C9, is tentatively proposed on the basis of the NOEs between the amino protons of C9 at the lesion site and the imino protons of flanking Watson-Crick base pairs.

  10. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    PubMed

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  11. Effect of flanking bases on quadruplex stability and Watson-Crick duplex competition.

    PubMed

    Arora, Amit; Nair, Divya R; Maiti, Souvik

    2009-07-01

    Guanine-rich DNA sequences have the ability to fold into four-stranded structures called G-quadruplexes, and are considered as promising anticancer targets. Although the G-quadruplex structure is composed of quartets and interspersed loops, in the genome it is also flanked on each side by numerous bases. The effect of loop length and composition on quadruplex conformation and stability has been well investigated in the past, but the effect of flanking bases on quadruplex stability and Watson-Crick duplex competition has not been addressed. We have studied in detail the effect of flanking bases on quadruplex stability and on duplex formation by the G-quadruplex in the presence of complementary strands using the quadruplex-forming sequence located in the promoter region of the c-kit oncogene. The results obtained from CD, thermal difference spectrum and UV melting demonstrated the effect of flanking bases on quadruplex structure and stability. With the increase in flank length, the increase in the more favorable DeltaH(vH) is accompanied by a striking increase in the unfavorable DeltaS(vH), which resulted in a decrease in the overall DeltaG(vH) of quadruplex formation. Furthermore, CD, fluorescence and isothermal titration calorimetry studies demonstrated that the propensity to attain quadruplex structure decreases with increasing flank length.

  12. Revision of AMBER Torsional Parameters for RNA Improves Free Energy Predictions for Tetramer Duplexes with GC and iGiC Base Pairs

    PubMed Central

    2011-01-01

    All-atom force fields are important for predicting thermodynamic, structural, and dynamic properties of RNA. In this paper, results are reported for thermodynamic integration calculations of free energy differences of duplex formation when CG pairs in the RNA duplexes r(CCGG)2, r(GGCC)2, r(GCGC)2, and r(CGCG)2 are replaced by isocytidine–isoguanosine (iCiG) pairs. Agreement with experiment was improved when ε/ζ, α/γ, β, and χ torsional parameters in the AMBER99 force field were revised on the basis of quantum mechanical calculations. The revised force field, AMBER99TOR, brings free energy difference predictions to within 1.3, 1.4, 2.3, and 2.6 kcal/mol at 300 K, respectively, compared to experimental results for the thermodynamic cycles of CCGG → iCiCiGiG, GGCC → iGiGiCiC, GCGC → iGiCiGiC, and CGCG → iCiGiCiG. In contrast, unmodified AMBER99 predictions for GGCC → iGiGiCiC and GCGC → iGiCiGiC differ from experiment by 11.7 and 12.6 kcal/mol, respectively. In order to test the dynamic stability of the above duplexes with AMBER99TOR, four individual 50 ns molecular dynamics (MD) simulations in explicit solvent were run. All except r(CCGG)2 retained A-form conformation for ≥82% of the time. This is consistent with NMR spectra of r(iGiGiCiC)2, which reveal an A-form conformation. In MD simulations, r(CCGG)2 retained A-form conformation 52% of the time, suggesting that its terminal base pairs may fray. The results indicate that revised backbone parameters improve predictions of RNA properties and that comparisons to measured sequence dependent thermodynamics provide useful benchmarks for testing force fields and computational methods. PMID:22249447

  13. Effects of formamide on the thermal stability of DNA duplexes on biochips.

    PubMed

    Fuchs, Julia; Dell'Atti, Daniela; Buhot, Arnaud; Calemczuk, Roberto; Mascini, Marco; Livache, Thierry

    2010-02-01

    In molecular biology, formamide (FA) is a commonly used denaturing agent for DNA. Although its influence on DNA duplex stability in solution is well established, little is known about immobilized DNA on microarrays. We measured thermal denaturation curves for oligonucleotides immobilized by two standard protocols: thiol self-assembling and pyrrole electrospotting. A decrease of the DNA denaturation temperature with increasing FA fraction of the solvent was observed on sequences with mutations for both surface chemistries. The average dissociation temperature decrease was found to be -0.58+/-0.05 degrees C/% FA (v/v) independently of grafting chemistry and probe sequence. Copyright 2009 Elsevier Inc. All rights reserved.

  14. Process for stabilizing dimensions of duplex stainless steels for service at elevated temperatures

    DOEpatents

    Hull, Frederick C.; Tobin, John C.

    1981-01-01

    Duplex stainless steel materials containing austenite plus delta ferrite, are dimensionally stabilized by heating the material to a reaction temperature between about 1050.degree.-1450.degree. F. (566.degree.-788.degree. C.), holding it at this temperature during transformation of delta ferrite to austenite plus sigma phase, and subsequently heating to a reversion temperature between about 1625.degree.-1750.degree. F. (885.degree.-954.degree. C.), whereby the sigma phase transforms back to ferrite, but the austenite remains dispersed in the ferrite phase. Final controlled cooling permits transformation of ferrite to austenite plus sigma and, later, precipitation of carbides.

  15. Postsynthetic modification of oligonucleotides with imidazophenazine dye and its effect on duplex stability.

    PubMed

    Dubey, Larysa; Ryazanova, Olga; Zozulya, Victor; Fedoryak, Dmytro; Dubey, Igor

    2011-01-01

    Carboxyalkyl derivative of the intercalating agent imidazo[4,5-b]phenazine was used for the postsynthetic oligonucleotide modification. Model pentadecathymidylate-imidazophenazine conjugate was prepared from 5'-aminoalkyl-modified (dT)(15) by using phosphonium coupling reagent BOP in the presence of 1-hydroxybenzotriazole. Spectral-fluorescent properties of the conjugate were studied. The attachment of the dye was found to increase the thermal stability of (dT)(15) duplex with poly(dA) by more than 4°C, probably by the intercalation mechanism.

  16. Interaction of octahedral ruthenium(II) polypyridyl complex [Ru(bpy)2(PIP)](2+) with poly(U)·poly(A)*poly(U) triplex: Increasing third-strand stabilization of the triplex without affecting the stability of the duplex.

    PubMed

    Zhu, Zhiyuan; Peng, Mengna; Zhang, Jingwen; Tan, Lifeng

    2017-04-01

    Triple-helical RNA are of interest because of possible biological roles as well as the potential therapeutic uses of these structures, while the stability of triplexes is usually weaker than that of the Watson-Crick base pairing duplex strand due to the electrostatic repulsion between three polyanionic strands. Therefore, how to increase the stability of the specific sequences of triplexes are of importance. In this paper the binding of a Ru(II) complex, [Ru(bpy)2(PIP)](2+) (bpy=2.2'-bipyridine, PIP=2-phenyl-1H-imidazo[4,5-f]- [1,10]-phenanthroline), with poly(U)·poly(A)*poly(U) triplex has been investigated by spectrophotometry, spectrofluorometry, viscosimetry and circular dichroism. The results suggest that [Ru(bpy)2(PIP)](2+) as a metallointercalator can stabilize poly(U)·poly(A)*poly(U) triplex (where · denotes the Watson-Crick base pairing and * denotes the Hoogsteen base pairing),while it stabilizes third-strand with no obvious effect on the duplex of poly(U)·poly(A), reflecting the binding of this complex with the triplex is favored by the Hoogsteen paired poly(U) third strand to a great extent.

  17. Thermal stability and conformation of antiparallel duplexes formed by P-stereodefined phosphorothioate DNA/LNA chimeric oligomers with DNA and RNA matrices.

    PubMed

    Jastrzębska, Katarzyna; Maciaszek, Anna; Dolot, Rafał; Bujacz, Grzegorz; Guga, Piotr

    2015-10-21

    3'-O-(2-Thio-4,4-pentamethylene-1,3,2-oxathiaphospholane) derivatives of LNA-type nucleosides (LNA-OTPs, 2a-d; B' = Thy, Ade(Bz), Cyt(Bz), Gua(dmf), respectively) were synthesized and separated into pure P-diastereomers. X-ray analysis allowed for assignment of the absolute configuration of the phosphorus atom in the detritylated, fast-eluting diastereomer 2a. The diastereomerically pure LNA-OTP monomers were used in solid phase synthesis of P-stereodefined chimeric PS-(DNA/LNA) 11-mers containing 2-3 LNA units. Formally, among the phosphorothioate oligomers the biggest enhancement in thermal stability of Watson-Crick paired duplexes was found for [SP-PS]-(DNA/LNA)/RNA duplexes (on average 8.2 °C per LNA nucleotide), followed by [RP-PS]-(DNA/LNA)/RNA (6.3 °C), [RP-PS]-(DNA/LNA)/DNA (3.8 °C) and [SP-PS]-(DNA/LNA)/DNA (2.4 °C per LNA nucleotide). However, detailed analysis of the thermal dissociation data showed that the thermal stability of (PS-LNA)-containing duplexes does not depend on the spatial orientation of the sulfur atoms. This conclusion received support from CD measurements.

  18. MHF complex senses branched DNA via binding a pair of crossover DNA duplexes

    PubMed Central

    Zhao, Qi; Saro, Dorina; Sachpatzidis, Aristidis; Singh, Thiyam Ramsing; Schlingman, Daniel; Zheng, Xiao-Feng; Mack, Andrew; Tsai, Miaw-Sheue; Mochrie, Simon; Regan, Lynne; Meetei, Amom Ruhikanta; Sung, Patrick; Xiong, Yong

    2014-01-01

    The conserved MHF1-MHF2 (MHF) complex functions in the activation of the Fanconi anemia (FA) pathway of DNA damage response, in regulating homologous recombination, and in DNA replication fork maintenance. MHF facilitates the processing of multiple types of branched DNAs by the FA DNA translocase FANCM. Here we report the crystal structure of a human MHF-DNA complex that reveals the DNA binding mode of MHF. The structure suggests an MHF preference for branched DNA over double stranded DNA through engaging two duplex arms, which is supported by single molecule studies. Biochemical analyses verify that MHF preferentially engage DNA forks or various four-way junctions independent of the junction-site structure. Genetic experiments provide evidence that the observed DNA-binding interface of MHF is important for cellular resistance to DNA damage. These results provide insights into how the MHF complex recognizes branched DNA and stimulates FANCM activity at such a structure to promote genome maintenance. PMID:24390579

  19. Dynamics and relative stabilities of parallel- and antiparallel-stranded DNA duplexes.

    PubMed Central

    Garcia, A E; Soumpasis, D M; Jovin, T M

    1994-01-01

    The dynamics and stability of four DNA duplexes are studied by means of molecular dynamics simulations. The four molecules studied are combinations of 4, 15 bases long, single-stranded oligomers, F1, F2, F3, and F4. The sequence of these single strand oligomers are chosen such that F1-F2 and F3-F4 form parallel (ps) DNA double helices, whereas F1-F4 and F2-F3 form antiparallel-stranded (aps) DNA double helices. Simulations were done at low (100 K) and room (300 K) temperatures. At low temperatures the dynamics are quasi-harmonic and the analysis of the trajectories gives good estimates of the low frequency vibrational modes and density of states. These are used to estimate the linear (harmonic) contribution of local fluctuations to the configurational entropy of the systems. Estimates of the differences in enthalpy between ps and aps duplexes show that aps double helices are more stable than the corresponding ps duplexes, in agreement with experiments. At higher temperatures, the distribution of the fluctuations around the average structures are multimodal and estimates of the configurational entropy cannot be obtained. The multi-basin, nonlinear character of the dynamics at 300 K is established using a novel method which extracts large amplitude nonlinear motions from the molecular dynamics trajectories. Our analysis shows that both ps DNA exhibit much larger fluctuations than the two aps DNA. The large fluctuations of ps DNA are explained in terms of correlated transitions in the beta, epsilon, and zeta backbone dihedral angles. Images FIGURE 1 FIGURE 2 PMID:8075315

  20. Hoogsteen-Paired Homopurine [RP-PS]-DNA and Homopyrimidine RNA Strands Form a Thermally Stable Parallel Duplex

    PubMed Central

    Guga, Piotr; Janicka, Magdalena; Maciaszek, Anna; Rębowska, Beata; Nowak, Genowefa

    2007-01-01

    Homopurine deoxyribonucleoside phosphorothioates possessing all internucleotide linkages of RP configuration form a duplex with an RNA or 2′-OMe-RNA strand with Hoogsteen complementarity. The duplexes formed with RNA templates are thermally stable at pH 5.3, while those formed with a 2′-OMe-RNA are stable at neutrality. Melting temperature and fluorescence quenching experiments indicate that the strands are parallel. Remarkably, these duplexes are thermally more stable than parallel Hoogsteen duplexes and antiparallel Watson-Crick duplexes formed by unmodified homopurine DNA molecules of the same sequence with corresponding RNA templates. PMID:17693472

  1. Hoogsteen-paired homopurine [RP-PS]-DNA and homopyrimidine RNA strands form a thermally stable parallel duplex.

    PubMed

    Guga, Piotr; Janicka, Magdalena; Maciaszek, Anna; Rebowska, Beata; Nowak, Genowefa

    2007-11-15

    Homopurine deoxyribonucleoside phosphorothioates possessing all internucleotide linkages of R(P) configuration form a duplex with an RNA or 2'-OMe-RNA strand with Hoogsteen complementarity. The duplexes formed with RNA templates are thermally stable at pH 5.3, while those formed with a 2'-OMe-RNA are stable at neutrality. Melting temperature and fluorescence quenching experiments indicate that the strands are parallel. Remarkably, these duplexes are thermally more stable than parallel Hoogsteen duplexes and antiparallel Watson-Crick duplexes formed by unmodified homopurine DNA molecules of the same sequence with corresponding RNA templates.

  2. Solution structure of RNA duplexes containing alternating CG base pairs: NMR study of r(CGCGCG)2 and 2'-O-Me(CGCGCG)2 under low salt conditions.

    PubMed Central

    Popenda, M; Biala, E; Milecki, J; Adamiak, R W

    1997-01-01

    Structures of r(CGCGCG)2 and 2'-O-Me(CGCGCG)2 have been determined by NMR spectroscopy under low salt conditions. All protons and phosphorus nuclei resonances have been assigned. Signals of H5'/5" have been assigned stereospecifically. All 3JH,H and 3JP,H coupling constants have been measured. The structures were determined and refined using an iterative relaxation matrix procedure (IRMA) and the restrained MD simulation. Both duplexes form half-turn, right-handed helices with several conformational features which deviate significantly from a canonical A-RNA structure. Duplexes are characterised as having C3'-endo sugar pucker, very low base-pair rise and high helical twist and inclination angles. Helices are overwound with <10 bp per turn. There is limited inter-strand guanine stacking for CG steps. Within CG steps of both duplexes, the planes of the inter-strand cytosines are not parallel while guanines are almost parallel. For the GC steps this pattern is reversed. The 2'-O-methyl groups are spatially close to the 5'-hydrogens of neighbouring residues from the 3'-side and are directed towards the minor groove of 2'-O-Me(CGCGCG)2 forming a hydrophobic layer. Solution structures of both duplexes are similar; the effect of 2'-O-methylation on the parent RNA structure is small. This suggests that intrinsic properties imposed by alternating CG base pairs govern the overall conformation of both duplexes. PMID:9358170

  3. The Contribution of the Activation Entropy to the Gas-Phase Stability of Modified Nucleic Acid Duplexes

    NASA Astrophysics Data System (ADS)

    Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J.; Schürch, Stefan

    2016-07-01

    Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes.

  4. The Contribution of the Activation Entropy to the Gas-Phase Stability of Modified Nucleic Acid Duplexes.

    PubMed

    Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J; Schürch, Stefan

    2016-07-01

    Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes. Graphical Abstract ᅟ.

  5. Spectroscopic study on the effect of imidazophenazine tethered to 5'-end of pentadecathymidilate on stability of poly(dA)·(dT)15 duplex.

    PubMed

    Ryazanova, Olga; Dubey, Larysa; Dubey, Igor; Zozulya, Victor

    2012-11-01

    The effect of imidazo[4,5-d]phenazine (Pzn) attached to the 5(')-end of (dT)(15) oligonucleotide via a flexible linker on the thermal stability of poly(dA)·(dT)(15) duplex was studied in aqueous buffered solution containing 0.1 М NaCl at the equimolar ratio of adenine and thymine bases (100 μM each) using spectroscopic techniques. Duplex formation was investigated by measuring UV absorption and fluorescence melting curves for the Pzn-modified system. Tethered phenazine derivative enhances the thermostability of poly(dA)·(dT)(15) duplex increasing the helix-to-coil transition temperature by 4.5 °С due to an intercalation of the dye chromophore between AT-base pairs. The thermodynamic parameters of the transition for non-modified and modified systems were estimated using "all-or-none" model. The modification of the (dT)(15) results in a decrease in the transition enthalpy, however, the observed gain in the Gibbs free energy of complex formation, ΔG, is provided with the corresponding decrease in entropy change. The increase of ΔG value at 37 °C in consequence of (dT)(15) modification was found to be equal to 1.3 kcal/mol per oligonucleotide strand.

  6. 2,6-Diaminopurine to TNA: Effect on Duplex Stabilities and on the Efficiency of Template-Controlled Ligations

    NASA Technical Reports Server (NTRS)

    Wu, Xiaolin; Delgado, Guillermo; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2003-01-01

    Replacement of adenine by 2,6-diaminopurine-two nucleobases to be considered equivalent from an etlological point of view-strongly enhances the stability of TNA/TNA, TNA/RNA, or TNA/DNA duplexes and efficiently accelerates template-directed ligation of TNA ligands.

  7. 2,6-Diaminopurine to TNA: Effect on Duplex Stabilities and on the Efficiency of Template-Controlled Ligations

    NASA Technical Reports Server (NTRS)

    Wu, Xiaolin; Delgado, Guillermo; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2003-01-01

    Replacement of adenine by 2,6-diaminopurine-two nucleobases to be considered equivalent from an etlological point of view-strongly enhances the stability of TNA/TNA, TNA/RNA, or TNA/DNA duplexes and efficiently accelerates template-directed ligation of TNA ligands.

  8. Human PSF concentrates DNA and stimulates duplex capture in DMC1-mediated homologous pairing

    PubMed Central

    Morozumi, Yuichi; Ino, Ryohei; Takaku, Motoki; Hosokawa, Mihoko; Chuma, Shinichiro; Kurumizaka, Hitoshi

    2012-01-01

    PSF is considered to have multiple functions in RNA processing, transcription and DNA repair by mitotic recombination. In the present study, we found that PSF is produced in spermatogonia, spermatocytes and spermatids, suggesting that PSF may also function in meiotic recombination. We tested the effect of PSF on homologous pairing by the meiosis-specific recombinase DMC1, and found that human PSF robustly stimulated it. PSF synergistically enhanced the formation of a synaptic complex containing DMC1, ssDNA and dsDNA during homologous pairing. The PSF-mediated DMC1 stimulation may be promoted by its DNA aggregation activity, which increases the local concentrations of ssDNA and dsDNA for homologous pairing by DMC1. These results suggested that PSF may function as an activator for the meiosis-specific recombinase DMC1 in higher eukaryotes. PMID:22156371

  9. MD and NMR analyses of choline and TMA binding to duplex DNA: on the origins of aberrant sequence-dependent stability by alkyl cations in aqueous and water-free solvents.

    PubMed

    Portella, Guillem; Germann, Markus W; Hud, Nicholas V; Orozco, Modesto

    2014-02-26

    It has been known for decades that alkylammonium ions, such as tetramethyl ammonium (TMA), alter the usual correlation between DNA GC-content and duplex stability. In some cases it is even possible for an AT-rich duplex to be more stable than a GC-rich duplex of the same length. There has been much speculation regarding the origin of this aberration in sequence-dependent DNA duplex stability, but no clear resolution. Using a combination of molecular dynamics simulations and NMR spectroscopy we demonstrate that choline (2-hydroxy-N,N,N-trimethylethanaminium) and TMA are preferentially localized in the minor groove of DNA duplexes at A·T base pairs and these same ions show less pronounced localization in the major groove compared to what has been demonstrated for alkali and alkali earth metal ions. Furthermore, free energy calculations show that single-stranded GC-rich sequences exhibit more favorable solvation by choline than single-stranded AT-rich sequences. The sequence-specific nature of choline and TMA binding provides a rationale for the enhanced stability of AT-rich sequences when alkyl-ammonium ions are used as the counterions of DNA. Our combined theoretical and experimental study provides one of the most detailed pictures to date of cations localized along DNA in the solution state, and provides insights that go beyond understanding alkyl-ammonium ion binding to DNA. In particular, because choline and TMA bind to DNA in a manner that is found to be distinct from that previously reported for Na(+), K(+), Mg(2+), and Ca(2+), our results reveal the important but underappreciated role that most other cations play in sequence-specific duplex stability.

  10. Structural destabilization of DNA duplexes containing single-base lesions investigated by nanopore measurements.

    PubMed

    Jin, Qian; Fleming, Aaron M; Ding, Yun; Burrows, Cynthia J; White, Henry S

    2013-11-12

    The influence of DNA duplex structural destabilization introduced by a single base-pair modification was investigated by nanopore measurements. A series of 11 modified base pairs were introduced into the context of an otherwise complementary DNA duplex formed by a 17-mer and a 65-mer such that the overhanging ends comprised poly(dT)23 tails, generating a representative set of duplexes that display a range of unzipping mechanistic behaviors and kinetic stabilities. The guanine oxidation products 8-oxo-7,8-dihydroguanine (OG), guanidinohydantoin (Gh), and spiroiminodihydantoin (Sp) were paired with either cytosine (C), adenine (A), or 2,6-diaminopurine (D) to form modified base pairs. The mechanism and kinetic rate constants of duplex dissociation were determined by threading either the 3' or 5' overhangs into an α-hemolysin (α-HL) channel under an electrical field and measuring the distributions of unzipping times at constant force. In order of decreasing thermodynamic stability (as measured by duplex melting points), the rate of duplex dissociation increases, and the mechanism evolves from a first-order reaction to two sequential first-order reactions. These measurements allow us to rank the kinetic stability of lesion-containing duplexes relative to the canonical G:C base pair in which the OG:C, Gh:C, and Sp:C base pairs are, respectively, 3-200 times less stable. The rate constants also depend on whether unzipping was initiated from the 3' versus 5' side of the duplex. The kinetic stability of these duplexes was interpreted in terms of the structural destabilization introduced by the single base-pair modification. Specifically, a large distortion of the duplex backbone introduced by the presence of the highly oxidized guanine products Sp and Gh leads to a rapid two-step unzipping. The number of hydrogen bonds in the modified base pair plays a lesser role in determining the kinetics of duplex dissociation.

  11. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices.

  12. Stability and proton transfer in DNA base pairs of AMD473-DNA adduct

    NASA Astrophysics Data System (ADS)

    Sarmah, Pubalee; Deka, Ramesh C.

    2011-05-01

    We investigate the energetics of four different adducts of cisplatin analogue cis-[PtCl 2(NH 3)(2-picoline)] (AMD473) with a duplex DNA using DFT/ONIOM methods to probe their stabilities. Further, we study the possibilities of proton transfer between DNA base pairs of the most stable drug-DNA adduct. The adduct b(2-picoline trans to 3'-G and 2-methyl group directs to the DNA major groove) is found to be the most stable configuration among all the possible adducts. From the proton transfer analysis we found that the single proton transfer between N1 position of guanine (G) and N3 position of cytosine (C) of each GC pair gives a structure energetically as stable as the original one.

  13. Synthesis and base pairing studies of geranylated 2-thiothymidine, a natural variant of thymidine.

    PubMed

    Wang, Rui; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Shen, Fusheng; Chen, Alan; Sheng, Jia

    2015-11-25

    The synthesis and base pairing of DNA duplexes containing the geranylated 2-thiothymidine have been investigated. This naturally existing hydrophobic modification could grant better base pairing stability to the T-G pair over normal T-A and other mismatched pairs in the duplex context. This study provides a potential explanation for the different codon recognition preferences of the geranylated tRNAs.

  14. Base pair opening kinetics and dynamics in the DNA duplexes that specifically recognized by very short patch repair protein (Vsr).

    PubMed

    Cho, Sung Jae; Bang, Jongchul; Lee, Joon-Hwa; Choi, Byong-Seok

    2010-09-15

    In Escherichia coli, the very short patch (VSP) repair system is a major pathway for removal of T.G mismatches in Dcm target sequences. In the VSP repair pathway, the very short patch repair (Vsr) endonuclease selectively recognizes a T.G mismatch in Dcm target sequences and hydrolyzes the 5'-phosphate group of the mismatched thymine. The hydrogen exchange NMR studies here revealed that the T5.G18 mismatch in the Dcm target sequence significantly stabilizes own base pair but destabilizes the two neighboring G4.C19 and A6.T17 base pairs compare to other T.G mismatches. These unusual patterns of base pair stability in the Dcm target sequence can explain how the Vsr endonuclease specifically recognizes the mismatched Dcm target sequence and intercalates into the DNA. Copyright 2010 Elsevier Inc. All rights reserved.

  15. Stability and size of particle pairs in complex plasmas

    SciTech Connect

    Nosenko, V.; Ivlev, A. V.; Kompaneets, R.; Morfill, G.

    2014-11-15

    Particle pairing in a complex plasma was experimentally studied with the emphasis on pair spatial extent and stability. Micron-size particles were suspended in the (pre)sheath area above the lower electrode in a capacitively coupled radio-frequency discharge in argon. They formed vertical pairs due to the ion wakes created by the flow of ions past particles. We discuss the confinement mechanism for the lower particle, resulting from a combination of the wake field and the field of non-uniform sheath. A model of particle pairs is proposed, which provides good description for the dependence of pair size and stability on experimental parameters.

  16. Synthesis and triplex-forming properties of oligonucleotides capable of recognizing corresponding DNA duplexes containing four base pairs.

    PubMed

    Ohkubo, Akihiro; Yamada, Kenji; Ito, Yu; Yoshimura, Kiichi; Miyauchi, Koichiro; Kanamori, Takashi; Masaki, Yoshiaki; Seio, Kohji; Yuasa, Hideya; Sekine, Mitsuo

    2015-07-13

    A triplex-forming oligonucleotide (TFO) could be a useful molecular tool for gene therapy and specific gene modification. However, unmodified TFOs have two serious drawbacks: low binding affinities and high sequence-dependencies. In this paper, we propose a new strategy that uses a new set of modified nucleobases for four-base recognition of TFOs, and thereby overcome these two drawbacks. TFOs containing a 2'-deoxy-4N-(2-guanidoethyl)-5-methylcytidine (d(g)C) residue for a C-G base pair have higher binding and base recognition abilities than those containing 2'-OMe-4N-(2-guanidoethyl)-5-methylcytidine (2'-OMe (g)C), 2'-OMe-4N-(2-guanidoethyl)-5-methyl-2-thiocytidine (2'-OMe (g)Cs), d(g)C and 4S-(2-guanidoethyl)-4-thiothymidine ((gs)T). Further, we observed that N-acetyl-2,7-diamino-1,8-naphtyridine ((DA)Nac) has a higher binding and base recognition abilities for a T-A base pair compared with that of dG and the other DNA derivatives. On the basis of this knowledge, we successfully synthesized a fully modified TFO containing (DA)Nac, d(g)C, 2'-OMe-2-thiothymidine (2'-OMe (s)T) and 2'-OMe-8-thioxoadenosine (2'-OMe (s)A) with high binding and base recognition abilities. To the best of our knowledge, this is the first report in which a fully modified TFO accurately recognizes a complementary DNA duplex having a mixed sequence under neutral conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Synthesis and studies on the effect of 2-thiouridine and 4-thiouridine on sugar conformation and RNA duplex stability.

    PubMed Central

    Kumar, R K; Davis, D R

    1997-01-01

    In order to understand the effect of 2-thiouridine (s2U) substitution on RNA structure and the potential for stabilization of tRNA codon-anticodon interactions through s2U-34 modification, a pentamer RNA sequence, Gs2UUUC, was synthesized and characterized by NMR spectroscopy. The single strand contains the UUU anticodon sequence of tRNALys with flanking GCs to increase duplex stability. Regiochemical effects of uridine thiolation were determined by comparing the structure and stability of the 2-thiouridine containing oligonucleotide with an identical sequence containing 4-thiouridine (s4U) and also the normal uridine nucleoside. Circular dichroism spectrum indicated an A-form helical conformation for Gs2UUUC which was further confirmed by 2D ROESY NMR experiments. The duplex stability of the three pentamers complexed with a 2'-O-methyl-ribonucleotide complementary strand, GmAmAmAmCm, was determined by UV thermal melting studies and by 1H NMR spectroscopy. The duplex containing s2U has a T m of 30.7 degrees C compared to 19. 0 degrees C for the unmodified control and 14.5 degrees C for the s4U containing duplex. The results from UV experiments were corroborated by imino proton NMR studies that show proton exchange rates, chemical shift differences, and NH proton linewidths indicative of the stability order s2U >U >s4U. The magnitude of the effect of s2U in our model system is comparable to the 20 degrees C stabilization observed by Grosjean and co-workers for 2-thiolation in a codon-anticodon model system composed of two tRNAs with complementary anticodon sequences [Houssier, C., Degee, P., Nicoghosian, K. and Grosjean, H. (1988) J. Biomol. Struct. Dyn., 5, 1259-1266]. PMID:9092639

  18. Stabilizing contributions of sulfur-modified nucleotides: crystal structure of a DNA duplex with 2'-O-[2-(methoxy)ethyl]-2-thiothymidines

    SciTech Connect

    Diop-Frimpong, Benjamin; Prakash, Thazha P.; Rajeev, Kallanthottathil G.; Manoharan, Muthiah; Egli, Martin

    2010-03-05

    Substitution of oxygen atoms by sulfur at various locations in the nucleic acid framework has led to analogs such as the DNA phosphorothioates and 4'-thio RNA. The phosphorothioates are excellent mimics of DNA, exhibit increased resistance to nuclease degradation compared with the natural counterpart, and have been widely used as first-generation antisense nucleic acid analogs for applications in vitro and in vivo. The 4'-thio RNA analog exhibits significantly enhanced RNA affinity compared with RNA, and shows potential for incorporation into siRNAs. 2-Thiouridine (s{sup 2}U) and 5-methyl-2-thiouridine (m{sup 5}s{sup 2}U) are natural nucleotide analogs. s{sup 2}U in tRNA confers greater specificity of codon-anticodon interactions by discriminating more strongly between A and G compared with U. 2-Thio modification preorganizes the ribose and 2'-deoxyribose sugars for a C3'-endo conformation, and stabilizes heteroduplexes composed of modified DNA and complementary RNA. Combination of the 2-thio and sugar 2'-O-modifications has been demonstrated to boost both thermodynamic stability and nuclease resistance. Using the 2'-O-[2-(methoxy)ethyl]-2-thiothymidine (m{sup 5}s{sup 2}Umoe) analog, we have investigated the consequences of the replacement of the 2-oxygen by sulfur for base-pair geometry and duplex conformation. The crystal structure of the A-form DNA duplex with sequence GCGTAT*ACGC (T* = m{sup 5}s{sup 2}Umoe) was determined at high resolution and compared with the structure of the corresponding duplex with T* = m{sup 5}Umoe. Notable changes as a result of the incorporation of sulfur concern the base-pair parameter 'opening', an improvement of stacking in the vicinity of modified nucleotides as measured by base overlap, and a van der Waals interaction between sulfur atoms from adjacent m{sup 5}s{sup 2}Umoe residues in the minor groove. The structural data indicate only minor adjustments in the water structure as a result of the presence of sulfur. The observed

  19. Robust silver-mediated imidazolo-dC base pairs in metal DNA: dinuclear silver bridges with exceptional stability in double helices with parallel and antiparallel strand orientation.

    PubMed

    Jana, Sunit Kumar; Guo, Xiurong; Mei, Hui; Seela, Frank

    2015-12-18

    A new unprecedented metal-mediated base pair was designed that stabilizes reverse Watson-Crick DNA (parallel strand orientation, ps) as well as canonical Watson-Crick DNA (antiparallel strand orientation, aps). This base pair contains two imidazolo-dC units decorated with furan residues. Tm measurements and spectroscopic studies reveal that each silver-mediated furano-imidazolo-dC forms exceptionally stable duplexes with ps and aps chain orientation. This stability increase by a silver-mediated base pair is the highest reported so far for ps and aps DNA helices.

  20. The role of duplex stability for wavelength-shifting fluorescent DNA probes: energy transfer vs. exciton interactions in DNA "traffic lights".

    PubMed

    Barrois, Sebastian; Wörner, Samantha; Wagenknecht, Hans-Achim

    2014-08-01

    Exciton interactions between thiazole orange and thiazole red as nucleotide substitutes in DNA hairpins interfere with efficient energy transfer and fluorescence color change as readout. This interference can be tuned by two structural parameters that control the hairpin duplex stability.

  1. Oligonucleotides with "clickable" sugar residues: synthesis, duplex stability, and terminal versus central interstrand cross-linking of 2'-O-propargylated 2-aminoadenosine with a bifunctional azide.

    PubMed

    Pujari, Suresh S; Leonard, Peter; Seela, Frank

    2014-05-16

    Duplex DNA with terminal and internal sugar cross-links were synthesized by the CuAAC reaction from oligonucleotides containing 2'-O-propargyl-2-aminoadenosine as a clickable site and a bifunctional azide (4). Stepwise click chemistry was employed to introduce cross-links at internal and terminal positions. Copper turnings were used as catalyst, reducing the copper load of the reaction mixture and avoiding complexing agents. For oligonucleotide building block synthesis, a protecting group strategy was developed for 2'-O-propargyl-2-aminoadenosine owing to the rather different reactivities of the two amino groups. Phosphoramidites were synthesized bearing clickable 2'-O-propargyl residues (14 and 18) as well as a 2'-deoxyribofuranosyl residue (10). Hybridization experiments of non-cross-linked oligonucleotides with 2,6-diaminopurine as nucleobase showed no significant thermal stability changes over those containing adenine. Surprisingly, an isobutyryl group protecting the 2-amino function has no negative impact on the stability of DNA-DNA and DNA-RNA duplexes. Oligonucleotide duplexes with cross-linked 2'-O-propargylated 2-aminoadenosine (1) and 2'-O-propargylated adenosine (3) at terminal positions are significantly stabilized (ΔT(m) = +29 °C). The stability results from a molecularity change from duplex to hairpin melting and is influenced by the ligation position. Terminal ligation led to higher melting duplexes than corresponding hairpins, while duplexes with central ligation sites were less stable.

  2. DNA . RNA heteroduplex containing 8-oxo-7,8-dihydroguanosine: base pairing, structures, and thermodynamic stability.

    PubMed

    Kim, Sang Kook; Lee, Sung Hwa; Kwon, Oh-Shin; Moon, Byung Jo

    2004-11-30

    Oligoribonucleotides containing 8-oxo-7,8-dihydroguanosine (8-oxoG) and 8-oxo-7,8-dihydro-2'-O-methylguanosine (8-oxoG-Me) were synthesized. The base pairing properties of 8-oxoG and 8-oxoG-Me in oligoribonucleotide in cDNA synthesis by reverse transcriptases were studied. dCMP was preferentially incorporated into the site opposite 8-oxoG or 8-oxoG-Me than into other dNMPs. TMP and dCMP were inserted preferentially into sites opposite 8-oxoG or 8-oxoG by reverse transcriptases. HIV-RT did not incorporate TMP, but RAV2-RT incorporated 50% more TMP than dCMP into the site opposite 8-oxoG. In the site opposite 8-oxoG-Me TMP was substantially incorporated by HIV-RT or RAV2-RT. Thermodynamic analysis of the DNA.RNA heteroduplex containing 8-oxoG revealed that 8-oxoG and 8-oxoG-Me formed base pairs with cytidine and thymidine with similar stability. The thermodynamic parameter (DeltaG degrees ) demonstrated that the formation of duplexes between 8-oxoG or 8-oxoG-Me and cytidine or thymidine is more thermodynamically favorable than with adenosine and guanosine. However, differences in the melting temperature and DeltaG degrees 's of 8-oxoG/dC and 8-oxoG/T were much smaller than between G/dC and G/T. CD spectra showed that DNA . RNA containing 8-oxoG or 8-oxoG-Me duplexes showed similarities between the A-type RNA and B-type DNA conformations.

  3. Pyrazolo[3,4-d]pyrimidine nucleic acids: adjustment of dA-dT to dG-dC base pair stability.

    PubMed

    Seela, F; Becher, G

    2001-05-15

    Oligonucleotides incorporating 8-aza-7-deazapurin-2,6-diamine (pyrazolo[3,4-d]pyrimidin-4,6-diamine) nucleoside 2a or its 7-bromo derivative 2b show enhanced duplex stability compared to those containing dA. While incorporation of 2a opposite dT increases the T(m) value only slightly, the 7-bromo compound 2b forms a very stable base pair which is as strong as the dG-dC pair. Compound 2b shows a similar base discrimination in duplex DNA as dA. The base-modified nucleosides 2a,b have a significantly more stable N-glycosylic bond than the rather labile purin-2,6-diamine 2'-deoxyribonucleoside 1. Base protection with acyl groups, with which we had difficulties in the case of purine nucleoside 1, was effective with pyrazolo[3,4-d]-pyrimidine nucleosides 2a,b. Oligonucleotides containing 2a,b were obtained by solid phase synthesis employing phosphoramidite chemistry. Compound 2b harmonizes the stability of DNA duplexes. Their stability is no longer dependent on the base pair composition while they still maintain their sequence specificity. Thus, they have the potential to reduce the number of mispairs when hybridized in solution or immobilized on arrays.

  4. Effects of salt, polyethylene glycol, and locked nucleic acids on the thermodynamic stabilities of consecutive terminal adenosine mismatches in RNA duplexes.

    PubMed

    Gu, Xiaobo; Nguyen, Mai-Thao; Overacre, Abigail; Seaton, Samantha; Schroeder, Susan J

    2013-04-04

    Consecutive terminal mismatches add thermodynamic stability to RNA duplexes and occur frequently in microRNA-mRNA interactions. Accurate thermodynamic stabilities of consecutive terminal mismatches contribute to the development of specific, high-affinity siRNA therapeutics. Consecutive terminal adenosine mismatches (TAMS) are studied at different salt concentrations, with polyethylene glycol cosolutes, and with locked nucleic acid (LNA) substitutions. These measurements provide benchmarks for the application of thermodynamic predictions to different physiological or therapeutic conditions. The salt dependence for RNA duplex stability is similar for TAMS, internal loops, and Watson-Crick duplexes. A unified model for predicting the free energy of an RNA duplex with or without loops and mismatches at lower sodium concentrations is presented. The destabilizing effects of PEG 200 are larger for TAMS than internal loops or Watson-Crick duplexes, which may result from different base stacking conformations, dynamics, and water hydration. In contrast, LNA substitutions stabilize internal loops much more than TAMS. Surprisingly, the average per adenosine increase in stability for LNA substitutions in internal loops is -1.82 kcal/mol and only -0.20 kcal/mol for TAMS. The stabilities of TAMS and internal loops with LNA substitutions have similar favorable free energies. Thus, the unfavorable free energy of adenosine internal loops is largely an entropic effect. The favorable stabilities of TAMS result mainly from base stacking. The ability of RNA duplexes to form extended terminal mismatches in the absence of proteins such as argonaute and identifying the enthalpic contributions to terminal mismatch stabilities provide insight into the physical basis of microRNA-mRNA molecular recognition and specificity.

  5. Differential stability of 2'F-ANA*RNA and ANA*RNA hybrid duplexes: roles of structure, pseudohydrogen bonding, hydration, ion uptake and flexibility.

    PubMed

    Watts, Jonathan K; Martín-Pintado, Nerea; Gómez-Pinto, Irene; Schwartzentruber, Jeremy; Portella, Guillem; Orozco, Modesto; González, Carlos; Damha, Masad J

    2010-04-01

    Hybrids of RNA with arabinonucleic acids 2'F-ANA and ANA have very similar structures but strikingly different thermal stabilities. We now present a thorough study combining NMR and other biophysical methods together with state-of-the-art theoretical calculations on a fully modified 10-mer hybrid duplex. Comparison between the solution structure of 2'F-ANA*RNA and ANA*RNA hybrids indicates that the increased binding affinity of 2'F-ANA is related to several subtle differences, most importantly a favorable pseudohydrogen bond (2'F-purine H8) which contrasts with unfavorable 2'-OH-nucleobase steric interactions in the case of ANA. While both 2'F-ANA and ANA strands maintained conformations in the southern/eastern sugar pucker range, the 2'F-ANA strand's structure was more compatible with the A-like structure of a hybrid duplex. No dramatic differences are found in terms of relative hydration for the two hybrids, but the ANA*RNA duplex showed lower uptake of counterions than its 2'F-ANA*RNA counterpart. Finally, while the two hybrid duplexes are of similar rigidities, 2'F-ANA single strands may be more suitably preorganized for duplex formation. Thus the dramatically increased stability of 2'F-ANA*RNA and ANA*RNA duplexes is caused by differences in at least four areas, of which structure and pseudohydrogen bonding are the most important.

  6. NMR studies of exocyclic 1,N sup 2 -propanodeoxyguanosine adducts (X) opposite purines in DNA duplexes: Protonated X(syn)ter dot A(anti) pairing (acidic pH) and X(syn)ter dot G(anti) pairing (neutral pH) at the lesion site

    SciTech Connect

    Kouchakdjian, M.; Gao, X.; Patel, D. ); Marinelli, E.; Johnson, F.; Grollman, A. )

    1989-06-27

    Proton and phosphorus two-dimensional NMR studies are reported for the complementary d(C1-A2-T3-G4-X5-G6-T7-A8-C9){center dot}d(G10-T11-A12-C13-A14-C15-A16-T17-G18) nonanucleotide duplex (designated X{center dot}A 9-mer) that contains a 1,N{sup 2}-propanodeoxyguanosine exocyclic adduct, X5, opposite deoxyadenosine A14 in the center of the helix. The NMR studies detect a pH-dependent conformational transition; this paper focuses on the structure present at pH 5.8. The two-dimensional NOESY studies of the X{center dot}A 9-mer duplex in H{sub 2}O and D{sub 2}O solution establish that X5 adopts a syn orientation while A14 adopts an anti orientation about the glycosidic bond at the lesion site. At pH 5.8, the observed NOE between the H8 proton of X5 and the H2 proton of A14 in the X{center dot}A 9-mer duplex demonstrates unequivocally the formation of the protonated X5(syn){center dot}A14(anti) pair. A perturbation in the phosphodiester backbone is detected at the C13-A14 phosphorus located at the lesion site by {sup 31}P NMR spectroscopy. The two-dimensional NMR studies have been extended to the related complementary X{center dot}G 9-mer duplex that contains a central X5{center dot}G14 lesion in a sequence that is otherwise identical with the X{center dot}A 9-mer duplex. The NMR experimental parameters are consistent with formation of a pH-independent X5(syn){center dot}G14(anti) pair stabilized by two hydrogen bonds with the 1,N{sup 2}-propano exocyclic adduct of X5(syn) located in the major groove.

  7. Effects of Monofunctional Adducts of Platinum(II) Complexes on Thermodynamic Stability and Energetics of DNA Duplexes

    PubMed Central

    Bursova, Vendula; Kasparkova, Jana; Hofr, Ctirad; Brabec, Viktor

    2005-01-01

    Effects of adducts of [PtCl(NH3)3]Cl or chlorodiethylenetriamineplatinum(II) on DNA stability were studied with emphasis on thermodynamic origins of that stability. Oligodeoxyribonucleotide duplexes (15-bp) containing the single, site-specific monofunctional adduct at G-residues of the central sequences TGT/ACA or 5′-AGT/5′-ACT were prepared and analyzed by differential scanning calorimetry, temperature-dependent ultraviolet absorption and circular dichroism. The unfolding of the platinated duplexes was accompanied by relatively small unfavorable free energy terms. This destabilization was enthalpic in origin. On the other hand, a relatively large reduction of melting temperature (Tm) was observed as a consequence of the monofunctional adduct in the TGT sequence, whereas Tm due to the adduct in the AGT sequence was reduced only slightly. We also examined the efficiency of the mammalian nucleotide excision repair system to remove from DNA the monofunctional adducts and found that these lesions were not recognized by this repair system. Thus, rather thermodynamic than thermal characterization of DNA adducts of monofunctional platinum compounds is a property implicated in the modulation of downstream effects such as protein recognition and repair. PMID:15574710

  8. Kinematic stability of roller pairs in free rolling contact

    NASA Technical Reports Server (NTRS)

    Savage, M.; Loewenthal, S. H.

    1976-01-01

    A set of generalized stability equations was developed for roller pairs in free rolling contact. A symmetric, dual contact model was used. Four possible external contact profiles that possess continuous contacting surfaces were studied. It was found that kinematic stability would be insured if the larger radius of transverse curvature, in absolute value, and the smaller rolling radius both exist on the roller that has the apex of its conical surface outboard of its main body. The stability criteria developed are considered to be useful for assessing axial restraint requirements for a variety of roller mechanisms and in the selection of roller contact geometry for traction drive devices.

  9. Structure, stability and function of 5-chlorouracil modified A:U and G:U base pairs

    SciTech Connect

    Patra, Amritraj; Harp, Joel; Pallan, Pradeep S.; Zhao, Linlin; Abramov, Mikhail; Herdewijn, Piet; Egli, Martin

    2012-12-28

    The thymine analog 5-chlorouridine, first reported in the 1950s as anti-tumor agent, is known as an effective mutagen, clastogen and toxicant as well as an effective inducer of sister-chromatid exchange. Recently, the first microorganism with a chemically different genome was reported; the selected Escherichia coli strain relies on the four building blocks 5-chloro-2'-deoxyuridine (ClU), A, C and G instead of the standard T, A, C, G alphabet [Marlière,P., Patrouix,J., Döring,V., Herdewijn,P., Tricot,S., Cruveiller,S., Bouzon,M. and Mutzel,R. (2011) Chemical evolution of a bacterium’s genome. Angew. Chem. Int. Ed., 50, 7109–7114]. The residual fraction of T in the DNA of adapted bacteria was <2% and the switch from T to ClU was accompanied by a massive number of mutations, including >1500 A to G or G to A transitions in a culture. The former is most likely due to wobble base pairing between ClU and G, which may be more common for ClU than T. To identify potential changes in the geometries of base pairs and duplexes as a result of replacement of T by ClU, we determined four crystal structures of a B-form DNA dodecamer duplex containing ClU:A or ClU:G base pairs. The structures reveal nearly identical geometries of these pairs compared with T:A or T:G, respectively, and no consequences for stability and cleavage by an endonuclease (EcoRI). The lack of significant changes in the geometry of ClU:A and ClU:G base pairs relative to the corresponding native pairs is consistent with the sustained unlimited self-reproduction of E. coli strains with virtually complete T→ClU genome substitution.

  10. 2-Methoxypyridine as Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability and NMR Structural Studies.

    PubMed

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-08-31

    Development of nucleic acid base pair analogues that use new modes of molecular recognition is important for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme could enhance the thermal stability of DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability by ~10 ºC in DNA-DNA duplexes and ~20 ºC in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Contribution of the intrinsic mechanical energy of the phosphodiester linkage to the relative stability of the A, BI, and BII forms of duplex DNA.

    PubMed

    MacKerell, Alexander D

    2009-03-12

    Canonical forms of duplex DNA are known to sample well-defined regions of the alpha, beta, gamma, epsilon, and zeta dihedral angles that define the conformation of the phosphodiester linkage in the backbone of oligonucleotides. While extensive studies of base composition and base sequence dependent effects on the sampling of the A, B1, and BII canonical forms of duplex DNA have been presented, our understanding of the intrinsic contribution of the five dihedral degrees of freedom associated with the phosphodiester linkage to the conformational properties of duplex DNA is still limited. To better understand this contribution, ab initio quantum mechanical (QM) calculations were performed on a model compound representative of the phosphodiester backbone to systematically sample the energetics about the alpha, beta, gamma, epsilon, and zeta dihedral angles relevant to the conformational properties of duplex DNA. Low-energy regions of dihedral potential energy surfaces are shown to correlate with the regions of dihedral space sampled in experimental crystal structures of the canonical forms of DNA, validating the utility of the model compound and emphasizing the contribution of the intrinsic mechanical properties of the phosphodiester backbone to the conformational properties of duplex DNA. Those contributions include the relative stability of the A, BI, and BII conformations of duplex DNA, where the gas-phase energetics favor the BI form over the A and BII forms. In addition, subtle features of the potential energy surfaces mimic changes in the probability distributions of alpha, beta, gamma, epsilon, and zeta dihedral angles in A, BI, and BII forms of DNA as well as with conformations sampled in single-stranded DNA. These results show that the intrinsic mechanical properties of the phosphodiester backbone make a significant contribution to conformational properties of duplex DNA observed in the condensed phase and allow for the prediction that single-stranded DNA

  12. Contribution of the intrinsic mechanical energy of the phosphodiester linkage to the relative stability of the A, BI and BII forms of duplex DNA

    PubMed Central

    MacKerell, Alexander D.

    2009-01-01

    Canonical forms of duplex DNA are known to sample well defined regions of the α, β, γ, ε and ζ dihedral angles that define the conformation of the phosphodiester linkage in the backbone of oligonucleotides. While extensive studies of base composition and base sequence dependent effects on the sampling of the A, BI and BII canonical forms of duplex DNA have been presented, our understanding of the intrinsic contribution of the five dihedral degrees of freedom associated with the phosphodiester linkage to the conformational properties of duplex DNA is still limited. To better understand this contribution ab initio quantum mechanical (QM) calculations were performed on a model compound representative of the phosphodiester backbone to systematically sample the energetics about the α β γ ε and ζ dihedral angles relevant to the conformational properties of duplex DNA. Low energy regions of dihedral potential energy surfaces are shown to correlate with the regions of dihedral space sampled in experimental crystal structures of the canonical forms of DNA, validating the utility of the model compound and emphasizing the contribution of the intrinsic mechanical properties of the phosphodiester backbone to the conformational properties of duplex DNA. Those contributions include the relative stability of the A, BI and BII conformations of duplex DNA, where the gas phase energetics favor the BI form over the A and BII forms. In addition, subtle features of the potential energy surfaces mimic changes in the probability distributions of α, β, γ, ε and ζ dihedral angles in A, BI and BII forms of DNA as well as with conformations sampled in single-stranded DNA. These results show that the intrinsic mechanical properties of the phosphodiester backbone make a significant contribution to conformational properties of duplex DNA observed in the condensed phase and allow for the prediction that single stranded DNA primarly samples folded conformations thereby possibly

  13. The structure of the human tRNALys3 anticodon bound to the HIV genome is stabilized by modified nucleosides and adjacent mismatch base pairs.

    PubMed

    Bilbille, Yann; Vendeix, Franck A P; Guenther, Richard; Malkiewicz, Andrzej; Ariza, Xavier; Vilarrasa, Jaume; Agris, Paul F

    2009-06-01

    Replication of human immunodeficiency virus (HIV) requires base pairing of the reverse transcriptase primer, human tRNA(Lys3), to the viral RNA. Although the major complementary base pairing occurs between the HIV primer binding sequence (PBS) and the tRNA's 3'-terminus, an important discriminatory, secondary contact occurs between the viral A-rich Loop I, 5'-adjacent to the PBS, and the modified, U-rich anticodon domain of tRNA(Lys3). The importance of individual and combined anticodon modifications to the tRNA/HIV-1 Loop I RNA's interaction was determined. The thermal stabilities of variously modified tRNA anticodon region sequences bound to the Loop I of viral sub(sero)types G and B were analyzed and the structure of one duplex containing two modified nucleosides was determined using NMR spectroscopy and restrained molecular dynamics. The modifications 2-thiouridine, s(2)U(34), and pseudouridine, Psi(39), appreciably stabilized the interaction of the anticodon region with the viral subtype G and B RNAs. The structure of the duplex results in two coaxially stacked A-form RNA stems separated by two mismatched base pairs, U(162)*Psi(39) and G(163)*A(38), that maintained a reasonable A-form helix diameter. The tRNA's s(2)U(34) stabilized the interaction between the A-rich HIV Loop I sequence and the U-rich anticodon, whereas the tRNA's Psi(39) stabilized the adjacent mismatched pairs.

  14. Comprehensive Deformation Analysis of a Newly Designed Ni-Free Duplex Stainless Steel with Enhanced Plasticity by Optimizing Austenite Stability

    NASA Astrophysics Data System (ADS)

    Moallemi, Mohammad; Zarei-Hanzaki, Abbas; Eskandari, Mostafa; Burrows, Andrew; Alimadadi, Hossein

    2017-08-01

    A new metastable Ni-free duplex stainless steel has been designed with superior plasticity by optimizing austenite stability using thermodynamic calculations of stacking fault energy and with reference to literature findings. Several characterization methods comprising optical microscopy, magnetic phase measurements, X-ray diffraction (XRD) and electron backscattered diffraction were employed to study the plastic deformation behavior and to identify the operating plasticity mechanisms. The results obtained show that the newly designed duplex alloy exhibits some extraordinary mechanical properties, including an ultimate tensile strength of 900 MPa and elongation to fracture of 94 pct due to the synergistic effects of transformation-induced plasticity and twinning-induced plasticity. The deformation mechanism of austenite is complex and includes deformation banding, strain-induced martensite formation, and deformation-induced twinning, while the ferrite phase mainly deforms by dislocation slip. Texture analysis indicates that the Copper and Rotated Brass textures in austenite (FCC phase) and {001}<110> texture in ferrite and martensite (BCC phases) are the main active components during tensile deformation. The predominance of these components is logically related to the strain-induced martensite and/or twin formation.

  15. Electrochemiluminescent monomers for solid support syntheses of Ru(II)-PNA bioconjugates: multimodal biosensing tools with enhanced duplex stability.

    PubMed

    Joshi, Tanmaya; Barbante, Gregory J; Francis, Paul S; Hogan, Conor F; Bond, Alan M; Gasser, Gilles; Spiccia, Leone

    2012-03-05

    The feasibility of devising a solid support mediated approach to multimodal Ru(II)-peptide nucleic acid (PNA) oligomers is explored. Three Ru(II)-PNA-like monomers, [Ru(bpy)(2)(Cpp-L-PNA-OH)](2+) (M1), [Ru(phen)(2)(Cpp-L-PNA-OH)](2+) (M2), and [Ru(dppz)(2)(Cpp-L-PNA-OH)](2+) (M3) (bpy = 2,2'-bipyridine, phen = 1,10-phenanthroline, dppz = dipyrido[3,2-a:2',3'-c]phenazine, Cpp-L-PNA-OH = [2-(N-9-fluorenylmethoxycarbonyl)aminoethyl]-N-[6-(2-(pyridin-2yl)pyrimidine-4-carboxamido)hexanoyl]-glycine), have been synthesized as building blocks for Ru(II)-PNA oligomers and characterized by IR and (1)H NMR spectroscopy, mass spectrometry, electrochemistry and elemental analysis. As a proof of principle, M1 was incorporated on the solid phase within the PNA sequences H-g-c-a-a-t-a-a-a-a-Lys-NH(2) (PNA1) and H-P-K-K-K-R-K-V-g-c-a-a-t-a-a-a-a-lys-NH(2) (PNA4) to give PNA2 (H-g-c-a-a-t-a-a-a-a-M1-lys-NH(2)) and PNA3 (H-P-K-K-K-R-K-V-g-c-a-a-t-a-a-a-a-M1-lys-NH(2)), respectively. The two Ru(II)-PNA oligomers, PNA2 and PNA3, displayed a metal to ligand charge transfer (MLCT) transition band centered around 445 nm and an emission maximum at about 680 nm following 450 nm excitation in aqueous solutions (10 mM PBS, pH 7.4). The absorption and emission response of the duplexes formed with the cDNA strand (DNA: 5'-T-T-T-T-T-T-T-A-T-T-G-C-T-T-T-3') showed no major variations, suggesting that the electronic properties of the Ru(II) complexes are largely unaffected by hybridization. The thermal stability of the PNA·DNA duplexes, as evaluated from UV melting experiments, is enhanced compared to the corresponding nonmetalated duplexes. The melting temperature (T(m)) was almost 8 °C higher for PNA2·DNA duplex, and 4 °C for PNA3·DNA duplex, with the stabilization attributed to the electrostatic interaction between the cationic residues (Ru(II) unit and positively charged lysine/arginine) and the polyanionic DNA backbone. In presence of tripropylamine (TPA) as co-reactant, PNA2, PNA3, PNA2

  16. Pairing Geometry of the Hydrophobic Thymine Analogue 2,4-Difluorotoluene in Duplex DNA as Analyzed by X-ray Crystallography

    SciTech Connect

    Pallan, Pradeep S.; Egli, Martin

    2009-12-01

    Certain DNA polymerases (pols) were found to efficiently insert A opposite the hydrophobic T isostere 2,4-difluorotoluene (F) and vice versa, resulting in the widely held belief that some pols rely on shape rather than H-bonding for accurate replication. Using X-ray crystallography we have analyzed the geometry of F:A pairs in duplex DNA and observed a distance between fluorine and the exocyclic amino group of A that is consistent with a H-bond, thus challenging the assumption that the F analogue is unable to engage in H-bonding as well as the steric hypothesis of DNA replication. Therefore, shape and H-bonding are inherently related, and steric constraints at a pol active site, or conferred by stacking or the DNA backbone conformation, may enable H-bonding by F.

  17. Separation of preferential interaction and excluded volume effects on DNA duplex and hairpin stability

    PubMed Central

    Knowles, D. B.; LaCroix, Andrew S.; Deines, Nickolas F.; Shkel, Irina; Record, M. Thomas

    2011-01-01

    Small solutes affect protein and nucleic acid processes because of favorable or unfavorable chemical interactions of the solute with the biopolymer surface exposed or buried in the process. Large solutes also exclude volume and affect processes where biopolymer molecularity and/or shape changes. Here, we develop an analysis to separate and interpret or predict excluded volume and chemical effects of a flexible coil polymer on a process. We report a study of the concentration-dependent effects of the full series from monomeric to polymeric PEG on intramolecular hairpin and intermolecular duplex formation by 12-nucleotide DNA strands. We find that chemical effects of PEG on these processes increase in proportion to the product of the amount of DNA surface exposed on melting and the amount of PEG surface that is accessible to this DNA, and these effects are completely described by two interaction terms that quantify the interactions between this DNA surface and PEG end and interior groups. We find that excluded volume effects, once separated from these chemical effects, are quantitatively described by the analytical theory of Hermans, which predicts the excluded volume between a flexible polymer and a rigid molecule. From this analysis, we show that at constant concentration of PEG monomer, increasing PEG size increases the excluded volume effect but decreases the chemical interaction effect, because in a large PEG coil a smaller fraction of the monomers are accessible to the DNA. Volume exclusion by PEG has a much larger effect on intermolecular duplex formation than on intramolecular hairpin formation. PMID:21742980

  18. Oligodeoxynucleoside phosphoramidates (P-NH2): synthesis and thermal stability of duplexes with DNA and RNA targets.

    PubMed Central

    Peyrottes, S; Vasseur, J J; Imbach, J L; Rayner, B

    1996-01-01

    Syntheses of non ionic oligodeoxynucleoside phosphoramidates (P-NH2) and mixed phosphoramidate- phosphodiester oligomers were accomplished on automated solid supported DNA synthesizer using both H-phosphonate and phosphoramidite chemistries, in combination with t-butylphenoxyacetyl for N-protection of nucleoside bases, an oxalyl anchored solid support and a final treatment with methanolic ammonia. Thermal stabilities of the hybrids formed between these new analogues and their DNA and RNA complementary strands were determined and compared with those of the corresponding unmodified oligonucleotides, as well as of the phosphorothioate and methylphosphonate derivatives. Dodecathymidines containing P-NH2 links form less stable duplexes with DNA targets, d(C2A12C2) (deltaTm/modification -1.4 degrees C) and poly dA (deltaTm/modification -1.1 degrees C) than the corresponding phosphodiester and methylphosphonate analogues, but the hybrids are slightly more stable than the one obtained with phosphorothioate derivative. The destabilization is more pronounced with poly rA as the target (deltaTm/modification -3 degrees C) and could be compared with that found with the dodecathymidine methylphosphonate. The modification is less destabilizing in an heteropolymer-RNA duplex (deltaTm/modification -2 degrees C). As expected, the P-NH2 modifications are highly resistant towards the action of various nucleases. It is also demonstrated that an all P-NH2 oligothymidine does not elicit Escherichia coli RNase H hydrolysis of the poly rA target but that the modification may be exploited in chimeric oligonucleotides combining P-NH2 sections with a central phosphodiester section. PMID:8657564

  19. Base-pairing behavior of a carbocyclic Janus-AT nucleoside analogue capable of recognizing A and T within a DNA duplex.

    PubMed

    Largy, Eric; Liu, Wenbo; Hasan, Abid; Perrin, David M

    2013-11-04

    Janus-type nucleosides are heterocycles with two faces, each of which is designed to complement the H-bonding interactions of natural nucleosides comprising a canonical Watson-Crick base pair. By intercepting all of the hydrogen bonds contained within the base pair, oligomeric Janus nucleosides are expected to achieve sequence-specific DNA recognition through the formation of J-loops that will be more stable than D-loops, which simply replaces one base-pair with another. Herein, we report the synthesis of a novel Janus-AT nucleoside analogue, JAT , affixed on a carbocyclic analogue of deoxyribose that was converted to the corresponding phosphoramidite. A single JAT was successfully incorporated into a DNA strand by solid phase for targeting both A and T bases, and characterized through biophysical and computational methods. Experimental UV-melting and circular dichroism data demonstrated that within the context of a standard duplex, JAT associates preferentially with T over A, and much more poorly with C and G. Density functional theory calculations confirm that the JAT structure is well suited to associate only with A and T thereby highlighting the importance of the electronic structure in terms of H-bonding. Finally, molecular dynamics simulations validated the observation that JAT can substitute more effectively as an A-analogue than as a T-analogue without substantial distortion of the B-helix. Overall, this new Janus nucleotide is a promising tool for the targeting of A-T base pairs in DNA, and will lead to the development of oligo-Janus-nucleotide strands for sequence-specific DNA recognition.

  20. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    PubMed

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (Tm =43 °C) than that incorporating the β-dC-Ag(+) -β-dC homo pair (Tm =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large Tm value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Ligand-Induced Stabilization of a Duplex-like Architecture Is Crucial for the Switching Mechanism of the SAM-III Riboswitch.

    PubMed

    Suresh, Gorle; Srinivasan, Harini; Nanda, Shivani; Priyakumar, U Deva

    2016-06-21

    Riboswitches are structured RNA motifs that control gene expression by sensing the concentrations of specific metabolites and make up a promising new class of antibiotic targets. S-Adenosylmethionine (SAM)-III riboswitch, mainly found in lactic acid bacteria, is involved in regulating methionine and SAM biosynthetic pathways. SAM-III riboswitch regulates the gene expression by switching the translation process on and off with respect to the absence and presence of the SAM ligand, respectively. In this study, an attempt is made to understand the key conformational transitions involved in ligand binding using atomistic molecular dynamics (MD) simulations performed in an explicit solvent environment. G26 is found to recognize the SAM ligand by forming hydrogen bonds, whereas the absence of the ligand leads to opening of the binding pocket. Consistent with experimental results, the absence of the SAM ligand weakens the base pairing interactions between the nucleobases that are part of the Shine-Dalgarno (SD) and anti-Shine-Dalgarno (aSD) sequences, which in turn facilitates recognition of the SD sequence by ribosomes. Detailed analysis reveals that a duplex-like structure formed by nucleotides from different parts of the RNA and the adenine base of the ligand is crucial for the stability of the completely folded state in the presence of the ligand. Previous experimental studies have shown that the SAM-III riboswitch exists in equilibrium between the unfolded and partially folded states in the absence of the ligand, which completely folds upon binding of the ligand. Comparison of the results presented here to the available experimental data indicates the structures obtained using the MD simulations resemble the partially folded state. Thus, this study provides a detailed understanding of the fully and partially folded structures of the SAM-III riboswitch in the presence and absence of the ligand, respectively. This study hypothesizes a dual role for the SAM ligand

  2. LNA units present in the (2'-OMe)-RNA strand stabilize parallel duplexes (2'-OMe)-RNA/[All-R(P)-PS]-DNA and parallel triplexes (2'-OMe)-RNA/[All-R(P)-PS]-DNA/RNA. An improved tool for the inhibition of reverse transcription.

    PubMed

    Maciaszek, Anna; Krakowiak, Agnieszka; Janicka, Magdalena; Tomaszewska-Antczak, Agnieszka; Sobczak, Milena; Mikołajczyk, Barbara; Guga, Piotr

    2015-02-28

    Homopurine phosphorothioate analogs of DNA, possessing all phosphorus atoms of RP configuration ([All-RP-PS]-DNA), when interact with appropriate complementary RNA or (2'-OMe)-RNA templates, form parallel triplexes or parallel duplexes of very high thermodynamic stability. The present results show that T-LNA or 5-Me-C-LNA units introduced into the parallel Hoogsteen-paired (2'-OMe)-RNA strands (up to four units in the oligomers of 9 or 12 nt in length) stabilize these parallel complexes. At neutral pH, dodecameric parallel duplexes have Tm values of 62-68 °C, which are by 4-10 °C higher than Tm for the reference duplex (with no LNA units present), while for the corresponding triplexes, Tm values exceeded 85 °C. For nonameric parallel duplexes, melting temperatures of 38-62 °C were found and (2'-OMe)-RNA oligomers containing 5-Me-C-LNA units stabilized the complexes more efficiently than the T-LNA containing congeners. In both series the stability of the parallel complexes increased with an increasing number of LNA units present. The same trend was observed in experiments of reverse transcription RNA→DNA (using AMV RT reverse transcriptase) where the formation of parallel triplexes (consisting of an RNA template, [All-RP-PS]-DNA nonamer and Hoogsteen-paired (2'-OMe)-RNA strands containing the LNA units) led to the efficient inhibition of the process. Under the best conditions checked (four 5-Me-C-LNA units, three-fold excess over the RNA template) the inhibition was 94% effective, compared to 71% inhibition observed in the reference system with the Hoogsteen-paired (2'-OMe)-RNA strand carrying no LNA units. This kind of complexation may "arrest" harmful RNA oligomers (e.g., viral RNA or mRNA of unwanted proteins) and, beneficially, exclude them from enzymatic processes, otherwise leading to viral or genetic diseases.

  3. Hybridization accompanying FRET event in labeled natural nucleoside-unnatural nucleoside containing chimeric DNA duplexes.

    PubMed

    Bag, Subhendu Sekhar; Das, Suman K; Pradhan, Manoj Kumar; Jana, Subhashis

    2016-09-01

    Förster resonance energy transfer (FRET) is a highly efficient strategy in illuminating the structures, structural changes and dynamics of DNA, proteins and other biomolecules and thus is being widely utilized in studying such phenomena, in designing molecular/biomolecular probes for monitoring the hybridization event of two single stranded DNA to form duplex, in gene detection and in many other sensory applications in chemistry, biology and material sciences. Moreover, FRET can give information about the positional status of chromophores within the associated biomolecules with much more accuracy than other methods can yield. Toward this end, we want to report here the ability of fluorescent unnatural nucleoside, triazolylphenanthrene ((TPhen)BDo) to show FRET interaction upon hybridization with fluorescently labeled natural nucleosides, (Per)U or (OxoPy)U or (Per)U, forming two stable chimeric DNA duplexes. The pairing selectivity and the thermal duplex stability of the chimeric duplexes are higher than any of the duplexes with natural nucleoside formed. The hybridization results in a Förster resonance energy transfer (FRET) from donor triazolylphenanthrene of (TPhen)BDo to acceptor oxopyrene of (OxoPy)U and/or to perylene chromophore of (Per)U, respectively, in two chimeric DNA duplexes. Therefore, we have established the FRET process in two chimeric DNA duplexes wherein a fluorescently labeled natural nucleoside ((OxoPy)U or (Per)U) paired against an unnatural nucleoside ((TPhen)BDo) without sacrificing the duplex stability and B-DNA conformation. The hybridization accompanying FRET event in these classes of interacting fluorophores is new. Moreover, there is no report of such designed system of chimeric DNA duplex. Our observed phenomenon and the design can potentially be exploited in designing more of such efficient FRET pairs for useful application in the detection and analysis of biomolecular interactions and in material science application. Copyright

  4. 2-Amino-alpha-2'-deoxyadenosine increased duplex stability of methoxyethylphosphoramidate alpha-oligodeoxynucleotides with RNA target.

    PubMed

    Naval, Magali; Michel, Thibaut; Vasseur, Jean-Jacques; Debart, Françoise

    2002-06-03

    A new efficient synthesis of 2-amino-alpha-2'-deoxyadenosine and its incorporation into methoxyethylphosphoramidate alpha-oligodeoxynucleotides (ODNs) via H-phosphonate chemistry were reported. Thermal denaturation experiments demonstrated a significant stabilization of the complexes formed between these analogues and their RNA target (+2 degrees C/NH2A) relative to adenosine-containing phosphoramidate alpha-oligonucleotides. Concerning the binding specificity of these modified ODNs, unlike natural ODNs, discrimination against G pairing is higher and against C pairing is lower.

  5. Orbiting pairs of walking droplets: Dynamics and stability

    NASA Astrophysics Data System (ADS)

    Oza, Anand U.; Siéfert, Emmanuel; Harris, Daniel M.; Moláček, Jan; Bush, John W. M.

    2017-05-01

    A decade ago, Couder and Fort [Phys. Rev. Lett. 97, 154101 (2006)], 10.1103/PhysRevLett.97.154101 discovered that a millimetric droplet sustained on the surface of a vibrating fluid bath may self-propel through a resonant interaction with its own wave field. We here present the results of a combined experimental and theoretical investigation of the interactions of such walking droplets. Specifically, we delimit experimentally the different regimes for an orbiting pair of identical walkers and extend the theoretical model of Oza et al. [J. Fluid Mech. 737, 552 (2013)], 10.1017/jfm.2013.581 in order to rationalize our observations. A quantitative comparison between experiment and theory highlights the importance of spatial damping of the wave field. Our results also indicate that walkers adapt their impact phase according to the local wave height, an effect that stabilizes orbiting bound states.

  6. Duplex ultrasound

    MedlinePlus

    ... duplex ultrasound combines: Traditional ultrasound: This uses sound waves that bounce off blood vessels to create pictures. Doppler ultrasound: This records sound waves reflecting off moving objects, such as blood, to ...

  7. Enhancement of gene silencing potency and nuclease stability by chemically modified duplex RNA.

    PubMed

    Kubo, Takanori; Zhelev, Zhivko; Bakalova, Rumiana; Ohba, Hideki

    2007-01-01

    In this study, we describe a development of chemically modified dsRNAs with improved biological properties. These dsRNAs possess an enhanced RNAi activity and a dramatically increased stability in cell cultured medium (containing 10% serum) in comparison with widely used 21nt siRNA. The chemically modified dsRNAs manifested a high longterm gene suppression after one week post-transfection, whereas 21nt siRNA showed a high RNAi activity only after 48 h cell transfection.

  8. Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

    PubMed

    Patel, D J; Canuel, L L

    1977-07-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

  9. Pyrimidine-pyrimidine base pairs stabilized by silver(I) ions.

    PubMed

    Urata, Hidehito; Yamaguchi, Eriko; Nakamura, Yasunari; Wada, Shun-ichi

    2011-01-21

    In the presence of Ag(I) ions, the C-T and m(5)iC (5-methylisocytosine)-T base pairs showed comparable stability to the C-Ag(I)-C base pair, and the m(5)iC-C base pair was highly stabilized by the synergetic effect of Ag(I) coordination and possible hydrogen bonding.

  10. Synthesis and characterization of DNA duplexes containing an N3T-ethyl-N3T interstrand crosslink in opposite orientations.

    PubMed

    Wilds, Christopher J; Noronha, Anne M; Robidoux, Sebastien; Miller, Paul S

    2005-01-01

    DNA duplexes containing an ethyl interstrand crosslink that bridges the N3 atoms of thymidines on the opposite strands have been synthesized using an approach that combines conventional solid phase oligonucleotide synthesis and the selective removal of protecting groups of a crosslinked thymidine dimer. This approach allows for the assembly of a crosslinked duplex directly on the solid support. Duplexes that contain a N3T-ethyl-N3T interstrand crosslink in a staggered orientation at either a -TA- or -AT-step in a duplex have been prepared. When placed in an -AT- step of a duplex the effect was stabilizing relative to the non-crosslinked control duplex (deltaTm= +24 degrees C) and this crosslinked duplex was found to efficiently form multimers in the presence of T4 ligase. In the case of the -TA- crosslinked duplex the stabilizing effect was less pronounced (deltaT.= +6 degrees C) and likewise did not undergo self ligation under identical conditions. Molecular modeling studies suggested that the -AT- containing lesion had little deviation in structure relative to the non-crosslinked duplex DNA control, whereas the -TA- crosslinked duplex exhibited significant buckling of the base pairs flanking the lesion.

  11. Using DNA duplex stability information for transcription factor binding site discovery.

    PubMed

    Gordân, Raluca; Hartemink, Alexander J

    2008-01-01

    Transcription factor (TF) binding site discovery is an important step in understanding transcriptional regulation. Many computational tools have already been developed, but their success in detecting TF motifs is still limited. We believe one of the main reasons for the low accuracy of current methods is that they do not take into account the structural aspects of TF-DNA interaction. We have previously shown that knowledge about the structural class of the TF and information about nucleosome occupancy can be used to improve motif discovery. Here, we demonstrate the benefits of using information about the DNA double-helical stability for motif discovery. We notice that, in general, the energy needed to destabilize the DNA double helix is higher at TF binding sites than at random DNA sites. We use this information to derive informative positional priors that we incorporate into a motif finding algorithm. When applied to yeast ChIP-chip data, the new informative priors improve the performance of the motif finder significantly when compared to priors that do not use the energetic stability information.

  12. Stability and functional effectiveness of phosphorothioate modified duplex DNA and synthetic 'mini-genes'.

    PubMed

    Ciafrè, S A; Rinaldi, M; Gasparini, P; Seripa, D; Bisceglia, L; Zelante, L; Farace, M G; Fazio, V M

    1995-10-25

    Several gene transfer techniques that employ 'naked DNA' molecules have recently been developed and numerous gene therapy protocols that make use of 'naked-DNA' have been proposed. We studied the possibility of enhancing the stability of 'naked DNA vectors' and thus also gene transfer and expression efficiencies, by constructing phosphorothioate (PS-) double strand DNA molecules and functional transcription units. We first synthesized short PS-double strand DNA molecules by the annealing of two complementary, 35 nt long, oligonucleotides. The accessibility of DNA modifying enzymes to this molecule was significantly decreased: T4-ligase and kinase activity were respectively reduced up to 1/2 and to 1/6, as compared to the normal phosphodiester molecule. Nucleolytic stability was increased either to purified enzymes (DNase I and Bal31) or to incubations in fresh serum, cell culture medium or in muscle protein extract. Phosphorothioate end-capped complete eukaryotic transcription units (obtained by Taq polymerase amplification with PS-primers) were not significantly protected from nucleolytic attack. On the contrary, synthetic transcription units, 'mini genes', obtained by Taq amplification with 1, 2 or 3 PS-dNTP substitutions, were resistant to DNase I and Bal31 nucleolytic activity. Transcription efficiency, driven by the T7 promoter, was 96.5, 95 and 33.5% (respectively with 1, 2 or 3 substitutions), as compared to the normal phosphodiester molecules.

  13. Positional and Neighboring Base Pair Effects on the Thermodynamic Stability of RNA Single Mismatches†

    PubMed Central

    Davis, Amber R.; Znosko, Brent M.

    2010-01-01

    Many naturally occurring RNA structures contain single mismatches, many of which occur near the ends of helices. However, previous thermodynamic studies have focused their efforts on thermodynamically characterizing centrally placed single mismatches. Additionally, algorithms currently used to predict secondary structure from sequence are based on two assumptions to predict stability of RNA duplexes containing this motif. It has been assumed that the thermodynamic contribution of small RNA motifs is independent of both its position in the duplex and identity of the non-nearest neighbors. Thermodynamically characterizing single mismatches three nucleotides from both the 3′ and 5′ ends (i.e., off-center) of an RNA duplex and comparing these results to those of the same single mismatch-nearest neighbor combination centrally located has allowed for the investigation of these effects. The thermodynamic contribution of 13 single mismatch-nearest neighbor combinations are reported but only 9 combinations are studied at all three duplex positions and are used to determine trends and patterns. In general, the 5′ and 3′ shifted single mismatches are relatively similar, on average, and more favorable in free energy than centrally placed single mismatches. However, close examination and comparison shows there are several associated idiosyncrasies with these identified general trends. These peculiarities may be due, in part, to the identities of the single mismatch, the nearest neighbors, and the non-nearest neighbors, along with the effects of single mismatch position in the duplex. The prediction algorithm recently proposed by Davis and Znosko (Biochemistry 47, 10178–10187) is used to predict the thermodynamic parameters of single mismatch contribution and is compared to the measured values presented here. This comparison suggests the proposed model is a good approximation but could be improved by the addition of parameters which account for positional and/or non

  14. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    PubMed

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  15. Spermine Condenses DNA, but Not RNA Duplexes

    SciTech Connect

    Katz, Andrea M.; Tolokh, Igor S.; Pabit, Suzette A.; Baker, Nathan; Onufriev, Alexey V.; Pollack, Lois

    2017-01-01

    Interactions between the polyamine spermine and nucleic acids drive important cellular processes. Spermine condenses DNA, and some RNAs such as poly(rA):poly(rU). A large fraction of the spermine present in cells is bound to RNA, but apparently does not condense it. Here, we study the effect of spermine binding to short duplex RNA and DNA and compare our findings with predictions of molecular dynamics simulations. When small numbers of spermine are introduced, RNA with a designed sequence, containing a mixture of 14 GC pairs and 11 AU pairs, resists condensation relative to DNA of an equivalent sequence or to 25 base pair poly(rA):poly(rU) RNA. Comparison of wide-angle x-ray scattering profiles with simulation suggests that spermine is sequestered deep within the major groove of mixed sequence RNA, preventing condensation by limiting opportunities to bridge to other molecules as well as stabilizing the RNA by locking it into a particular conformation. In contrast, for DNA, simulations suggest that spermine binds external to the duplex, offering opportunities for intermolecular interaction. The goal of this study is to explain how RNA can remain soluble, and available for interaction with other molecules in the cell, despite the presence of spermine at concentrations high enough to precipitate DNA.

  16. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair.

  17. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    SciTech Connect

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  18. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  19. Positional and neighboring base pair effects on the thermodynamic stability of RNA single mismatches.

    PubMed

    Davis, Amber R; Znosko, Brent M

    2010-10-12

    Many naturally occurring RNA structures contain single mismatches, many of which occur near the ends of helices. However, previous thermodynamic studies have focused their efforts on thermodynamically characterizing centrally placed single mismatches. Additionally, algorithms currently used to predict secondary structure from sequence are based on two assumptions for predicting the stability of RNA duplexes containing this motif. It has been assumed that the thermodynamic contribution of small RNA motifs is independent of both its position in the duplex and the identity of the non-nearest neighbors. Thermodynamically characterizing single mismatches three nucleotides from both the 3' and 5' ends (i.e., off-center) of an RNA duplex and comparing these results to those of the same single mismatch-nearest neighbor combination centrally located have allowed for the investigation of these effects. The thermodynamic contributions of 13 single mismatch-nearest neighbor combinations are reported, but only nine combinations are studied at all three duplex positions and are used to determine trends and patterns. In general, the 5'- and 3'-shifted single mismatches are relatively similar, on average, and more favorable in free energy than centrally placed single mismatches. However, close examination and comparison shows there are several associated idiosyncrasies with these identified general trends. These peculiarities may be due, in part, to the identities of the single mismatch, the nearest neighbors, and the non-nearest neighbors, along with the effects of the single mismatch position in the duplex. The prediction algorithm recently proposed by Davis and Znosko [Davis, A. R., and Znosko, B. M. (2008) Biochemistry 47, 10178-10187] is used to predict the thermodynamic parameters of single mismatch contribution, and those values are compared to the measured values presented here. This comparison suggests the proposed model is a good approximation but could be improved by

  20. Calculation of the stabilization energies of oxidatively damaged guanine base pairs with guanine.

    PubMed

    Suzuki, Masayo; Kino, Katsuhito; Morikawa, Masayuki; Kobayashi, Takanobu; Komori, Rie; Miyazawa, Hiroshi

    2012-06-01

    DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H)-oxazolone (Oz), guanidinohydantoin (Gh)/iminoallantoin (Ia) and spiro-imino-dihydantoin (Sp) are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  1. Stability, Chaos and Entrapment of Stars in Very Wide Pairs

    DTIC Science & Technology

    2012-01-01

    M., 1970, A&A, 9, 24 Jiang Y.-F., Tremaine S., 2010, MNRAS, 401, 977 King I., Gilmore G., van der Kruit P. C., 1990, The Milky Way as a Galaxy...reflection is necessary, because only retrograde trajectories are stable. A stable trajectory obtained this way for a pair of initially unbound stars

  2. Spermine moiety attached to the C-5 position of deoxyuridine enhances the duplex stability of the phosphorothioate DNA/complementary DNA and shows the susceptibility of the substrate to RNase H.

    PubMed

    Moriguchi, Tomohisa; Sakai, Hideaki; Suzuki, Hideo; Shinozuka, Kazuo

    2008-09-01

    Novel phosphorothioate-modified oligodeoxynucleotides (S-ODNs) containing a deoxyuridine derivative bearing a spermine moiety at the C-5 position were synthesized. The study of the thermal stability and the thermodynamic stability showed that the modified S-ODNs have been able to form the stable duplexes with the complementary DNA. It was also found that the duplex composed of the modified S-ODN and its complementary RNA strand is the substrate for Escherichia coli RNase H, and the cleavage of the RNA strand by the enzyme was almost similar as in the case of the unmodified one.

  3. Hydrophobic, Non-Hydrogen-Bonding Bases and Base Pairs in DNA

    PubMed Central

    Schweitzer, Barbara A.; Kool, Eric T.

    2009-01-01

    We report the properties of hydrophobic isosteres of pyrimidines and purines in synthetic DNA duplexes. Phenyl nucleosides 1 and 2 are nonpolar isosteres of the natural thymidine nucleoside, and indole nucleoside 3 is an analog of the complementary purine 2-aminodeoxyadenosine. The nucleosides were incorporated into synthetic oligodeoxynucleotides and were paired against each other and against the natural bases. Thermal denaturation experiments were used to measure the stabilities of the duplexes at neutral pH. It is found that the hydrophobic base analogs are nonselective in pairing with the four natural bases but selective for pairing with each other rather than with the natural bases. For example, compound 2 selectively pairs with itself rather than with A, T, G, or C; the magnitude of this selectivity is found to be 6.5–9.3 °C in Tm or 1.5–1.8 kcal/mol in free energy (25 °C). All possible hydrophobic pairing combinations of 1, 2, and 3 were examined. Results show that the pairing affinity depends on the nature of the pairs and on position in the duplex. The highest affinity pairs are found to be the 1–1 and 2–2 self-pairs and the 1–2 heteropair. The best stabilization occurs when the pairs are placed at the ends of duplexes rather than internally; the internal pairs may be destabilized by imperfect steric mimicry which leads to non-ideal duplex structure. In some cases the hydrophobic pairs are significantly stabilizing to the DNA duplex; for example, when situated at the end of a duplex, the 1–1 pair is more stabilizing than a T–A pair. When situated internally, the affinity of the 1–1 pair is the same as, or slightly better than, the analogous T–T mismatch pair, which is known to have two hydrogen bonds. The studies raise the possibility that hydrogen bonds may not always be required for the formation of stable duplex DNA-like structure. In addition, the results point out the importance of solvation and desolvation in natural base pairing

  4. High-resolution NMR studies of chimeric DNA-RNA-DNA duplexes, heteronomous base pairing, and continuous base stacking at junctions

    SciTech Connect

    Chou, Shanho Univ. of Washington, Seattle ); Flynn, P.; Wang, A.; Reid, B. )

    1991-05-28

    Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3{prime}-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3{prime} end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1{prime}-H2{prime} J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2{prime}-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies.

  5. Urea Mimics Nucleobases by Preserving the Helical Integrity of B-DNA Duplexes via Hydrogen Bonding and Stacking Interactions.

    PubMed

    Suresh, Gorle; Padhi, Siladitya; Patil, Indrajit; Priyakumar, U Deva

    2016-10-11

    Urea lesions are formed in DNA because of free radical damage of the thymine base, and their occurrence in DNA blocks DNA polymerases, which has deleterious consequences. Recently, it has been shown that urea is capable of forming hydrogen bonding and stacking interactions with nucleobases, which are responsible for the unfolding of RNA in aqueous urea. Base pairing and stacking are inherent properties of nucleobases; because urea is able to form both, this study attempts to investigate if urea can mimic nucleobases in the context of nucleic acid structures by examining the effect of introducing urea lesions complementary to the four different nucleobases on the overall helical integrity of B-DNA duplexes and their thermodynamic stabilities using molecular dynamics (MD) simulations. The MD simulations resulted in stable duplexes without significant changes in the global B-DNA conformation. The urea lesions occupy intrahelical positions by forming hydrogen bonds with nitrogenous nucleobases, in agreement with experimental results. Furthermore, these urea lesions form hydrogen bonding and stacking interactions with other nucleobases of the same and partner strands, analogous to nucleobases in typical B-DNA duplexes. Direct hydrogen bond interactions are observed for the urea-purine pairs within DNA duplexes, whereas two different modes of pairing, namely, direct hydrogen bonds and water-mediated hydrogen bonds, are observed for the urea-pyrimidine pairs. The latter explains the complexities involved in interpreting the experimental nuclear magnetic resonance data reported previously. Binding free energy calculations were further performed to confirm the thermodynamic stability of the urea-incorporated DNA duplexes with respect to pure duplexes. This study suggests that urea mimics nucleobases by pairing opposite all four nucleobases and maintains the overall structure of the B-DNA duplexes.

  6. Multi-quasiparticle isomers near stability and reduced pairing

    SciTech Connect

    Dracoulis, G.D.

    1996-12-31

    The proximity of high-{Omega} orbitals near both proton and neutron Fermi surfaces in nuclei near Z = 74 and N = 104 results in high-K states competing with collective rotation of low-seniority configurations to generate the yrast line. In favorable situations it is possible to observe both the intrinsic states and associated rotational bands. The band properties allow characterization of the configurations and evaluation of orbital and seniority-dependent effects, including pairing reduction and consequent loss of nuclear superfluidity.

  7. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    PubMed

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

  8. Structure, stability, and dynamics of canonical and noncanonical base pairs: quantum chemical studies.

    PubMed

    Roy, Ashim; Panigrahi, Swati; Bhattacharyya, Malyasri; Bhattacharyya, Dhananjay

    2008-03-27

    The importance of non-Watson-Crick base pairs in the three-dimensional structure of RNA is now well established. The structure and stability of these noncanonical base pairs are, however, poorly understood. We have attempted to understand structural features of 33 frequently occurring base pairs using density functional theory. These are of three types, namely (i) those stabilized by two or more polar hydrogen bonds between the bases, (ii) those having one polar and another C-H...O/N type interactions, and (iii) those having one H-bond between the bases and another involving one of the sugars linked to the bases. We found that the base pairs having two polar H-bonds are very stable as compared to those having one C-H...O/N interaction. Our quantitatively analysis of structures of these optimized base pairs indicates that they possess a different amount of nonplanarity with large propeller or buckle values as also observed in the crystal structures. We further found that geometry optimization does not modify the hydrogen-bonding pattern, as values of shear and open angle of the base pairs remain conserved. The structures of initial crystal geometry and final optimized geometry of some base pairs having only one polar H-bond and a C-H...O/N interaction, however, are significantly different, indicating the weak nature of the nonpolar interaction. The base pair flexibility, as measured from normal-mode analysis, in terms of the intrinsic standard deviations of the base pair structural parameters are in conformity with those calculated from RNA crystal structures. We also noticed that deformation of a base pair along the stretch direction is impossible for all of the base pairs, and movements of the base pairs along shear and open are also quite restricted. The base pair opening mode through alteration of propeller or buckle is considerably less restricted for most of the base pairs.

  9. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials.

  10. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  11. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  12. Double-coding nucleic acids: introduction of a nucleobase sequence in the major groove of the DNA duplex using double-headed nucleotides.

    PubMed

    Kumar, Pawan; Sorinas, Antoni Figueras; Nielsen, Lise J; Slot, Maria; Skytte, Kirstine; Nielsen, Annie S; Jensen, Michael D; Sharma, Pawan K; Vester, Birte; Petersen, Michael; Nielsen, Poul

    2014-09-05

    A series of double-headed nucleosides were synthesized using the Sonogashira cross-coupling reaction. In the reactions, additional nucleobases (thymine, cytosine, adenine, or guanine) were attached to the 5-position of 2'-deoxyuridine or 2'-deoxycytidine through a propyne linker. The modified nucleosides were incorporated into oligonucleotides, and these were combined in different duplexes that were analyzed by thermal denaturation studies. All of the monomers were well tolerated in the DNA duplexes and induced only small changes in the thermal stability. Consecutive incorporations of the monomers led to increases in duplex stability owing to increased stacking interactions. The modified nucleotide monomers maintained the Watson-Crick base pair fidelity. Stable duplexes were observed with heavily modified oligonucleotides featuring 14 consecutive incorporations of different double-headed nucleotide monomers. Thus, modified duplexes with an array of nucleobases on the exterior of the duplex were designed. Molecular dynamics simulations demonstrated that the additional nucleobases could expose their Watson-Crick and/or Hoogsteen faces for recognition in the major groove. This presentation of nucleobases may find applications in providing molecular information without unwinding the duplex.

  13. Enthalpy and heat capacity changes for formation of an oligomeric DNA duplex: interpretation in terms of coupled processes of formation and association of single-stranded helices.

    PubMed

    Holbrook, J A; Capp, M W; Saecker, R M; Record, M T

    1999-06-29

    The thermodynamics of self-assembly of a 14 base pair DNA double helix from complementary strands have been investigated by titration (ITC) and differential scanning (DSC) calorimetry, in conjunction with van't Hoff analysis of UV thermal scans of individual strands. These studies demonstrate that thermodynamic characterization of the temperature-dependent contributions of coupled conformational equilibria in the individual "denatured" strands and in the duplex is essential to understand the origins of duplex stability and to derive stability prediction schemes of general applicability. ITC studies of strand association at 293 K and 120 mM Na+ yield an enthalpy change of -73 +/- 2 kcal (mol of duplex)-1. ITC studies between 282 and 312 K at 20, 50, and 120 mM Na+ show that the enthalpy of duplex formation is only weakly salt concentration-dependent but is very strongly temperature-dependent, decreasing approximately linearly with increasing temperature with a heat capacity change (282-312 K) of -1.3 +/- 0.1 kcal K-1 (mol of duplex)-1. From DSC denaturation studies in 120 mM Na+, we obtain an enthalpy of duplex formation of -120 +/- 5 kcal (mol of duplex)-1 and an estimate of the corresponding heat capacity change of -0.8 +/- 0.4 kcal K-1 (mol of duplex)-1 at the Tm of 339 K. van't Hoff analysis of UV thermal scans on the individual strands indicates that single helix formation is noncooperative with a temperature-independent enthalpy change of -5.5 +/- 0.5 kcal at 120 mM Na+. From these observed enthalpy and heat capacity changes, we obtain the corresponding thermodynamic quantities for two fundamental processes: (i) formation of single helices from disordered strands, involving only intrastrand (vertical) interactions between neighboring bases; and (ii) formation of double helices by association (docking) of single helical strands, involving interstrand (horizontal and vertical) interactions. At 293 K and 120 mM Na+, we calculate that the enthalpy change for

  14. The Effect of Small Cosolutes that Mimic Molecular Crowding Conditions on the Stability of Triplexes Involving Duplex DNA

    PubMed Central

    Aviñó, Anna; Mazzini, Stefania; Gargallo, Raimundo; Eritja, Ramon

    2016-01-01

    Triplex stability is studied in crowding conditions using small cosolutes (ethanol, acetonitrile and dimethylsulfoxide) by ultraviolet (UV), circular dichroism (CD) and nuclear magnetic resonance (NMR) spectroscopies. The results indicate that the triplex is formed preferentially when the triplex forming oligonucleotide (TFO) is RNA. In addition, DNA triplexes (D:D·D) are clearly less stable in cosolute solutions while the stability of the RNA triplexes (R:D·D) is only slightly decreased. The kinetic of triplex formation with RNA-TFO is slower than with DNA-TFO and the thermal stability of the triplex is increased with the salt concentration in EtOH-water solutions. Accordingly, RNA could be considered a potential molecule to form a stable triplex for regulatory purposes in molecular crowding conditions. PMID:26861295

  15. Passive Layer Stability of 2205 Duplex Stainless Steel in Oilfield-Produced Water: Potentiostatic Critical Pitting Temperature Test and Wavelet Analysis

    NASA Astrophysics Data System (ADS)

    Sabouri, M.; Hoseiny, H.

    2017-08-01

    In this article, the potentiostatic passivation behavior of 2205 duplex stainless steel was investigated in oilfield-produced water with a focus on the variation of the passive layer stability with temperature. The obtained current-time transients were analyzed using wavelet transform to evaluate the passive layer deterioration at different time domains corresponding to the temperatures of 303 K, 313 K, 323 K, and 333 K (30 °C, 40 °C, 50 °C, and 60 °C). The results showed that the critical pitting temperature (CPT) of the 2205 alloy in the studied produced water was 333.2 K (60.2 °C). In addition, the optimum passivation of the material surface was obtained between 303 K and 313 K (30 °C and 40 °C). The passive layer deteriorated at about 323 K (50 °C) by penetration of chloride and subsequently entered into the transpassive region. Moreover, at 333 K (60 °C), the metastable pits converted to permanent or overlapped pits. Corrosion morphology confirmed the results obtained by wavelet analyses. In addition, microscopical studies of the alloy microstructure showed that both phases, i.e., austenite and ferrite, were attacked by corrosion, although it was more severe in ferrite.

  16. Structures and Energetics of Four Adjacent G·U Pairs That Stabilize an RNA Helix

    PubMed Central

    Gu, Xiaobo; Mooers, Blaine H.M.; Thomas, Leonard M.; Malone, Joshua; Harris, Steven; Schroeder, Susan J.

    2016-01-01

    Consecutive G·U base pairs inside RNA helices can be destabilizing while those at the ends of helices are thermodynamically stabilizing. To determine if this paradox could be explained by differences in base stacking, we determined the high-resolution (1.32 Å) crystal structure of (5’-GGUGGCUGUU-3')2 and studied three sequences with four consecutive terminal G·U pairs by NMR spectroscopy. In the crystal structure of (5’-GGUGGCUGUU-3')2, the helix is overwound but retains the overall features of A-form RNA. The penultimate base steps at each end of the helix have high base overlap and contribute to the unexpectedly favorable energetic contribution for the 5’-GU-3’/3’-UG-5’ motif in this helix position. The balance of base stacking and helical twist contributes to the positional dependence of G·U pair stabilities. The energetic stabilities and similarity to A-form RNA helices suggest that consecutive G·U pairs would be recognized by RNA helix binding proteins, such as Dicer and Ago. Thus, these results will aid future searches for target sites of small RNAs in gene regulation. PMID:26425937

  17. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  18. Watson-Crick-like pairs in CCUG repeats: evidence for tautomeric shifts or protonation.

    PubMed

    Rypniewski, Wojciech; Banaszak, Katarzyna; Kuliński, Tadeusz; Kiliszek, Agnieszka

    2016-01-01

    RNA transcripts that include expanded CCUG repeats are associated with myotonic dystrophy type 2. Crystal structures of two CCUG-containing oligomers show that the RNA strands associate into slipped duplexes that contain noncanonical C-U pairs that have apparently undergone tautomeric transition or protonation resulting in an unusual Watson-Crick-like pairing. The overhanging ends of the duplexes interact forming U-U pairs, which also show tautomerism. Duplexes consisting of CCUG repeats are thermodynamically less stable than the trinucleotide repeats involved in the TRED genetic disorders, but introducing LNA residues increases their stability and raises the melting temperature of the studied oligomers by ∼10°C, allowing detailed crystallographic studies. Quantum mechanical calculations were performed to test the possibility of the tautomeric transitions or protonation within the noncanonical pairs. The results indicate that tautomeric or ionic shifts of nucleobases can manifest themselves in biological systems, supplementing the canonical "rules of engagement."

  19. Watson–Crick-like pairs in CCUG repeats: evidence for tautomeric shifts or protonation

    PubMed Central

    Rypniewski, Wojciech; Banaszak, Katarzyna; Kuliński, Tadeusz; Kiliszek, Agnieszka

    2016-01-01

    RNA transcripts that include expanded CCUG repeats are associated with myotonic dystrophy type 2. Crystal structures of two CCUG-containing oligomers show that the RNA strands associate into slipped duplexes that contain noncanonical C–U pairs that have apparently undergone tautomeric transition or protonation resulting in an unusual Watson–Crick-like pairing. The overhanging ends of the duplexes interact forming U–U pairs, which also show tautomerism. Duplexes consisting of CCUG repeats are thermodynamically less stable than the trinucleotide repeats involved in the TRED genetic disorders, but introducing LNA residues increases their stability and raises the melting temperature of the studied oligomers by ∼10°C, allowing detailed crystallographic studies. Quantum mechanical calculations were performed to test the possibility of the tautomeric transitions or protonation within the noncanonical pairs. The results indicate that tautomeric or ionic shifts of nucleobases can manifest themselves in biological systems, supplementing the canonical “rules of engagement.” PMID:26543073

  20. Duplex DNA and DNA-RNA hybrids with parallel strand orientation: 2'-deoxy-2'-fluoroisocytidine, 2'-deoxy-2'-fluoroisoguanosine, and canonical nucleosides with 2'-fluoro substituents cause unexpected changes on the double helix stability.

    PubMed

    Ingale, Sachin A; Leonard, Peter; Tran, Quang Nhat; Seela, Frank

    2015-03-20

    Oligonucleotides with parallel or antiparallel strand orientation incorporating 2'-fluorinated 2'-deoxyribonucleosides with canonical nucleobases or 2'-deoxy-2'-fluoroisocytidine ((F)iCd, 1c) and 2'-deoxy-2'-fluoroisoguanosine ((F)iGd, 3c) were synthesized. To this end, the nucleosides 1c and 3c as well as the phosphoramidite building blocks 19 and 23 were prepared and employed in solid-phase oligonucleotide synthesis. Unexpectedly, (F)iCd is not stable during oligonucleotide deprotection (55 °C, aq NH3) and was converted to a cyclonucleoside (14). Side product formation was circumvented when oligonucleotides were deprotected under mild conditions (aq ammonia-EtOH, rt). Oligonucleotides containing 2'-fluoro substituents ((F)iCd, (F)iGd and fluorinated canonical 2'-deoxyribonucleosides) stabilize double-stranded DNA, RNA, and DNA-RNA hybrids with antiparallel strand orientation. Unexpected strong stability changes are observed for oligonucleotide duplexes with parallel chains. While fluorinated oligonucleotides form moderately stable parallel stranded duplexes with complementary DNA, they do not form stable hybrids with RNA. Furthermore, oligoribonucleotide duplexes with parallel strand orientation are extremely unstable. It is anticipated that nucleic acids with parallel chains might be too rigid to accept sugar residues in the N-conformation as observed for ribonucleosides or 2'-deoxy-2'-fluororibonucleosides. These observations might explain why nature has evolved the principle of antiparallel chain orientation and has not used the parallel chain alignment.

  1. Effect of guanine to inosine substitution on stability of canonical DNA and RNA duplexes: molecular dynamics thermodynamics integration study.

    PubMed

    Krepl, Miroslav; Otyepka, Michal; Banáš, Pavel; Šponer, Jiří

    2013-02-14

    Guanine to inosine (G → I) substitution has often been used to study various properties of nucleic acids. Inosine differs from guanine only by loss of the N2 amino group, while both bases have similar electrostatic potentials. Therefore, G → I substitution appears to be optimally suited to probe structural and thermodynamics effects of single H-bonds and atomic groups. However, recent experiments have revealed substantial difference in free energy impact of G → I substitution in the context of B-DNA and A-RNA canonical helices, suggesting that the free energy changes reflect context-dependent balance of energy contributions rather than intrinsic strength of a single H-bond. In the present study, we complement the experiments by free energy computations using thermodynamics integration method based on extended explicit solvent molecular dynamics simulations. The computations successfully reproduce the basic qualitative difference in free energy impact of G → I substitution in B-DNA and A-RNA helices although the magnitude of the effect is somewhat underestimated. The computations, however, do not reproduce the salt dependence of the free energy changes. We tentatively suggest that the different effect of G → I substitution in A-RNA and B-DNA may be related to different topologies of these helices, which affect the electrostatic interactions between the base pairs and the negatively charged backbone. Limitations of the computations are briefly discussed.

  2. Sequence-Selective Formation of Synthetic H-Bonded Duplexes.

    PubMed

    Stross, Alexander E; Iadevaia, Giulia; Núñez-Villanueva, Diego; Hunter, Christopher A

    2017-09-13

    Oligomers equipped with a sequence of phenol and pyridine N-oxide groups form duplexes via H-bonding interactions between these recognition units. Reductive amination chemistry was used to synthesize all possible 3-mer sequences: AAA, AAD, ADA, DAA, ADD, DAD, DDA, and DDD. Pairwise interactions between the oligomers were investigated using NMR titration and dilution experiments in toluene. The measured association constants vary by 3 orders of magnitude (10(2) to 10(5) M(-1)). Antiparallel sequence-complementary oligomers generally form more stable complexes than mismatched duplexes. Mismatched duplexes that have an excess of H-bond donors are stabilized by the interaction of two phenol donors with one pyridine N-oxide acceptor. Oligomers that have a H-bond donor and acceptor on the ends of the chain can fold to form intramolecular H-bonds in the free state. The 1,3-folding equilibrium competes with duplex formation and lowers the stability of duplexes involving these sequences. As a result, some of the mismatch duplexes are more stable than some of the sequence-complementary duplexes. However, the most stable mismatch duplexes contain DDD and compete with the most stable sequence-complementary duplex, AAA·DDD, so in mixtures that contain all eight sequences, sequence-complementary duplexes dominate. Even higher fidelity sequence selectivity can be achieved if alternating donor-acceptor sequences are avoided.

  3. Parallel thermodynamic analysis of duplexes on oligodeoxyribonucleotide microchips.

    SciTech Connect

    Fotin, A. V.; Drobyshev, A. L.; Proudnikov, D. Y.; Perov, A. N.; Mirzabekov, A. D.; Center for Mechanistic Biology and Biotechnology; Engelhardt Inst. of Molecular Biology

    1998-03-15

    A microchip method has been developed for massive and parallel thermodynamic analyses of DNA duplexes. Fluorescently labeled oligonucleotides were hybridized with oligonucleotides immobilized in the 100 x 100 x 20 mum gel pads of the microchips. The equilibrium melting curves for all microchip duplexes were measured in real time in parallel for all microchip duplexes. Thermodynamic data for perfect and mismatched duplexes that were obtained using the microchip method directly correlated with data obtained in solution. Fluorescent labels or longer linkers between the gel and the oligonucleotides appeared to have no significant effect on duplex stability. Extending the immobilized oligonucleotides with a four-base mixture from the 3'-end or one or two universal bases (5-nitroindole) from the 3'- and/or 5'- end increased the stabilities of their duplexes. These extensions were applied to increase the stabilities of the duplexes formed with short oligonucleotides in microchips, to significantly lessen the differences in melting curves of the AT- and GC-rich duplexes, and to improve discrimination of perfect duplexes from those containing poorly recognized terminal mismatches. This study explored a way to increase the efficiency of sequencing by hybridization on oligonucleotide microchips.

  4. Effect of emulsifier pairs on physical stability of emulsions containing three different natural oils.

    PubMed

    Boonme, Prapaporn; Maneenuan, Duangkhae

    2014-01-01

    The purpose of this study was to formulate oil-in-water (o/w) emulsions containing 40% w/w natural oil (i.e., olive oil, rice bran oil, or sesame oil), 10% w/w emulsifier blend, and 50% w/w water. The hydrophile-lipophile balance system was used to calculate the amount of each non-ionic emulsifier in the formulations. All studied oils have an identical required hydrophile-lipophile balance of 7. In emulsifier blend, polyoxyethylene (20) sorbitan monooleate (hydrophile-lipophile balance = 15.0) was fixed as a high hydrophile-lipophile balance emulsifier, while sorbitan monostearate (hydrophile-lipophile balance = 4.7) or sorbitan monooleate (hydrophile-lipophile balance = 4.3) was used as a low hydrophile-lipophile balance emulsifier. The effect of emulsifier pairs on physical properties of the prepared samples was investigated. The physical stability of the emulsions was evaluated at ambient temperature (≈ 30°C) after storage for 30 and 60 days. It was found that emulsifier pairs influenced both characteristics and stability of the samples. Sorbitan monostearate could provide stable emulsions of all studied natural oils when blended with polyoxyethylene (20) sorbitan monooleate while sorbitan monooleate could not. From the obtained results, it could be concluded that not only suitable hydrophile-lipophile balance but also suitable emulsifier pair were important parameters in emulsion formulations.

  5. RNA chaperones stimulate formation and yield of the U3 snoRNA-pre-rRNA duplexes needed for eukaryotic ribosome biogenesis

    PubMed Central

    Gérczei, Tímea; Shah, Binal N.; Manzo, Anthony J.; Walter, Nils G.; Correll, Carl C.

    2010-01-01

    To satisfy the high demand for ribosome synthesis in rapidly growing eukaryotic cells, short duplexes between the U3 small nucleolar RNA (snoRNA) and the precursor ribosomal RNA (pre-rRNA) must form quickly and with high yield. These interactions, designated the U3-ETS and U3-18S duplexes, are essential to initiate the processing of small subunit rRNA. Previously, we showed in vitro that duplexes corresponding to those in Saccharomyces cerevisiae are only observed after addition of one of two proteins: Imp3p or Imp4p. Here, we used fluorescence-based and other in vitro assays to determine whether these proteins possess RNA chaperone activities and to assess whether these activities are sufficient to satisfy the duplex yield and rate requirements expected in vivo. Assembly of both proteins with the U3 snoRNA into a chaperone complex destabilizes a U3-stem structure, apparently to expose its 18S base-pairing site. As a result, the chaperone complex accelerates formation of the U3-18S duplex from an undetectable rate to one comparable to the intrinsic rate observed for hybridizing short duplexes. The chaperone complex also stabilizes the U3-ETS duplex by 2.7 kcal/mol. These chaperone activities provide high U3-ETS duplex yield and rapid U3-18S duplex formation over a broad concentration range to help ensure that the U3-pre-rRNA interactions limit neither ribosome biogenesis nor rapid cell growth. The thermodynamic and kinetic framework used is general and thus suitable to investigate the mechanism of action of other RNA chaperones. PMID:19482034

  6. Sequence-specific intercalating agents: intercalation at specific sequences on duplex DNA via major groove recognition by oligonucleotide-intercalator conjugates.

    PubMed Central

    Sun, J S; François, J C; Montenay-Garestier, T; Saison-Behmoaras, T; Roig, V; Thuong, N T; Hélène, C

    1989-01-01

    An acridine derivative was covalently linked to the 5' end of a homopyrimidine oligonucleotide. Specific binding to a homopurine-homopyrimidine sequence of duplex DNA was demonstrated by spectroscopic studies (absorption and fluorescence) and by "footprinting" experiments with a copper phenanthroline chelate used as an artificial nuclease. A hypochromism and a red shift of the acridine absorption were observed. Triple-helix formation was also accompanied by a hypochromism in the ultraviolet range. The fluorescence of the acridine ring was quenched by a stacking interaction with a G.C base pair adjacent to the homopurine-homopyrimidine target sequence. The intercalating agent strongly stabilized the complex formed by the oligopyrimidine with its target duplex sequence. Cytosine methylation further increased the stability of the complexes. Footprinting studies revealed that the oligopyrimidine binds in a parallel orientation with respect to the homopurine-containing strand of the duplex. The intercalated acridine extended by 2 base pairs the region of the duplex protected by the oligopyrimidine against degradation by the nuclease activity of the copper phenanthroline chelate. Random intercalation of the acridine ring was lost due to the repulsive effect of the negatively charged oligonucleotide tail. Intercalation occurred only at those double-stranded sequences where the homopyrimidine oligonucleotide recognized the major groove of duplex DNA. Images PMID:2594761

  7. Regulation of nuclear reactors by duplexed control rods; Linearized analysis

    SciTech Connect

    Haidar, N.H.S. ); Diab, H.B. )

    1991-10-01

    In this paper the dynamic behavior of a duplex control rod for a nuclear reactor is analyzed by linearized modeling. A simulation-aided design for this duplex, which has performance and safety characteristics that are improved over those of conventional single control rods with the same stability margins, is reported.

  8. Full-duplex optical communication system

    NASA Technical Reports Server (NTRS)

    Shay, Thomas M. (Inventor); Hazzard, David A. (Inventor); Horan, Stephen (Inventor); Payne, Jason A. (Inventor)

    2004-01-01

    A method of full-duplex electromagnetic communication wherein a pair of data modulation formats are selected for the forward and return data links respectively such that the forward data electro-magnetic beam serves as a carrier for the return data. A method of encoding optical information is used wherein right-hand and left-hand circular polarizations are assigned to optical information to represent binary states. An application for an earth to low earth orbit optical communications system is presented which implements the full-duplex communication and circular polarization keying modulation format.

  9. Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

    PubMed

    Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

    2015-03-01

    Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert.

  10. Stability of a pair of co-rotating vortices with axial flow

    NASA Astrophysics Data System (ADS)

    Roy, Clément; Schaeffer, Nathanaël; Le Dizès, Stéphane; Thompson, Mark

    2008-09-01

    The three-dimensional linear temporal stability properties of a flow composed of two corotating q-vortices (also called Batchelor vortices) are predicted by numerical stability analysis. As for the corresponding counter-rotating case, when the axial flow parameter is increased, different instability modes are observed and identified as a combination of resonant Kelvin modes of azimuthal wavenumbers m and m +2 within each vortex. In particular, we show that the sinuous mode, which is the dominant instability mode without axial flow, is stabilized in the presence of a moderate axial flow. Different types of mode with a large amplitude in the critical layer are also identified. For small separation distances (above the merging threshold), unstable eigenmodes, corresponding to axial wavenumbers that cannot be easily identified with simple resonant interactions of Kelvin modes, are also observed. Their growth rate is a substantial fraction of the growth rates of low-order resonant modes. The effects of the Reynolds number and vortex separation distance on the growth rate parameter map are considered. Finally, we analyze the similarities and differences between the stability characteristics of co- and counter-rotating vortex pairs.

  11. An alternative strategy to synthesize PNA and DNA magnetic conjugates forming nanoparticle assembly based on PNA/DNA duplexes.

    PubMed

    Milano, Giovanna; Musumeci, Domenica; Gaglione, Maria; Messere, Anna

    2010-03-01

    In this paper we report an alternative approach to synthesize PNA and DNA magnetic nanoconjugates. Chemical modifications were introduced on the 130 nm dextran-magnetite particles to obtain poly-functionalized particles containing reversible bonds sensitive to the cellular environment and suitable for the direct introduction of unmodified oligomers. Due to the polyvalent nature of the nanoparticles, when the complementary PNA and DNA nanoconjugates were mixed together, the resulting duplex structures bring to a nanoparticle assembly driven by W-C base pairs. The formation of the nanoparticle assembly was investigated by optical spectroscopy (UV, FTIR), scanning and transmission electron microscopies and by the analysis of the macroscopic behaviour of the nanoparticle-conjugates in aqueous solution with and without magnetic field application. Furthermore, serum stability assays revealed an increased enzymatic resistance in FCS of the PNA/DNA nanoconjugate duplex with respect to the unconjugated duplex. The described nanosystem could be extended to other duplex structures, possibly involving aptameric sequences of biomedical relevance, and could be very useful in order to obtain high local concentration at the target site of both the duplex and the magnetic nanoparticles in biotechnological applications.

  12. Mesophase stabilization in ionic liquid crystals through pairing equally shaped mesogenic cations and anions

    SciTech Connect

    Stappert, Kathrin; Lipinski, Gregor; Kopiec, Gabriel; Spielberg, Eike T.; Mudring, Anja -Verena

    2015-07-23

    The synthesis and properties of a set of novel ionic liquid crystals with congruently shaped cations and anions are reported to check whether pairing mesogenic cations with mesogenic anions leads to a stabilization of a liquid crystalline phase. To that avail 1-alkyl-3-methyl-triazolium cations with an alkyl chain length of 10, 12, and 14 carbon atoms have been combined with p-alkyloxy-benzenesulfonate anions with different alkyl chain lengths (n = 10, 12, and 14). The corresponding triazolium iodides have been synthesized as reference compounds where the cation and anion have strong size and shape mismatch. The mesomorphic behavior of all compounds is studied by differential scanning calorimetry and polarizing optical microscopy. All compounds except 1-methyl-3-decyltriazolium iodide, which qualifies as an ionic liquid, are thermotropic ionic liquid crystals. All other compounds adopt smectic A phases. As a result, a comparison of the thermal phase behavior of the 1-methyl-3-decyltriazolium bromides to the corresponding p-alkoxy-benzensulfonates reveals that definitely the mesophase is stabilized by pairing the rod-shaped 1-alkyl-3-methyltriazolium cation with a rod-like anion of similar size.

  13. Mesophase stabilization in ionic liquid crystals through pairing equally shaped mesogenic cations and anions

    DOE PAGES

    Stappert, Kathrin; Lipinski, Gregor; Kopiec, Gabriel; ...

    2015-07-23

    The synthesis and properties of a set of novel ionic liquid crystals with congruently shaped cations and anions are reported to check whether pairing mesogenic cations with mesogenic anions leads to a stabilization of a liquid crystalline phase. To that avail 1-alkyl-3-methyl-triazolium cations with an alkyl chain length of 10, 12, and 14 carbon atoms have been combined with p-alkyloxy-benzenesulfonate anions with different alkyl chain lengths (n = 10, 12, and 14). The corresponding triazolium iodides have been synthesized as reference compounds where the cation and anion have strong size and shape mismatch. The mesomorphic behavior of all compounds ismore » studied by differential scanning calorimetry and polarizing optical microscopy. All compounds except 1-methyl-3-decyltriazolium iodide, which qualifies as an ionic liquid, are thermotropic ionic liquid crystals. All other compounds adopt smectic A phases. As a result, a comparison of the thermal phase behavior of the 1-methyl-3-decyltriazolium bromides to the corresponding p-alkoxy-benzensulfonates reveals that definitely the mesophase is stabilized by pairing the rod-shaped 1-alkyl-3-methyltriazolium cation with a rod-like anion of similar size.« less

  14. Neomycin-neomycin dimer: an all-carbohydrate scaffold with high affinity for AT-rich DNA duplexes.

    PubMed

    Kumar, Sunil; Xue, Liang; Arya, Dev P

    2011-05-18

    A dimeric neomycin-neomycin conjugate 3 with a flexible linker, 2,2'-(ethylenedioxy)bis(ethylamine), has been synthesized and characterized. Dimer 3 can selectively bind to AT-rich DNA duplexes with high affinity. Biophysical studies have been performed between 3 and different nucleic acids with varying base composition and conformation by using ITC (isothermal calorimetry), CD (circular dichroism), FID (fluorescent intercalator displacement), and UV (ultraviolet) thermal denaturation experiments. A few conclusions can be drawn from this study: (1) FID assay with 3 and polynucleotides demonstrates the preference of 3 toward AT-rich sequences over GC-rich sequences. (2) FID assay and UV thermal denaturation experiments show that 3 has a higher affinity for the poly(dA)·poly(dT) DNA duplex than for the poly(dA)·2poly(dT) DNA triplex. Contrary to neomycin, 3 destabilizes poly(dA)·2poly(dT) triplex but stabilizes poly(dA)·poly(dT) duplex, suggesting the major groove as the binding site. (3) UV thermal denaturation studies and ITC experiments show that 3 stabilizes continuous AT-tract DNA better than DNA duplexes with alternating AT bases. (4) CD and FID titration studies show a DNA binding site size of 10-12 base pairs/drug, depending upon the structure/sequence of the duplex for AT-rich DNA duplexes. (5) FID and ITC titration between 3 and an intramolecular DNA duplex [d(5'-A(12)-x-T(12)-3'), x = hexaethylene glycol linker] results in a binding stoichiometry of 1:1 with a binding constant ∼10(8) M(-1) at 100 mM KCl. (6) FID assay using 3 and 512 hairpin DNA sequences that vary in their AT base content and placement also show a higher binding selectivity of 3 toward continuous AT-rich than toward DNA duplexes with alternate AT base pairs. (7) Salt-dependent studies indicate the formation of three ion pairs during binding of the DNA duplex d[5'-A(12)-x-T(12)-3'] and 3. (8) ITC-derived binding constants between 3 and DNA duplexes have the following order: AT

  15. Structural Properties of G,T-Parallel Duplexes

    PubMed Central

    Aviñó, Anna; Cubero, Elena; Gargallo, Raimundo; González, Carlos; Orozco, Modesto; Eritja, Ramon

    2010-01-01

    The structure of G,T-parallel-stranded duplexes of DNA carrying similar amounts of adenine and guanine residues is studied by means of molecular dynamics (MD) simulations and UV- and CD spectroscopies. In addition the impact of the substitution of adenine by 8-aminoadenine and guanine by 8-aminoguanine is analyzed. The presence of 8-aminoadenine and 8-aminoguanine stabilizes the parallel duplex structure. Binding of these oligonucleotides to their target polypyrimidine sequences to form the corresponding G,T-parallel triplex was not observed. Instead, when unmodified parallel-stranded duplexes were mixed with their polypyrimidine target, an interstrand Watson-Crick duplex was formed. As predicted by theoretical calculations parallel-stranded duplexes carrying 8-aminopurines did not bind to their target. The preference for the parallel-duplex over the Watson-Crick antiparallel duplex is attributed to the strong stabilization of the parallel duplex produced by the 8-aminopurines. Theoretical studies show that the isomorphism of the triads is crucial for the stability of the parallel triplex. PMID:20798879

  16. Small molecule-mediated duplex formation of nucleic acids with 'incompatible' backbones.

    PubMed

    Cafferty, Brian J; Musetti, Caterina; Kim, Keunsoo; Horowitz, Eric D; Krishnamurthy, Ramanarayanan; Hud, Nicholas V

    2016-04-07

    Proflavine, a known intercalator of DNA and RNA, promotes duplex formation by nucleic acids with natural and non-natural backbones that otherwise form duplexes with low thermal stability, and even some that show no sign of duplex formation in the absence of proflavine. These findings demonstrate the potential for intercalators to be used as cofactors for the assembly of rationally designed nucleic acid structures, and could provide fundamental insights regarding intercalation of natural nucleic acid duplexes.

  17. Ion pairs significantly stabilize coiled-coils in the absence of electrolyte.

    PubMed

    Yu, Y; Monera, O D; Hodges, R S; Privalov, P L

    1996-01-26

    We have used a synthetic coiled-coil peptide model system to address the long perplexing issue as to why coiled-coils are in general more stable at acidic pH than at neutral pH. Contrary to the above expectation, our results show that at low ionic strength (10 mM) the coiled-coil was much more stable at neutral pH than at acidic pH against both thermal and urea unfolding, indicating that the Lys(+)-Glu- ions pairs present around the coiled-coil interface at neutral pH contribute significantly to the stability of the coiled-coil. However, while the addition of NaCl had no significant effect on the coiled-coil stability at neutral pH, its stability at acidic pH increased dramatically. The cross-over point between the stability at acidic pH and neutral pH occurred at around 100 mM salt, above which the coiled-coil became more stable at acidic pH, in agreement with published results. Therefore, salt effect, rather than intrinsic property, such as carboxyl-carboxyl hydrogen bonding, causes this coiled-coil to become more stable at acidic pH. The preferential stabilizing effect of salt on the coiled-coil at acidic pH can be best explained in terms of the condensation of anions to the positively charged groups on the coiled-coil, the net density of which increases as glutamic acid residues become protonated in acidic pH.

  18. Fluorescent C-linked C8-aryl-guanine probe for distinguishing syn from anti structures in duplex DNA.

    PubMed

    Manderville, Richard A; Omumi, Alireza; Rankin née Schlitt, Katherine M; Wilson, Katie A; Millen, Andrea L; Wetmore, Stacey D

    2012-06-18

    The synthesis and optical properties of the carbon (C)-linked C(8)-(2"-benzo[b]thienyl)-2'-deoxyguanosine ((Bth)dG), which acts as a fluorescent reporter of syn versus anti glycosidic conformations in duplex DNA, are described. In the syn-conformation, the probe stabilizes a G:G mismatch, emits at ∼385 nm (excitation ∼285 nm), and shows an induced circular dichroism (ICD) signal at ∼320 nm. Molecular dynamics (MD) simulations predict a wedge (W)-conformation for the mismatched duplex with the C(8)-benzo[b]thienyl moiety residing in the minor groove. In contrast, the probe destabilizes the duplex when base paired with its normal pyrimidine partner C. With flanking purine bases, a major groove B-type duplex is favored with (Bth)dG present in the anti-conformation emitting at ∼413 nm (excitation ∼326 nm) and no ICD signal. However, with flanking pyrimidine bases, (Bth)dG adopts the syn-conformation when base paired with C, and MD simulations predict a base-displaced stacked (S)-conformation, with the opposing C flipped out of the helix. The different duplex (B-, S-, and W-) conformers formed upon incorporation of (Bth)dG are known to play a critical role in the biological activity of N-linked C8-dG adducts formed by arylamine carcinogens. Bulky environment-sensitive fluorescent C(8)-dG adducts that mimic the duplex structures formed by carcinogens may be useful in luminescence-based DNA polymerase assays.

  19. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  20. Wobble Pairs of the HDV Ribozyme Play Specific Roles in Stabilization of Active Site Dynamics

    PubMed Central

    Sripathi, Kamali N.; Banáš, Pavel; Reblova, Kamila; Šponer, Jiři; Otyepka, Michal

    2015-01-01

    The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5′) hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5′) general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5′) hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs. PMID:25631765

  1. Higher order structural effects stabilizing the reverse Watson-Crick Guanine-Cytosine base pair in functional RNAs.

    PubMed

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch.

  2. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  3. [Renal duplex: clinical usefulness].

    PubMed

    Miralles, M; Giménez, A; Cairols, M A; Riambau, V; Sáez, A

    1993-01-01

    It is the purpose of this report to focus attention on the clinical usefulness of Renal Duplex for the diagnosis of patients with vasculo-renal diseases in terms of: 1. Accuracy of Duplex/Angiography in the measurement of the renal stenosis degree. 2. Correlationship between Duplex ans Isotopic Renogram with respect to the study of the parenchyma's perfusion. 3. The effect of the inhibitors of the conversor enzyme (Captopril) on the Doppler signal of the parenchyma, comparing it with the results from the captopril test about the peripheral plasmatic renin activity and the isotopic renogram, in patients with vasculo-renal HTA. Results obtains by Duplex and Angiography were compared in 92 renal arteries from 46 patients. For both technics, three degrees of stenosis were established: 0-59%, 60-99% and occlusion. The Duplex technique identified 49/54 stenosis < 60%, 28/33 stenosis > 60% and 5/5 occlusions (Kappa 0.8). Sensibility and specificity of Duplex for the diagnosis of stenosis > 60% were, respectively, 89.5% and 90.7%; with an exactness of 90.2%. The angiographies showed stenosis > 60% in 23 patients with HTA (diastolic pressures > 100 mmHg). In all of the patients, a measurement of the plasmatic renin activity, an isotopic renogram and a Doppler of the interlobar arteries basal and post-captopril, were performed. The correlationship between Duplex and isotopic renogram with respect to the measurement of the relative renal perfusion was statistically significant (r = 0.91; p < 0.0001). The captopril test for renin and isotopic renogram were positives for 5 patients (4 with unilateral stenosis an 1 with bilateral stenosis). All of them showed severe stenosis (> 80%).(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Determination of Base Binding Strength and Base Stacking Interaction of DNA Duplex Using Atomic Force Microscope

    PubMed Central

    Zhang, Tian-biao; Zhang, Chang-lin; Dong, Zai-li; Guan, Yi-fu

    2015-01-01

    As one of the most crucial properties of DNA, the structural stability and the mechanical strength are attracting a great attention. Here, we take advantage of high force resolution and high special resolution of Atom Force Microscope and investigate the mechanical force of DNA duplexes. To evaluate the base pair hydrogen bond strength and base stacking force in DNA strands, we designed two modes (unzipping and stretching) for the measurement rupture forces. Employing k-means clustering algorithm, the ruptured force are clustered and the mean values are estimated. We assessed the influence of experimental parameters and performed the force evaluation for DNA duplexes of pure dG/dC and dA/dT base pairs. The base binding strength of single dG/dC and single dA/dT were estimated to be 20.0 ± 0.2 pN and 14.0 ± 0.3 pN, respectively, and the base stacking interaction was estimated to be 2.0 ± 0.1 pN. Our results provide valuable information about the quantitative evaluation of the mechanical properties of the DNA duplexes. PMID:25772017

  5. Determination of base binding strength and base stacking interaction of DNA duplex using atomic force microscope.

    PubMed

    Zhang, Tian-biao; Zhang, Chang-lin; Dong, Zai-li; Guan, Yi-fu

    2015-03-16

    As one of the most crucial properties of DNA, the structural stability and the mechanical strength are attracting a great attention. Here, we take advantage of high force resolution and high special resolution of Atom Force Microscope and investigate the mechanical force of DNA duplexes. To evaluate the base pair hydrogen bond strength and base stacking force in DNA strands, we designed two modes (unzipping and stretching) for the measurement rupture forces. Employing k-means clustering algorithm, the ruptured force are clustered and the mean values are estimated. We assessed the influence of experimental parameters and performed the force evaluation for DNA duplexes of pure dG/dC and dA/dT base pairs. The base binding strength of single dG/dC and single dA/dT were estimated to be 20.0 ± 0.2 pN and 14.0 ± 0.3 pN, respectively, and the base stacking interaction was estimated to be 2.0 ± 0.1 pN. Our results provide valuable information about the quantitative evaluation of the mechanical properties of the DNA duplexes.

  6. NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

    SciTech Connect

    Gao, X.; Patel, D.J.

    1988-03-08

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H/sub 2/O and D/sub 2/O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution.

  7. 1. VIEW OF DUPLEX (FEATURE 7). CORNER OF DUPLEX (FEATURE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. VIEW OF DUPLEX (FEATURE 7). CORNER OF DUPLEX (FEATURE 6) IS VISIBLE AT LEFT. MILL SITE IS VISIBLE IN THE BACKGROUND. FACING EAST. - Copper Canyon Camp of the International Smelting & Refining Company, Duplex, Copper Canyon, Battle Mountain, Lander County, NV

  8. Ion pairs and their role in modulating stability of cold- and warm-active uracil DNA glycosylase.

    PubMed

    Olufsen, Magne; Papaleo, Elena; Smalås, Arne Oskar; Brandsdal, Bjørn Olav

    2008-05-15

    MD simulations and continuum electrostatics calculations have been used to study the observed differences in thermostability of cold- and warm-active uracil DNA glycosylase (UDG). The present study focuses on the role of ion pairs and how they affect the thermal stability of the two enzymes. Analysis of the MD generated structural ensembles show that cod UDG (cUDG) and human UDG (hUDG) have 11 and 12 ion pairs which are present in at least 30% of the conformations. The electrostatic contribution of the ion pairs, computed using continuum electrostatics, is slightly more favorable in cUDG at 298 K. This is primarily attributed to more optimized interactions between the ion pairs and nearby dipoles/charges in cUDG. More global salt bridges are found in hUDG and are more stabilizing when compared to cUDG, possibly playing a role in maintaining overall stability and reducing conformational entropy. Both enzymes contain one three-member ionic network, but the one found in hUDG is far more stabilizing. Our results also suggest that care should be taken when performing statistical analysis of crystal structures with respect to ion pairs, and that crystallization conditions must be carefully examined when performing such analysis.

  9. ATP hydrolysis Promotes Duplex DNA Release by the RecA Presynaptic Complex.

    PubMed

    Lee, Ja Yil; Qi, Zhi; Greene, Eric C

    2016-10-14

    Homologous recombination is an important DNA repair pathway that plays key roles in maintaining genome stability. Escherichia coli RecA is an ATP-dependent DNA-binding protein that catalyzes the DNA strand exchange reactions in homologous recombination. RecA assembles into long helical filaments on single-stranded DNA, and these presynaptic complexes are responsible for locating and pairing with a homologous duplex DNA. Recent single molecule studies have provided new insights into RecA behavior, but the potential influence of ATP in the reactions remains poorly understood. Here we examine how ATP influences the ability of the RecA presynaptic complex to interact with homologous dsDNA. We demonstrate that over short time regimes, RecA presynaptic complexes sample heterologous dsDNA similarly in the presence of either ATP or ATPγS, suggesting that initial interactions do not depend on ATP hydrolysis. In addition, RecA stabilizes pairing intermediates in three-base steps, and stepping energetics is seemingly unaltered in the presence of ATP. However, the overall dissociation rate of these paired intermediates with ATP is ∼4-fold higher than with ATPγS. These experiments suggest that ATP plays an unanticipated role in promoting the turnover of captured duplex DNA intermediates as RecA attempts to align homologous sequences during the early stages of recombination.

  10. N 2-methylguanosine is iso-energetic with guanosine in RNA duplexes and GNRA tetraloops.

    PubMed Central

    Rife, J P; Cheng, C S; Moore, P B; Strobel, S A

    1998-01-01

    Modified nucleotides are resource-intensive alternatives to the four nucleotides that constitute the bulk of natural RNAs. Yet, even in cases where modifications are highly conserved, their functions are difficult to identify. One possible function might be to modulate the stability of RNA structures. To investigate this possibility for N 2-methylguanosine (m2G), which is present in a wide variety of RNAs, we have determined the thermodynamic consequences of substituting m2G for G in G-C Watson-Crick pairs and G@U wobble pairs within RNA duplexes. The m2G substitution is iso-energetic with G in all cases, except for aninternal m2G@U pair, where it has a modest (0.3 kcal/mol) stabilizing effect. We have also examined theconsequences of replacing G by m2G, and A by N 6, N 6-dimethyladenosine (m26A) in the helix 45 tetraloop of 16S rRNA, which would otherwise be a standard GNRA tetraloop. This loop is a conserved, hypermethylated region of the ribosome where methylation appears to modulate activity. m26A substitution destabilizes the tetraloop, presumably because it prevents the formation of the G@A sheared pair it would otherwise contain. m2G substitution has no effect on tetraloop stability. Together, these results suggest that m2G is equally stable as either the s-cis or s-trans rotamer. The lack of a significant effect on secondary structural stability in these systems suggests that m2G is introduced into naturally occurring RNAs for reasons other than modulation of duplex stability. PMID:9685477

  11. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs.

    PubMed

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-29

    Two identical 5'GACG3' tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5' end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5'GACG3') forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5'A·U3' for H3, 5'U·A3' for H2) to 5'G·C3'/5'C·G3' has significant effect on the stability of the kissing complexes: the substitution to 5'C·G3' significantly decreases both thermal and mechanical stability, while switching to the 5'G·C3' significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5'A·U3' for H3 and 5'U·A3' for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Duplex unwinding and ATPase activities of the DEAD-box helicase eIF4A are coupled by eIF4G and eIF4B.

    PubMed

    Özeş, Ali R; Feoktistova, Kateryna; Avanzino, Brian C; Fraser, Christopher S

    2011-09-30

    Eukaryotic initiation factor (eIF) 4A is a DEAD-box helicase that stimulates translation initiation by unwinding mRNA secondary structure. The accessory proteins eIF4G, eIF4B, and eIF4H enhance the duplex unwinding activity of eIF4A, but the extent to which they modulate eIF4A activity is poorly understood. Here, we use real-time fluorescence assays to determine the kinetic parameters of duplex unwinding and ATP hydrolysis by these initiation factors. To ensure efficient duplex unwinding, eIF4B and eIF4G cooperatively activate the duplex unwinding activity of eIF4A. Our data reveal that eIF4H is much less efficient at stimulating eIF4A unwinding activity than eIF4B, implying that eIF4H is not able to completely substitute for eIF4B in duplex unwinding. By monitoring unwinding and ATPase assays under identical conditions, we demonstrate that eIF4B couples the ATP hydrolysis cycle of eIF4A with strand separation, thereby minimizing nonproductive unwinding events. Using duplex substrates with altered GC contents but similar predicted thermal stabilities, we further show that the rate of formation of productive unwinding complexes is strongly influenced by the local stability per base pair, in addition to the stability of the entire duplex. This finding explains how a change in the GC content of a hairpin is able to influence translation initiation while maintaining the overall predicted thermal stability.

  13. Protonation of base pairs in RNA: context analysis and quantum chemical investigations of their geometries and stabilities.

    PubMed

    Chawla, Mohit; Sharma, Purshotam; Halder, Sukanya; Bhattacharyya, Dhananjay; Mitra, Abhijit

    2011-02-17

    Base pairs involving protonated nucleobases play important roles in mediating global macromolecular conformational changes and in facilitation of catalysis in a variety of functional RNA molecules. Here we present our attempts at understanding the role of such base pairs by detecting possible protonated base pairs in the available RNA crystal structures using BPFind software, in their specific structural contexts, and by the characterization of their geometries, interaction energies, and stabilities using advanced quantum chemical computations. We report occurrences of 18 distinct protonated base pair combinations from a representative data set of RNA crystal structures and propose a theoretical model for one putative base pair combination. Optimization of base pair geometries was carried out at the B3LYP/cc-pVTZ level, and the BSSE corrected interaction energies were calculated at the MP2/aug-cc-pVDZ level of theory. The geometries for each of the base pairs were characterized in terms of H-bonding patterns observed, rmsd values observed on optimization, and base pair geometrical parameters. In addition, the intermolecular interaction in these complexes was also analyzed using Morokuma energy decomposition. The gas phase interaction energies of the base pairs range from -24 to -49 kcal/mol and reveal the dominance of Hartree-Fock component of interaction energy constituting 73% to 98% of the total interaction energy values. On the basis of our combined bioinformatics and quantum chemical analysis of different protonated base pairs, we suggest resolution of structural ambiguities and correlate their geometric and energetic features with their structural and functional roles. In addition, we also examine the suitability of specific base pairs as key elements in molecular switches and as nucleators for higher order structures such as base triplets and quartets.

  14. Duplex tab exhaust nozzle

    NASA Technical Reports Server (NTRS)

    Gutmark, Ephraim Jeff (Inventor); Martens, Steven (nmn) (Inventor)

    2012-01-01

    An exhaust nozzle includes a conical duct terminating in an annular outlet. A row of vortex generating duplex tabs are mounted in the outlet. The tabs have compound radial and circumferential aft inclination inside the outlet for generating streamwise vortices for attenuating exhaust noise while reducing performance loss.

  15. Nucleic acid unwinding by hepatitis C virus and bacteriophage t7 helicases is sensitive to base pair stability.

    PubMed

    Donmez, Ilker; Rajagopal, Vaishnavi; Jeong, Yong-Joo; Patel, Smita S

    2007-07-20

    Helicases are motor enzymes that convert the chemical energy of NTP hydrolysis into mechanical force for motion and nucleic acid strand separation. Within the cell, helicases process a range of nucleic acid sequences. It is not known whether this composite rate of moving and opening the strands of nucleic acids depends on the base sequence. Our presteady state kinetic studies of helicases from two classes, the ring-shaped T7 helicase and two forms of non-ring-shaped hepatitis C virus (HCV) helicase, show that both the unwinding rate and processivity depend on the sequence and decrease as the nucleic acid stability increases. The DNA unwinding activity of T7 helicase and the RNA unwinding activity of HCV helicases decrease steeply with increasing base pair stability. On the other hand, the DNA unwinding activity of HCV helicases is less sensitive to base pair stability. These results predict that helicases will fall into a spectrum of modest to high sensitivity to base pair stability depending on their biological role in the cell. Modeling of the dependence provided the degree of the active involvement of helicase in base pair destabilization during the unwinding process and distinguished between passive and active mechanisms of unwinding.

  16. Role of the Closing Base Pair for d(GCA) Hairpin Stability: Free Energy Analysis and Folding Simulations

    SciTech Connect

    Kannan, Srinivasaraghavan; Zacharias, Martin W.

    2011-06-30

    Hairpin loops belong to the most important structural motifs in folded nucleic acids. The d(GNA) sequence in DNA can form very stable trinucleotide hairpin loops depending, however, strongly on the closing base pair. Replica-exchange molecular dynamics (REMD) were employed to study hairpin folding of two DNA sequences, d(gcGCAgc) and d(cgGCAcg), with the same central loop motif but different closing base pairs starting from singlestranded structures. In both cases, conformations of the most populated conformational cluster at the lowest temperature showed close agreement with available experimental structures. For the loop sequence with the less stable G:C closing base pair, an alternative loop topology accumulated as second most populated conformational state indicating a possible loop structural heterogeneity. Comparative-free energy simulations on induced loop unfolding indicated higher stability of the loop with a C:G closing base pair by 3 kcal mol1 (compared to a G:C closing base pair) in very good agreement with experiment. The comparative energetic analysis of sampled unfolded, intermediate and folded conformational states identified electrostatic and packing interactions as the main contributions to the closing base pair dependence of the d(GCA) loop stability.

  17. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  18. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    PubMed Central

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  19. Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

    DOE PAGES

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

    2015-01-29

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T8X9G10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmCmore » and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  20. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    PubMed

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  1. Theoretical Studies on the Intermolecular Interactions of Potentially Primordial Base-Pair Analogues

    SciTech Connect

    Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri; Sumpter, Bobby G; Fuentes-Cabrera, Miguel A; Vazquez-Mayagoitia, Alvaro

    2010-01-01

    Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the bases and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.

  2. Atomistic Simulations on the Thermal Stability of the Antisite Pair in 3C- and 4H-SiC

    SciTech Connect

    Posselt, Matthias; Gao, Fei; Weber, William J.

    2006-03-31

    The thermal stability of the first-neighbor antisite pair configurations in 3C- and 4H-SiC is investigated by a comprehensive atomistic study. At first the structure and energetics of these defects is determined in order to check the accuracy of the Gao-Weber interatomic potential used. The results are comparable with literature data obtained by the density-functional theory. Then, the lifetime of the antisite pair configurations is calculated for temperatures between 800 and 2500 K. Both in 3C- and 4H-SiC the thermal stability of the antisite pairs is rather low. In contrast to previous theoretical interpretations, the antisite pair can be therefore not correlated with the DI photoluminescence center that is stable to above 2000 K. The atomic mechanisms during the recombination of the antisite pair in 3C-SiC and of three antisite pair configurations in 4H-SiC is a modified concerted exchange. Due to the different sizes of the silicon and the carbon atoms, this process is not identical with the concerted exchange in Si. Two intermediate metastable configurations found during the recombination are similar to the bond defect in Si. Since the SiC lattice contains two types of atoms, there are also two different types of bond defects. The two bond defects can be considered as the result of the incomplete recombination of a carbon vacancy and a neighboring mixed dumbbell interstitial. For selected temperatures the thermal stability of the antisite pair in 3C-SiC is investigated by molecular dynamics simulations that are based on the density-functional theory. Their results are very similar to those of the atomistic study, i.e. the Gao-Weber potential describes the antisite pair and its recombination reasonably well. The antisite pair in 4H-SiC with the two atoms on hexagonal sites has a slightly different formation energy than the other three antisite pair configurations in 4H-SiC. Its lifetime shows another dependence on the temperature, and its recombination is

  3. Silver(I)-mediated Hoogsteen-type base pairs.

    PubMed

    Megger, Dominik A; Fonseca Guerra, Célia; Bickelhaupt, F Matthias; Müller, Jens

    2011-11-01

    Metal-mediated Hoogsteen-type base pairs are useful for the construction of DNA duplexes containing contiguous stretches of metal ions along the helical axis. To fine-tune the stability of such base pairs and the selectivity toward different metal ions, the availability of a selection of artificial nucleobases is highly desirable. In this study, we follow a theoretical approach utilizing dispersion-corrected density functional methods to evaluate a variety of artificial nucleobases as candidates for metal-mediated Hoogsteen-type base pairs. We focus on silver(I)-mediated Hoogsteen- and reverse Hoogsteen-type base pairs formed between 1-deaza- and 1,3-dideazapurine-derived nucleobases, respectively, and cytosine. Apart from two coordinative bonds, these base pairs are stabilized by a hydrogen bond. We elucidate the impact of different substituents at the C6 position and the presence or absence of an endocyclic N3 nitrogen atom on the overall stability of a base pair and concomitantly on the strength of the hydrogen and coordinative bonds. All artificial base pairs investigated in this study are less stable than the experimentally established benchmark base pair C-Ag(+)-G. The base pair formed from 1,3-dideaza-6-methoxypurine is isoenergetic to the experimentally observed C-Ag(+)-C base pair. This makes 1,3-dideaza-6-methoxypurine a promising candidate for the use as an artificial nucleobase in DNA.

  4. Using small RNA deep sequencing data to detect siRNA duplexes induced by plant viruses

    USDA-ARS?s Scientific Manuscript database

    Small interfering RNA (siRNA) duplexes are produced in plants during virus infection, which are short (usually 21 to 24-base pair) double-stranded RNAs (dsRNAs) with several overhanging nucleotides on the 5' end and 3' end. The investigation of the siRNA duplexes is useful to better understand the R...

  5. Alternative DNA base pairing through metal coordination.

    PubMed

    Clever, Guido H; Shionoya, Mitsuhiko

    2012-01-01

    Base-pairing in the naturally occurring DNA and RNA oligonucleotide duplexes is based on π-stacking, hydrogen bonding, and shape complementarity between the nucleobases adenine, thymine, guanine, and cytosine as well as on the hydrophobic-hydrophilic balance in aqueous media. This complex system of multiple supramolecular interactions is the product of a long-term evolutionary process and thus highly optimized to serve its biological functions such as information storage and processing. After the successful implementation of automated DNA synthesis, chemists have begun to introduce artificial modifications inside the core of the DNA double helix in order to study various aspects of base pairing, generate new base pairs orthogonal to the natural ones, and equip the biopolymer with entirely new functions. The idea to replace the hydrogen bonding interactions with metal coordination between ligand-like nucleosides and suitable transition metal ions culminated in the development of a plethora of artificial base-pairing systems termed "metal base-pairs" which were shown to strongly enhance the DNA duplex stability. Furthermore, they show great potential for the use of DNA as a molecular wire in nanoscale electronic architectures. Although single electrons have proven to be transmitted by natural DNA over a distance of several base pairs, the high ohmic resistance of unmodified oligonucleotides was identified as a serious obstacle. By exchanging some or all of the Watson-Crick base pairs in DNA with metal complexes, this problem may be solved. In the future, these research efforts are supposed to lead to DNA-like materials with superior conductivity for nano-electronic applications. Other fields of potential application such as DNA-based supramolecular architecture and catalysis may be strongly influenced by these developments as well. This text is meant to illustrate the basic concepts of metal-base pairing and give an outline over recent developments in this field.

  6. alpha-DNA X: alpha and beta tetrathymidilates covalently linked to oxazolopyridocarbazolium (OPC): comparative stabilization of oligo beta-[dT]:oligo beta-[dA] and oligo alpha-[dT]:oligo beta-[dA] duplexes by the intercalating agent.

    PubMed Central

    Bazile, D; Gautier, C; Rayner, B; Imbach, J L; Paoletti, C; Paoletti, J

    1989-01-01

    The influence of the intercalating oxazolopyridocarbazolium (HOPC) on the stabilization of modified oligonucleotides: alpha-T4c5OPC or beta-T4c5OPC associated to beta-oligo (dA) was studied. It appears that the situation is different from what has been observed for the interaction of these modified oligonucleotides with poly (rA). The higher free energy of formation of the alpha-T4c5OPC :beta-oligo(dA), when compared to beta-T4c5OPC, is essentially due to the overall stability added to this system by the intercalator. This enhanced stability comes from a higher number of binding sites of HOPC for the alpha:beta duplex together with a lower van't Hoff energy of formation of the alpha:beta duplex. PMID:2798125

  7. The stability of calcium chloride ion pairs in aqueous solutions at temperatures between 100 and 360 degree C

    SciTech Connect

    Williams-Jones, A.E. ); Seward, T.M. )

    1989-02-01

    The speciation of calcium in chloride solutions has been investigated between 100 and 360{degree}C by measuring the solubility of AgCl in HCl-CaCl{sub 2} solutions in which chloride varies from 0.3 to 3.0 m and calcium is maintained constant at 0.1 m. Cumulative equilibrium formation constants of calcium chloride ion pairs were evaluated using a non-liner least squares procedure. Association constants of calcium chloride ion pairs from the data at 100{degree}C. However, at 150{degree}C the cumulative formation constants for CaCl{sup +} and CaCl{sup 0}{sub 2} are 0.85 and 1.73, respectively. The stability field for CaCl{sup +} decreases with increasing temperature, whereas that for CaCl{sup 0}{sub 2} increases sharply and at 360{degree}C K{sub 2} is 4.95 {center dot} 10{sup 4}. Higher order calcium chloride ion pairs either do not form or have stability fields too small to be detected by the methods used in this study. The neutral aqueous calcium chloride ion pair CaCl{sup 0}{sub 2} contributes significantly to calcium speciation in intermediate to high salinity hydrothermal solutions: at 250{degree}C, 50 mol percent of the calcium in a 1 m HCl solution occurs as CaCl{sup 0}{sub 2}. The effect of this ion pairing is to increase the pH stability limits and solubilities of calcium-bearing minerals in such solutions.

  8. Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides

    PubMed Central

    Pasternak, Anna; Wengel, Jesper

    2010-01-01

    Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4.0–6.6 kcal/mol. Slight destabilization, by ∼0.5–1.5 kcal/mol, is observed for 5′- or 3′-terminal UNA residues. Furthermore, thermodynamic effects caused by UNA residues are extremely additive with ΔG°37 conformity up to 98%. Direct mismatches involving UNA residues decrease the thermodynamic stability less than unmodified mismatches in RNA duplexes. Additionally, the presence of UNA residues adjacent to unpaired RNA residues reduces mismatch discrimination. Thermodynamic analysis of UNA 5′- and 3′-dangling ends revealed that stacking interactions of UNA residues are always less favourable than that of RNA residues. Finally, circular dichroism spectra imply no changes in overall A-form structure of UNA–RNA/RNA duplexes relative to the unmodified RNA duplexes. PMID:20562222

  9. Conformational transitions of duplex and triplex nucleic acid helices: thermodynamic analysis of effects of salt concentration on stability using preferential interaction coefficients.

    PubMed Central

    Bond, J. P.; Anderson, C. F.; Record, M. T.

    1994-01-01

    For order-disorder transitions of double- and triple-stranded nucleic acid helices, the midpoint temperatures Tm depend strongly on a +/-, the mean ionic activity of uniunivalent salt. Experimental determinations of dTm/d ln a +/- and of the enthalpy change (delta H(o)) accompanying the transition in excess salt permit evaluation of delta gamma, the stoichiometrically weighted combination of preferential interaction coefficients, each of which reflects thermodynamic effects of interactions of salt ions with a reactant or product of the conformational transition (formula; see text) Here delta H(o) is defined per mole of nucleotide by analogy to delta gamma. Application of Eq. 1 to experimental values of delta H(o) and Tm yields values of delta gamma for the denaturation of B-DNA over the range of NaCl concentrations 0.01-0.20 M (Privalov et al. (1969), Biopolymers 8,559) and for each of four order-disorder transitions of poly rA.(poly rU)n, n = 1, 2 over the range of NaCl concentrations 0.01-1.0 M (Krakauer and Sturtevant (1968), Biopolymers 6, 491). For denaturation of duplexes and triplexes, delta gamma is negative and not significantly dependent on a +/-, but delta gamma is positive and dependent on a +/- for the disproportionation transition of poly rA.poly rU duplexes. Quantitative interpretations of these trends and magnitudes of delta gamma in terms of coulombic and excluded volume effects are obtained by fitting separately each of the two sets of thermodynamic data using Eq. 1 with delta gamma PB evaluated from the cylindrically symmetric Poisson-Boltzmann (PB) equation for a standard model of salt-polyelectrolyte solutions. The only structural parameters required by this model are: b, the mean axial distance between the projections of adjacent polyion charges onto the cylindrical axis; and a, the mean distance of closest approach between a salt ion center and the cylindrical axis. Fixing bMS and aMS for the multi-stranded (ordered) conformations, we

  10. Computational comparison of oxidation stability: Solvent/salt monomers vs solvent-solvent/salt pairs

    NASA Astrophysics Data System (ADS)

    Kim, Dong Young; Park, Min Sik; Lim, Younhee; Kang, Yoon-Sok; Park, Jin-Hwan; Doo, Seok-Gwang

    2015-08-01

    A fundamental understanding of the anodic stabilities of electrolytes is important for the development of advanced high-voltage electrolytes. In this study, we calculated and systematically compared the oxidation stabilities of monomeric solvents and anions, and bimolecular solvent-solvent and anion-solvent systems that are considered to be high-voltage electrolyte components, using ab initio calculations. Oxidation stabilities of solvent or anion monomers without considering specific solvation molecules cannot represent experimental oxidation stabilities. The oxidation of electrolytes usually forms neutral or cationic radicals, which immediately undergo further reactions stabilizing the products. Oxidatively driven intermolecular reactions are the main reason for the lower oxidation stabilities of electrolytes compared with those of monomeric compounds. Electrolyte components such as tetramethylene sulfone (TMS), ethyl methyl sulfone (EMS), bis(oxalate)borate (BOB-), and bis(trifluoromethane)sulfonamide (TFSI-) that minimize such intermolecular chemical reactions on oxidation can maintain the oxidation stabilities of monomers. In predictions of the theoretical oxidation stabilities of electrolytes, simple comparisons of highest occupied molecular orbital energies can be misleading, even if microsolvation or bulk clusters are considered. Instead, bimolecular solvent complexes with a salt anion should be at least considered in oxidation calculations. This study provides important information on fundamental and applied aspects of the development of electrolytes.

  11. View of 501 8th St., a sidegable duplex bungalow with ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of 501 8th St., a side-gable duplex bungalow with engaged porch and paired and clustered columns. Built as worker housing for Lanett Cotton Mill - 501 Eighth Street (House), 501 Eighth Street, Lanett, Chambers County, AL

  12. Non-nearest-neighbor dependence of stability for group III RNA single nucleotide bulge loops.

    PubMed

    Kent, Jessica L; McCann, Michael D; Phillips, Daniel; Panaro, Brandon L; Lim, Geoffrey F S; Serra, Martin J

    2014-06-01

    Thirty-five RNA duplexes containing single nucleotide bulge loops were optically melted and the thermodynamic parameters for each duplex determined. The bulge loops were of the group III variety, where the bulged nucleotide is either a AG/U or CU/G, leading to ambiguity to the exact position and identity of the bulge. All possible group III bulge loops with Watson-Crick nearest-neighbors were examined. The data were used to develop a model to predict the free energy of an RNA duplex containing a group III single nucleotide bulge loop. The destabilization of the duplex by the group III bulge could be modeled so that the bulge nucleotide leads to the formation of the Watson-Crick base pair rather than the wobble base pair. The destabilization of an RNA duplex caused by the insertion of a group III bulge is primarily dependent upon non-nearest-neighbor interactions and was shown to be dependent upon the stability of second least stable stem of the duplex. In-line structure probing of group III bulge loops embedded in a hairpin indicated that the bulged nucleotide is the one positioned further from the hairpin loop irrespective of whether the resulting stem formed a Watson-Crick or wobble base pair. Fourteen RNA hairpins containing group III bulge loops, either 3' or 5' of the hairpin loop, were optically melted and the thermodynamic parameters determined. The model developed to predict the influence of group III bulge loops on the stability of duplex formation was extended to predict the influence of bulge loops on hairpin stability. © 2014 Kent et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  13. An extremely stable, self-complementary hydrogen-bonded duplex

    SciTech Connect

    Zeng, Huang; Yang, Xiaowu; Brown, A L.; Martinovic, Suzana; Smith, Richard D.; Gong, Bing

    2003-07-30

    This paper describes the design, synthesis and characterization of a self-complementary six-H-bonded duplex with an association constant greater than 10{sup 9}/M in CHCl3. Numerous unnatural self-assembly systems have been developed in recent years. Most of these previously described systems are case-dependent, i.e., the individual components carry the information that defines only the formation of the specific assembly. An alternative approach involves the design of highly specific and highly stable recognition units (modules)that are compatible with a variety of structural components. Such recognition modules or ''molecular glues'' then direct the assembly of these structural components. In this regard,hydrogen-bonded complexes based on rigid heterocycles with multiple H-bonding donor (D) and acceptor (A) sites have received the most attention in recent years. Other complexes, most based on H-bonding interactions, have also been reported. Highly stable, self-complementary H-bonded complexes are particularly attractive for developing supramolecular homopolymers of very high molecular weights. In spite of the intriguing perspective, only a very small number of self-complementary H-bonded complexes with high stabilities are known. The best known examples involve two pairs of quadruply H-bonded, self-complementary complexes, both based on the AADD-DDAA array, and with association constants greater than 10{sup 7}/M. We report here the design and characterization of our first six-H-bonded, self-complementary duplex that contains the AADADD-DDADAA array.

  14. Weakened N3 Hydrogen Bonding by 5-Formylcytosine and 5-Carboxylcytosine Reduces Their Base-Pairing Stability.

    PubMed

    Dai, Qing; Sanstead, Paul J; Peng, Chunte Sam; Han, Dali; He, Chuan; Tokmakoff, Andrei

    2016-02-19

    In the active cytosine demethylation pathway, 5-methylcytosine (5mC) is oxidized sequentially to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC). Thymine DNA glycosylase (TDG) selectively excises 5fC and 5caC but not cytosine (C), 5mC, and 5hmC. We propose that the electron-withdrawing properties of -CHO and -COOH in 5fC and 5caC increase N3 acidity, leading to weakened hydrogen bonding and reduced base pair stability relative to C, 5mC, and 5hmC, thereby facilitating the selective recognition of 5fC and 5caC by TDG. Through (13)C NMR, we measured the pKa at N3 of 5fC as 2.4 and the two pKa's of 5caC as 2.1 and 4.2. We used isotope-edited IR spectroscopy coupled with density functional theory (DFT) calculations to site-specifically assign the more acidic pKa of 5caC to protonation at N3, indicating that N3 acidity is increased in 5fC and 5caC relative to C. IR and UV melting studies of self-complementary DNA oligomers confirm reduced stability for 5fC-G and 5caC-G base pairs. Furthermore, while the 5fC-G base pair stability is insensitive to pH, the 5caC-G stability is reduced as pH decreases and the carboxyl group is increasingly protonated. Despite suggestions that 5fC and 5caC may exist in rare tautomeric structures which form wobble GC base pairs, our two-dimensional infrared (2D IR) spectroscopy of 5fC and 5caC free nucleosides confirms that both bases are predominantly in the canonical amino-keto form. Taken together, these findings support our model that weakened base pairing ability for 5fC and 5caC in dsDNA contributes to their selective recognition by TDG.

  15. Finding the first cosmic explosions. IV. 90–140 $\\;{{M}_{\\odot }}$ pair-stability supernovae

    SciTech Connect

    Smidt, Joseph; Whalen, Daniel J.; Chatzopoulos, E.; Wiggins, Brandon; Chen, Ke-Jung; Kozyreva, Alexandra; Even, Wesley

    2015-05-19

    Population III stars that die as pair-instability supernovae are usually thought to fall in the mass range of 140 - 260 M. However, several lines of work have now shown that rotation can build up the He cores needed to encounter the pair instability at stellar masses as low as 90 M. Depending on the slope of the initial mass function of Population III stars, there could be 4 - 5 times as many stars from 90 - 140 M in the primordial universe than in the usually accepted range. We present numerical simulations of the pair-instability explosions of such stars performed with the MESA, FLASH and RAGE codes. We find that they will be visible to supernova factories such as Pan-STARRS and LSST in the optical out to z ~ 1-2 and JWST and the 30 m-class telescopes in the NIR out to z ~ 7-10. Such explosions will thus probe the stellar populations of the first galaxies and cosmic star formation rates in the era of cosmological reionization. These supernovae are also easily distinguished from more massive pair-instability explosions, underscoring the fact that there is far greater variety to the light curves of these events than previously understood.

  16. Finding the first cosmic explosions. IV. 90–140 $$\\;{{M}_{\\odot }}$$ pair-stability supernovae

    DOE PAGES

    Smidt, Joseph; Whalen, Daniel J.; Chatzopoulos, E.; ...

    2015-05-19

    Population III stars that die as pair-instability supernovae are usually thought to fall in the mass range of 140 - 260 M⊙. However, several lines of work have now shown that rotation can build up the He cores needed to encounter the pair instability at stellar masses as low as 90 M⊙. Depending on the slope of the initial mass function of Population III stars, there could be 4 - 5 times as many stars from 90 - 140 M⊙ in the primordial universe than in the usually accepted range. We present numerical simulations of the pair-instability explosions of suchmore » stars performed with the MESA, FLASH and RAGE codes. We find that they will be visible to supernova factories such as Pan-STARRS and LSST in the optical out to z ~ 1-2 and JWST and the 30 m-class telescopes in the NIR out to z ~ 7-10. Such explosions will thus probe the stellar populations of the first galaxies and cosmic star formation rates in the era of cosmological reionization. These supernovae are also easily distinguished from more massive pair-instability explosions, underscoring the fact that there is far greater variety to the light curves of these events than previously understood.« less

  17. Thermal stability comparison of nanocrystalline Fe-based binary alloy pairs

    SciTech Connect

    Clark, Blythe G.; Hattar, Khalid Mikhiel; Marshall, Michael Thomas; Chookajorn, Tonghai; Boyce, Brad L.; Schuh, Christopher A.

    2016-03-24

    Here, the widely recognized property improvements of nanocrystalline (NC) materials have generated significant interest, yet have been difficult to realize in engineering applications due to the propensity for grain growth in these interface-dense systems. While traditional pathways to thermal stabilization can slow the mobility of grain boundaries, recent theories suggest that solute segregation in NC alloy can reduce the grain boundary energy such that thermodynamic stabilization is achieved. Following the predictions of Murdock et al., here we compare for the first time the thermal stability of a predicted NC stable alloy (Fe-10at.% Mg) with a predicted non-NC stable alloy (Fe-10at.% Cu) using the same processing and characterization methodologies. Results indicate improved thermal stability of the Fe-Mg alloy in comparison to the Fe-Cu, and observed microstructures are consistent with those predicted by Monte Carlo simulations.

  18. Thermal stability comparison of nanocrystalline Fe-based binary alloy pairs

    DOE PAGES

    Clark, Blythe G.; Hattar, Khalid Mikhiel; Marshall, Michael Thomas; ...

    2016-03-24

    Here, the widely recognized property improvements of nanocrystalline (NC) materials have generated significant interest, yet have been difficult to realize in engineering applications due to the propensity for grain growth in these interface-dense systems. While traditional pathways to thermal stabilization can slow the mobility of grain boundaries, recent theories suggest that solute segregation in NC alloy can reduce the grain boundary energy such that thermodynamic stabilization is achieved. Following the predictions of Murdock et al., here we compare for the first time the thermal stability of a predicted NC stable alloy (Fe-10at.% Mg) with a predicted non-NC stable alloy (Fe-10at.%more » Cu) using the same processing and characterization methodologies. Results indicate improved thermal stability of the Fe-Mg alloy in comparison to the Fe-Cu, and observed microstructures are consistent with those predicted by Monte Carlo simulations.« less

  19. Thermal Stability Comparison of Nanocrystalline Fe-Based Binary Alloy Pairs

    NASA Astrophysics Data System (ADS)

    Clark, B. G.; Hattar, K.; Marshall, M. T.; Chookajorn, T.; Boyce, B. L.; Schuh, C. A.

    2016-06-01

    The widely recognized property improvements of nanocrystalline (NC) materials have generated significant interest; yet, they have been difficult to realize in engineering applications due to the propensity for grain growth in these interface-dominated systems. Although traditional pathways to thermal stabilization can slow the mobility of grain boundaries, recent theories suggest that solute segregation in NC alloys can reduce the grain boundary energy such that thermodynamic stabilization is achieved. Following the predictions of Murdoch et al., here we compare for the first time the thermal stability of a predicted NC stable alloy (Fe-10 at.% Mg) with a predicted non-NC stable alloy (Fe-10 at.% Cu) using the same processing and characterization methodologies. Results show improved thermal stability of the Fe-Mg alloy in comparison with the Fe-Cu, and thermally-evolved microstructures that are consistent with those predicted by Monte Carlo simulations.

  20. Surface morphology of CuFeS2: The stability of the polar (112 ) /(112 ¯) surface pair

    NASA Astrophysics Data System (ADS)

    Chen, Vincent H.-Y.; Mallia, Giuseppe; Martínez-Casado, Ruth; Harrison, Nicholas M.

    2015-10-01

    The reconstruction and energetics for a range of chalcopyrite (CuFeS2) surfaces have been investigated using hybrid-exchange density functional theory. The stable nonpolar surfaces in increasing order of surface energy are (110), (102), and (114). In addition, the polar (112 ) /(112 ¯) surface pair was found to be remarkably stable with a surface formation energy that is only slightly higher than that of the (110) surface. The stability of (112 ) /(112 ¯) can be attributed to a combination of geometric and electronic mechanisms that result in the suppression of the electrostatic dipole perpendicular to the surface. Defect formation is a third mechanism that can further stabilize the (112 ) /(112 ¯) surface pair to an extent that it is thermodynamically preferred over the (110) surface. The stability of (112 ) /(112 ¯) means that regardless of the growth conditions, (112) and (112 ¯) facets are expected to have a significant presence in the surface morphology of CuFeS2.

  1. Unique base-pair breathing dynamics in PNA-DNA hybrids.

    PubMed

    Leijon, M; Sehlstedt, U; Nielsen, P E; Gräslund, A

    1997-08-22

    Kinetic and thermodynamic parameters, derived from 1H-NMR measurements of the imino proton exchange rates upon titration with the exchange catalyst ammonia, are reported for two mixed-sequence peptide nucleic acid (PNA)-DNA hybrids and their counterpart DNA duplex. The exchange times of the imino protons in the PNA strands extrapolate to very short base-pair lifetimes in the limit of infinite exchange catalyst concentration. This is not due to generally less stable base-pairs in PNA-DNA hybrids, since the lifetimes, apparent dissociation constants and thermodynamic stability (DeltaG degrees ) of the innermost DNA guanine imino protons are similar in the hybrid duplexes and in the DNA duplex. In addition, the apparent dissociation constants determined for PNA bases of the hybrids are of the same order as those of the corresponding bases in the DNA duplex. An exchange process from the closed state was found to be inconsistent with the experimental data. From these results, we conclude that opening and closing rates of the PNA guanine and thymine bases are at least two orders of magnitude higher than those of the corresponding bases in the DNA duplex. Unusual kinetics in the hybrids is also evident from the destabilization of the complementary DNA strand thymine bases, which exhibit base-pair dissociation constants increased by approximately two orders of magnitude compared to what is observed in the DNA duplex, while the DNA strand guanine bases are largely unaffected. The general pattern of the base-pair dynamics in the hybrids obtained when using trimethylamine as an exchange catalyst is the same as when using ammonia. However, the long base-pair lifetimes i. e. those of the DNA duplex and the guanine bases of the DNA strands in the hybrids, are approximately three to five times longer than when using ammonia. Thus, all opening events sensed by ammonia are not accessible to trimethylamine. These observations are discussed in regard to the mechanism of base-pair

  2. Role of ion-pair interactions on asphaltene stabilization by alkylbenzenesulfonic acids.

    PubMed

    Goual, Lamia; Sedghi, Mohammad

    2015-02-15

    The dispersion of asphaltenes by dodecylbenzenesulfonic acid (DBSA) has been the subject of several studies in the past. However, it is unclear how these interactions affect the structure of asphaltenes and why asphaltene aggregates are larger in the presence of ionic DBSA. The main goal of this study was to address these points using a combination of high-resolution transmission electron microscopy (HRTEM) and molecular dynamics (MD) simulations. Another objective was to compare ionic DBSA (i.e., dodecylbenzenesulfonate or DBS(-)) to nonionic amphiphiles such as alkylphenols. A striking similarity between dodecylbenzenesulfonate and alkylphenols was that both favored the formation of filamentary rather than globular asphaltene flocculates. However the mechanism by which those filaments formed was very different. Two strong electrostatic interactions between DBSA and asphaltenes were found: (i) those between protonated asphaltenes (i.e., AH(+)) and DBS(-) molecules, which were fifteen times stronger than asphaltene-alkylphenol interactions, and (ii) those between two asphaltene-dispersant pairs (i.e., AH(+)-DBS(-) ion pairs), which did not exist with alkylphenols. These interactions promoted the formation of large and compact asphaltene flocculates, as compared to small and loose ones formed without DBSA. Flocculates with DBSA could further bind to each other through ion-pair interactions. The binding occurred in series (generating long filaments) or in parallel (generating lateral ramifications). However the series configuration was energetically favored due to less steric effects generated by the side aliphatic chains of asphaltenes and DBSA.

  3. The stabilization effect of dielectric constant and acidic amino acids on arginine-arginine (Arg-Arg) pairings: database survey and computational studies.

    PubMed

    Zhang, Zhengyan; Xu, Zhijian; Yang, Zhuo; Liu, Yingtao; Wang, Jin'an; Shao, Qiang; Li, Shujin; Lu, Yunxiang; Zhu, Weiliang

    2013-05-02

    Database survey in this study revealed that about one-third of the protein structures deposited in the Protein Data Bank (PDB) contain arginine-arginine (Arg-Arg) pairing with a carbon···carbon (CZ···CZ) interaction distance less than 5 Å. All the Arg-Arg pairings were found to bury in a polar environment composed of acidic residues, water molecules, and strong polarizable or negatively charged moieties from binding site or bound ligand. Most of the Arg-Arg pairings are solvent exposed and 68.3% Arg-Arg pairings are stabilized by acidic residues, forming Arg-Arg-Asp/Glu clusters. Density functional theory (DFT) was then employed to study the effect of environment on the pairing structures. It was revealed that Arg-Arg pairings become thermodynamically stable (about -1 kcal/mol) as the dielectric constant increases to 46.8 (DMSO), in good agreement with the results of the PDB survey. DFT calculations also demonstrated that perpendicular Arg-Arg pairing structures are favorable in low dielectric constant environment, while in high dielectric constant environment parallel structures are favorable. Additionally, the acidic residues can stabilize the Arg-Arg pairing structures to a large degree. Energy decomposition analysis of Arg-Arg pairings and Arg-Arg-Asp/Glu clusters showed that both solvation and electrostatic energies contribute significantly to their stability. The results reported herein should be very helpful for understanding Arg-Arg pairing and its application in drug design.

  4. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m(5)dCyd: Implications for the Stability of DNA i-Motif Conformations.

    PubMed

    Yang, Bo; Rodgers, M T

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m(5)dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m(5)dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m(5)dCyd)H(+)(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  5. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  6. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  7. Quantifying the Temperature Dependence of Glycine Betaine RNA Duplex Destabilization

    PubMed Central

    Schwinefus, Jeffrey J.; Menssen, Ryan J.; Kohler, James M.; Schmidt, Elliot C.; Thomas, Alexandra L.

    2013-01-01

    Glycine betaine stabilizes folded protein structure due to its unfavorable thermodynamic interactions with amide oxygen and aliphatic carbon surface area exposed during protein unfolding. However, glycine betaine can attenuate nucleic acid secondary structure stability, although its mechanism of destabilization is not currently understood. In this work we quantify glycine betaine interactions with the surface area exposed during thermal denaturation of nine RNA dodecamer duplexes with guanine-cytosine (GC) contents of 17–100%. Hyperchromicity values indicate increasing glycine betaine molality attenuates stacking. Glycine betaine destabilizes higher GC content RNA duplexes to a greater extent than low GC content duplexes due to greater accumulation at the surface area exposed during unfolding. The accumulation is very sensitive to temperature and displays characteristic entropy-enthalpy compensation. Since the entropic contribution to the m-value (used to quantify GB interaction with the RNA solvent accessible surface area exposed during denaturation) is more dependent on temperature than the enthalpic contribution, higher GC content duplexes with their larger transition temperatures are destabilized to a greater extent than low GC content duplexes. The concentration of glycine betaine at the RNA surface area exposed during unfolding relative to bulk was quantified using the solute partitioning model. Temperature correction predicts a glycine betaine concentration at 25 °C to be nearly independent of GC content, indicating that glycine betaine destabilizes all sequences equally at this temperature. PMID:24219229

  8. Effect of base modifications on structure, thermodynamic stability, and gene silencing activity of short interfering RNA

    PubMed Central

    Sipa, Katarzyna; Sochacka, Elzbieta; Kazmierczak-Baranska, Julia; Maszewska, Maria; Janicka, Magdalena; Nowak, Genowefa; Nawrot, Barbara

    2007-01-01

    A series of nucleobase-modified siRNA duplexes containing “rare” nucleosides, 2-thiouridine (s2U), pseudouridine (Ψ), and dihydrouridine (D), were evaluated for their thermodynamic stability and gene silencing activity. The duplexes with modified units at terminal positions exhibited similar stability as the nonmodified reference. Introduction of the s2U or Ψ units into the central part of the antisense strand resulted in duplexes with higher melting temperatures (Tm). In contrary, D unit similarly like wobble base pair led to the less stable duplexes (ΔTm 3.9 and 6.6°C, respectively). Gene-silencing activity of siRNA duplexes directed toward enhanced green fluorescent protein or beta-site APP cleaving enzyme was tested in a dual fluorescence assay. The duplexes with s2U and Ψ units at their 3′-ends and with a D unit at their 5′-ends (with respect to the guide strands) were the most potent gene expression inhibitors. Duplexes with s2U and Ψ units at their 5′-ends were by 50% less active than the nonmodified counterpart. Those containing a D unit or wobble base pair in the central domain had the lowest Tm, disturbed the A-type helical structure, and had more than three times lower activity than their nonmodified congener. Activity of siRNA containing the wobble base pair could be rescued by placing the thio-nucleoside at the position 3′-adjacent to the mutation site. Thermally stable siRNA molecules containing several s2U units in the antisense strand were biologically as potent as their native counterparts. The present results provide a new chemical tool for modulation of siRNA gene-silencing activity. PMID:17585051

  9. The roles of entropy and enthalpy in stabilizing ion-pairs at transition states in zeolite acid catalysis.

    PubMed

    Gounder, Rajamani; Iglesia, Enrique

    2012-02-21

    Acidic zeolites are indispensable catalysts in the petrochemical industry because they select reactants and their chemical pathways based on size and shape. Voids of molecular dimensions confine reactive intermediates and transition states that mediate chemical reactions, stabilizing them by van der Waals interactions. This behavior is reminiscent of the solvation effects prevalent within enzyme pockets and has analogous consequences for catalytic specificity. Voids provide the "right fit" for certain transition states, reflected in their lower free energies, thus extending the catalytic diversity of zeolites well beyond simple size discrimination. This catalytic diversity is even more remarkable because acid strength is essentially unaffected by confinement among known crystalline aluminosilicates. In this Account, we discuss factors that determine the "right fit" for a specific chemical reaction, exploring predictive criteria that extend the prevailing discourse based on size and shape. We link the structures of reactants, transition states, and confining voids to chemical reactivity and selectivity. Confinement mediates enthalpy-entropy compromises that determine the Gibbs free energies of transition states and relevant reactants; these activation free energies determine turnover rates via transition state theory. At low temperatures (400-500 K), dimethyl ether carbonylation occurs with high specificity within small eight-membered ring (8-MR) voids in FER and MOR zeolite structures, but at undetectable rates within larger voids (MFI, BEA, FAU, and SiO(2)-Al(2)O(3)). More effective van der Waals stabilization within 8-MR voids leads to lower ion-pair enthalpies but also lower entropies; taken together, carbonylation activation free energies are lower within 8-MR voids. The "right fit" is a "tight fit" at low temperatures, a consequence of how temperature appears in the defining equation for Gibbs free energy. In contrast, entropy effects dominate in high

  10. Predicting structure and stability for RNA complexes with intermolecular loop–loop base-pairing

    PubMed Central

    Cao, Song; Xu, Xiaojun; Chen, Shi-Jie

    2014-01-01

    RNA loop–loop interactions are essential for genomic RNA dimerization and regulation of gene expression. In this article, a statistical mechanics-based computational method that predicts the structures and thermodynamic stabilities of RNA complexes with loop–loop kissing interactions is described. The method accounts for the entropy changes for the formation of loop–loop interactions, which is a notable advancement that other computational models have neglected. Benchmark tests with several experimentally validated systems show that the inclusion of the entropy parameters can indeed improve predictions for RNA complexes. Furthermore, the method can predict not only the native structures of RNA/RNA complexes but also alternative metastable structures. For instance, the model predicts that the SL1 domain of HIV-1 RNA can form two different dimer structures with similar stabilities. The prediction is consistent with experimental observation. In addition, the model predicts two different binding sites for hTR dimerization: One binding site has been experimentally proposed, and the other structure, which has a higher stability, is structurally feasible and needs further experimental validation. PMID:24751648

  11. Theoretical study on the structure, stability, and electronic properties of the guanine-Zn-cytosine base pair in M-DNA

    SciTech Connect

    Fuentes-Cabrera, Miguel A; Sumpter, Bobby G; Sponer, Judit; Sponer, Jiri; Petit, Leon; Wells, Jack C

    2007-01-01

    M-DNA is a type of metalated DNA that forms at high pH and in the presence of Zn, Ni, and Co, with the metals placed in between each base pair, as in G-Zn-C. Experiments have found that M-DNA could be a promising candidate for a variety of nanotechnological applications, as it is speculated that the metal d-states enhance the conductivity, but controversy still clouds these findings. In this paper, we carry out a comprehensive ab initio study of eight G-Zn-C models in the gas phase to help discern the structure and electronic properties of Zn-DNA. Specifically, we study whether a model prefers to be planar and has electronic properties that correlate with Zn-DNA having a metallic-like conductivity. Out of all the studied models, there is only one which preserves its planarity upon full geometry optimization. Nevertheless, starting from this model, one can deduce a parallel Zn-DNA architecture only. This duplex would contain the imino proton, in contrast to what has been proposed experimentally. Among the nonplanar models, there is one that requires less than 8 kcal/mol to flatten (both in gas and solvent conditions), and we propose that it is a plausible model for building an antiparallel duplex. In this duplex, the imino proton would be replaced by Zn, in accordance with experimental models. Neither planar nor nonplanar models have electronic properties that correlate with Zn-DNA having a metallic-like conductivity due to Zn d-states. To understand whether density functional theory (DFT) can describe appropriately the electronic properties of M-DNAs, we have investigated the electronic properties of G-Co-C base pairs. We have found that when self-interaction corrections (SIC) are not included the HOMO state contains Co d-levels, whereas these levels are moved below the HOMO state when SIC are considered. This result indicates that caution should be exercised when studying the electronic properties of M-DNAs with functionals that do not account for strong

  12. NMR spectroscopy of RNA duplexes containing pseudouridine in supercooled water.

    PubMed

    Schroeder, Kersten T; Skalicky, Jack J; Greenbaum, Nancy L

    2005-07-01

    We have performed NMR experiments in supercooled water in order to decrease the temperature-dependent exchange of protons in RNA duplexes. NMR spectra of aqueous samples of RNA in bundles of narrow capillaries that were acquired at temperatures as low as -18 degrees C reveal resonances of exchangeable protons not seen at higher temperatures. In particular, we detected the imino protons of terminal base pairs and the imino proton of a non-base-paired pseudouridine in a duplex representing the eukaryotic pre-mRNA branch site helix. Analysis of the temperature dependence of chemical shift changes (thermal coefficients) for imino protons corroborated hydrogen bonding patterns observed in the NMR-derived structural model of the branch site helix. The ability to observe non-base-paired imino protons of RNA is of significant value in structure determination of RNA motifs containing loop and bulge regions.

  13. [Carotid duplex ultrasonography for neurosurgeons].

    PubMed

    Sadahiro, Hirokazu; Ishihara, Hideyuki; Oka, Fumiaki; Suzuki, Michiyasu

    2011-12-01

    Carotid duplex ultrasonography (CDU) is one of the most well-known imaging methods for arteriosclerosis and ischemic stroke. For neurosurgeons, it is very important for the details of carotid plaque to be thoroughly investigated by CDU. Symptomatic carotid plaque is very fragile and easily changes morphologically, and so requires frequent CDU examination. Furthermore, after carotid endarterectomy (CEA) and carotid artery stenting (CAS), restenosis is evaluated with CDU. CDU facilitates not only morphological imaging in the B mode, but also allows a flow study with color Doppler and duplex imaging. So, CDU can help assess the presence of proximal and intracranial artery lesions in spite of only having a cervical view, and the patency of the extracranial artery to intracranial artery bypass is revealed with CDU, which shows a rich velocity and low pulsatility index (PI) in duplex imaging. For the examiner, it is necessary to ponder on what duplex imaging means in examinations, and to summarize all imaging finding.

  14. Stability of 100 homo and heterotypic coiled-coil a-a' pairs for ten amino acids (A, L, I, V, N, K, S, T, E, and R).

    PubMed

    Acharya, Asha; Rishi, Vikas; Vinson, Charles

    2006-09-26

    We present the thermal stability monitored by circular dichroism (CD) spectroscopy at 222 nm of 100 heterodimers that contain all possible coiled-coil a-a' pairs for 10 amino acids (I, V, L, N, A, K S, T, E, and R). This includes the stability of 36 heterodimers for 6 amino acids (I, V, L, N, A, and K) previously described and 64 new heterodimers including the 4 amino acids (S, T, E, and R). We have calculated a double mutant alanine thermodynamic cycle to determine a-a' pair coupling energies to evaluate which a-a' pairs encourage specific dimerization partners. The four new homotypic a-a' pairs (T-T, S-S, R-R, E-E) are repulsive relative to A-A and have destabilizing coupling energies. Among the 90 heterotypic a-a' pairs, the stabilizing coupling energies contain lysine or arginine paired with either an aliphatic or a polar amino acid. The range in coupling energies for each amino acid reveals its potential to regulate dimerization specificity. The a-a' pairs containing isoleucine and asparagine have the greatest range in coupling energies and thus contribute dramatically to dimerization specificity, which is to encourage homodimerization. In contrast, the a-a' pairs containing charged amino acids (K, R, and E) show the least range in coupling energies and promiscuously encourage heterodimerization.

  15. Functional Relationship of ATP Hydrolysis, Presynaptic Filament Stability, and Homologous DNA Pairing Activity of the Human Meiotic Recombinase DMC1.

    PubMed

    Chang, Hao-Yen; Liao, Chia-Yu; Su, Guan-Chin; Lin, Sheng-Wei; Wang, Hong-Wei; Chi, Peter

    2015-08-07

    DMC1 and RAD51 are conserved recombinases that catalyze homologous recombination. DMC1 and RAD51 share similar properties in DNA binding, DNA-stimulated ATP hydrolysis, and catalysis of homologous DNA strand exchange. A large body of evidence indicates that attenuation of ATP hydrolysis leads to stabilization of the RAD51-ssDNA presynaptic filament and enhancement of DNA strand exchange. However, the functional relationship of ATPase activity, presynaptic filament stability, and DMC1-mediated homologous DNA strand exchange has remained largely unexplored. To address this important question, we have constructed several mutant variants of human DMC1 and characterized them biochemically to gain mechanistic insights. Two mutations, K132R and D223N, that change key residues in the Walker A and B nucleotide-binding motifs ablate ATP binding and render DMC1 inactive. On the other hand, the nucleotide-binding cap D317K mutant binds ATP normally but shows significantly attenuated ATPase activity and, accordingly, forms a highly stable presynaptic filament. Surprisingly, unlike RAD51, presynaptic filament stabilization achieved via ATP hydrolysis attenuation does not lead to any enhancement of DMC1-catalyzed homologous DNA pairing and strand exchange. This conclusion is further supported by examining wild-type DMC1 with non-hydrolyzable ATP analogues. Thus, our results reveal an important mechanistic difference between RAD51 and DMC1. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. The solution structure of double helical arabino nucleic acids (ANA and 2'F-ANA): effect of arabinoses in duplex-hairpin interconversion.

    PubMed

    Martín-Pintado, Nerea; Yahyaee-Anzahaee, Maryam; Campos-Olivas, Ramón; Noronha, Anne M; Wilds, Christopher J; Damha, Masad J; González, Carlos

    2012-10-01

    We report here the first structure of double helical arabino nucleic acid (ANA), the C2'-stereoisomer of RNA, and the 2'-fluoro-ANA analogue (2'F-ANA). A chimeric dodecamer based on the Dickerson sequence, containing a contiguous central segment of arabino nucleotides, flanked by two 2'-deoxy-2'F-ANA wings was studied. Our data show that this chimeric oligonucleotide can adopt two different structures of comparable thermal stabilities. One structure is a monomeric hairpin in which the stem is formed by base paired 2'F-ANA nucleotides and the loop by unpaired ANA nucleotides. The second structure is a bimolecular duplex, with all the nucleotides (2'F-ANA and ANA) forming Watson-Crick base pairs. The duplex structure is canonical B-form, with all arabinoses adopting a pure C2'-endo conformation. In the ANA:ANA segment, steric interactions involving the 2'-OH substituent provoke slight changes in the glycosidic angles and, therefore, in the ANA:ANA base pair geometry. These distortions are not present in the 2'F-ANA:2'F-ANA regions of the duplex, where the -OH substituent is replaced by a smaller fluorine atom. 2'F-ANA nucleotides adopt the C2'-endo sugar pucker and fit very well into the geometry of B-form duplex, allowing for favourable 2'F···H8 interactions. This interaction shares many features of pseudo-hydrogen bonds previously observed in 2'F-ANA:RNA hybrids and in single 2'F-ANA nucleotides.

  17. Dda helicase tightly couples translocation on single-stranded DNA to unwinding of duplex DNA: Dda is an optimally active helicase.

    PubMed

    Byrd, Alicia K; Matlock, Dennis L; Bagchi, Debjani; Aarattuthodiyil, Suja; Harrison, David; Croquette, Vincent; Raney, Kevin D

    2012-07-13

    Helicases utilize the energy of ATP hydrolysis to unwind double-stranded DNA while translocating on the DNA. Mechanisms for melting the duplex have been characterized as active or passive, depending on whether the enzyme actively separates the base pairs or simply sequesters single-stranded DNA (ssDNA) that forms due to thermal fraying. Here, we show that Dda translocates unidirectionally on ssDNA at the same rate at which it unwinds double-stranded DNA in both ensemble and single-molecule experiments. Further, the unwinding rate is largely insensitive to the duplex stability and to the applied force. Thus, Dda transduces all of its translocase activity into DNA unwinding activity so that the rate of unwinding is limited by the rate of translocation and that the enzyme actively separates the duplex. Active and passive helicases have been characterized by dividing the velocity of DNA unwinding in base pairs per second (V(un)) by the velocity of translocation on ssDNA in nucleotides per second (V(trans)). If the resulting fraction is 0.25, then a helicase is considered to be at the lower end of the "active" range. In the case of Dda, the average DNA unwinding velocity was 257±42 bp/s, and the average translocation velocity was 267±15 nt/s. The V(un)/V(trans) value of 0.96 places Dda in a unique category of being an essentially "perfectly" active helicase.

  18. Determination of sensor oversize for stereo-pair mismatch compensation and image stabilization

    NASA Astrophysics Data System (ADS)

    Kulkarni, Prajit

    2013-03-01

    Stereoscopic cameras consist of two camera modules that in theory are mounted parallel to each other at a fixed distance along a single plane. Practical tolerances in the manufacturing and assembly process can, however, cause mismatches in the relative orientation of the modules. One solution to this problem is to design sensors that image a larger field-of-view than is necessary to meet system specifications. This requires the computation of the sensor oversize needed to compensate for the various types of mismatch. This work presents a mathematical framework to determine these oversize values for mismatch along each of the six degrees of freedom. One module is considered as the reference and the extreme rays of the field-of-view of the second sensor are traced in order to derive equations for the required horizontal and vertical oversize. As a further application, by modeling user hand-shake as the displacement of the sensor from its intended position, these deterministic equations could be used to estimate the sensor oversize required to stabilize images that are captured using cell phones.

  19. Structural basis for duplex RNA recognition and cleavage by Archaeoglobus fulgidus C3PO

    PubMed Central

    Parizotto, Eneida A; Lowe, Edward D; Parker, James S

    2013-01-01

    Oligomeric complexes of Trax and Translin proteins, known as C3POs, participate in a variety of eukaryotic nucleic acid metabolism pathways including RNAi and tRNA processing. In RNAi in humans and Drosophila, C3PO activates pre-RISC by removing the passenger strand of the siRNA precursor duplex using nuclease activity present in Trax. It is not known how C3POs engage with nucleic acid substrates. Here we identify a single protein from Archaeoglobus fulgidus that assembles into an octamer with striking similarity to human C3PO. The structure in complex with duplex RNA reveals that the octamer entirely encapsulates a single thirteen base-pair RNA duplex inside a large inner cavity. Trax-like subunit catalytic sites target opposite strands of the duplex for cleavage, separated by seven base pairs. The structure provides insight into the mechanism of RNA recognition and cleavage by an archaeal C3PO-like complex. PMID:23353787

  20. Synthesis of native-like crosslinked duplex RNA and study of its properties.

    PubMed

    Onizuka, Kazumitsu; Hazemi, Madoka E; Thomas, Justin M; Monteleone, Leanna R; Yamada, Ken; Imoto, Shuhei; Beal, Peter A; Nagatsugi, Fumi

    2017-04-01

    A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in order to carry out its functions. We have endeavored to prepare the covalently crosslinked native-like duplex RNA, which could be useful for biochemical studies and RNA nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in RNA. We measured melting temperatures and CD spectra to identify the properties of the VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic stability without disturbing the natural conformation of dsRNA. In addition, a competitive binding experiment with the duplex RNA binding enzyme, ADAR2, showed the crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural dsRNA, confirming that it has finely preserved the natural traits of duplex RNA.

  1. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex

    PubMed Central

    Ueda, Yu-mi; Zouzumi, Yu-ki; Maruyama, Atsushi; Nakano, Shu-ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    Abstract We systematically investigated effects of molecular crowding with trimethylamine N-oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences. PMID:27933115

  2. The F box protein partner of paired regulates stability of Drosophila centromeric histone H3, CenH3(CID).

    PubMed

    Moreno-Moreno, Olga; Medina-Giró, Sònia; Torras-Llort, Mònica; Azorín, Fernando

    2011-09-13

    Centromere identity and function is determined by the specific localization of CenH3 (reviewed in [1-7]). Several mechanisms regulate centromeric CenH3 localization, including proteasome-mediated degradation that, both in budding yeast and Drosophila, regulates CenH3 levels and prevents promiscuous misincorporation throughout chromatin [8, 9]. CenH3(CENP-A) proteolysis has also been reported in senescent human cells [10] or upon infection with herpes simplex virus 1 [11]. Little is known, however, about the actual mechanisms that regulate CenH3 proteolysis. Recent work in budding yeast identified Psh1 as an E3-ubiquitin ligase that mediates degradation of CenH3(Cse4p) [12, 13], but E3-ligases regulating CenH3 stability in metazoans are unknown. Here, we report that the F box protein partner of paired (Ppa), which is a variable subunit of the main E3-ligase SCF [14-17], mediates CenH3(CID) stability in Drosophila. Our results show that Ppa depletion results in increased CenH3(CID) levels. Ppa physically interacts with CenH3(CID) through the CATD(CID) that, in the fly, mediates Ppa-dependent CenH3(CID) stability. Altogether, these results strongly suggest that, in Drosophila, SCF(Ppa) regulates CenH3(CID) proteolysis. Interestingly, most known SCF complexes are inactive when, at mitosis, de novo CenH3(CID) deposition takes place at centromeres, suggesting that, in Drosophila, CenH3(CID) deposition and proteolysis are synchronized events.

  3. Benefits of Automatic Duplexing Fact Sheet

    EPA Pesticide Factsheets

    This resource provides a how-to duplex guide, informs the reader on the benefits and cost savings from automatic duplexing, and several off the shelf print management software options for your facility.

  4. Dissecting the contributions of β-hairpin tyrosine pairs to the folding and stability of long-lived human γD-crystallins.

    PubMed

    Yang, Zaixing; Xia, Zhen; Huynh, Tien; King, Jonathan A; Zhou, Ruhong

    2014-01-01

    Ultraviolet-radiation-induced damage to and aggregation of human lens crystallin proteins are thought to be a significant pathway to age-related cataract. The aromatic residues within the duplicated Greek key domains of γ- and β-crystallins are the main ultraviolet absorbers and are susceptible to direct and indirect ultraviolet damage. The previous site-directed mutagenesis studies have revealed a striking difference for two highly conserved homologous β-hairpin Tyr pairs, at the N-terminal domain (N-td) and C-terminal domain (C-td), respectively, in their contribution to the overall stability of HγD-Crys, but why they behave so differently still remains a mystery. In this paper, we systematically investigated the underlying molecular mechanism and detailed contributions of these two Tyr pairs with large scale molecular dynamics simulations. A series of different tyrosine-to-alanine pair(s) substitutions were performed in either the N-td, the C-td, or both. Our results suggest that the Y45A/Y50A pair substitution in the N-td mainly affects the stability of the N-td itself, while the Y133A/Y138A pair substitution in the C-td leads to a more cooperative unfolding of both N-td and C-td. The stability of motif 2 in the N-td is mainly determined by the interdomain interface, while motif 1 in the N-td or motifs 3 and 4 in the C-td are mainly stabilized by the intradomain hydrophobic core. The damage to any tyrosine pair(s) can directly introduce some apparent water leakage to the hydrophobic core at the interface, which in turn causes a serious loss in the stability of the N-td. However, for the C-td substitutions, it may further impair the stable "sandwich-like" Y133-R167-Y138 cluster (through cation-π interactions) in the wild-type, thus causing the loop regions near the residue A138 to undergo large fluctuations, which in turn results in the intrusion of water into the hydrophobic core of the C-td and induces the C-td to lose its stability. These findings help

  5. DNA Duplex Engineering for Enantioselective Fluorescent Sensor.

    PubMed

    Hu, Yuehua; Lin, Fan; Wu, Tao; Zhou, Yufeng; Li, Qiusha; Shao, Yong; Xu, Zhiai

    2017-02-21

    The rapid identification of biomacromolecule structure that has a specific association with chiral enantiomers especially from natural sources will be helpful in developing enantioselective sensor and in speeding up drug exploitation. Herein, owing to its existence also in living cells, apurinic/apyrimidinic site (AP site) was first engineered into ds-DNA duplex to explore its competence in enantiomer selectivity. An AP site-specific fluorophore was utilized as an enantioselective discrimination probe to develop a straightforward chiral sensor using natural tetrahydropalmatine (L- and D-THP) as enantiomer representatives. We found that only L-THP can efficiently replace the prebound fluorophore to cause a significant fluorescence increase due to its specific binding with the AP site (two orders magnitude higher in affinity than binding with D-THP). The AP site binding specificity of L-THP over D-THP was assessed via intrinsic fluorescence, isothermal titration calorimetry, and DNA stability. The enantioselective performance can be easily tuned by the sequences near the AP site and the number of AP sites. A single AP site provides a perfect binding pocket to differentiate the chiral atom-induced structure discrepancy. We expect that our work will inspire interest in engineering local structures into a ds-DNA duplex for developing novel enantioselective sensors.

  6. Base-pairing energies of protonated nucleobase pairs and proton affinities of 1-methylated cytosines: model systems for the effects of the sugar moiety on the stability of DNA i-motif conformations.

    PubMed

    Yang, Bo; Moehlig, Aaron R; Frieler, C E; Rodgers, M T

    2015-02-05

    Expansion of (CCG)n·(CGG)n trinucleotide repeats leads to hypermethylation of cytosine residues and results in Fragile X syndrome, the most common cause of inherited intellectual disability in humans. The (CCG)n·(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical protonated nucleobase pairs of cytosine (C(+)·C). Previously, we investigated the effects of 5-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present work, we extend our investigations to include protonated homo- and heteronucleobase pairs of cytosine, 1-methylcytosine, 5-methylcytosine, and 1,5-dimethylcytosine. The 1-methyl substituent prevents most tautomerization processes of cytosine and serves as a mimic for the sugar moiety of DNA nucleotides. In contrast to permethylation of cytosine at the 5-position, 1-methylation is found to exert very little influence on the BPE. All modifications to both nucleobases lead to a small increase in the BPEs, with 5-methylation producing a larger enhancement than either 1-methyl or 1,5-dimethylation. In contrast, modifications to a single nucleobase are found to produce a small decrease in the BPEs, again with 5-methylation producing a larger effect than 1-methylation. However, the BPEs of all of the protonated nucleobase pairs examined here significantly exceed those of canonical G·C and neutral C·C base pairs, and thus should still provide the driving force stabilizing DNA i-motif conformations even in the presence of such modifications. The proton affinities of the methylated cytosines are also obtained from the TCID experiments by competitive analyses of the primary dissociation pathways that occur in parallel for the protonated heteronucleobase pairs.

  7. Duplex evaluation of venous insufficiency.

    PubMed

    Labropoulos, Nicos; Leon, Luis R

    2005-03-01

    Duplex ultrasound is the most useful examination for the evaluation of venous valvular incompetence. Multi-frequency 4 to 7-MHz linear array transducers are typically used for this assessment of superficial and deep reflux. The examination is done with the patient standing and manual compression maneuvers are used to initiate reflux. Automatic rapid inflation and deflation cuffs may be used when a standard stimulus is needed. Cutoff values for reflux have been defined. Perforating veins must be identified and flow direction during compression recorded. When ulcers are present, duplex ultrasound is used to investigate veins of the ulcerated legs. Venous outflow obstruction is also studied by duplex ultrasound and chronic changes in deep and superficial veins following deep venous thrombosis noted. The main drawback in evaluation of chronic obstruction is inability to quantify hemodynamic significance. Anatomic variations in superficial and deep veins are common and their identification is necessary. Reporting results of duplex ultrasound studies must take into consideration the proper classification of venous disease as well as the new anatomic terms that have been accepted.

  8. Thermodynamic Consequences of the Hyperoxidized Guanine Lesion Guanidinohydantoin in Duplex DNA

    PubMed Central

    Yennie, Craig J.; Delaney, Sarah

    2012-01-01

    Guanidinohydantoin (Gh) is a hyperoxidized DNA lesion produced by oxidation of 8-oxo-7,8-dihydroguanine (8-oxoG). Previous work has shown that Gh is potently mutagenic both in vitro and in vivo coding for G → T and G → C transversion mutations. In this work, analysis by circular dichroism shows that the Gh lesion does not significantly alter the global structure of a 15-mer duplex, and that the DNA remains in the B-form. However, we find that Gh causes a large decrease in the thermal stability, decreasing the duplex melting temperature by ~ 17 °C relative to an unmodified duplex control. Using optical melting analysis and differential scanning calorimetry the thermodynamic parameters describing duplex melting were also determined. We find that the Gh lesion causes a dramatic decrease in the enthalpic stability of the duplex. This enthalpic destabilization is somewhat tempered by entropic stabilization yet Gh results in an overall decrease in thermodynamic stability of the duplex relative to a control which lacks DNA damage, with a ΔΔG° of −7 kcal/mol. These results contribute to our understanding of the consequences of hyperoxidation of G and provide insight into how the thermal and thermodynamic destabilization caused by Gh may influence replication and/or repair of the lesion. PMID:22780843

  9. Oligonucleotide probes containing pyrimidine analogs reveal diminished hydrogen bonding capacity of the DNA adduct O⁶-methyl-G in DNA duplexes.

    PubMed

    Angelov, Todor; Dahlmann, Heidi A; Sturla, Shana J

    2013-10-15

    Oligonucleotide hybridization probes containing nucleoside analogs offer a potential strategy for binding specific DNA sequences that bear pro-mutagenic O(6)-G alkylation adducts. To optimize O(6)-Me-G-targeting probes, an understanding of how base pairs with O(6)-Me-G are stabilized is needed. In this study, we compared the ability of O(6)-Me-G and G to hydrogen bond with three pyrimidine-like nucleobases (Z, 4-thio-U, and 3-deaza-C) bearing varied hydrogen bond donor and acceptor groups. We found that duplexes containing the pyrimidine analog nucleoside:G pairs were more thermodynamically stable than those containing pyrimidine analog nucleoside:O(6)-alkyl-G pairs. Thus, hydrogen bonding alone was not sufficient to impart selectivity to probes that target O(6)-G alkylation adducts in DNA.

  10. Test-retest reliability and stability of N400 effects in a word-pair semantic priming paradigm.

    PubMed

    Kiang, Michael; Patriciu, Iulia; Roy, Carolyn; Christensen, Bruce K; Zipursky, Robert B

    2013-04-01

    Elicited by any meaningful stimulus, the N400 event-related potential (ERP) component is reduced when the stimulus is related to a preceding one. This N400 semantic priming effect has been used to probe abnormal semantic relationship processing in clinical disorders, and suggested as a possible biomarker for treatment studies. Validating N400 semantic priming effects as a clinical biomarker requires characterizing their test-retest reliability. We assessed test-retest reliability of N400 semantic priming in 16 healthy adults who viewed the same related and unrelated prime-target word pairs in two sessions one week apart. As expected, N400 amplitudes were smaller for related versus unrelated targets across sessions. N400 priming effects (amplitude differences between unrelated and related targets) were highly correlated across sessions (r=0.85, P<0.0001), but smaller in the second session due to larger N400s to related targets. N400 priming effects have high reliability over a one-week interval. They may decrease with repeat testing, possibly because of motivational changes. Use of N400 priming effects in treatment studies should account for possible magnitude decreases with repeat testing. Further research is needed to delineate N400 priming effects' test-retest reliability and stability in different age and clinical groups, and with different stimulus types. Copyright © 2012 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  11. NMR studies of DNA duplexes singly cross-linked by different synthetic linkers.

    PubMed Central

    Altmann, S; Labhardt, A M; Bur, D; Lehmann, C; Bannwarth, W; Billeter, M; Wüthrich, K; Leupin, W

    1995-01-01

    Molecular modelling studies resulted in the design of a variety of non-nucleotidic covalent linkers to bridge the 3'-end of the (+)-strand and the 5'-end of the (-)-strand in DNA duplexes. Three of these linkers were synthesized and used to prepare singly cross-linked duplexes d(GTGGAATTC)-linker-d(GAATTCCAC). Linker I is an assembly of a propylene-, a phosphate- and a second propylene-group and is thought to mimic the backbone of two nucleotides. Linkers II and III consist of five and six ethyleneglycol units, respectively. The melting temperatures of the cross-linked duplexes are 65 degrees C for I and 73 degrees C for II and III, as compared with 36 degrees C for the corresponding non-linked nonadeoxynucleotide duplex. The three cross-linked duplexes were structurally characterized by nuclear magnetic resonance spectroscopy. The 1H and 31P resonance assignments in the DNA stem were obtained using standard methods. For the resonance assignment of the linker protons, two-dimensional 1H-31P heteronuclear COSY and two-quantum-experiments were used. Distance geometry calculations with NOE-derived distance constraints were performed and the resulting structures were energy-minimized. In duplex I, the nucleotides flanking the propylene-phosphate-propylene-linker do not form a Watson-Crick base pair, whereas in duplexes II and III the entire DNA stem is in a B-type double helix conformation. Images PMID:8532525

  12. The coupling between stability and ion pair formation in magnesium electrolytes from first-principles quantum mechanics and classical molecular dynamics.

    PubMed

    Rajput, Nav Nidhi; Qu, Xiaohui; Sa, Niya; Burrell, Anthony K; Persson, Kristin A

    2015-03-11

    In this work we uncover a novel effect between concentration dependent ion pair formation and anion stability at reducing potentials, e.g., at the metal anode. Through comprehensive calculations using both first-principles as well as well-benchmarked classical molecular dynamics over a matrix of electrolytes, covering solvents and salt anions with a broad range in chemistry, we elucidate systematic correlations between molecular level interactions and composite electrolyte properties, such as electrochemical stability, solvation structure, and dynamics. We find that Mg electrolytes are highly prone to ion pair formation, even at modest concentrations, for a wide range of solvents with different dielectric constants, which have implications for dynamics as well as charge transfer. Specifically, we observe that, at Mg metal potentials, the ion pair undergoes partial reduction at the Mg cation center (Mg(2+) → Mg(+)), which competes with the charge transfer mechanism and can activate the anion to render it susceptible to decomposition. Specifically, TFSI(-) exhibits a significant bond weakening while paired with the transient, partially reduced Mg(+). In contrast, BH4(-) and BF4(-) are shown to be chemically stable in a reduced ion pair configuration. Furthermore, we observe that higher order glymes as well as DMSO improve the solubility of Mg salts, but only the longer glyme chains reduce the dynamics of the ions in solution. This information provides critical design metrics for future electrolytes as it elucidates a close connection between bulk solvation and cathodic stability as well as the dynamics of the salt.

  13. Dissecting the contributions of β-hairpin tyrosine pairs to the folding and stability of long-lived human γD-crystallins

    NASA Astrophysics Data System (ADS)

    Yang, Zaixing; Xia, Zhen; Huynh, Tien; King, Jonathan A.; Zhou, Ruhong

    2014-01-01

    Ultraviolet-radiation-induced damage to and aggregation of human lens crystallin proteins are thought to be a significant pathway to age-related cataract. The aromatic residues within the duplicated Greek key domains of γ- and β-crystallins are the main ultraviolet absorbers and are susceptible to direct and indirect ultraviolet damage. The previous site-directed mutagenesis studies have revealed a striking difference for two highly conserved homologous β-hairpin Tyr pairs, at the N-terminal domain (N-td) and C-terminal domain (C-td), respectively, in their contribution to the overall stability of HγD-Crys, but why they behave so differently still remains a mystery. In this paper, we systematically investigated the underlying molecular mechanism and detailed contributions of these two Tyr pairs with large scale molecular dynamics simulations. A series of different tyrosine-to-alanine pair(s) substitutions were performed in either the N-td, the C-td, or both. Our results suggest that the Y45A/Y50A pair substitution in the N-td mainly affects the stability of the N-td itself, while the Y133A/Y138A pair substitution in the C-td leads to a more cooperative unfolding of both N-td and C-td. The stability of motif 2 in the N-td is mainly determined by the interdomain interface, while motif 1 in the N-td or motifs 3 and 4 in the C-td are mainly stabilized by the intradomain hydrophobic core. The damage to any tyrosine pair(s) can directly introduce some apparent water leakage to the hydrophobic core at the interface, which in turn causes a serious loss in the stability of the N-td. However, for the C-td substitutions, it may further impair the stable ``sandwich-like'' Y133-R167-Y138 cluster (through cation-π interactions) in the wild-type, thus causing the loop regions near the residue A138 to undergo large fluctuations, which in turn results in the intrusion of water into the hydrophobic core of the C-td and induces the C-td to lose its stability. These findings help

  14. Water-evaporation reduction by duplex films: application to the human tear film.

    PubMed

    Cerretani, Colin F; Ho, Nghia H; Radke, C J

    2013-09-01

    Water-evaporation reduction by duplex-oil films is especially important to understand the physiology of the human tear film. Secreted lipids, called meibum, form a duplex film that coats the aqueous tear film and purportedly reduces tear evaporation. Lipid-layer deficiency is correlated with the occurrence of dry-eye disease; however, in-vitro experiments fail to show water-evaporation reduction by tear-lipid duplex films. We review the available literature on water-evaporation reduction by duplex-oil films and outline the theoretical underpinnings of spreading and evaporation kinetics that govern behavior of these systems. A dissolution-diffusion model unifies the data reported in the literature and identifies dewetting of duplex films into lenses as a key challenge to obtaining significant evaporation reduction. We develop an improved apparatus for measuring evaporation reduction by duplex-oil films including simultaneous assessment of film coverage, stability, and temperature, all under controlled external mass transfer. New data reported in this study fit into the larger body of work conducted on water-evaporation reduction by duplex-oil films. Duplex-oil films of oxidized mineral oil/mucin (MOx/BSM), human meibum (HM), and bovine meibum (BM) reduce water evaporation by a dissolution-diffusion mechanism, as confirmed by agreement between measurement and theory. The water permeability of oxidized-mineral-oil duplex films agrees with those reported in the literature, after correction for the presence of mucin. We find that duplex-oil films of bovine and human meibum at physiologic temperature reduce water evaporation only 6-8% for a 100-nm film thickness pertinent to the human tear film. Comparison to in-vivo human tear-evaporation measurements is inconclusive because evaporation from a clean-water surface is not measured and because the mass-transfer resistance is not characterized. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Cavitation erosion of duplex and super duplex stainless steels

    SciTech Connect

    Kwok, C.T.; Man, H.C.; Cheng, F.T.

    1998-10-05

    Owing to their excellent corrosion resistance, stainless steels are widely used both in the marine, urban water, chemical and food industries. In addition to the corrosive environment, high fluid flow speeds are always encountered for components used in these industries. The cavitation characteristics of S30400 and S31600 austenitic stainless steels and duplex stainless steels were studied in detail by a number of authors. It was generally agreed that S30400 has higher cavitation erosion resistance than that of S31600 due to higher tendency of strain induced martensitic transformation under high impulse of stress. A considerable number of results on stress corrosion cracking characteristics of SDSS and duplex stainless steels have been published but data concerning their cavitation erosion property are extremely rare.

  16. A model for parallel triple helix formation by RecA: single-single association with a homologous duplex via the minor groove.

    PubMed

    Bertucat, G; Lavery, R; Prévost, C

    1998-12-01

    The nucleoproteic filaments of RecA polymerized on single stranded DNA are able to integrate double stranded DNA in a coaxial arrangement (with DNA stretched by a factor 1.5), to recognize homologous sequences in the duplex and to perform strand exchange between the single stranded and double stranded molecules. While experimental results favor the hypothesis of an invasion of the minor groove of the duplex by the single strand, parallel minor groove triple helices have never been isolated or even modeled, the minor groove offering little space for a third strand to interact. Based on an internal coordinate modeling study, we show here that such a structure is perfectly conceivable when the two interacting oligomers are stretched by a factor 1.5, in order to open the minor groove of the duplex. The model helix presents characteristics that coincide with known experimental data on unwinding, base pair inclination and inter-proton distances. Moreover, we show that extension and unwinding stabilize the triple helix. New patterns of triplet interaction via the minor groove are presented.

  17. Laser Safety Method For Duplex Open Loop Parallel Optical Link

    DOEpatents

    Baumgartner, Steven John; Hedin, Daniel Scott; Paschal, Matthew James

    2003-12-02

    A method and apparatus are provided to ensure that laser optical power does not exceed a "safe" level in an open loop parallel optical link in the event that a fiber optic ribbon cable is broken or otherwise severed. A duplex parallel optical link includes a transmitter and receiver pair and a fiber optic ribbon that includes a designated number of channels that cannot be split. The duplex transceiver includes a corresponding transmitter and receiver that are physically attached to each other and cannot be detached therefrom, so as to ensure safe, laser optical power in the event that the fiber optic ribbon cable is broken or severed. Safe optical power is ensured by redundant current and voltage safety checks.

  18. Aminoglycoside complexation with a DNA.RNA hybrid duplex: the thermodynamics of recognition and inhibition of RNA processing enzymes.

    PubMed

    Barbieri, Christopher M; Li, Tsai-Kun; Guo, Susan; Wang, Gang; Shallop, Anthony J; Pan, Weidong; Yang, Gengcheng; Gaffney, Barbara L; Jones, Roger A; Pilch, Daniel S

    2003-05-28

    Spectroscopic and calorimetric techniques were employed to characterize and contrast the binding of the aminoglycoside paromomycin to three octamer nucleic acid duplexes of identical sequence but different strand composition (a DNA.RNA hybrid duplex and the corresponding DNA.DNA and RNA.RNA duplexes). In addition, the impact of paromomycin binding on both RNase H- and RNase A-mediated cleavage of the RNA strand in the DNA.RNA duplex was also determined. Our results reveal the following significant features: (i) Paromomycin binding enhances the thermal stabilities of the RNA.RNA and DNA.RNA duplexes to similar extents, with this thermal enhancement being substantially greater in magnitude than that of the DNA.DNA duplex. (ii) Paromomycin binding to the DNA.RNA hybrid duplex induces CD changes consistent with a shift from an A-like to a more canonical A-conformation. (iii) Paromomycin binding to all three octamer duplexes is linked to the uptake of a similar number of protons, with the magnitude of this number being dependent on pH. (iv) The affinity of paromomycin for the three host duplexes follows the hierarchy, RNA.RNA > DNA.RNA > DNA.DNA. (v) The observed affinity of paromomycin for the RNA.RNA and DNA.RNA duplexes decreases with increasing pH. (vi) The binding of paromomycin to the DNA.RNA hybrid duplex inhibits both RNase H- and RNase A-mediated cleavage of the RNA strand. We discuss the implications of our combined results with regard to the specific targeting of DNA.RNA hybrid duplex domains and potential antiretroviral applications.

  19. Alternating d(GA)n DNA sequences form antiparallel stranded homoduplexes stabilized by the formation of G.A base pairs.

    PubMed Central

    Huertas, D; Bellsolell, L; Casasnovas, J M; Coll, M; Azorín, F

    1993-01-01

    Alternating d(GA)n DNA sequences form antiparallel stranded homoduplexes which are stabilized by the formation of G.A pairs. Three base pairings are known to occur between adenine and guanine: AH+ (anti).G(syn), A(anti).G(anti) and A(syn).G(anti). Protonation of the adenine residues is not involved in the stabilization of this structure, since it is observed at any pH value from 8.3 to 4.5; at pH < or = 4.0 antiparallel stranded d(GA.GA) DNA is destabilized. The results reported in this paper strongly suggest that antiparallel stranded d(GA.GA) homoduplexes are stabilized by the formation of alternating A(anti).G(anti) and G(anti).A(syn) pairs. In this structure, all guanine residues are in the anti conformation with their N7 position freely accessible to DMS methylation. On the other hand, adenines in one strand adopt the anti conformation, with their N7 position also free for reaction, while those of the opposite strand are in the syn conformation, with their N7 position hydrogen bonded to the guanine N1 group of the opposite strand. A regular right-handed helix can be generated using alternating G(anti).A(syn) and A(anti).G(anti) pairs. Images PMID:8404869

  20. Gemcitabine, Pyrrologemcitabine and 2'-Fluoro- 2'-Deoxycytidines: Synthesis, Physical Properties and Impact of Sugar Fluorination on Silver Ion Mediated Base Pairing.

    PubMed

    Seela, Frank; Guo, Xiurong; Leonard, Peter; Ingale, Sachin Asaram

    2017-09-14

    The stability of silver mediated "dC-dC" base pairs relies not only on the structure of the nucleobase but also is sensitive to structural modification on the sugar moiety. 2'-Fluorinated 2'-deoxycytidines with fluorine atoms in the arabino (up) and the ribo (down) configuration, as well as with geminal fluorine substitution (anticancer drug gemcitabine) and the novel fluorescent phenylpyrrolo-gemcitabine (phPyrGem) were synthesized. All nucleosides display the recognition face of naturally occurring 2'-deoxycytidine. Nucleosides were converted into phosphoramidites and incorporated in 12-mer oligonucleotides by solid-phase synthesis. Addition of silver ions to DNA duplexes with a fluorine modified "dC-dC" pair near central position led to significant duplex stabilization. The stability increase was higher for duplexes with fluorinated sugar residues than those with the unchanged 2'-deoxyribose moiety. Similar observations were made on "dC-dT" pairs and to a minor extend on the "dC-dA" pairs. The increase of silver ion mediated base pair stability was reversed by annulation of a pyrrole ring to the cytosine moiety as shown for 2'-fluorinated phPyrGem compared to phenylpyrrolo-dC (phPyrdC). The phenomenon results from stereoelectronic effects induced by fluoro substitution which are transmitted from the sugar moiety to the silver ion mediated base pairs. This depends on the number of fluorine substituents, their configuration and the structure of the nucleobase. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Thermodynamic profiles and nuclear magnetic resonance studies of oligonucleotide duplexes containing single diastereomeric spiroiminodihydantoin lesions.

    PubMed

    Khutsishvili, Irine; Zhang, Na; Marky, Luis A; Crean, Conor; Patel, Dinshaw J; Geacintov, Nicholas E; Shafirovich, Vladimir

    2013-02-26

    The spiroiminodihydantoins (Sp) are highly mutagenic oxidation products of guanine and 8-oxo-7,8-dihydroguanine in DNA. The Sp lesions have recently been detected in the liver and colon of mice infected with Helicobacter hepaticus that induces inflammation and the development of liver and colon cancers in murine model systems [Mangerich, A., et al. (2012) Proc. Natl. Acad. Sci. U.S.A. 109, E1820-E1829]. The impact of Sp lesions on the thermodynamic characteristics and the effects of the diastereomeric Sp-R and Sp-S lesions on the conformational features of double-stranded 11-mer oligonucleotide duplexes have been studied by a combination of microcalorimetric methods, analysis of DNA melting curves, and two-dimensional nuclear magnetic resonance methods. The nonplanar, propeller-like shapes of the Sp residues strongly diminish the extent of local base stacking interactions that destabilize the DNA duplexes characterized by unfavorable enthalpy contributions. Relative to that of an unmodified duplex, the thermally induced unfolding of the duplexes with centrally positioned Sp-R and Sp-S lesions into single strands is accompanied by a smaller release of cationic counterions (Δn(Na⁺) = 0.6 mol of Na⁺/mol of duplex) and water molecules (Δn(w) = 17 mol of H₂O/mol of duplex). The unfolding parameters are similar for the Sp-R and Sp-S lesions, although their orientations in the duplexes are different. The structural disturbances radiate one base pair beyond the flanking C:G pair, although Watson-Crick hydrogen bonding is maintained at all flanking base pairs. The observed relatively strong destabilization of B-form DNA by the physically small Sp lesions is expected to have a significant impact on the processing of these lesions in biological environments.

  2. RNA Internal Loops with Tandem AG Pairs: The Structure of the 5′GAGU/3′UGAG Loop Can Be Dramatically Different from Others, Including 5′AAGU/3′UGAA†

    PubMed Central

    2010-01-01

    Thermodynamic stabilities of 2 × 2 nucleotide tandem AG internal loops in RNA range from −1.3 to +3.4 kcal/mol at 37 °C and are not predicted well with a hydrogen-bonding model. To provide structural information to facilitate development of more sophisticated models for the sequence dependence of stability, we report the NMR solution structures of five RNA duplexes: (rGACGAGCGUCA)2, (rGACUAGAGUCA)2, (rGACAAGUGUCA)2, (rGGUAGGCCA)2, and (rGACGAGUGUCA)2. The structures of these duplexes are compared to that of the previously solved (rGGCAGGCC)2 (Wu, M., SantaLucia, J., Jr., and Turner, D. H. (1997) Biochemistry 36, 4449−4460). For loops bounded by Watson−Crick pairs, the AG and Watson−Crick pairs are all head-to-head imino-paired (cis Watson−Crick/Watson−Crick). The structures suggest that the sequence-dependent stability may reflect non-hydrogen-bonding interactions. Of the two loops bounded by G-U pairs, only the 5′UAGG/3′GGAU loop adopts canonical UG wobble pairing (cis Watson−Crick/Watson−Crick), with AG pairs that are only weakly imino-paired. Strikingly, the 5′GAGU/3′UGAG loop has two distinct duplex conformations, the major of which has both guanosine residues (G4 and G6 in (rGACGAGUGUCA)2) in a syn glycosidic bond conformation and forming a sheared GG pair (G4-G6*, GG trans Watson−Crick/Hoogsteen), both uracils (U7 and U7*) flipped out of the helix, and an AA pair (A5-A5*) in a dynamic or stacked conformation. These structures provide benchmarks for computational investigations into interactions responsible for the unexpected differences in loop free energies and structure. PMID:20481618

  3. Surface Acoustic Wave Duplexer for US Personal Communication Services with Good Temperature Characteristics

    NASA Astrophysics Data System (ADS)

    Kadota, Michio; Nakao, Takeshi; Taniguchi, Norio; Takata, Eiichi; Mimura, Masakazu; Nishiyama, Kenji; Hada, Takuo; Komura, Tomohisa

    2005-06-01

    The transmission (Tx) and receiving (Rx) passbands of the Personal Communication Services (PCS) mobile phone system in the US are 1850-1910 MHz and 1930-1990 MHz, respectively. The transition bandwidth between Tx and Rx is very narrow, 20 MHz. A duplexer for the US-PCS employing surface acoustic waves (SAWs) requires a substrate which has good temperature stability, an optimum electromechanical coupling factor, a large reflection coefficient, and a good resonant mechanical Q value. Previously, there did not exist any substrate suitable for the US-PCS SAW duplexer. In this paper, we describe a new substrate that is suitable for the US-PCS SAW duplexer and a US-PCS SAW duplexer constructed with this new substrate.

  4. The coupling between stability and ion pair formation in magnesium electrolytes from first-principles quantum mechanics and classical molecular dynamics

    SciTech Connect

    Rajput, Nav Nidhi; Qu, Xiaohuui; Sa, Niya; Burrell, Anthony K.; Persson, Kristin A.

    2015-02-10

    Here in this work we uncover a novel effect between concentration dependent ion pair formation and anion stability at reducing potentials, e.g., at the metal anode. Through comprehensive calculations using both first-principles as well as well-benchmarked classical molecular dynamics over a matrix of electrolytes, covering solvents and salt anions with a broad range in chemistry, we elucidate systematic correlations between molecular level interactions and composite electrolyte properties, such as electrochemical stability, solvation structure, and dynamics. We find that Mg electrolytes are highly prone to ion pair formation, even at modest concentrations, for a wide range of solvents with different dielectric constants, which have implications for dynamics as well as charge transfer. Specifically, we observe that, at Mg metal potentials, the ion pair undergoes partial reduction at the Mg cation center (Mg2+ -> Mg+), which competes with the charge transfer mechanism and can activate the anion to render it susceptible to decomposition. Specifically, TFSI exhibits a significant bond weakening while paired with the transient, partially reduced Mg+. In contrast, BH4$-$ and BF4$-$ are shown to be chemically stable in a reduced ion pair configuration. Furthermore, we observe that higher order glymes as well as DMSO improve the solubility of Mg salts, but only the longer glyme chains reduce the dynamics of the ions in solution. This information provides critical design metrics for future electrolytes as it elucidates a close connection between bulk solvation and cathodic stability as well as the dynamics of the salt.

  5. The coupling between stability and ion pair formation in magnesium electrolytes from first-principles quantum mechanics and classical molecular dynamics

    DOE PAGES

    Rajput, Nav Nidhi; Qu, Xiaohuui; Sa, Niya; ...

    2015-02-10

    Here in this work we uncover a novel effect between concentration dependent ion pair formation and anion stability at reducing potentials, e.g., at the metal anode. Through comprehensive calculations using both first-principles as well as well-benchmarked classical molecular dynamics over a matrix of electrolytes, covering solvents and salt anions with a broad range in chemistry, we elucidate systematic correlations between molecular level interactions and composite electrolyte properties, such as electrochemical stability, solvation structure, and dynamics. We find that Mg electrolytes are highly prone to ion pair formation, even at modest concentrations, for a wide range of solvents with different dielectricmore » constants, which have implications for dynamics as well as charge transfer. Specifically, we observe that, at Mg metal potentials, the ion pair undergoes partial reduction at the Mg cation center (Mg2+ -> Mg+), which competes with the charge transfer mechanism and can activate the anion to render it susceptible to decomposition. Specifically, TFSI exhibits a significant bond weakening while paired with the transient, partially reduced Mg+. In contrast, BH4$-$ and BF4$-$ are shown to be chemically stable in a reduced ion pair configuration. Furthermore, we observe that higher order glymes as well as DMSO improve the solubility of Mg salts, but only the longer glyme chains reduce the dynamics of the ions in solution. This information provides critical design metrics for future electrolytes as it elucidates a close connection between bulk solvation and cathodic stability as well as the dynamics of the salt.« less

  6. ESI-MS Investigation of an Equilibrium between a Bimolecular Quadruplex DNA and a Duplex DNA/RNA Hybrid

    NASA Astrophysics Data System (ADS)

    Birrento, Monica L.; Bryan, Tracy M.; Samosorn, Siritron; Beck, Jennifer L.

    2015-07-01

    Electrospray ionization mass spectrometry (ESI-MS) conditions were optimized for simultaneous observation of a bimolecular qDNA and a Watson-Crick base-paired duplex DNA/RNA hybrid. The DNA sequence used was telomeric DNA, and the RNA contained the template for telomerase-mediated telomeric DNA synthesis. Addition of RNA to the quadruplex DNA (qDNA) resulted in formation of the duplex DNA/RNA hybrid. Melting profiles obtained using circular dichroism spectroscopy confirmed that the DNA/RNA hybrid exhibited greater thermal stability than the bimolecular qDNA in solution. Binding of a 13-substituted berberine ( 1) derivative to the bimolecular qDNA stabilized its structure as evidenced by an increase in its stability in the mass spectrometer, and an increase in its circular dichroism (CD) melting temperature of 10°C. The DNA/RNA hybrid did not bind the ligand extensively and its thermal stability was unchanged in the presence of ( 1). The qDNA-ligand complex resisted unfolding in the presence of excess RNA, limiting the formation of the DNA/RNA hybrid. Previously, it has been proposed that DNA secondary structures, such as qDNA, may be involved in the telomerase mechanism. DNA/RNA hybrid structures occur at the active site of telomerase. The results presented in the current work show that if telomeric DNA was folded into a qDNA structure, it is possible for a DNA/RNA hybrid to form as is required during template alignment. The discrimination of ligand ( 1) for binding to the bimolecular qDNA over the DNA/RNA hybrid positions it as a useful compound for probing the role(s), if any, of antiparallel qDNA in the telomerase mechanism.

  7. Smectic phase in suspensions of gapped DNA duplexes

    PubMed Central

    Salamonczyk, Miroslaw; Zhang, Jing; Portale, Giuseppe; Zhu, Chenhui; Kentzinger, Emmanuel; Gleeson, James T.; Jakli, Antal; De Michele, Cristiano; Dhont, Jan K. G.; Sprunt, Samuel; Stiakakis, Emmanuel

    2016-01-01

    Smectic ordering in aqueous solutions of monodisperse stiff double-stranded DNA fragments is known not to occur, despite the fact that these systems exhibit both chiral nematic and columnar mesophases. Here, we show, unambiguously, that a smectic-A type of phase is formed by increasing the DNA's flexibility through the introduction of an unpaired single-stranded DNA spacer in the middle of each duplex. This is unusual for a lyotropic system, where flexibility typically destabilizes the smectic phase. We also report on simulations suggesting that the gapped duplexes (resembling chain-sticks) attain a folded conformation in the smectic layers, and argue that this layer structure, which we designate as smectic-fA phase, is thermodynamically stabilized by both entropic and energetic contributions to the system's free energy. Our results demonstrate that DNA as a building block offers an exquisitely tunable means to engineer a potentially rich assortment of lyotropic liquid crystals. PMID:27845332

  8. Smectic phase in suspensions of gapped DNA duplexes

    SciTech Connect

    Salamonczyk, Miroslaw; Zhang, Jing; Portale, Giuseppe; Zhu, Chenhui; Kentzinger, Emmanuel; Gleeson, James T.; Jakli, Antal; De Michele, Cristiano; Dhont, Jan K. G.; Sprunt, Samuel; Stiakakis, Emmanuel

    2016-11-15

    Smectic ordering in aqueous solutions of monodisperse stiff double-stranded DNA fragments is known not to occur, in spite of the fact that these systems exhibit both chiral nematic and columnar mesophases. Here, we show, unambiguously, that a smectic-A type of phase is formed by increasing the DNA's flexibility through the introduction of an unpaired single-stranded DNA spacer in the middle of each duplex. This is unusual for a lyotropic system, where flexibility typically destabilizes the smectic phase. We also report on simulations suggesting that the gapped duplexes (resembling chain-sticks) attain a folded conformation in the smectic layers, and argue that this layer structure, which we designate as smectic-fA phase, is thermodynamically stabilized by both entropic and energetic contributions to the system's free energy. These results demonstrate that DNA as a building block offers an exquisitely tunable means to engineer a potentially rich assortment of lyotropic liquid crystals.

  9. Smectic phase in suspensions of gapped DNA duplexes

    NASA Astrophysics Data System (ADS)

    Salamonczyk, Miroslaw; Zhang, Jing; Portale, Giuseppe; Zhu, Chenhui; Kentzinger, Emmanuel; Gleeson, James T.; Jakli, Antal; de Michele, Cristiano; Dhont, Jan K. G.; Sprunt, Samuel; Stiakakis, Emmanuel

    2016-11-01

    Smectic ordering in aqueous solutions of monodisperse stiff double-stranded DNA fragments is known not to occur, despite the fact that these systems exhibit both chiral nematic and columnar mesophases. Here, we show, unambiguously, that a smectic-A type of phase is formed by increasing the DNA's flexibility through the introduction of an unpaired single-stranded DNA spacer in the middle of each duplex. This is unusual for a lyotropic system, where flexibility typically destabilizes the smectic phase. We also report on simulations suggesting that the gapped duplexes (resembling chain-sticks) attain a folded conformation in the smectic layers, and argue that this layer structure, which we designate as smectic-fA phase, is thermodynamically stabilized by both entropic and energetic contributions to the system's free energy. Our results demonstrate that DNA as a building block offers an exquisitely tunable means to engineer a potentially rich assortment of lyotropic liquid crystals.

  10. Stability of the d-wave pairing with respect to the intersite Coulomb repulsion in cuprate superconductors

    NASA Astrophysics Data System (ADS)

    Val'kov, V. V.; Dzebisashvili, D. M.; Korovushkin, M. M.; Barabanov, A. F.

    2017-10-01

    Within the spin-fermion model for cuprate superconductors, the influence of the intersite Coulomb interactions V2 and V‧2 between holes located at the next-nearest-neighbor oxygen ions of CuO2 plane on the implementation of the dx2-y2-wave pairing is studied. It is shown that d-wave pairing can be suppressed only for unphysically large values of V2 and V‧2.

  11. Imp3p and Imp4p mediate formation of essential U3–precursor rRNA (pre-rRNA) duplexes, possibly to recruit the small subunit processome to the pre-rRNA

    PubMed Central

    Gérczei, Tímea; Correll, Carl C.

    2004-01-01

    In eukaryotes, formation of short duplexes between the U3 small nucleolar RNA (snoRNA) and the precursor rRNA (pre-rRNA) at multiple sites is a prerequisite for three endonucleolytic cleavages that initiate small subunit biogenesis by releasing the 18S rRNA precursor from the pre-rRNA. The most likely role of these RNA duplexes is to guide the U3 snoRNA and its associated proteins, designated the small subunit processome, to the target cleavage sites on the pre-rRNA. Studies by others in Saccharomyces cerevisiae have identified the proteins Mpp10p, Imp3p, and Imp4p as candidates to mediate U3–pre-rRNA interactions. We report here that Imp3p and Imp4p appear to stabilize an otherwise unstable duplex between the U3 snoRNA hinge region and complementary bases in the external transcribed spacer of the pre-rRNA. In addition, Imp4p, but not Imp3p, seems to rearrange the U3 box A stem structure to expose the site that base-pairs with the 5′ end of the 18S rRNA, thereby mediating duplex formation at a second site. By mediating formation of both essential U3–pre-rRNA duplexes, Imp3p and Imp4p may help the small subunit processome to dock onto the pre-rRNA, an event indispensable for ribosome biogenesis and hence for cell growth. PMID:15489263

  12. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    PubMed Central

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  13. Alteration of the Relative Stability of dA·dT and dG·dC Base Pairs in DNA

    PubMed Central

    Melchior, William B.; Von Hippel, Peter H.

    1973-01-01

    Several small alkylammonium ions can eliminate, or even reverse, the usual dependence of the DNA transition temperature on base composition. For example, in 3 M tetramethylammonium chloride, or 2.4 M tetraethylammonium chloride, DNAs of different base compositions all melt at a common temperature, and with a greatly decreased breadth of transition reflecting only the sequence-independent components of melting cooperativity. At still higher concentrations of such additives, dG·dC-rich DNAs melt at lower temperatures than dA·dT-rich molecules. Circular dichroism spectra show that these additives alter the structure of the DNA double helix very little at room temperature. This differential (base-specific) effect on helix stability is investigated with several small additives related to the tetraalkylammonium ions. Additives larger than tetraethylammonium ion have little differential effect on helix stability. Preferential binding of ions to dA·dT base pairs, requiring fit into a “groove” of DNA, is consistent with these data and with equilibrium binding studies. These differential effects can be distinguished from general destabilizing effects, which are independent of specific features of macromolecular conformation or chemistry. Possible experimental uses of this ability to alter the base-composition-dependent components of the stability of the DNA helix are discussed, as well as the insight this phenomenon provides into the molecular basis for the differential stability of dA·dT and dG·dC base pairs. PMID:4346879

  14. Experience with duplex bearings in narrow angle oscillating applications

    NASA Technical Reports Server (NTRS)

    Phinney, D. D.; Pollard, C. L.; Hinricks, J. T.

    1988-01-01

    Duplex ball bearings are matched pairs on which the abutting faces of the rings have been accurately ground so that when the rings are clamped together, a controlled amount of interference (preload) exists across the balls. These bearings are vulnerable to radial temperature gradients, blocking in oscillation and increased sensitivity to contamination. These conditions decrease the service life of these bearings. It was decided that an accelerated thermal vacuum life test should be conducted. The test apparatus and results are described and the rationale is presented for reducing a multiyear life test on oil lubricated bearings to less than a year.

  15. End-to-end attraction of duplex DNA

    PubMed Central

    Maffeo, Christopher; Luan, Binquan; Aksimentiev, Aleksei

    2012-01-01

    Recent experiments [Nakata, M. et al., End-to-end stacking and liquid crystal condensation of 6 to 20 basepair DNA duplexes. Science 2007; 318:1276–1279] have demonstrated spontaneous end-to-end association of short duplex DNA fragments into long rod-like structures. By means of extensive all-atom molecular dynamic simulations, we characterized end-to-end interactions of duplex DNA, quantitatively describing the forces, free energy and kinetics of the end-to-end association process. We found short DNA duplexes to spontaneously aggregate end-to-end when axially aligned in a small volume of monovalent electrolyte. It was observed that electrostatic repulsion of 5′-phosphoryl groups promoted the formation of aggregates in a conformation similar to the B-form DNA double helix. Application of an external force revealed that rupture of the end-to-end assembly occurs by the shearing of the terminal base pairs. The standard binding free energy and the kinetic rates of end-to-end association and dissociation processes were estimated using two complementary methods: umbrella sampling simulations of two DNA fragments and direct observation of the aggregation process in a system containing 458 DNA fragments. We found the end-to-end force to be short range, attractive, hydrophobic and only weakly dependent on the ion concentration. The relation between the stacking free energy and end-to-end attraction is discussed as well as possible roles of the end-to-end interaction in biological and nanotechnological systems. PMID:22241779

  16. A crystallographic study of the binding of 13 metal ions to two related RNA duplexes

    PubMed Central

    Ennifar, Eric; Walter, Philippe; Dumas, Philippe

    2003-01-01

    Metal ions, and magnesium in particular, are known to be involved in RNA folding by stabilizing secondary and tertiary structures, and, as cofactors, in RNA enzymatic activity. We have conducted a systematic crystallographic analysis of cation binding to the duplex form of the HIV-1 RNA dimerization initiation site for the subtype-A and -B natural sequences. Eleven ions (K+, Pb2+, Mn2+, Ba2+, Ca2+, Cd2+, Sr2+, Zn2+, Co2+, Au3+ and Pt4+) and two hexammines [Co (NH3)6]3+ and [Ru (NH3)6]3+ were found to bind to the DIS duplex structure. Although the two sequences are very similar, strong differences were found in their cation binding properties. Divalent cations bind almost exclusively, as Mg2+, at ‘Hoogsteen’ sites of guanine residues, with a cation-dependent affinity for each site. Notably, a given cation can have very different affinities for a priori equivalent sites within the same molecule. Surprisingly, none of the two hexammines used were able to efficiently replace hexahydrated magnesium. Instead, [Co (NH3)4]3+ was seen bound by inner-sphere coordination to the RNA. This raises some questions about the practical use of [Co (NH3)6]3+ as a [Mg (H2O)6]2+ mimetic. Also very unexpected was the binding of the small Au3+ cation exactly between the Watson–Crick sites of a G-C base pair after an obligatory deprotonation of N1 of the guanine base. This extensive study of metal ion binding using X-ray crystallography significantly enriches our knowledge on the binding of middleweight or heavy metal ions to RNA, particularly compared with magnesium. PMID:12736317

  17. Synthesis and structure of duplex DNA containing the genotoxic nucleobase lesion N7-methylguanine

    SciTech Connect

    Lee, S.; Bowman, B.R.; Ueno, Y.; Wang, S.; Verdine, G.L.

    2008-11-03

    The predominant product of aberrant DNA methylation is the genotoxic lesion N7-methyl-2{prime}-deoxyguanosine (m{sup 7}dG). M{sup 7}dG is recognized and excised by lesion-specific DNA glycosylases, namely AlkA in E. coli and Aag in humans. Structural studies of m{sup 7}dG recognition and catalysis by these enzymes have been hampered due to a lack of efficient means by which to incorporate the chemically labile m{sup 7}dG moiety site-specifically into DNA on a preparative scale. Here we report a solution to this problem. We stabilized the lesion toward acid-catalyzed and glycosylase-catalyzed depurination by 2{prime}-fluorination and toward base-catalyzed degradation using mild, nonaqueous conditions in the DNA deprotection reaction. Duplex DNA containing 2{prime}-fluoro-m{sup 7}dG (Fm{sup 7}dG) cocrystallized with AlkA as a host-guest complex in which the lesion-containing segment of DNA was nearly devoid of protein contacts, thus enabling the first direct visualization of the N7-methylguanine lesion nucleobase in DNA. The structure reveals that the base-pairing mode of Fm{sup 7}dG:C is nearly identical to that of G:C, and Fm{sup 7}dG does not induce any apparent structural disturbance of the duplex structure. These observations suggest that AlkA and Aag must perform a structurally invasive interrogation of DNA in order to detect the presence of intrahelical m{sup 7}dG lesions.

  18. Base pairing between hepatitis C virus RNA and microRNA 122 3' of its seed sequence is essential for genome stabilization and production of infectious virus.

    PubMed

    Shimakami, Tetsuro; Yamane, Daisuke; Welsch, Christoph; Hensley, Lucinda; Jangra, Rohit K; Lemon, Stanley M

    2012-07-01

    MicroRNA 122 (miR-122) facilitates hepatitis C virus (HCV) replication by recruiting an RNA-induced silencing complex (RISC)-like complex containing argonaute 2 (Ago2) to the 5' end of the HCV genome, thereby stabilizing the viral RNA. This requires base pairing between the miR-122 "seed sequence" (nucleotides [nt] 2 to 8) and two sequences near the 5' end of the HCV RNA: S1 (nt 22 to 28) and S2 (nt 38 to 43). However, recent reports suggest that additional base pair interactions occur between HCV RNA and miR-122. We searched 606 sequences from a public database (genotypes 1 to 6) and identified two conserved, putatively single-stranded RNA segments, upstream of S1 (nt 2 and 3) and S2 (nt 30 to 34), with potential for base pairing to miR-122 (nt 15 and 16 and nt 13 to 16, respectively). Mutagenesis and genetic complementation experiments confirmed that HCV nt 2 and 3 pair with nt 15 and 16 of miR-122 bound to S1, while HCV nt 30 to 33 pair with nt 13 to 16 of miR-122 at S2. In genotype 1 and 6 HCV, nt 4 also base pairs with nt 14 of miR-122. These 3' supplementary base pair interactions of miR-122 are functionally important and are required for Ago2 recruitment to HCV RNA by miR-122, miR-122-mediated stabilization of HCV RNA, and production of infectious virus. However, while complementary mutations at HCV nt 30 and 31 efficiently rescued the activity of a 15C,16C miR-122 mutant targeting S2, similar mutations at nt 2 and 3 failed to rescue Ago2 recruitment at S1. These data add to the current understanding of miR-122 interactions with HCV RNA but indicate that base pairing between miR-122 and the 5' 43 nt of the HCV genome is more complex than suggested by existing models.

  19. Base Pairing between Hepatitis C Virus RNA and MicroRNA 122 3′ of Its Seed Sequence Is Essential for Genome Stabilization and Production of Infectious Virus

    PubMed Central

    Shimakami, Tetsuro; Yamane, Daisuke; Welsch, Christoph; Hensley, Lucinda; Jangra, Rohit K.

    2012-01-01

    MicroRNA 122 (miR-122) facilitates hepatitis C virus (HCV) replication by recruiting an RNA-induced silencing complex (RISC)-like complex containing argonaute 2 (Ago2) to the 5′ end of the HCV genome, thereby stabilizing the viral RNA. This requires base pairing between the miR-122 “seed sequence” (nucleotides [nt] 2 to 8) and two sequences near the 5′ end of the HCV RNA: S1 (nt 22 to 28) and S2 (nt 38 to 43). However, recent reports suggest that additional base pair interactions occur between HCV RNA and miR-122. We searched 606 sequences from a public database (genotypes 1 to 6) and identified two conserved, putatively single-stranded RNA segments, upstream of S1 (nt 2 and 3) and S2 (nt 30 to 34), with potential for base pairing to miR-122 (nt 15 and 16 and nt 13 to 16, respectively). Mutagenesis and genetic complementation experiments confirmed that HCV nt 2 and 3 pair with nt 15 and 16 of miR-122 bound to S1, while HCV nt 30 to 33 pair with nt 13 to 16 of miR-122 at S2. In genotype 1 and 6 HCV, nt 4 also base pairs with nt 14 of miR-122. These 3′ supplementary base pair interactions of miR-122 are functionally important and are required for Ago2 recruitment to HCV RNA by miR-122, miR-122-mediated stabilization of HCV RNA, and production of infectious virus. However, while complementary mutations at HCV nt 30 and 31 efficiently rescued the activity of a 15C,16C miR-122 mutant targeting S2, similar mutations at nt 2 and 3 failed to rescue Ago2 recruitment at S1. These data add to the current understanding of miR-122 interactions with HCV RNA but indicate that base pairing between miR-122 and the 5′ 43 nt of the HCV genome is more complex than suggested by existing models. PMID:22532678

  20. Duplex gall bladder: bystander or culprit.

    PubMed

    Kumar, Jogender; Yadav, Arushi

    2017-08-30

    Gall bladder (GB) duplication is a rare anatomical malformation, which can be detected by preoperative imaging study. We present a case of duplex gall bladder in a 14-year-old boy who presented with abdominal pain. On ultrasound, he had right nephrolithiasis and duplex gall bladder. Duplex gall bladder was confirmed on MR cholangiopancreatography. There was a dilemma for surgical management of duplex gall bladder; however, he became asymptomatic after conservative treatment. Prophylactic surgery is not recommended for asymptomatic incidentally detected duplex gall bladder. Radiologists and paediatric surgeons should be sensitised about the exact anatomy of this entity. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  1. Phase Transformations in Cast Duplex Stainless Steels

    SciTech Connect

    Kim, Yoon-Jun

    2004-01-01

    Duplex stainless steels (DSS) constitute both ferrite and austenite as a matrix. Such a microstructure confers a high corrosion resistance with favorable mechanical properties. However, intermetallic phases such as σ and χ can also form during casting or high-temperature processing and can degrade the properties of the DSS. This research was initiated to develop time-temperature-transformation (TTT) and continuous-cooling-transformation (CCT) diagrams of two types of cast duplex stainless steels, CD3MN (Fe-22Cr-5Ni-Mo-N) and CD3MWCuN (Fe-25Cr-7Ni-Mo-W-Cu-N), in order to understand the time and temperature ranges for intermetallic phase formation. The alloys were heat treated isothermally or under controlled cooling conditions and then characterized using conventional metallographic methods that included tint etching, and also using electron microscopy (SEM, TEM) and wavelength dispersive spectroscopy (WDS). The kinetics of intermetallic-phase (σ + χ) formation were analyzed using the Johnson-Mehl-Avrami (MA) equation in the case of isothermal transformations and a modified form of this equation in the case of continuous cooling transformations. The rate of intermetallic-phase formation was found to be much faster in CD3MWCuN than CD3MN due mainly to differences in the major alloying contents such as Cr, Ni and Mo. To examine in more detail the effects of these elements of the phase stabilities; a series of eight steel castings was designed with the Cr, Ni and Mo contents systematically varied with respect to the nominal composition of CD3MN. The effects of varying the contents of alloying additions on the formation of intermetallic phases were also studied computationally using the commercial thermodynamic software package, Thermo-Calc. In general, σ was stabilized with increasing Cr addition and χ by increasing Mo addition. However, a delicate balance among Ni and other minor elements such as N and Si also exists. Phase equilibria in DSS can be affected by

  2. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  3. Alternative strategy for adjusting the association specificity of hydrogen-bonded duplexes.

    PubMed

    Zhang, Penghui; Chu, Hongzhu; Li, Xianghui; Feng, Wen; Deng, Pengchi; Yuan, Lihua; Gong, Bing

    2011-01-07

    A strategy for creating new association specificity of hydrogen-bonded duplexes by varying the spacings between neighboring hydrogen bonds is described. Incorporation of naphthalene-based residues has provided oligoamide strands that pair into duplexes sharing the same H-bonding sequences (e.g., DDAA) but differing in the spacings between their intermolecular hydrogen bonds, leading to homo- or heteroduplexes. The ability to manipulate association-specificity as demonstrated by this work may be extended to other multiple hydrogen bonded systems, thereby further enhancing the diversity of multiple hydrogen-bonded association units for constructing supramolecular structures.

  4. Duplex Direct Data Distribution System

    NASA Technical Reports Server (NTRS)

    Greenfield, Israel (Technical Monitor)

    2001-01-01

    The NASA Glenn Research Center (GRC) is developing and demonstrating communications and network technologies that are helping to enable the near-Earth space Internet. GRC envisions several service categories. The first of these categories is direct data distribution or D3 (pronounced "D-cubed"). Commercially provided D3 will make it possible to download a data set from a spacecraft, like the International Space Station. as easily as one can extract a file from a remote server today, using a file transfer protocol. In a second category, NASA spacecraft will make use of commercial satellite communication (SATCOM) systems. Some of those services will come from purchasing time on unused transponders that cover landmasses. While it is likely there will be gaps in service coverage, Internet services should be available using these systems. This report addresses alternative methods of implementing a full duplex enhancement of the GRC developed experimental Ka-Band Direct Data Distribution (D3) space-to-ground communication link. The resulting duplex version is called the Duplex Direct Data Distribution (D4) system. The D4 system is intended to provide high-data-rate commercial direct or internet-based communications service between the NASA spacecraft in low earth orbit (LEO) and the respective principal investigators associated with these spacecraft. Candidate commercial services were assessed regarding their near-term potential to meet NASA requirements. Candidates included Ka-band and V-band geostationary orbit and non-geostationary orbit satellite relay services and direct downlink ("LEO teleport") services. End-to-end systems concepts were examined and characterized in terms of alternative link layer architectures. Alternatives included a Direct Link, a Relay Link, a Hybrid Link, and a Dual Mode Link. The direct link assessment examined sample ground terminal placements and antenna angle issues. The SATCOM-based alternatives examined existing or proposed commercial

  5. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    PubMed

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  6. Biophysics of Artificially Expanded Genetic Information Systems. Thermodynamics of DNA Duplexes Containing Matches and Mismatches Involving 2-Amino-3-nitropyridin-6-one (Z) and Imidazo[1,2-a]-1,3,5-triazin-4(8H)one (P).

    PubMed

    Wang, Xiaoyu; Hoshika, Shuichi; Peterson, Raymond J; Kim, Myong-Jung; Benner, Steven A; Kahn, Jason D

    2017-05-19

    Synthetic nucleobases presenting non-Watson-Crick arrangements of hydrogen bond donor and acceptor groups can form additional nucleotide pairs that stabilize duplex DNA independent of the standard A:T and G:C pairs. The pair between 2-amino-3-nitropyridin-6-one 2'-deoxyriboside (presenting a {donor-donor-acceptor} hydrogen bonding pattern on the Watson-Crick face of the small component, trivially designated Z) and imidazo[1,2-a]-1,3,5-triazin-4(8H)one 2'-deoxyriboside (presenting an {acceptor-acceptor-donor} hydrogen bonding pattern on the large component, trivially designated P) is one of these extra pairs for which a substantial amount of molecular biology has been developed. Here, we report the results of UV absorbance melting measurements and determine the energetics of binding of DNA strands containing Z and P to give short duplexes containing Z:P pairs as well as various mismatches comprising Z and P. All measurements were done at 1 M NaCl in buffer (10 mM Na cacodylate, 0.5 mM EDTA, pH 7.0). Thermodynamic parameters (ΔH°, ΔS°, and ΔG°37) for oligonucleotide hybridization were extracted. Consistent with the Watson-Crick model that considers both geometric and hydrogen bonding complementarity, the Z:P pair was found to contribute more to duplex stability than any mismatches involving either nonstandard nucleotide. Further, the Z:P pair is more stable than a C:G pair. The Z:G pair was found to be the most stable mismatch, forming either a deprotonated mismatched pair or a wobble base pair analogous to the stable T:G mismatch. The C:P pair is less stable, perhaps analogous to the wobble pair observed for C:O(6)-methyl-G, in which the pyrimidine is displaced into the minor groove. The Z:A and T:P mismatches are much less stable. Parameters for predicting the thermodynamics of oligonucleotides containing Z and P bases are provided. This represents the first case where this has been done for a synthetic genetic system.

  7. Role of a Guanidinium Cation-Phosphodianion Pair in Stabilizing the Vinyl Carbanion Intermediate of Orotidine 5'-Phosphate Decarboxylase-Catalyzed Reactions.†

    PubMed Central

    Goryanova, Bogdana; Goldman, Lawrence M.; Amyes, Tina L.; Gerlt, John A; Richard, John P.

    2013-01-01

    The side chain cation of Arg235 provides a 5.6 and 2.6 kcal/mol stabilization of the transition states for orotidine 5'-monophosphate decarboxylase from Saccharomyces cerevisiae (OMPDC) catalyzed reactions of OMP and 5-fluoroorotidine 5'-monophosphate (FOMP), respectively, a 7.2 kcal/mol stabilization of the vinyl carbanion-like transition state for enzyme-catalyzed exchange of the C-6 proton of 5-fluorouridine 5'-monophosphate (FUMP), but no stabilization of the transition states for enzyme-catalyzed decarboxylation of truncated substrates 1-(β-d-erythrofuranosyl)orotic acid and 1-(β-d-erythrofuranosyl) 5-fluorouracil. These observations show that the transition state stabilization results from formation of a protein cation-phosphodianion pair, and that there is no detectable stabilization from an interaction between the side chain and the pyrimidine ring of substrate. The 5.6 kcal/mol side chain interaction with the transition state for the decarboxylation reaction is 50% of the total 11.2 kcal/mol transition state stabilization by interactions with the phosphodianion of OMP, while the 7.2 kcal/mol side-chain interaction with the transition state for the deuterium exchange reaction is a larger 78% of the total 9.2 kcal/mol transition state stabilization by interactions with the phosphodianion of FUMP. The effect of the R235A mutation on the enzyme-catalyzed deuterium exchange is expressed predominantly as a change in the turnover number kex while the effect on the enzyme-catalyzed decarboxylation of OMP is expressed predominantly as a change in the Michaelis constant Km. These results are rationalized by a mechanism in which the binding of OMP, compared with FUMP, provides a larger driving force for conversion of OMPDC from an inactive open conformation to a productive, active, closed conformation. PMID:24053466

  8. Structural, Dynamical, and Electronic Transport Properties of Modified DNA Duplexes Containing Size-Expanded Nucleobases

    SciTech Connect

    Fuentes-Cabrera, Miguel A; Orozco, Modesto; Luque, Javier; Sumpter, Bobby G; Blas, Jose; Ordejon, Pablo J; Huertas, Oscar; Tabares, Carolina

    2011-01-01

    Among the distinct strategies proposed to expand the genetic alphabet, sizeexpanded nucleobases are promising for the development of modified DNA duplexes with improved biotechnological properties. In particular, duplexes built up by replacing canonical bases with the corresponding benzo-fused counterparts could be valuable as molecular nanowires. In this context, this study reports the results of classical molecular dynamics simulations carried out to examine the structural and dynamical features of size-expanded DNAs, including both hybrid duplexes containing mixed pairs of natural and benzo-fused bases (xDNA) and pure size-expanded (xxDNA) duplexes. Furthermore, the electronic structure of both natural and size-expanded duplexes is examined by means of density functional computations. The results confirm that the structural and flexibility properties of the canonical DNA are globally little affected by the presence of benzo-fused bases. Themost relevant differences are found in the enhanced size of the grooves, and the reduction in the twist. However, the analysis also reveals subtle structural effects related to the nature and sequence of benzo-fused bases in the duplex. On the other hand, electronic structure calculations performed for xxDNAs confirm the reduction in the HOMOLUMO gap predicted from the analysis of the natural bases and their size-expanded counterparts, which suggests that pure size-expanded DNAs can be good conductors. A more complex situation is found for xDNAs, where fluctuations in the electrostatic interaction between base pairs exerts a decisive influence on the modulation of the energy gap.

  9. Fluorescence Turn-On Sensing of DNA Duplex Formation by a Tricyclic Cytidine Analogue

    PubMed Central

    Burns, Dillon D.; Teppang, Kristine L.; Lee, Raymond W.; Lokensgard, Melissa E.; Purse, Byron W.

    2017-01-01

    Most fluorescent nucleoside analogues are quenched when base stacked and some maintain their brightness, but there has been little progress toward developing nucleoside analogues that markedly increase their fluorescence upon duplex formation. Here, we report on the design and synthesis of a new tricyclic cytidine analogue, 8-diethylamino-tC (8-DEA-tC), that responds to DNA duplex formation with up to a 20-fold increase in fluorescent quantum yield as compared with the free nucleoside, depending on neighboring bases. This turn-on response to duplex formation is the greatest of any reported nucleoside analogue that can participate in Watson–Crick base pairing. Measurements of the quantum yield of 8-DEA-tC mispaired with adenosine and, separately, opposite an abasic site show that there is almost no fluorescence increase without the formation of correct Watson–Crick hydrogen bonds. Kinetic isotope effects from the use of deuterated buffer show that the duplex protects 8-DEA-tC against quenching by excited state proton transfer. These results, supported by DFT calculations, suggest a rationale for the observed photophysical properties that is dependent on duplex integrity and the electronic structure of the analogue. PMID:28080035

  10. DNA Duplexes with Hydrophobic Modifications Inhibit Fusion between HIV-1 and Cell Membranes

    PubMed Central

    Xu, Liang; Cai, Lifeng; Chen, Xueliang; Jiang, Xifeng; Chong, Huihui; Zheng, Baohua; Wang, Kun; He, Junlin; Chen, Wei; Zhang, Tao; Cheng, Maosheng; He, Yuxian

    2013-01-01

    Discovery of new drugs for the treatment of AIDS typically possessing unique structures associated with novel mechanisms of action has been of great importance due to the quick drug-resistant mutations of HIV-1 strains. The work presented in this report describes a novel class of DNA duplex-based HIV-1 fusion inhibitors. Hydrophobic groups were introduced into a DNA duplex skeleton either at one end, at both ends, or in the middle. These modified DNA duplexes inhibited fusion between HIV-1 and human cell membranes at micro- or submicromolar concentrations. Respective inhibitors adopted an aptamer pattern instead of a base-pairing interaction pattern. Structure-activity relationship studies of the respective DNA duplexes showed that the rigid and negatively charged DNA skeletons, in addition to the presence of hydrophobic groups, were crucial to the anti-HIV-1 activity of these compounds. A fluorescent resonance energy transfer (FRET)-based inhibitory assay showed that these duplex inhibitors interacted with the primary pocket in the gp41 N-terminal heptad repeat (NHR) instead of interacting with the lipid bilayers. PMID:23896466

  11. Fluorescence Turn-On Sensing of DNA Duplex Formation by a Tricyclic Cytidine Analogue.

    PubMed

    Burns, Dillon D; Teppang, Kristine L; Lee, Raymond W; Lokensgard, Melissa E; Purse, Byron W

    2017-02-01

    Most fluorescent nucleoside analogues are quenched when base stacked and some maintain their brightness, but there has been little progress toward developing nucleoside analogues that markedly increase their fluorescence upon duplex formation. Here, we report on the design and synthesis of a new tricyclic cytidine analogue, 8-diethylamino-tC (8-DEA-tC), that responds to DNA duplex formation with up to a 20-fold increase in fluorescent quantum yield as compared with the free nucleoside, depending on neighboring bases. This turn-on response to duplex formation is the greatest of any reported nucleoside analogue that can participate in Watson-Crick base pairing. Measurements of the quantum yield of 8-DEA-tC mispaired with adenosine and, separately, opposite an abasic site show that there is almost no fluorescence increase without the formation of correct Watson-Crick hydrogen bonds. Kinetic isotope effects from the use of deuterated buffer show that the duplex protects 8-DEA-tC against quenching by excited state proton transfer. These results, supported by DFT calculations, suggest a rationale for the observed photophysical properties that is dependent on duplex integrity and the electronic structure of the analogue.

  12. PCR hot-start using duplex primers.

    PubMed

    Kong, Deming; Shen, Hanxi; Huang, Yanping; Mi, Huaifeng

    2004-02-01

    A new technique of PCR hot-start using duplex primers has been developed which can decrease the undesirable products arising throughout PCR amplification thereby giving better results than a manual hot-start method.

  13. Cisplatin-induced duplex dissociation of complementary and destabilized short GG-containing duplex RNAs.

    PubMed

    Polonyi, Christopher; Alshiekh, Alak; Sarsam, Lamya A; Clausén, Maria; Elmroth, Sofi K C

    2014-08-21

    The ability of the anticancer active drug cisplatin to exert biological activity through interference with nucleic acid function is well documented. Since kinetics play a key role in determining product distributions in these systems, methods for accurate documentation of reactivity serve the purpose to identify preferential metal binding sites. In the present study, the aim has been to further explore a recently communicated approach (C. Polonyi and S. K. C. Elmroth, J. Chem. Soc., Dalton Trans., 2013, 42, 14959-14962) utilizing UV/vis spectroscopy and metal induced duplex RNA melting for monitoring of kinetics. More specifically, the sensitivity of the UV/vis-methodology has been evaluated by investigation of how overall length and changes of base-pairing in the close vicinity of a centrally located GG-site affect the rate of cisplatin binding, using the intracellularly active mono-aquated form of cisplatin (cis-Pt(NH3)2Cl(OH2)(+), ()) as the platination reagent. For this purpose, the reactivity of five different 13- to 17 base-pair duplex RNAs was monitored at 38 °C. A common trend of a ca. 10-fold reduction in reactivity was found to accompany an increase of bulk sodium concentration from CNa+ = 122 mM to 1.0 M. Typical half-lives are exemplified by the interaction of with the fully complementary 15-mer RNA-1 with t1/2 = ca. 0.5 and 4.8 hours, at CNa+ = 122 mM and 1.0 M respectively, and C = 45 μM. Lowering of melting temperature (Tm) was found to promote reactivity regardless of whether the change involved a decrease or increase of the RNA length. For example, at CNa+ = 1.0 M, truncation of the fully complementary and GG-containing 15-mer RNA-1 (Tm = 68.9 °C) to the 13-mer RNA-1-1-S (Tm = 63.9 °C) resulted in an increase of k2,app from ca. 0.9 M(-1) s(-1) to 2.0 M(-1) s(-1). Further, the 17-mer RNA-1-4 (Tm = 42.0 °C) with a central U4 bulge exhibited the highest reactivity of the sequences studied with k2,app = 4.0 M(-1) s(-1). The study shows that the

  14. Influence of buffer species on the thermodynamics of short DNA duplex melting: sodium phosphate versus sodium cacodylate.

    PubMed

    Alemayehu, Saba; Fish, Daniel J; Brewood, Greg P; Horne, M Todd; Manyanga, Fidelis; Dickman, Rebekah; Yates, Ian; Benight, Albert S

    2009-03-05

    Thermodynamic parameters of the melting transitions of 53 short duplex DNAs were experimentally evaluated by differential scanning calorimetry melting curve analysis. Solvents for the DNA solutions contained approximately 1 M Na+ and either 10 mM cacodylate or phosphate buffer. Thermodynamic parameters obtained in the two solvent environments were compared and quantitatively assessed. Thermodynamic stabilities (deltaG(o) (25 degrees C)) of the duplexes studied ranged from quite stable perfect match duplexes (approximately -30 kcal/mol) to relatively unstable mismatch duplexes (approximately -9 kcal/mol) and ranged in length from 18 to 22 basepairs. A significant difference in stability (average free energy difference of approximately 3 kcal/mol) was found for all duplexes melted in phosphate (greater stability) versus cacodylate buffers. Measured effects of buffer species appear to be relatively unaffected by duplex length or sequence content. The popular sets of published nearest-neighbor (n-n) stability parameters for Watson-Crick (w/c) and single-base mismatches were evaluated from melting studies performed in cacodylate buffer (SantaLucia and Hicks, Annu. Rev. Biophys. Biomol. Struct. 2004, 33, 415). Thus, when using these parameters to make predictions of sequence dependent stability of DNA oligomers in buffers other than cacodylate (e.g., phosphate) one should be mindful that in addition to sodium ion concentration, the type of buffer species also provides a minor but significant contribution to duplex stability. Such considerations could potentially influence results of sequence dependent analysis using published n-n parameters and impact results of thermodynamic calculations. Such calculations and analyses are typically employed in the design and interpretation of DNA multiplex hybridization experiments.

  15. Contiguous metal-mediated base pairs comprising two Ag(I) ions.

    PubMed

    Megger, Dominik A; Guerra, Célia Fonseca; Hoffmann, Jan; Brutschy, Bernhard; Bickelhaupt, F Matthias; Müller, Jens

    2011-05-27

    The incorporation of transition-metal ions into nucleic acids by using metal-mediated base pairs has proved to be a promising strategy for the site-specific functionalization of these biomolecules. We report herein the formation of Ag(+)-mediated Hoogsteen-type base pairs comprising 1,3-dideaza-2'-deoxyadenosine and thymidine. By defunctionalizing the Watson-Crick edge of adenine, the formation of regular base pairs is prohibited. The additional substitution of the N3 nitrogen atom of adenine by a methine moiety increases the basicity of the exocyclic amino group. Hence, 1,3-dideazaadenine and thymine are able to incorporate two Ag(+) ions into their Hoogsteen-type base pair (as compared with one Ag(+) ion in base pairs with 1-deazaadenine and thymine). We show by using a combination of experimental techniques (UV and circular dichroism (CD) spectroscopies, dynamic light scattering, and mass spectrometry) that this type of base pair is compatible with different sequence contexts and can be used contiguously in DNA double helices. The most stable duplexes were observed when using a sequence containing alternating purine and pyrimidine nucleosides. Dispersion-corrected density functional theory calculations have been performed to provide insight into the structure, formation and stabilization of the twofold metalated base pair. They revealed that the metal ions within a base pair are separated by an Ag···Ag distance of about 2.88 Å. The Ag-Ag interaction contributes some 16 kcal mol(-1) to the overall stability of the doubly metal-mediated base pair, with the dominant contribution to the Ag-Ag bonding resulting from a donor-acceptor interaction between silver 4d-type and 4s orbitals. These Hoogsteen-type base pairs enable a higher functionalization of nucleic acids with metal ions than previously reported metal-mediated base pairs, thereby increasing the potential of DNA-based nanotechnology.

  16. Testing the Nearest Neighbor Model for Canonical RNA Base Pairs: Revision of GU Parameters

    PubMed Central

    2012-01-01

    Thermodynamic parameters for GU pairs are important for predicting the secondary structures of RNA and for finding genomic sequences that code for structured RNA. Optical melting curves were measured for 29 RNA duplexes with GU pairs to improve nearest neighbor parameters for predicting stabilities of helixes. The updated model eliminates a prior penalty assumed for terminal GU pairs. Six additional duplexes with the 5′GG/3′UU motif were added to the single representation in the previous database. This revises the ΔG°37 for the 5′GG/3′UU motif from an unfavorable 0.5 kcal/mol to a favorable −0.2 kcal/mol. Similarly, the ΔG°37 for the 5′UG/3′GU motif changes from 0.3 to −0.6 kcal/mol. The correlation coefficients between predicted and experimental ΔG°37, ΔH°, and ΔS° for the expanded database are 0.95, 0.89, and 0.87, respectively. The results should improve predictions of RNA secondary structure. PMID:22490167

  17. A new general model for predicting melting thermodynamics of complementary and mismatched B-form duplexes containing locked nucleic acids: application to probe design for digital PCR detection of somatic mutations.

    PubMed

    Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles

    2015-02-17

    Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a

  18. Kinetic Monte Carlo Investigation of the Effects of Vacancy Pairing on Oxygen Diffusivity in Yttria-Stabilized Zirconia

    NASA Technical Reports Server (NTRS)

    Good, Brian S.

    2011-01-01

    Yttria-stabilized zirconia s high oxygen diffusivity and corresponding high ionic conductivity, and its structural stability over a broad range of temperatures, have made the material of interest for use in a number of applications, for example, as solid electrolytes in fuel cells. At low concentrations, the stabilizing yttria also serves to increase the oxygen diffusivity through the presence of corresponding oxygen vacancies, needed to maintain charge neutrality. At higher yttria concentration, however, diffusivity is impeded by the larger number of relatively high energy migration barriers associated with yttrium cations. In addition, there is evidence that oxygen vacancies preferentially occupy nearest-neighbor sites around either dopant or Zr cations, further affecting vacancy diffusion. We present the results of ab initio calculations that indicate that it is energetically favorable for oxygen vacancies to occupy nearest-neighbor sites adjacent to Y ions, and that the presence of vacancies near either species of cation lowers the migration barriers. Kinetic Monte Carlo results from simulations incorporating this effect are presented and compared with results from simulations in which the effect is not present.

  19. Thermodynamic contribution and nearest-neighbor parameters of pseudouridine-adenosine base pairs in oligoribonucleotides

    PubMed Central

    Hudson, Graham A.; Bloomingdale, Richard J.; Znosko, Brent M.

    2013-01-01

    Pseudouridine (Ψ) is the most common noncanonical nucleotide present in naturally occurring RNA and serves a variety of roles in the cell, typically appearing where structural stability is crucial to function. Ψ residues are isomerized from native uridine residues by a class of highly conserved enzymes known as pseudouridine synthases. In order to quantify the thermodynamic impact of pseudouridylation on U-A base pairs, 24 oligoribonucleotides, 16 internal and eight terminal Ψ-A oligoribonucleotides, were thermodynamically characterized via optical melting experiments. The thermodynamic parameters derived from two-state fits were used to generate linearly independent parameters for use in secondary structure prediction algorithms using the nearest-neighbor model. On average, internally pseudouridylated duplexes were 1.7 kcal/mol more stable than their U-A counterparts, and terminally pseudouridylated duplexes were 1.0 kcal/mol more stable than their U-A equivalents. Due to the fact that Ψ-A pairs maintain the same Watson-Crick hydrogen bonding capabilities as the parent U-A pair in A-form RNA, the difference in stability due to pseudouridylation was attributed to two possible sources: the novel hydrogen bonding capabilities of the newly relocated imino group as well as the novel stacking interactions afforded by the electronic configuration of the Ψ residue. The newly derived nearest-neighbor parameters for Ψ-A base pairs may be used in conjunction with other nearest-neighbor parameters for accurately predicting the most likely secondary structure of A-form RNA containing Ψ-A base pairs. PMID:24062573

  20. Base-pairing energies of proton-bound heterodimers of cytosine and modified cytosines: implications for the stability of DNA i-motif conformations.

    PubMed

    Yang, Bo; Rodgers, M T

    2014-01-08

    The DNA i-motif conformation was discovered in (CCG)•(CGG)n trinucleotide repeats, which are associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The DNA i-motif is a four-stranded structure whose strands are held together by proton-bound dimers of cytosine (C(+)•C). The stronger base-pairing interactions in C(+)•C proton-bound dimers as compared to Watson-Crick G•C base pairs are the major forces responsible for stabilization of i-motif conformations. Methylation of cytosine results in silencing of the FMR1 gene and causes fragile X syndrome. However, the influence of methylation or other modifications such as halogenation of cytosine on the base-pairing energies (BPEs) in the i-motif remains elusive. To address this, proton-bound heterodimers of cytosine and 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, and 5-iodocytosine are probed in detail. Experimentally, the BPEs of proton-bound heterodimers of cytosine and modified cytosines are determined using threshold collision-induced dissociation (TCID) techniques. All modifications at the 5-position of cytosine are found to lower the BPE and therefore would tend to destabilize DNA i-motif conformations. However, the BPEs in these proton-bound heterodimers still significantly exceed those of the Watson-Crick G•C and neutral C•C base pairs, suggesting that C(+)•C mismatches are still energetically favored such that i-motif conformations are preserved. Excellent agreement between TCID measured BPEs and B3LYP calculated values is found with the def2-TZVPPD and 6-311+G(2d,2p) basis sets, suggesting that calculations at these levels of theory can be employed to provide reliable energetic predictions for related systems.

  1. Duplex sampling apparatus and method

    DOEpatents

    Brown, Paul E.; Lloyd, Robert

    1992-01-01

    An improved apparatus is provided for sampling a gaseous mixture and for measuring mixture components. The apparatus includes two sampling containers connected in series serving as a duplex sampling apparatus. The apparatus is adapted to independently determine the amounts of condensable and noncondensable gases in admixture from a single sample. More specifically, a first container includes a first port capable of selectively connecting to and disconnecting from a sample source and a second port capable of selectively connecting to and disconnecting from a second container. A second container also includes a first port capable of selectively connecting to and disconnecting from the second port of the first container and a second port capable of either selectively connecting to and disconnecting from a differential pressure source. By cooling a mixture sample in the first container, the condensable vapors form a liquid, leaving noncondensable gases either as free gases or dissolved in the liquid. The condensed liquid is heated to drive out dissolved noncondensable gases, and all the noncondensable gases are transferred to the second container. Then the first and second containers are separated from one another in order to separately determine the amount of noncondensable gases and the amount of condensable gases in the sample.

  2. The hydrogen-bonding structure in parallel-stranded duplex DNA is reverse Watson-Crick

    SciTech Connect

    Otto, C., Thomas, G.A.; Peticolas, W.L. ); Rippe, K.; Jovin, T.M. )

    1991-03-26

    Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5{prime}-d-((A){sub 10}TAATTTTAAATATTT)-3{prime} (D1) and 5{prime}-d((T){sub 10}ATTAAAATTTATAAA)-3{prime} (D2) in H{sub 2}O and D{sub 2}O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5{prime}-d(AAATATTTAAAATTA-(T){sub 10})-3{prime} (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly(d(A)){center dot}poly(d(T)) and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due to changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent with formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogeneous sequence and high A,T content are observed at 843 and 1,092 cm{sup {minus}1} in the spectra of the parallel-stranded duplex.

  3. NMR studies of abasic sites in DNA duplexes: Deoxyadenosine stacks into the helix opposite acyclic lesions

    SciTech Connect

    Kalnik, M.W.; Chang, Chienneng; Johnson, F.; Grollman, A.P.; Patel, D.J. )

    1989-04-18

    Proton and phosphorus NMR studies are reported for two complementary nonanucleotide duplexes containing acyclic abasic sites. The first duplex, d(C-A-T-G-A-G-T-A-C){center dot}d(G-T-A-C-P-C-A-T-G), contains an acyclic propanyl moiety, P, located opposite a deoxyadenosine at the center of the helix (designated AP{sub P} 9-mer duplex). The second duplex, d(C-A-T-G-A-G-T-A-C-){center dot}d(G-T-A-C-E-C-A-T-G), contains a similarly located acyclic ethanyl moiety, E (designated AP{sub E} 9-mer duplex). The ethanyl moiety is one carbon shorter than the natural carbon-phosphodiester backbone of a single nucleotide unit of DNA. The majority of the exchangeable and nonexchangeable base and sugar protons in both the AP{sub P} 9-mer and AP{sub E} 9-mer duplexes, including those at the abasic site, have been assigned by recording and analyzing two-dimensional phase-sensitive NOESY data sets in H{sub 2}O and D{sub 2}O solution between -5 and 5{degree}C. These spectroscopic observations establish that A5 inserts into the helix opposite the abasic site (P14 and El14) and stacks between the flanking G4{center dot}C15 and G6{center dot}C13 Watson-Crick base pairs in both the AP{sub P} 9-mer and AP{sub E} 9-mer duplexes. Proton NMR parameters for the Ap{sub P} 9-mer and AP{sub E}9-mer duplexes are similar to those reported previously. These proton NMR experiments demonstrate that the structures at abasic sites are very similar whether the five-membered ring is open or closed or whether the phosphodiester backbone is shortened by one carbon atom. Phosphorus spectra of the AP{sub P} 9-mer and AP{sub E} 9-mer duplexes (5{degree}C) indicate that the backbone conformation is similarly perturbed at three phosphodiester backbone torsion angles.

  4. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed Central

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-01-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977

  5. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-02-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

  6. Different duplex/quadruplex junctions determine the properties of anti-thrombin aptamers with mixed folding.

    PubMed

    Russo Krauss, Irene; Spiridonova, Vera; Pica, Andrea; Napolitano, Valeria; Sica, Filomena

    2016-01-29

    Mixed duplex/quadruplex oligonucleotides have attracted great interest as therapeutic targets as well as effective biomedical aptamers. In the case of thrombin-binding aptamer (TBA), the addition of a duplex motif to the G-quadruplex module improves the aptamer resistance to biodegradation and the affinity for thrombin. In particular, the mixed oligonucleotide RE31 is significantly more effective than TBA in anticoagulation experiments and shows a slower disappearance rate in human plasma and blood. In the crystal structure of the complex with thrombin, RE31 adopts an elongated structure in which the duplex and quadruplex regions are perfectly stacked on top of each other, firmly connected by a well-structured junction. The lock-and-key shape complementarity between the TT loops of the G-quadruplex and the protein exosite I gives rise to the basic interaction that stabilizes the complex. However, our data suggest that the duplex motif may have an active role in determining the greater anti-thrombin activity in biological fluids with respect to TBA. This work gives new information on mixed oligonucleotides and highlights the importance of structural data on duplex/quadruplex junctions, which appear to be varied, unpredictable, and fundamental in determining the aptamer functional properties.

  7. pH might play a role in regulating the function of paired amphipathic helices domains of human Sin3B by altering structure and thermodynamic stability.

    PubMed

    Hasan, Tauheed; Ali, Mashook; Saluja, Daman; Singh, Laishram Rajendrakumar

    2015-04-01

    Human Sin3B (hSin3B), a transcription regulator, is a scaffold protein that binds to different transcription factors and regulates transcription. It consists of six conserved domains that include four paired amphipathic helices (PAH 1-4), histone deacetylase interaction domain (HID), and highly conserved region (HCR). Interestingly, the PAH domains of hSin3B are significantly homologous to each other, yet each one interacts with a specific set of unique transcription factors. Though various partners interacting with hSin3B PAH domains have been characterized, there is no structural information available on the individual PAH domains of hSin3B. Here we characterize the structure and stability of different PAH domains of hSin3B at both nuclear and physiological pH values by using different optical probes. We found that the native state structure and stability of different PAH domains are different at nuclear pH where hSin3B performs its biological function. We also found that PAH2 and PAH3 behave differently at both nuclear and physiological pH in terms of native state structure and thermodynamic stability, while the structural identity of PAH1 remains unaltered at both pH values. The study indicates that the structural heterogeneity of different PAH domains might be responsible for having a unique set of interacting transcription factors.

  8. Mammalian E-type cyclins control chromosome pairing, telomere stability and CDK2 localization in male meiosis.

    PubMed

    Martinerie, Laetitia; Manterola, Marcia; Chung, Sanny S W; Panigrahi, Sunil K; Weisbach, Melissa; Vasileva, Ana; Geng, Yan; Sicinski, Peter; Wolgemuth, Debra J

    2014-02-01

    Loss of function of cyclin E1 or E2, important regulators of the mitotic cell cycle, yields viable mice, but E2-deficient males display reduced fertility. To elucidate the role of E-type cyclins during spermatogenesis, we characterized their expression patterns and produced additional deletions of Ccne1 and Ccne2 alleles in the germline, revealing unexpected meiotic functions. While Ccne2 mRNA and protein are abundantly expressed in spermatocytes, Ccne1 mRNA is present but its protein is detected only at low levels. However, abundant levels of cyclin E1 protein are detected in spermatocytes deficient in cyclin E2 protein. Additional depletion of E-type cyclins in the germline resulted in increasingly enhanced spermatogenic abnormalities and corresponding decreased fertility and loss of germ cells by apoptosis. Profound meiotic defects were observed in spermatocytes, including abnormal pairing and synapsis of homologous chromosomes, heterologous chromosome associations, unrepaired double-strand DNA breaks, disruptions in telomeric structure and defects in cyclin-dependent-kinase 2 localization. These results highlight a new role for E-type cyclins as important regulators of male meiosis.

  9. Mammalian E-type Cyclins Control Chromosome Pairing, Telomere Stability and CDK2 Localization in Male Meiosis

    PubMed Central

    Chung, Sanny S. W.; Panigrahi, Sunil K.; Weisbach, Melissa; Vasileva, Ana; Geng, Yan; Sicinski, Peter; Wolgemuth, Debra J.

    2014-01-01

    Loss of function of cyclin E1 or E2, important regulators of the mitotic cell cycle, yields viable mice, but E2-deficient males display reduced fertility. To elucidate the role of E-type cyclins during spermatogenesis, we characterized their expression patterns and produced additional deletions of Ccne1 and Ccne2 alleles in the germline, revealing unexpected meiotic functions. While Ccne2 mRNA and protein are abundantly expressed in spermatocytes, Ccne1 mRNA is present but its protein is detected only at low levels. However, abundant levels of cyclin E1 protein are detected in spermatocytes deficient in cyclin E2 protein. Additional depletion of E-type cyclins in the germline resulted in increasingly enhanced spermatogenic abnormalities and corresponding decreased fertility and loss of germ cells by apoptosis. Profound meiotic defects were observed in spermatocytes, including abnormal pairing and synapsis of homologous chromosomes, heterologous chromosome associations, unrepaired double-strand DNA breaks, disruptions in telomeric structure and defects in cyclin-dependent-kinase 2 localization. These results highlight a new role for E-type cyclins as important regulators of male meiosis. PMID:24586195

  10. Structure of an A-form RNA duplex obtained by degradation of 6S RNA in a crystallization droplet

    PubMed Central

    Kondo, Jiro; Dock-Bregeon, Anne-Catherine; Willkomm, Dagmar K.; Hartmann, Roland K.; Westhof, Eric

    2013-01-01

    In the course of a crystallographic study of a 132 nt variant of Aquifex aeolicus 6S RNA, a crystal structure of an A-form RNA duplex containing 12 base pairs was solved at a resolution of 2.6 Å. In fact, the RNA duplex is part of the 6S RNA and was obtained by accidental but precise degradation of the 6S RNA in a crystallization droplet. 6S RNA degradation was confirmed by microscopic observation of crystals and gel electrophoresis of crystallization droplets. The RNA oligomers obtained form regular A-form duplexes containing three GoU wobble-type base pairs, one of which engages in intermolecular contacts through a ribose-zipper motif at the crystal-packing interface. PMID:23722840

  11. New method of solving the optimized paired-phonon analysis equations and stability of thin films of liquid 4He at T=0 K

    NASA Astrophysics Data System (ADS)

    Szybisz, L.; Ristig, M. L.

    1989-09-01

    We propose a novel numerical method to solve the two-body Euler-Lagrange equation derived by Krotscheck, Qian, and Kohn in the paired-phonon analysis for an inhomogeneous Bose liquid at zero temperature. The new algorithm is applied to thin films of liquid 4He supported by an external potential. Numerical results are reported for density profiles, chemical potentials, binding energies, and corrective Jastrow correlation factors as a function of the particle number of the film and the strength of the external potential. The stability of this kind of film is discussed in detail. Some evidence for a long-wavelength instability of free thin films is provided. In addition, in order to unify results obtained from different derivations, it is proved that the expression for the Hartree potential reported by Krotscheck et al. is equal, within the framework of the hypernetted-chain theory, to a previously published one by Saarela, Pietiläinen, and Kallio.

  12. Plastomes of the green algae Hydrodictyon reticulatum and Pediastrum duplex (Sphaeropleales, Chlorophyceae).

    PubMed

    McManus, Hilary A; Sanchez, Daniel J; Karol, Kenneth G

    2017-01-01

    Comparative studies of chloroplast genomes (plastomes) across the Chlorophyceae are revealing dynamic patterns of size variation, gene content, and genome rearrangements. Phylogenomic analyses are improving resolution of relationships, and uncovering novel lineages as new plastomes continue to be characterized. To gain further insight into the evolution of the chlorophyte plastome and increase the number of representative plastomes for the Sphaeropleales, this study presents two fully sequenced plastomes from the green algal family Hydrodictyaceae (Sphaeropleales, Chlorophyceae), one from Hydrodictyon reticulatum and the other from Pediastrum duplex. Genomic DNA from Hydrodictyon reticulatum and Pediastrum duplex was subjected to Illumina paired-end sequencing and the complete plastomes were assembled for each. Plastome size and gene content were characterized and compared with other plastomes from the Sphaeropleales. Homology searches using BLASTX were used to characterize introns and open reading frames (orfs) ≥ 300 bp. A phylogenetic analysis of gene order across the Sphaeropleales was performed. The plastome of Hydrodictyon reticulatum is 225,641 bp and Pediastrum duplex is 232,554 bp. The plastome structure and gene order of H. reticulatum and P. duplex are more similar to each other than to other members of the Sphaeropleales. Numerous unique open reading frames are found in both plastomes and the plastome of P. duplex contains putative viral protein genes, not found in other Sphaeropleales plastomes. Gene order analyses support the monophyly of the Hydrodictyaceae and their sister relationship to the Neochloridaceae. The complete plastomes of Hydrodictyon reticulatum and Pediastrum duplex, representing the largest of the Sphaeropleales sequenced thus far, once again highlight the variability in size, architecture, gene order and content across the Chlorophyceae. Novel intron insertion sites and unique orfs indicate recent, independent invasions into each

  13. Effect of Solvent Choice on the Self-Assembly Properties of a Diphenylalanine Amphiphile Stabilized by an Ion Pair.

    PubMed

    Mayans, Enric; Ballano, Gema; Sendros, Javier; Font-Bardia, Merçè; Campos, J Lourdes; Puiggalí, Jordi; Cativiela, Carlos; Alemán, Carlos

    2017-07-19

    A diphenylalanine (FF) amphiphile blocked at the C terminus with a benzyl ester (OBzl) and stabilized at the N terminus with a trifluoroacetate (TFA) anion was synthetized and characterized. Aggregation of peptide molecules was studied by considering a peptide solution in an organic solvent and adding pure water, a KCl solution, or another organic solvent as co-solvent. The choice of the organic solvent and co-solvent and the solvent/co-solvent ratio allowed the mixture to be tuned by modulating the polarity, the ionic strength, and the peptide concentration. Differences in the properties of the media used to dissolve the peptides resulted in the formation of different self-assembled microstructures (e.g. fibers, branched-like structures, plates, and spherulites). Furthermore, crystals of TFA⋅FF-OBzl were obtained from the aqueous peptide solutions for X-ray diffraction analysis. The results revealed a hydrophilic core constituted by carboxylate (from TFA), ester, and amide groups, and the core was found to be surrounded by a hydrophobic crown with ten aromatic rings. This segregated organization explains the assemblies observed in the different solvent mixtures as a function of the environmental polarity, ionic strength, and peptide concentration. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Genetic Analysis of the Role of the Transfer Gene, traN, of the F and R100-1 Plasmids in Mating Pair Stabilization during Conjugation

    PubMed Central

    Klimke, William A.; Frost, Laura S.

    1998-01-01

    Mating pair stabilization occurs during conjugative DNA transfer whereby the donor and recipient cells form a tight junction which requires pili as well as TraN and TraG in the donor cell. The role of the outer membrane protein, TraN, during conjugative transfer was examined by introduction of a chloramphenicol resistance cassette into the traN gene on an F plasmid derivative, pOX38, to produce pOX38N1::CAT. pOX38N1::CAT was greatly reduced in its ability to transfer DNA, indicating that TraN plays a greater role in conjugation than previously thought. F and R100-1 traN were capable of complementing pOX38N1::CAT transfer equally well when wild-type recipients were used. F traN, but not R100-1 traN, supported a much lower level of transfer when there was an ompA mutation or lipopolysaccharide (LPS) deficiency in the recipient cell, suggesting receptor specificity. The R100-1 traN gene was sequenced, and the gene product was found to exhibit 82.3% overall similarity with F TraN. The differences were mainly located within a central region of the proteins (amino acids 162 to 333 of F and 162 to 348 of R100-1). Deletion analysis of F traN suggested that this central portion might be responsible for the receptor specificity displayed by TraN. TraN was not responsible for TraT-dependent surface exclusion. Thus, TraN, and not the F pilus, appears to interact with OmpA and LPS moieties during conjugation, resulting in mating pair stabilization, the first step in efficient mobilization of DNA. PMID:9696748

  15. Reduced-stringency DNA reassociation: sequence specific duplex formation.

    PubMed Central

    Burr, H E; Schimke, R T

    1982-01-01

    Reduced-stringency DNA reassociation conditions allow low stability duplexes to be detected in prokaryotic, plant, fish, avian, mammalian, and primate genomes. Highly diverged families of sequences can be detected in avian, mouse, and human unique sequence dNAs. Such a family has been described among twelve species of birds; based on species specific melting profiles and fractionation of sequences belonging to this family, it was concluded that permissive reassociation conditions did not artifactually produce low stability structures (1). We report S1 nuclease and optical melting experiments, and further fractionation of the diverged family to confirm sequence specific DNA reassociation at 50 degrees in 0.5 M phosphate buffer. PMID:6278429

  16. Stacked base-pair structures of adenine nucleosides stabilized by the formation of hydrogen-bonding network involving the two sugar groups

    NASA Astrophysics Data System (ADS)

    Asami, Hiroya; Yagi, Kiyoshi; Ohba, Masashi; Urashima, Shu-hei; Saigusa, Hiroyuki

    2013-06-01

    We have employed a laser desorption technique combined with supersonic-jet cooling for producing base pairs of adenine nucleosides, adenosine (Ado) and N6,N6-dimethyladenosine (DMAdo) under low-temperature conditions. The resulting base pairs are then ionized through resonant two-photon ionization (R2PI) and analyzed by time-of-flight mass spectrometry. It is found that dimers of these adenine nucleosides are stable, especially in the case of DMAdo, with respect to those of the corresponding bases, i.e., adenine and N6,N6-dimethyladenine. Structural analysis of the DMAdo dimer is performed based on the IR-UV double resonance measurements and theoretical calculations. The result demonstrates that the dimer possesses a stacked structure being stabilized by the formation of hydrogen-bonding network involving the two sugar groups. The occurrence of the frequency shift and broadening is explained satisfactorily based on the anharmonic coupling of the OH stretching modes with specific bending modes and low-frequency modes of base and sugar moieties.

  17. m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

    PubMed Central

    Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

    2016-01-01

    The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

  18. Aromatic oligomers that form hetero duplexes in aqueous solution.

    PubMed

    Gabriel, Gregory J; Iverson, Brent L

    2002-12-25

    The electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (Ndi) and electron-rich 1,5-dialkoxynaphthalene (Dan) have been shown to complex strongly with each other in water due to the hydrophobic effect as modulated through the electrostatic complementarity of the stacked dimer. Previously, oligomers of alternating Ndi and Dan units, termed aedamers, were the first foldamers to employ intramolecular aromatic stacking to effect the formation of secondary structure of nonnatural chains in aqueous solution. Described here is the use of this aromatic-aromatic (or pi-pi) interaction, this time in an intermolecular format, to demonstrate the self-assembly of stable hetero duplexes from a set of molecular strands (1a-4a) and (1b-4b) incorporating Ndi and Dan units, respectively. A 1-to-1 binding stoichiometry was determined from NMR and isothermal titration calorimetry (ITC) investigations, and these experiments indicated that association is enthalpically favored with the tetra-Ndi (4a) and tetra-Dan (4b) strands forming hetero duplexes (4a:4b) with a stability constant of 350 000 M-1 at T = 318 K. Polyacrylamide gel electrophoresis (PAGE) also illustrated the strong interaction between 4a and 4b and support a 1-to-1 binding mode even when one component is in slight excess. Overall, this system is the first to utilize complementary aromatic units to drive discrete self-assembly in aqueous solution. This new approach for designing assemblies is encouraging for future development of duplex systems with highly programmable modes of binding in solution or on surfaces.

  19. Interpretation of duplex ultrasound dialysis access testing.

    PubMed

    Bandyk, Dennis F

    2013-01-01

    Conditions producing dialysis access dysfunction include failure of access maturation, cannulation injury to the conduit wall, thrombosis, low-volume flow, and aneurysmal degeneration. Duplex ultrasound is an accurate diagnostic technique to assess dialysis access anatomy and function, including the obligatory criteria for maturation, eg, volume flow >800 mL/min, conduit depth 0.6 cm from skin surface, and adequate (>5 mm) conduit diameter for cannulation. Measurement of access volume flow from the brachial artery or access conduit is prognostic for effective dialysis and conduit patency; including the determination of whether access maturation has occurred or when to intervene for a duplex-identified access stenosis. The application of duplex surveillance after autogenous vein or prosthetic bridge dialysis access construction has the potential to improve patency and function in the patient whose life is dependent on effective hemodialysis. © 2013 Elsevier Inc. All rights reserved.

  20. 1. VIEW OF DUPLEX (FEATURE 9), FACING NORTHEAST. MILL SITE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. VIEW OF DUPLEX (FEATURE 9), FACING NORTHEAST. MILL SITE IS SHOWN IN UPPER RIGHT CORNER OF PHOTOGRAPH. - Copper Canyon Camp of the International Smelting & Refining Company, Duplex, Copper Canyon, Battle Mountain, Lander County, NV

  1. 3. VIEW OF DUPLEX (FEATURE 7), FACING NORTH. OFFICE (FEATURE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. VIEW OF DUPLEX (FEATURE 7), FACING NORTH. OFFICE (FEATURE 11) VISIBLE IN BACKGROUND. - Copper Canyon Camp of the International Smelting & Refining Company, Duplex, Copper Canyon, Battle Mountain, Lander County, NV

  2. FACILITY 810, REAR OF DUPLEX SHOWING COURTYARD BETWEEN WINGS, OBLIQUE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    FACILITY 810, REAR OF DUPLEX SHOWING COURTYARD BETWEEN WINGS, OBLIQUE VIEW FACING EAST. - Schofield Barracks Military Reservation, Duplex Housing Type with Corner Entries, Between Hamilton & Tidball Streets near Williston Avenue, Wahiawa, Honolulu County, HI

  3. The cardiac muscle duplex as a method to study myocardial heterogeneity

    PubMed Central

    Solovyova, O.; Katsnelson, L.B.; Konovalov, P.V.; Kursanov, A.G.; Vikulova, N.A.; Kohl, P.; Markhasin, V.S.

    2014-01-01

    This paper reviews the development and application of paired muscle preparations, called duplex, for the investigation of mechanisms and consequences of intra-myocardial electro-mechanical heterogeneity. We illustrate the utility of the underlying combined experimental and computational approach for conceptual development and integration of basic science insight with clinically relevant settings, using previously published and new data. Directions for further study are identified. PMID:25106702

  4. A stability-indicating, ion-pairing, reversed-phase liquid chromatography method for studies of daunorubicin degradation in i.v. infusion fluids.

    PubMed

    Respaud, R; Quenum, L; Plichon, C; Tournamille, J F; Gyan, E; Antier, D; Viaud-Massuard, M C

    2013-09-01

    A new stability-indicating method based on high-performance liquid chromatography coupled to ultraviolet and evaporative light scattering detection (HPLC-UV-ELSD) was developed for the quantification of daunorubicin. This is an ion-pairing, reversed-phase method. The column was a Synergi MAX-RP C12 4 μm (150 mm × 4.6 mm). The mobile phase was 6.2mM nonafluoropentanoic acid in aqueous solution and acetonitrile under isocratic elution mode. The drug was subjected to oxidation, basic and acid hydrolysis to apply stress conditions. Good resolution was achieved between daunorubicin, related products and all degradation products in an overall analytical run time of approximately 16 min with the parent compound daunorubicin eluting at approximately 8 min. The method was fully validated according to ICH guidelines and SFSTP protocols in terms of accuracy, precision, specificity and linearity. For daunorubicin, the decision criteria selected consisted of the acceptability limits (±3%) and the proportion of results within the calculated tolerance intervals (95%). In conclusion, the proposed analytical procedures were validated over the selected validation domains daunorubicin (0.25-0.45 mg/mL) and shown to provide a very effective method. Physical and chemical stability study was carried out on daunorubicin preparation in our hospital centralized pharmacy unit.

  5. A Case of Zoster Duplex Bilateralis

    PubMed Central

    Shin, Jung Woong; Kim, Dae-Hyun; Whang, Kyu Uang; Lee, Jongsuk; Park, Younglip; Cho, Moon Kyun; Lee, Sanghoon

    2009-01-01

    The skin lesions of herpes zoster are classically limited to a single dermatome and most cases of multidermatomal herpes zoster have contiguous skin lesions. Simultaneous involvement of two noncontiguous dermatomes is very rare and it has been referred to as zoster duplex unilateralis or bilateralis, depending whether one or both halves of the body are involved. A 67-year-old woman presented with a group of painful vesicles on the right buttock and thigh, and left anterior chest and back. The Tzanck smear and skin biopsy were consistent with a herpetic infection. We report a rare case of zoster duplex bilateralis. PMID:20523839

  6. Extensional duplex in the Purcell Mountains of southeastern British Columbia

    SciTech Connect

    Root, K.G. )

    1990-05-01

    An extensional duplex consisting of fault-bounded blocks (horses) located between how-angle normal faults is exposed in Proterozoic strata in the Purcell Mountains of British Columbia, Canada. This is one of the first documented extensional duplexes, and it is geometrically and kinematically analogous to duplexes developed in contractional and strike-slip fault systems. The duplex formed within an extensional fault with a ramp and flat geometry when horses were sliced from the ramp and transported within the fault system.

  7. Smectic phase in suspensions of gapped DNA duplexes

    DOE PAGES

    Salamonczyk, Miroslaw; Zhang, Jing; Portale, Giuseppe; ...

    2016-11-15

    Smectic ordering in aqueous solutions of monodisperse stiff double-stranded DNA fragments is known not to occur, in spite of the fact that these systems exhibit both chiral nematic and columnar mesophases. Here, we show, unambiguously, that a smectic-A type of phase is formed by increasing the DNA's flexibility through the introduction of an unpaired single-stranded DNA spacer in the middle of each duplex. This is unusual for a lyotropic system, where flexibility typically destabilizes the smectic phase. We also report on simulations suggesting that the gapped duplexes (resembling chain-sticks) attain a folded conformation in the smectic layers, and argue thatmore » this layer structure, which we designate as smectic-fA phase, is thermodynamically stabilized by both entropic and energetic contributions to the system's free energy. These results demonstrate that DNA as a building block offers an exquisitely tunable means to engineer a potentially rich assortment of lyotropic liquid crystals.« less

  8. Klenow exo-, as opposed to exo+, traverses through G-G:C triplex by melting G-G base pairs.

    PubMed

    Ramanathan, Sunita; Chary, Kandala V R; Rao, Basuthkar J

    2002-07-19

    G-G base-paired hairpin DNA structures on template strands offer potential "road-blocks" to a traversing polymerase. Klenow polymerase (exo+) pauses while replicating through G-G base-paired hairpin DNA due to the generation of G-G:C triplex. However, exonuclease-deficient Klenow traverses through de novo generated G-G:C triplexes leading to full-length C:G duplexes. Alleviation of such road-blocks by exo- Klenow ensues faster at lower Mg2+, a kinetic effect consistent with the role of Mg2+ in stabilizing G-G:C triplex fold. The ability of exonuclease-deficient polymerase to go past the de novo generated G-G:C triplexes suggests that the "idling" of exo+ polymerase at G-G road-block is due to the reiterative polymerase/exonuclease action. The full-length replication product carrying a C(n)-G(n) duplex at one end is further "expanded" by exo- Klenow through C-strand "slippage" leading to the generation of C+-G:C triplex, which is exemplified by the premature arrest of the same at low pH that further stabilizes the C+-G:C triplex. (c) 2002 Elsevier Science (USA).

  9. How Mg(2+) ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    PubMed

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2016-08-02

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg(2+) ions through water-mediated interaction. It is important to know the synergic role of Mg(2+) and the water network surrounding Mg(2+) in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg(2+) is pulled from RNA, which causes disturbance of the water network. It was found that Mg(2+) remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg(2+) interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg(2+) and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg(2+) is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  10. Overstretching of a 30 bp DNA duplex studied with steered molecular dynamics simulation: Effects of structural defects on structure and force-extension relation

    NASA Astrophysics Data System (ADS)

    Li, H.; Gisler, T.

    2009-11-01

    Single-molecule experiments on polymeric DNA show that the molecule can be overstretched at nearly constant force by about 70% beyond its relaxed contour length. In this publication we use steered molecular dynamics (MD) simulation to study the effect of structural defects on force-extension curves and structures at high elongation in a 30 base pair duplex pulled by its torsionally unconstrained 5' -5' ends. The defect-free duplex shows a plateau in the force-extension curve at 120pN in which large segments with inclined and paired bases (“S-DNA”) near both ends of the duplex coexist with a central B-type segment separated from the former by small denaturation bubbles. In the presence of a base mismatch or a nick, force-extension curves are very similar to the ones of the defect-free duplex. For the duplex with a base mismatch, S-type segments with highly inclined base pairs are not observed; rather, the overstretched duplex consists of B-type segments separated by denaturation bubbles. The nicked duplex evolves, via a two-step transition, into a two-domain structure characterized by a large S-type segment coexisting with several short S-type segments which are separated by short denaturation bubbles. Our results suggest that in the presence of nicks the force-extension curve of highly elongated duplex DNA might reflect locally highly inhomogeneous stretching. Supplementary material in the form of a PDF file available from the Journal web page at 10.1140/epje/i2009-10524-5 and is accessible for authorised users.

  11. Stereodefined phosphorothioate analogues of DNA: relative thermodynamic stability of the model PS-DNA/DNA and PS-DNA/RNA complexes.

    PubMed

    Boczkowska, Małgorzata; Guga, Piotr; Stec, Wojciech J

    2002-10-15

    Thermodynamic data regarding the influence of P-chirality on stability of duplexes formed between phosphorothioate DNA oligonucleotides (of either stereo-defined all-R(P) or all-S(P) or random configuration at the P atoms) and complementary DNA or RNA strands are presented. Measured melting temperatures and calculated DeltaG(37)(o) values showed that duplexes formed by PS-DNA oligomers with DNA strands are less stable than their unmodified counterparts. However, relative stability of the duplexes ([all-R(P)]-PS-DNA/DNA vs [all-S(P)]-PS-DNA/DNA) depends on their sequential composition rather than on the absolute configuration of PS-oligos, contrary to the results of theoretical considerations and molecular modeling reported in the literature. On the other hand, for all six analyzed pairs of diastereomers, the [all-R(P)]-PS isomers form more stable duplexes with RNA templates, but the origin of stereodifferentiation depends on the sequence with more favorable entropy and enthalpy factors which correlated with dT-rich and dA/dG-rich PS-oligomers, respectively.

  12. Defusing Complexity in Intermetallics: How Covalently Shared Electron Pairs Stabilize the FCC Variant Mo2Cu(x)Ga(6-x) (x ≈ 0.9).

    PubMed

    Kilduff, Brandon J; Yannello, Vincent J; Fredrickson, Daniel C

    2015-08-17

    Simple sphere packings of metallic atoms are generally assumed to exhibit highly delocalized bonding, often visualized in terms of a lattice of metal cations immersed in an electron gas. In this Article, we present a compound that demonstrates how covalently shared electron pairs can, in fact, play a key role in the stability of such structures: Mo2Cu(x)Ga(6-x) (x ≈ 0.9). Mo2Cu(x)Ga(6-x) adopts a variant of the common TiAl3 structure type, which itself is a binary coloring of the fcc lattice. Electronic structure calculations trace the formation of this compound to a magic electron count of 14 electrons/T atom (T = transition metal) for the TiAl3 type, for which the Fermi energy coincides with an electronic pseudogap. This count is one electron/T atom lower than the electron concentration for a hypothetical MoGa3 phase, making this structure less competitive relative to more complex alternatives. The favorable 14 electron count can be reached, however, through the partial substitution of Ga with Cu. Using DFT-calibrated Hückel calculations and the reversed approximation Molecular Orbital (raMO) method, we show that the favorability of the 14 electron count has a simple structural origin in terms of the 18 - n rule of T-E intermetallics (E = main group element): the T atoms of the TiAl3 type are arranged into square nets whose edges are bridged by E atoms. The presence of shared electron pairs along these T-T contacts allows for 18 electron configurations to be achieved on the T atoms despite possessing only 18 - 4 = 14 electrons/T atom. This bonding scheme provides a rationale for the observed stability range of TiAl3 type TE3 phases of ca. 13-14 electrons/T atom, and demonstrates how the concept of the covalent bond can extend even to the most metallic of structure types.

  13. Helical molecular duplex strands: multiple hydrogen-bond-mediated assembly of self-complementary oligomeric hydrazide derivatives.

    PubMed

    Yang, Yong; Yang, Zhi-Yong; Yi, Yuan-Ping; Xiang, Jun-Feng; Chen, Chuan-Feng; Wan, Li-Jun; Shuai, Zhi-Gang

    2007-06-22

    Careful examination of the X-ray structure of a ditopic hydrazide derivative 7 led to the concept that with malonyl groups as interhydrazide linkers hydrogen-bonding-mediated molecular duplex strands might be obtained. Complexation studies between 7, 8, and 9 confirmed this hypothesis. Two quadruple hydrogen-bonded heterodimers formed, in which spectator repulsive secondary electrostatic interaction was found to play an important role in determining the stability of the complexes. Extensive studies on 1-4 indicated that the hydrogen-bonding mode could persist in longer oligomeric hydrazide derivatives with chain extension from monomer to tetramer. Molecular duplex strands via two to fourteen interstrand hydrogen bonds were obtained. In addition to affecting the stability of the duplex strands, spectator repulsive secondary electrostatic interaction also played an important role in determining dynamic behavior of the duplex strands as exemplified by variable temperature (1)H NMR experiments. IR studies confirmed stronger hydrogen bonding in the longer oligomers. The assemblies of 1-4 on HOPG were also studied by STM technology. Molecular mechanical calculations further revealed double-helical structures for the longer oligomers. The results provide new opportunities for development of polymeric helical duplexes with well-defined structures.

  14. Assessment of reactive synovitis in rotating-platform posterior-stabilized design: a 10-year prospective matched-pair MRI study.

    PubMed

    Meftah, Morteza; Potter, Hollis G; Gold, Stephanie; Ranawat, Anil S; Ranawat, Amar S; Ranawat, Chitranjan S

    2013-10-01

    This is the first long-term (mean 11.6 years), prospective, matched-pair study (based on age, gender, BMI and UCLA scores) using MAVRIC (multi-acquisition variable-resonance image combination) magnetic resonance imaging to analyze reactive synovitis and osteolysis between rotating-platform posterior-stabilized (RP-PS), fixed-bearing metal-back (FB-MB), and all-polyethylene tibial (APT) in active patients (24 total, 8 in each group, mean age of 64 years, mean UCLA of 8.5) with identical femoral component and polyethylene. Reactive synovitis was observed in 6 RP-PS (75%), all 8 FB-MB (100%), and 6 APT (75%). There was a significant difference between the RP-PS and FB-MB knees in volumetric synovitis (P=0.023). Osteolysis with bone loss more than 4mm was seen in 3 FB-MB, 2 APT and none for RP-PS. These were not statistically significant.

  15. Development of a stability-indicating RP-LC method for the separation of a critical pair of impurities and their degradants in zafirlukast.

    PubMed

    Thiyagarajan, Thilak Kumar; Abdul Hakeem, Jamal Abdul Nasser; Baksam, Vijayakumar

    2012-01-01

    A high-throughput reverse-phase liquid chromatographic (RP-LC) method is developed for the quantification of zafirlukast and its related impurities in drug substance. The separation of known impurities is accomplished using a short (50 mm) LC column with sub-2-µm particle size in a relatively short run-time. A linear gradient elution involves ammonium formate and acetonitrile as mobile phase. The critical impurity pair is the meta and para isomers of zafirlukast, which are known to be potential impurities of zafirlukast, whose resolution is sensitive to pH. The stability-indicating capability of the developed method is demonstrated using forced degradation samples from stress conditions such as hydrolysis, oxidation, thermal and photolytic degradation. The developed RP-LC method is validated in accordance with International Conference on Harmonization requirements. The results from the validation study indicate that this RP-LC method can be used for the determination of synthetic and degradation impurities in regular quality control analysis for the drug substance.

  16. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures.

  17. NMR studies of G:A mismatches in oligodeoxyribonucleotide duplexes modelled after ribozymes.

    PubMed Central

    Katahira, M; Sato, H; Mishima, K; Uesugi, S; Fujii, S

    1993-01-01

    The structures of two oligodeoxyribonucleotide duplexes, the base sequences of which were modelled after both a hammerhead ribozyme and a small metalloribozyme, were studied by NMR. Both duplexes contain adjacent G:A mismatches; one has a PyGAPu:PyGAPu sequence and the other a PyGAPy:PuGAPu sequence. It is concluded on the basis of many characteristic NOEs that in both duplexes G:A base pairs are formed in the unique 'sheared' form, where an amino proton instead of an imino proton of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head'. A photo-CIDNP experiment, which gives unique and independent information on the solvent accessibility of nucleotide bases, also supports G:A base pairing rather than a bulged-out structure of G and A residues. This is the first demonstration that not only the PyGAPu:PyGAPu sequence but also the PyGAPy:PuGAPu sequence can form the unique sheared G:A base pairs. Taking the previous studies on G:A mismatches into account, the idea is suggested that a PyGA:GAPu sequence is a minimum and essential element for the formation of the sheared G:A base pairs. The sheared G:A base pairs in the PyGAPu:PyGAPu sequence are suggested to be more stable than those in the PyGAPy:PuGAPu sequence. This is explained rationally by the idea proposed above. PMID:8265358

  18. G-quadruplexes significantly stimulate Pif1 helicase-catalyzed duplex DNA unwinding.

    PubMed

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-03-20

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation.

  19. Thermodynamics of Oligonucleotide Duplex Melting

    NASA Astrophysics Data System (ADS)

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-05-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply rigorous thermodynamic analysis to an important biochemical problem. Because the stacking of base pairs on top of one another is a significant factor in the energetics of oligonucleotide melting, several investigators have applied van't Hoff analysis to melting temperature data using a nearest-neighbor model and have obtained entropies and enthalpies for the stacking of bases. The present article explains how the equilibrium constant for the dissociation of strands from double-stranded oligonucleotides can be expressed in terms of the total strand concentration and thus how the total strand concentration influences the melting temperature. It also presents a simplified analysis based on the entropies and enthalpies of stacking that is manually tractable so that students can work examples to help them understand the thermodynamics of oligonucleotide melting.

  20. Hands-on work fine-tunes X-band PIN-diode duplexer

    NASA Astrophysics Data System (ADS)

    Schneider, P.

    1985-06-01

    Computer-aided design (CAD) programs for fabricating PIN-diode duplexers are useful in avoiding time-consuming cut-and-try techniques. Nevertheless, to attain minimum insertion loss, only experimentation yields the optimum microstrip circuitry. A PIN-diode duplexer, consisting of two SPST PIN-diode switches and a pair of 3-dB Lange microstrip couplers, designed for an X-band transmit/receive module exemplifies what is possible when computer-derived designs and experimentation are used together. Differences between the measured and computer-generated figures for insertion loss can be attributed to several factors not included in the CAD program - for example, radiation and connector losses. Mechanical tolerances of the microstrip PC board and variations in the SMA connector-to-microstrip transition contribute to the discrepancy.

  1. Structure, stability, and thermodynamics of a short intermolecular purine-purine-pyrimidine triple helix

    SciTech Connect

    Pilch, D.S.; Shafer, R.H. ); Levenson, C. )

    1991-06-25

    The authors have investigated the structure and physical chemistry of the d(C{sub 3}T{sub 4}C{sub 3}){center dot}2(d(G{sub 3}A{sub 4}G{sub 3})) triple helix by polyacrylamide gel electrophoresis (PAGE), {sup 1}H NMR, and ultraviolet (UV) absorption spectroscopy. The triplex was stabilized with MgCl{sub 2} at neutral pH. PAGE studies verify the stoichiometry of the strands comprising the triplex and indicate that the orientation of the third strand in purine-purine-pyrimidine (pur-pur-pyr) triplexes is antiparallel with respect to the purine strand of the underlying duplex. Imino proton NMR spectra provide evidence for the existence of new purine-purine (pur{center dot}pur) hydrogen bonds, in addition to those of the Watson-Crick (W-C) base pairs, in the triplex structure. These new hydrogen bonds are likely to correspond to the interaction between third-strand guanine NH1 imino protons and the N7 atoms of guanine residues on the puring strand of the underlying duplex. Thermal denaturation of the triplex proceeds to single strands in one step, under the conditions used in this study. Binding of the third strand appears to enhance the thermal stability of the duplex by 1-3 C, depending on the DNA concentration. This marked enhancement in stability, coupled with the lack of an acidic pH requirement, suggests that pur-pur-pyr triplexes are appealing choices for use in applications involving oligonucleotide targeting of duplex DNA in vitro and in vivo.

  2. Dislocation substructure in fatigued duplex stainless steel

    SciTech Connect

    Polak, J. . Lab. de Mecanique de Lille Inst. of Physical Metallurgy, Brno . Academy of Sciences); Degallaix, S. . Lab. de Mecanique de Lille); Kruml, T. . Academy of Sciences)

    1993-12-15

    Cyclic plastic straining of crystalline materials results in the formation of specific dislocation structures. Considerable progress in mapping and understanding internal dislocation structures has been achieved by studying single crystal behavior: however, most structural materials have a polycrystalline structure and investigations of polycrystals in comparison to single crystal behavior of simple metals prove to be very useful in understanding more complex materials. There are some classes of materials, however, with complicated structure which do not have a direct equivalent in single crystalline form. Moreover, the specific dimensions and shapes of individual crystallites play an important role both in the cyclic stress-strain response of these materials and in the formation of their interior structure in cyclic straining. Austenitic-ferritic duplex stainless steel, which is a kind of a natural composite, is a material of this type. The widespread interest in the application of duplex steels is caused by approximately doubled mechanical properties and equal corrosion properties, when compared with classical austenitic stainless steels. Fatigue resistance of these steels as well as the surface damage evolution in cyclic straining have been studied; however, much less is known about the internal substructure development in cyclic straining. In this study the dislocation arrangement in ferritic and austenitic grains of the austenitic-ferritic duplex steel alloyed with nitrogen and cyclically strained with two strain amplitudes, is reported and compared to the dislocation arrangement found in single and polycrystals of austenitic and ferritic materials of a similar composition and with the surface relief produced in cyclic plastic straining.

  3. Conformational influence of the ribose 2'-hydroxyl group: crystal structures of DNA-RNA chimeric duplexes

    NASA Technical Reports Server (NTRS)

    Egli, M.; Usman, N.; Rich, A.

    1993-01-01

    We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.

  4. Conformational influence of the ribose 2'-hydroxyl group: crystal structures of DNA-RNA chimeric duplexes

    NASA Technical Reports Server (NTRS)

    Egli, M.; Usman, N.; Rich, A.

    1993-01-01

    We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.

  5. Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase

    PubMed Central

    Aarattuthodiyil, Suja; Byrd, Alicia K.; Raney, Kevin D.

    2014-01-01

    Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding. PMID:25249618

  6. Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase.

    PubMed

    Aarattuthodiyil, Suja; Byrd, Alicia K; Raney, Kevin D

    2014-10-01

    Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding.

  7. Characterization of thermal aging of duplex stainless steel by SQUID

    SciTech Connect

    Isobe, Y.; Kamimura, A.; Aoki, K.; Nakayasu, F.

    1995-08-01

    Thermal aging is a growing concern for long-term-aged duplex stainless steel piping in nuclear power plants. Superconducting QUantum Interference Device (SQUID) was used for the detection of thermal aging of SUS329 rolled duplex stainless steel and SCS16 cast duplex stainless steel. It was found that the SQUID output signal pattern in the presence of AC magnetic field applied to the specimen was sensitive to the changes in electromagnetic properties due to thermal aging.

  8. Quantitative analysis of the ion-dependent folding stability of DNA triplexes.

    PubMed

    Chen, Gengsheng; Chen, Shi-Jie

    2011-12-01

    A DNA triplex is formed through binding of a third strand to the major groove of a duplex. Due to the high charge density of a DNA triplex, metal ions are critical for its stability. We recently developed the tightly bound ion (TBI) model for ion-nucleic acids interactions. The model accounts for the potential correlation and fluctuations of the ion distribution. We now apply the TBI model to analyze the ion dependence of the thermodynamic stability for DNA triplexes. We focus on two experimentally studied systems: a 24-base DNA triplex and a pair of interacting 14-base triplexes. Our theoretical calculations for the number of bound ions indicate that the TBI model provides improved predictions for the number of bound ions than the classical Poisson-Boltzmann (PB) equation. The improvement is more significant for a triplex, which has a higher charge density than a duplex. This is possibly due to the higher ion concentration around the triplex and hence a stronger ion correlation effect for a triplex. In addition, our analysis for the free energy landscape for a pair of 14-mer triplexes immersed in an ionic solution shows that divalent ions could induce an attractive force between the triplexes. Furthermore, we investigate how the protonated cytosines in the triplexes affect the stability of the triplex helices.

  9. Quantitative analysis of the ion-dependent folding stability of DNA triplexes

    NASA Astrophysics Data System (ADS)

    Chen, Gengsheng; Chen, Shi-Jie

    2011-12-01

    A DNA triplex is formed through binding of a third strand to the major groove of a duplex. Due to the high charge density of a DNA triplex, metal ions are critical for its stability. We recently developed the tightly bound ion (TBI) model for ion-nucleic acids interactions. The model accounts for the potential correlation and fluctuations of the ion distribution. We now apply the TBI model to analyze the ion dependence of the thermodynamic stability for DNA triplexes. We focus on two experimentally studied systems: a 24-base DNA triplex and a pair of interacting 14-base triplexes. Our theoretical calculations for the number of bound ions indicate that the TBI model provides improved predictions for the number of bound ions than the classical Poisson-Boltzmann (PB) equation. The improvement is more significant for a triplex, which has a higher charge density than a duplex. This is possibly due to the higher ion concentration around the triplex and hence a stronger ion correlation effect for a triplex. In addition, our analysis for the free energy landscape for a pair of 14-mer triplexes immersed in an ionic solution shows that divalent ions could induce an attractive force between the triplexes. Furthermore, we investigate how the protonated cytosines in the triplexes affect the stability of the triplex helices.

  10. Zn2+ selectively stabilizes FdU-substituted DNA through a unique major groove binding motif.

    PubMed

    Ghosh, Supratim; Salsbury, Freddie R; Horita, David A; Gmeiner, William H

    2011-05-01

    We report, based on semi-empirical calculations, that Zn(2+) binds duplex DNA containing consecutive FdU-dA base pairs in the major groove with distorted trigonal bipyramidal geometry. In this previously uncharacterized binding motif, O4 and F5 on consecutive FdU are axial ligands while three water molecules complete the coordination sphere. NMR spectroscopy confirmed Zn(2+) complexation occurred with maintenance of base pairing while a slight hypsochromic shift in circular dichroism (CD) spectra indicated moderate structural distortion relative to B-form DNA. Zn(2+) complexation inhibited ethidium bromide (EtBr) intercalation and stabilized FdU-substituted duplex DNA (ΔT(m) > 15 °C). Mg(2+) neither inhibited EtBr complexation nor had as strong of a stabilizing effect. DNA sequences that did not contain consecutive FdU were not stabilized by Zn(2+). A lipofectamine preparation of the Zn(2+)-DNA complex displayed enhanced cytotoxicity toward prostate cancer cells relative to the individual components prepared as lipofectamine complexes indicating the potential utility of Zn(2+)-DNA complexes for cancer treatment.

  11. Thermodynamic and kinetic analysis of an RNA kissing interaction and its resolution into an extended duplex.

    PubMed

    Salim, Nilshad; Lamichhane, Rajan; Zhao, Rui; Banerjee, Tuhina; Philip, Jane; Rueda, David; Feig, Andrew L

    2012-03-07

    Kissing hairpin interactions form when the loop residues of two hairpins have Watson-Crick complementarity. In a unimolecular context, kissing interactions are important for tertiary folding and pseudoknot formation, whereas in a bimolecular context, they provide a basis for molecular recognition. In some cases, kissing complexes can be a prelude to strand displacement reactions where the two hairpins resolve to form a stable extended intermolecular duplex. The kinetics and thermodynamics of kissing-complex formation and their subsequent strand-displacement reactions are poorly understood. Here, biophysical techniques including isothermal titration calorimetry, surface plasmon resonance, and single-molecule fluorescence have been employed to probe the factors that govern the stability of kissing complexes and their subsequent structural rearrangements. We show that the general understanding of RNA duplex formation can be extended to kissing complexes but that kissing complexes display an unusual level of stability relative to simple duplexes of the same sequence. These interactions form and break many times at room temperature before becoming committed to a slow, irreversible forward transition to the strand-displaced form. Furthermore, using smFRET we show that the primary difference between stable and labile kissing complexes is based almost completely on their off rates. Both stable and labile complexes form at the same rate within error, but less stable species dissociate rapidly, allowing us to understand how these complexes can help generate specificity along a folding pathway or during a gene regulation event. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  12. Thermodynamic and Kinetic Analysis of an RNA Kissing Interaction and Its Resolution into an Extended Duplex

    PubMed Central

    Salim, Nilshad; Lamichhane, Rajan; Zhao, Rui; Banerjee, Tuhina; Philip, Jane; Rueda, David; Feig, Andrew L.

    2012-01-01

    Kissing hairpin interactions form when the loop residues of two hairpins have Watson-Crick complementarity. In a unimolecular context, kissing interactions are important for tertiary folding and pseudoknot formation, whereas in a bimolecular context, they provide a basis for molecular recognition. In some cases, kissing complexes can be a prelude to strand displacement reactions where the two hairpins resolve to form a stable extended intermolecular duplex. The kinetics and thermodynamics of kissing-complex formation and their subsequent strand-displacement reactions are poorly understood. Here, biophysical techniques including isothermal titration calorimetry, surface plasmon resonance, and single-molecule fluorescence have been employed to probe the factors that govern the stability of kissing complexes and their subsequent structural rearrangements. We show that the general understanding of RNA duplex formation can be extended to kissing complexes but that kissing complexes display an unusual level of stability relative to simple duplexes of the same sequence. These interactions form and break many times at room temperature before becoming committed to a slow, irreversible forward transition to the strand-displaced form. Furthermore, using smFRET we show that the primary difference between stable and labile kissing complexes is based almost completely on their off rates. Both stable and labile complexes form at the same rate within error, but less stable species dissociate rapidly, allowing us to understand how these complexes can help generate specificity along a folding pathway or during a gene regulation event. PMID:22404932

  13. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.

  14. Unprecedented dinuclear silver(I)-mediated base pair involving the DNA lesion 1,N(6)-ethenoadenine.

    PubMed

    Mandal, Soham; Hepp, Alexander; Müller, Jens

    2015-02-28

    The DNA lesion 1,N(6)-ethenoadenine (εA) has been investigated with respect to its metal-binding properties. A synthetic DNA duplex comprising an εA : εA mispair readily forms doubly silver(I)-mediated base pairs εA-Ag(I)2-εA, representing the first example for a dinuclear metal-mediated homo base pair of a purine derivative. It also constitutes the first example for a Hoogsteen-type metal-mediated homo base pair within a B-DNA duplex.

  15. Spectroscopic data for the G-quadruplex DNA to duplex DNA reaction.

    PubMed

    Mendoza, Oscar; Elezgaray, Juan; Mergny, Jean-Louis

    2015-12-01

    This article describes additional data related to a research article entitled "Kinetics of Quadruplex to Duplex Conversion" (Mendoza et al. 2015 [1]). We followed the opening reaction of a series of intramolecular G-quadruplex structures by the addition of their corresponding complementary strand. Fluorolabeled complementary strands allowed to monitor the reaction in real-time. An adapted kinetic model was then applied in order to obtain the kinetic parameters of this reaction. We present a series of kinetic traces providing raw data of the G4 opening reaction and the fitting model applied in every case. In addition CD spectra and UV melting data is also provided to confirm the stability of all the DNA structures considered (G-quadruplex and duplex DNA).

  16. Spectroscopic data for the G-quadruplex DNA to duplex DNA reaction

    PubMed Central

    Mendoza, Oscar; Elezgaray, Juan; Mergny, Jean-Louis

    2015-01-01

    This article describes additional data related to a research article entitled “Kinetics of Quadruplex to Duplex Conversion” (Mendoza et al. 2015 [1]). We followed the opening reaction of a series of intramolecular G-quadruplex structures by the addition of their corresponding complementary strand. Fluorolabeled complementary strands allowed to monitor the reaction in real-time. An adapted kinetic model was then applied in order to obtain the kinetic parameters of this reaction. We present a series of kinetic traces providing raw data of the G4 opening reaction and the fitting model applied in every case. In addition CD spectra and UV melting data is also provided to confirm the stability of all the DNA structures considered (G-quadruplex and duplex DNA). PMID:26693518

  17. Pick a Pair. Pancake Pairs

    ERIC Educational Resources Information Center

    Miller, Pat

    2005-01-01

    Cold February weather and pancakes are a traditional pairing. Pancake Day began as a way to eat up the foods that were abstained from in Lent--traditionally meat, fat, eggs and dairy products. The best-known pancake event is The Pancake Day Race in Buckinghamshire, England, which has been run since 1445. This column describes pairs of books that…

  18. Pick a Pair. Pancake Pairs

    ERIC Educational Resources Information Center

    Miller, Pat

    2005-01-01

    Cold February weather and pancakes are a traditional pairing. Pancake Day began as a way to eat up the foods that were abstained from in Lent--traditionally meat, fat, eggs and dairy products. The best-known pancake event is The Pancake Day Race in Buckinghamshire, England, which has been run since 1445. This column describes pairs of books that…

  19. Full Duplex, Spread Spectrum Radio System

    NASA Technical Reports Server (NTRS)

    Harvey, Bruce A.

    2000-01-01

    The goal of this project was to support the development of a full duplex, spread spectrum voice communications system. The assembly and testing of a prototype system consisting of a Harris PRISM spread spectrum radio, a TMS320C54x signal processing development board and a Zilog Z80180 microprocessor was underway at the start of this project. The efforts under this project were the development of multiple access schemes, analysis of full duplex voice feedback delays, and the development and analysis of forward error correction (FEC) algorithms. The multiple access analysis involved the selection between code division multiple access (CDMA), frequency division multiple access (FDMA) and time division multiple access (TDMA). Full duplex voice feedback analysis involved the analysis of packet size and delays associated with full loop voice feedback for confirmation of radio system performance. FEC analysis included studies of the performance under the expected burst error scenario with the relatively short packet lengths, and analysis of implementation in the TMS320C54x digital signal processor. When the capabilities and the limitations of the components used were considered, the multiple access scheme chosen was a combination TDMA/FDMA scheme that will provide up to eight users on each of three separate frequencies. Packets to and from each user will consist of 16 samples at a rate of 8,000 samples per second for a total of 2 ms of voice information. The resulting voice feedback delay will therefore be 4 - 6 ms. The most practical FEC algorithm for implementation was a convolutional code with a Viterbi decoder. Interleaving of the bits of each packet will be required to offset the effects of burst errors.

  20. Real-time fluorescence assays to monitor duplex unwinding and ATPase activities of helicases.

    PubMed

    Özeş, Ali R; Feoktistova, Kateryna; Avanzino, Brian C; Baldwin, Enoch P; Fraser, Christopher S

    2014-07-01

    Many physiological functions of helicases are dependent on their ability to unwind nucleic acid duplexes in an ATP-dependent fashion. Determining the kinetic frameworks of these processes is crucial to understanding how these proteins function. We recently developed a fluorescence assay to monitor RNA duplex unwinding by DEAD-box helicases in real time. In this assay, two fluorescently modified short reporter oligonucleotides are annealed to an unmodified RNA loading strand of any length so that the fluorescent moieties of the two reporters find themselves in close proximity to each other and fluorescence is quenched. One reporter is modified with cyanine 3 (Cy3), whereas the other is modified with a spectrally paired black-hole quencher (BHQ). As the helicase unwinds the loading strand, the enzyme displaces the Cy3-modified reporter, which will bind to a capture or competitor DNA strand, permanently separating it from the BHQ-modified reporter. Complete separation of the Cy3-modified reporter strand is thus detected as an increase in total fluorescence. This assay is compatible with reagentless biosensors to monitor ATPase activity so that the coupling between ATP hydrolysis and duplex unwinding can be determined. With the protocol described, obtaining data and analyzing results of unwinding and ATPase assays takes ∼4 h.

  1. Duplex unwinding with DEAD-box proteins.

    PubMed

    Jankowsky, Eckhard; Putnam, Andrea

    2010-01-01

    DEAD-box proteins, which comprise the largest helicase family, are involved in virtually all aspects of RNA metabolism. DEAD-box proteins catalyze diverse ATP-driven functions including the unwinding of RNA secondary structures. In contrast to many well-studied DNA and viral RNA helicases, DEAD-box proteins do not rely on translocation on one of the nucleic acid strands for duplex unwinding, but directly load onto helical regions and then locally pry the strands apart in an ATP-dependent fashion. In this chapter, we outline substrate design and unwinding protocols for DEAD-box proteins and focus on the quantitative evaluation of their unwinding activity.

  2. Sigmatization of duplex forgings: A case history

    SciTech Connect

    Crolet, J.L.; Corbineau, S.; Perrollet, C.P.

    1997-08-01

    An S31803 (22-05 alloy) duplex stainless steel flow-cross in service fin the H{sub 2}S-containing Saint-Faust gas field near Lacq was almost broken in two by a corrosion crack resulting from improper heat treatment. Sensitization had occurred much more rapidly than expected from the kinetics of sigma phase formation generally considered in the literature. None of the inspection techniques routinely employed in the oil and gas industry would have been capable of detecting this manufacturing defect. More stringent quality acceptance criteria are therefore necessary.

  3. A Density Functional Theory Examination of the Local Conformational Energetics of Normal and Epigenetically Modified Duplex DNA

    NASA Astrophysics Data System (ADS)

    Yusufaly, Tahir; Olson, Wilma

    2013-03-01

    We report density functional theory calculations of various local regions of duplex DNA, including hydrogen bonded base pairs, stacked nearest-neighbor bases, and sugar-phosphate backbones. Special attention is given to the methylation of 5-cytosine, an epigenetic modification believed to play a key role in eukaryotic gene regulation. Energetically stable molecular conformations are identified and their elastic properties analyzed. Our results are compared with previous ab initio studies and high-resolution crystalline structural data.

  4. 52. Photocopy of copy of original Officers' Duplex Quarters drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    52. Photocopy of copy of original Officers' Duplex Quarters drawing by Copeland, 7 April 1932 (Original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Heating - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  5. Criteria for the Segmentation of Vowels on Duplex Oscillograms.

    ERIC Educational Resources Information Center

    Naeser, Margaret A.

    This paper develops criteria for the segmentation of vowels on duplex oscillograms. Previous vowel duration studies have primarily used sound spectrograms. The use of duplex oscillograms, rather than sound spectrograms, permits faster production (real time) at less expense (adding machine paper may be used). The speech signal can be more spread…

  6. MAIN VIEW OF DUPLEX FROM THE NORTH SIDE OF THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MAIN VIEW OF DUPLEX FROM THE NORTH SIDE OF THE STREET SHOWING DUAL DRIVEWAYS WITH CENTRAL PLANTING STRIP - Camp H.M. Smith and Navy Public Works Center Manana Title VII (Capehart) Housing, M-Shaped Four-Bedroom Duplex Type 5, Birch Circle, Cedar Drive, Pearl City, Honolulu County, HI

  7. 53. Photocopy of copy of original Officers' Duplex Quarters drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. Photocopy of copy of original Officers' Duplex Quarters drawing by A.G.D., 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Electrical - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  8. Methods And Devices For Characterizing Duplex Nucleic Acid Molecules

    DOEpatents

    Akeson, Mark; Vercoutere, Wenonah; Haussler, David; Winters-Hilt, Stephen

    2005-08-30

    Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.

  9. Solution structure, mechanism of replication, and optimization of an unnatural base pair.

    PubMed

    Malyshev, Denis A; Pfaff, Danielle A; Ippoliti, Shannon I; Hwang, Gil Tae; Dwyer, Tammy J; Romesberg, Floyd E

    2010-11-08

    As part of an ongoing effort to expand the genetic alphabet for in vitro and eventual in vivo applications, we have synthesized a wide variety of predominantly hydrophobic unnatural base pairs and evaluated their replication in DNA. Collectively, the results have led us to propose that these base pairs, which lack stabilizing edge-on interactions, are replicated by means of a unique intercalative mechanism. Here, we report the synthesis and characterization of three novel derivatives of the nucleotide analogue dMMO2, which forms an unnatural base pair with the nucleotide analogue d5SICS. Replacing the para-methyl substituent of dMMO2 with an annulated furan ring (yielding dFMO) has a dramatically negative effect on replication, while replacing it with a methoxy (dDMO) or with a thiomethyl group (dTMO) improves replication in both steady-state assays and during PCR amplification. Thus, dTMO-d5SICS, and especially dDMO-d5SICS, represent significant progress toward the expansion of the genetic alphabet. To elucidate the structure-activity relationships governing unnatural base pair replication, we determined the solution structure of duplex DNA containing the parental dMMO2-d5SICS pair, and also used this structure to generate models of the derivative base pairs. The results strongly support the intercalative mechanism of replication, reveal a surprisingly high level of specificity that may be achieved by optimizing packing interactions, and should prove invaluable for the further optimization of the unnatural base pair.

  10. Infrared Multiphoton Dissociation of Duplex DNA/Drug Complexes in a Quadrupole Ion Trap

    PubMed Central

    Wilson, Jeffrey J.; Brodbelt, Jennifer S.

    2008-01-01

    Non-covalent duplex DNA/drug complexes formed between one of three 14-base pair non-self complementary duplexes with variable GC content and one of eight different DNA-interactive drugs are characterized by infrared multiphoton dissociation (IRMPD), and the resulting spectra are compared to conventional collisional activated dissociation (CAD) mass spectra in a quadrupole ion trap mass spectrometer. IRMPD yielded comparable information to previously reported CAD results in which strand separation pathways dominate for complexes containing the more AT-rich sequences and/or minor groove binding drugs, whereas drug ejection pathways are prominent for complexes containing intercalating drugs and/or duplexes with higher GC base content. The large photoabsorptive cross-section of the phosphate backbone at 10.6 μm promotes highly efficient dissociation within short irradiation times (< 2 ms at 50 W) or using lower laser powers and longer irradiation times (< 15 W at 15 ms), activation times on par with or shorter than standard CAD experiments. This large photoabsorptivity leads to a controllable ion activation method which can be used to produce qualitatively similar spectra to CAD while minimizing uninformative base loss dissociation pathways or instead be tuned to yield a high degree of secondary fragmentation. Additionally, the low mass cut-off associated with conventional CAD plays no role in IRMPD, resulting in richer MS/MS information in the low m/z region. IRMPD is also used for multi-adduct dissociation in order to increase MS/MS sensitivity, and a two stage IRMPD/IRMPD method is demonstrated as a means to give specific DNA sequence information that would be useful when screening drug binding by mixtures of duplexes. PMID:17249688

  11. Eddy Current Assessment of Duplex Metallic Coatings

    NASA Astrophysics Data System (ADS)

    Krzywosz, K. J.

    2004-02-01

    EPRI is involved in a multi-year program with the Department of Energy to test, evaluate, and develop a field-deployable eddy current NDE system for life assessment of blade coatings for advanced gas turbines. The coatings evaluated from these advanced GE engines include CoCrAlY (GT 29) and NiCoCrAlY (GT 33) bond coats followed by top aluminide overlay coatings. These duplex metallic coatings commonly referred to as GT 29+ and GT 33+ coatings, respectively. In general, during cycling and continuous operation at higher operating temperature, coatings fail due to spallation of protective oxide layers, leading to consumption of protective coating by oxidation and to eventual failure of blades. To extend service life of these critical rotating components, an inspection-based condition assessment program has been initiated to help establish more optimum inspection intervals that are not dependent on time-in-service maintenance approach. This paper summarizes the latest results obtained to date using the state-of-the-art frequency-scanning eddy current tester with a built-in three-layer inversion analysis algorithm. Significant progress has been made in assessing and discriminating the duplex metallic coatings as normal, degraded, and/or cracked. In addition, quantitative assessment was conducted by estimating various coating and substrate conductivity values.

  12. Nickel-free duplex stainless steels

    SciTech Connect

    Wang, J.; Uggowitzer, P.J.; Magdowski, R.; Speidel, M.O.

    1998-12-04

    It is well known that nitrogen-alloying in steel produces a variety of exceptional properties such as high strength, high ductility and, eventually, resistance to stress corrosion cracking. High-nitrogen steels (HNS), therefore, have recently been developed to enhance the strength and corrosion resistance of stainless steels. However, due to a low solubility of nitrogen in a liquid steel under atmospheric pressure, the production of such high-nitrogen alloys needs high-pressure facilities that cause an extra cost. A possible route of developing high-nitrogen alloys under atmospheric pressure is to choose a duplex microstructure, where the amount of austenite and ferrite phase is nearly equal. A much lower nitrogen content is needed to maintain a 50% austenite phase compared with the necessary addition of nitrogen to reach a 100% austenitic microstructure. In addition, duplex stainless steels (DSS) with 40--60% ferrite can significantly improve the SCC-resistance. The objective of this work was to develop a new group of nickel-free, high strength and corrosion resistant DSS. Nickel was completely replaced by nitrogen in order to enhance SCC resistance and reduce the alloying element cost. The microstructure, mechanical properties, corrosion resistance and cost analysis of new alloys are investigated in comparison with some commercial stainless steels.

  13. Helix-Dependent Spin Filtering through the DNA Duplex.

    PubMed

    Zwang, Theodore J; Hürlimann, Sylvia; Hill, Michael G; Barton, Jacqueline K

    2016-12-07

    Recent work suggests that electrons can travel through DNA and other chiral molecules in a spin-selective manner, but little is known about the origin of this spin selectivity. Here we describe experiments on magnetized DNA-modified electrodes to explore spin-selective electron transport through hydrated duplex DNA. Our results show that the two spins migrate through duplex DNA with a different yield and that spin selectivity requires charge transport through the DNA duplex. Significantly, shifting the same duplex DNA between right-handed B- and left-handed Z-forms leads to a diode-like switch in spin selectivity; which spin moves more efficiently through the duplex depends upon the DNA helicity. With DNA, the supramolecular organization of chiral moieties, rather than the chirality of the individual monomers, determines the selectivity in spin, and thus a conformational change can switch the spin selectivity.

  14. Binding of actinomycin C1 (D) and actinomin to base-modified oligonucleotide duplexes with parallel chain orientation.

    PubMed

    Li, Hong; Peng, Xiaohua; Leonard, Peter; Seela, Frank

    2006-06-15

    The binding of actinomycin D (C1, 1) and its analog actinomin (2) was studied on base-modified oligonucleotide duplexes with parallel chain orientation (ps) and with anti-parallel chains (aps) for comparison. Actinomycin D binds not only to aps duplexes containing guanine-cytosine base pairs but also to those incorporating modified bases such as 7-deazaguanine or its 6-deoxo derivative. For this, novel phosphoramidites were prepared. The new building block of 7-deaza-2'-deoxyguanosine is significantly more stable than the one currently used and allows normal oxidation conditions during solid-phase oligonucleotide synthesis. Actinomycin binds weakly to ps duplexes containing guanine-isocytosine base pairs but not to ps-DNA incorporating pairs of isoguanine-cytosine residues. On the contrary, the actinomycin D analog actinomin, which contains positively charged side chains instead of the chiral peptide rings, is strongly bound to both ps- and aps-DNA. Guanines, isoguanine, as well as other 7-deaza derivatives are accepted as nucleobases. Apparently, the pentapeptide lacton rings of actinomycin do not fit nicely into the groove of ps-DNA thereby reducing the binding strength of the antibiotic while the groove size of ps-DNA does not affect actinomin binding notably.

  15. Effect of Duplex Aging on the Initiation and Propagation of Fatigue Cracks in the Solute-rich Metastable β Titanium Alloy Ti 38-644

    NASA Astrophysics Data System (ADS)

    Schmidt, P.; El-Chaikh, A.; Christ, H.-J.

    2011-09-01

    Aging of highly β-stabilized titanium alloys commonly leads to the formation of precipitate-free zones being susceptible to fatigue crack initiation. Duplex aging improves the fatigue properties of metastable β titanium alloys by enhancing a homogeneous α phase formation. In this study a duplex-aging cycle was designed for Ti 38-644 ( β-C). Depending on the prior processing history heat treatment parameters were adapted on the basis of microstructure studies, hardness measurements and comparative tensile tests. The fatigue limit and fatigue crack growth threshold were determined for duplex-aged β-C. The results indicate that duplex aging promotes a homogeneously precipitated α phase providing excellent values of the fatigue limit. Surface-related fatigue crack initiation was observed. Comparing the fracture surfaces of direct- and duplex-aged β-C a transition of the tensile fracture mode from intergranular to predominantly transgranular was observed accompanied by a gain in ductility at comparable yield strengths. This was assumed to be the reason for the slightly improved fatigue crack growth behavior of duplex-aged as compared to direct-aged β-C. Along the entire heat treatment cycle the microstructure response was evaluated with regard to the particular effects on the fatigue properties. The results indicate clearly that key to success is a completely recrystallized β microstructure and the reasonably controlled aging response.

  16. Identification of a pKa-regulating motif stabilizing imidazole-modified double-stranded DNA

    PubMed Central

    Buyst, Dieter; Gheerardijn, Vicky; Fehér, Krisztina; Van Gasse, Bjorn; Van Den Begin, Jos; Martins, José C.; Madder, Annemieke

    2015-01-01

    The predictable 3D structure of double-stranded DNA renders it ideally suited as a template for the bottom-up design of functionalized nucleic acid-based active sites. We here explore the use of a 14mer DNA duplex as a scaffold for the precise and predictable positioning of catalytic functionalities. Given the ubiquitous participation of the histidine-based imidazole group in protein recognition and catalysis events, single histidine-like modified duplexes were investigated. Tethering histamine to the C5 of the thymine base via an amide bond, allows the flexible positioning of the imidazole function in the major groove. The mutual interactions between the imidazole and the duplex and its influence on the imidazolium pKaH are investigated by placing a single modified thymine at four different positions in the center of the 14mer double helix. Using NMR and unrestrained molecular dynamics, a structural motif involving the formation of a hydrogen bond between the imidazole and the Hoogsteen side of the guanine bases of two neighboring GC base pairs is established. The motif contributes to a stabilization against thermal melting of 6°C and is key in modulating the pKaH of the imidazolium group. The general features, prerequisites and generic character of the new pKaH-regulating motif are described. PMID:25520197

  17. A Structural Transition in Duplex DNA Induced by Ethylene Glycol

    PubMed Central

    Brewood, Greg P.; Aliwarga, Theresa; Schurr, J. Michael

    2010-01-01

    The twist energy parameter (ET) that governs the supercoiling free energy, and the linking difference (Δl) are measured for p30 δ DNA in solutions containing 0 to 40 w/v% ethylene glycol (EG). A plot of ET vs. −ln aw, where aw is the water activity, displays the full (reverse) sigmoidal profile of a discrete structural transition. A general theory for the effect of added osmolyte on a cooperative structural transition between two duplex states, 1□ 2, is formulated in terms of parameters applicable to individual base-pairs subunits. The resulting fraction of base-pairs in the 2-state ( f20), is incorporated into expressions for the effective torsion and bending elastic constants, the effective twist energy parameter ( ETeff), and the change in intrinsic twist (δl0). Fitting the expression for ETeff to the measured ET -values yields reasonably unambiguous estimates of ET1and ET2, the midpoint value (ln aw)1/2, and midpoint slope (∂ET/∂ln aw)1/2, but does not yield unambiguous estimates of the equilibrium constant ( K0), the difference in DNA-water preferential interaction coefficient (ΔΓ), or the inverse cooperativity parameter, J. Fitting a non-cooperative model (assumed J=1.0) to the data yields, K0 = 0.067, and ΔΓ = − 30.0 per base-pair (bp). Essentially equivalent fits are provided by models with a wide range of correlated J, ΔΓ, and K0 values. Other results favor ΔΓ in the range − 1.0 to 0, which then requires K0 ≥ 0.914, and a cooperativity parameter, 1/J ≥ 30.0 bp. The measured δl0 and circular dichroism (CD) at 272 nm are found to be compatible with curves predicted using the same f20-values that best-fit the ET -data. At least 7 to 10 % of the base-pairs are inferred to exist in the 2-state in 0.1 M NaCl in the complete absence of added osmolyte. Compared with the 1-state, the 2-state has a ~2.0- to 2.1-fold greater torsion elastic constant, a ~0.70-fold smaller bending elastic constant, a ~0.91-fold smaller ET -value, a ~0

  18. A nanoscale duplex precipitation approach for improving the properties of Fe-base alloys

    SciTech Connect

    Zhang, Zhongwu; Liu, C T; Wang, Xun-Li; Wen, Y. R.; Fujita, T.; Hirata, A.; Chen, M.W.; Miller, Michael K; Chen, Guang; Chin, Bryan

    2013-01-01

    The precipitate size and number density are important factors for tailoring the mechanical behaviors of nanoscale precipitate-hardened alloys. However during thermal aging, the precipitate size and number density change leading to either poor strength or high strength but significantly reduced ductility. Here we demonstrate, by producing nanoprecipitates with unusual duplex structures in a composition-optimized multicomponent precipitation-hardened alloy, a unique approach to improve the stability of the alloy against the effects of thermal aging and consequently change in the mechanical properties. Our study provides compelling experimental evidence that these nanoscale precipitates consist of a duplex structures with a Cu-enriched bcc core that is partially encased by a B2-ordered Ni(Mn,Al) phase. This duplex structure enables the precipitate size and number density to be independently optimized, provides a more complex obstacle for dislocation movement due to the ordering and an additional interphase interface, and yields a high yield strength alloy without sacrificing the ductility.

  19. Hybrid recursive active filters for duplexing in RF transmitter front-ends

    NASA Astrophysics Data System (ADS)

    Gottardo, Giuseppe; Donati, Giovanni; Musolff, Christian; Fischer, Georg; Felgentreff, Tilman

    2016-08-01

    Duplex filters in modern base transceiver stations shape the channel in order to perform common frequency division duplex operations. Usually, they are designed as cavity filters, which are expensive and have large dimensions. Thanks to the emerging digital technology and fast digital converters, it is possible to transfer the efforts of designing analog duplex filters into digital numeric algorithms applied to feedback structures, operating on power. This solution provides the shaping of the signal spectrum directly at the output of the radio frequency (RF) power amplifiers (PAs) relaxing the transmitter design especially in the duplexer and in the antenna sections. The design of a digital baseband feedback applied to the analog power RF amplifiers (hybrid filter) is presented and verified by measurements. A model to describe the hybrid system is investigated, and the relation between phase and resonance peaks of the resulting periodic band-pass transfer function is described. The stability condition of the system is analyzed using Nyquist criterion. A solution involving a number of digital feedback and forward branches is investigated defining the parameters of the recursive structure. This solution allows the closed loop system to show a periodic band pass with up to 500 kHz bandwidth at the output of the RF amplifier. The band-pass magnitude reaches up to 17 dB selectivity. The rejection of the PA noise in the out-of-band frequencies is verified by measurements. The filter is tested with a modulated LTE (Long Term Evolution) signal showing an ACPR (Adjacent Channel Power Ratio) enhancement of 10 dB of the transmitted signal.

  20. Sequence-dependent dynamics of duplex DNA: the applicability of a dinucleotide model.

    PubMed Central

    Okonogi, T M; Alley, S C; Reese, A W; Hopkins, P B; Robinson, B H

    2002-01-01

    The short-time (submicrosecond) bending dynamics of duplex DNA were measured to determine the effect of sequence on dynamics. All measurements were obtained from a single site on duplex DNA, using a single, site-specific modified base containing a rigidly tethered, electron paramagnetic resonance active spin probe. The observed dynamics are interpreted in terms of single-step sequence-dependent bending force constants, determined from the mean squared amplitude of bending relative to the end-to-end vector using the modified weakly bending rod model. The bending dynamics at a single site are a function of the sequence of the nucleotides constituting the duplex DNA. We developed and examined several dinucleotide-based models for flexibility. The models indicate that the dominant feature of the dynamics is best explained in terms of purine- and pyrimidine-type steps, although distinction is made among all 10 unique steps: It was found that purine-purine steps (which are the same as pyrimidine-pyrimidine steps) were near average in flexibility, but the pyrimidine-purine steps (5' to 3') were nearly twice as flexible, whereas purine-pyrimidine steps were more than half as flexible as average DNA. Therefore, the range of stepwise flexibility is approximately fourfold and is characterized by both the type of base pair step (pyrimidine/purine combination) and the identity of the bases within the pair (G, A, T, or C). All of the four models considered here underscore the complexity of the dependence of dynamics on DNA sequence with certain sequences not satisfactorily explainable in terms of any dinucleotide model. These findings provide a quantitative basis for interpreting the dynamics and kinetics of DNA-sequence-dependent biological processes, including protein recognition and chromatin packaging. PMID:12496111

  1. Reliability analysis of a repairable duplex system

    NASA Astrophysics Data System (ADS)

    Vanderperre, E. J.; Makhanov, S. S.

    2014-09-01

    We analyse the survival time of a repairable duplex system characterised by cold standby and by a pre-emptive priority rule. We allow general probability distributions for failure and repair. Moreover, an important realistic feature of the system is the general assumption that the non-priority unit has a memory. This combination of features has not been analysed in the previous literature. Our (new) methodology is based on a concatenation of a Cauchy-type integral representation of the modified Heaviside unit-step function and a two-sided stochastic inequality. Finally, we introduce a security interval related to a security level and a suitable risk-criterion based on the survival function of the system. As a practical application, we analyse some particular cases of the survival function jointly with the security interval corresponding to a security level of 90.

  2. Lubrication for high load duplex bearings

    SciTech Connect

    Steinhoff, R.G.

    1997-08-01

    Three ES and H-compatible lubricants (Environment, Safety and Health) for high load duplex bearing applications were evaluated and compared against trichlorotrifluoroethane (Freon) deposition of low molecular weight polytetrafluoroethylene (PTFE) bearing lubricant extracted from Vydax{trademark}. Vydax is a product manufactured by DuPont consisting of various molecular weights of PTFE suspended in trichlorotrifluoroethane (Freon) which is an ozone-depleting solvent. Bearings with Supercritical CO{sub 2} deposition of PTFE extracted from Vydax AR/IPA, bearings with titanium carbide coated balls, and bearings with diamond-like carbon races and retainers were evaluated. Bearings with Supercritical CO{sub 2} deposition of PTFE from Vydax AR/IPA performed as well as bearings with Freon deposition of PTFE from Freon-based Vydax.

  3. Altering the electrostatic potential in the major groove: thermodynamic and structural characterization of 7-deaza-2'-deoxyadenosine:dT base pairing in DNA.

    PubMed

    Kowal, Ewa A; Ganguly, Manjori; Pallan, Pradeep S; Marky, Luis A; Gold, Barry; Egli, Martin; Stone, Michael P

    2011-12-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg(2+). The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. © 2011 American Chemical Society

  4. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2′-deoxyadenosine:dT Base Pairing in DNA

    PubMed Central

    2011-01-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929

  5. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

    SciTech Connect

    Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

    2012-02-15

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.

  6. Duplex scanning on admission prevents unnecessary carotid endarterectomies.

    PubMed

    Dalainas, I; Nano, G; Casana, R; Bianchi, P; Stegher, S; Malacrida, G; Tealdi, D G

    2006-06-01

    This retrospective single Institution study, aims to evaluate the performance of duplex scanning on admission of patients with carotid artery disease to avoid unnecessary carotid endarterectomies. From 1 January 1997 until 31 Decem-ber 2004, 1 504 patients were admitted to our Institution to undergo carotid endarterectomy. A duplex scan on admission was performed in all of them. A total of 1 369 from these patients (91%) underwent surgery, while 135 (9%) were dismissed because there was no indication for surgical treatment. They were put in conservative treatment and periodic duplex control appointments. In 9% of the patients, unnecessary carotid endarterectomy was avoided.

  7. Force measurements reveal how small binders perturb the dissociation mechanisms of DNA duplex sequences

    NASA Astrophysics Data System (ADS)

    Burmistrova, Anastasia; Fresch, Barbara; Sluysmans, Damien; de Pauw, Edwin; Remacle, Françoise; Duwez, Anne-Sophie

    2016-06-01

    The force-driven separation of double-stranded DNA is crucial to the accomplishment of cellular processes like genome transactions. Ligands binding to short DNA sequences can have a local stabilizing or destabilizing effect and thus severely affect these processes. Although the design of ligands that bind to specific sequences is a field of intense research with promising biomedical applications, so far, their effect on the force-induced strand separation has remained elusive. Here, by means of AFM-based single molecule force spectroscopy, we show the co-existence of two different mechanisms for the separation of a short DNA duplex and demonstrate how they are perturbed by small binders. With the support of Molecular Dynamics simulations, we evidence that above a critical pulling rate one of the dissociation pathways becomes dominant, with a dramatic effect on the rupture forces. Around the critical threshold, we observe a drop of the most probable rupture forces for ligand-stabilized duplexes. Our results offer a deep understanding of how a stable DNA-ligand complex behaves under force-driven strand separation.The force-driven separation of double-stranded DNA is crucial to the accomplishment of cellular processes like genome transactions. Ligands binding to short DNA sequences can have a local stabilizing or destabilizing effect and thus severely affect these processes. Although the design of ligands that bind to specific sequences is a field of intense research with promising biomedical applications, so far, their effect on the force-induced strand separation has remained elusive. Here, by means of AFM-based single molecule force spectroscopy, we show the co-existence of two different mechanisms for the separation of a short DNA duplex and demonstrate how they are perturbed by small binders. With the support of Molecular Dynamics simulations, we evidence that above a critical pulling rate one of the dissociation pathways becomes dominant, with a dramatic effect

  8. The Formation of Martensitic Austenite During Nitridation of Martensitic and Duplex Stainless Steels

    NASA Astrophysics Data System (ADS)

    Zangiabadi, Amirali; Dalton, John C.; Wang, Danqi; Ernst, Frank; Heuer, Arthur H.

    2017-01-01

    Isothermal martensite/ferrite-to-austenite phase transformations have been observed after low-temperature nitridation in the martensite and δ-ferrite phases in 15-5 PH (precipitation hardening), 17-7 PH, and 2205 (duplex) stainless steels. These transformations, in the region with nitrogen concentrations of 8 to 16 at. pct, are consistent with the notion that nitrogen is a strong austenite stabilizer and substitutional diffusion is effectively frozen at the paraequilibrium temperatures of our experiments. Our microstructural and diffraction analyses provide conclusive evidence for the martensitic nature of these phase transformations.

  9. NMR studies of abasic sites in DNA duplexes: deoxyadenosine stacks into the helix opposite the cyclic analog of 2-deoxyribose

    SciTech Connect

    Kalnik, M.W.; Chang, C.N.; Grollman, A.P.; Patel, D.J.

    1988-02-09

    Proton and phosphorus NMR studies are reported for the complementary d(C-A-T-G-A-G-T-A-C) x d(G-T-A-C-F-C-A-T-G) nonanucleotide duplex (designated AP/sub F/ 9-mer duplex) which contains a stable abasic site analog, F, in the center of the helix. This oligodeoxynucleotide contains a modified tetrahydrofuran moiety, isosteric with 2-deoxyribofuranose, which serves as a structural analog of a natural apurinic/apyrimidinic site. Exchangeable and nonexchangeable base and sugar protons, including those located at the abasic site, have been assigned in the complementary AP/sub F/ 9-mer duplex by recording and analyzing two-dimensional phase-sensitive NOESY data sets in H/sub 2/O and D/sub 2/O solution at low temperature (0/sup 0/C). These studies indicate that A5 inserts into the helix opposite the abasic site F14 and stacks with flanking G4 x C15 and G6 x C13 Watson-Crick base pairs. Base-sugar proton NOE connectivities were measured through G4-A5-G6 on the unmodified strand and between the base protons of C15 and the sugar protons of the 5'-flanking residue F14 on the modified strand. These studies establish that all glycosidic torsion angles are anti and that the helix is right-handed at and adjacent to the abasic site in the AP/sub F/ 9-mer duplex. Two of the 16 phosphodiester groups exhibit phosphorus resonances outside the normal spectral dispersion indicative of altered torsion angles at two of the phosphate groups in the backbone of the AP/sub F/ 9-mer duplex.

  10. π-π orbital resonance in twisting duplex DNA: Dynamical phyllotaxis and electronic structure effects

    NASA Astrophysics Data System (ADS)

    Maciá, Enrique

    2009-09-01

    The presence of synchronized, collective twist motions of the Watson-Crick base pairs in DNA duplexes (helicoidal standing waves) can efficiently enhance the π-π orbital overlapping between nonconsecutive base pairs via a long-range, phonon-correlated tunneling effect. The resulting structural patterns are described within the framework of dynamical phyllotaxis, providing a realistic treatment which takes into account both the intrinsic three-dimensional, helicoidal geometry of DNA, and the coupling between the electronic degrees of freedom and double-helix DNA molecular dynamics at low frequencies. The main features of the resulting electronic band structures are discussed for several resonance frequencies of interest, highlighting the possible biophysical implications of the obtained results.

  11. Pathway of ATP utilization and duplex rRNA unwinding by the DEAD-box helicase, DbpA.

    PubMed

    Henn, Arnon; Cao, Wenxiang; Licciardello, Nicholas; Heitkamp, Sara E; Hackney, David D; De La Cruz, Enrique M

    2010-03-02

    DEAD-box RNA helicase proteins use the energy of ATP hydrolysis to drive the unwinding of duplex RNA. However, the mechanism that couples ATP utilization to duplex RNA unwinding is unknown. We measured ATP utilization and duplex RNA unwinding by DbpA, a non-processive bacterial DEAD-box RNA helicase specifically activated by the peptidyl transferase center (PTC) of 23S rRNA. Consumption of a single ATP molecule is sufficient to unwind and displace an 8 base pair rRNA strand annealed to a 32 base pair PTC-RNA "mother strand" fragment. Strand displacement occurs after ATP binding and hydrolysis but before P(i) product release. P(i) release weakens binding to rRNA, thereby facilitating the release of the unwound rRNA mother strand and the recycling of DbpA for additional rounds of unwinding. This work explains how ATPase activity of DEAD-box helicases is linked to RNA unwinding.

  12. 1. VIEW OF STAFF HOUSE (FEATURE 10), FACING SOUTHWEST. DUPLEX ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. VIEW OF STAFF HOUSE (FEATURE 10), FACING SOUTHWEST. DUPLEX (FEATURE 7) IS VISIBLE IN THE BACKGROUND AT RIGHT. - Copper Canyon Camp of the International Smelting & Refining Company, Staff House, Copper Canyon, Battle Mountain, Lander County, NV

  13. 1. VIEW OF RESIDENCE (FEATURE 12), FACING SOUTHWEST. DUPLEX (FEATURE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. VIEW OF RESIDENCE (FEATURE 12), FACING SOUTHWEST. DUPLEX (FEATURE 9) IS VISIBLE IN THE BACKGROUND. - Copper Canyon Camp of the International Smelting & Refining Company, Residence, Copper Canyon, Battle Mountain, Lander County, NV

  14. 43. View of station from southwest side with duplex keepers' ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    43. View of station from southwest side with duplex keepers' dwelling to the left. USLHB photo by Herbert Bamber, June 9, 1893. - Bodie Island Light Station, Off Highway 12, Nags Head, Dare County, NC

  15. Thermoacoustic Duplex Technology for Cooling and Powering a Venus Lander

    NASA Astrophysics Data System (ADS)

    Walker, A. R.; Haberbusch, M. S.; Sasson, J.

    2015-04-01

    A Thermoacoustic Stirling Heat Engine (TASHE) is directly coupled to a Pulse Tube Refrigerator (PTR) in a duplex configuration, providing simultaneous cooling and electrical power, thereby suiting the needs of a long-lived Venus lander.

  16. Duplex ultrasound assessment of femorodistal grafts: correlation with angiography.

    PubMed

    McShane, M D; Gazzard, V M; Clifford, P C; Hacking, C N; Fairhurst, J J; Humphries, K N; Birch, S J; Webster, J H; Chant, A D

    1987-12-01

    Fifty-eight grafts have been assessed using duplex scanning and ankle brachial pressure indices. This assessment is compared with the findings by angiography. Eighteen grafts were occluded and 40 patent. Duplex scanning defined graft status with a greater accuracy than pressure indices. Pressure indices alone would not differentiate "satisfactory" grafts from those with localised, haemodynamically significant disease. Only 55% of those grafts with localised stenoses demonstrated a fall of greater than 0.2 in ankle brachial pressure index after exercise. When the information obtained using pressure indices and duplex scanning was combined non-invasive assessment had a sensitivity of 86% and specificity of 94% for detection of localised, haemodynamically significant disease in patent grafts. Haemodynamically significant disease, as defined by angiography, can be detected and localised with duplex scanning complementing the use of pressure indices in graft assessment.

  17. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    PubMed

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

  18. Comparative analysis of inosine-substituted duplex DNA by circular dichroism and X-ray crystallography.

    PubMed

    Peters, Justin P; Kowal, Ewa A; Pallan, Pradeep S; Egli, Martin; Maher, L James

    2017-09-04

    Leveraging structural biology tools, we report the results of experiments seeking to determine if the different mechanical properties of DNA polymers with base analog substitutions can be attributed, at least in part, to induced changes from classical B-form DNA. The underlying hypothesis is that different inherent bending and twisting flexibilities may characterize non-canonical B-DNA, so that it is inappropriate to interpret mechanical changes caused by base analog substitution as resulting simply from 'electrostatic' or 'base stacking' influences without considering the larger context of altered helical geometry. Circular dichroism spectra of inosine-substituted oligonucleotides and longer base-substituted DNAs in solution indicated non-canonical helical conformations, with the degree of deviation from a standard B-form geometry depending on the number of I⋅C pairs. X-ray diffraction of a highly inosine-substituted DNA decamer crystal (eight I⋅C and two A⋅T pairs) revealed an A-tract-like conformation with a uniformly narrow minor groove, reduced helical rise, and the majority of sugars adopting a C1'-exo (southeastern) conformation. This contrasts with the standard B-DNA geometry with C2'-endo sugar puckers (south conformation). In contrast, the crystal structure of a decamer with only four I⋅C pairs has a geometry similar to that of the reference duplex with eight G⋅C and two A⋅T pairs. The unique crystal geometry of the inosine-rich duplex is noteworthy given its unusual CD signature in solution and the altered mechanical properties of some inosine-containing DNAs.

  19. The Origins of Microtexture in Duplex Ti Alloys (Preprint)

    DTIC Science & Technology

    2008-06-01

    To) June 2008 Journal Article Preprint 4 . TITLE AND SUBTITLE THE ORIGINS OF MICROTEXTURE IN DUPLEX Ti ALLOYS (PREPRINT) 5a. CONTRACT NUMBER In...house 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 62102F 6 . AUTHOR(S) M.G. Glavic (UES, Inc.) B.B. Bartha (United Technologies Corporation...applicable to duplex alpha/beta titanium microstructures. The crystallographic coherency of the primary and secondary alpha phase with the prior beta

  20. Magnetic resonance urography in duplex kidney with ectopic ureteral insertion

    PubMed Central

    Thambidorai, Conjeevaram Rajendrarao; Anuar, Zulfiqar

    2011-01-01

    This is a report on the use of magnetic resonance urography (MRU) in a 6-year-old girl who presented with urinary incontinence. She had a left duplex kidney with poorly functioning upper moiety and ectopic insertion of the dilated upper pole ureter. MRU has been shown to be superior to conventional imaging techniques in delineating poorly functioning moieties of duplex kidneys and ectopic ureters. PMID:21897576

  1. A novel form of intercalation involving four DNA duplexes in an acridine-4-carboxamide complex of d(CGTACG)2

    PubMed Central

    Adams, Adrienne; Guss, J. Mitchell; Collyer, Charles A.; Denny, William A.; Wakelin, Laurence P. G.

    2000-01-01

    The structures of the complexes formed between 9-amino-[N-(2-dimethyl-amino)butyl]acridine-4-carboxamide and d(CG5BrUACG)2 and d(CGTACG)2 have been solved by X-ray crystallography using MAD phasing methodology and refined to a resolution of 1.6 Å. The complexes crystallised in space group C222. An asymmetric unit in the brominated complex comprises two strands of DNA, one disordered drug molecule, two cobalt (II) ions and 19 water molecules (31 in the native complex). Asymmetric units in the native complex also contain a sodium ion. The structures exhibit novel features not previously observed in crystals of DNA/drug complexes. The DNA helices stack in continuous columns with their central 4 bp adopting a B-like motif. However, despite being a palindromic sequence, the terminal GC base pairs engage in quite different interactions. At one end of the duplex there is a CpG dinucleotide overlap modified by ligand intercalation and terminal cytosine exchange between symmetry-related duplexes. A novel intercalation complex is formed involving four DNA duplexes, four ligand molecules and two pairs of base tetrads. The other end of the DNA is frayed with the terminal guanine lying in the minor groove of the next duplex in the column. The structure is stabilised by guanine N7/cobalt (II) coordination. We discuss our findings with respect to the effects of packing forces on DNA crystal structure, and the potential effects of intercalating agents on biochemical processes involving DNA quadruplexes and strand exchanges. NDB accession numbers: DD0032 (brominated) and DD0033 (native). PMID:11058124

  2. Three in one: prototropy-free highly stable AADD-type self-complementary quadruple hydrogen-bonded molecular duplexes with a built-in fluorophore.

    PubMed

    Kheria, Sanjeev; Rayavarapu, Suresh; Kotmale, Amol S; Sanjayan, Gangadhar J

    2017-02-15

    This communication reports an effective approach for addressing the prototropy-related problems in heterocycle-based AADD-type self-assembling systems by freezing their hydrogen-bonding codes, by utilizing intramolecular bifurcated hydrogen bonding interactions. Using this strategy, we have also developed a hydroquinone-conjugated AADD-type self-assembling system adorned with three valuable features such as prototropy-free dimerization yielding single duplexes, high duplex stability and a built-in fluorophore, which would augment its application potential. The rational approach used herein to arrest prototropic shift may also find application elsewhere, wherein proton shift-mediated structural changes become a detrimental factor.

  3. Hybrid density functional theory insight into the stability and microscopic properties of Bi-doped LiNbO3: Lone electron pair effect

    NASA Astrophysics Data System (ADS)

    Li, Lili; Li, Yanlu; Zhao, Xian

    2017-09-01

    It has recently been reported that Bi-doped LiNbO3 exhibits more excellent photorefractive properties than the traditional Fe doping. Bi-induced structural and physical properties remain unverified by either experiment or theory, however. Thus, here the basic characteristics of Bi-doped LiNbO3, such as the preferable Bi doping site, local lattice distortion, and the effect of Bi doping on the electronic structure and optical properties, are investigated by density functional theory with a hybrid functional. In particular, we focus on the effect of a Bi lone electron pair on the structural distortion and polaronic behavior of LiNbO3. The calculated results show that Bi substitutional Li in its +4 charge state (BiLi 4 +) and Bi substitutional Nb in its neutral state (BiNb 0) are energetically preferable in the majority of LiNbO3 samples. The incorporation of Bi could form a small bound electron polaron in LiNbO3. The strongly polarized localization of the Bi 6 s2 lone electron pair around the Bi center dominantly contributes to the large local lattice relaxation and the huge energy gain of BiLi 2 + that result in the negative U effect. A new BiLi 4 +/2 + photorefractive center that is 2.2 eV deeper than the intrinsic NbLi 4 +/2 + photorefractive center is introduced by Bi doping.

  4. Terahertz absorption of DNA decamer duplex.

    PubMed

    Li, Xiaowei; Globus, Tatiana; Gelmont, Boris; Salay, Luiz C; Bykhovski, Alexei

    2008-11-27

    This work combines experimental and theoretical approaches to investigate terahertz absorption spectra of the DNA formed by the sequence oligomer 5'-CCGGCGCCGG-3'. The three-dimensional structure of this self-complimentary DNA decamer has been well-studied, permitting us to perform direct identification of the low-frequency phonon modes associated with specific conformation and to conduct comprehensive computer simulations. Two modeling techniques, normal-mode analysis and nanosecond molecular dynamics with explicit solvent molecules, were employed to extract the low-frequency vibrational modes based on which the absorption spectra were calculated. The absorption spectra of the DNA decamer in aqueous solution were measured in the frequency range 10-25 cm(-1) using the terahertz Fourier transform infrared spectroscopy. Multiple well-resolved and reproducible resonance modes were observed. When calculated and experimental spectra were compared, the spectrum based on molecular dynamics simulations showed a better correlation with the experimental spectra than the one based on normal-mode analysis. These results demonstrate that there exist a considerable number of active low-frequency phonon modes in this short DNA duplex.

  5. [Appendix vermiformis duplex--a rare surprise].

    PubMed

    Sobhian, Babak; Mostegel, Margit; Kunc, Claudia; Karner, Josef

    2005-07-01

    Duplication of the vermiform appendix is extremely rare. It is found in only 1/25.000 patients (0.004%) operated on for acute appendicitis. A 60-year-old male patient was hospitalized for a peridiverticular sigmoid abscess without signs of a free abdominal perforation and an abscess cavity in the small pelvis. A Hartmann's resection and an appendectomy (the vermiform appendix was part of the abscess wall) were performed. The pathology report described an external appendicitis. After 3 months, the intestine was successfully reanastomosed. During mobilisation of the coecum, a second retrocoecal vermiform appendix was surprisingly found. Because of signs of a chronic appendicitis a second resection was performed. Although the diagnosis of an appendix duplex is a rarity, surgeons should be aware of the possibility, especially when clinical signs and symptoms point to appendicitis, although at laparotomy the appendix looks normal. A routine exploration for a second appendix is definitely not indicated because of the rarity and the increased complication rate.

  6. Wavelength-tunable duplex integrated light source

    NASA Astrophysics Data System (ADS)

    Okamoto, Hiroshi; Yasaka, Hiroshi; Oe, Kunishige

    1996-04-01

    A monolithically integrated opto-electronic device is proposed as a fast wavelength-switching light source. This tunable duplex integrated light source comprises two wavelength-tunable distributed Bragg reflector (DBR) laser diodes (LDs), two MQW-electro-absorption optical switches, a Y-shaped waveguide coupler, a MQW-electro-absorption modulator, and two thermal drift compensators (TDCs). The wavelength-switching time of the optical switches was estimated to be 60 ps including a 50-ps rise time for the electrical-pulse generator. The wavelength of a 10-Gbit/s NRZ-modulated optical signal can be switched without bit loss. The function of the TDCs is to keep the device-chip temperature constant. Thermal-transient- induced wavelength drift with a millisecond-order time constant, which has been reported for DBR-LDs, and thermal crosstalk between the tuning regions of the integrated LDs, which causes wavelength fluctuation, are effectively suppressed by thermal-drift-compensation operation using the TDCs.

  7. Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Wu, R. R.; Rodgers, M. T.

    2015-09-01

    (CCG)n•(CGG)n trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C+•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

  8. Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif.

    PubMed

    Yang, Bo; Wu, R R; Rodgers, M T

    2015-09-01

    (CCG)(n)•(CGG)(n) trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)(n)•(CGG)(n) repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C(+)•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

  9. Potential dependence of cuprous/cupric duplex film growth on copper electrode in alkaline media

    NASA Astrophysics Data System (ADS)

    He, Jian-Bo; Lu, Dao-Yong; Jin, Guan-Ping

    2006-11-01

    The duplex oxide film potentiostatically formed on copper in concentrated alkaline media has been investigated by XRD, XPS, negative-going voltammetry and cathodic chronopotentiometry. The interfacial capacity was also measured using fast triangular voltage method under quasi-stationary condition. The obvious differences in the thickness, composition, passivation degree and capacitance behavior were observed between the duplex film formed in lower potential region (-0.13 to 0.18 V versus Hg|HgO electrode with the same solution as the electrolyte) and that formed in higher potential region (0.18-0.60 V). Cuprous oxides could be formed and exist stably in the inner layer in the both potential regions, and three cupric species, soluble ions and Cu(OH) 2 and CuO, could be independently produced from the direct oxidation of metal copper, as indicated by three pairs of redox voltammetric peaks. One of the oxidation peaks appeared only after the scan was reversed from high potential and could be attributed to CuO formation upon the pre-accumulation of O 2- ions within the film under high anodic potentials. A new mechanism for the film growth on the investigated time scale from 1 to 30 min is proposed, that is, the growth of the duplex film in the lower potential region takes place at the film|solution interface to form a thick Cu(OH) 2 outer layer by field-assisted transfer of Cu 2+ ions through the film to solution, whereas the film in the higher potential region grows depressingly and slowly at the metal|film interface to form Cu 2O and less CuO by the transfer of O 2- ions through the film to electrode.

  10. Reproducibility of duplex ultrasonography and air plethysmography used for the evaluation of chronic venous insufficiency.

    PubMed

    Asbeutah, Akram Mahmoud; Riha, Andrea Zdena; Cameron, James Donald; McGrath, Barry Patrick

    2005-04-01

    The purpose of this study was to determine the reproducibility of measurements on duplex ultrasonography (DU) and air plethysmography (APG) in subjects with post-thrombotic syndrome. Duplex ultrasonography and APG were used to measure indices of lower limb venous reflux in 15 limbs with a history of deep vein thrombosis and evidence of venous insufficiency as diagnosed by ultrasonography. Three limbs were in class 0; 4 were in classes 1 to 3; and 8 were in classes 4 to 6, according to clinical, etiologic, anatomic, and pathophysiologic clinical classification. Duplex ultrasonography was performed 3 times on the same day, and venous diameter, area, peak reflux velocity, reflux flow volume, and reflux duration measurements were obtained. Air plethysmography was performed on 2 days, 7 to 10 days apart, with 1 measurement on the first day and 2 measurements on the second day. Values obtained from APG included outflow fraction, venous filling index, ejection fraction, and residual volume fraction. The measurements were performed by a vascular technologist blinded to the previous test results. One-way analysis of variance, the Student paired t test, and Bland-Altman plots were used to examine the statistical differences of the DU and APG parameters for all measurements. The mean coefficient of variation for within-subject measurements of all DU and APG parameters measured was less than 10%. Bland-Altman plots showed that there were no apparent trends with increasing values over a wide range for any of the DU parameters, nor were there any for the APG parameters. Under ideal conditions, when measured by a highly trained technologist, both DU and APG showed satisfactory reproducibility.

  11. Watson-Crick base pairing controls excited-state decay in natural DNA.

    PubMed

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states.

  12. Structure determination of DNA methylation lesions N1-meA and N3-meC in duplex DNA using a cross-linked protein-DNA system.

    PubMed

    Lu, Lianghua; Yi, Chengqi; Jian, Xing; Zheng, Guanqun; He, Chuan

    2010-07-01

    N(1)-meA and N(3)-meC are cytotoxic DNA base methylation lesions that can accumulate in the genomes of various organisms in the presence of S(N)2 type methylating agents. We report here the structural characterization of these base lesions in duplex DNA using a cross-linked protein-DNA crystallization system. The crystal structure of N(1)-meA:T pair shows an unambiguous Hoogsteen base pair with a syn conformation adopted by N(1)-meA, which exhibits significant changes in the opening, roll and twist angles as compared to the normal A:T base pair. Unlike N(1)-meA, N(3)-meC does not establish any interaction with the opposite G, but remains partially intrahelical. Also, structurally characterized is the N(6)-meA base modification that forms a normal base pair with the opposite T in duplex DNA. Structural characterization of these base methylation modifications provides molecular level information on how they affect the overall structure of duplex DNA. In addition, the base pairs containing N(1)-meA or N(3)-meC do not share any specific characteristic properties except that both lesions create thermodynamically unstable regions in a duplex DNA, a property that may be explored by the repair proteins to locate these lesions.

  13. LNA effects on DNA binding and conformation: from single strand to duplex and triplex structures.

    PubMed

    Pabon-Martinez, Y Vladimir; Xu, You; Villa, Alessandra; Lundin, Karin E; Geny, Sylvain; Nguyen, Chi-Hung; Pedersen, Erik B; Jørgensen, Per T; Wengel, Jesper; Nilsson, Lennart; Smith, C I Edvard; Zain, Rula

    2017-09-08

    The anti-gene strategy is based on sequence-specific recognition of double-strand DNA by triplex forming (TFOs) or DNA strand invading oligonucleotides to modulate gene expression. To be efficient, the oligonucleotides (ONs) should target DNA selectively, with high affinity. Here we combined hybridization analysis and electrophoretic mobility shift assay with molecular dynamics (MD) simulations to better understand the underlying structural features of modified ONs in stabilizing duplex- and triplex structures. Particularly, we investigated the role played by the position and number of locked nucleic acid (LNA) substitutions in the ON when targeting a c-MYC or FXN (Frataxin) sequence. We found that LNA-containing single strand TFOs are conformationally pre-organized for major groove binding. Reduced content of LNA at consecutive positions at the 3'-end of a TFO destabilizes the triplex structure, whereas the presence of Twisted Intercalating Nucleic Acid (TINA) at the 3'-end of the TFO increases the rate and extent of triplex formation. A triplex-specific intercalating benzoquinoquinoxaline (BQQ) compound highly stabilizes LNA-containing triplex structures. Moreover, LNA-substitution in the duplex pyrimidine strand alters the double helix structure, affecting x-displacement, slide and twist favoring triplex formation through enhanced TFO major groove accommodation. Collectively, these findings should facilitate the design of potent anti-gene ONs.

  14. ES and H-compatible lubrication for duplex bearings

    SciTech Connect

    Steinhoff, R.G.

    1997-10-01

    Two ES and H-compatible lubricants (environment, safety, and health) for duplex bearing applications and one hybrid material duplex bearing were evaluated and compared against duplex bearings with trichlorotrifluoroethane (Freon) deposition of low molecular weight polytetrafluoroethylene (PTFE) bearing lubricant extracted from Vydax{trademark}. Vydax is a product manufactured by DuPont consisting of various molecular weights of PTFE suspended in trichlorotrifluoroethane (Freon), which is an ozone-depleting solvent. Vydax has been used as a bearing lubricant in strong link mechanisms since 1974. Hybrid duplex bearings with silicon nitride balls and molded glass-nylon-Teflon retainers, duplex bearings lubricated with sputtered MoS{sub 2} on races and retainers, and duplex bearings lubricated with electrophoretic deposited MoS{sub 2} were evaluated. Bearings with electrophoretic deposited MoS{sub 2} performed as well as bearings with Freon deposition of PTFE from Freon-based Vydax. Hybrid bearings with silicon nitride balls performed worse than bearings lubricated with Vydax, but their performance would still be acceptable for most applications. Bearings lubricated with sputtered MoS{sub 2} on the races and retainers had varying amounts of film on the bearings. This affected the performance of the bearings. Bearings with a uniform coating performed to acceptable levels, but bearings with no visible MoS{sub 2} on the races and retainers did not perform as well as bearings with the other coatings. Unless process controls are incorporated in the sputtering process or the bearings are screened, they do not appear to be acceptable for duplex bearing applications.

  15. Hardware Impairments Aware Transceiver for Full-Duplex Massive MIMO Relaying

    NASA Astrophysics Data System (ADS)

    Xia, Xiaochen; Zhang, Dongmei; Xu, Kui; Ma, Wenfeng; Xu, Youyun

    2015-12-01

    This paper studies the massive MIMO full-duplex relaying (MM-FDR), where multiple source-destination pairs communicate simultaneously with the help of a common full-duplex relay equipped with very large antenna arrays. Different from the traditional MM-FDR protocol, a general model where sources/destinations are allowed to equip with multiple antennas is considered. In contrast to the conventional MIMO system, massive MIMO must be built with low-cost components which are prone to hardware impairments. In this paper, the effect of hardware impairments is taken into consideration, and is modeled using transmit/receive distortion noises. We propose a low complexity hardware impairments aware transceiver scheme (named as HIA scheme) to mitigate the distortion noises by exploiting the statistical knowledge of channels and antenna arrays at sources and destinations. A joint degree of freedom and power optimization algorithm is presented to further optimize the spectral efficiency of HIA based MM-FDR. The results show that the HIA scheme can mitigate the "ceiling effect" appears in traditional MM-FDR protocol, if the numbers of antennas at sources and destinations can scale with that at the relay.

  16. Initiation of the microgene polymerization reaction with non-repetitive homo-duplexes

    SciTech Connect

    Itsko, Mark Zaritsky, Arieh; Rabinovitch, Avinoam; Ben-Dov, Eitan

    2008-04-11

    Microgene Polymerization Reaction (MPR) is used as an experimental system to artificially simulate evolution of short, non-repetitive homo-duplex DNA into multiply-repetitive products that can code for functional proteins. Blunt-end ligation by DNA polymerase is crucial in expansion of homo-duplexes (HDs) into head-to-tail multiple repeats in MPR. The propagation mechanism is known, but formation of the initial doublet (ID) by juxtaposing two HDs and polymerization through the gap has been ambiguous. Initiation events with pairs of HDs using Real-Time PCR were more frequent at higher HD concentrations and slightly below the melting temperature. A process molecularity of about 3.1, calculated from the amplification efficiency and the difference in PCR cycles at which propagation was detected at varying HD concentrations, led to a simple mechanism for ID formation: the gap between two HDs is bridged by a third. Considering thermodynamic aspects of the presumed intermediate 'nucleation complex' can predict relative propensity for the process with other HDs.

  17. The relative flexibility of B-DNA and A-RNA duplexes: database analysis

    PubMed Central

    Pérez, Alberto; Noy, Agnes; Lankas, Filip; Luque, F. Javier; Orozco, Modesto

    2004-01-01

    An extensive analysis of structural databases is carried out to investigate the relative flexibility of B-DNA and A-RNA duplexes in crystal form. Our results show that the general anisotropic concept of flexibility is not very useful to compare the deformability of B-DNA and A-RNA duplexes, since the flexibility patterns of B-DNA and A-RNA are quite different. In other words, ‘flexibility’ is a dangerous word for describing macromolecules, unless it is clearly defined. A few soft essential movements explain most of the natural flexibility of A-RNA, whereas many are necessary for B-DNA. Essential movements occurring in naked B-DNAs are identical to those necessary to deform DNA in DNA–protein complexes, which suggest that evolution has designed DNA–protein complexes so that B-DNA is deformed according to its natural tendency. DNA is generally more flexible, but for some distortions A-RNA is easier to deform. Local stiffness constants obtained for naked B-DNAs and DNA complexes are very close, demonstrating that global distortions in DNA necessary for binding to proteins are the result of the addition of small concerted deformations at the base-pair level. Finally, it is worth noting that in general the picture of the relative deformability of A-RNA and DNA derived from database analysis agrees very well with that derived from state of the art molecular dynamics (MD) simulations. PMID:15562006

  18. Targeting duplex DNA with chimeric α,β-triplex-forming oligonucleotides

    PubMed Central

    Kolganova, N. A.; Shchyolkina, A. K.; Chudinov, A. V.; Zasedatelev, A. S.; Florentiev, V. L.; Timofeev, E. N.

    2012-01-01

    Triplex-directed DNA recognition is strictly limited by polypurine sequences. In an attempt to address this problem with synthetic biology tools, we designed a panel of short chimeric α,β-triplex-forming oligonucleotides (TFOs) and studied their interaction with fluorescently labelled duplex hairpins using various techniques. The hybridization of hairpin with an array of chimeric probes suggests that recognition of double-stranded DNA follows complicated rules combining reversed Hoogsteen and non-canonical homologous hydrogen bonding. In the presence of magnesium ions, chimeric TFOs are able to form highly stable α,β-triplexes, as indicated by native gel-electrophoresis, on-array thermal denaturation and fluorescence-quenching experiments. CD spectra of chimeric triplexes exhibited features typically observed for anti-parallel purine triplexes with a GA or GT third strand. The high potential of chimeric α,β-TFOs in targeting double-stranded DNA was demonstrated in the EcoRI endonuclease protection assay. In this paper, we report, for the first time, the recognition of base pair inversions in a duplex by chimeric TFOs containing α-thymidine and α-deoxyguanosine. PMID:22641847

  19. Kinematic model for out-of-sequence thrusting: Motion of two ramp-flat faults and the production of upper plate duplex systems

    NASA Astrophysics Data System (ADS)

    Pavlis, Terry L.

    2013-06-01

    Kinematic models developed here suggest a bewildering array of structural styles can be generated during out-of-sequence thrusting. Many of these structures would be difficult to distinguish from a normally stacked thrust sequence and the process can produce younger-on-older faults that could easily be misinterpreted as normal faults. This paper considers a small subset of this problem within a large model space by considering structures that develop along a pair of ramp-flat faults that are moving simultaneously, or sequentially. Motion on the lower ramp warps the structurally higher fault due to fault-bend folding and when the fault ruptures through the warp it transfers a horse to the upper hanging wall. Continuity of the process generates what is referred to here as an "upper plate duplex" to distinguish the structure from a conventional duplex. Kinematic parameters are developed for two models within this general problem: 1) a system with a fixed ramp in the lower thrust, overridden by an upper thrust; and 2) a double-duplex system where a conventional duplex develops along the lower fault at the same time as an upper plate duplex is formed along the upper fault. The theory is tested with forward models using 2D Move software and these tests indicate different families of structural styles form in association with relative scaling of ramp systems, slip-ratio between faults, and aspect ratios of horse blocks formed in the upper-plate duplex. A first-order result of the analysis is that an upper plate duplex can be virtually indistinguishable from a conventional duplex unless the trailing branch lines of the horses are exposed or imaged; a condition seldom met in natural exposures. Restoration of an upper-plate duplex produces counterintuitive fault geometry in the restored state, and thus, restorations of upper plate duplexes that erroneously assume a conventional duplex model would produce restored states that are seriously in error. In addition, in most of

  20. Duplex Ultrasonography in Assessing Restenosis of Renal Artery Stents

    SciTech Connect

    Bakker, Jeannette; Beutler, Jaap J.; Elgersma, Otto E.H.; Lange, Eduard E. de; Kort, Gerard A.P. de; Beek, Frederik J. A.

    1999-11-15

    Purpose: To determine the accuracy and optimal threshold values of duplex ultrasonography (US) in assessing restenosis of renal artery stents. Methods: Twenty-four consecutive patients with 33 renal arteries that had previously been treated with placement of a Palmaz stent underwent duplex US prior to intraarterial digital subtraction angiography (DSA), which was the reference standard. Diagnostic accuracy of in-stent peak systolic velocity (PSV) and reno-aortic ratio (RAR = PSV renal stent/PSV aorta) in detecting > 50% in-stent restenosis were evaluated by the receiver operating characteristic curve. Sensitivity and specificity were determined using the optimal threshold values, and using published threshold values: RAR > 3.5 and in-stent PSV > 180 cm/sec. Results: Six examinations were technically inadequate. Nine stents had residual or restenosis > 50% at DSA. The two duplex parameters were equally accurate since areas under the curves were similar (0.943). With optimal threshold values of 226 cm/sec for PSV and 2.7 for RAR, sensitivities and specificities were 100% and 90%, and 100% and 84%, respectively. Using the published duplex criteria resulted in sensitivities and specificities of 100% and 74% for PSV, and 50% and 89% for RAR. Conclusion: Duplex US is a sensitive modality for detecting in-stent restenosis if laboratory-specific threshold values are used.

  1. Doppler ultrasonography of the central retinal artery by duplex scanning.

    PubMed

    Steigerwalt, R D; Cesarone, M R; Laurora, G; Belcaro, G V; De Sanctis, M T; Incandela, L; Christopoulos, V

    1996-01-01

    To present duplex scanning of the central retinal artery, which the authors have termed duplex scanner imaging, as an alternative to color Doppler imaging in the evaluation of retinal blood flow velocity, and to show the difference in measurements obtained with the two different techniques. The high-resolution ATL-Ultramark 4 duplex scanner (Advanced Technology Laboratories, Bothell, WA) with the variable focus access probe was used to measure blood flow velocity of the central retinal artery in the eyes of 48 healthy volunteers. Using this technique the peak systolic flow velocity (+/- standard deviation [SD]) of the central retinal artery was 36.6 +/- 10.8 cm/sec, and the end diastolic flow velocity was 12.6 +/- 3.7 cm/sec. The flow velocity measurements of the central retinal artery obtained with this technique were much higher than those obtained by other authors using color Doppler imaging (9.6 cm/sec for the peak systolic flow velocity, and 4.7 cm/sec for the end diastolic flow velocity). The authors propose duplex scanner imaging as an alternative to color Doppler imaging for evaluating retinal blood flow velocity. The duplex scanner also can be used to measure the flow velocity of orbital vessels.

  2. Considerations for measurement setup for second-order nonlinearity in radio-frequency bulk acoustic wave duplexers.

    PubMed

    Wang, Yiliu; Thalmayr, Florian; Wu, Nan; Hashimoto, Ken-ya

    2010-08-01

    This paper discusses the influence of the setup on the measurement reliability and reproducibility for the secondorder inter-modulation distortion (IMD2) generated in RF BAW duplexers. Our measurement results show that the IMD2 level can be reliably and reproducibly measured when the port terminations are properly applied. For example, a filter and a relatively large (>20 dB) attenuator are necessary between an oscillator and the antenna port of the duplexer to suppress the nonlinear mixing and the impedance mismatching. If the order of these two devices were reversed, the IMD2 level would change significantly. Although an isolator is commonly used to stabilize the power amplifier output, our research results show that not using an ISO produced more accurate results.

  3. Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

    2001-04-01

    Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

  4. A novel universal real-time PCR system using the attached universal duplex probes for quantitative analysis of nucleic acids

    PubMed Central

    Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing

    2008-01-01

    Background Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. Results We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. Conclusion The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost. PMID:18522756

  5. A single-tube duplex and multiplex PCR for simultaneous detection of four cassava mosaic begomovirus species in cassava plants.

    PubMed

    Aloyce, R C; Tairo, F; Sseruwagi, P; Rey, M E C; Ndunguru, J

    2013-04-01

    A single-tube duplex and multiplex PCR was developed for the simultaneous detection of African cassava mosaic virus (ACMV), East African cassava mosaic Cameroon virus (EACMCV), East African cassava mosaic Malawi virus (EACMMV) and East African cassava mosaic Zanzibar virus (EACMZV), four cassava mosaic begomoviruses (CMBs) affecting cassava in sub-Saharan Africa. Co-occurrence of the CMBs in cassava synergistically enhances disease symptoms and complicates their detection and diagnostics. Four primer pairs were designed to target DNA-A component sequences of cassava begomoviruses in a single tube PCR amplification using DNA extracted from dry-stored cassava leaves. Duplex and multiplex PCR enabled the simultaneous detection and differentiation of the four CMBs, namely ACMV (940bp), EACMCV (435bp), EACMMV (504bp) and EACMZV (260bp) in single and mixed infections, and sequencing results confirmed virus identities according to the respective published sequences of begomovirus species. In addition, we report here a modified Dellapotra et al. (1983) protocol, which was used to extract DNA from dry and fresh cassava leaves with comparable results. Using the duplex and multiplex techniques, time was saved and amount of reagents used were reduced, which translated into reduced cost of the diagnostics. This tool can be used by cassava breeders screening for disease resistance; scientists doing virus diagnostic studies; phytosanitary officers checking movement of diseased planting materials, and seed certification and multipliers for virus indexing.

  6. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  7. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    PubMed

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  8. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  9. Cavitation Erosion of Sensitized UNS S31803 Duplex Stainless Steels

    NASA Astrophysics Data System (ADS)

    Mitelea, Ion; Micu, Lavinia Mădălina; Bordeaşu, Ilare; Crăciunescu, Corneliu Marius

    2016-05-01

    During processing or use, duplex steels can be subjected to heating at high temperatures that can affect their behavior. This work aims to correlate the influence of the sensitization treatment on the ultrasonic cavitation erosion behavior of a UNS S31803 (X2CrNiMoN22-5-3) duplex stainless steel. Duplex stainless steels, formed as a result of rapid cooling after solution annealing, are sensitized at temperatures of 475 and 850 °C, respectively, leading to hardening and embrittlement due to the spinodal decomposition of the ferrite and the precipitation of secondary phases. The ultrasonic cavitation erosion experiments showed that the sensitization at 850 °C reduced the mean depth of erosion by about 11% and the mean depth of erosion rate by 28%. By contrast, the sensitization at 475 °C deteriorates the cavitation erosion resistance, increasing the erosion parameters by up to 22%, compared to the solution annealed state.

  10. Defined presentation of carbohydrates on a duplex DNA scaffold.

    PubMed

    Schlegel, Mark K; Hütter, Julia; Eriksson, Magdalena; Lepenies, Bernd; Seeberger, Peter H

    2011-12-16

    A new method for the spatially defined alignment of carbohydrates on a duplex DNA scaffold is presented. The use of an N-hydroxysuccinimide (NHS)-ester phosphoramidite along with carbohydrates containing an alkylamine linker allows for on-column labeling during solid-phase oligonucleotide synthesis. This modification method during solid-phase synthesis only requires the use of minimal amounts of complex carbohydrates. The covalently attached carbohydrates are presented in the major groove of the B-form duplex DNA as potential substrates for murine type II C-type lectin receptors mMGL1 and mMGL2. CD spectroscopy and thermal melting revealed only minimal disturbance of the overall helical structure. Surface plasmon resonance and cellular uptake studies with bone-marrow-derived dendritic cells were used to assess the capability of these carbohydrate-modified duplexes to bind to mMGL receptors.

  11. CMOS serial link for fully duplexed data communication

    NASA Astrophysics Data System (ADS)

    Lee, Kyeongho; Kim, Sungjoon; Ahn, Gijung; Jeong, Deog-Kyoon

    1995-04-01

    This paper describes a CMOS serial link allowing fully duplexed 500 Mbaud serial data communication. The CMOS serial link is a robust and low-cost solution to high data rate requirements. A central charge pump PLL for generating multiphase clocks for oversampling is shared by several serial link channels. Fully duplexed serial data communication is realized in the bidirectional bridge by separating incoming data from the mixed signal on the cable end. The digital PLL accomplishes process-independent data recovery by using a low-ratio oversampling, a majority voting, and a parallel data recovery scheme. Mostly, digital approach could extend its bandwidth further with scaled CMOS technology. A single channel serial link and a charge pump PLL are integrated in a test chip using 1.2 micron CMOS process technology. The test chip confirms upto 500 Mbaud unidirectional mode operation and 320 Mbaud fully duplexed mode operation with pseudo random data patterns.

  12. Several Cis-regulatory Elements Control mRNA Stability, Translation Efficiency, and Expression Pattern of Prrxl1 (Paired Related Homeobox Protein-like 1)*

    PubMed Central

    Regadas, Isabel; Matos, Mariana Raimundo; Monteiro, Filipe Almeida; Gómez-Skarmeta, José Luis; Lima, Deolinda; Bessa, José; Casares, Fernando; Reguenga, Carlos

    2013-01-01

    The homeodomain transcription factor Prrxl1/DRG11 has emerged as a crucial molecule in the establishment of the pain circuitry, in particular spinal cord targeting of dorsal root ganglia (DRG) axons and differentiation of nociceptive glutamatergic spinal cord neurons. Despite Prrxl1 importance in the establishment of the DRG-spinal nociceptive circuit, the molecular mechanisms that regulate its expression along development remain largely unknown. Here, we show that Prrxl1 transcription is regulated by three alternative promoters (named P1, P2, and P3), which control the expression of three distinct Prrxl1 5′-UTR variants, named 5′-UTR-A, 5′-UTR-B, and 5′-UTR-C. These 5′-UTR sequences confer distinct mRNA stability and translation efficiency to the Prrxl1 transcript. The most conserved promoter (P3) contains a TATA-box and displays in vivo enhancer activity in a pattern that overlaps with the zebrafish Prrxl1 homologue, drgx. Regulatory modules present in this sequence were identified and characterized, including a binding site for Phox2b. Concomitantly, we demonstrate that zebrafish Phox2b is required for the expression of drgx in the facial, glossopharyngeal, and vagal cranial ganglia. PMID:24214975

  13. On the thermomechanical deformation behavior of duplex-type materials

    NASA Astrophysics Data System (ADS)

    Siegmund, T.; Werner, E.; Fischer, F. D.

    1995-04-01

    Two-phase duplex-type materials possess microstructures containing roughly the same amounts of the constituent phases whose grains form interwoven networks. Duplex stainless steels are typical representatives of this material group. In these steels the constituent phases austenite and ferrite have different coefficients of thermal expansion. On pure thermal loading or thermomechanical loading the yield strength of the phases can be exceeded. Specimens of a forged duplex steel with a uniaxially anisotropic micro-structure deform irreversibly even under pure thermal cycling conditions with a monotonic accumulation of strain. The results of a systematic finite element based micromechanical analysis of the thermomechanical deformation behavior of duplex steels are presented and discussed. The analysis is based on a quantitative characterization of both the real and model microstructures. Additionally, an extended constitutive material law for the thermomechanical loading of the duplex steel is proposed. For dual-phase materials this description incorporates an additional thermomechanical strain increment as a very important contribution to the total strain increment. Both the micromechanical model and the analytical model are used to analyse the experimental findings from dilatometer tests. The micromechanical approach allows the evolution of the irreversible strains in the two phases generated in a thermal cycle to be modeled. It is shown that the matrix-phase is always more deformed than the inclusion-phase, irrespective of which of the two phases (austenite or ferrite) forms the matrix. This prediction is confirmed by electron microscopic observations of a thermally cycled duplex steel. Based on these results a mechanism driving the ratchet effect is proposed.

  14. Pairing Learners in Pair Work Activity

    ERIC Educational Resources Information Center

    Storch, Neomy; Aldosari, Ali

    2013-01-01

    Although pair work is advocated by major theories of second language (L2) learning and research findings suggest that pair work facilitates L2 learning, what is unclear is how to best pair students in L2 classes of mixed L2 proficiency. This study investigated the nature of pair work in an English as a Foreign Language (EFL) class in a college in…

  15. Pairing Learners in Pair Work Activity

    ERIC Educational Resources Information Center

    Storch, Neomy; Aldosari, Ali

    2013-01-01

    Although pair work is advocated by major theories of second language (L2) learning and research findings suggest that pair work facilitates L2 learning, what is unclear is how to best pair students in L2 classes of mixed L2 proficiency. This study investigated the nature of pair work in an English as a Foreign Language (EFL) class in a college in…

  16. Synthesis of peptide nucleic acids containing pyridazine derivatives as cytosine and thymine analogs, and their duplexes with complementary oligodeoxynucleotides.

    PubMed

    Tomori, Takahito; Miyatake, Yuya; Sato, Yuta; Kanamori, Takashi; Masaki, Yoshiaki; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

    2015-03-20

    Synthesis of peptide nucleic acids (PNAs) is reported with new pyridazine-type nucleobases: 3-aminopyridazine (aPz) and 1-aminophthalazine (aPh) as cytosine analogs, and pyridazin-3-one (Pz(O)) and phthalazin-1-one (Ph(O)) as thymine analogs. The PNAs having an aPz or a Pz(O) formed duplexes with each complementary oligodeoxynucleotide forming a base pair with G or A, respectively, as evaluated by using UV melting analyses and circular dichroism (CD) spectra.

  17. An experimental and analytical study of the stability of counter-rotating vortex pairs with applications for aircraft wake turbulence control

    NASA Astrophysics Data System (ADS)

    Babie, Brian Matthew

    Aircraft trailing vortex wakes are commonly referred to as `wake turbulence' and may pose a flight safety hazard to other aircraft that may encounter the wake. This hazard is of critical interest during the take-off and landing stages of flight, where aircraft are in the closest proximity to one another. During these flight stages, it is common for transport aircraft to be in a high-lift, or flaps down, configuration. In an effort to study these wakes a generic four-vortex wake is generated experimentally, such that the results are independent of a specific wing loading condition. Three principle objectives served to focus the research project that is presented in this dissertation. The first two objectives were to develop an improved understanding of the wake configurations that were conducive to large instability growth rates and to subsequently use quantitative methods to identify the instability modes that dominate the far-field wake dynamic. With a clear understanding of the physics of an unstable aircraft wake, the third objective of the research project was to use this newly attained information to recommend methods for a reliable wake control strategy. A compilation of flow visualization results shows a design space of counter-rotating wake configurations, defined by the circulation and span ratios, where rapidly amplifying instabilities are consistently seen to exist. This design space is also seen to encompass rigidly-translating wake systems. A combination of quantitative flow visualization estimates, hot-wire anemometry and an analytical stability analysis was successful in identifying two forms of bending wave instability, namely the long and short-wavelength modes. Having identified two bending instability modes in the experimental wake, it was possible to suggest a strategy by which these modes could be exploited for the control of aircraft wakes.

  18. Structural features of an exocyclic adduct positioned opposite an abasic site in a DNA duplex

    SciTech Connect

    Kouchakdjian, M.; Patel, D.J. ); Eisenberg, M.; Johnson, F.; Grollman, A.P. )

    1991-04-02

    Structural studies have been extended to dual lesions where an exocyclic adduct is positioned opposite an abasic site in the center of a DNA oligomer duplex. NMR and energy minimization studies were performed on the 1,N{sup 2}-propanodeoxyguanosine exocyclic adduct (X) positioned opposite a tetrahydrofuran abasic site (F) with the dual lesions located in the center of the (C1-A2-T3-G4-X5-G6-T7-A8-C9){center dot}(G10-T11-A12-C13-F14-C15-A16-T17-G18) X{center dot}F 9-mer duplex. Two-dimensional NMR experiments establish that the X{center dot}F 9-mer helix is right-handed with Watson-Crick A{center dot}T and G{center dot}C base pairing on either side of the lesion site. NOEs are detected from the methylene protons of the exocyclic ring of X5 to the imino protons of G4{center dot}C15 and G6{center dot}C13 which flank the lesion site, as well as to the H1{prime} and H1{double prime} protons of the cross strand F14 tetrahydrofuran moiety. These NMR results establish that the exocyclic adduct X5 is positioned between flanking G4{center dot}C15 and G6{center dot}C13 base pairs and directed toward the abasic lesion F14 on the partner strand. These studies establish that the exocyclic ring of the 1,N{sup 2}-propanodeoxyguanosine adduct fits into the cavity generated by the abasic site.

  19. Fluorophore-Quencher Pair For Monitoring Protein Motion

    PubMed Central

    Tahmassebi, Deborah C.; Millar, David P.

    2009-01-01

    A fluorophore/quencher pair capable of detecting conformational changes of DNA-protein complexes is described. The system employs a fluorescent nucleoside analog 1,3-diaza-2-oxophenothiazine (tC) within duplex DNA and a non-fluorescent quencher (TEMPO) attached to an engineered cysteine residue of the protein. The straightforward labeling methodology allows for the placement of the fluorophore and quencher moieties at specific positions suited to studying the conformational change of interest. To illustrate the utility of the tC-TEMPO pair, we have monitored nucleotide-induced conformational changes of the Klenow fragment (KF) polymerase bound to duplex DNA. In this system, tC was incorporated in the primer strand of the duplex, adjacent to the 3’ end, while TEMPO was positioned at the end of the O-helix within the fingers domain of KF. Using steady-state fluorescence spectroscopy, we measured the quenching efficiency in a binary complex of tC-modified DNA and TEMPO-labeled KF and in ternary complexes containing cognate or non-cognate dNTP substrates. The quenching efficiency is significantly enhanced in the presence of a cognate dNTP, indicating that the O-helix has moved closer towards the DNA. In contrast, no significant tC quenching is observed in the presence of a non-cognate dNTP, indicating that the O-helix remains in a position that is beyond the distance reporting range of the tC-TEMPO pair. These results demonstrate that a cognate dNTP substrate induces a large conformational change of the O-helix, which can be sensitively detected using the tC-TEMPO pair. This fluorophore/quencher pair may be useful to study conformational changes associated with other DNA-enzyme complexes. PMID:19167347

  20. Synthesis of specific diastereomers of a DNA methylphosphonate heptamer, d(CpCpApApApCpA), and stability of base pairing with the normal DNA octamer d(TPGPTPTPTPGPGPC).

    PubMed Central

    Vyazovkina, E V; Savchenko, E V; Lokhov, S G; Engels, J W; Wickstrom, E; Lebedev, A V

    1994-01-01

    DNA methylphosphonates are candidate derivatives for use in antisense DNA therapy. Their efficacy is limited by weak hybridization. One hypothesis to explain this phenomenon holds that one configuration of the chiral methylphosphonate linkage, Rp, permits stronger base pairing than the other configuration, Sp. To test this hypothesis, four specific pairs of Rp and Sp diastereomers of the DNA methylphosphonate heptamer d(CpCpApApApCpA) were prepared by block coupling of different combinations of individual diastereomers of d(CpCpApA) and d(ApCpA). Each pair of the diastereomers of the heptamer was separated into individual diastereomes using affinity chromatography on a Lichrosorb-NH2 silica column with a covalently attached complementary normal DNA octamer, d(pTpGpTpTpTpGpGpC). The stabilities of complementary complexes of phosphodiester d(TpGpTpTpTpGpGpC) with 8 individual diastereomers of methylphosphonate d(CpCpApApApCpA) were studied by measuring their melting temperatures (Tm). A direct correlation of Tm values with the number of Rp methylphosphonate centers in the heptamer was found: the more Rp centers, the higher the stability of the complex. Tm values for the diastereomers with 6 all-Rp or all-Sp methylphosphonate centers were found to be 30.5 degrees and 12.5 degrees C, respectively, in 100 mM NaCl, 10 mM Na2HPO4, 1 mM EDTA, pH 7.0 with 15 microM of each oligomer. On the average, each substitution of one Rp-center to an Sp-center in the heptamer decreased the Tm by 3 degrees C. Under the same conditions, the Tm of the normal DNA heptamer with its complement was 21 degrees C. These results are consistent with the model that all-Rp methylphosphonate DNAs hybridize much more tightly to complementary normal DNA than do racemic methylphosphonate DNAs, and may therefore exhibit greater potency as antisense inhibitors. PMID:8036171

  1. Specific DNA duplex formation at an artificial lipid bilayer: fluorescence microscopy after Sybr Green I staining.

    PubMed

    Werz, Emma; Rosemeyer, Helmut

    2014-01-01

    The article describes the immobilization of different probe oligonucleotides (4, 7, 10) carrying each a racemic mixture of 2,3-bis(hexadecyloxy)propan-1-ol (1a) at the 5'-terminus on a stable artificial lipid bilayer composed of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC). The bilayer separates two compartments (cis/trans channel) of an optical transparent microfluidic sample carrier with perfusion capabilities. Injection of unlabeled target DNA sequences (6, 8, or 9), differing in sequence and length, leads in the case of complementarity to the formation of stable DNA duplexes at the bilayer surface. This could be verified by Sybr Green I double strand staining, followed by incubation periods and thorough perfusions, and was visualized by single molecule fluorescence spectroscopy and microscopy. The different bilayer-immobilized complexes consisting of various DNA duplexes and the fluorescent dye were studied with respect to the kinetics of their formation as well as to their stability against perfusion.

  2. Chemical structure and properties of interstrand cross-links formed by reaction of guanine residues with abasic sites in duplex DNA.

    PubMed

    Catalano, Michael J; Liu, Shuo; Andersen, Nisana; Yang, Zhiyu; Johnson, Kevin M; Price, Nathan E; Wang, Yinsheng; Gates, Kent S

    2015-03-25

    A new type of interstrand cross-link resulting from the reaction of a DNA abasic site with a guanine residue on the opposing strand of the double helix was recently identified, but the chemical connectivity of the cross-link was not rigorously established. The work described here was designed to characterize the chemical structure and properties of dG-AP cross-links generated in duplex DNA. The approach involved characterization of the nucleoside cross-link "remnant" released by enzymatic digestion of DNA duplexes containing the dG-AP cross-link. We first carried out a chemical synthesis and complete spectroscopic structure determination of the putative cross-link remnant 9b composed of a 2-deoxyribose adduct attached to the exocyclic N(2)-amino group of dG. A reduced analogue of the cross-link remnant was also prepared (11b). Liquid chromatography-tandem mass spectrometric (LC-MS/MS) analysis revealed that the retention times and mass spectral properties of synthetic standards 9b and 11b matched those of the authentic cross-link remnants released by enzymatic digestion of duplexes containing the native and reduced dG-AP cross-link, respectively. These results establish the chemical connectivity of the dG-AP cross-link released from duplex DNA and provide a foundation for detection of this lesion in biological samples. The dG-AP cross-link in duplex DNA was remarkably stable, decomposing with a half-life of 22 days at pH 7 and 23 °C. The intrinsic chemical stability of the dG-AP cross-link suggests that this lesion in duplex DNA may have the power to block DNA-processing enzymes involved in transcription and replication.

  3. Homologous pairing and the role of pairing centers in meiosis.

    PubMed

    Tsai, Jui-He; McKee, Bruce D

    2011-06-15

    Homologous pairing establishes the foundation for accurate reductional segregation during meiosis I in sexual organisms. This Commentary summarizes recent progress in our understanding of homologous pairing in meiosis, and will focus on the characteristics and mechanisms of specialized chromosome sites, called pairing centers (PCs), in Caenorhabditis elegans and Drosophila melanogaster. In C. elegans, each chromosome contains a single PC that stabilizes chromosome pairing and initiates synapsis of homologous chromosomes. Specific zinc-finger proteins recruited to PCs link chromosomes to nuclear envelope proteins--and through them to the microtubule cytoskeleton--thereby stimulating chromosome movements in early prophase, which are thought to be important for homolog sorting. This mechanism appears to be a variant of the 'telomere bouquet' process, in which telomeres cluster on the nuclear envelope, connect chromosomes through nuclear envelope proteins to the cytoskeleton and lead chromosome movements that promote homologous synapsis. In Drosophila males, which undergo meiosis without recombination, pairing of the largely non-homologous X and Y chromosomes occurs at specific repetitive sequences in the ribosomal DNA. Although no other clear examples of PC-based pairing mechanisms have been described, there is evidence for special roles of telomeres and centromeres in aspects of chromosome pairing, synapsis and segregation; these roles are in some cases similar to those of PCs.

  4. Chirality- and sequence-selective successive self-sorting via specific homo- and complementary-duplex formations

    PubMed Central

    Makiguchi, Wataru; Tanabe, Junki; Yamada, Hidekazu; Iida, Hiroki; Taura, Daisuke; Ousaka, Naoki; Yashima, Eiji

    2015-01-01

    Self-recognition and self-discrimination within complex mixtures are of fundamental importance in biological systems, which entirely rely on the preprogrammed monomer sequences and homochirality of biological macromolecules. Here we report artificial chirality- and sequence-selective successive self-sorting of chiral dimeric strands bearing carboxylic acid or amidine groups joined by chiral amide linkers with different sequences through homo- and complementary-duplex formations. A mixture of carboxylic acid dimers linked by racemic-1,2-cyclohexane bis-amides with different amide sequences (NHCO or CONH) self-associate to form homoduplexes in a completely sequence-selective way, the structures of which are different from each other depending on the linker amide sequences. The further addition of an enantiopure amide-linked amidine dimer to a mixture of the racemic carboxylic acid dimers resulted in the formation of a single optically pure complementary duplex with a 100% diastereoselectivity and complete sequence specificity stabilized by the amidinium–carboxylate salt bridges, leading to the perfect chirality- and sequence-selective duplex formation. PMID:26051291

  5. FRONT VIEW OF FACILITY 561, WHICH WAS ORIGINALLY A DUPLEX. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    FRONT VIEW OF FACILITY 561, WHICH WAS ORIGINALLY A DUPLEX. PHOTO SHOWS THE ONLY UNIT REMAINING, UNIT B (UNIT A WAS DEMOLISHED AFTER A FIRE). VIEW FACING NORTH - Camp H.M. Smith and Navy Public Works Center Manana Title VII (Capehart) Housing, Intersection of Acacia Road and Brich Circle, Pearl City, Honolulu County, HI

  6. A most spectrum-efficient duplexing system: CDD

    NASA Astrophysics Data System (ADS)

    Lee, William C. Y.

    2001-10-01

    The game to play in wireless communications when it comes to increasing spectrum efficiency is to eliminate interference. Currently, all cellular systems use FDD (Frequency Division Duplexing) in an attempt to eliminate the interference from the adjacent cells. Through the use of many technologies only one type of interference remains and that is the adjacent base-tohome mobile interference. TDD (Time Division Duplexing) has not been used for mobile cellular systems, not only because of the adjacent base-to-home mobile interference, but also because of the additional adjacent base-to-home base interference, and adjacent mobile-to-home mobile interference. Therefore, TDD can only be used for small, confined area systems. CDD (Code Division Duplexing) can eliminate all three kinds of interference; the adjacent base-to-home mobile, the adjacent baseto-home base, and the adjacent mobile- to- home in cellular systems. Eliminating each of these interferences makes CDD the most spectrum efficient duplexing system. This talk will elaborate on a set of smart codes, which will make an efficient CDD system a reality.

  7. Computer Maintenance Operations Center (CMOC), showing duplexed cyber 170174 computers ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Computer Maintenance Operations Center (CMOC), showing duplexed cyber 170-174 computers - Beale Air Force Base, Perimeter Acquisition Vehicle Entry Phased-Array Warning System, Techinical Equipment Building, End of Spencer Paul Road, north of Warren Shingle Road (14th Street), Marysville, Yuba County, CA

  8. Extrahelical cytosine bases in DNA duplexes containing d[GCC](n).d[GCC](n) repeats: detection by a mechlorethamine crosslinking reaction.

    PubMed

    Rojsitthisak, P; Romero, R M; Haworth, I S

    2001-11-15

    The cytosine-cytosine (C-C) pair is one of the least stable DNA mismatch pairs. The bases of the C-C mismatch are only weakly hydrogen bonded, and previous work has shown that, in certain sequence contexts, they can become unstacked from the core helix, and adopt an 'extrahelical' location. Here, using DNA duplexes with d[GCC](n).d[GCC](n) fragments containing C-C mismatches in a 1,4 bp relationship, we show that cytosine bases of different formal mismatch pairs can be crosslinked by mechlorethamine. For example, in the duplex d[CTCTCGCCGCCGCCGTATC].d[GATACGCCGCCGCCGAGAG], where underlined cytosine bases are present as the formal C-C mismatch pairs C(7)-C(32), C(10)-C(29) and C(13)-C(26), we show that two mechlorethamine crosslinks form between C(13) and C(29) and between C(10) and C(32), in addition to crosslinks at C(7)-C(32), C(10)-C(29) and C(13)-C(26) (we have reported previously the crosslinking of formal C-C pairs by mechlorethamine). We interpret the formation of the C(13)-C(29) and C(10)-C(32) crosslinks as evidence of an extrahelical location of the crosslinkable cytosines. Such extrahelical cytosine bases have been observed previously for a single C-C mismatch pair (in the so-called E-motif conformation). In the E-motif, the extrahelical cytosines are folded back towards the 5'-end of the duplex, consistent with our crosslinking data, and also consistent with the absence of C(7)-C(29) and C(10)-C(26) crosslinks in the current work. Hence, our data provide evidence for an extended E-motif DNA (eE-DNA) conformation in short d[GCC](n).d[GCC](n) repeat fragments, and raise the possibility that such structures might occur in much longer d[GCC](n).d[GCC](n) repeat tracts.

  9. Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

    PubMed

    Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

    2017-02-23

    Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT)25 or cytosine-guanine (dGdC)20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT)25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC)20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure

  10. A duplex recombinant viral nucleoprotein microbead immunoassay for simultaneous detection of seroresponses to human respiratory syncytial virus and metapneumovirus infections.

    PubMed

    Zhang, Yange; Brooks, W Abdullah; Goswami, Doli; Rahman, Mustafizur; Luby, Stephen P; Erdman, Dean D

    2014-09-01

    Serologic diagnosis of human respiratory syncytial virus (hRSV) and human metapneumovirus (hMPV) infections has been shown to complement virus detection methods in epidemiologic studies. Enzyme immunoassays (EIAs) using cultured virus lysate antigens are often used to diagnose infection by demonstration of a ≥4-fold rises in antibody titer between acute and convalescent serum pairs. In this study, hRSV and hMPV nucleocapsid (recN) proteins were expressed in a baculovirus system and their performance compared with virus culture lysate antigen in EIAs using paired serum specimens collected from symptomatic children. The recN proteins were also used to develop a duplex assay based on the Luminex microbead-based suspension array technology, where diagnostic rises in antibody levels could be determined simultaneously at a single serum dilution. Antibody levels measured by the recN and viral lysate EIAs correlated moderately (hRSV, r(2)=0.72; hMPV, r(2)=0.76); the recN EIAs identified correctly 35 of 37 (94.6%) and 48 of 50 (96%) serum pairs showing diagnostic antibody rises by viral lysate EIAs. Purified recN proteins were then coupled to microbeads and serum pairs were tested at a single dilution on a Luminex MAGPIX(®) analyzer. The duplex recN assay identified correctly 33 of 39 (85%) and 41 of 47 (86.7%) serum pairs showing diagnostic rises to hRSV and hMPV, respectively. The recN assay permits simultaneous testing for acute hRSV and hMPV infections and offers a platform for expanded multiplexing of other respiratory virus assays.

  11. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    PubMed Central

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  12. Evoked potentials to auditory movement sensation in duplex perception.

    PubMed

    Laufer, Ilan; Pratt, Hillel

    2003-07-01

    The purpose of this study was to examine the processing of auditory movement sensation accompanying duplex perception in binaural hearing. Stimuli were formant transitions (presented to the front, left or right of the subject) and base (presented to the front), that fused to result in vowel-consonant-vowel (V-C-V) sequences /aga/ and /ada/. An illusion of auditory movement (duplex sensation) accompanied the fusion of these V-C-V sequences when the spatial locations of the formant transitions and base were different. Ten right-handed, adult, native Hebrew speakers discriminated each fused stimulus, and the brain potentials associated with performance of the task were recorded from 21 electrodes. The processing of auditory movement was studied by a factorial design (ANOVA) and statistical non-parametric mapping (SnPM) of low resolution electromagnetic tomography (LORETA) images of the net-fusion response. Brain regions implicated in auditory movement processing were expected to be associated with the lateralized formant location, which gave rise to duplex perception. In addition, the time-course of significant activation in brain areas that differentiated between fusion conditions was determined. The posterior parietal, anterior cingulate and premotor cortices were found to be implicated in duplex processing. Auditory cortex involvement was also evident, and together with the latter two brain regions was affected by right-ear advantage. Duplex perception resulting from fusion of spatially separate sounds forming an auditory object results in activation of a network of brain regions reflecting enhanced allocation of attention and the effect of language processing.

  13. Direct measurement of sequence-dependent transition path times and conformational diffusion in DNA duplex formation.

    PubMed

    Neupane, Krishna; Wang, Feng; Woodside, Michael T

    2017-02-07

    The conformational diffusion coefficient, D, sets the timescale for microscopic structural changes during folding transitions in biomolecules like nucleic acids and proteins. D encodes significant information about the folding dynamics such as the roughness of the energy landscape governing the folding and the level of internal friction in the molecule, but it is challenging to measure. The most sensitive measure of D is the time required to cross the energy barrier that dominates folding kinetics, known as the transition path time. To investigate the sequence dependence of D in DNA duplex formation, we measured individual transition paths from equilibrium folding trajectories of single DNA hairpins held under tension in high-resolution optical tweezers. Studying hairpins with the same helix length but with G:C base-pair content varying from 0 to 100%, we determined both the average time to cross the transition paths, τtp, and the distribution of individual transit times, PTP(t). We then estimated D from both τtp and PTP(t) from theories assuming one-dimensional diffusive motion over a harmonic barrier. τtp decreased roughly linearly with the G:C content of the hairpin helix, being 50% longer for hairpins with only A:T base pairs than for those with only G:C base pairs. Conversely, D increased linearly with helix G:C content, roughly doubling as the G:C content increased from 0 to 100%. These results reveal that G:C base pairs form faster than A:T base pairs because of faster conformational diffusion, possibly reflecting lower torsional barriers, and demonstrate the power of transition path measurements for elucidating the microscopic determinants of folding.

  14. [Interaction of Dystamycin Dimeric Analog with Poly(dA) x poly(dT), Poly[d(A-T)] x poly[d(A-T)] and Duplex O23 at Origin of Replication of the Herpes Simplex Virus].

    PubMed

    Surovaya, A N; Bazhulina, N P; Lepehina, S Yu; Andronova, V L; Galegov, G A; Moiseeva, E D; Grokhovsky, S L; Gursky, G V

    2016-01-01

    The binding of distamycin dimeric analog (Pt-bis-Dst) to poly[d(A-T)] x poly[d(A-T)1, poly(dA) x poly(dT) and duplex O23 with the sequence 5'-GCCAATATATATATATTATTAGG-3' which is present at the origin of replication of herpes simplex virus OriS is investigated with the use of UV and CD spectroscopy. The distinction of the synthetic polyamide from a natural antibiotic lies in the fact that in the synthetic polyamide there are two distamycin moieties bound via a glycine cis-diamino platinum group. It was shown that the binding of Pt-bis-Dst to poly[d(A-T)] x poly[d(A-T)] and poly(dA) x poly(dT) reaches saturation if one molecule of the ligand occurs at approximately every 8 bp. With further increase in the ratio of the added ligand to the base pairs in CD spectra of complexes with poly[d(A-T)] x poly[d(A-T)], we observed that the maximum wavelength band tend to be shifted towards longer wavelengths, while in the spectral region of 290-310 nm a "shoulder", that was absent in the spectra of the complexes obtained at low polymer coverages by the ligand, appeared. At high molar concentration ratios of ligand to oligonucleotide Pt-bis-Dst can bind to poly[d(A-T)] x poly[d(A-T)] in the form of hairpins or may form associates by the interaction between the distamycin moieties of neighboring molecules of Pt-bis-Dst. The structure of the complexes is stabilized by interactions between pirrolcarboxamide moieties of two molecules of Pt-bis-Dst adsorbed on adjacent overlapping binding sites. These interactions are probably also responsible for the concentration-dependent spectral changes observed during the formation of a complex between Pt-bis-Dst and poly[d(A-T)] x poly[d(A-T)]. Spectral changes are almost absent in binding of Pt-bis-Dst to poly(dA) x poly(dT). Binding of Pt-bis-Dst to duplex O23 reaches saturation if two ligand molecules occur in a duplex that contains a cluster of 18 AT pairs. With increasing the molar concentration ratio of the ligand to the duplex CD

  15. Mapping structurally defined guanine oxidation products along DNA duplexes: influence of local sequence context and endogenous cytosine methylation.

    PubMed

    Ming, Xun; Matter, Brock; Song, Matthew; Veliath, Elizabeth; Shanley, Ryan; Jones, Roger; Tretyakova, Natalia

    2014-03-19

    DNA oxidation by reactive oxygen species is nonrandom, potentially leading to accumulation of nucleobase damage and mutations at specific sites within the genome. We now present the first quantitative data for sequence-dependent formation of structurally defined oxidative nucleobase adducts along p53 gene-derived DNA duplexes using a novel isotope labeling-based approach. Our results reveal that local nucleobase sequence context differentially alters the yields of 2,2,4-triamino-2H-oxal-5-one (Z) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (OG) in double stranded DNA. While both lesions are overproduced within endogenously methylated (Me)CG dinucleotides and at 5' Gs in runs of several guanines, the formation of Z (but not OG) is strongly preferred at solvent-exposed guanine nucleobases at duplex ends. Targeted oxidation of (Me)CG sequences may be caused by a lowered ionization potential of guanine bases paired with (Me)C and the preferential intercalation of riboflavin photosensitizer adjacent to (Me)C:G base pairs. Importantly, some of the most frequently oxidized positions coincide with the known p53 lung cancer mutational "hotspots" at codons 245 (GGC), 248 (CGG), and 158 (CGC) respectively, supporting a possible role of oxidative degradation of DNA in the initiation of lung cancer.

  16. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    PubMed

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  17. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes

    NASA Astrophysics Data System (ADS)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-03-01

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10-3 to 10-5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  18. Assessment of thermal embrittlement in duplex stainless steels 2003 and 2205 for nuclear power applications

    DOE PAGES

    Tucker, J. D.; Miller, M. K.; Young, G. A.

    2015-04-01

    Duplex stainless steels are desirable for use in power generation systems due to their attractive combination of strength, corrosion resistance, and cost. However, thermal embrittlement at intermediate homologous temperatures of ~887°F (475°C) and below, via spinodal decomposition, limits upper service temperatures for many applications. New lean grade duplex alloys have improved thermal stability over standard grades and potentially increase the upper service temperature or the lifetime at a given temperature for this class of material. The present work compares the thermal stability of lean grade, alloy 2003 to standard grade, alloy 2205, through a series of isothermal agings between 500°Fmore » (260°C) and 900°F (482°C) for times between 1 and 10,000 hours. Aged samples were characterized by changes in microhardness and impact toughness. Additionally, atom probe tomography was performed to illustrate the evolution of the α-α' phase separation in both alloys at select conditions. Atom probe tomography confirmed that phase separation occurs via spinodal decomposition for both alloys and identified the formation of Ni-Cu-Si-Mn-P clusters in alloy 2205 that may contribute to embrittlement of this alloy. The impact toughness model predictions for upper service temperature show that alloy 2003 can be considered for use in 550°F applications for 80 year service lifetimes based on a Charpy V-notch criteria of 35 ft-lbs at 70°F. Alloy 2205 should be limited to 500°F applications.« less

  19. Assessment of thermal embrittlement in duplex stainless steels 2003 and 2205 for nuclear power applications

    SciTech Connect

    Tucker, J. D.; Miller, M. K.; Young, G. A.

    2015-04-01

    Duplex stainless steels are desirable for use in power generation systems due to their attractive combination of strength, corrosion resistance, and cost. However, thermal embrittlement at intermediate homologous temperatures of ~887°F (475°C) and below, via spinodal decomposition, limits upper service temperatures for many applications. New lean grade duplex alloys have improved thermal stability over standard grades and potentially increase the upper service temperature or the lifetime at a given temperature for this class of material. The present work compares the thermal stability of lean grade, alloy 2003 to standard grade, alloy 2205, through a series of isothermal agings between 500°F (260°C) and 900°F (482°C) for times between 1 and 10,000 hours. Aged samples were characterized by changes in microhardness and impact toughness. Additionally, atom probe tomography was performed to illustrate the evolution of the α-α' phase separation in both alloys at select conditions. Atom probe tomography confirmed that phase separation occurs via spinodal decomposition for both alloys and identified the formation of Ni-Cu-Si-Mn-P clusters in alloy 2205 that may contribute to embrittlement of this alloy. The impact toughness model predictions for upper service temperature show that alloy 2003 can be considered for use in 550°F applications for 80 year service lifetimes based on a Charpy V-notch criteria of 35 ft-lbs at 70°F. Alloy 2205 should be limited to 500°F applications.

  20. The physical determinants of the DNA conformational landscape: an analysis of the potential energy surface of single-strand dinucleotides in the conformational space of duplex DNA

    PubMed Central

    Elsawy, Karim M.; Hodgson, Michael K.; Caves, Leo S. D.

    2005-01-01

    A multivariate analysis of the backbone and sugar torsion angles of dinucleotide fragments was used to construct a 3D principal conformational subspace (PCS) of DNA duplex crystal structures. The potential energy surface (PES) within the PCS was mapped for a single-strand dinucleotide model using an empirical energy function. The low energy regions of the surface encompass known DNA forms and also identify previously unclassified conformers. The physical determinants of the conformational landscape are found to be predominantly steric interactions within the dinucleotide backbone, with medium-dependent backbone-base electrostatic interactions serving to tune the relative stability of the different local energy minima. The fidelity of the PES to duplex DNA properties is validated through a correspondence to the conformational distribution of duplex DNA crystal structures and the reproduction of observed sequence specific propensities for the formation of A-form DNA. The utility of the PES is demonstrated through its succinct and accurate description of complex conformational processes in simulations of duplex DNA. The study suggests that stereochemical considerations of the nucleic acid backbone play a role in determining conformational preferences of DNA which is analogous to the role of local steric interactions in determining polypeptide secondary structure. PMID:16214808

  1. Development and evaluation of a single-step duplex PCR for simultaneous detection of Fasciola hepatica and Fasciola gigantica (family Fasciolidae, class Trematoda, phylum Platyhelminthes).

    PubMed

    Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

    2012-08-01

    A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.

  2. Development and Evaluation of a Single-Step Duplex PCR for Simultaneous Detection of Fasciola hepatica and Fasciola gigantica (Family Fasciolidae, Class Trematoda, Phylum Platyhelminthes)

    PubMed Central

    Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

    2012-01-01

    A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744

  3. Stability of Electron Pairs--A Myth.

    ERIC Educational Resources Information Center

    Duke, B. J.

    1978-01-01

    This article discusses errors in the presentation of valence theory in undergraduate chemistry textbooks, and the resulting misunderstandings in the minds of many students. Particular emphasis is given to the explanation of the trend in ionization energies along the first row of the periodic table. (BB)

  4. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

    NASA Astrophysics Data System (ADS)

    Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

    2005-09-01

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  5. Electron interaction with a DNA duplex: dCpdC:dGpdG.

    PubMed

    Gu, Jiande; Wang, Jing; Leszczynski, Jerzy

    2016-05-21

    Electron attachment to double-stranded cytosine-rich DNA, dCpdC:dGpdG, has been studied by density functional theory. This system represents a minimal descriptive unit of a cytosine-rich double-stranded DNA helix. A significant electron affinity for the formation of a cytosine-centered radical anion is revealed to be about 2.2 eV. The excess electron may reside on the nucleobase at the 5' position (dC˙(-)pdC:dGpdG) or at the 3' position (dCpdC˙(-):dGpdG). The inter-strand proton transfer between the radical anion centered cytosine (N3) and the paired guanine (HN1) results in the formation of radical anion center separated complexes dC1H˙pdC:dG2-H(-)pdG and dCpdC2H˙:dGpdG1-H(-). These distonic radical anions are found to be approximately 1 to 4 kcal mol(-1) more stable than the normal radical anions. Intra-strand cytosine π→π transition energies are below the electron detachment energy. Inter-strand π→π transitions of the excess electron from C to G are predicted to be less than 2.79 eV. Electron transfer might also be possible through the inter-strand base-jumping mode. An analysis of absorption visible spectra reveals the absorption bands ranging from 500 nm to 700 nm for the cytosine-rich radical anions of the DNA duplex. Electron attachment to cytidine oligomers might add color to the DNA duplex.

  6. Homologous recombination intermediates between two duplex DNA catalysed by human cell extracts.

    PubMed Central

    Lopez, B; Rousset, S; Coppey, J

    1987-01-01

    Using as substrates, 1: the replicative form (RF) of phage M13 mp8 in which the reading frame of the lac Z' gene was disrupted by insertion of an octonucleotide, and 2: a restriction fragment one kb long, containing the functional lac Z' gene (isolated from wild type M13 mp8), we show that nuclear extracts from human cells (3 lines tested) promote the targeted replacement of the altered sequence by the functional one. Following incubation with the extracts, the DNA's were introduced in JM 109 bacteria (rec A- and lac Z'-) which were grown in presence of a colorimetric indicator of beta-galactosidase activity. Homologous recombination gives rise to the genotypical modification: lac Z'+ instead of lac Z'- in the bacteriophage DNA. This is revealed by phenotypical expression of the lac Z' gene product in replicating bacteriophage, i.e. the formation of blue instead of white plaques. The frequency of recombination (blue/total plaques) is increased by a factor of 50-80 as a function of protein concentration and of incubation time. The maximal frequency observed is 5 X 10(-5). There is no increase over the background when extracts are boiled. Electrophoresis and electron microscopy of DNA's incubated with the extracts show the formation of recombination intermediates with single strand exchange. Restriction analysis of recombined DNA confirms that the process corresponds to targeted sequence exchange. These data allow to propose three steps for homologous recombination between two duplex DNA's: i) unpairing of the two duplexes; ii) single-strand exchange and synaptic pairing; iii) resolution of the cross-junctions. The three steps correspond to those predicted by the gene conversion model of Holliday. Images PMID:3302944

  7. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

    PubMed

    Izanloo, Cobra

    2017-09-26

    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  8. Gas-fired duplex free-piston Stirling refrigerator

    NASA Astrophysics Data System (ADS)

    Urieli, L.

    1984-03-01

    The duplex free-piston Stirling refrigerator is a potentially high efficiency, high reliability device which is ideally suited to the home appliance field, in particular as a gas-fired refrigerator. It has significant advantages over other equivalent devices including freedom from halogenated hydrocarbons, extremely low temperatures available at a high efficiency, integrated water heating, and simple burner system control. The design and development of a portable working demonstration gas-fired duplex Stirling refrigeration unit is described. A unique combination of computer aided development and experimental development was used, enabling a continued interaction between the theoretical analysis and practical testing and evaluation. A universal test rig was developed in order to separately test and evaluate major subunits, enabling a smooth system integration phase.

  9. Herpes Zoster Duplex Unilateralis: Two Cases and Brief Literature Review

    PubMed Central

    Son, Jee Hee; Chung, Bo Young; Kim, Hye One; Cho, Hee Jin

    2016-01-01

    Cases involving dermatomal herpes zoster in two or more locations are rare, especially in immunocompetent patients. When two noncontiguous dermatomes are involved, if affected unilaterally, it is called herpes zoster duplex unilateralis; if bilaterally, bilateralis. Here, we report two cases of herpes zoster duplex unilateralis. A 66-year-old man presented with painful erythematous grouped vesicles on his left scalp, forehead, trunk, and back (left [Lt.] V1, Lt. T8). Histologic findings were consistent with herpetic infection. A 33-year-old woman presented with painful erythematous grouped vesicles and crust on her left forehead and neck (Lt. V1, Lt. C5). Both patients were treated with oral administration of famcyclovir 750 mg/day for seven days. PMID:27904277

  10. Direct surface-enhanced Raman scattering analysis of DNA duplexes.

    PubMed

    Guerrini, Luca; Krpetić, Željka; van Lierop, Danny; Alvarez-Puebla, Ramon A; Graham, Duncan

    2015-01-19

    The exploration of the genetic information carried by DNA has become a major scientific challenge. Routine DNA analysis, such as PCR, still suffers from important intrinsic limitations. Surface-enhanced Raman spectroscopy (SERS) has emerged as an outstanding opportunity for the development of DNA analysis, but its application to duplexes (dsDNA) has been largely hampered by reproducibility and/or sensitivity issues. A simple strategy is presented to perform ultrasensitive direct label-free analysis of unmodified dsDNA with the means of SERS by using positively charged silver colloids. Electrostatic adhesion of DNA promotes nanoparticle aggregation into stable clusters yielding intense and reproducible SERS spectra at nanogram level. As potential applications, we report the quantitative recognition of hybridization events as well as the first examples of SERS recognition of single base mismatches and base methylations (5-methylated cytosine and N6-methylated Adenine) in duplexes.

  11. Conserved guanine-guanine stacking in tetraplex and duplex DNA.

    PubMed

    Kypr, J; Fialová, M; Chládková, J; Tůmová, M; Vorlícková, M

    2001-12-01

    Using a series of suitably chosen oligonucleotides, we demonstrate that the DNA duplex of d(CCCCGGGG) provides an almost identical CD spectrum as the parallel-stranded tetraplex of d(GGGG). The CD spectra are very sensitive to base stacking in DNA so that the above observation indicates that guanine-guanine stacking is essentially the same within the duplex of d(CCCCGGGG) and the tetraplex of d(GGGG). A very similar CD spectrum is also provided by the A-form of d(CCCCGGGG) induced by trifluoroethanol. These results reveal that guanine-guanine stacking is a structural invariant conserved in various nucleic acid conformers. The structural invariance is likely to cohere with evolution of the genetic molecules and be important for fundamental functions, e.g. initiation of transcription.

  12. Duplex stainless steels for the pulp and paper industry

    SciTech Connect

    Alfonsson, E.; Olsson, J.

    1999-07-01

    The metallurgy and corrosion resistance of duplex stainless steel, particularly with regards to applications in the pulp and paper industry, are described. Practical experiences from pressure vessel installations in cooking plants and bleach plants as well as from non-pressurized items in different parts along the fiber line, are given. The paper also reviews corrosion test results presented previously and compares these with recent test data and the practical experiences. Though most of the installations have been successful, some cases of corrosion attacks on duplex stainless steel have been reported, although these are very limited in number: one digester, one calorifier, two pulp storage towers, and two bleach plant filter washers, of a total of more than 700 identified installations.

  13. Recursive DNA Assembly Using Protected Oligonucleotide Duplex Assisted Cloning (PODAC).

    PubMed

    Van Hove, Bob; Guidi, Chiara; De Wannemaeker, Lien; Maertens, Jo; De Mey, Marjan

    2017-06-16

    A problem rarely tackled by current DNA assembly methods is the issue of cloning additional parts into an already assembled construct. Costly PCR workflows are often hindered by repeated sequences, and restriction based strategies impose design constraints for each enzyme used. Here we present Protected Oligonucleotide Duplex Assisted Cloning (PODAC), a novel technique that makes use of an oligonucleotide duplex for iterative Golden Gate cloning using only one restriction enzyme. Methylated bases confer protection from digestion during the assembly reaction and are removed during replication in vivo, unveiling a new cloning site in the process. We used this method to efficiently and accurately assemble a biosynthetic pathway and demonstrated its robustness toward sequence repeats by constructing artificial CRISPR arrays. As PODAC is readily amenable to standardization, it would make a useful addition to the synthetic biology toolkit.

  14. Microstructure, Properties and Weldability of Duplex Stainless Steel 2101

    NASA Astrophysics Data System (ADS)

    Ma, Li; Hu, Shengsun; Shen, Junqi

    2017-01-01

    The continuous development of duplex stainless steels (DSSs) is due to their excellent corrosion resistance in aggressive environments and their mechanical strength, which is usually twice of conventional austenitic stainless steels (ASSs). In this paper, a designed lean duplex stainless steel 2101, with the alloy design of reduced nickel content and increased additions of manganese and nitrogen, is studied by being partly compared with typical ASS 304L steels. The microstructure, mechanical properties, impact toughness, corrosion resistance and weldability of the designed DSS 2101 were conducted. The results demonstrated that both 2101 steel and its weldment show excellent mechanical properties, impact toughness and corrosion resistance, so DSS 2101 exhibits good comprehensive properties and can be used to replace 304L in numerous applications.

  15. Investigation of plastic deformation heterogeneities in duplex steel by EBSD

    SciTech Connect

    Wronski, S.; Tarasiuk, J.; Bacroix, B.; Baczmanski, A.; Braham, C.

    2012-11-15

    An EBSD analysis of a duplex steel (austeno-ferritic) deformed in tension up to fracture is presented. The main purpose of the paper is to describe, qualitatively and quantitatively, the differences in the behavior of the two phases during plastic deformation. In order to do so, several topological maps are measured on the deformed state using the electron backscatter diffraction technique. Distributions of grain size, misorientation, image quality factor and texture are then analyzed in detail. - Highlights: Black-Right-Pointing-Pointer Heterogeneities in duplex steel is studied. Black-Right-Pointing-Pointer The behavior of the two phases during plastic deformation is studied. Black-Right-Pointing-Pointer IQ factor distribution and misorientation characteristics are examined using EBSD.

  16. Target-controlled formation of silver nanoclusters in abasic site-incorporated duplex DNA for label-free fluorescence detection of theophylline

    NASA Astrophysics Data System (ADS)

    Park, Ki Soo; Oh, Seung Soo; Soh, H. Tom; Park, Hyun Gyu

    2014-08-01

    A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to the cytosine nucleobase is prevented. Consequently, fluorescent silver nanoclusters are not formed causing a significant reduction of the fluorescence signal. By employing this new sensor, theophylline can be highly selectively detected at a concentration as low as 1.8 μM. Finally, the diagnostic capability and practical application of this sensor were demonstrated by its use in detecting theophylline in human blood serum.A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex