NASA Technical Reports Server (NTRS)
Moehler, S.; Landsman, W. B.; Sweigart, A. V.; Grundahl, F.
2002-01-01
We present the results of spectroscopic analyses of hot horizontal branch (HB) stars in M13 and M3, which form a famous second parameter pair. From the spectra we derived - for the first time in M13 - atmospheric parameters (effective temperature and surface gravity) as well as abundances of helium, magnesium, and iron. Consistent with analyses of hot HB stars in other globular clusters we find evidence for helium depletion and iron enrichment in stars hotter than about 12,000 K in both M3 and M13. Accounting for the iron enrichment substantially improves the agreement with canonical evolutionary models, although the derived gravities and masses are still somewhat too low. This remaining discrepancy may be an indication that scaled-solar metal-rich model atmospheres do not adequately represent the highly non-solar abundance ratios found in blue HB stars with radiative levitation. We discuss the effects of an enhancement in the envelope helium abundance on the atmospheric parameters of the blue HB stars, as might be caused by deep mixing on the red giant branch or primordial pollution from an earlier generation of intermediate mass asymptotic giant branch stars.
Wang, Xiaoyu; Hoshika, Shuichi; Peterson, Raymond J; Kim, Myong-Jung; Benner, Steven A; Kahn, Jason D
2017-05-19
Synthetic nucleobases presenting non-Watson-Crick arrangements of hydrogen bond donor and acceptor groups can form additional nucleotide pairs that stabilize duplex DNA independent of the standard A:T and G:C pairs. The pair between 2-amino-3-nitropyridin-6-one 2'-deoxyriboside (presenting a {donor-donor-acceptor} hydrogen bonding pattern on the Watson-Crick face of the small component, trivially designated Z) and imidazo[1,2-a]-1,3,5-triazin-4(8H)one 2'-deoxyriboside (presenting an {acceptor-acceptor-donor} hydrogen bonding pattern on the large component, trivially designated P) is one of these extra pairs for which a substantial amount of molecular biology has been developed. Here, we report the results of UV absorbance melting measurements and determine the energetics of binding of DNA strands containing Z and P to give short duplexes containing Z:P pairs as well as various mismatches comprising Z and P. All measurements were done at 1 M NaCl in buffer (10 mM Na cacodylate, 0.5 mM EDTA, pH 7.0). Thermodynamic parameters (ΔH°, ΔS°, and ΔG° 37 ) for oligonucleotide hybridization were extracted. Consistent with the Watson-Crick model that considers both geometric and hydrogen bonding complementarity, the Z:P pair was found to contribute more to duplex stability than any mismatches involving either nonstandard nucleotide. Further, the Z:P pair is more stable than a C:G pair. The Z:G pair was found to be the most stable mismatch, forming either a deprotonated mismatched pair or a wobble base pair analogous to the stable T:G mismatch. The C:P pair is less stable, perhaps analogous to the wobble pair observed for C:O 6 -methyl-G, in which the pyrimidine is displaced into the minor groove. The Z:A and T:P mismatches are much less stable. Parameters for predicting the thermodynamics of oligonucleotides containing Z and P bases are provided. This represents the first case where this has been done for a synthetic genetic system.
NASA Technical Reports Server (NTRS)
Moehler, S.; Landsman, W. B.; Sweigart, A. V.; Grundahl, F.
2003-01-01
We present the results of spectroscopic analyses of hot horizontal branch (HB) stars in M 13 and M 3, which form a famous "second parameter" pair. F rom the spectra and Stromgren photometry we derived - for the first time in M 13 - atmospheric parameters (effective temperature and surface gravity). For stars with Stromgren temperatures between 10,000 and 12,000 K we found excellent agreement between the atmospheric parameters derived from Stromgren photometry and those derived from Balmer line profile fits. However, for cooler stars there is a disagreement in the parameters derived by the two methods, for which we have no satisfactory explanation. Stars hotter than 12,000 K show evidence for helium depletion and iron enrichment, both in M 3 and M 13. Accounting for the iron enrichment substantially improves the agreement with canonical evolutionary models, although the derived gravities and masses are still somewhat too low. This remaining discrepancy may be an indication that scaled-solar metal-rich model atmospheres do not adequately represent the highly non-solar abundance ratios found in blue HB stars affected by diffusion. We discuss the effects of an enhancement in the envelope helium abundance on the atmospheric parameters of the blue HB stars, as might be caused by deep mixing on the red giant branch or primordial pollution from an earlier generation of intermediate mass asymptotic giant branch stars. Key words. Stars: atmospheres - Stars: evolution - Stars: horizontal branch - Globular clusters: individual: M 3 - Globular clusters: individual: M 13
Pullen, Anthony E.; Faulmann, Christophe; Pokhodnya, Konstantin I.; Cassoux, Patrick; Tokumoto, Madoka
1998-12-28
A series of metal bis-mnt complexes (mnt = 1,2-dithiolatomaleonitrile) with the trimethylammonium methylferrocene cation have been synthesized and characterized using X-ray diffraction, magnetic susceptibility, and differential scanning calorimetry measurements. The complexes have the formulas (FcCH(2)NMe(3))[Ni(mnt)(2)] (2), (FcCH(2)NMe(3))[Pt(mnt)(2)] (3), and (FcCH(2)NMe(3))(2)[Cu(mnt)(2)] (4) (where Fc = ferrocene). At 300 K, the crystal structures of 1:1 complexes 2 and 3 are very similar. They consist of pairs of [M(mnt)(2)](-) in a slipped configuration packed in stacks. Each [M(mnt)(2)](-) stack is separated from adjacent stacks by two columns of cations. Within the pairs, the [M(mnt)(2)](-) anions interact via short M.S contacts, while there are no short contacts between the pairs. Complex 4, which has a 2:1 stoichiometry, exhibits a markedly different packing arrangement of the anionic units. Due to the special position of the Cu atom in the asymmetric unit cell, [Cu(mnt)(2)](2)(-) dianions are completely isolated from each other. The magnetic susceptibility behavior of the nickel complex is consistent with the presence of magnetically isolated, antiferromagnetically (AF) coupled [Ni(mnt)(2)](-) pairs with the AF exchange parameter, J = -840 cm(-)(1). The platinum complex undergoes an endothermic structural phase transition (T(p)) at 247 K. Below T(p) its structure is characterized by the formation of magnetically isolated [Pt(mnt)(2)](2)(2)(-) dimers in an eclipsed configuration with short Pt.Pt and S.S contacts between monomers. In the magnetic properties, the structural changes reveal themselves as an abrupt susceptibility drop implying a substantial increase of the AF exchange parameter. A mechanism of the phase transition in the platinum compound is proposed. For compound 4, paramagnetic behavior is observed.
Continuation of periodic orbits in the Sun-Mercury elliptic restricted three-body problem
NASA Astrophysics Data System (ADS)
Peng, Hao; Bai, Xiaoli; Xu, Shijie
2017-06-01
Starting from resonant Halo orbits in the Circular Restricted Three-Body Problem (CRTBP), Multi-revolution Elliptic Halo (ME-Halo) orbits around L1 and L2 points in the Sun-Mercury Elliptic Restricted Three-Body Problem (ERTBP) are generated systematically. Three pairs of resonant parameters M5N2, M7N3 and M9N4 are tested. The first pair shows special features and is investigated in detail. Three separated characteristic curves of periodic orbit around each libration point are obtained, showing the eccentricity varies non-monotonically along these curves. The eccentricity of the Sun-Mercury system can be achieved by continuation method in just a few cases. The stability analysis shows that these orbits are all unstable and the complex instability occurs with certain parameters. This paper shows new periodic orbits in both the CRTBP and the ERTBP. Totally four periodic orbits with parameters M5N2 around each libration points are extracted in the Sun-Mercury ERTBP.
Sowers, L C; Sedwick, W D; Shaw, B R
1989-11-01
Protonation of cytosine residues at physiological pH may occur in DNA as a consequence of both alkylation and aberrant base-pair formation. When cytosine derivatives are protonated, they undergo hydrolysis reactions at elevated rates and can either deaminate to form the corresponding uracil derivatives or depyrimidinate generating abasic sites. The kinetic parameters for reaction of protonated cytosine are derived by studying the hydrolysis of N3-methyl-2'-deoxycytidine (m3dC), a cytosine analogue which is predominantly protonated at physiological pH. Both deamination and depyrimidimation reaction rates are shown to be linearly dependent upon the fraction of protonated molecules. We present here thermodynamic parameters which allow determination of hydrolysis rates of m3dC as functions of pH and temperature. Protonation of cytosine residues in DNA, as induced by aberrant base-pair formation or base modification, may accelerate the rate of both deamination and depyrimidation up to several thousand-fold under physiological conditions.
Orbitally limited pair-density-wave phase of multilayer superconductors
NASA Astrophysics Data System (ADS)
Möckli, David; Yanase, Youichi; Sigrist, Manfred
2018-04-01
We investigate the magnetic field dependence of an ideal superconducting vortex lattice in the parity-mixed pair-density-wave phase of multilayer superconductors within a circular cell Ginzburg-Landau approach. In multilayer systems, due to local inversion symmetry breaking, a Rashba spin-orbit coupling is induced at the outer layers. This combined with a perpendicular paramagnetic (Pauli) limiting magnetic field stabilizes a staggered layer dependent pair-density-wave phase in the superconducting singlet channel. The high-field pair-density-wave phase is separated from the low-field BCS phase by a first-order phase transition. The motivating guiding question in this paper is: What is the minimal necessary Maki parameter αM for the appearance of the pair-density-wave phase of a superconducting trilayer system? To address this problem we generalize the circular cell method for the regular flux-line lattice of a type-II superconductor to include paramagnetic depairing effects. Then, we apply the model to the trilayer system, where each of the layers are characterized by Ginzburg-Landau parameter κ0 and a Maki parameter αM. We find that when the spin-orbit Rashba interaction compares to the superconducting condensation energy, the orbitally limited pair-density-wave phase stabilizes for Maki parameters αM>10 .
Estimation of Confidence Intervals for Multiplication and Efficiency
DOE Office of Scientific and Technical Information (OSTI.GOV)
Verbeke, J
2009-07-17
Helium-3 tubes are used to detect thermal neutrons by charge collection using the {sup 3}He(n,p) reaction. By analyzing the time sequence of neutrons detected by these tubes, one can determine important features about the constitution of a measured object: Some materials such as Cf-252 emit several neutrons simultaneously, while others such as uranium and plutonium isotopes multiply the number of neutrons to form bursts. This translates into unmistakable signatures. To determine the type of materials measured, one compares the measured count distribution with the one generated by a theoretical fission chain model. When the neutron background is negligible, the theoreticalmore » count distributions can be completely characterized by a pair of parameters, the multiplication M and the detection efficiency {var_epsilon}. While the optimal pair of M and {var_epsilon} can be determined by existing codes such as BigFit, the uncertainty on these parameters has not yet been fully studied. The purpose of this work is to precisely compute the uncertainties on the parameters M and {var_epsilon}, given the uncertainties in the count distribution. By considering different lengths of time tagged data, we will determine how the uncertainties on M and {var_epsilon} vary with the different count distributions.« less
Holographic screening length in a hot plasma of two sphere
NASA Astrophysics Data System (ADS)
Atmaja, A. Nata; Kassim, H. Abu; Yusof, N.
2015-11-01
We study the screening length L_{max} of a moving quark-antiquark pair in a hot plasma, which lives in a two sphere, S^2, using the AdS/CFT correspondence in which the corresponding background metric is the four-dimensional Schwarzschild-AdS black hole. The geodesic of both ends of the string at the boundary, interpreted as the quark-antiquark pair, is given by a stationary motion in the equatorial plane by which the separation length L of both ends of the string is parallel to the angular velocity ω . The screening length and total energy H of the quark-antiquark pair are computed numerically and show that the plots are bounded from below by some functions related to the momentum transfer P_c of the drag force configuration. We compare the result by computing the screening length in the reference frame of the moving quark-antiquark pair, in which the background metrics are "Boost-AdS" and Kerr-AdS black holes. Comparing both black holes, we argue that the mass parameters M_{Sch} of the Schwarzschild-AdS black hole and M_{Kerr} of the Kerr-AdS black hole are related at high temperature by M_{Kerr}=M_{Sch}(1-a^2l^2)^{3/2}, where a is the angular momentum parameter and l is the AdS curvature.
Machado, Christiano Bittencourt; Pereira, Wagner Coelho de Albuquerque; Meziri, Mahmoud; Laugier, Pascal
2006-05-01
This work studied the periodicity of in vitro healthy and pathologic liver tissue, using backscattered ultrasound (US) signals. It utilized the mean scatterer spacing (MSS) as a parameter of tissue characterization, estimated by three methods: the spectral autocorrelation (SAC), the singular spectrum analysis (SSA) and the quadratic transformation method (SIMON). The liver samples were classified in terms of tissue status using the METAVIR scoring system. Twenty tissue samples were classified in four groups: F0, F1, F3 and F4 (five samples for each). The Kolmogorov-Smirnov test (applied on group pairs) resulted as nonsignificant (p > 0.05) for two pairs only: F1/F3 (for SSA) and F3/F4 (for SAC). A discriminant analysis was applied using as parameters the MSS mean (MSS) and standard deviation (sigmaMSS), the estimates histogram mode (mMSS), and the speed of US (mc(foie)) in the medium, to evaluate the degree of discrimination among healthy and pathologic tissues. The better accuracy (Ac) with SAC (80%) was with parameter group (MSS, sigmaMSS, mc(foie)), achieving a sensitivity (Ss) of 92.3% and a specificity (Sp) of 57.1%. For SSA, the group with all four parameters showed an Ac of 75%, an Ss of 78.6% and an Sp of 66.70%. SIMON obtained the best Ac of all (85%) with group (MSS, mMSS, mc(foie)), an Ss of 100%, but with an Sp of 50%.
Pal Anagoni, Suresh; Kauser, Asma; Maity, Gopal; Upadhyayula, Vijayasarathi V R
2018-02-01
Chemical warfare agents such as organophosphorus nerve agents, mustard agents, and psychotomimetic agent like 3-quinuclidinylbenzilate degrade in the environment and form acidic degradation products, the analysis of which is difficult under normal analytical conditions. In the present work, a simultaneous extraction and derivatization method in which the analytes are butylated followed by gas chromatography and mass spectrometric identification of the analytes from aqueous and soil samples was carried out. The extraction was carried out using ion-pair solid-phase extraction with tetrabutylammonium hydroxide followed by gas chromatography with mass spectrometry in the electron ionization mode. Various parameters such as optimum concentration of the ion-pair reagent, pH of the sample, extraction solvent, and type of ion-pair reagent were optimized. The method was validated for various parameters such as linearity, accuracy, precision, and limit of detection and quantification. The method was observed to be linear from 1 to 1000 ng/mL range in selected ion monitoring mode. The extraction recoveries were in the range of 85-110% from the matrixes with the limit of quantification for alkyl phosphonic acids at 1 ng/mL, thiodiglycolic acid at 20 ng/mL, and benzilic acid at 50 ng/mL with intra- and interday precisions below 15%. The developed method was applied for the samples prepared in the scenario of challenging inspection. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.
2006-01-01
Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533
Pilch, D S; Brousseau, R; Shafer, R H
1990-01-01
We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768
Wake recontact: An experimental investigation using a ringslot parachute
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strickland, J.H.; Macha, J.M.
1989-01-01
A series of tests was conducted on a 10-ft.-diameter ringslot parachute with a geometric porosity of 20% to establish the conditions under which ''wake recontact'' occurs. The vertical helicopter drop tests covered a range of mass ratios from 0.5 to 3.0 and a range of Froude numbers from 70 to 400. Data consisted of velocity time histories obtained using a laser tracker and diameter time histories obtained from photometric data. A collapse parameter based on the ratio of the maximum parachute diameter to the subsequent minimum diameter was correlated with the mass ratio M/sub R/ and the Froude number Fr.more » This pair of similarity parameters was subsequently replaced by the equivalent pair M/sub R/ and V/sub o//V/sub t/ in order to provide more intuitive results (V/sub o//V/sub t/ is the initial to final velocity ratio). For large values of V/sub o//V/sub t/ the collapse parameter R/sub C/ appears to be a function of M/sub R/ alone. Non-dimensional opening time and ''collapse time'' data were also correlated with M/sub R/ and V/sub o//V/sub t/. In addition, opening load factors C/sub X/ were calculated from the data and plotted as a function of V/sub o//V/sub t/. 10 refs., 11 figs.« less
Braziel, S; Sullivan, K; Lee, S
2018-01-29
Using confocal Raman microspectroscopy, we derive parameters for bilayer water transport across an isolated nanoliter aqueous droplet pair. For a bilayer formed with two osmotically imbalanced and adherent nanoliter aqueous droplets in a surrounding oil solvent, a droplet interface bilayer (DIB), the water permeability coefficient across the lipid bilayer was determined from monitoring the Raman scattering from the C[triple bond, length as m-dash]N stretching mode of K 3 Fe(CN) 6 as a measure of water uptake into the swelling droplet of a DIB pair. We also derive passive diffusional permeability coefficient for D 2 O transport across a droplet bilayer using O-D Raman signal. This method provides a significant methodological advance in determining water permeability coefficients in a convenient and reliable way.
Xu, Si-Liu; Zhao, Guo-Peng; Belić, Milivoj R; He, Jun-Rong; Xue, Li
2017-04-17
We analyze three-dimensional (3D) vector solitary waves in a system of coupled nonlinear Schrödinger equations with spatially modulated diffraction and nonlinearity, under action of a composite self-consistent trapping potential. Exact vector solitary waves, or light bullets (LBs), are found using the self-similarity method. The stability of vortex 3D LB pairs is examined by direct numerical simulations; the results show that only low-order vortex soliton pairs with the mode parameter values n ≤ 1, l ≤ 1 and m = 0 can be supported by the spatially modulated interaction in the composite trap. Higher-order LBs are found unstable over prolonged distances.
Yamanel, Kivanc; Caglar, Alper; Özcan, Mutlu; Gulsah, Kamran; Bagis, Bora
2010-12-01
This study evaluated the color parameters of resin composite shade guides determined using a colorimeter and digital imaging method. Four composite shade guides, namely: two nanohybrid (Grandio [Voco GmbH, Cuxhaven, Germany]; Premise [KerrHawe SA, Bioggio, Switzerland]) and two hybrid (Charisma [Heraeus Kulzer, GmbH & Co. KG, Hanau, Germany]; Filtek Z250 [3M ESPE, Seefeld, Germany]) were evaluated. Ten shade tabs were selected (A1, A2, A3, A3,5, A4, B1, B2, B3, C2, C3) from each shade guide. CIE Lab values were obtained using digital imaging and a colorimeter (ShadeEye NCC Dental Chroma Meter, Shofu Inc., Kyoto, Japan). The data were analyzed using two-way analysis of variance and Bonferroni post hoc test. Overall, the mean ΔE values from different composite pairs demonstrated statistically significant differences when evaluated with the colorimeter (p < 0.001) but there was no significant difference with the digital imaging method (p = 0.099). With both measurement methods in total, 80% of the shade guide pairs from different composites (97/120) showed color differences greater than 3.7 (moderately perceptible mismatch), and 49% (59/120) had obvious mismatch (ΔE > 6.8). For all shade pairs evaluated, the most significant shade mismatches were obtained between Grandio-Filtek Z250 (p = 0.021) and Filtek Z250-Premise (p = 0.01) regarding ΔE mean values, whereas the best shade match was between Grandio-Charisma (p = 0.255) regardless of the measurement method. The best color match (mean ΔE values) was recorded for A1, A2, and A3 shade pairs in both methods. When proper object-camera distance, digital camera settings, and suitable illumination conditions are provided, digital imaging method could be used in the assessment of color parameters. Interchanging use of shade guides from different composite systems should be avoided during color selection. © 2010, COPYRIGHT THE AUTHORS. JOURNAL COMPILATION © 2010, WILEY PERIODICALS, INC.
Relativistic elliptic matrix tops and finite Fourier transformations
NASA Astrophysics Data System (ADS)
Zotov, A.
2017-10-01
We consider a family of classical elliptic integrable systems including (relativistic) tops and their matrix extensions of different types. These models can be obtained from the “off-shell” Lax pairs, which do not satisfy the Lax equations in general case but become true Lax pairs under various conditions (reductions). At the level of the off-shell Lax matrix, there is a natural symmetry between the spectral parameter z and relativistic parameter η. It is generated by the finite Fourier transformation, which we describe in detail. The symmetry allows one to consider z and η on an equal footing. Depending on the type of integrable reduction, any of the parameters can be chosen to be the spectral one. Then another one is the relativistic deformation parameter. As a by-product, we describe the model of N2 interacting GL(M) matrix tops and/or M2 interacting GL(N) matrix tops depending on a choice of the spectral parameter.
NASA Astrophysics Data System (ADS)
Houriez, Céline; Vallet, Valérie; Réal, Florent; Meot-Ner Mautner, Michael; Masella, Michel
2017-10-01
We performed molecular dynamics simulations of carboxylate/methylated ammonium ion pairs solvated in bulk water and of carboxylate/methylated ammonium salt solutions at ambient conditions using an ab initio-based polarizable force field whose parameters are assigned to reproduce only high end quantum computations, at the Møller-Plesset second-order perturbation theory/complete basis set limit level, regarding single ions and ion pairs as isolated and micro-hydrated in gas phase. Our results agree with the available experimental results regarding carboxylate/ammonium salt solutions. For instance, our force field approach predicts the percentage of acetate associated with ammonium ions in CH3 COO-/CH3 NH3+ solutions at the 0.2-0.8M concentration scale to range from 14% to 35%, in line with the estimates computed from the experimental ion association constant in liquid water. Moreover our simulations predict the number of water molecules released from the ion first hydration shell to the bulk upon ion association to be about 2.0 ± 0.6 molecules for acetate/protonated amine ion pairs, 3.1 ± 1.5 molecules for the HCOO-/NH4+ pair and 3.3 ± 1.2 molecules for the CH3COO-/(CH3)4N+ pair. For protonated amine-based ion pairs, these values are in line with experiment for alkali/halide pairs solvated in bulk water. All these results demonstrate the promising feature of ab initio-based force fields, i.e., their capacity in accurately modeling chemical systems that cannot be readily investigated using available experimental techniques.
On the P 21/m and Pmmn pathways of the B1 B2 phase transition in NaCl: a quantum-mechanical study
NASA Astrophysics Data System (ADS)
Catti, Michele
2004-06-01
The monoclinic P 21/m and orthorhombic Pmmn (Watanabe et al' s-type) mechanisms of the high-pressure phase transition of NaCl between the B1 (rocksalt, Fm\\overline 3 m ) and B2 (CsCl-like, Pm\\overline 3 m ) cubic phases were investigated by ab initio DFT techniques with all-electron localized basis sets. Enthalpy profiles versus the order parameter were computed at constant pressures of 15, 26.3 (equilibrium) and 35 GPa for each pathway. The monoclinic path shows a lower activation enthalpy at the equilibrium pressure, but at different p values (hysteresis effects) the other mechanism becomes competitive. In the P 21/m case, sharp jumps of structural parameters are observed along the transformation coordinate, which can be explained by a mechanism based on discontinuous sliding of alternating pairs of (100) atomic layers. This accounts also for the predicted formation of a metastable intermediate Cmcm phase with TlI-like structure, similar to that observed experimentally at high pressure in AgCl, and the relations with the KOH structure are discussed, too. On the other hand, along the Pmmn pathway the structural parameters vary quite smoothly, indicating a continuous motion of neighbouring atomic planes within the constraint of the additional mirror symmetry.
Kim, Jo-Eun; Yi, Won-Jin; Heo, Min-Suk; Lee, Sam-Sun; Choi, Soon-Chul; Huh, Kyung-Hoe
2015-12-01
To evaluate the potential feasibility of cone beam computed tomography (CBCT) in the assessment of trabecular bone microarchitecture. Sixty-eight specimens from four pairs of human jaw were scanned using both micro-computed tomography (micro-CT) of 19.37-μm voxel size and CBCT of 100-μm voxel size. The correlation of 3-dimensional parameters between CBCT and micro-CT was evaluated. All parameters, except bone-specific surface and trabecular thickness, showed linear correlations between the 2 imaging modalities (P < .05). Among the parameters, bone volume, percent bone volume, trabecular separation, and degree of anisotropy (DA) of CBCT images showed strong correlations with those of micro-CT images. DA showed the strongest correlation (r = 0.693). Most microarchitectural parameters from CBCT were correlated with those from micro-CT. Some microarchitectural parameters, especially DA, could be used as strong predictors of bone quality in the human jaw. Copyright © 2015 Elsevier Inc. All rights reserved.
Liu, Ning; Tian, Ru; Loeb, Daniel D
2003-02-18
Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.
NASA Astrophysics Data System (ADS)
Gajewski, Andrzej; Kolenderski, Piotr L.
2016-10-01
There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the experimental results presented in Refs [3,4]. Here we investigate typical, experimentally available source parameters: the widths of the pump beam and collected modes ranging from 20μm to 500m, the crystal length ranging from 1mm to 7.5mm while the pulse duration is set to 50fs, 100fs or 150fs. We achieve the correlation coefficient value as high as approximately 0.8, or - for different values of parameters - coupling efficiency equal to 0.76.
Kashefolgheta, Sadra; Vila Verde, Ana
2017-08-09
We present a set of Lennard-Jones parameters for classical, all-atom models of acetate and various alkylated and non-alkylated forms of sulfate, sulfonate and phosphate ions, optimized to reproduce their interactions with water and with the physiologically relevant sodium, ammonium and methylammonium cations. The parameters are internally consistent and are fully compatible with the Generalized Amber Force Field (GAFF), the AMBER force field for proteins, the accompanying TIP3P water model and the sodium model of Joung and Cheatham. The parameters were developed primarily relying on experimental information - hydration free energies and solution activity derivatives at 0.5 m concentration - with ab initio, gas phase calculations being used for the cases where experimental information is missing. The ab initio parameterization scheme presented here is distinct from other approaches because it explicitly connects gas phase binding energies to intermolecular interactions in solution. We demonstrate that the original GAFF/AMBER parameters often overestimate anion-cation interactions, leading to an excessive number of contact ion pairs in solutions of carboxylate ions, and to aggregation in solutions of divalent ions. GAFF/AMBER parameters lead to excessive numbers of salt bridges in proteins and of contact ion pairs between sodium and acidic protein groups, issues that are resolved by using the optimized parameters presented here.
Liu, Ning; Tian, Ru; Loeb, Daniel D.
2003-01-01
Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983
Larki, Arash; Nasrabadi, Mehdi Rahimi; Pourreza, Nahid
2015-06-01
In the present study, a simple, fast and inexpensive method based on dispersive liquid-liquid microextraction (DLLME) prior to microvolume UV-vis spectrophotometry was developed for the preconcentration and determination of trinitrotoluene (TNT). The procedure is based on the color reaction of TNT in alkaline medium and extraction into CCl4 as an ion pair assisted by trioctylmethylammonium chloride, which also acts as a disperser agent. Experimental parameters affecting the DLLME method such as pH, concentration of sodium hydroxide, amount of trioctylmethylammonium chloride, type and volume of extraction solvent were investigated and optimized. Under the optimum conditions, the limit of detection (LOD) was 0.9ng/mL and the calibration curve was linear in the range of 3-200ng/mL. The relative standard deviation for 25 and 100ng/mL of TNT were 3.7% and 1.5% (n=6), respectively. The developed DLLME method was applied for the determination of TNT in different water and soil samples. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Peroxidase-like activity of apoferritin paired gold clusters for glucose detection.
Jiang, Xin; Sun, Cuiji; Guo, Yi; Nie, Guangjun; Xu, Li
2015-02-15
The discovery and application of noble metal nanoclusters have received considerable attention. In this paper, we reported that apoferritin paired gold clusters (Au-Ft) could efficiently catalyze oxidation of 3.3',5.5'-tetramethylbenzidine (TMB) by H2O2 to produce a blue color reaction. Compared with natural enzyme, Au-Ft exhibited higher activity near acidic pH and could be used over a wide range of temperatures. Apoferritin nanocage enhanced the reaction activity of substrate TMB by H2O2. The reaction catalyzed by Au-Ft was found to follow a typical Michaelis-Menten kinetics. The kinetic parameters exhibited a lower K(m) value (0.097 mM) and a higher K(cat) value (5.8 × 10(4) s(-1)) for TMB than that of horse radish peroxidase (HRP). Base on these findings, Au-Ft, acting as a peroxidase mimetic, performed enzymatic spectrophotometric analysis of glucose. This system exhibited acceptable reproducibility and high selectivity in biosening, suggesting that it could have promising applications in the future. Copyright © 2014 Elsevier B.V. All rights reserved.
Pairing mechanism in Bi-O superconductors: A finite-size chain calculation
NASA Astrophysics Data System (ADS)
Aligia, A. A.; Nuez Regueiro, M. D.; Gagliano, E. R.
1989-09-01
We have studied the pairing mechanism in BiO3 systems by calculating the binding energy of a pair of holes in finite Bi-O chains, for parameters that simulate three-dimensional behavior. In agreement with previous results using perturbation theory in the hopping t, for covalent Bi-O binding and parameters for which the parent compound has a disproportionate ground state, pairing induced by the presence of biexcitons is obtained for sufficiently large interatomic Coulomb repulsion. The analysis of appropriate correlation functions shows a rapid metallization of the system as t and the number of holes increase. This fact shrinks the region of parameters for which the finite-size calculations can be trusted without further study. The same model for other parameters yields pairing in two other regimes: bipolaronic and magnetic excitonic.
Characterization on performance of micromixer using DC-biased AC electroosmosis
NASA Astrophysics Data System (ADS)
Park, Bi-O.; Song, Simon
2010-11-01
An active micromixer using DC-biased AC-Electroosmosis (ACEO) is investigated to figure out the effects of design parameters on the mixing performance. The mixer consists of a straight microchannel, with a cross section of 60 x 100 μm, and gold electrode pairs fabricated in the microchannel. The design parameters include the number of electrode pairs, flow rate, DC-biased voltage, AC voltage and AC frequency. First, we found that a mixing index became 80% 100 μm downstream of a single electrode pair with a length of 2 mm when applying a 25Vpp, 2.0 VDC, 100 kHz sine signal to the electrodes. With decreasing AC frequency, the mixing index is affected little. But the mixing index significantly increases with increasing either DC-biased voltage or AC voltage. Also, we were able to increase the mixing index up to 90% by introducing alternating vortices with multiple electrode pairs. Finally, we discovered that the mixing index decreases as the flow rate increases in the microchannel, and there is an optimal number of electrode pairs with respect to a flow rate. Detailed quantitative measurement results will be presented at the meeting.
Tests of remote aftershock triggering by small mainshocks using Taiwan's earthquake catalog
NASA Astrophysics Data System (ADS)
Peng, W.; Toda, S.
2014-12-01
To understand earthquake interaction and forecast time-dependent seismic hazard, it is essential to evaluate which stress transfer, static or dynamic, plays a major role to trigger aftershocks and subsequent mainshocks. Felzer and Brodsky focused on small mainshocks (2≤M<3) and their aftershocks, and then argued that only dynamic stress change brings earthquake-to-earthquake triggering, whereas Richards-Dingers et al. (2010) claimed that those selected small mainshock-aftershock pairs were not earthquake-to-earthquake triggering but simultaneous occurrence of independent aftershocks following a larger earthquake or during a significant swarm sequence. We test those hypotheses using Taiwan's earthquake catalog by taking the advantage of lacking any larger event and the absence of significant seismic swarm typically seen with active volcano. Using Felzer and Brodsky's method and their standard parameters, we only found 14 mainshock-aftershock pairs occurred within 20 km distance in Taiwan's catalog from 1994 to 2010. Although Taiwan's catalog has similar number of earthquakes as California's, the number of pairs is about 10% of the California catalog. It may indicate the effect of no large earthquakes and no significant seismic swarm in the catalog. To fully understand the properties in the Taiwan's catalog, we loosened the screening parameters to earn more pairs and then found a linear aftershock density with a power law decay of -1.12±0.38 that is very similar to the one in Felzer and Brodsky. However, none of those mainshock-aftershock pairs were associated with a M7 rupture event or M6 events. To find what mechanism controlled the aftershock density triggered by small mainshocks in Taiwan, we randomized earthquake magnitude and location. We then found that those density decay in a short time period is more like a randomized behavior than mainshock-aftershock triggering. Moreover, 5 out of 6 pairs were found in a swarm-like temporal seismicity rate increase. They locate mostly in high geothermal gradient areas, which are probably triggered by a small-scale aseismic process. Thus it rather supports the argument of Richards-Dingers et al. in which dynamic triggering by small mainshock is untenable.
Salehi, Morteza; Jafari, S A
2017-08-15
We suggest that spin-singlet pseudo-scalar s-wave superconducting pairing creates a two dimensional sea of Majorana fermions on the surface of three dimensional Dirac superconductors (3DDS). This pseudo-scalar superconducting order parameter Δ 5 , in competition with scalar Dirac mass m, leads to a topological phase transition due to band inversion. We find that a perfect Andreev-Klein reflection is guaranteed by presence of anomalous Andreev reflection along with the conventional one. This effect manifests itself in a resonant peak of the differential conductance. Furthermore, Josephson current of the Δ 5 |m|Δ 5 junction in the presence of anomalous Andreev reflection is fractional with 4π period. Our finding suggests another search area for condensed matter realization of Majorana fermions which are beyond the vortex-core of p-wave superconductors. The required Δ 5 pairing can be extrinsically induced by a conventional s-wave superconductor into a three dimensional Dirac material (3DDM).
Determination of the pairing-strength constants in the isovector plus isoscalar pairing case
NASA Astrophysics Data System (ADS)
Mokhtari, D.; Fellah, M.; Allal, N. H.
2016-05-01
A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.
Hsu, Ching-Lin; Ding, Wang-Hsien
2009-12-15
A rapid and environmental-friendly injection-port derivatization with gas chromatography-mass spectrometry (GC-MS) method was developed to determine selected low-molecular weight (LMW) dicarboxylic acids (from C2 to C10) in atmospheric aerosol samples. The parameters related to the derivatization process (i.e., type of ion-pair reagent, injection-port temperature and concentration of ion-pair reagent) were optimized. Tetrabutylammonium hydroxide (TBA-OH) 20 mM in methanol gave excellent yield for di-butyl ester dicarboxylate derivatives at injection-port temperature at 300 degrees C. Solid-phase extraction (SPE) method instead of rotary evaporation was used to concentrate analytes from filter extracts. The recovery from filter extracts ranged from 78 to 95% with relative standard deviation (RSD) less than 12%. Limits of quantitation (LOQs) ranged from 25 to 250 pg/m(3). The concentrations of di-carboxylated C2-C5 and total C6-C10 in particles of atmospheric aerosols ranged from 91.9 to 240, 11.3 to 56.7, 9.2 to 49.2, 8.7 to 35.3 and n.d. to 37.8 ng/m(3), respectively. Oxalic acid (C2) was the dominant LMW-dicarboxylic acids detected in aerosol samples. The quantitative results were comparable to the results obtained by the off-line derivatization.
The interactive scaling hypothesis and dynamic textures in nematics
NASA Astrophysics Data System (ADS)
Rozhkov, S.
2002-03-01
A new approach to the description of the dynamic textures (DT) in the systems with continuous symmetry is proposed. Such textures take place in various dissipative motions of liquid crystals with participation of different extended objects: topological defects in the order parameter field and suspended particles. The main idea of the approach is to transfer the law of interaction between the extended objects (hedgehogs, disclinations, boojums, colloidal particles, etc.) to the host system by redefining its spatiotemporal scales. I call this procedure the interactive scaling (IS). In a number of experiments with nematics^1-3 a pair of objects behaves itself as two point particles interacting by means of the attractive force F_a=CK(a/r)^m-1, where r is the separation between particle centers, K is the Frank elastic constant, C is a constant, and m>= 1. The dynamics of the objects is purely dissipative with the Stokes-type drag due to the reorientation of the order parameter (director) field in some vicinities of the objects. For the pair's dissipative dynamics in nematics we find the velocity v of reducing the interparticle distance r: v(r)=v_c(a/r)^m-1, with v_c=2CK/lη, where η is the orientational viscosity and l is the drag length. The parameters C, a and l can be estimated theoretically and defined experimentally. The IS hypothesis postulates the time dependence of the director field in the form n (r,; t)= n(x+ɛ v(2|x|)t/2,;y,;z) to yield the DT equation for n(r): (2νɛ^m/ax^m-1)partial_xn=nabla^2 n+(nablan)^2n, where ν=Ca/l is the IS ratio, ɛ=sign(x) and v(2|x|) coincides with the velocity of approaching the pair's particles in the x direction. This equation corresponds to the "one-constant approximation" and the absence of fluid flow. For m=2 (the "Coulombic" force) in the planar case: n=[\\cosΦ,sinΦ,0], we find the disclination solution of the DT equation: Φ=(k/2)C_νint_0^φ\\cos^2νφdφ, where k is an integer, φ is the polar angle and C_ν=surdπΓ(ν+1)/Γ(ν+1/2). ν=0 gives Frank's disclinations. 1. O.D.Lavrentovich and S.S.Rozhkov, JETP Lett. 47, 254 (1988). 2. A.Pargellis, N.Turok and B.Yurke, Phys.Rev.Lett. 67, 1570 (1991). 3. P.Poulin, V.Cabuil and D.A.Weiz, Phys.Rev.Lett. 79, 4862 (1997).
1.5-μm band polarization entangled photon-pair source with variable Bell states.
Arahira, Shin; Kishimoto, Tadashi; Murai, Hitoshi
2012-04-23
In this paper we report a polarization-entangled photon-pair source in a 1.5-μm band which can generate arbitrary entangled states including four maximum entangled states (Bell states) by using cascaded optical second nonlinearities (second-harmonic generation and the following spontaneous parametric down conversion) in a periodically poled LiNbO(3) (PPLN) ridge-waveguide device. Exchange among the Bell states was achieved by using an optical phase bias compensator (OPBC) in a Sagnac loop interferometer and a half-wave plate outside the loop for polarization conversion. Quantitative evaluation was made on the performance of the photon-pair source through the experiments of two-photon interferences, quantum state tomography, and test of violation of Bell inequality. We observed high visibilities of 96%, fidelities of 97%, and 2.71 of the S parameter in inequality of Clauser, Horne, Shimony, and Holt (CHSH). The experimental values, including peak coincidence counts in the two-photon interference (approximately 170 counts per second), remained almost unchanged in despite of the exchange among the Bell states. They were also in good agreement with the theoretical assumption from the mean number of the photon-pairs under the test (0.04 per pulse). More detailed experimental studies on the dependence of the mean number of the photon-pairs revealed that the quantum states were well understood as the Werner state. © 2012 Optical Society of America
Optimization of dose and image quality in adult and pediatric computed tomography scans
NASA Astrophysics Data System (ADS)
Chang, Kwo-Ping; Hsu, Tzu-Kun; Lin, Wei-Ting; Hsu, Wen-Lin
2017-11-01
Exploration to maximize CT image and reduce radiation dose was conducted while controlling for multiple factors. The kVp, mAs, and iteration reconstruction (IR), affect the CT image quality and radiation dose absorbed. The optimal protocols (kVp, mAs, IR) are derived by figure of merit (FOM) based on CT image quality (CNR) and CT dose index (CTDIvol). CT image quality metrics such as CT number accuracy, SNR, low contrast materials' CNR and line pair resolution were also analyzed as auxiliary assessments. CT protocols were carried out with an ACR accreditation phantom and a five-year-old pediatric head phantom. The threshold values of the adult CT scan parameters, 100 kVp and 150 mAs, were determined from the CT number test and line pairs in ACR phantom module 1and module 4 respectively. The findings of this study suggest that the optimal scanning parameters for adults be set at 100 kVp and 150-250 mAs. However, for improved low- contrast resolution, 120 kVp and 150-250 mAs are optimal. Optimal settings for pediatric head CT scan were 80 kVp/50 mAs, for maxillary sinus and brain stem, while 80 kVp /300 mAs for temporal bone. SNR is not reliable as the independent image parameter nor the metric for determining optimal CT scan parameters. The iteration reconstruction (IR) approach is strongly recommended for both adult and pediatric CT scanning as it markedly improves image quality without affecting radiation dose.
Scaling relations and the fundamental line of the local group dwarf galaxies
NASA Astrophysics Data System (ADS)
Woo, Joanna; Courteau, Stéphane; Dekel, Avishai
2008-11-01
We study the scaling relations between global properties of dwarf galaxies in the local group. In addition to quantifying the correlations between pairs of variables, we explore the `shape' of the distribution of galaxies in log parameter space using standardized principal component analysis, the analysis is performed first in the 3D structural parameter space of stellar mass M*, internal velocity V and characteristic radius R* (or surface brightness μ*). It is then extended to a 4D space that includes a stellar population parameter such as metallicity Z or star formation rate . We find that the local group dwarfs basically define a one-parameter `fundamental line' (FL), primarily driven by stellar mass, M*. A more detailed inspection reveals differences between the star formation properties of dwarf irregulars (dI's) and dwarf ellipticals (dE's), beyond the tendency of the latter to be more massive. In particular, the metallicities of dI's are typically lower by a factor of 3 at a given M* and they grow faster with increasing M*, showing a tighter FL in the 4D space for the dE's. The structural scaling relations of dI's resemble those of the more massive spirals, but the dI's have lower star formation rates for a given M* which also grow faster with increasing M*. On the other hand, the FL of the dE's departs from the fundamental plane of bigger ellipticals. While the one-parameter nature of the FL and the associated slopes of the scaling relations are consistent with the general predictions of supernova feedback from Dekel & Woo, the differences between the FL's of the dE's and the dI's remain a challenge and should serve as a guide for the secondary physical processes responsible for these two types.
Multidimensional Skyrme-density-functional study of the spontaneous fission of 238U
Sadhukhan, J.; Mazurek, K.; Dobaczewski, J.; ...
2015-01-01
We determined the spontaneous fission lifetime of 238U by a minimization of the action integral in a three-dimensional space of collective variables. Apart from the mass-distribution multipole moments Q 20 (elongation) and Q 30 (left–right asymmetry), we also considered the pairing-fluctuation parameter λ 2 as a collective coordinate. The collective potential was obtained self-consistently using the Skyrme energy density functional SkM*. The inertia tensor was obtained within the nonperturbative cranking approximation to the adiabatic time-dependent Hartree–Fock–Bogoliubov approach. As a result, the pairing-fluctuation parameter λ 2 allowed us to control the pairing gap along the fission path, which significantly changed themore » spontaneous fission lifetime.« less
Automatic Pulse Shaping with the AN/FPN-42 and AN/FPN-44A Loran-C transmitters
1992-12-01
with antenna simulator, pair 30. (a) TDW and (b) RF pulse. 39 CLOSEUP: POWER SPECTRUM OF TOW & RF (PAIR 30), 47 XMTR 190 17025 " 3 0 4 0 5 6 Sapl numbr... iec X 1e-6 (a) Phase Vf Selected Parameter 0.057 0.5 ... .. . . . ......... .... .. . ............... ,.. ...-.. . , .... celurro, 3 0.0517...PAIR 7 1), "SA XMTR ISO IS 25 30 35 40 4 0 55 60 Sample number, k Figure 3.15c: Closeup of power spectrum, 144A, pair 71i. 77 POLE/ZERO PLOT (PAIR 71
Lévy-stable two-pion Bose-Einstein correlations in s NN = 200 GeV Au + Au collisions
Adare, A.; Aidala, C.; Ajitanand, N. N.; ...
2018-06-14
Here, we present a detailed measurement of charged two-pion correlation functions in 0–30% centrality √ sNN = 200 GeV Au + Au collisions by the PHENIX experiment at the Relativistic Heavy Ion Collider. The data are well described by Bose-Einstein correlation functions stemming from Lévy-stable source distributions. Using a fine transverse momentum binning, we extract the correlation strength parameter λ, the Lévy index of stability α, and the Lévy length scale parameter R as a function of average transverse mass of the pair m T. We find that the positively and the negatively charged pion pairs yield consistent results, andmore » their correlation functions are represented, within uncertainties, by the same Lévy-stable source functions. The λ(m T) measurements indicate a decrease of the strength of the correlations at low m T. The Lévy length scale parameter R(m T) decreases with increasing m T, following a hydrodynamically predicted type of scaling behavior. The values of the Lévy index of stability α are found to be significantly lower than the Gaussian case of α = 2, but also significantly larger than the conjectured value that may characterize the critical point of a second-order quark-hadron phase transition.« less
Lévy-stable two-pion Bose-Einstein correlations in s NN = 200 GeV Au + Au collisions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adare, A.; Aidala, C.; Ajitanand, N. N.
Here, we present a detailed measurement of charged two-pion correlation functions in 0–30% centrality √ sNN = 200 GeV Au + Au collisions by the PHENIX experiment at the Relativistic Heavy Ion Collider. The data are well described by Bose-Einstein correlation functions stemming from Lévy-stable source distributions. Using a fine transverse momentum binning, we extract the correlation strength parameter λ, the Lévy index of stability α, and the Lévy length scale parameter R as a function of average transverse mass of the pair m T. We find that the positively and the negatively charged pion pairs yield consistent results, andmore » their correlation functions are represented, within uncertainties, by the same Lévy-stable source functions. The λ(m T) measurements indicate a decrease of the strength of the correlations at low m T. The Lévy length scale parameter R(m T) decreases with increasing m T, following a hydrodynamically predicted type of scaling behavior. The values of the Lévy index of stability α are found to be significantly lower than the Gaussian case of α = 2, but also significantly larger than the conjectured value that may characterize the critical point of a second-order quark-hadron phase transition.« less
2013-01-01
An intuitionistic method is proposed to design shadow masks to achieve thickness profile control for evaporation coating processes. The proposed method is based on the concept of the shadow matrix, which is a matrix that contains coefficients that build quantitive relations between shape parameters of masks and shadow quantities of substrate directly. By using the shadow matrix, shape parameters of shadow masks could be derived simply by solving a matrix equation. Verification experiments were performed on a special case where coating materials have different condensation characteristics. By using the designed mask pair with complementary shapes, thickness uniformities of better than 98% are demonstrated for MgF2 (m = 1) and LaF3 (m = 0.5) simultaneously on a 280 mm diameter spherical substrate with the radius curvature of 200 mm. PMID:24227996
NASA Astrophysics Data System (ADS)
Saari, Timo; Nieminen, Jouko; Bansil, Arun
2017-06-01
Motivated by the recent experiments indicating superconductivity in metal-decorated graphene sheets, we investigate their quasi-particle structure within the framework of an effective tight-binding Hamiltonian augmented by appropriate BCS-like pairing terms for p-type order parameter. The normal state band structure of graphene is modified not only through interaction with adsorbed metal atoms, but also due to the folding of bands at Brillouin zone boundaries resulting from a \\sqrt{3}× \\sqrt{3}R{{30}\\circ} reconstruction. Several different types of pairing symmetries are analyzed utilizing Nambu-Gorkov Green’s function techniques to show that p+\\text{i}p -symmetric nearest-neighbor pairing yields the most enhanced superconducting gap. The character of the order parameter depends on the nature of the atomic orbitals involved in the pairing process and exhibits interesting angular and radial asymmetries. Finally, we suggest a method to distinguish between singlet and triplet type superconductivity in the presence of magnetic substitutional impurities using scanning tunneling spectroscopy.
Cusick, Roland D; Hatzell, Marta; Zhang, Fang; Logan, Bruce E
2013-12-17
Power production from microbial reverse electrodialysis cell (MRC) electrodes is substantially improved compared to microbial fuel cells (MFCs) by using ammonium bicarbonate (AmB) solutions in multiple RED cell pair stacks and the cathode chamber. Reducing the number of RED membranes pairs while maintaining enhanced electrode performance could help to reduce capital costs. We show here that using only a single RED cell pair (CP), created by operating the cathode in concentrated AmB, dramatically increased power production normalized to cathode area from both acetate (Acetate: from 0.9 to 3.1 W/m(2)-cat) and wastewater (WW: 0.3 to 1.7 W/m(2)), by reducing solution and charge transfer resistances at the cathode. A second RED cell pair increased RED stack potential and reduced anode charge transfer resistance, further increasing power production (Acetate: 4.2 W/m(2); WW: 1.9 W/m(2)). By maintaining near optimal electrode power production with fewer membranes, power densities normalized to total membrane area for the 1-CP (Acetate: 3.1 W/m(2)-mem; WW: 1.7 W/m(2)) and 2-CP (Acetate: 1.3 W/m(2)-mem; WW: 0.6 W/m(2)) reactors were much higher than previous MRCs (0.3-0.5 W/m(2)-mem with acetate). While operating at peak power, the rate of wastewater COD removal, normalized to reactor volume, was 30-50 times higher in 1-CP and 2-CP MRCs than that in a single chamber MFC. These findings show that even a single cell pair AmB RED stack can significantly enhance electrical power production and wastewater treatment.
Ion Pairs or Neutral Molecule Adducts? Cooperativity in Hydrogen Bonding
ERIC Educational Resources Information Center
DeKock, Roger L.; Schipper, Laura A.; Dykhouse, Stephanie C.; Heeringa, Lee P.; Brandsen, Benjamin M.
2009-01-01
We performed theoretical studies on the systems NH[subscript 3] times HF times mH[subscript 2]O, NH[subscript 3] times HCl times mH[subscript 2]O, with m = 0, 1, 2, and 6. The molecules with m = 0 form hydrogen-bonded adducts with little tendency to form an ion-pair structure. The molecule NH[subscript 3] times HCl times H[subscript 2]O cannot be…
Multi-epoch observations with high spatial resolution of multiple T Tauri systems
NASA Astrophysics Data System (ADS)
Csépány, Gergely; van den Ancker, Mario; Ábrahám, Péter; Köhler, Rainer; Brandner, Wolfgang; Hormuth, Felix; Hiss, Hector
2017-07-01
Context. In multiple pre-main-sequence systems the lifetime of circumstellar discs appears to be shorter than around single stars, and the actual dissipation process may depend on the binary parameters of the systems. Aims: We report high spatial resolution observations of multiple T Tauri systems at optical and infrared wavelengths. We determine whether the components are gravitationally bound and orbital motion is visible, derive orbital parameters, and investigate possible correlations between the binary parameters and disc states. Methods: We selected 18 T Tau multiple systems (16 binary and two triple systems, yielding 16 + 2 × 2 = 20 binary pairs) in the Taurus-Auriga star-forming region from a previous survey, with spectral types from K1 to M5 and separations from 0.22″ (31 AU) to 5.8″ (814 AU). We analysed data acquired in 2006-07 at Calar Alto using the AstraLux lucky imaging system, along with data from SPHERE and NACO at the VLT, and from the literature. Results: We found ten pairs to orbit each other, five pairs that may show orbital motion, and five likely common proper motion pairs. We found no obvious correlation between the stellar parameters and binary configuration. The 10 μm infra-red excess varies between 0.1 and 7.2 mag (similar to the distribution in single stars, where it is between 1.7 and 9.1), implying that the presence of the binary star does not greatly influence the emission from the inner disc. Conclusions: We have detected orbital motion in young T Tauri systems over a timescale of ≈ 20 yr. Further observations with even longer temporal baseline will provide crucial information on the dynamics of these young stellar systems.
Wilczura-Wachnik, Hanna; Jónsdóttir, Svava Osk
2003-04-01
A method for calculating interaction parameters traditionally used in phase-equilibrium computations in low-molecular systems has been extended for the prediction of solvent activities of aromatic polymer solutions (polystyrene+methylcyclohexane). Using ethylbenzene as a model compound for the repeating unit of the polymer, the intermolecular interaction energies between the solvent molecule and the polymer were simulated. The semiempirical quantum chemical method AM1, and a method for sampling relevant internal orientations for a pair of molecules developed previously were used. Interaction energies are determined for three molecular pairs, the solvent and the model molecule, two solvent molecules and two model molecules, and used to calculated UNIQUAC interaction parameters, a(ij) and a(ji). Using these parameters, the solvent activities of the polystyrene 90,000 amu+methylcyclohexane system, and the total vapor pressures of the methylcyclohexane+ethylbenzene system were calculated. The latter system was compared to experimental data, giving qualitative agreement. Figure Solvent activities for the methylcylcohexane(1)+polystyrene(2) system at 316 K. Parameters aij (blue line) obtained with the AM1 method; parameters aij (pink line) from VLE data for the ethylbenzene+methylcyclohexane system. The abscissa is the polymer weight fraction defined as y2(x1)=(1mx1)M2/[x1M1+(1mx1)M2], where x1 is the solvent mole fraction and Mi are the molecular weights of the components.
Shim, Ji Suk; Lee, Jin Sook; Lee, Jeong Yol; Choi, Yeon Jo; Shin, Sang Wan; Ryu, Jae Jun
2015-10-01
This study investigated the marginal and internal adaptation of individual dental crowns fabricated using a CAD/CAM system (Sirona's BlueCam), also evaluating the effect of the software version used, and the specific parameter settings in the adaptation of crowns. Forty digital impressions of a master model previously prepared were acquired using an intraoral scanner and divided into four groups based on the software version and on the spacer settings used. The versions 3.8 and 4.2 of the software were used, and the spacer parameter was set at either 40 μm or 80 μm. The marginal and internal fit of the crowns were measured using the replica technique, which uses a low viscosity silicone material that simulates the thickness of the cement layer. The data were analyzed using a Friedman two-way analysis of variance (ANOVA) and paired t-tests with significance level set at p<0.05. The two-way ANOVA analysis showed the software version (p<0.05) and the spacer parameter (p<0.05) significantly affected the crown adaptation. The crowns designed with the version 4.2 of the software showed a better fit than those designed with the version 3.8, particularly in the axial wall and in the inner margin. The spacer parameter was more accurately represented in the version 4.2 of the software than in the version 3.8. In addition, the use of the version 4.2 of the software combined with the spacer parameter set at 80 μm showed the least variation. On the other hand, the outer margin was not affected by the variables. Compared to the version 3.8 of the software, the version 4.2 can be recommended for the fabrication of well-fitting crown restorations, and for the appropriate regulation of the spacer parameter.
Mesoscopic pairing without superconductivity
NASA Astrophysics Data System (ADS)
Hofmann, Johannes
2017-12-01
We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.
Zn3Sb4O6F6: Hydrothermal synthesis, crystal structure and nonlinear optical properties
NASA Astrophysics Data System (ADS)
Ali, Sk Imran; Zhang, Weiguo; Halasyamani, P. Shiv; Johnsson, Mats
2017-12-01
Zn3Sb4O6F6 has been synthesized hydrothermally at 230 °C. The crystal structure was determined from single crystal X-ray diffraction data. It crystallizes in the cubic non-centrosymmetric space group I-43m with the unit cell parameter a = 8.1291(4) Å and is isostructural with M3Sb4O6F6 (M = Co, Ni). The new compound is the first oxofluoride containing Zn2+ and a p-element cation with a stereochemically active lone pair. The crystal structure is made up by [ZnO2F4] octahedra forming a network via corner sharing at F-atoms and [SbO3] trigonal pyramids that form [Sb4O6] cages that connect via the O-atoms to the Zn-atoms. Powder second-harmonic generation (SHG) measurements using 1064 nm radiation on Zn3Sb4O6F6 indicate an SHG intensity of approximately 40 × α-SiO2.
Puranik, Ameya D; Nair, Gopinathan; Aggarwal, Rajiv; Bandyopadhyay, Abhijit; Shinto, Ajit; Zade, Anand
2013-04-01
The study aimed at developing a scoring system for scintigraphic grading of gastro-esophageal reflux (GER), on gastro-esophageal reflux scintigraphy (GERS) and comparison of clinical and scintigraphic scores, pre- and post-treatment. A total of 39 cases with clinically symptomatic GER underwent 99mTc sulfur colloid GERS; scores were assigned based on the clinical and scintigraphic parameters. Post domperidone GERS was performed after completion of treatment. Follow up GERS was performed and clinical and scintigraphic parameters were compared with baseline parameters. Paired t-test on pre and post domperidone treatment clinical scores showed that the decline in post-treatment scores was highly significant, with P value < 0.001. The scintigraphic scoring system had a sensitivity of 93.9% in assessing treatment response to domperidone, specificity of 83.3% i.e., 83.3% of children with no decline in scintigraphic scores show no clinical response to Domperidone. The scintigraphic scoring system had a positive predictive value of 96.9% and a negative predictive value of 71.4%. GERS with its quantitative parameters is a good investigation for assessing the severity of reflux and also for following children post-treatment.
NASA Astrophysics Data System (ADS)
Khachatryan, V.; Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Hartl, C.; Hörmann, N.; Hrubec, J.; Jeitler, M.; Knünz, V.; König, A.; Krammer, M.; Krätschmer, I.; Liko, D.; Matsushita, T.; Mikulec, I.; Rabady, D.; Rad, N.; Rahbaran, B.; Rohringer, H.; Schieck, J.; Schöfbeck, R.; Strauss, J.; Treberer-Treberspurg, W.; Waltenberger, W.; Wulz, C.-E.; Mossolov, V.; Shumeiko, N.; Suarez Gonzalez, J.; Alderweireldt, S.; Cornelis, T.; De Wolf, E. A.; Janssen, X.; Knutsson, A.; Lauwers, J.; Luyckx, S.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Van Spilbeeck, A.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; Daci, N.; De Bruyn, I.; Deroover, K.; Heracleous, N.; Keaveney, J.; Lowette, S.; Moreels, L.; Olbrechts, A.; Python, Q.; Strom, D.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Onsem, G. P.; Van Parijs, I.; Barria, P.; Brun, H.; Caillol, C.; Clerbaux, B.; De Lentdecker, G.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Léonard, A.; Maerschalk, T.; Marinov, A.; Pernié, L.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Yonamine, R.; Zenoni, F.; Zhang, F.; Beernaert, K.; Benucci, L.; Cimmino, A.; Crucy, S.; Dobur, D.; Fagot, A.; Garcia, G.; Gul, M.; Mccartin, J.; Ocampo Rios, A. A.; Poyraz, D.; Ryckbosch, D.; Salva, S.; Sigamani, M.; Tytgat, M.; Van Driessche, W.; Yazgan, E.; Zaganidis, N.; Basegmez, S.; Beluffi, C.; Bondu, O.; Brochet, S.; Bruno, G.; Caudron, A.; Ceard, L.; Delaere, C.; Favart, D.; Forthomme, L.; Giammanco, A.; Jafari, A.; Jez, P.; Komm, M.; Lemaitre, V.; Mertens, A.; Musich, M.; Nuttens, C.; Perrini, L.; Piotrzkowski, K.; Popov, A.; Quertenmont, L.; Selvaggi, M.; Vidal Marono, M.; Beliy, N.; Hammad, G. H.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Correa Martins Junior, M.; Hamer, M.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; De Jesus Damiao, D.; De Oliveira Martins, C.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Matos Figueiredo, D.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Prado Da Silva, W. L.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; De Souza Santos, A.; Dogra, S.; Tomei, T. R. Fernandez Perez; Gregores, E. M.; Mercadante, P. G.; Moon, C. S.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Rodozov, M.; Stoykova, S.; Sultanov, G.; Vutova, M.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Cheng, T.; Du, R.; Jiang, C. H.; Leggat, D.; Plestina, R.; Romeo, F.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Zhang, H.; Asawatangtrakuldee, C.; Ban, Y.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; Gomez, J. P.; Gomez Moreno, B.; Sanabria, J. C.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Kadija, K.; Luetic, J.; Micanovic, S.; Sudic, L.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Bodlak, M.; Finger, M.; Finger, M.; Abdelalim, A. A.; Awad, A.; Mahrous, A.; Radi, A.; Calpas, B.; Kadastik, M.; Murumaa, M.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Peltola, T.; Tuominiemi, J.; Tuovinen, E.; Wendland, L.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Fabbro, B.; Faure, J. L.; Favaro, C.; Ferri, F.; Ganjour, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Locci, E.; Machet, M.; Malcles, J.; Rander, J.; Rosowsky, A.; Titov, M.; Zghiche, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Chapon, E.; Charlot, C.; Davignon, O.; Filipovic, N.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Mastrolorenzo, L.; Miné, P.; Naranjo, I. N.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Regnard, S.; Salerno, R.; Sauvan, J. B.; Sirois, Y.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Agram, J.-L.; Andrea, J.; Aubin, A.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Goetzmann, C.; Le Bihan, A.-C.; Merlin, J. A.; Skovpen, K.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Bouvier, E.; Carrillo Montoya, C. A.; Chierici, R.; Contardo, D.; Courbon, B.; Depasse, P.; El Mamouni, H.; Fan, J.; Fay, J.; Gascon, S.; Gouzevitch, M.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Ruiz Alvarez, J. D.; Sabes, D.; Sgandurra, L.; Sordini, V.; Vander Donckt, M.; Verdier, P.; Viret, S.; Toriashvili, T.; Tsamalaidze, Z.; Autermann, C.; Beranek, S.; Feld, L.; Heister, A.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Ostapchuk, A.; Preuten, M.; Raupach, F.; Schael, S.; Schulte, J. F.; Verlage, T.; Weber, H.; Zhukov, V.; Ata, M.; Brodski, M.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Kreuzer, P.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Olschewski, M.; Padeken, K.; Papacz, P.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Sonnenschein, L.; Teyssier, D.; Thüer, S.; Cherepanov, V.; Erdogan, Y.; Flügge, G.; Geenen, H.; Geisler, M.; Hoehle, F.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Nehrkorn, A.; Nowack, A.; Nugent, I. M.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Asin, I.; Bartosik, N.; Behnke, O.; Behrens, U.; Borras, K.; Burgmeier, A.; Campbell, A.; Contreras-Campana, C.; Costanza, F.; Diez Pardos, C.; Dolinska, G.; Dooling, S.; Dorland, T.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Flucke, G.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Gunnellini, P.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Karacheban, O.; Kasemann, M.; Katsas, P.; Kieseler, J.; Kleinwort, C.; Korol, I.; Lange, W.; Leonard, J.; Lipka, K.; Lobanov, A.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Naumann-Emme, S.; Nayak, A.; Ntomari, E.; Perrey, H.; Pitzl, D.; Placakyte, R.; Raspereza, A.; Roland, B.; Sahin, M. Ö.; Saxena, P.; Schoerner-Sadenius, T.; Seitz, C.; Spannagel, S.; Trippkewitz, K. D.; Walsh, R.; Wissing, C.; Blobel, V.; Centis Vignali, M.; Draeger, A. R.; Erfle, J.; Garutti, E.; Goebel, K.; Gonzalez, D.; Görner, M.; Haller, J.; Hoffmann, M.; Höing, R. S.; Junkes, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Lapsien, T.; Lenz, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Nowatschin, D.; Ott, J.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Pietsch, N.; Poehlsen, J.; Rathjens, D.; Sander, C.; Scharf, C.; Schleper, P.; Schlieckau, E.; Schmidt, A.; Schumann, S.; Schwandt, J.; Sola, V.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Barth, C.; Baus, C.; Berger, J.; Böser, C.; Butz, E.; Chwalek, T.; Colombo, F.; De Boer, W.; Descroix, A.; Dierlamm, A.; Fink, S.; Frensch, F.; Friese, R.; Giffels, M.; Gilbert, A.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Katkov, I.; Kornmayer, A.; Lobelle Pardo, P.; Maier, B.; Mildner, H.; Mozer, M. U.; Müller, T.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Röcker, S.; Roscher, F.; Schröder, M.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wagner-Kuhr, J.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Psallidas, A.; Topsis-Giotis, I.; Agapitos, A.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Tziaferi, E.; Evangelou, I.; Flouris, G.; Foudas, C.; Kokkas, P.; Loukas, N.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Strologas, J.; Bencze, G.; Hajdu, C.; Hazi, A.; Hidas, P.; Horvath, D.; Sikler, F.; Veszpremi, V.; Vesztergombi, G.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Molnar, J.; Szillasi, Z.; Bartók, M.; Makovec, A.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Choudhury, S.; Mal, P.; Mandal, K.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Chawla, R.; Gupta, R.; Bhawandeep, U.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Mehta, A.; Mittal, M.; Singh, J. B.; Walia, G.; Kumar, Ashok; Bhardwaj, A.; Choudhary, B. C.; Garg, R. B.; Malhotra, S.; Naimuddin, M.; Nishu, N.; Ranjan, K.; Sharma, R.; Sharma, V.; Bhattacharya, S.; Chatterjee, K.; Dey, S.; Dutta, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Abdulsalam, A.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Banerjee, S.; Bhowmik, S.; Chatterjee, R. M.; Dewanjee, R. K.; Dugad, S.; Ganguly, S.; Ghosh, S.; Guchait, M.; Gurtu, A.; Jain, Sa.; Kole, G.; Kumar, S.; Mahakud, B.; Maity, M.; Majumder, G.; Mazumdar, K.; Mitra, S.; Mohanty, G. B.; Parida, B.; Sarkar, T.; Sur, N.; Sutar, B.; Wickramage, N.; Chauhan, S.; Dube, S.; Kapoor, A.; Kothekar, K.; Sharma, S.; Bakhshiansohi, H.; Behnamian, H.; Etesami, S. M.; Fahim, A.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Caputo, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Fiore, L.; Iaselli, G.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Silvestris, L.; Venditti, R.; Abbiendi, G.; Battilana, C.; Benvenuti, A. C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Brigliadori, L.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Cappello, G.; Chiorboli, M.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Gori, V.; Lenzi, P.; Meschini, M.; Paoletti, S.; Sguazzoni, G.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Lo Vetere, M.; Monge, M. R.; Robutti, E.; Tosi, S.; Brianza, L.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Gerosa, R.; Ghezzi, A.; Govoni, P.; Malvezzi, S.; Manzoni, R. A.; Marzocchi, B.; Menasce, D.; Moroni, L.; Paganoni, M.; Pedrini, D.; Ragazzi, S.; Redaelli, N.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; Di Guida, S.; Esposito, M.; Fabozzi, F.; Iorio, A. O. M.; Lanza, G.; Lista, L.; Meola, S.; Merola, M.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Bellato, M.; Benato, L.; Boletti, A.; Branca, A.; Dall'Osso, M.; Dorigo, T.; Fantinel, S.; Fanzago, F.; Gonella, F.; Gozzelino, A.; Kanishchev, K.; Lacaprara, S.; Margoni, M.; Meneguzzo, A. T.; Montecassiano, F.; Passaseo, M.; Pazzini, J.; Pegoraro, M.; Pozzobon, N.; Ronchese, P.; Simonetto, F.; Torassa, E.; Tosi, M.; Ventura, S.; Zanetti, M.; Zotto, P.; Zucchetta, A.; Braghieri, A.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Alunni Solestizi, L.; Bilei, G. M.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Mantovani, G.; Menichelli, M.; Saha, A.; Santocchia, A.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Bernardini, J.; Boccali, T.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Donato, S.; Fedi, G.; Foà, L.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Serban, A. T.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; D'imperio, G.; Del Re, D.; Diemoz, M.; Gelli, S.; Jorda, C.; Longo, E.; Margaroli, F.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Traczyk, P.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bellan, R.; Biino, C.; Cartiglia, N.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Finco, L.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Solano, A.; Staiano, A.; Belforte, S.; Candelise, V.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Gobbo, B.; La Licata, C.; Marone, M.; Schizzi, A.; Zanetti, A.; Kropivnitskaya, A.; Nam, S. K.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Kong, D. J.; Lee, S.; Oh, Y. D.; Sakharov, A.; Son, D. C.; Brochero Cifuentes, J. A.; Kim, H.; Kim, T. J.; Song, S.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Hong, B.; Kim, H.; Kim, Y.; Lee, B.; Lee, K.; Lee, K. S.; Lee, S.; Park, S. K.; Roh, Y.; Yoo, H. D.; Choi, M.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Ryu, G.; Ryu, M. S.; Choi, Y.; Goh, J.; Kim, D.; Kwon, E.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Komaragiri, J. R.; Md Ali, M. A. B.; Mohamad Idris, F.; Wan Abdullah, W. A. T.; Yusli, M. N.; Zolkapli, Z.; Casimiro Linares, E.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Hernandez-Almada, A.; Lopez-Fernandez, R.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Vazquez Valencia, F.; Pedraza, I.; Salazar Ibarguen, H. A.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Khan, W. A.; Khurshid, T.; Shoaib, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Romanowska-Rybinska, K.; Szleper, M.; Zalewski, P.; Brona, G.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Walczak, M.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Di Francesco, A.; Faccioli, P.; Ferreira Parracho, P. G.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nguyen, F.; Rodrigues Antunes, J.; Seixas, J.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Vischia, P.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Moisenz, P.; Palichik, V.; Perelygin, V.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Zarubin, A.; Golovtsov, V.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Levchenko, P.; Murzin, V.; Oreshkin, V.; Smirnov, I.; Sulimov, V.; Uvarov, L.; Vavilov, S.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Vlasov, E.; Zhokin, A.; Bylinkin, A.; Chadeeva, M.; Danilov, M.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Leonidov, A.; Mesyats, G.; Rusakov, S. V.; Baskakov, A.; Belyaev, A.; Boos, E.; Ershov, A.; Gribushin, A.; Kaminskiy, A.; Kodolova, O.; Korotkikh, V.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Petrushanko, S.; Savrin, V.; Snigirev, A.; Vardanyan, I.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Krychkine, V.; Petrov, V.; Ryutin, R.; Sobol, A.; Tourtchanovitch, L.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Calvo, E.; Cerrada, M.; Chamizo Llatas, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Navarro De Martino, E.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Santaolalla, J.; Soares, M. S.; Albajar, C.; de Trocóniz, J. F.; Missiroli, M.; Moran, D.; Cuevas, J.; Fernandez Menendez, J.; Folgueras, S.; Gonzalez Caballero, I.; Palencia Cortezon, E.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Castiñeiras De Saa, J. R.; De Castro Manzano, P.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Marco, R.; Martinez Rivero, C.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Rodríguez-Marrero, A. Y.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Auzinger, G.; Bachtis, M.; Baillon, P.; Ball, A. H.; Barney, D.; Benaglia, A.; Bendavid, J.; Benhabib, L.; Berruti, G. M.; Bloch, P.; Bocci, A.; Bonato, A.; Botta, C.; Breuker, H.; Camporesi, T.; Castello, R.; Cerminara, G.; D'Alfonso, M.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Guio, F.; De Roeck, A.; De Visscher, S.; Di Marco, E.; Dobson, M.; Dordevic, M.; Dorney, B.; du Pree, T.; Duggan, D.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Giordano, D.; Girone, M.; Glege, F.; Guida, R.; Gundacker, S.; Guthoff, M.; Hammer, J.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Kirschenmann, H.; Kortelainen, M. J.; Kousouris, K.; Krajczar, K.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Magini, N.; Malgeri, L.; Mannelli, M.; Martelli, A.; Masetti, L.; Meijers, F.; Mersi, S.; Meschi, E.; Moortgat, F.; Morovic, S.; Mulders, M.; Nemallapudi, M. V.; Neugebauer, H.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Piparo, D.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Ruan, M.; Sakulin, H.; Schäfer, C.; Schwick, C.; Seidel, M.; Sharma, A.; Silva, P.; Simon, M.; Sphicas, P.; Steggemann, J.; Stieger, B.; Stoye, M.; Takahashi, Y.; Treille, D.; Triossi, A.; Tsirou, A.; Veres, G. I.; Wardle, N.; Wöhri, H. K.; Zagozdzinska, A.; Zeuner, W. D.; Bertl, W.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Bachmair, F.; Bäni, L.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegá, M.; Eller, P.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Lecomte, P.; Lustermann, W.; Mangano, B.; Marionneau, M.; Martinez Ruiz del Arbol, P.; Masciovecchio, M.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrozzi, L.; Quittnat, M.; Rossini, M.; Schönenberger, M.; Starodumov, A.; Takahashi, M.; Tavolaro, V. R.; Theofilatos, K.; Wallny, R.; Aarrestad, T. K.; Amsler, C.; Caminada, L.; Canelli, M. F.; Chiochia, V.; De Cosa, A.; Galloni, C.; Hinzmann, A.; Hreus, T.; Kilminster, B.; Lange, C.; Ngadiuba, J.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Yang, Y.; Cardaci, M.; Chen, K. H.; Doan, T. H.; Jain, Sh.; Khurana, R.; Konyushikhin, M.; Kuo, C. M.; Lin, W.; Lu, Y. J.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chang, Y. H.; Chang, Y. W.; Chao, Y.; Chen, K. F.; Chen, P. H.; Dietz, C.; Fiori, F.; Grundler, U.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Miñano Moya, M.; Petrakou, E.; Tsai, J. f.; Tzeng, Y. M.; Asavapibhop, B.; Kovitanggoon, K.; Singh, G.; Srimanobhas, N.; Suwonjandee, N.; Adiguzel, A.; Cerci, S.; Demiroglu, Z. S.; Dozen, C.; Dumanoglu, I.; Gecit, F. H.; Girgis, S.; Gokbulut, G.; Guler, Y.; Gurpinar, E.; Hos, I.; Kangal, E. E.; Kayis Topaksu, A.; Onengut, G.; Ozcan, M.; Ozdemir, K.; Ozturk, S.; Tali, B.; Topakli, H.; Zorbilmez, C.; Bilin, B.; Bilmis, S.; Isildak, B.; Karapinar, G.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Yetkin, E. A.; Yetkin, T.; Cakir, A.; Cankocak, K.; Sen, S.; Vardarlí, F. I.; Grynyov, B.; Levchuk, L.; Sorokin, P.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Clement, E.; Cussans, D.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Meng, Z.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Senkin, S.; Smith, D.; Smith, V. J.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Worm, S. D.; Baber, M.; Bainbridge, R.; Buchmuller, O.; Bundock, A.; Burton, D.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Dunne, P.; Elwood, A.; Futyan, D.; Hall, G.; Iles, G.; Lane, R.; Lucas, R.; Lyons, L.; Magnan, A.-M.; Malik, S.; Nash, J.; Nikitenko, A.; Pela, J.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Seez, C.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Leslie, D.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Charaf, O.; Cooper, S. I.; Henderson, C.; Rumerio, P.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Alimena, J.; Berry, E.; Cutts, D.; Ferapontov, A.; Garabedian, A.; Hakala, J.; Heintz, U.; Jesus, O.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Piperov, S.; Sagir, S.; Syarif, R.; Breedon, R.; Breto, G.; Calderon De La Barca Sanchez, M.; Chauhan, S.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Ricci-Tam, F.; Shalhout, S.; Smith, J.; Squires, M.; Stolp, D.; Tripathi, M.; Wilbur, S.; Yohay, R.; Cousins, R.; Everaerts, P.; Florent, A.; Hauser, J.; Ignatenko, M.; Saltzberg, D.; Takasugi, E.; Valuev, V.; Weber, M.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Hanson, G.; Heilman, J.; Ivova Paneva, M.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Malberti, M.; Olmedo Negrete, M.; Shrinivas, A.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cerati, G. B.; Cittolin, S.; D'Agnolo, R. T.; Derdzinski, M.; Holzner, A.; Kelley, R.; Klein, D.; Letts, J.; Macneill, I.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Welke, C.; Würthwein, F.; Yagil, A.; Zevi Della Porta, G.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Flowers, K.; Franco Sevilla, M.; Geffert, P.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Incandela, J.; Mccoll, N.; Mullin, S. D.; Richman, J.; Stuart, D.; Suarez, I.; West, C.; Yoo, J.; Anderson, D.; Apresyan, A.; Bornheim, A.; Bunn, J.; Chen, Y.; Duarte, J.; Mott, A.; Newman, H. B.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhu, R. Y.; Andrews, M. B.; Azzolini, V.; Calamba, A.; Carlson, B.; Ferguson, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Cumalat, J. P.; Ford, W. T.; Gaz, A.; Jensen, F.; Johnson, A.; Krohn, M.; Mulholland, T.; Nauenberg, U.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chatterjee, A.; Chaves, J.; Chu, J.; Dittmer, S.; Eggert, N.; Mirman, N.; Nicolas Kaufman, G.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Sun, W.; Tan, S. M.; Teo, W. D.; Thom, J.; Thompson, J.; Tucker, J.; Weng, Y.; Wittich, P.; Abdullin, S.; Albrow, M.; Apollinari, G.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Cheung, H. W. K.; Chlebana, F.; Cihangir, S.; Elvira, V. D.; Fisk, I.; Freeman, J.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Hanlon, J.; Hare, D.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Linacre, J.; Lincoln, D.; Lipton, R.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; Newman-Holmes, C.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Carnes, A.; Carver, M.; Curry, D.; Das, S.; Field, R. D.; Furic, I. K.; Gleyzer, S. V.; Konigsberg, J.; Korytov, A.; Kotov, K.; Ma, P.; Matchev, K.; Mei, H.; Milenovic, P.; Mitselmakher, G.; Rank, D.; Rossin, R.; Shchutska, L.; Snowball, M.; Sperka, D.; Terentyev, N.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Hewamanage, S.; Linn, S.; Markowitz, P.; Martinez, G.; Rodriguez, J. L.; Ackert, A.; Adams, J. R.; Adams, T.; Askew, A.; Bein, S.; Bochenek, J.; Diamond, B.; Haas, J.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Khatiwada, A.; Prosper, H.; Weinberg, M.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Kalakhety, H.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Bucinskaite, I.; Cavanaugh, R.; Evdokimov, O.; Gauthier, L.; Gerber, C. E.; Hofman, D. J.; Kurt, P.; O'Brien, C.; Sandoval Gonzalez, I. D.; Turner, P.; Varelas, N.; Wu, Z.; Zakaria, M.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Anderson, I.; Barnett, B. A.; Blumenfeld, B.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Martin, C.; Osherson, M.; Roskes, J.; Sady, A.; Sarica, U.; Swartz, M.; Xiao, M.; Xin, Y.; You, C.; Baringer, P.; Bean, A.; Benelli, G.; Bruner, C.; Kenny, R. P.; Majumder, D.; Malek, M.; Mcbrayer, W.; Murray, M.; Sanders, S.; Stringer, R.; Wang, Q.; Ivanov, A.; Kaadze, K.; Khalil, S.; Makouski, M.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Lange, D.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Gomez, J. A.; Hadley, N. J.; Jabeen, S.; Kellogg, R. G.; Kolberg, T.; Kunkle, J.; Lu, Y.; Mignerey, A. C.; Shin, Y. H.; Skuja, A.; Tonjes, M. B.; Tonwar, S. C.; Apyan, A.; Barbieri, R.; Baty, A.; Bierwagen, K.; Brandt, S.; Busza, W.; Cali, I. A.; Demiragli, Z.; Di Matteo, L.; Gomez Ceballos, G.; Goncharov, M.; Gulhan, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Sumorok, K.; Varma, M.; Velicanu, D.; Veverka, J.; Wang, J.; Wang, T. W.; Wyslouch, B.; Yang, M.; Zhukova, V.; Dahmes, B.; Evans, A.; Finkel, A.; Gude, A.; Hansen, P.; Kalafut, S.; Kao, S. C.; Klapoetke, K.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Tambe, N.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bartek, R.; Bloom, K.; Bose, S.; Claes, D. R.; Dominguez, A.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Knowlton, D.; Kravchenko, I.; Meier, F.; Monroy, J.; Ratnikov, F.; Siado, J. E.; Snow, G. R.; Alyari, M.; Dolen, J.; George, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Kaisen, J.; Kharchilava, A.; Kumar, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Baumgartel, D.; Chasco, M.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wang, R.-J.; Wood, D.; Zhang, J.; Bhattacharya, S.; Hahn, K. A.; Kubik, A.; Low, J. F.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M.; Sung, K.; Trovato, M.; Velasco, M.; Brinkerhoff, A.; Dev, N.; Hildreth, M.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Valls, N.; Wayne, M.; Wolf, M.; Woodard, A.; Antonelli, L.; Brinson, J.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Hart, A.; Hill, C.; Hughes, R.; Ji, W.; Ling, T. Y.; Liu, B.; Luo, W.; Puigh, D.; Rodenburg, M.; Winer, B. L.; Wulsin, H. W.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Koay, S. A.; Lujan, P.; Marlow, D.; Medvedeva, T.; Mooney, M.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Tully, C.; Zuranski, A.; Malik, S.; Barker, A.; Barnes, V. E.; Benedetti, D.; Bortoletto, D.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Jung, K.; Kumar, A.; Miller, D. H.; Neumeister, N.; Radburn-Smith, B. C.; Shi, X.; Shipsey, I.; Silvers, D.; Sun, J.; Svyatkovskiy, A.; Wang, F.; Xie, W.; Xu, L.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Redjimi, R.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Betchart, B.; Bodek, A.; de Barbaro, P.; Demina, R.; Eshaq, Y.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Harel, A.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Petrillo, G.; Tan, P.; Verzetti, M.; Chou, J. P.; Contreras-Campana, E.; Ferencek, D.; Gershtein, Y.; Halkiadakis, E.; Heindl, M.; Hidas, D.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Lath, A.; Nash, K.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Foerster, M.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Castaneda Hernandez, A.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Kamon, T.; Krutelyov, V.; Mueller, R.; Osipenkov, I.; Pakhotin, Y.; Patel, R.; Perloff, A.; Rose, A.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Cowden, C.; Damgov, J.; Dragoiu, C.; Dudero, P. R.; Faulkner, J.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Undleeb, S.; Volobouev, I.; Appelt, E.; Delannoy, A. G.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Mao, Y.; Melo, A.; Ni, H.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Cox, B.; Francis, B.; Goodell, J.; Hirosky, R.; Ledovskoy, A.; Li, H.; Lin, C.; Neu, C.; Sinthuprasith, T.; Sun, X.; Wang, Y.; Wolfe, E.; Wood, J.; Xia, F.; Clarke, C.; Harr, R.; Karchin, P. E.; Kottachchi Kankanamge Don, C.; Lamichhane, P.; Sturdy, J.; Belknap, D. A.; Carlsmith, D.; Cepeda, M.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Mohapatra, A.; Ojalvo, I.; Perry, T.; Pierro, G. A.; Polese, G.; Ruggles, T.; Sarangi, T.; Savin, A.; Sharma, A.; Smith, N.; Smith, W. H.; Taylor, D.; Verwilligen, P.; Woods, N.; CMS Collaboration
2017-07-01
Two-particle correlations in p Pb collisions at a nucleon-nucleon center-of-mass energy of 5.02 TeV are studied as a function of the pseudorapidity separation (Δ η ) of the particle pair at small relative azimuthal angle (|Δ ϕ |<π /3 ). The correlations are decomposed into a jet component that dominates the short-range correlations (|Δ η |<1 ), and a component that persists at large Δ η and may originate from collective behavior of the produced system. The events are classified in terms of the multiplicity of the produced particles. Finite azimuthal anisotropies are observed in high-multiplicity events. The second and third Fourier components of the particle-pair azimuthal correlations, V2 and V3, are extracted after subtraction of the jet component. The single-particle anisotropy parameters v2 and v3 are normalized by their laboratory frame midrapidity value and are studied as a function of ηc.m.. The normalized v2 distribution is found to be asymmetric about ηc.m.=0 , with smaller values observed at forward pseudorapidity, corresponding to the direction of the proton beam, while no significant pseudorapidity dependence is observed for the normalized v3 distribution within the statistical uncertainties.
Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.
Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun
2013-03-01
N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.
Search for neutral MSSM Higgs bosons decaying to a pair of tau leptons in pp collisions
Khachatryan, Vardan
2014-10-28
Our search for neutral Higgs bosons in the minimal supersymmetric extension of the standard model (MSSM) decaying to tau-lepton pairs in pp collisions is performed, using events recorded by the CMS experiment at the LHC. The dataset corresponds to an integrated luminosity of 24.6 fb -1, with 4.9 fb -1 at 7 TeV and 19.7 fb -1 at 8 TeV. To enhance the sensitivity to neutral MSSM Higgs bosons, the search includes the case where the Higgs boson is produced in association with a b-quark jet. No excess is observed in the tau-lepton-pair invariant mass spectrum. Exclusion limits are presentedmore » in the MSSM parameter space for different benchmark scenarios, m h max , m h mod + , m h mod - , light-stop, light-stau, τ-phobic, and low- m H. Lastly, upper limits on the cross section times branching fraction for gluon fusion and b-quark associated Higgs boson production are also given.« less
Search for neutral MSSM Higgs bosons decaying to a pair of tau leptons in pp collisions
NASA Astrophysics Data System (ADS)
Khachatryan, V.; Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Bergauer, T.; Dragicevic, M.; Erö, J.; Fabjan, C.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Hartl, C.; Hörmann, N.; Hrubec, J.; Jeitler, M.; Kiesenhofer, W.; Knünz, V.; Krammer, M.; Krätschmer, I.; Liko, D.; Mikulec, I.; Rabady, D.; Rahbaran, B.; Rohringer, H.; Schöfbeck, R.; Strauss, J.; Taurok, A.; Treberer-Treberspurg, W.; Waltenberger, W.; Wulz, C.-E.; Mossolov, V.; Shumeiko, N.; Suarez Gonzalez, J.; Alderweireldt, S.; Bansal, M.; Bansal, S.; Cornelis, T.; De Wolf, E. A.; Janssen, X.; Knutsson, A.; Luyckx, S.; Ochesanu, S.; Rougny, R.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Van Spilbeeck, A.; Blekman, F.; Blyweert, S.; D'Hondt, J.; Daci, N.; Heracleous, N.; Keaveney, J.; Lowette, S.; Maes, M.; Olbrechts, A.; Python, Q.; Strom, D.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Onsem, G. P.; Villella, I.; Caillol, C.; Clerbaux, B.; De Lentdecker, G.; Dobur, D.; Favart, L.; Gay, A. P. R.; Grebenyuk, A.; Léonard, A.; Mohammadi, A.; Perniè, L.; Reis, T.; Seva, T.; Thomas, L.; Vander Velde, C.; Vanlaer, P.; Wang, J.; Zenoni, F.; Adler, V.; Beernaert, K.; Benucci, L.; Cimmino, A.; Costantini, S.; Crucy, S.; Dildick, S.; Fagot, A.; Garcia, G.; Mccartin, J.; Ocampo Rios, A. A.; Ryckbosch, D.; Salva Diblen, S.; Sigamani, M.; Strobbe, N.; Thyssen, F.; Tytgat, M.; Yazgan, E.; Zaganidis, N.; Basegmez, S.; Beluffi, C.; Bruno, G.; Castello, R.; Caudron, A.; Ceard, L.; Da Silveira, G. G.; Delaere, C.; du Pree, T.; Favart, D.; Forthomme, L.; Giammanco, A.; Hollar, J.; Jafari, A.; Jez, P.; Komm, M.; Lemaitre, V.; Nuttens, C.; Pagano, D.; Perrini, L.; Pin, A.; Piotrzkowski, K.; Popov, A.; Quertenmont, L.; Selvaggi, M.; Vidal Marono, M.; Vizan Garcia, J. M.; Beliy, N.; Caebergs, T.; Daubie, E.; Hammad, G. H.; Aldá, W. L.; Alves, G. A.; Brito, L.; Correa Martins, M.; Dos Reis Martins, T.; Mora Herrera, C.; Pol, M. E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; De Jesus Damiao, D.; De Oliveira Martins, C.; Fonseca De Souza, S.; Malbouisson, H.; Matos Figueiredo, D.; Mundim, L.; Nogima, H.; Prado Da Silva, W. L.; Santaolalla, J.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Vilela Pereira, A.; Bernardes, C. A.; Dogra, S.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Novaes, S. F.; Padula, Sandra S.; Aleksandrov, A.; Genchev, V.; Iaydjiev, P.; Marinov, A.; Piperov, S.; Rodozov, M.; Stoykova, S.; Sultanov, G.; Tcholakov, V.; Vutova, M.; Dimitrov, A.; Glushkov, I.; Hadjiiska, R.; Kozhuharov, V.; Litov, L.; Pavlov, B.; Petkov, P.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Du, R.; Jiang, C. H.; Plestina, R.; Tao, J.; Wang, Z.; Asawatangtrakuldee, C.; Ban, Y.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Zou, W.; Avila, C.; Chaparro Sierra, L. F.; Florez, C.; Gomez, J. P.; Gomez Moreno, B.; Sanabria, J. C.; Godinovic, N.; Lelas, D.; Polic, D.; Puljak, I.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Kadija, K.; Luetic, J.; Mekterovic, D.; Sudic, L.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Bodlak, M.; Finger, M.; Finger, M.; Assran, Y.; Ellithi Kamel, A.; Mahmoud, M. A.; Radi, A.; Kadastik, M.; Murumaa, M.; Raidal, M.; Tiko, A.; Eerola, P.; Fedi, G.; Voutilainen, M.; Härkönen, J.; Karimäki, V.; Kinnunen, R.; Kortelainen, M. J.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Mäenpää, T.; Peltola, T.; Tuominen, E.; Tuominiemi, J.; Tuovinen, E.; Wendland, L.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Fabbro, B.; Faure, J. L.; Favaro, C.; Ferri, F.; Ganjour, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Locci, E.; Malcles, J.; Rander, J.; Rosowsky, A.; Titov, M.; Baffioni, S.; Beaudette, F.; Busson, P.; Charlot, C.; Dahms, T.; Dalchenko, M.; Dobrzynski, L.; Filipovic, N.; Florent, A.; Granier de Cassagnac, R.; Mastrolorenzo, L.; Miné, P.; Mironov, C.; Naranjo, I. N.; Nguyen, M.; Ochando, C.; Paganini, P.; Regnard, S.; Salerno, R.; Sauvan, J. B.; Sirois, Y.; Veelken, C.; Yilmaz, Y.; Zabi, A.; Agram, J.-L.; Andrea, J.; Aubin, A.; Bloch, D.; Brom, J.-M.; Chabert, E. C.; Collard, C.; Conte, E.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Goetzmann, C.; Le Bihan, A.-C.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Beaupere, N.; Boudoul, G.; Bouvier, E.; Brochet, S.; Carrillo Montoya, C. A.; Chasserat, J.; Chierici, R.; Contardo, D.; Depasse, P.; El Mamouni, H.; Fan, J.; Fay, J.; Gascon, S.; Gouzevitch, M.; Ille, B.; Kurca, T.; Lethuillier, M.; Mirabito, L.; Perries, S.; Ruiz Alvarez, J. D.; Sabes, D.; Sgandurra, L.; Sordini, V.; Vander Donckt, M.; Verdier, P.; Viret, S.; Xiao, H.; Tsamalaidze, Z.; Autermann, C.; Beranek, S.; Bontenackels, M.; Edelhoff, M.; Feld, L.; Hindrichs, O.; Klein, K.; Ostapchuk, A.; Perieanu, A.; Raupach, F.; Sammet, J.; Schael, S.; Weber, H.; Wittmer, B.; Zhukov, V.; Ata, M.; Brodski, M.; Dietz-Laursonn, E.; Duchardt, D.; Erdmann, M.; Fischer, R.; Güth, A.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Klingebiel, D.; Knutzen, S.; Kreuzer, P.; Merschmeyer, M.; Meyer, A.; Millet, P.; Olschewski, M.; Padeken, K.; Papacz, P.; Reithler, H.; Schmitz, S. A.; Sonnenschein, L.; Teyssier, D.; Thüer, S.; Weber, M.; Cherepanov, V.; Erdogan, Y.; Flügge, G.; Geenen, H.; Geisler, M.; Haj Ahmad, W.; Heister, A.; Hoehle, F.; Kargoll, B.; Kress, T.; Kuessel, Y.; Künsken, A.; Lingemann, J.; Nowack, A.; Nugent, I. M.; Perchalla, L.; Pooth, O.; Stahl, A.; Asin, I.; Bartosik, N.; Behr, J.; Behrenhoff, W.; Behrens, U.; Bell, A. J.; Bergholz, M.; Bethani, A.; Borras, K.; Burgmeier, A.; Cakir, A.; Calligaris, L.; Campbell, A.; Choudhury, S.; Costanza, F.; Diez Pardos, C.; Dooling, S.; Dorland, T.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Flucke, G.; Garay Garcia, J.; Geiser, A.; Gunnellini, P.; Hauk, J.; Hellwig, G.; Hempel, M.; Horton, D.; Jung, H.; Kalogeropoulos, A.; Kasemann, M.; Katsas, P.; Kieseler, J.; Kleinwort, C.; Krücker, D.; Lange, W.; Leonard, J.; Lipka, K.; Lobanov, A.; Lohmann, W.; Lutz, B.; Mankel, R.; Marfin, I.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mnich, J.; Mussgiller, A.; Naumann-Emme, S.; Nayak, A.; Novgorodova, O.; Ntomari, E.; Perrey, H.; Pitzl, D.; Placakyte, R.; Raspereza, A.; Ribeiro Cipriano, P. M.; Roland, B.; Ron, E.; Sahin, M. Ö.; Salfeld-Nebgen, J.; Saxena, P.; Schmidt, R.; Schoerner-Sadenius, T.; Schröder, M.; Seitz, C.; Spannagel, S.; Vargas Trevino, A. D. R.; Walsh, R.; Wissing, C.; Aldaya Martin, M.; Blobel, V.; Centis Vignali, M.; Draeger, A. r.; Erfle, J.; Garutti, E.; Goebel, K.; Görner, M.; Haller, J.; Hoffmann, M.; Höing, R. S.; Kirschenmann, H.; Klanner, R.; Kogler, R.; Lange, J.; Lapsien, T.; Lenz, T.; Marchesini, I.; Ott, J.; Peiffer, T.; Pietsch, N.; Poehlsen, J.; Poehlsen, T.; Rathjens, D.; Sander, C.; Schettler, H.; Schleper, P.; Schlieckau, E.; Schmidt, A.; Seidel, M.; Sola, V.; Stadie, H.; Steinbrück, G.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Barth, C.; Baus, C.; Berger, J.; Böser, C.; Butz, E.; Chwalek, T.; De Boer, W.; Descroix, A.; Dierlamm, A.; Feindt, M.; Frensch, F.; Giffels, M.; Hartmann, F.; Hauth, T.; Husemann, U.; Katkov, I.; Kornmayer, A.; Kuznetsova, E.; Lobelle Pardo, P.; Mozer, M. U.; Müller, Th.; Nürnberg, A.; Quast, G.; Rabbertz, K.; Ratnikov, F.; Röcker, S.; Simonis, H. J.; Stober, F. M.; Ulrich, R.; Wagner-Kuhr, J.; Wayand, S.; Weiler, T.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Markou, A.; Markou, C.; Psallidas, A.; Topsis-Giotis, I.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Stiliaris, E.; Aslanoglou, X.; Evangelou, I.; Flouris, G.; Foudas, C.; Kokkas, P.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Bencze, G.; Hajdu, C.; Hidas, P.; Horvath, D.; Sikler, F.; Veszpremi, V.; Vesztergombi, G.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Molnar, J.; Palinkas, J.; Szillasi, Z.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Swain, S. K.; Beri, S. B.; Bhatnagar, V.; Gupta, R.; Bhawandeep, U.; Kalsi, A. K.; Kaur, M.; Kumar, R.; Mittal, M.; Nishu, N.; Singh, J. B.; Kumar, Ashok; Kumar, Arun; Ahuja, S.; Bhardwaj, A.; Choudhary, B. C.; Kumar, A.; Malhotra, S.; Naimuddin, M.; Ranjan, K.; Sharma, V.; Banerjee, S.; Bhattacharya, S.; Chatterjee, K.; Dutta, S.; Gomber, B.; Jain, Sa.; Jain, Sh.; Khurana, R.; Modak, A.; Mukherjee, S.; Roy, D.; Sarkar, S.; Sharan, M.; Abdulsalam, A.; Dutta, D.; Kailas, S.; Kumar, V.; Mohanty, A. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Banerjee, S.; Bhowmik, S.; Chatterjee, R. M.; Dewanjee, R. K.; Dugad, S.; Ganguly, S.; Ghosh, S.; Guchait, M.; Gurtu, A.; Kole, G.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Mohanty, G. B.; Parida, B.; Sudhakar, K.; Wickramage, N.; Bakhshiansohi, H.; Behnamian, H.; Etesami, S. M.; Fahim, A.; Goldouzian, R.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Barbone, L.; Calabria, C.; Chhibra, S. S.; Colaleo, A.; Creanza, D.; De Filippis, N.; De Palma, M.; Fiore, L.; Iaselli, G.; Maggi, G.; Maggi, M.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Selvaggi, G.; Silvestris, L.; Singh, G.; Venditti, R.; Zito, G.; Abbiendi, G.; Benvenuti, A. C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Brigliadori, L.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Primavera, F.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Travaglini, R.; Albergo, S.; Cappello, G.; Chiorboli, M.; Costa, S.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Gallo, E.; Gonzi, S.; Gori, V.; Lenzi, P.; Meschini, M.; Paoletti, S.; Sguazzoni, G.; Tropiano, A.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Ferretti, R.; Ferro, F.; Lo Vetere, M.; Robutti, E.; Tosi, S.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Gerosa, R.; Ghezzi, A.; Govoni, P.; Lucchini, M. T.; Malvezzi, S.; Manzoni, R. A.; Martelli, A.; Marzocchi, B.; Menasce, D.; Moroni, L.; Paganoni, M.; Pedrini, D.; Ragazzi, S.; Redaelli, N.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; Di Guida, S.; Fabozzi, F.; Iorio, A. O. M.; Lista, L.; Meola, S.; Merola, M.; Paolucci, P.; Azzi, P.; Bacchetta, N.; Bisello, D.; Branca, A.; Carlin, R.; Checchia, P.; Dall'Osso, M.; Dorigo, T.; Dosselli, U.; Galanti, M.; Gasparini, F.; Gasparini, U.; Giubilato, P.; Gozzelino, A.; Kanishchev, K.; Lacaprara, S.; Margoni, M.; Meneguzzo, A. T.; Pazzini, J.; Pozzobon, N.; Ronchese, P.; Simonetto, F.; Torassa, E.; Tosi, M.; Zotto, P.; Zucchetta, A.; Zumerle, G.; Gabusi, M.; Ratti, S. P.; Re, V.; Riccardi, C.; Salvini, P.; Vitulo, P.; Biasini, M.; Bilei, G. M.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Mantovani, G.; Menichelli, M.; Romeo, F.; Saha, A.; Santocchia, A.; Spiezia, A.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Bernardini, J.; Boccali, T.; Broccolo, G.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Donato, S.; Fiori, F.; Foà, L.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Martini, L.; Messineo, A.; Moon, C. S.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Serban, A. T.; Spagnolo, P.; Squillacioti, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Vernieri, C.; Barone, L.; Cavallari, F.; D'imperio, G.; Del Re, D.; Diemoz, M.; Grassi, M.; Jorda, C.; Longo, E.; Margaroli, F.; Meridiani, P.; Micheli, F.; Nourbakhsh, S.; Organtini, G.; Paramatti, R.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Soffi, L.; Traczyk, P.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bellan, R.; Biino, C.; Cartiglia, N.; Casasso, S.; Costa, M.; Degano, A.; Demaria, N.; Finco, L.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Musich, M.; Obertino, M. M.; Ortona, G.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Potenza, A.; Romero, A.; Ruspa, M.; Sacchi, R.; Solano, A.; Staiano, A.; Tamponi, U.; Belforte, S.; Candelise, V.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Gobbo, B.; La Licata, C.; Marone, M.; Schizzi, A.; Umer, T.; Zanetti, A.; Chang, S.; Kropivnitskaya, A.; Nam, S. K.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Kong, D. J.; Lee, S.; Oh, Y. D.; Park, H.; Sakharov, A.; Son, D. C.; Kim, T. J.; Kim, J. Y.; Song, S.; Choi, S.; Gyun, D.; Hong, B.; Jo, M.; Kim, H.; Kim, Y.; Lee, B.; Lee, K. S.; Park, S. K.; Roh, Y.; Choi, M.; Kim, J. H.; Park, I. C.; Ryu, G.; Ryu, M. S.; Choi, Y.; Choi, Y. K.; Goh, J.; Kim, D.; Kwon, E.; Lee, J.; Seo, H.; Yu, I.; Juodagalvis, A.; Komaragiri, J. R.; Md Ali, M. A. B.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-de La Cruz, I.; Hernandez-Almada, A.; Lopez-Fernandez, R.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Vazquez Valencia, F.; Pedraza, I.; Salazar Ibarguen, H. A.; Casimiro Linares, E.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Reucroft, S.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Khalid, S.; Khan, W. A.; Khurshid, T.; Shah, M. A.; Shoaib, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Romanowska-Rybinska, K.; Szleper, M.; Zalewski, P.; Brona, G.; Bunkowski, K.; Cwiok, M.; Dominik, W.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Wolszczak, W.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Faccioli, P.; Ferreira Parracho, P. G.; Gallinaro, M.; Lloret Iglesias, L.; Nguyen, F.; Rodrigues Antunes, J.; Seixas, J.; Varela, J.; Vischia, P.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Konoplyanikov, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Moisenz, P.; Palichik, V.; Perelygin, V.; Shmatov, S.; Skatchkov, N.; Smirnov, V.; Zarubin, A.; Golovtsov, V.; Ivanov, Y.; Kim, V.; Levchenko, P.; Murzin, V.; Oreshkin, V.; Smirnov, I.; Sulimov, V.; Uvarov, L.; Vavilov, S.; Vorobyev, A.; Vorobyev, An.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Safronov, G.; Semenov, S.; Spiridonov, A.; Stolin, V.; Vlasov, E.; Zhokin, A.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Leonidov, A.; Mesyats, G.; Rusakov, S. V.; Vinogradov, A.; Belyaev, A.; Boos, E.; Bunichev, V.; Dubinin, M.; Dudko, L.; Ershov, A.; Gribushin, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Obraztsov, S.; Petrushanko, S.; Savrin, V.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Krychkine, V.; Petrov, V.; Ryutin, R.; Sobol, A.; Tourtchanovitch, L.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Ekmedzic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Battilana, C.; Calvo, E.; Cerrada, M.; Chamizo Llatas, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Domínguez Vázquez, D.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Navarro De Martino, E.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; Albajar, C.; de Trocóniz, J. F.; Missiroli, M.; Moran, D.; Brun, H.; Cuevas, J.; Fernandez Menendez, J.; Folgueras, S.; Gonzalez Caballero, I.; Brochero Cifuentes, J. A.; Cabrillo, I. J.; Calderon, A.; Duarte Campderros, J.; Fernandez, M.; Gomez, G.; Graziano, A.; Lopez Virto, A.; Marco, J.; Marco, R.; Martinez Rivero, C.; Matorras, F.; Munoz Sanchez, F. J.; Piedra Gomez, J.; Rodrigo, T.; Rodríguez-Marrero, A. Y.; Ruiz-Jimeno, A.; Scodellaro, L.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Auzinger, G.; Bachtis, M.; Baillon, P.; Ball, A. H.; Barney, D.; Benaglia, A.; Bendavid, J.; Benhabib, L.; Benitez, J. F.; Bernet, C.; Bianchi, G.; Bloch, P.; Bocci, A.; Bonato, A.; Bondu, O.; Botta, C.; Breuker, H.; Camporesi, T.; Cerminara, G.; Colafranceschi, S.; D'Alfonso, M.; d'Enterria, D.; Dabrowski, A.; David, A.; De Guio, F.; De Roeck, A.; De Visscher, S.; Di Marco, E.; Dobson, M.; Dordevic, M.; Dupont-Sagorin, N.; Elliott-Peisert, A.; Eugster, J.; Franzoni, G.; Funk, W.; Gigi, D.; Gill, K.; Giordano, D.; Girone, M.; Glege, F.; Guida, R.; Gundacker, S.; Guthoff, M.; Hammer, J.; Hansen, M.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Kousouris, K.; Krajczar, K.; Lecoq, P.; Lourenço, C.; Magini, N.; Malgeri, L.; Mannelli, M.; Marrouche, J.; Masetti, L.; Meijers, F.; Mersi, S.; Meschi, E.; Moortgat, F.; Morovic, S.; Mulders, M.; Musella, P.; Orsini, L.; Pape, L.; Perez, E.; Perrozzi, L.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Pimiä, M.; Piparo, D.; Plagge, M.; Racz, A.; Rolandi, G.; Rovere, M.; Sakulin, H.; Schäfer, C.; Schwick, C.; Sharma, A.; Siegrist, P.; Silva, P.; Simon, M.; Sphicas, P.; Spiga, D.; Steggemann, J.; Stieger, B.; Stoye, M.; Takahashi, Y.; Treille, D.; Tsirou, A.; Veres, G. I.; Vlimant, J. R.; Wardle, N.; Wöhri, H. K.; Wollny, H.; Zeuner, W. D.; Bertl, W.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Renker, D.; Rohe, T.; Bachmair, F.; Bäni, L.; Bianchini, L.; Buchmann, M. A.; Casal, B.; Chanon, N.; Dissertori, G.; Dittmar, M.; Donegà, M.; Dünser, M.; Eller, P.; Grab, C.; Hits, D.; Hoss, J.; Lustermann, W.; Mangano, B.; Marini, A. C.; Martinez Ruiz del Arbol, P.; Masciovecchio, M.; Meister, D.; Mohr, N.; Nägeli, C.; Nessi-Tedaldi, F.; Pandolfi, F.; Pauss, F.; Peruzzi, M.; Quittnat, M.; Rebane, L.; Rossini, M.; Starodumov, A.; Takahashi, M.; Theofilatos, K.; Wallny, R.; Weber, H. A.; Amsler, C.; Canelli, M. F.; Chiochia, V.; De Cosa, A.; Hinzmann, A.; Hreus, T.; Kilminster, B.; Lange, C.; Millan Mejias, B.; Ngadiuba, J.; Robmann, P.; Ronga, F. J.; Taroni, S.; Verzetti, M.; Yang, Y.; Cardaci, M.; Chen, K. H.; Ferro, C.; Kuo, C. M.; Lin, W.; Lu, Y. J.; Volpe, R.; Yu, S. S.; Chang, P.; Chang, Y. H.; Chang, Y. W.; Chao, Y.; Chen, K. F.; Chen, P. H.; Dietz, C.; Grundler, U.; Hou, W.-S.; Kao, K. Y.; Lei, Y. J.; Liu, Y. F.; Lu, R.-S.; Majumder, D.; Petrakou, E.; Tzeng, Y. M.; Wilken, R.; Asavapibhop, B.; Srimanobhas, N.; Suwonjandee, N.; Adiguzel, A.; Bakirci, M. N.; Cerci, S.; Dozen, C.; Dumanoglu, I.; Eskut, E.; Girgis, S.; Gokbulut, G.; Gurpinar, E.; Hos, I.; Kangal, E. E.; Kayis Topaksu, A.; Onengut, G.; Ozdemir, K.; Ozturk, S.; Polatoz, A.; Sunar Cerci, D.; Tali, B.; Topakli, H.; Vergili, M.; Akin, I. V.; Bilin, B.; Bilmis, S.; Gamsizkan, H.; Karapinar, G.; Ocalan, K.; Sekmen, S.; Surat, U. E.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Isildak, B.; Kaya, M.; Kaya, O.; Cankocak, K.; Vardarlı, F. I.; Levchuk, L.; Sorokin, P.; Brooke, J. J.; Clement, E.; Cussans, D.; Flacher, H.; Frazier, R.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Meng, Z.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Senkin, S.; Smith, V. J.; Williams, T.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Womersley, W. J.; Worm, S. D.; Baber, M.; Bainbridge, R.; Buchmuller, O.; Burton, D.; Colling, D.; Cripps, N.; Cutajar, M.; Dauncey, P.; Davies, G.; Della Negra, M.; Dunne, P.; Ferguson, W.; Fulcher, J.; Futyan, D.; Gilbert, A.; Hall, G.; Iles, G.; Jarvis, M.; Karapostoli, G.; Kenzie, M.; Lane, R.; Lucas, R.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mathias, B.; Nash, J.; Nikitenko, A.; Pela, J.; Pesaresi, M.; Petridis, K.; Raymond, D. M.; Rogerson, S.; Rose, A.; Seez, C.; Sharp, P.; Tapper, A.; Vazquez Acosta, M.; Virdee, T.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Leggat, D.; Leslie, D.; Martin, W.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Dittmann, J.; Hatakeyama, K.; Kasmi, A.; Liu, H.; Scarborough, T.; Charaf, O.; Cooper, S. I.; Henderson, C.; Rumerio, P.; Avetisyan, A.; Bose, T.; Fantasia, C.; Lawson, P.; Richardson, C.; Rohlf, J.; St. John, J.; Sulak, L.; Alimena, J.; Berry, E.; Bhattacharya, S.; Christopher, G.; Cutts, D.; Demiragli, Z.; Dhingra, N.; Ferapontov, A.; Garabedian, A.; Heintz, U.; Kukartsev, G.; Laird, E.; Landsberg, G.; Luk, M.; Narain, M.; Segala, M.; Sinthuprasith, T.; Speer, T.; Swanson, J.; Breedon, R.; Breto, G.; Calderon De La Barca Sanchez, M.; Chauhan, S.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Gardner, M.; Ko, W.; Lander, R.; Miceli, T.; Mulhearn, M.; Pellett, D.; Pilot, J.; Ricci-Tam, F.; Searle, M.; Shalhout, S.; Smith, J.; Squires, M.; Stolp, D.; Tripathi, M.; Wilbur, S.; Yohay, R.; Cousins, R.; Everaerts, P.; Farrell, C.; Hauser, J.; Ignatenko, M.; Rakness, G.; Takasugi, E.; Valuev, V.; Weber, M.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Hanson, G.; Heilman, J.; Ivova Rikova, M.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Luthra, A.; Malberti, M.; Nguyen, H.; Olmedo Negrete, M.; Shrinivas, A.; Sumowidagdo, S.; Wimpenny, S.; Andrews, W.; Branson, J. G.; Cerati, G. B.; Cittolin, S.; D'Agnolo, R. T.; Evans, D.; Holzner, A.; Kelley, R.; Klein, D.; Lebourgeois, M.; Letts, J.; Macneill, I.; Olivito, D.; Padhi, S.; Palmer, C.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Sudano, E.; Tadel, M.; Tu, Y.; Vartak, A.; Welke, C.; Würthwein, F.; Yagil, A.; Barge, D.; Bradmiller-Feld, J.; Campagnari, C.; Danielson, T.; Dishaw, A.; Flowers, K.; Franco Sevilla, M.; Geffert, P.; George, C.; Golf, F.; Gouskos, L.; Incandela, J.; Justus, C.; Mccoll, N.; Richman, J.; Stuart, D.; To, W.; West, C.; Yoo, J.; Apresyan, A.; Bornheim, A.; Bunn, J.; Chen, Y.; Duarte, J.; Mott, A.; Newman, H. B.; Pena, C.; Rogan, C.; Spiropulu, M.; Timciuc, V.; Wilkinson, R.; Xie, S.; Zhu, R. Y.; Azzolini, V.; Calamba, A.; Carlson, B.; Ferguson, T.; Iiyama, Y.; Paulini, M.; Russ, J.; Vogel, H.; Vorobiev, I.; Cumalat, J. P.; Ford, W. T.; Gaz, A.; Luiggi Lopez, E.; Nauenberg, U.; Smith, J. G.; Stenson, K.; Ulmer, K. A.; Wagner, S. R.; Alexander, J.; Chatterjee, A.; Chu, J.; Dittmer, S.; Eggert, N.; Mirman, N.; Nicolas Kaufman, G.; Patterson, J. R.; Ryd, A.; Salvati, E.; Skinnari, L.; Sun, W.; Teo, W. D.; Thom, J.; Thompson, J.; Tucker, J.; Weng, Y.; Winstrom, L.; Wittich, P.; Winn, D.; Abdullin, S.; Albrow, M.; Anderson, J.; Apollinari, G.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Cheung, H. W. K.; Chlebana, F.; Cihangir, S.; Elvira, V. D.; Fisk, I.; Freeman, J.; Gao, Y.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Hanlon, J.; Hare, D.; Harris, R. M.; Hirschauer, J.; Hooberman, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Kaadze, K.; Klima, B.; Kreis, B.; Kwan, S.; Linacre, J.; Lincoln, D.; Lipton, R.; Liu, T.; Lykken, J.; Maeshima, K.; Marraffino, J. M.; Martinez Outschoorn, V. I.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mishra, K.; Mrenna, S.; Musienko, Y.; Nahn, S.; Newman-Holmes, C.; O'Dell, V.; Prokofyev, O.; Sexton-Kennedy, E.; Sharma, S.; Soha, A.; Spalding, W. J.; Spiegel, L.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vidal, R.; Whitbeck, A.; Whitmore, J.; Yang, F.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Carver, M.; Cheng, T.; Curry, D.; Das, S.; De Gruttola, M.; Di Giovanni, G. P.; Field, R. D.; Fisher, M.; Furic, I. K.; Hugon, J.; Konigsberg, J.; Korytov, A.; Kypreos, T.; Low, J. F.; Matchev, K.; Milenovic, P.; Mitselmakher, G.; Muniz, L.; Rinkevicius, A.; Shchutska, L.; Snowball, M.; Sperka, D.; Yelton, J.; Zakaria, M.; Hewamanage, S.; Linn, S.; Markowitz, P.; Martinez, G.; Rodriguez, J. L.; Adams, T.; Askew, A.; Bochenek, J.; Diamond, B.; Haas, J.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Prosper, H.; Veeraraghavan, V.; Weinberg, M.; Baarmand, M. M.; Hohlmann, M.; Kalakhety, H.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Bazterra, V. E.; Berry, D.; Betts, R. R.; Bucinskaite, I.; Cavanaugh, R.; Evdokimov, O.; Gauthier, L.; Gerber, C. E.; Hofman, D. J.; Khalatyan, S.; Kurt, P.; Moon, D. H.; O'Brien, C.; Silkworth, C.; Turner, P.; Varelas, N.; Albayrak, E. A.; Bilki, B.; Clarida, W.; Dilsiz, K.; Duru, F.; Haytmyradov, M.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Rahmat, R.; Sen, S.; Tan, P.; Tiras, E.; Wetzel, J.; Yetkin, T.; Yi, K.; Barnett, B. A.; Blumenfeld, B.; Bolognesi, S.; Fehling, D.; Gritsan, A. V.; Maksimovic, P.; Martin, C.; Swartz, M.; Baringer, P.; Bean, A.; Benelli, G.; Bruner, C.; Kenny, R. P.; Malek, M.; Murray, M.; Noonan, D.; Sanders, S.; Sekaric, J.; Stringer, R.; Wang, Q.; Wood, J. S.; Barfuss, A. F.; Chakaberia, I.; Ivanov, A.; Khalil, S.; Makouski, M.; Maravin, Y.; Saini, L. K.; Shrestha, S.; Skhirtladze, N.; Svintradze, I.; Gronberg, J.; Lange, D.; Rebassoo, F.; Wright, D.; Baden, A.; Belloni, A.; Calvert, B.; Eno, S. C.; Gomez, J. A.; Hadley, N. J.; Kellogg, R. G.; Kolberg, T.; Lu, Y.; Marionneau, M.; Mignerey, A. C.; Pedro, K.; Skuja, A.; Tonjes, M. B.; Tonwar, S. C.; Apyan, A.; Barbieri, R.; Bauer, G.; Busza, W.; Cali, I. A.; Chan, M.; Di Matteo, L.; Dutta, V.; Gomez Ceballos, G.; Goncharov, M.; Gulhan, D.; Klute, M.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Ma, T.; Paus, C.; Ralph, D.; Roland, C.; Roland, G.; Stephans, G. S. F.; Stöckli, F.; Sumorok, K.; Velicanu, D.; Veverka, J.; Wyslouch, B.; Yang, M.; Zanetti, M.; Zhukova, V.; Dahmes, B.; Gude, A.; Kao, S. C.; Klapoetke, K.; Kubota, Y.; Mans, J.; Pastika, N.; Rusack, R.; Singovsky, A.; Tambe, N.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bloom, K.; Bose, S.; Claes, D. R.; Dominguez, A.; Gonzalez Suarez, R.; Keller, J.; Knowlton, D.; Kravchenko, I.; Lazo-Flores, J.; Malik, S.; Meier, F.; Snow, G. R.; Zvada, M.; Dolen, J.; Godshalk, A.; Iashvili, I.; Kharchilava, A.; Kumar, A.; Rappoccio, S.; Alverson, G.; Barberis, E.; Baumgartel, D.; Chasco, M.; Haley, J.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Trocino, D.; Wang, R.-J.; Wood, D.; Zhang, J.; Hahn, K. A.; Kubik, A.; Mucia, N.; Odell, N.; Pollack, B.; Pozdnyakov, A.; Schmitt, M.; Stoynev, S.; Sung, K.; Velasco, M.; Won, S.; Brinkerhoff, A.; Chan, K. M.; Drozdetskiy, A.; Hildreth, M.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Luo, W.; Lynch, S.; Marinelli, N.; Pearson, T.; Planer, M.; Ruchti, R.; Valls, N.; Wayne, M.; Wolf, M.; Woodard, A.; Antonelli, L.; Brinson, J.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Hill, C.; Hughes, R.; Kotov, K.; Ling, T. Y.; Puigh, D.; Rodenburg, M.; Smith, G.; Winer, B. L.; Wolfe, H.; Wulsin, H. W.; Driga, O.; Elmer, P.; Hebda, P.; Hunt, A.; Koay, S. A.; Lujan, P.; Marlow, D.; Medvedeva, T.; Mooney, M.; Olsen, J.; Piroué, P.; Quan, X.; Saka, H.; Stickland, D.; Tully, C.; Werner, J. S.; Zuranski, A.; Brownson, E.; Mendez, H.; Ramirez Vargas, J. E.; Barnes, V. E.; Benedetti, D.; Bortoletto, D.; De Mattia, M.; Gutay, L.; Hu, Z.; Jha, M. K.; Jones, M.; Jung, K.; Kress, M.; Leonardo, N.; Lopes Pegna, D.; Maroussov, V.; Miller, D. H.; Neumeister, N.; Radburn-Smith, B. C.; Shi, X.; Shipsey, I.; Silvers, D.; Svyatkovskiy, A.; Wang, F.; Xie, W.; Xu, L.; Yoo, H. D.; Zablocki, J.; Zheng, Y.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Ecklund, K. M.; Geurts, F. J. M.; Li, W.; Michlin, B.; Padley, B. P.; Redjimi, R.; Roberts, J.; Zabel, J.; Betchart, B.; Bodek, A.; Covarelli, R.; de Barbaro, P.; Demina, R.; Eshaq, Y.; Ferbel, T.; Garcia-Bellido, A.; Goldenzweig, P.; Han, J.; Harel, A.; Khukhunaishvili, A.; Petrillo, G.; Vishnevskiy, D.; Ciesielski, R.; Demortier, L.; Goulianos, K.; Lungu, G.; Mesropian, C.; Arora, S.; Barker, A.; Chou, J. P.; Contreras-Campana, C.; Contreras-Campana, E.; Duggan, D.; Ferencek, D.; Gershtein, Y.; Gray, R.; Halkiadakis, E.; Hidas, D.; Kaplan, S.; Lath, A.; Panwalkar, S.; Park, M.; Patel, R.; Salur, S.; Schnetzer, S.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Rose, K.; Spanier, S.; York, A.; Bouhali, O.; Castaneda Hernandez, A.; Eusebi, R.; Flanagan, W.; Gilmore, J.; Kamon, T.; Khotilovich, V.; Krutelyov, V.; Montalvo, R.; Osipenkov, I.; Pakhotin, Y.; Perloff, A.; Roe, J.; Rose, A.; Safonov, A.; Sakuma, T.; Suarez, I.; Tatarinov, A.; Akchurin, N.; Cowden, C.; Damgov, J.; Dragoiu, C.; Dudero, P. R.; Faulkner, J.; Kovitanggoon, K.; Kunori, S.; Lee, S. W.; Libeiro, T.; Volobouev, I.; Appelt, E.; Delannoy, A. G.; Greene, S.; Gurrola, A.; Johns, W.; Maguire, C.; Mao, Y.; Melo, A.; Sharma, M.; Sheldon, P.; Snook, B.; Tuo, S.; Velkovska, J.; Arenton, M. W.; Boutle, S.; Cox, B.; Francis, B.; Goodell, J.; Hirosky, R.; Ledovskoy, A.; Li, H.; Lin, C.; Neu, C.; Wood, J.; Clarke, C.; Harr, R.; Karchin, P. E.; Kottachchi Kankanamge Don, C.; Lamichhane, P.; Sturdy, J.; Belknap, D. A.; Carlsmith, D.; Cepeda, M.; Dasu, S.; Dodd, L.; Duric, S.; Friis, E.; Hall-Wilton, R.; Herndon, M.; Hervé, A.; Klabbers, P.; Lanaro, A.; Lazaridis, C.; Levine, A.; Loveless, R.; Mohapatra, A.; Ojalvo, I.; Perry, T.; Pierro, G. A.; Polese, G.; Ross, I.; Sarangi, T.; Savin, A.; Smith, W. H.; Taylor, D.; Verwilligen, P.; Vuosalo, C.; Woods, N.
2014-10-01
A search for neutral Higgs bosons in the minimal supersymmetric extension of the standard model (MSSM) decaying to tau-lepton pairs in pp collisions is performed, using events recorded by the CMS experiment at the LHC. The dataset corresponds to an integrated luminosity of 24.6 fb-1, with 4.9 fb-1 at 7 TeV and 19.7 fb-1 at 8 TeV. To enhance the sensitivity to neutral MSSM Higgs bosons, the search includes the case where the Higgs boson is produced in association with a b-quark jet. No excess is observed in the tau-lepton-pair invariant mass spectrum. Exclusion limits are presented in the MSSM parameter space for different benchmark scenarios, m {h/max}, m {h/mod +}, m {h/mod -}, light-stop, light-stau, τ-phobic, and low- m H. Upper limits on the cross section times branching fraction for gluon fusion and b-quark associated Higgs boson production are also given. [Figure not available: see fulltext.
Miller, Andrew W; Rodriguez, Derrick R; Honeyman, Bruce D
2013-05-01
Upscaling from bench scale systems to field scale systems incorporates physical and chemical heterogeneities from atomistic up to field scales. Heterogeneities of intermediate scale (~10(-1) m) are impossible to incorporate in a bench scale experiment. To transcend these scale discrepancies, this second in a pair of papers presents results from an intermediate scale, 3-D tank experiment completed using five different particle sizes of uranium contaminated sediment from a former uranium mill field site. The external dimensions of the tank were 2.44 m×0.61 m×0.61 m (L×H×W). The five particle sizes were packed in a heterogeneous manner using roughly 11 cm cubes. Small groundwater wells were installed for spatial characterization of chemical gradients and flow parameters. An approximately six month long bromide tracer test was used for flow field characterization. Within the flow domain, local uranium breakthrough curves exhibited a wide range of behaviors. However, the global effluent breakthrough curve was smooth, and not unlike breakthrough curves observed in column scale experiments. This paper concludes with an inter-tank comparison of all three experimental systems presented in this pair of papers. Although there is a wide range of chemical and physical variability between the three tanks, major chemical constituent behaviors are often quite similar or even identical. Copyright © 2013 Elsevier B.V. All rights reserved.
Luo, Huimin; Baker, Gary A; Dai, Sheng
2008-08-21
Vaporization enthalpies for two series of ionic liquids (ILs) composed of 1- n-alkyl-3-methylimidazolium cations, [Imm1+] (m=2, 3, 4, 6, 8, or 10), paired with either the bis(trifluoromethanesulfonyl)amide, [Tf2N-], or the bis(perfluoroethylsulfonyl)amide anion, [beti-], were determined using a simple, convenient, and highly reproducible thermogravimetric approach, and from these values, Hildebrand solubility parameters were estimated. Our results reveal two interesting and unanticipated outcomes: (i) methylation at the C2 position of [Imm1+] affords a significantly higher vaporization enthalpy; (ii) in all cases, the [beti-] anion served to lower the enthalpy of vaporization relative to [Tf2N-]. The widespread availability of the apparatus required for these measurements coupled with the ease of automation suggests the broad potential of this methodology for determining this critical parameter in a multitude of ILs.
Della Volpe, Angelique; Volker, Schmidt; Krautwald-Junghanns, Maria-Elisabeth
2011-03-01
The purpose of this study was to establish a technique for collecting semen from blue-fronted Amazon parrots (Amazona aestiva aestiva) and to evaluate the samples that were collected. The massage method is the most common technique used to collect semen in birds and has been proven successful in several psittacine species; however, collection attempts in larger parrots have been unsatisfactory. Six blue-fronted Amazon parrot males, 3 paired with hens and 3 unpaired, were used in this study. The semen collection technique was revised to allow collection from individual birds by a single person. Semen collection was attempted from the 6 parrots on 52-56 occasions, which totaled 330 single attempts. Nineteen ejaculates were collected, and each bird produced at least 1 ejaculate that contained spermatozoa. Large ranges of sample volume (1-15.4 microL), sperm quality (motility = 2%-60%; live:dead ratio = 2:198 to 185:15), sperm concentration (0.79-3.3 x 10(6) sperm/mL), and contamination rate (0%-100%) were observed. Measured parameters did not appear to be significantly impacted by birds being paired or kept singly. Because of the relatively short acclimation period, the birds appeared to be sexually inactive for the majority of the study. Further research using sexually active birds will be necessary to determine standard spermatological parameters and verify the success of the methodology used here.
BVR photometric investigation of galaxy pair KPG 562
NASA Astrophysics Data System (ADS)
Hendy, Y. H. M.
2018-06-01
This work presents BVR photometric observations and analyses for galaxy pair KPG 562 selected from the Karachentsev Catalog of Isolated Pairs of Galaxies. The observations were obtained using the 1.88-m Telescope of the Kottamia Astronomical Observatory (KAO), Egypt. There is no interaction signs assigned for this pair as reported by Karachentsev Catalog. We used the surface photometry technique to obtain photometric parameters for each galaxy of the pair. The isophotal contours, the luminosity profiles, color profiles (B-V, V-R), ellipticity profiles, position angle (PA) profiles and isophotal center-shift (xc, yc) profiles have been presented. The total and absolute magnitude, ellipticity and position angle (PA) were also obtained from the studied galaxy pair. The studied galaxy pair is clearly showing signs of interaction opposed to that found by Karachentsev. We found that the galaxy KPG 562b contains one tidal tail. The length and thickness of tidal tail were obtained and presented in this study.
Barker, Jacqueline M; Lench, Daniel H; Chandler, L Judson
2016-01-01
Alcohol use disorders are associated with deficits in adaptive behavior. While some behavioral impairments that are associated with alcohol use disorders may predate exposure to drugs of abuse, others may result directly from exposure to drugs of abuse, including alcohol. Identifying a causal role for how alcohol exposure leads to these impairments will enable further investigation of the neurobiological mechanisms by which it acts to dysregulate adaptive behavior. In the present study, we examined the effects of chronic intermittent ethanol exposure (CIE) on the use of reward-paired cues to guide consummatory behaviors in a mouse model, and further, how manipulations of mGluR2/3 signaling-known to be dysregulated after chronic alcohol exposure-may alter the expression of this behavior. Adult male C57B/6J mice were trained to self-administer 10 % ethanol and exposed to CIE via vapor inhalation. After CIE exposure, mice were trained in a Pavlovian task wherein a cue (tone) was paired with the delivery of a 10 % sucrose unconditioned stimulus. The use of the reward-paired cue to guide licking behavior was determined across training. The effect of systemic mGluR2/3 manipulation on discrimination between cue-on and cue-off intervals was assessed by administration of the mGluR2/3 agonist LY379268 or the antagonist LY341495 prior to a testing session. Exposure to CIE resulted in reductions in discrimination between cue-on and cue-off intervals, with CIE-exposed mice exhibiting significantly lower consummatory behavior during reward-paired cues than air controls. In addition, systemic administration of an mGluR2/3 agonist restored the use of reward-paired cues in CIE-exposed animals without impacting behavior in air controls. Conversely, administration of an mGluR2/3 antagonist mimicked the effects of CIE on cue-guided licking behavior, indicating that mGluR2/3 signaling can bidirectionally regulate the ability to use reward-paired cues to guide behavior. Together, these data suggest that chronic ethanol exposure drives impairments in the ability to use reward-paired cues to adaptively regulate behavior and that mGluR2/3 receptors represent a therapeutic target for restoration of these deficits in behavioral control in the alcoholic.
The Eclipsing System EP Andromedae and Its Circumbinary Companions
NASA Astrophysics Data System (ADS)
Lee, Jae Woo; Hinse, Tobias Cornelius; Park, Jang-Ho
2013-04-01
We present new long-term CCD photometry for EP And acquired during the period 2007-2012. The light curves display total eclipses at primary minima and season-to-season light variability. Our synthesis for all available light curves indicates that the eclipsing pair is a W-type overcontact binary with parameters of q = 2.578, i = 83.°3, ΔT = 27 K, f = 28%, and l 3 = 2%-3%. The asymmetric light curves in 2007 were satisfactorily modeled by a cool spot on either of the eclipsing components from a magnetic dynamo. Including our 95 timing measurements, a total of 414 times of minimum light spanning about 82 yr was used for a period study. A detailed analysis of the eclipse timing diagram revealed that the orbital period of EP And has varied as a combination of an upward-opening parabola and two periodic variations, with cycle lengths of P 3 = 44.6 yr and P 4 = 1.834 yr and semi-amplitudes of K 3 = 0.0100 days and K 4 = 0.0039 days, respectively. The observed period increase at a fractional rate of +1.39 × 10-10 is in excellent agreement with that calculated from the W-D code and can be plausibly explained by some combination of mass transfer from the primary to the secondary star and angular momentum loss due to magnetic braking. The most reasonable explanation for both cycles is a pair of light-travel-time effects driven by the possible existence of a third and fourth component with projected masses of M 3 = 0.25 M ⊙ and M 4 = 0.90 M ⊙. The more massive companion could be revealed using high-resolution spectroscopic data extending over the course of a few years and could also be a binary itself. It is possible that the circumbinary objects may have played an important role in the formation and evolution of the eclipsing pair, which would cause it to have a short initial orbital period and thus evolve into an overcontact configuration by angular momentum loss.
Aflague, Tanisha F; Boushey, Carol J; Guerrero, Rachael T Leon; Ahmad, Ziad; Kerr, Deborah A; Delp, Edward J
2015-06-02
Children's readiness to use technology supports the idea of children using mobile applications for dietary assessment. Our goal was to determine if children 3-10 years could successfully use the mobile food record (mFR) to capture a usable image pair or pairs. Children in Sample 1 were tasked to use the mFR to capture an image pair of one eating occasion while attending summer camp. For Sample 2, children were tasked to record all eating occasions for two consecutive days at two time periods that were two to four weeks apart. Trained analysts evaluated images. In Sample 1, 90% (57/63) captured one usable image pair. All children (63/63) returned the mFR undamaged. Sixty-two children reported: The mFR was easy to use (89%); willingness to use the mFR again (87%); and the fiducial marker easy to manage (94%). Children in Sample 2 used the mFR at least one day at Time 1 (59/63, 94%); Time 2 (49/63, 78%); and at both times (47/63, 75%). This latter group captured 6.21 ± 4.65 and 5.65 ± 3.26 mean (± SD) image pairs for Time 1 and Time 2, respectively. Results support the potential for children to independently record dietary intakes using the mFR.
Udupa, Kaviraja; Bahl, Nina; Ni, Zhen; Gunraj, Carolyn; Mazzella, Filomena; Moro, Elena; Hodaie, Mojgan; Lozano, Andres M; Lang, Anthony E; Chen, Robert
2016-01-13
Noninvasive brain stimulation studies have shown abnormal motor cortical plasticity in Parkinson's disease (PD). These studies used peripheral nerve stimulation paired with transcranial magnetic stimulation (TMS) to primary motor cortex (M1) at specific intervals to induce plasticity. Induction of cortical plasticity through stimulation of the basal ganglia (BG)-M1 connections has not been studied. In the present study, we used a novel technique of plasticity induction by repeated pairing of deep-brain stimulation (DBS) of the BG with M1 stimulation using TMS. We hypothesize that repeated pairing of subthalamic nucleus (STN)-DBS and M1-TMS at specific time intervals will lead to plasticity in the M1. Ten PD human patients with STN-DBS were studied in the on-medication state with DBS set to 3 Hz. The interstimulus intervals (ISIs) between STN-DBS and TMS that produced cortical facilitation were determined individually for each patient. Three plasticity induction conditions with repeated pairings (180 times) at specific ISIs (∼ 3 and ∼ 23 ms) that produced cortical facilitation and a control ISI of 167 ms were tested in random order. Repeated pairing of STN-DBS and M1-TMS at short (∼ 3 ms) and medium (∼ 23 ms) latencies increased M1 excitability that lasted for at least 45 min, whereas the control condition (fixed ISI of 167 ms) had no effect. There were no specific changes in motor thresholds, intracortical circuits, or recruitment curves. Our results indicate that paired-associative cortical plasticity can be induced by repeated STN and M1 stimulation at specific intervals. These results show that STN-DBS can modulate cortical plasticity. We introduced a new experimental paradigm to test the hypothesis that pairing subthalamic nucleus deep-brain stimulation (STN-DBS) with motor cortical transcranial magnetic stimulation (M1-TMS) at specific times can induce cortical plasticity in patients with Parkinson's disease (PD). We found that repeated pairing of STN-DBS with TMS at short (∼ 3 ms) and medium (∼ 23 ms) intervals increased cortical excitability that lasted for up to 45 min, whereas the control condition (fixed latency of 167 ms) had no effects on cortical excitability. This is the first demonstration of associative plasticity in the STN-M1 circuits in PD patients using this novel technique. The potential therapeutic effects of combining DBS and noninvasive cortical stimulation should be investigated further. Copyright © 2016 the authors 0270-6474/16/360397-09$15.00/0.
A new exact and more powerful unconditional test of no treatment effect from binary matched pairs.
Lloyd, Chris J
2008-09-01
We consider the problem of testing for a difference in the probability of success from matched binary pairs. Starting with three standard inexact tests, the nuisance parameter is first estimated and then the residual dependence is eliminated by maximization, producing what I call an E+M P-value. The E+M P-value based on McNemar's statistic is shown numerically to dominate previous suggestions, including partially maximized P-values as described in Berger and Sidik (2003, Statistical Methods in Medical Research 12, 91-108). The latter method, however, may have computational advantages for large samples.
The effect of charge transfer fluctuation on superconductivity in high temperature superconductors
NASA Astrophysics Data System (ADS)
Liu, Yihsuan; Wu, Huan-Kuang; Lee, Ting-Kuo
H i g h - Tc Cuprates have been studied quite often as an effective one band t - J model that neglects charge fluctuation between oxygen 2p6 band and copper 3d10 band, and Zhang-Rice singlet is just a hole in the model. However, recent Scanning Tunneling Spectra(STS) measurement on underdoped Cuprate shows that charge transfer gap is only of order 12 eV. This small gap necessitates a re-examination of the charge transfer fluctuation. Here we modify the t-J model by including charge transfer fluctuation allowing the formation of doubly occupied sites. For certain parameters it is similar with the t-J-U model. This model is studied via variational Monte Carlo method(VMC). Our result shows that this model can give a unified behavior of superconducting dome with different long rang hopping parameters. The anti-correlation between charge transfer gap and pairing is also confirmed. More interestingly the charge fluctuation is found to affect pairing order parameter in different ways in underdoped and overdoped regions. This work is partially supported by Taiwan Ministry of Science and Technology with Grant. MOST 105-2112-M-001-008 and calculation was supported by a National Center of High Performance Computing in Taiwan.
Permogorov, V I; Tiaglov, B V; Minaev, V E
1980-01-01
The data on the dependence of the melting curve parameters of double-stranded RNA (replicative form of RNA of f2 bacteriophage) poly(A) times poly(U) and poly(G) times poly(C) on the concentration of (C2H5)4NBr were obtained. The RNA melting range width is shown to pass through the minimum value T =2.1+/-0.1degrees at the point of inversion of relative stability of GC and AU pairs that corresponds to 4.0+/-0.1 M concentration of (C2H5)4NBr. Using the melting temperatures of poly(A) times poly(U) and poly(G) times poly(C) the rependence of Tgc-Tau parameter on (C2H5)4NBr concentration was shown. It was concluded from these data that the effect of the double-stranded RNA stacking heterogeneity was negligible in the 0-3 M range of (C2H5)4NBr concentration. Melting curves of RNA were obtained at various values of Tgc-Tau parameter. It was shown that the profile of fine structure of melting curves depends on the value of Tgc-Tau parameter.
Real-time observation of formation and relaxation dynamics of NH4 in (CH3OH)m(NH3)n clusters.
Yamada, Yuji; Nishino, Yoko; Fujihara, Akimasa; Ishikawa, Haruki; Fuke, Kiyokazu
2009-03-26
The formation and relaxation dynamics of NH4(CH3OH)m(NH3)n clusters produced by photolysis of ammonia-methanol mixed clusters has been observed by a time-resolved pump-probe method with femtosecond pulse lasers. From the detailed analysis of the time evolutions of the protonated cluster ions, NH4(+)(CH3OH)m(NH3)n, the kinetic model has been constructed, which consists of sequential three-step reaction: ultrafast hydrogen-atom transfer producing the radical pair (NH4-NH2)*, the relaxation process of radical-pair clusters, and dissociation of the solvated NH4 clusters. The initial hydrogen transfer hardly occurs between ammonia and methanol, implying the unfavorable formation of radical pair, (CH3OH2-NH2)*. The remarkable dependence of the time constants in each step on the number and composition of solvents has been explained by the following factors: hydrogen delocalization within the clusters, the internal conversion of the excited-state radical pair, and the stabilization of NH4 by solvation. The dependence of the time profiles on the probe wavelength is attributed to the different ionization efficiency of the NH4(CH3OH)m(NH3)n clusters.
NASA Astrophysics Data System (ADS)
Jentschura, Ulrich D.; Nándori, István; Ehrlich, Robert
2017-10-01
We consider in detail the calculation of the decay rate of high-energy superluminal neutrinos against (charged) lepton pair Cerenkov radiation, and neutrino pair Cerenkov radiation, i.e., against the decay channels ν \\to ν {e}+ {e}- and ν \\to ν \\overline{ν } ν . Under the hypothesis of a tachyonic nature of neutrinos, these decay channels put constraints on the lifetime of high-energy neutrinos for terrestrial experiments as well as on cosmic scales. For the oncoming neutrino, we use the Lorentz-covariant tachyonic relation {E}ν =\\sqrt{{p}2-{m}ν 2}, where m ν is the tachyonic mass parameter. We derive both threshold conditions as well as on decay and energy loss rates, using the plane-wave fundamental bispinor solutions of the tachyonic Dirac equation. Various intricacies of rest frame versus lab frame calculations are highlighted. The results are compared to the observations of high-energy IceCube neutrinos of cosmological origin.
Žužek, Monika C; Rozman, Janez; Pečlin, Polona; Vrecl, Milka; Frangež, Robert
2017-02-01
The ability to selectively stimulate Aα, Aβ-fibers and Aδ-fibers in an isolated rat sciatic nerve (SNR) was assessed. The stimulus used was a current, biphasic pulse with a quasitrapezoidal cathodic phase and rectangular anodic phase where parameters were systematically varied: intensity of the cathodic phase (ic); width of the cathodic phase (tc); width of the cathodic exponential decay (texp) and time constant of the exponential decay (τexp). A SNR was stimulated using a pair of hook electrodes while conduction velocity (CV) and compound action potentials (CAP) were measured at two sites along the SNR using another two pairs of electrodes. Results showed that the highest CAP1 (8.5-9 mV), shall be expected when parameters of the stimulus were within the following range: ic=3.8-4 mA, tc=350-400 μs and texp=330-440 μs. Results also showed that with ascending tc and texp, CV of the corresponding superficial region of the SNR was reduced in both, conduction velocity of CAP1 and conduction velocity of CAP2. It was concluded that action potentials (APs) were activated in the Aβ-fibers and Aδ-fibers along with a slight AP inhibition in the Aβ-fibers. The obtained results, could serve as a tool for developing multi-electrode systems that potentially enable fiber-type selective stimulation of nerve fibers.
Quadratic RK shooting solution for a environmental parameter prediction boundary value problem
NASA Astrophysics Data System (ADS)
Famelis, Ioannis Th.; Tsitouras, Ch.
2014-10-01
Using tools of Information Geometry, the minimum distance between two elements of a statistical manifold is defined by the corresponding geodesic, e.g. the minimum length curve that connects them. Such a curve, where the probability distribution functions in the case of our meteorological data are two parameter Weibull distributions, satisfies a 2nd order Boundary Value (BV) system. We study the numerical treatment of the resulting special quadratic form system using Shooting method. We compare the solutions of the problem when we employ a classical Singly Diagonally Implicit Runge Kutta (SDIRK) 4(3) pair of methods and a quadratic SDIRK 5(3) pair . Both pairs have the same computational costs whereas the second one attains higher order as it is specially constructed for quadratic problems.
Schwinger pair production by electric field coupled to inflaton
NASA Astrophysics Data System (ADS)
Geng, Jia-Jia; Li, Bao-Fei; Soda, Jiro; Wang, Anzhong; Wu, Qiang; Zhu, Tao
2018-02-01
We analytically investigate the Schwinger pair production in the de Sitter background by using the uniform asymptotic approximation method, and show that the equation of motion in general has two turning points, and the nature of these points could be single, double, real or complex, depending on the choice of the free parameters involved in the theory. Different natures of these points lead to different electric currents. In particular, when β ≡ m2/H2‑9/4 is positive, both turning points are complex, and the electric current due to the Schwinger process is highly suppressed, where m and H denote, respectively, the mass of the particle and the Hubble parameter. For the turning points to be real, it is necessary to have β < 0, and the more negative of β, the easier to produce particles. In addition, when β < 0, we also study the particle production when the electric field E is very weak. We find that the electric current in this case is proportional to E1/2 ‑ √|β|, which is strongly enhanced in the weak electric field limit when m < √2 H.
Electron spin resonance for the detection of long-range spin nematic order
NASA Astrophysics Data System (ADS)
Furuya, Shunsuke C.; Momoi, Tsutomu
2018-03-01
Spin nematic phase is a quantum magnetic phase characterized by a quadrupolar order parameter. Since the quadrupole operators are directly coupled to neither the magnetic field nor the neutron, currently, it is an important issue to develop a method for detecting the long-range spin nematic order. In this paper, we propose that electron spin resonance (ESR) measurements enable us to detect the long-range spin nematic order. We show that the frequency of the paramagnetic resonance peak in the ESR spectrum is shifted by the ferroquadrupolar order parameter together with other quantities. The ferroquadrupolar order parameter is extractable from the angular dependence of the frequency shift. In contrast, the antiferroquadrupolar order parameter is usually invisible in the frequency shift. Instead, the long-range antiferroquadrupolar order yields a characteristic resonance peak in the ESR spectrum, which we call a magnon-pair resonance peak. This resonance corresponds to the excitation of the bound magnon pair at the wave vector k =0 . Reflecting the condensation of bound magnon pairs, the field dependence of the magnon-pair resonance frequency shows a singular upturn at the saturation field. Moreover, the intensity of the magnon-pair resonance peak shows a characteristic angular dependence and it vanishes when the magnetic field is parallel to one of the axes that diagonalize the weak anisotropic interactions. We confirm these general properties of the magnon-pair resonance peak in the spin nematic phase by studying an S =1 bilinear-biquadratic model on the square lattice in the linear flavor-wave approximation. In addition, we argue applications to the S =1/2 frustrated ferromagnets and also the S =1/2 orthogonal dimer spin system SrCu2(BO3)2, both of which are candidate materials of spin nematics. Our theory for the antiferroquadrupolar ordered phase is consistent with many features of the magnon-pair resonance peak experimentally observed in the low-magnetization regime of SrCu2(BO3)2.
N = 2 supersymmetry and Bailey pairs
NASA Astrophysics Data System (ADS)
Berkovich, Alexander; McCoy, Barry M.; Schilling, Anne
1996-02-01
We demonstrate that the Bailey pair formulation of Rogers-Ramanujan identities unifies the calculations of the characters of N = 1 and N = 2 supersymmetric conformal field theories with the counterpart theory with no supersymmetry. We illustrate this construction for the M(3,4) (Ising) model where the Bailey pairs have been given by Slater. We then present the general unitary case. We demonstrate that the model M( p,p + 1) is derived from M( p - 1, p) by a Bailey renormalization flow and conclude by obtaining the N = 1 model SM( p,p + 2) and the unitary N = 2 model with central charge c = 3(1 - 2/ p).
Design of Energetic Ionic Liquids
2007-06-01
associated polarizable force fields, and mesoscale-level simulations with currently usedpropellants. of bulk ionic liquids based upon multiscale coarse A...pair. The 1H,3H cation paired with perchlorate ( nitrate ) has a proton transfer barrier of 2.7 0.08w ’I (3.0) kcal/mol. /.04 - M K I 373K<[Emimlllm-l Ion...series of ion clusters [Emim+]m[Im’]mn± 4-amino- 1,2,4-triazolium nitrate (HEATN) have (m=l-3) were computed using the hybrid B3LYP density identified a
Nonin, S; Leroy, J L
1996-08-23
At slightly acidic pH, protonation of C-rich oligomers results in the formation of a four-stranded structure composed of two parallel duplexes in a head to tail orientation with their hemi-protonated C.C+ pairs intercalated in a so-called i-motif. In all cases reported previously the duplexes are identical. The tetramer formed by the d(5mCCTCC) oligomer is different. The structure is computed on the basis of 55 inter-residue distances derived from NOESY cross-peaks measured at short mixing times. It consists of two intercalated non-equivalent symmetrical duplexes. The base stacking order is C5* C1 C4* C2 (T3*) T3 C2* C4 C1* C5, but the thymidine bases (T3*) of one duplex are looped out and lie in the wide grooves of the tetramer. The thymidine bases T3 stack as a symmetrical T.T pair between the sequentially adjacent C2.C2+ pair and the C2*.C2*+ pair of the other duplex. Numerous exchange cross-peaks provide evidence for duplex interconversion. The interconversion rate is 1.4 s-1 at 0 degree C and the activation energy is 94 kJ/mol. The opening of the T3.T3 pair, the closing of the T3*.T3 pair, and the opening of the C2*.C2*+ pair occur simultaneously with the duplex interconversion. This suggests that the concerted opening and closing of the thymidine bases drive the duplex interconversion. Opening of the C4.C4+ and C4*.C4*+ pairs, and dissociation of the tetramer are not part of the interconversion since they occur at much slower rates. Duplex interconversion within the [d(5mCCTCC)]4 tetramer provides the first structural and kinetics characterization of broken symmetry in a biopolymer. The tetramer formed by d(5mCCUCC) adopts a similar structure, but the rate of duplex interconversion is faster: 40 s-1 at 0 degree C. At 32 degrees C, interconversion is fast on the NMR time scale.
Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes
Watkins, Norman E.; SantaLucia, John
2005-01-01
Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087
MAJOR-MERGER GALAXY PAIRS IN THE COSMOS FIELD-MASS-DEPENDENT MERGER RATE EVOLUTION SINCE z = 1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, C. Kevin; Zhao, Yinghe; Gao, Y.
2012-03-10
We present results of a statistical study of the cosmic evolution of the mass-dependent major-merger rate since z = 1. A stellar mass limited sample of close major-merger pairs (the CPAIR sample) was selected from the archive of the COSMOS survey. Pair fractions at different redshifts derived using the CPAIR sample and a local K-band-selected pair sample show no significant variations with stellar mass. The pair fraction exhibits moderately strong cosmic evolution, with the best-fitting function of f{sub pair} = 10{sup -1.88({+-}0.03)}(1 + z){sup 2.2({+-}0.2)}. The best-fitting function for the merger rate is R{sub mg} (Gyr{sup -1}) = 0.053 Multiplication-Signmore » (M{sub star}/10{sup 10.7} M{sub Sun} ){sup 0.3}(1 + z){sup 2.2}/(1 + z/8). This rate implies that galaxies of M{sub star} {approx} 10{sup 10}-10{sup 11.5} M{sub Sun} have undergone {approx}0.5-1.5 major mergers since z = 1. Our results show that, for massive galaxies (M{sub star} {>=} 10{sup 10.5} M{sub Sun }) at z {<=} 1, major mergers involving star-forming galaxies (i.e., wet and mixed mergers) can account for the formation of both ellipticals and red quiescent galaxies (RQGs). On the other hand, major mergers cannot be responsible for the formation of most low mass ellipticals and RQGs of M{sub star} {approx}< 10{sup 10.3} M{sub Sun }. Our quantitative estimates indicate that major mergers have significant impact on the stellar mass assembly of the most massive galaxies (M{sub star} {>=} 10{sup 11.3} M{sub Sun }), but for less massive galaxies the stellar mass assembly is dominated by the star formation. Comparison with the mass-dependent (ultra)luminous infrared galaxies ((U)LIRG) rates suggests that the frequency of major-merger events is comparable to or higher than that of (U)LIRGs.« less
Non-equilibrium effects in steady relativistic e^+e^-gamma winds
NASA Astrophysics Data System (ADS)
Grimsrud, Ole M.; Wasserman, Ira
1998-11-01
We consider an ultrarelativistic wind consisting of electron-positron pairs and photons with the principal goal of finding the asymptotic Lorentz factor gamma_∞ for zero baryon number. The wind is assumed to originate at radius r_i where it has a Lorentz factor gamma_i and a temperature T_i sufficiently high to maintain pair equilibrium. As r increases, T decreases and becomes less than the temperature corresponding to the electron mass m_e, after which non-equilibrium effects become important. The pairs, which carry only a small fraction of the total energy, may be accelerated by the photons until tau falls below ~2x10^-5gamma^3/4_i. Radiative transfer calculations show that only at this point do the radiation flux and pressure start to deviate significantly from their blackbody values. The acceleration of the pairs increases gamma by a factor ~45 compared with its value at the photosphere; it is shown to approach gamma_∞~1.4x10^3(r^6_i/10cm)^1/4gamma^{3/4}_iT_i/m_e. The limit of zero baryon number is a good approximation when the mass injection rate Msolar in the flow is below a critical value corresponding to (Esolar/MsolarM)_c,0~5x10^7(r^6_i/10cm)T_i/m_e for fixed energy injection rate E/E. For large baryon loading, (Esolar/Msolar<~Esolar/Msolar)_c,M~350(r_i/10^6cm)^1/4gamma^3/4_iT_i/ m_e, the asymptotic Lorentz factor is gamma_∞~Esolar/Msolar. Surprisingly, increasing Esolar/Msolar from (Esolar/Msolar)_c,M to ∞ only increases gamma_∞ by a factor ~(m_p/m_e)^1/4~6.5, less than an order of magnitude. As Esolar/Msolar increases, the fraction of the energy carried by pairs decreases, reaching ~10^-5gamma^3/4_i as Esolar/Msolar to ∞.
Quasar lenses and pairs in the VST-ATLAS and Gaia
NASA Astrophysics Data System (ADS)
Agnello, A.; Schechter, P. L.; Morgan, N. D.; Treu, T.; Grillo, C.; Malesani, D.; Anguita, T.; Apostolovski, Y.; Rusu, C. E.; Motta, V.; Rojas, K.; Chehade, B.; Shanks, T.
2018-04-01
We report on discovery results from a quasar lens search in the ATLAS-DR3 public footprint. Spectroscopic follow-up campaigns, conducted at the 2.6 m Nordic Optical Telescope (La Palma) and 3.6 m New Technology Telescope (La Silla) in 2016, yielded seven pairs of quasars exhibiting the same lines at the same redshift and monotonic flux ratios with wavelength (hereafter NIQs, nearly identical quasar pairs). Magellan spectra of A0140-1152 (01h40m03{^s.}0-11d52m19{^s.}0, zs = 1.807) confirm it as a lens with deflector at zl = 0.277 and Einstein radius θE = (0.73 ± 0.02) arcsec. Follow-up imaging of the NIQ A2213-2652 (22h13m38{^s.}4-26d52m27{^s.}1) reveals the deflector galaxy and confirms it as a lens. We show the use of spatial resolution from the Gaia mission to select lenses and list additional systems from a WISE-Gaia-ATLAS search, yielding three additional lenses (02h35m27{^s.}4-24d33m13{^s.}2, 02h59m33s-23d38m01{^s.}8, 01h46m32{^s.}9-11d33m39{^s.}0). The overall sample consists of 11 lenses/NIQs, plus three lenses known before 2016, over the ATLAS-DR3 footprint (≈3500 deg2). Finally, we discuss future prospects for objective classification of pair/NIQ/contaminant spectra.
Pairing matrix elements and pairing gaps with bare, effective, and induced interactions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barranco, F.; Bortignon, P.F.; Colo, G.
2005-11-01
The dependence on the single-particle states of the pairing matrix elements of the Gogny force and of the bare low-momentum nucleon-nucleon potential v{sub low-k}--designed so as to reproduce the low-energy observables avoiding the use of a repulsive core--is studied for a typical finite, superfluid nucleus ({sup 120}Sn). It is found that the matrix elements of v{sub low-k} follow closely those of v{sub Gogny} on a wide range of energy values around the Fermi energy e{sub F}, those associated with v{sub low-k} being less attractive. This result explains the fact that around e{sub F} the pairing gap {delta}{sub Gogny} associated withmore » the Gogny interaction (and with a density of single-particle levels corresponding to an effective k mass m{sub k}{approx_equal}0.7 m) is a factor of about 2 larger than {delta}{sub low-k}, being in agreement with {delta}{sub exp}=1.4 MeV. The exchange of low-lying collective surface vibrations among pairs of nucleons moving in time-reversal states gives rise to an induced pairing interaction v{sub ind} peaked at e{sub F}. The interaction (v{sub low-k}+v{sub ind}) Z{sub {omega}} arising from the renormalization of the bare nucleon-nucleon potential and of the single-particle motion ({omega}-mass and quasiparticle strength Z{sub {omega}}) associated with the particle-vibration coupling mechanism, leads to a value of the pairing gap at the Fermi energy {delta}{sub ren} that accounts for the experimental value. An important question that remains to be studied quantitatively is to what extent {delta}{sub Gogny}, which depends on average parameters, and {delta}{sub ren}, which explicitly depends on the parameters describing the (low-energy) nuclear structure, display or not a similar isotopic dependence and whether this dependence is borne out by the data.« less
An inversion of 25 base pairs causes feline GM2 gangliosidosis variant.
Martin, Douglas R; Krum, Barbara K; Varadarajan, G S; Hathcock, Terri L; Smith, Bruce F; Baker, Henry J
2004-05-01
In G(M2) gangliosidosis variant 0, a defect in the beta-subunit of lysosomal beta-N-acetylhexosaminidase (EC 3.2.1.52) causes abnormal accumulation of G(M2) ganglioside and severe neurodegeneration. Distinct feline models of G(M2) gangliosidosis variant 0 have been described in both domestic shorthair and Korat cats. In this study, we determined that the causative mutation of G(M2) gangliosidosis in the domestic shorthair cat is a 25-base-pair inversion at the extreme 3' end of the beta-subunit (HEXB) coding sequence, which introduces three amino acid substitutions at the carboxyl terminus of the protein and a translational stop that is eight amino acids premature. Cats homozygous for the 25-base-pair inversion express levels of beta-subunit mRNA approximately 190% of normal and protein levels only 10-20% of normal. Because the 25-base-pair inversion is similar to mutations in the terminal exon of human HEXB, the domestic shorthair cat should serve as an appropriate model to study the molecular pathogenesis of human G(M2) gangliosidosis variant 0 (Sandhoff disease).
Measuring and predicting Delta(vap)H298 values of ionic liquids.
Deyko, Alexey; Lovelock, Kevin R J; Corfield, Jo-Anne; Taylor, Alasdair W; Gooden, Peter N; Villar-Garcia, Ignacio J; Licence, Peter; Jones, Robert G; Krasovskiy, Vladimir G; Chernikova, Elena A; Kustov, Leonid M
2009-10-14
We report the enthalpies of vaporisation (measured using temperature programmed desorption by mass spectrometry) of twelve ionic liquids (ILs), covering four imidazolium, [C(m)C(n)Im]+, five pyrrolidinium, [C(n)C(m)Pyrr]+, two pyridinium, [C(n)Py]+, and a dication, [C3(C1Im)2]2+ based IL. These cations were paired with a range of anions: [BF4]-, [FeCl4]-, [N(CN)2]-, [PF3(C2F5)3]- ([FAP]-), [(CF3SO2)2N]- ([Tf2N]-) and [SCN]-. Using these results, plus those for a further eight imidazolium based ILs published earlier (which include the anions [CF3SO3]- ([TfO]-), [PF6]- and [EtSO4]-), we show that the enthalpies of vaporisation can be decomposed into three components. The first component is the Coulombic interaction between the ions, DeltaU(Cou,R), which is a function of the IL molar volume, V(m), and a parameter R(r) which quantifies the relative change in anion-cation distance on evaporation from the liquid phase to the ion pair in the gas phase. The second and third components are the van der Waals contributions from the anion, DeltaH(vdw,A), and the cation, DeltaH(vdw,C). We derive a universal value for R(r), and individual values of DeltaH(vdw,A) and DeltaH(vdw,C) for each of the anions and cations considered in this study. Given the molar volume, it is possible to estimate the enthalpies of vaporisation of ILs composed of any combination of the ions considered here; values for fourteen ILs which have not yet been studied experimentally are given.
Galaxy And Mass Assembly (GAMA): galaxy close pairs, mergers and the future fate of stellar mass
NASA Astrophysics Data System (ADS)
Robotham, A. S. G.; Driver, S. P.; Davies, L. J. M.; Hopkins, A. M.; Baldry, I. K.; Agius, N. K.; Bauer, A. E.; Bland-Hawthorn, J.; Brough, S.; Brown, M. J. I.; Cluver, M.; De Propris, R.; Drinkwater, M. J.; Holwerda, B. W.; Kelvin, L. S.; Lara-Lopez, M. A.; Liske, J.; López-Sánchez, Á. R.; Loveday, J.; Mahajan, S.; McNaught-Roberts, T.; Moffett, A.; Norberg, P.; Obreschkow, D.; Owers, M. S.; Penny, S. J.; Pimbblet, K.; Prescott, M.; Taylor, E. N.; van Kampen, E.; Wilkins, S. M.
2014-11-01
We use a highly complete subset of the Galaxy And Mass Assembly II (GAMA-II) redshift sample to fully describe the stellar mass dependence of close pairs and mergers between 108 and 1012 M⊙. Using the analytic form of this fit we investigate the total stellar mass accreting on to more massive galaxies across all mass ratios. Depending on how conservatively we select our robust merging systems, the fraction of mass merging on to more massive companions is 2.0-5.6 per cent. Using the GAMA-II data we see no significant evidence for a change in the close pair fraction between redshift z = 0.05 and 0.2. However, we find a systematically higher fraction of galaxies in similar mass close pairs compared to published results over a similar redshift baseline. Using a compendium of data and the function γM = A(1 + z)m to predict the major close pair fraction, we find fitting parameters of A = 0.021 ± 0.001 and m = 1.53 ± 0.08, which represents a higher low-redshift normalization and shallower power-law slope than recent literature values. We find that the relative importance of in situ star formation versus galaxy merging is inversely correlated, with star formation dominating the addition of stellar material below M^* and merger accretion events dominating beyond M^*. We find mergers have a measurable impact on the whole extent of the galaxy stellar mass function (GSMF), manifest as a deepening of the `dip' in the GSMF over the next ˜Gyr and an increase in M^* by as much as 0.01-0.05 dex.
Fisher, Darrell R.; Wai, Chien M.; Chen, Xiaoyuan
2000-01-01
The invention pertains to compounds which specifically bind radionuclides, and to methods of making radionuclide complexing compounds. In one aspect, the invention includes a radionuclide delivery system comprising: a) a calix[n]arene-crown-[m]-ether compound, wherein n is an integer greater than 3, and wherein m is an integer greater than 3, the calix[n]arene-crown-[m]-ether compound comprising at least two ionizable groups; and b) an antibody attached to the calix[n]arene-crown-[m]-ether compound. In another aspect, the invention includes a method of making a radium complexing compound, comprising: a) providing a calix[n]arene compound, wherein n is an integer greater than 3, the calix[n]arene compound comprising n phenolic hydroxyl groups; b) providing a crown ether precursor, the crown ether precursor comprising a pair of tosylated ends; c) reacting the pair of tosylated ends with a pair of the phenolic hydroxyl groups to convert said pair of phenolic hydroxyl groups to ether linkages, the ether linkages connecting the crown ether precursor to the calix[n]arene to form a calix[n]arene-crown-[m]-ether compound, wherein m is an integer greater than 3; d) converting remaining phenolic hydroxyl groups to esters; e) converting the esters to acids, the acids being proximate a crown-[m]-ether portion of the calix[n]arene-crown-[m]-ether compound; and f) providing a Ra.sup.2+ ion within the crown-[m]-ether portion of the calix[n]arene-crown-[m]-ether compound.
mRNA–mRNA duplexes that auto-elicit Staufen1-mediated mRNA decay
Gong, Chenguang; Tang, Yalan; Maquat, Lynne E.
2013-01-01
We report a new mechanism by which human mRNAs crosstalk: an Alu element in the 3'-untranslated region (3' UTR) of one mRNA can base-pair with a partially complementary Alu element in the 3' UTR of a different mRNA thereby creating a Staufen1 (STAU1)-binding site (SBS). STAU1 binding to a 3' UTR SBS was previously shown to trigger STAU1-mediated mRNA decay (SMD) by directly recruiting the ATP-dependent RNA helicase UPF1, which is also a key factor in the mechanistically related nonsense-mediated mRNA decay (NMD) pathway. In the case of a 3' UTR SBS created via mRNA–mRNA base-pairing, we show that SMD targets both mRNAs in the duplex provided that both mRNAs are translated. If only one mRNA is translated, then it alone is targeted for SMD. We demonstrate the importance of mRNA–mRNA-triggered SMD to the processes of cell migration and invasion. PMID:24056942
Line Parameters of the PH_3 Pentad in the 4-5 μm Region
NASA Astrophysics Data System (ADS)
Devi, V. Malathy; Benner, D. Chris; Kleiner, I.; Sams, R. L.; Blake, T. A.; Brown, Linda R.; Fletcher, L. N.
2012-06-01
Line positions, intensities and line shape parameters are reported for four bands of phosphine between 2150 and 2400 cm-1 in order to improve the spectroscopic database for remote sensing of the giant planets. Knowledge of PH_3 in this spectral region is important for Cassini/VIMS exploration of dynamics and chemistry on Saturn, as well as for interpreting the near-IR data from Juno and ESA's proposed Jupiter mission. For this study, five high-resolution (0.0023 cm-1), high signal-to-noise (>2000) spectra of pure PH_3 were recorded at room temperature (298.2 K) with the Bruker IFS 125HR Fourier transform spectrometer at Pacific Northwest National Laboratory. Individual line parameters were retrieved by multispectrum fitting of all five spectra simultaneously. Positions and intensities were measured for over 3100 transitions. The rotational quantum numbers of measured lines go as high as J''=16 and K''=15 in the ν_3 and ν_1 bands; some lines of the weaker bands 2ν_4 and ν_2+ν_4 are also reported. The measured positions and intensities are compared to new theoretical calculations of the pentad. Lorentz self-broadened width and pressure-induced shift coefficients of many transitions were also obtained, along with speed dependence parameters. Line mixing coefficients were determined for several A+A- pairs of transitions for K''=3, 6, and 9. Research described in this paper was performed at the College of William and Mary and the Jet Propulsion Laboratory, California Institute of Technology, under contracts and cooperative agreements with the National Aeronautics and Space Administration. L. Fletcher acknowledges support from a Glasstone Science Fellowship. D. C. Benner, C. P. Rinsland, V. Malathy Devi, M. A. H. Smith and D. A. Atkins, JQSRT 53 (1995) 705-721.
Impacts of a Stochastic Ice Mass-Size Relationship on Squall Line Ensemble Simulations
NASA Astrophysics Data System (ADS)
Stanford, M.; Varble, A.; Morrison, H.; Grabowski, W.; McFarquhar, G. M.; Wu, W.
2017-12-01
Cloud and precipitation structure, evolution, and cloud radiative forcing of simulated mesoscale convective systems (MCSs) are significantly impacted by ice microphysics parameterizations. Most microphysics schemes assume power law relationships with constant parameters for ice particle mass, area, and terminal fallspeed relationships as a function of size, despite observations showing that these relationships vary in both time and space. To account for such natural variability, a stochastic representation of ice microphysical parameters was developed using the Predicted Particle Properties (P3) microphysics scheme in the Weather Research and Forecasting model, guided by in situ aircraft measurements from a number of field campaigns. Here, the stochastic framework is applied to the "a" and "b" parameters of the unrimed ice mass-size (m-D) relationship (m=aDb) with co-varying "a" and "b" values constrained by observational distributions tested over a range of spatiotemporal autocorrelation scales. Diagnostically altering a-b pairs in three-dimensional (3D) simulations of the 20 May 2011 Midlatitude Continental Convective Clouds Experiment (MC3E) squall line suggests that these parameters impact many important characteristics of the simulated squall line, including reflectivity structure (particularly in the anvil region), surface rain rates, surface and top of atmosphere radiative fluxes, buoyancy and latent cooling distributions, and system propagation speed. The stochastic a-b P3 scheme is tested using two frameworks: (1) a large ensemble of two-dimensional idealized squall line simulations and (2) a smaller ensemble of 3D simulations of the 20 May 2011 squall line, for which simulations are evaluated using observed radar reflectivity and radial velocity at multiple wavelengths, surface meteorology, and surface and satellite measured longwave and shortwave radiative fluxes. Ensemble spreads are characterized and compared against initial condition ensemble spreads for a range of variables.
Competing order parameters in Fermi systems with engineered band dispersion
NASA Astrophysics Data System (ADS)
Wu, Chien-Te; Boyack, Rufus; Anderson, Brandon; Levin, K.
We explore a variety of competing phases in 2D and 3D Fermi gases in the presence of novel dispersion relations resulting from a shaken optical lattice. We incorporate spin imbalance along with attractive interactions. In 3D, at the mean field level we present phase diagrams reflecting the stability of alternative order parameters in the pairing (including LOFF) and charge density wave channels. We perform analogous studies in 2D, where we focus on the competition between different paired phases. Important in this regard is that our 2D studies are consistent with the Mermin Wagner theorem, so that, while there is competition, conventional superfluidity cannot occur
NASA Astrophysics Data System (ADS)
Becker, Harry
The possible application of Compact Heat and Mass Exchangers (CHME) in a gas fired Absorption Heat Pump (AHP) for domestic heating is studied. The above mentioned heat and mass exchangers are of the plate type. The space between the parallel and plain plates is filled up with corrugated plates of a certain height. The plain and finned plates are stacked and welded together. This gives a heat and mass exchanger which is very compact, expressed by a high area density (m2/m3). This leads to heat and mass transfer processes with small temperature and concentration differences. For testing purposes a pilot plant was built using the above type of components in order to test their heat and/or mass transfer performance. Only the generator is of the Shell And Tube (SAT) type. As the working pair, CH3OH - LiBr/ ZnBr2 was chosen, with the alcohol as the solvent and the salt mixture as the absorbent. This leads to sub atmospheric working pressures with only solvent in the vapor phase. Three series of experiments have been carried out, during which the input parameters were varied over a certain range. It is concluded that the plate fin CHMES are very suitable for application in an AHP for domestic heating purposes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Jing; Peter Grünberg Institute; Zhang, Yi
2014-05-15
We investigated and optimized the low-frequency noise characteristics of a preamplifier used for readout of direct current superconducting quantum interference devices (SQUIDs). When the SQUID output was detected directly using a room-temperature low-voltage-noise preamplifier, the low-frequency noise of a SQUID system was found to be dominated by the input current noise of the preamplifiers in case of a large dynamic resistance of the SQUID. To reduce the current noise of the preamplifier in the low-frequency range, we investigated the dependence of total preamplifier noise on the collector current and source resistance. When the collector current was decreased from 8.4 mAmore » to 3 mA in the preamplifier made of 3 parallel SSM2220 transistor pairs, the low-frequency total voltage noise of the preamplifier (at 0.1 Hz) decreased by about 3 times for a source resistance of 30 Ω whereas the white noise level remained nearly unchanged. Since the relative contribution of preamplifier's input voltage and current noise is different depending on the dynamic resistance or flux-to-voltage transfer of the SQUID, the results showed that the total noise of a SQUID system at low-frequency range can be improved significantly by optimizing the preamplifier circuit parameters, mainly the collector current in case of low-noise bipolar transistor pairs.« less
NASA Astrophysics Data System (ADS)
Zhao, Jing; Zhang, Yi; Lee, Yong-Ho; Krause, Hans-Joachim
2014-05-01
We investigated and optimized the low-frequency noise characteristics of a preamplifier used for readout of direct current superconducting quantum interference devices (SQUIDs). When the SQUID output was detected directly using a room-temperature low-voltage-noise preamplifier, the low-frequency noise of a SQUID system was found to be dominated by the input current noise of the preamplifiers in case of a large dynamic resistance of the SQUID. To reduce the current noise of the preamplifier in the low-frequency range, we investigated the dependence of total preamplifier noise on the collector current and source resistance. When the collector current was decreased from 8.4 mA to 3 mA in the preamplifier made of 3 parallel SSM2220 transistor pairs, the low-frequency total voltage noise of the preamplifier (at 0.1 Hz) decreased by about 3 times for a source resistance of 30 Ω whereas the white noise level remained nearly unchanged. Since the relative contribution of preamplifier's input voltage and current noise is different depending on the dynamic resistance or flux-to-voltage transfer of the SQUID, the results showed that the total noise of a SQUID system at low-frequency range can be improved significantly by optimizing the preamplifier circuit parameters, mainly the collector current in case of low-noise bipolar transistor pairs.
Barger, Vernon; Han, Tao; Walker, Devin G E
2008-01-25
We study top-quark pair production to probe new physics at the CERN Large Hadron Collider. We propose reconstruction methods for tt[over] semileptonic events and use them to reconstruct the tt[over] invariant mass. The angular distribution of top quarks in their c.m. frame can determine the spin and production subprocess for each new physics resonance. Forward-backward asymmetry and CP-odd variables can be constructed to further delineate the nature of new physics. We parametrize the new resonances with a few generic parameters and show high invariant mass top pair production may provide an early indicator for new physics beyond the standard model.
Quality of corneal lamellar cuts quantified using atomic force microscopy
Ziebarth, Noël M.; Dias, Janice; Hürmeriç, Volkan; Shousha, Mohamed Abou; Yau, Chiyat Ben; Moy, Vincent T.; Culbertson, William; Yoo, Sonia H.
2012-01-01
PURPOSE To quantify the cut quality of lamellar dissections made with the femtosecond laser using atomic force microscopy (AFM). SETTING Bascom Palmer Eye Institute, University of Miami Miller School of Medicine, Miami, Florida, USA. DESIGN Experimental study. METHODS Experiments were performed on 3 pairs of human cadaver eyes. The cornea was thinned to physiologic levels by placing the globe, cornea side down, in 25% dextran for 24 hours. The eyes were reinflated to normal pressures by injecting a balanced salt solution into the vitreous cavity. The eyes were placed in a holder, the epithelium was removed, and the eyes were cut with a Visumax femtosecond laser. The energy level was 180 nJ for the right eye and 340 nJ for the left eye of each pair. The cut depths were 200 μm, 300 μm, and 400 μm, with the cut depth maintained for both eyes of each pair. A 12.0 mm trephination was then performed. The anterior portion of the lamellar surface was placed in a balanced salt solution and imaged with AFM. As a control, the posterior surface was placed in 2% formalin and imaged with environmental scanning electron microscopy (SEM). Four quantitative parameters (root-mean-square deviation, average deviation, skewness, kurtosis) were calculated from the AFM images. RESULTS From AFM, the 300 μm low-energy cuts were the smoothest. Similar results were seen qualitatively in the environmental SEM images. CONCLUSION Atomic force microscopy provided quantitative information on the quality of lamellar dissections made using a femtosecond laser, which is useful in optimizing patient outcomes in refractive and lamellar keratoplasty surgeries. PMID:23141078
2013-03-01
12 curve fit to the 2Σ1 2� − 2Σ1 2� difference potential Table 2.2a: Lennard - Jones parameters for Rubidium + Helium lines. Difference...Table Page Table 2.2a. Lennard - Jones parameters for Rubidium + Helium lines 22 Table 2.2b. Line broadening and shift parameters for Rb + He lines...all nine M + Ng pairs, using Lennard - Jones (6-12) potentials in Anderson- Talman 25 Table 2.2e. Broadening and shift coefficients (in MHz/torr
2007-05-08
deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the
NASA Astrophysics Data System (ADS)
Singh, Kundan; Siwal, Davinder
2018-04-01
A digital timing algorithm is explored for fast scintillator detectors, viz. LaBr3, BaF2, and BC501A. Signals were collected with CAEN 250 mega samples per second (MSPS) and 500 MSPS digitizers. The zero crossing time markers (TM) were obtained with a standard digital constant fraction timing (DCF) method. Accurate timing information is obtained using cubic spline interpolation of a DCF transient region sample points. To get the best time-of-flight (TOF) resolution, an optimization of DCF parameters is performed (delay and constant fraction) for each pair of detectors: (BaF2-LaBr3), (BaF2-BC501A), and (LaBr3-BC501A). In addition, the slope information of an interpolated DCF signal is extracted at TM position. This information gives a new insight to understand the broadening in TOF, obtained for a given detector pair. For a pair of signals having small relative slope and interpolation deviations at TM, leads to minimum time broadening. However, the tailing in TOF spectra is dictated by the interplay between the interpolation error and slope variations. Best TOF resolution achieved at the optimum DCF parameters, can be further improved by using slope parameter. Guided by the relative slope parameter, events selection can be imposed which leads to reduction in TOF broadening. While the method sets a trade-off between timing response and coincidence efficiency, it provides an improvement in TOF. With the proposed method, the improved TOF resolution (FWHM) for the aforementioned detector pairs are; 25% (0.69 ns), 40% (0.74 ns), 53% (0.6 ns) respectively, obtained with 250 MSPS, and corresponds to 12% (0.37 ns), 33% (0.72 ns), 35% (0.69 ns) respectively with 500 MSPS digitizers. For the same detector pair, event survival probabilities are; 57%, 58%, 51% respectively with 250 MSPS and becomes 63%, 57%, 68% using 500 MSPS digitizers.
Stereo Cameras for Clouds (STEREOCAM) Instrument Handbook
DOE Office of Scientific and Technical Information (OSTI.GOV)
Romps, David; Oktem, Rusen
2017-10-31
The three pairs of stereo camera setups aim to provide synchronized and stereo calibrated time series of images that can be used for 3D cloud mask reconstruction. Each camera pair is positioned at approximately 120 degrees from the other pair, with a 17o-19o pitch angle from the ground, and at 5-6 km distance from the U.S. Department of Energy (DOE) Central Facility at the Atmospheric Radiation Measurement (ARM) Climate Research Facility Southern Great Plains (SGP) observatory to cover the region from northeast, northwest, and southern views. Images from both cameras of the same stereo setup can be paired together tomore » obtain 3D reconstruction by triangulation. 3D reconstructions from the ring of three stereo pairs can be combined together to generate a 3D mask from surrounding views. This handbook delivers all stereo reconstruction parameters of the cameras necessary to make 3D reconstructions from the stereo camera images.« less
Identical superdeformed bands in yrast 152Dy: a systematic description
NASA Astrophysics Data System (ADS)
Dadwal, Anshul; Mittal, H. M.
2018-06-01
The nuclear softness (NS) formula, semiclassical particle rotor model (PRM) and modified exponential model with pairing attenuation are used for the systematic study of the identical superdeformed bands in the A ∼ 150 mass region. These formulae/models are employed to study the identical superdeformed bands relative to the yrast SD band 152Dy(1), {152Dy(1), 151Tb(2)}, {152Dy(1), 151Dy(4)} (midpoint), {152Dy(1), 153Dy(2)} (quarter point), {152Dy(1), 153Dy(3)} (three-quarter point). The parameters, baseline moment of inertia ({{I}}0), alignment (i) and effective pairing parameter (Δ0) are calculated using the least-squares fitting of the γ-ray transitions energies in the NS formula, semiclassical-PRM and modified exponential model with pairing attenuation, respectively. The calculated parameters are found to depend sensitively on the proposed baseline spin (I 0).
Lee, Kyung Tai; Kim, Eung Soo; Kim, Young Ho; Ryu, Je Seong; Rhyu, Im Joo; Lee, Young Koo
2016-04-01
The all-inside arthroscopic modified Broström operation has been developed for lateral ankle instability. We compared the biomechanical parameters of the all-inside arthroscopic procedure to the open modified Broström operation. Eleven matched pairs of human cadaver specimens [average age 71.5 (range 58-98) years] were subject to the arthroscopic modified Broström operation using a suture anchor and the open modified Broström operation. The ligaments were loaded cyclically 20 times and then tested to failure. Torque to failure, degrees to failure, and stiffness were measured. A matched-pair analysis was performed. There was no significant difference in torque to failure between the open and arthroscopic modified Broström operation (19.9 ± 8.9 vs. 23.3 ± 12.1 Nm, n.s). The degrees to failure did not differ significantly between the open and arthroscopic modified Broström operations (46.8 ± 9.9° vs. 46.7 ± 7.6°, n.s). The working construct stiffness (or stiffness to failure) was no significant difference in the two groups (0.438 ± 0.21 vs. 0.487 ± 0.268 Nm/deg for the open and arthroscopic modified Broström operations, respectively, n.s). The all-inside arthroscopic modified Broström operation and the open modified Broström operation resulted in no significantly different torque to failure, degrees to failure, and working construct stiffness with no significant differences (n.s, n.s, and n.s, respectively). Our results indicate that the arthroscopic modified Broström operation is a reasonable alternative procedure for chronic ankle instability.
Waitt, Catriona; Olagunju, Adeniyi; Nakalema, Shadia; Kyohaire, Isabella; Owen, Andrew; Lamorde, Mohammed; Khoo, Saye
2018-01-01
Abstract Background Breast milk transfer of first-line ART from mother to infant is not fully understood. Objectives To determine the concentrations of lamivudine, emtricitabine and tenofovir in maternal blood, breast milk and infant blood from breastfeeding mother–infant pairs. Methods Intensive pharmacokinetic sampling of maternal dried blood spots (DBS), dried breast milk spots (DBMS) and infant DBS from 30 Ugandan and 29 Nigerian mothers receiving first-line ART and their infants was conducted. DBS and DBMS were collected pre-dose and at 5–6 timepoints up to 12 h following observed dosing. Infant DBS were sampled twice during this period. Lamivudine, emtricitabine and tenofovir were quantified using LC-MS/MS, with non-compartmental analysis to calculate key pharmacokinetic parameters. Results Peak concentrations in breast milk from women taking lamivudine and emtricitabine occurred later than in plasma (4–8 h compared with 2 h for lamivudine and 2–4 h for emtricitabine). Consequently, the milk-to-plasma (M:P) ratio of lamivudine taken once daily was 0.95 (0.82–1.15) for AUC0–12, whereas for AUC12–20 this was 3.04 (2.87–4.16). Lamivudine was detectable in 36% (14/39) of infants [median 17.7 (16.3–22.7) ng/mL]. For 200 mg of emtricitabine once daily, the median M:P ratio was 3.01 (2.06–3.38). Three infants (19%) had measurable emtricitabine [median 18.5 (17.6–20.8) ng/mL]. For 300 mg of tenofovir once daily, the median M:P ratio was 0.015 (0–0.03) and no infant had measurable tenofovir concentrations. Conclusions Emtricitabine and lamivudine accumulate in breast milk and were detected in breastfeeding infants. In contrast, tenofovir penetrates the breast milk to a small degree, but is undetectable in breastfeeding infants. PMID:29309634
Waitt, Catriona; Olagunju, Adeniyi; Nakalema, Shadia; Kyohaire, Isabella; Owen, Andrew; Lamorde, Mohammed; Khoo, Saye
2018-04-01
Breast milk transfer of first-line ART from mother to infant is not fully understood. To determine the concentrations of lamivudine, emtricitabine and tenofovir in maternal blood, breast milk and infant blood from breastfeeding mother-infant pairs. Intensive pharmacokinetic sampling of maternal dried blood spots (DBS), dried breast milk spots (DBMS) and infant DBS from 30 Ugandan and 29 Nigerian mothers receiving first-line ART and their infants was conducted. DBS and DBMS were collected pre-dose and at 5-6 timepoints up to 12 h following observed dosing. Infant DBS were sampled twice during this period. Lamivudine, emtricitabine and tenofovir were quantified using LC-MS/MS, with non-compartmental analysis to calculate key pharmacokinetic parameters. Peak concentrations in breast milk from women taking lamivudine and emtricitabine occurred later than in plasma (4-8 h compared with 2 h for lamivudine and 2-4 h for emtricitabine). Consequently, the milk-to-plasma (M:P) ratio of lamivudine taken once daily was 0.95 (0.82-1.15) for AUC0-12, whereas for AUC12-20 this was 3.04 (2.87-4.16). Lamivudine was detectable in 36% (14/39) of infants [median 17.7 (16.3-22.7) ng/mL]. For 200 mg of emtricitabine once daily, the median M:P ratio was 3.01 (2.06-3.38). Three infants (19%) had measurable emtricitabine [median 18.5 (17.6-20.8) ng/mL]. For 300 mg of tenofovir once daily, the median M:P ratio was 0.015 (0-0.03) and no infant had measurable tenofovir concentrations. Emtricitabine and lamivudine accumulate in breast milk and were detected in breastfeeding infants. In contrast, tenofovir penetrates the breast milk to a small degree, but is undetectable in breastfeeding infants.
Constraining scalar resonances with top-quark pair production at the LHC
NASA Astrophysics Data System (ADS)
Franzosi, Diogo Buarque; Fabbri, Federica; Schumann, Steffen
2018-03-01
Constraints on models which predict resonant top-quark pair production at the LHC are provided via a reinterpretation of the Standard Model (SM) particle level measurement of the top-anti-top invariant mass distribution, m(t\\overline{t}) . We make use of state-of-the-art Monte Carlo event simulation to perform a direct comparison with measurements of m(t\\overline{t}) in the semi-leptonic channels, considering both the boosted and the resolved regime of the hadronic top decays. A simplified model to describe various scalar resonances decaying into top-quarks is considered, including CP-even and CP-odd, color-singlet and color-octet states, and the excluded regions in the respective parameter spaces are provided.
3-dimensional telepresence system for a robotic environment
Anderson, Matthew O.; McKay, Mark D.
2000-01-01
A telepresence system includes a camera pair remotely controlled by a control module affixed to an operator. The camera pair provides for three dimensional viewing and the control module, affixed to the operator, affords hands-free operation of the camera pair. In one embodiment, the control module is affixed to the head of the operator and an initial position is established. A triangulating device is provided to track the head movement of the operator relative to the initial position. A processor module receives input from the triangulating device to determine where the operator has moved relative to the initial position and moves the camera pair in response thereto. The movement of the camera pair is predetermined by a software map having a plurality of operation zones. Each zone therein corresponds to unique camera movement parameters such as speed of movement. Speed parameters include constant speed, or increasing or decreasing. Other parameters include pan, tilt, slide, raise or lowering of the cameras. Other user interface devices are provided to improve the three dimensional control capabilities of an operator in a local operating environment. Such other devices include a pair of visual display glasses, a microphone and a remote actuator. The pair of visual display glasses are provided to facilitate three dimensional viewing, hence depth perception. The microphone affords hands-free camera movement by utilizing voice commands. The actuator allows the operator to remotely control various robotic mechanisms in the remote operating environment.
The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate
Mooers, Blaine H.M.; Singh, Amritanshu
2011-01-01
Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548
Transfer-Matrix Method for Solving the Spin 1/2 Antiferromagnetic Heisenberg Chain
NASA Astrophysics Data System (ADS)
Garcia-Bach, M. A.; Klein, D. J.; Valenti, R.
Following the discovery of high Tc superconductivity in the copper oxides, there has been a great deal of interest in the RVB wave function proposed by Anderson [1]. As a warm-up exercise we have considered a valence-bond wave function for the one dimensional spin-1/2 Heisenberg chain. The main virtue of our work is to propose a new variational singlet wavefunction which is almost analytically tractable by a transfer-matrix technique. We have obtained the ground state energy for finite as well as infinite chains, in good agreement with exact results. Correlation functions, excited states, and the effects of other interactions (e.g., spin-Peierls) are also accessible within this scheme [2]. Since the ground state of the chain is known to be a singlet (Lieb & Mattis [3]), we write the appropriate wave function as a superposition of valence-bond singlets, |ψ > =∑ limits k C k | k>, where |k> is a spin configuration obtained by pairing all spins into singlet pairs, in a way which is common in valence-bond calculations of large molecules. As in that case, each configuration, |k>, can be represented by a Rümer diagram, with directed bonds connecting each pair of spins on the chain. The ck's are variational co-efficients, the form of which is determined as follows: Each singlet configuration (Rümer diagram) is divided into "zones", a "zone" corresponding to the region between two consecutive sites. Each zone is indexed by its distance from the end of the chain and by the number of bonds crossing it. Our procedure assigns a variational parameter, xij, to the jth zone, when crossed by i bonds. The resulting wavefunction for an N-site chain is written as |ψ > =∑ limits k ∏ M limits { i =1} ∏ { N -1}limits { j =1} X ij{ m ij (k)} | k> where mij(k) equals 1 when zone j is crossed by i bonds and zero otherwise. To make the calculation tractable we reduce the number of variational parameters by disallowing configurations with bonds connecting any two sites separated by more than 2M lattice points. (For simplicity, we have limited ourselves to M=3, but the scheme can be used for any M). With the simple ansatz, matrix elements can be calculated by a transfer-matrix method. To understand the transfer-matrix method note that since only local zone parameters appear in the description of each state |k>, matrix elements and overlaps, < k| bar S q bar S{ q +1} |k'> and
Joseph, Aswathy; Thomas, Vibin Ipe; Żyła, Gaweł; Padmanabhan, A S; Mathew, Suresh
2018-01-11
A comprehensive study on the structure, nature of interaction, and properties of six ionic pairs of 1-butylpyridinium and 1-butyl-4-methylpyridinium cations in combination with tetrafluoroborate (BF 4 - ), chloride (Cl - ), and bromide (Br - ) anions have been carried out using density functional theory (DFT). The anion-cation interaction energy (ΔE int ), thermochemistry values, theoretical band gap, molecular orbital energy order, DFT-based chemical activity descriptors [chemical potential (μ), chemical hardness (η), and electrophilicity index (ω)], and distribution of density of states (DOS) of these ion pairs were investigated. The ascendancy of the -CH 3 substituent at the fourth position of the 1-butylpyridinium cation ring on the values of ΔE int , theoretical band gap and chemical activity descriptors was evaluated. The ΔE int values were negative for all six ion pairs and were highest for Cl - containing ion pairs. The theoretical band gap value after -CH 3 substitution increased from 3.78 to 3.96 eV (for Cl - ) and from 2.74 to 2.88 eV (for Br - ) and decreased from 4.9 to 4.89 eV (for BF 4 - ). Ion pairs of BF 4 - were more susceptible to charge transfer processes as inferred from their significantly high η values and comparatively small difference in ω value after -CH 3 substitution. The change in η and μ values due to the -CH 3 substituent is negligibly small in all cases except for the ion pairs of Cl - . Critical-point (CP) analyses were carried out to investigate the AIM topological parameters at the interionic bond critical points (BCPs). The RDG isosurface analysis indicated that the anion-cation interaction was dominated by strong H cat ···X ani and C cat ···X ani interactions in ion pairs of Cl - and Br - whereas a weak van der Waal's effect dominated in ion pairs of BF 4 - . The molecular electrostatic potential (MESP)-based parameter ΔΔV min measuring the anion-cation interaction strength showed a good linear correlation with ΔE int for all 1-butylpyridinium ion pairs (R 2 = 0.9918). The ionic crystal density values calculated by using DFT-based MESP showed only slight variations from experimentally reported values.
Estimating the mass of the Local Group using machine learning applied to numerical simulations
NASA Astrophysics Data System (ADS)
McLeod, M.; Libeskind, N.; Lahav, O.; Hoffman, Y.
2017-12-01
We present a new approach to calculating the combined mass of the Milky Way (MW) and Andromeda (M31), which together account for the bulk of the mass of the Local Group (LG). We base our work on an ensemble of 30,190 halo pairs from the Small MultiDark simulation, assuming a ΛCDM (Cosmological Constant and Cold Dark Matter) cosmology. This is used in conjunction with machine learning methods (artificial neural networks, ANN) to investigate the relationship between the mass and selected parameters characterising the orbit and local environment of the binary. ANN are employed to take account of additional physics arising from interactions with larger structures or dynamical effects which are not analytically well understood. Results from the ANN are most successful when the velocity shear is provided, which demonstrates the flexibility of machine learning to model physical phenomena and readily incorporate new information. The resulting estimate for the Local Group mass, when shear information is included, is 4.9×1012Msolar, with an error of ±0.8×1012Msolar from the 68% uncertainty in observables, and a r.m.s. scatter interval of +1.7‑1.3×1012Msolar estimated scatter from the differences between the model estimates and simulation masses for a testing sample of halo pairs. We also consider a recently reported large relative transverse velocity of M31 and the Milky Way, and produce an alternative mass estimate of 3.6±0.3+2.1‑1.3×1012Msolar. Although the methods used predict similar values for the most likely mass of the LG, application of ANN compared to the traditional Timing Argument reduces the scatter in the log mass by approximately half when tested on samples from the simulation.
q -deformed statistics and the role of light fermionic dark matter in SN1987A cooling
NASA Astrophysics Data System (ADS)
Guha, Atanu; J, Selvaganapathy; Das, Prasanta Kumar
2017-01-01
The light dark matter (≃1 - 30 MeV ) particles pair produced in electron-positron annihilation e-e+→ γ χ χ ¯ inside the supernova core can take away the energy released in the supernova SN1987A explosion. Working within the formalism of q -deformed statistics [with the average value of the supernovae core temperature (fluctuating) being TS N=30 MeV ] and using the Raffelt's criterion on the emissivity for any new channel ɛ ˙ (e+e-→χ χ ¯ )≤1 019 erg g-1 s-1 , we find that as the deformation parameter q changes from 1.0 (undeformed scenario) to 1.1 (deformed scenario), the lower bound on the scale Λ of the dark matter effective theory varies from 3.3 ×1 06 TeV to 3.2 ×1 07 TeV for a dark matter fermion of mass mχ=30 MeV . Using the optical depth criteria on the free streaming of the dark matter fermion, we find the lower bound on Λ ˜1 08 TeV for mχ=30 MeV . In a scenario, where the dark matter fermions are pair produced in the outermost sector of the supernova core [with radius 0.9 Rc≤r ≤Rc , Rc(=10 km ) being the supernova core radius or the radius of protoneutron star], we find that the bound on Λ (˜3 ×1 07 TeV ) obtained from SN cooling criteria (Raffelt's criteria) is comparable with the bound obtained from free streaming (optical depth criterion) for light fermion dark matter of mass mχ=10 - 30 MeV .
Complex vibrations in arsenide skutterudites and oxyskutterudites
NASA Astrophysics Data System (ADS)
Bridges, F.; Car, B.; Sutton, L.; Hoffman-Stapleton, M.; Keiber, T.; Baumbach, R. E.; Maple, M. B.; Henkie, Z.; Wawryk, R.
2015-01-01
The local structure of two skutterudite families—Ce M4As12 (M =Fe , Ru, Os) and L n Cu3Ru4O12 (L n =La , Pr, and Nd)—have been studied using the extended x-ray absorption fine structure (EXAFS) technique with a focus on the lattice vibrations about the rare-earth "rattler atoms" and the extent to which these vibrations can be considered local modes, with the rattler vibrating inside a nearly rigid cage. X-ray absorption data at all the metal edges were collected over a temperature range of 4 to 300 K and analyzed using standard procedures. The pair distances from EXAFS results agree quite well with the average structure obtained from diffraction. The cage structure is formed by the M and As atoms in Ce M4As12 and by Cu, O, and Ru atoms in L n Cu3Ru4O12 . Although some of the bonds within the cage are quite stiff (correlated Debye temperatures, θcD, are ˜500 K for Ce M4As12 and above 800 K for L n Cu3Ru4O12 ), we show that the structure is not completely rigid. For the rattler atom the nearest-neighbor pairs have a relatively low Einstein temperature, θE:˜100 - 120 K for Ce-As and ˜130 K for L n -O . Surprisingly, the behaviors of the second-neighbor pairs are quite different: for Ce M4As12 the second-neighbor pairs (Ce -M ) have a weaker bond while for L n Cu3Ru4O12 the L n -Ru second-neighbor pair has a stiffer effective spring constant than the first-neighbor pair. In addition, we show that the As4 or CuO4 rings are relatively rigid units and that their vibrations are anisotropic within these cubic structures, with stiff restoring forces perpendicular to the rings and much weaker restoring forces in directions parallel to the rings. Consequently vibrations of the rings may also act as "rattlers" and help suppress thermal conductivity. In general neither the rigid-cage approximation nor the simple reduced-mass approximation are sufficient for describing rattler behavior.
Assessment of effect of Yb3+ ion pairs on a highly Yb-doped double-clad fibre laser
NASA Astrophysics Data System (ADS)
Vallés, J. A.; Martín, J. C.; Berdejo, V.; Cases, R.; Álvarez, J. M.; Rebolledo, M. Á.
2018-03-01
Using a previously validated characterization method based on the careful measurement of the characteristic parameters and fluorescence emission spectra of a highly Yb-doped double-clad fibre, we evaluate the contribution of ion pair induced processes to the output power of a double-clad Yb-doped fibre ring laser. This contribution is proved to be insignificant, contrary to analysis by other authors, who overestimate the role of ion pairs.
GenoMycDB: a database for comparative analysis of mycobacterial genes and genomes.
Catanho, Marcos; Mascarenhas, Daniel; Degrave, Wim; Miranda, Antonio Basílio de
2006-03-31
Several databases and computational tools have been created with the aim of organizing, integrating and analyzing the wealth of information generated by large-scale sequencing projects of mycobacterial genomes and those of other organisms. However, with very few exceptions, these databases and tools do not allow for massive and/or dynamic comparison of these data. GenoMycDB (http://www.dbbm.fiocruz.br/GenoMycDB) is a relational database built for large-scale comparative analyses of completely sequenced mycobacterial genomes, based on their predicted protein content. Its central structure is composed of the results obtained after pair-wise sequence alignments among all the predicted proteins coded by the genomes of six mycobacteria: Mycobacterium tuberculosis (strains H37Rv and CDC1551), M. bovis AF2122/97, M. avium subsp. paratuberculosis K10, M. leprae TN, and M. smegmatis MC2 155. The database stores the computed similarity parameters of every aligned pair, providing for each protein sequence the predicted subcellular localization, the assigned cluster of orthologous groups, the features of the corresponding gene, and links to several important databases. Tables containing pairs or groups of potential homologs between selected species/strains can be produced dynamically by user-defined criteria, based on one or multiple sequence similarity parameters. In addition, searches can be restricted according to the predicted subcellular localization of the protein, the DNA strand of the corresponding gene and/or the description of the protein. Massive data search and/or retrieval are available, and different ways of exporting the result are offered. GenoMycDB provides an on-line resource for the functional classification of mycobacterial proteins as well as for the analysis of genome structure, organization, and evolution.
Redeker, F A; Beckers, H; Riedel, S
2017-11-30
Here we discuss the reaction products of laser ablated alkali chlorides and elemental chlorine. Salt ablation using this technique combined with matrix-isolation spectroscopy allows for the formation and characterization of novel anionic species. The laser ablation of solid MCl with M = Cs, Rb, and K in the presence of Cl 2 produced free [Cl 3 ] - ions which were isolated in solid noble-gas matrices. For M = Cs, Rb, K, and Na, the ion pairs M + [Cl 3 ] - are the main reaction products. Trends in the formation and bonding of these trichloride anions will be discussed. In contrast to the trifluoride analogues, the isolated ion pairs M + [Cl 3 ] - feature a systematic distortion due to metal coordination.
NASA Astrophysics Data System (ADS)
Elliott, E. Judith; Braun, Alexander
2017-11-01
Unconventional heavy oil resource plays are important contributors to oil and gas production, as well as controversial for posing environmental hazards. Monitoring those reservoirs before, during, and after operations would assist both the optimization of economic benefits and the mitigation of potential environmental hazards. This study investigates how gravity gradiometry using superconducting gravimeters could resolve depletion areas in steam assisted gravity drainage (SAGD) reservoirs. This is achieved through modelling of a SAGD reservoir at 1.25 and 5 years of operation. Specifically, the density change structure identified from geological, petrological, and seismic observations is forward modelled for gravity and gradients. Three main parameters have an impact on the resolvability of bitumen depletion volumes and are varied through a suitable parameter space: well pair separation, depth to the well pairs, and survey grid sampling. The results include a resolvability matrix, which identifies reservoirs that could benefit from time-lapse gravity gradiometry monitoring. After 1.25 years of operation, during the rising phase, the resolvable maximum reservoir depth ranges between the surface and 230 m, considering a well pair separation between 80 and 200 m. After 5 years of production, during the spreading phase, the resolvability of depletion volumes around single well pairs is greatly compromised as the depletion volume is closer to the surface, which translates to a larger portion of the gravity signal. The modelled resolvability matrices were derived from visual inspection and spectral analysis of the gravity gradient signatures and can be used to assess the applicability of time-lapse gradiometry to monitor reservoir density changes.
Wu, Jingming; Lee, Hian Kee
2006-10-15
Injection port derivatization following ion-pair hollow fiber-protected liquid-phase microextraction (LPME) for the trace determination of acidic herbicides (2,4-dichlorobenzoic acid, 2,4-dichlorophenoxyacetic acid, 2-(2,4-dichlorophenoxy)propionic acid, 3,5-dichlorobenzoic acid, 2-(2,4,5-trichlorophenoxy)propionic acid) in aqueous samples by gas chromatography/mass spectrometry (GC/MS) was developed. Prior to GC injection port derivatization, acidic herbicides were converted into their ion-pair complexes with tetrabutylammonium chloride in aqueous samples and then extracted by 1-octanol impregnated in the hollow fiber. Upon injection, ion pairs of acidic herbicides were quantitatively derivatized to their butyl esters in the GC injection port. Thus, several parameters related to the derivatization process (i.e., injection temperature, purge-off time) were evaluated, and main parameters affecting the hollow fiber-protected LPME procedure such as extraction organic solvent, ion-pair reagent type, pH of aqueous medium, concentration of ion-pair reagent, sodium chloride concentration added to the aqueous medium, stirring speed, and extraction time profile, optimized. At the selected extraction and derivatization conditions, no matrix effects were observed. This method proved good repeatability (RSDs <12.3%, n = 6) and good linearity (r2 > or = 0.9939) for spiked deionized water samples for five analytes. The limits of detection were in the range of 0.51-13.7 ng x L(-1) (S/N =3) under GC/MS selected ion monitoring mode. The results demonstrated that injection port derivatization following ion-pair hollow fiber-protected LPME was a simple, rapid, and accurate method for the determination of trace acidic herbicides from aqueous samples. In addition, this method proved to be environmentally friendly since it completely avoided open derivatization with potentially hazardous reagents.
Sun, Wei; Gong, Shixing; Shi, Fan; Cao, Lili; Ling, Luyang; Zheng, Weizhe; Wang, Wencheng
2014-07-01
In this paper a novel sensing platform based on graphene oxide (GO), ionic liquid (IL) 1-ethyl-3-methylimidazolium tetrafluoroborate and Nafion for the immobilization of hemoglobin (Hb) was adopted with a carbon ionic liquid electrode (CILE) as the substrate electrode, which was denoted as Nafion/Hb-GO-IL/CILE. Spectroscopic results suggested that Hb molecules were not denatured in the composite. A pair of well-defined redox peaks appeared on the cyclic voltammogram, which was attributed to the realization of direct electron transfer of Hb on the electrode. Electrochemical behaviors of Hb entrapped in the film were carefully investigated by cyclic voltammetry with the electrochemical parameters calculated. Based on the catalytic ability of the immobilized Hb, Nafion/Hb-GO-IL/CILE exhibited excellent electrocatalytic behavior towards the reduction of different substrates such as trichloroacetic acid in the concentration range from 0.01 to 40.0mM with the detection limit as 3.12 μM (3σ), H2O2 in the concentration range from 0.08 to 635.0 μM with the detection limit as 0.0137 μM (3σ) and NaNO2 in the concentration range from 0.5 to 800.0 μM with the detection limit as 0.0104 μM (3σ). So the proposed bioelectrode could be served as a new third-generation electrochemical sensor without mediator. Copyright © 2014 Elsevier B.V. All rights reserved.
Zhang, Degang
2009-10-30
The energy band structure of FeAs-based superconductors is fitted by a tight-binding model with two Fe ions per unit cell and two degenerate orbitals per Fe ion. Based on this, superconductivity with extended s-wave pairing symmetry of the form cosk(x)+cosk(y) is examined. The local density of states near an impurity is also investigated by using the T-matrix approach. For the nonmagnetic scattering potential, we found that there exist two major resonances inside the gap. The height of the resonance peaks depends on the strength of the impurity potential. These in-gap resonances are originated in the Andreev's bound states due to the quasiparticle scattering between the hole Fermi surfaces around Gamma point with positive order parameter and the electron Fermi surfaces around M point with negative order parameter.
Supernova 2007bi as a pair-instability explosion.
Gal-Yam, A; Mazzali, P; Ofek, E O; Nugent, P E; Kulkarni, S R; Kasliwal, M M; Quimby, R M; Filippenko, A V; Cenko, S B; Chornock, R; Waldman, R; Kasen, D; Sullivan, M; Beshore, E C; Drake, A J; Thomas, R C; Bloom, J S; Poznanski, D; Miller, A A; Foley, R J; Silverman, J M; Arcavi, I; Ellis, R S; Deng, J
2009-12-03
Stars with initial masses such that 10M[symbol: see text]
Monoclinic structures of niobium trisulfide
NASA Astrophysics Data System (ADS)
Bloodgood, Matthew A.; Wei, Pingrong; Aytan, Ece; Bozhilov, Krassimir N.; Balandin, Alexander A.; Salguero, Tina T.
2018-02-01
Two new polymorphs of niobium trisulfide are established by single crystal x-ray diffraction. NbS3-iv crystallizes in the monoclinic space group P21/c with lattice parameters a = 6.7515(5) Å, b = 4.9736(4) Å, c = 18.1315(13) Å, and β = 90.116(2)°. Its structure is based on chains of [NbS6] trigonal prisms containing Nb-Nb pairs with a bond length of 3.0448(8) Å; this pairing causes the chains to corrugate slightly along their axis, a feature also present in triclinic NbS3-i that leads to semiconductor properties. The stacking arrangement of chains is different in these polymorphs, however, with NbS3-i having an ABCDE repeating sequence of chain bilayers and NbS3-iv having an AB repeating sequence. HRTEM studies show the presence of topotactically-oriented intergrown zones and numerous dislocations, which result in mosaic structuring. A second new polymorph, NbS3-v, crystallizes in the monoclinic space group P21/m with lattice parameters a = 4.950(5) Å, b = 3.358(4) Å, c = 9.079(10) Å, β = 97.35(2)°. In contrast to NbS3-iv, NbS3-v maintains fixed a Nb-Nb bond distance of 3.358(4) Å along the chains, and it has an ABCDE repeating sequence of chain bilayers similar to NbS3-i. High resolution scanning transmission electron microscopy (HR-STEM) imaging of an exfoliated NbS3-v nanoribbon shows the continuous [NbS6] chains oriented along the b-axis. These results provide the first firmly established structural data for monoclinic NbS3. In addition, SEM images show the formation of NbS3 rings and cylinders, and a combination of powder x-ray diffraction and Raman spectroscopy provides a way to distinguish between NbS3 polymorphs.
High spectral purity silicon ring resonator photon-pair source
NASA Astrophysics Data System (ADS)
Steidle, Jeffrey A.; Fanto, Michael L.; Tison, Christopher C.; Wang, Zihao; Preble, Stefan F.; Alsing, Paul M.
2015-05-01
Here we present the experimental demonstration of a Silicon ring resonator photon-pair source. The crystalline Silicon ring resonator (radius of 18.5μm) was designed to realize low dispersion across multiple resonances, which allows for operation with a high quality factor of Q~50k. In turn, the source exhibits very high brightness of >3x105 photons/s/mW2/GHz since the produced photon pairs have a very narrow bandwidth. Furthermore, the waveguidefiber coupling loss was minimized to <1.5dB using an inverse tapered waveguide (tip width of ~150nm over a 300μm length) that is butt-coupled to a high-NA fiber (Nufern UHNA-7). This ensured minimal loss of photon pairs to the detectors, which enabled very high purity photon pairs with minimal noise, as exhibited by a very high Coincidental-Accidental Ratio of >1900. The low coupling loss (3dB fiber-fiber) also allowed for operation with very low off-chip pump power of <200μW. In addition, the zero dispersion of the ring resonator resulted in the production of a photon-pair comb across multiple resonances symmetric about the pump resonance (every ~5nm spanning >20nm), which could be used in future wavelength division multiplexed quantum networks.
Horwitz, Noah E; Phelan, Brian T; Nelson, Jordan N; Mauck, Catherine M; Krzyaniak, Matthew D; Wasielewski, Michael R
2017-06-15
Photoexcitation of electron donor-acceptor molecules frequently produces radical ion pairs with well-defined initial spin-polarized states that have attracted significant interest for spintronics. Transfer of this initial spin polarization to a stable radical is predicted to depend on the rates of the radical ion pair recombination reactions, but this prediction has not been tested experimentally. In this study, a stable radical/electron donor/chromophore/electron acceptor molecule, BDPA • -mPD-ANI-NDI, where BDPA • is α,γ-bisdiphenylene-β-phenylallyl, mPD is m-phenylenediamine, ANI is 4-aminonaphthalene-1,8-dicarboximide, and NDI is naphthalene-1,4:5,8-bis(dicarboximide), was synthesized. Photoexcitation of ANI produces the triradical BDPA • -mPD +• -ANI-NDI -• in which the mPD +• -ANI-NDI -• radical ion pair is spin coupled to the BDPA • stable radical. BDPA • -mPD +• -ANI-NDI -• and its counterpart lacking the stable radical are found to exhibit spin-selective charge recombination in which the triplet radical ion pair 3 (mPD +• -ANI-NDI -• ) is in equilibrium with the 3 *NDI charge recombination product. Time-resolved EPR measurements show that this process is associated with an inversion of the sign of the polarization transferred to BDPA • over time. The polarization transfer rates are found to be strongly solvent dependent, as shifts in this equilibrium affect the spin dynamics. These results demonstrate that even small changes in electron transfer dynamics can have a large effect on the spin dynamics of photogenerated multispin systems.
NASA Astrophysics Data System (ADS)
Monajjemi, M.; Razavian, M. H.; Mollaamin, F.; Naderi, F.; Honarparvar, B.
2008-12-01
Quantum-chemical solvent effect theories describe the electronic structure of a molecular subsystem embedded in a solvent or other molecular environment. The solvation of biomolecules is important in molecular biology, since numerous processes involve proteins interacting in changing solvent-solute systems. In this theoretical study, we focus on mRNA-tRNA base pairs as a fundamental step in protein synthesis influenced by hydrogen bonding between two antiparallel trinucleotides, namely, the mRNA codon and tRNA anticodon. We use the mean reaction field theories, which describe electrostatic and polarization interactions between solute and solvent in the AAA, UUU, AAG, and UUC triplex sequences optimized in various solvent media such as water, dimethylsulfoxide, methanol, ethanol, and cyclopean using the self-consistent reaction field model. This process depends on either the reaction potential function of the solvent or charge transfer operators that appear in solute-solvent interaction. Because of codon and anticodon biological criteria, we performed nonempirical quantum-mechanical calculations at the BLYP and B3LYP/3-21G, 6-31G, and 6-31G* levels of theory in the gas phase and five solvents at three temperatures. Finally, to obtain more information, we calculated thermochemical parameters to find that the dielectric constant of solvents plays an important role in the displacement of amino acid sequences on codon-anticodon residues in proteins, which can cause some mutations in humans.
Structure of thermal pair clouds around gamma-ray-emitting black holes
NASA Technical Reports Server (NTRS)
Liang, Edison P.
1991-01-01
Using certain simplifying assumptions, the general structure of a quasi-spherical thermal pair-balanced cloud surrounding an accreting black hole is derived from first principles. Pair-dominated hot solutions exist only for a restricted range of the viscosity parameter. These results are applied as examples to the 1979 HEAO 3 gamma-ray data of Cygnus X-1 and the Galactic center. Values are obtained for the viscosity parameter lying in the range of about 0.1-0.01. Since the lack of synchrotron soft photons requires the magnetic field to be typically less than 1 percent of the equipartition value, a magnetic field cannot be the main contributor to the viscous stress of the inner accretion flow, at least during the high gamma-ray states.
One-dimensional magnetophotonic crystals with magnetooptical double layers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berzhansky, V. N., E-mail: v.n.berzhansky@gmail.com; Shaposhnikov, A. N.; Prokopov, A. R.
2016-11-15
One-dimensional magnetophotonic microcavity crystals with nongarnet dielectric mirrors are created and investigated. The defect layers in the magnetophotonic crystals are represented by two bismuth-substituted yttrium iron garnet Bi:YIG layers with various bismuth contents in order to achieve a high magnetooptical response of the crystals. The parameters of the magnetophotonic crystal layers are optimized by numerical solution of the Maxwell equations by the transfer matrix method to achieve high values of Faraday rotation angle Θ{sub F} and magnetooptical Q factor. The calculated and experimental data agree well with each other. The maximum values of Θ{sub F} =–20.6°, Q = 8.1° atmore » a gain t = 16 are obtained for magnetophotonic crystals with m = 7 pairs of layers in Bragg mirrors, and the parameters obtained for crystals with m = 4 and t = 8.5 are Θ{sub F} =–12.5° and Q = 14.3°. It is shown that, together with all-garnet and multimicrocavities magnetophotonic crystals, such structures have high magnetooptical characteristics.« less
Probing the tides in interacting galaxy pairs
NASA Technical Reports Server (NTRS)
Borne, Kirk D.
1990-01-01
Detailed spectroscopic and imaging observations of colliding elliptical galaxies revealed unmistakable diagnostic signatures of the tidal interactions. It is possible to compare both the distorted luminosity distributions and the disturbed internal rotation profiles with numerical simulations in order to model the strength of the tidal gravitational field acting within a given pair of galaxies. Using the best-fit numerical model, one can then measure directly the mass of a specific interacting binary system. This technique applies to individual pairs and therefore complements the classical methods of measuring the masses of galaxy pairs in well-defined statistical samples. The 'personalized' modeling of galaxy pairs also permits the derivation of each binary's orbit, spatial orientation, and interaction timescale. Similarly, one can probe the tides in less-detailed observations of disturbed galaxies in order to estimate some of the physical parameters for larger samples of interacting galaxy pairs. These parameters are useful inputs to the more universal problems of (1) the galaxy merger rate, (2) the strength and duration of the driving forces behind tidally stimulated phenomena (e.g., starbursts and maybe quasi steller objects), and (3) the identification of long-lived signatures of interaction/merger events.
Interdigital pair bonding for high frequency (20-50 MHz) ultrasonic composite transducers.
Liu, R; Harasiewicz, K A; Foster, F S
2001-01-01
Interdigital pair bonding is a novel methodology that enables the fabrication of high frequency piezoelectric composites with high volume fractions of the ceramic phase. This enhancement in ceramic volume fraction significantly reduces the dimensional scale of the epoxy phase and increases the related effective physical parameters of the composite, such as dielectric constant and the longitudinal sound velocity, which are major concerns in the development of high frequency piezoelectric composites. In this paper, a method called interdigital pair bonding (IPB) is used to prepare 1-3 piezoelectric composite with a pitch of 40 microns, a kerf of 4 microns, and a ceramic volume fraction of 81%. The composites prepared in this fashion exhibited a very pure thickness-mode resonance up to a frequency of 50 MHz. Unlike the 2-2 piezoelectric composites with the same ceramic and epoxy scales developed earlier, the anticipated lateral modes between 50 to 100 MHz were not observed in the current 1-3 composites. The mechanisms for the elimination of the lateral modes at high frequency are discussed. The effective electromechanical coupling coefficient of the composite was 0.72 at a frequency of 50 MHz. The composites showed a high longitudinal sound velocity of 4300 m/s and a high clamped dielectric constant of 1111 epsilon 0, which will benefit the development of high frequency ultrasonic transducers and especially high frequency transducer arrays for medical imaging.
Gaz Phase IR and UV Spectroscopy of Neutral Contact Ion Pairs
NASA Astrophysics Data System (ADS)
Habka, Sana; Brenner, Valerie; Mons, Michel; Gloaguen, Eric
2016-06-01
Cations and anions, in solution, tend to pair up forming ion pairs. They play a crucial role in many fundamental processes in ion-concentrated solutions and living organisms. Despite their importance and vast applications in physics, chemistry and biochemistry, they remain difficult to characterize namely because of the coexistence of several types of pairing in solution. However, an interesting alternative consists in applying highly selective gas phase spectroscopy which can offer new insights on these neutral ion pairs. Our study consists in characterizing contact ion pairs (CIPs) in isolated model systems (M+, Ph-(CH2)n-COO- with M=Li, Na, K, Rb, Cs, and n=1-3), to determine their spectral signatures and compare them to ion pairs in solution. We have used laser desorption to vaporize a solid tablet containing the desired salt. Structural information for each system was obtained by mass-selective, UV and IR laser spectroscopy combined with high level quantum chemistry calculations1. Evidence of the presence of neutral CIPs was found by scanning the π-π* transition of the phenyl ring using resonant two-photon ionization (R2PI). Then, conformational selective IR/UV double resonance spectra were recorded in the CO2- stretch region for each conformation detected. The good agreement between theoretical data obtained at the BSSE-corrected-fullCCSD(T)/dhf-TZVPP//B97-D3/dhf-TZVPP level and experimental IR spectra led us to assign the 3D structure for each ion pair formed. Spectral signatures of (M+, Ph-CH2-COO-) pairs, were assigned to a bidentate CIPs between the alkali cation and the carboxylate group. In the case of (Li+, Ph-(CH2)3-COO-) pairs, the presence of a flexible side chain promotes a cation-π interaction leading to a tridentate O-O-π structure with its unique IR and UV signatures. IR spectra obtained on isolated CIPs were found very much alike the ones published on lithium and sodium acetate in solution2. However, in the case of sodium acetate, solution spectra were assigned to solvent shared pairs. Yet, the striking resemblance with our spectral data raises questions about the type assigned, pointing out that CIPs could be more present in these electrolyte solutions than previously thought. The novelty of the gas phase approach to investigate neutral ion pairs, opens the door for various new spectroscopic studies, paving the way to greater knowledge regarding the properties of ion pairs in many scientific fields. 1. Gloaguen, E.; Mons, M.; Topics in Current Chemistry, 2015, Vol 364, 225-270 2. Rudolph, W.W.; Fischer, D.; Irmer, G.; Dalton Transactions 2014, 43, (8), 3174-3185
Majorana Kramers pair in a nematic vortex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Fengcheng; Martin, Ivar
A time-reversal (TR) invariant topological superconductor is characterized by a Kramers pair of Majorana zero-energy modes on boundaries and in a core of a TR invariant vortex. A vortex defect that preserves TR symmetry has remained primarily of theoretical interest, since typically a magnetic field, which explicitly breaks TR, needs to be applied to create vortices in superconductors. In this paper, we show that an odd-parity topological superconductor with a nematic pairing order parameter can host a nematic vortex that preserves TR symmetry and binds a Majorana Kramers pair. Such a nematic superconductor could be realized in metal-doped Bi 2Semore » 3, as suggested by recent experiments. We provide an analytic solution for the zero modes in a continuous nematic vortex. In lattice, crystalline anisotropy can pin the two-component order parameter along high-symmetry directions. We show that a discrete nematic vortex, which forms when three nematic domains meet, also supports a TR pair of Majorana modes. Lastly, we discuss possible experiments to probe the zero modes.« less
Majorana Kramers pair in a nematic vortex
Wu, Fengcheng; Martin, Ivar
2017-06-05
A time-reversal (TR) invariant topological superconductor is characterized by a Kramers pair of Majorana zero-energy modes on boundaries and in a core of a TR invariant vortex. A vortex defect that preserves TR symmetry has remained primarily of theoretical interest, since typically a magnetic field, which explicitly breaks TR, needs to be applied to create vortices in superconductors. In this paper, we show that an odd-parity topological superconductor with a nematic pairing order parameter can host a nematic vortex that preserves TR symmetry and binds a Majorana Kramers pair. Such a nematic superconductor could be realized in metal-doped Bi 2Semore » 3, as suggested by recent experiments. We provide an analytic solution for the zero modes in a continuous nematic vortex. In lattice, crystalline anisotropy can pin the two-component order parameter along high-symmetry directions. We show that a discrete nematic vortex, which forms when three nematic domains meet, also supports a TR pair of Majorana modes. Lastly, we discuss possible experiments to probe the zero modes.« less
On the Feasibility of a Pulsed 14 TeV C.M.E. Muon Collider in the LHC Tunnel
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shiltsev, Vladimir; Neuffer, D.
We discuss the technical feasibility, key machine pa-rameters and major challenges of a 14 TeV c.m.e. muon-muon collider in the LHC tunnel [1]. The luminosity of the collider is evaluated for three alternative muon sources – the PS synchrotron, one of a type developed by the US Muon Accelerator Program (MAP) and a low-emittance option based on resonant μ-pair production.
6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.
Berressem, R; Engels, J W
1995-01-01
2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied. PMID:7567457
6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.
Berressem, R; Engels, J W
1995-09-11
2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied.
System and method for calibrating a rotary absolute position sensor
NASA Technical Reports Server (NTRS)
Davis, Donald R. (Inventor); Permenter, Frank Noble (Inventor); Radford, Nicolaus A (Inventor)
2012-01-01
A system includes a rotary device, a rotary absolute position (RAP) sensor generating encoded pairs of voltage signals describing positional data of the rotary device, a host machine, and an algorithm. The algorithm calculates calibration parameters usable to determine an absolute position of the rotary device using the encoded pairs, and is adapted for linearly-mapping an ellipse defined by the encoded pairs to thereby calculate the calibration parameters. A method of calibrating the RAP sensor includes measuring the rotary position as encoded pairs of voltage signals, linearly-mapping an ellipse defined by the encoded pairs to thereby calculate the calibration parameters, and calculating an absolute position of the rotary device using the calibration parameters. The calibration parameters include a positive definite matrix (A) and a center point (q) of the ellipse. The voltage signals may include an encoded sine and cosine of a rotary angle of the rotary device.
Yan, Yiming; Su, Nan; Zhao, Chunhui; Wang, Liguo
2017-09-19
In this paper, a novel framework of the 3D reconstruction of buildings is proposed, focusing on remote sensing super-generalized stereo-pairs (SGSPs). As we all know, 3D reconstruction cannot be well performed using nonstandard stereo pairs, since reliable stereo matching could not be achieved when the image-pairs are collected at a great difference of views, and we always failed to obtain dense 3D points for regions of buildings, and cannot do further 3D shape reconstruction. We defined SGSPs as two or more optical images collected in less constrained views but covering the same buildings. It is even more difficult to reconstruct the 3D shape of a building by SGSPs using traditional frameworks. As a result, a dynamic multi-projection-contour approximating (DMPCA) framework was introduced for SGSP-based 3D reconstruction. The key idea is that we do an optimization to find a group of parameters of a simulated 3D model and use a binary feature-image that minimizes the total differences between projection-contours of the building in the SGSPs and that in the simulated 3D model. Then, the simulated 3D model, defined by the group of parameters, could approximate the actual 3D shape of the building. Certain parameterized 3D basic-unit-models of typical buildings were designed, and a simulated projection system was established to obtain a simulated projection-contour in different views. Moreover, the artificial bee colony algorithm was employed to solve the optimization. With SGSPs collected by the satellite and our unmanned aerial vehicle, the DMPCA framework was verified by a group of experiments, which demonstrated the reliability and advantages of this work.
Exotic superfluidity and pairing phenomena in atomic Fermi gases in mixed dimensions.
Zhang, Leifeng; Che, Yanming; Wang, Jibiao; Chen, Qijin
2017-10-11
Atomic Fermi gases have been an ideal platform for simulating conventional and engineering exotic physical systems owing to their multiple tunable control parameters. Here we investigate the effects of mixed dimensionality on the superfluid and pairing phenomena of a two-component ultracold atomic Fermi gas with a short-range pairing interaction, while one component is confined on a one-dimensional (1D) optical lattice whereas the other is in a homogeneous 3D continuum. We study the phase diagram and the pseudogap phenomena throughout the entire BCS-BEC crossover, using a pairing fluctuation theory. We find that the effective dimensionality of the non-interacting lattice component can evolve from quasi-3D to quasi-1D, leading to strong Fermi surface mismatch. Upon pairing, the system becomes effectively quasi-two dimensional in the BEC regime. The behavior of T c bears similarity to that of a regular 3D population imbalanced Fermi gas, but with a more drastic departure from the regular 3D balanced case, featuring both intermediate temperature superfluidity and possible pair density wave ground state. Unlike a simple 1D optical lattice case, T c in the mixed dimensions has a constant BEC asymptote.
The binary white dwarf LHS 3236
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harris, Hugh C.; Dahn, Conard C.; Canzian, Blaise
2013-12-10
The white dwarf LHS 3236 (WD1639+153) is shown to be a double-degenerate binary, with each component having a high mass. Astrometry at the U.S. Naval Observatory gives a parallax and distance of 30.86 ± 0.25 pc and a tangential velocity of 98 km s{sup –1}, and reveals binary orbital motion. The orbital parameters are determined from astrometry of the photocenter over more than three orbits of the 4.0 yr period. High-resolution imaging at the Keck Observatory resolves the pair with a separation of 31 and 124 mas at two epochs. Optical and near-IR photometry give a set of possible binarymore » components. Consistency of all data indicates that the binary is a pair of DA stars with temperatures near 8000 and 7400 K and with masses of 0.93 and 0.91 M {sub ☉}; also possible is a DA primary and a helium DC secondary with temperatures near 8800 and 6000 K and with masses of 0.98 and 0.69 M {sub ☉}. In either case, the cooling ages of the stars are ∼3 Gyr and the total ages are <4 Gyr. The combined mass of the binary (1.66-1.84 M {sub ☉}) is well above the Chandrasekhar limit; however, the timescale for coalescence is long.« less
NASA Astrophysics Data System (ADS)
Liu, Honggang; Zheng, Wenchen
2018-01-01
Electron paramagnetic resonance (EPR) is an important tool to study the complex interactions (e.g., exchange and magnetic dipole-dipole interactions) for a pair of lanthanide (Ln) ions in crystals. How to analyze these EPR spectra and obtain the strength of each interaction is a challenge for experimentalists. In this work, a general way of calculating the EPR lines for two magnetically equivalent Ln ions is given by us to solve this problem. In order to explain their EPR spectra and obtain exchange interaction parameters Ji (i = x, y, z) between them, we deduce the analytic formulas for computing the angular dependent EPR lines for such Ln pairs under the condition of weak coupling (|Ji| ≪ hv, where v is the microwave frequency in the EPR experiment) and set up the spin-Hamiltonian energy matrix that should be diagonalized to obtain these lines if intermediate (|Ji| ˜ hv) and strong (|Ji| > hv) couplings are encountered. To verify our method, the experimental EPR spectra for the Yb3+ doped BaY2F8 crystal are considered by us and the EPR lines from the isolated Yb3+ ion and Yb3+-Yb3+ pair with distance R equal to 0.371 nm are identified clearly. Moreover, exchange interaction parameters (Jx ≈ -0.04 cm-1, Jy ≈ -0.24 cm-1, and Jz ≈ -0.1 cm-1) for such a pair are also determined by our calculations. This case study demonstrates that the theoretical method given in this work would be useful and could be applied to understand interactions between Ln ions in crystals.
New color-octet axial vector boson revisited
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang Hao; Wang Youkai; Institute of Theoretical Physics, Chinese Academy of Sciences, Beijing 100190
2011-11-01
In this paper we reexamine how to utilize the previous proposed color-octet axial-vector boson Z{sub C} to explain the 3.4{sigma} anomaly of tt forward-backward (FB) asymmetry A{sub FB} for m{sub tt}>450 GeV observed by CDF. Our numerical results indicate that the best-fit parameters are g{sub A}{sup q}=0.07, g{sub A}{sup Q}=3, and M{sub C}=440 GeV, which are obtained by fitting the mass dependent A{sub FB} and total cross section data provided by a recent CDF measurement. Here g{sub A}{sup q}(g{sub A}{sup Q}) and M{sub C} are the axial couplings among Z{sub C} with the first two (the third) generation quarks, andmore » Z{sub C} mass, respectively. We also calculate one-side forward-backward asymmetry A{sub OFB} for top and bottom quark pair production at the LHC, focusing on the new contributions from Z{sub C}. Our studies show that A{sub OFB} can be utilized to measure the properties of new particle Z{sub C}.« less
Redshift-space distortions with the halo occupation distribution - II. Analytic model
NASA Astrophysics Data System (ADS)
Tinker, Jeremy L.
2007-01-01
We present an analytic model for the galaxy two-point correlation function in redshift space. The cosmological parameters of the model are the matter density Ωm, power spectrum normalization σ8, and velocity bias of galaxies αv, circumventing the linear theory distortion parameter β and eliminating nuisance parameters for non-linearities. The model is constructed within the framework of the halo occupation distribution (HOD), which quantifies galaxy bias on linear and non-linear scales. We model one-halo pairwise velocities by assuming that satellite galaxy velocities follow a Gaussian distribution with dispersion proportional to the virial dispersion of the host halo. Two-halo velocity statistics are a combination of virial motions and host halo motions. The velocity distribution function (DF) of halo pairs is a complex function with skewness and kurtosis that vary substantially with scale. Using a series of collisionless N-body simulations, we demonstrate that the shape of the velocity DF is determined primarily by the distribution of local densities around a halo pair, and at fixed density the velocity DF is close to Gaussian and nearly independent of halo mass. We calibrate a model for the conditional probability function of densities around halo pairs on these simulations. With this model, the full shape of the halo velocity DF can be accurately calculated as a function of halo mass, radial separation, angle and cosmology. The HOD approach to redshift-space distortions utilizes clustering data from linear to non-linear scales to break the standard degeneracies inherent in previous models of redshift-space clustering. The parameters of the occupation function are well constrained by real-space clustering alone, separating constraints on bias and cosmology. We demonstrate the ability of the model to separately constrain Ωm,σ8 and αv in models that are constructed to have the same value of β at large scales as well as the same finger-of-god distortions at small scales.
Bajar, Bryce T; Wang, Emily S; Lam, Amy J; Kim, Bongjae B; Jacobs, Conor L; Howe, Elizabeth S; Davidson, Michael W; Lin, Michael Z; Chu, Jun
2016-02-16
Many genetically encoded biosensors use Förster resonance energy transfer (FRET) to dynamically report biomolecular activities. While pairs of cyan and yellow fluorescent proteins (FPs) are most commonly used as FRET partner fluorophores, respectively, green and red FPs offer distinct advantages for FRET, such as greater spectral separation, less phototoxicity, and lower autofluorescence. We previously developed the green-red FRET pair Clover and mRuby2, which improves responsiveness in intramolecular FRET reporters with different designs. Here we report the engineering of brighter and more photostable variants, mClover3 and mRuby3. mClover3 improves photostability by 60% and mRuby3 by 200% over the previous generation of fluorophores. Notably, mRuby3 is also 35% brighter than mRuby2, making it both the brightest and most photostable monomeric red FP yet characterized. Furthermore, we developed a standardized methodology for assessing FP performance in mammalian cells as stand-alone markers and as FRET partners. We found that mClover3 or mRuby3 expression in mammalian cells provides the highest fluorescence signals of all jellyfish GFP or coral RFP derivatives, respectively. Finally, using mClover3 and mRuby3, we engineered an improved version of the CaMKIIα reporter Camuiα with a larger response amplitude.
Schade, Alexander; Behme, Nicole; Spange, Stefan
2014-02-17
The four empirical solvent polarity parameters according to the Catalán scale--solvent acidity (SA), solvent basicity (SB), solvent polarizability (SP), and solvent dipolarity (SdP)--of 64 ionic liquids (ILs) were determined by the solvatochromic method. The SA parameter was determined solely by using [Fe(II)(1,10-phenanthroline)2(CN)2] (Fe), the SB parameter by using the pair of structurally comparable dyes 3-(4-amino-3-methylphenyl)-7-phenylbenzo[1,2-b:4,5-b']difuran-2,6-dione (ABF) and 3-(4-N,N-dimethylaminophenyl)-7-phenylbenzo[1,2-b:4,5-b']-difuran-2,6-dione (DMe-ABF), and the SP and SdP parameters by using the homomorphic pair of 4-tert-butyl-2-(dicyanomethylene)-5-[4-(diethylamino)benzylidene]-Δ(3)-thiazoline (Th) and 2-[4-(N,N-dimethylamino)benzylidene]malononitrile (BMN). The separation of SP and SdP for a set of 64 various ILs was performed for the first time. Correlation analyses of SP with physicochemical data related to ionization potentials of anions of ILs as well as with theoretical data show the correctness of the applied method. The found correlations of the Catalán parameters with each other and with the alkyl-chain length of 1-alkyl-3-methylimidazolium-type ILs gives new information about interactions within ILs. An analytical comparison of the determined Catalán parameters with the established Kamlet-Taft parameters and the Gutmann acceptor and donor numbers is also presented. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bai, Yang; Zhou, Zhong-Jun; Wang, Jia-Jun; Li, Ying; Wu, Di; Chen, Wei; Li, Zhi-Ru; Sun, Chia-Chung
2013-04-04
Using the strong electron hole cage C20F19 acceptor, the NH2...M/M3O (M = Li, Na, and K) complicated donors with excess electron, and the unusual σ chain (CH2)4 bridge, we construct a new kind of electride molecular salt e(-)@C20F19-(CH2)4-NH2...M(+)/M3O(+) (M = Li, Na, and K) with excess electron anion inside the hole cage (to be encapsulated excess electron-hole pair) serving as a new A-B-D strategy for enhancing nonlinear optical (NLO) response. An interesting push-pull mechanism of excess electron generation and its long-range transfer is exhibited. The excess electron is pushed out from the (super)alkali atom M/M3O by the lone pair of NH2 in the donor and further pulled inside the hole cage C20F19 acceptor through the efficient long σ chain (CH2)4 bridge. Owing to the long-range electron transfer, the new designed electride molecular salts with the excess electron-hole pair exhibit large NLO response. For the e(-)@C20F19-(CH2)4-NH2...Na(+), its large first hyperpolarizability (β0) reaches up to 9.5 × 10(6) au, which is about 2.4 × 10(4) times the 400 au for the relative e(-)@C20F20...Na(+) without the extended chain (CH2)4-NH2. It is shown that the new strategy is considerably efficient in enhancing the NLO response for the salts. In addition, the effects of different bridges and alkali atomic number on β0 are also exhibited. Further, three modulating factors are found for enhancing NLO response. They are the σ chain bridge, bridge-end group with lone pair, and (super)alkali atom. The new knowledge may be significant for designing new NLO materials and electronic devices with electrons inside the cages. They may also be the basis of establishing potential organic chemistry with electron-hole pair.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rechkoblit, Olga; Delaney, James C.; Essigmann, John M.
DNA is susceptible to alkylation damage by a number of environmental agents that modify the Watson-Crick edge of the bases. Such lesions, if not repaired, may be bypassed by Y-family DNA polymerases. The bypass polymerase Dpo4 is strongly inhibited by 1-methylguanine (m1G) and 3-methylcytosine (m3C), with nucleotide incorporation opposite these lesions being predominantly mutagenic. Further, extension after insertion of both correct and incorrect bases, introduces additional base substitution and deletion errors. Crystal structures of the Dpo4 ternary extension complexes with correct and mismatched 3'-terminal primer bases opposite the lesions reveal that both m1G and m3C remain positioned within the DNAmore » template/primer helix. However, both correct and incorrect pairing partners exhibit pronounced primer terminal nucleotide distortion, being primarily evicted from the DNA helix when opposite m1G or misaligned when pairing with m3C. Our studies provide insights into mechanisms related to hindered and mutagenic bypass of methylated lesions and models associated with damage recognition by repair demethylases.« less
Are H-reflex and M-wave recruitment curve parameters related to aerobic capacity?
Piscione, Julien; Grosset, Jean-François; Gamet, Didier; Pérot, Chantal
2012-10-01
Soleus Hoffmann reflex (H-reflex) amplitude is affected by a training period and type and level of training are also well known to modify aerobic capacities. Previously, paired changes in H-reflex and aerobic capacity have been evidenced after endurance training. The aim of this study was to investigate possible links between H- and M-recruitment curve parameters and aerobic capacity collected on a cohort of subjects (56 young men) that were not involved in regular physical training. Maximal H-reflex normalized with respect to maximal M-wave (H(max)/M(max)) was measured as well as other parameters of the H- or M-recruitment curves that provide information about the reflex or direct excitability of the motoneuron pool, such as thresholds of stimulus intensity to obtain H or M response (H(th) and M(th)), the ascending slope of H-reflex, or M-wave recruitment curves (H(slp) and M(slp)) and their ratio (H(slp)/M(slp)). Aerobic capacity, i.e., maximal oxygen consumption and maximal aerobic power (MAP) were, respectively, estimated from a running field test and from an incremental test on a cycle ergometer. Maximal oxygen consumption was only correlated with M(slp), an indicator of muscle fiber heterogeneity (p < 0.05), whereas MAP was not correlated with any of the tested parameters (p > 0.05). Although higher H-reflex are often described for subjects with a high aerobic capacity because of endurance training, at a basic level (i.e., without training period context) no correlation was observed between maximal H-reflex and aerobic capacity. Thus, none of the H-reflex or M-wave recruitment curve parameters, except M(slp), was related to the aerobic capacity of young, untrained male subjects.
Paired quantum Hall states on noncommutative two-tori
NASA Astrophysics Data System (ADS)
Marotta, Vincenzo; Naddeo, Adele
2010-08-01
By exploiting the notion of Morita equivalence for field theories on noncommutative tori and choosing rational values of the noncommutativity parameter θ (in appropriate units), a one-to-one correspondence between an Abelian noncommutative field theory (NCFT) and a non-Abelian theory of twisted fields on ordinary space can be established. Starting from this general result, we focus on the conformal field theory (CFT) describing a quantum Hall fluid (QHF) at paired states fillings ν=mp/m+2 Cristofano et al. (2000) [1], recently obtained by means of m-reduction procedure, and show that it is the Morita equivalent of a NCFT. In this way we extend the construction proposed in Marotta and Naddeo (2008) [2] for the Jain series ν=>m2p/m+1. The case m=2 is explicitly discussed and the role of noncommutativity in the physics of quantum Hall bilayers is emphasized. Our results represent a step forward the construction of a new effective low energy description of certain condensed matter phenomena and help to clarify the relationship between noncommutativity and quantum Hall fluids.
Two- and three-dimensional natural and mixed convection simulation using modular zonal models
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wurtz, E.; Nataf, J.M.; Winkelmann, F.
We demonstrate the use of the zonal model approach, which is a simplified method for calculating natural and mixed convection in rooms. Zonal models use a coarse grid and use balance equations, state equations, hydrostatic pressure drop equations and power law equations of the form {ital m} = {ital C}{Delta}{sup {ital n}}. The advantage of the zonal approach and its modular implementation are discussed. The zonal model resolution of nonlinear equation systems is demonstrated for three cases: a 2-D room, a 3-D room and a pair of 3-D rooms separated by a partition with an opening. A sensitivity analysis withmore » respect to physical parameters and grid coarseness is presented. Results are compared to computational fluid dynamics (CFD) calculations and experimental data.« less
An Improved Interferometric Calibration Method Based on Independent Parameter Decomposition
NASA Astrophysics Data System (ADS)
Fan, J.; Zuo, X.; Li, T.; Chen, Q.; Geng, X.
2018-04-01
Interferometric SAR is sensitive to earth surface undulation. The accuracy of interferometric parameters plays a significant role in precise digital elevation model (DEM). The interferometric calibration is to obtain high-precision global DEM by calculating the interferometric parameters using ground control points (GCPs). However, interferometric parameters are always calculated jointly, making them difficult to decompose precisely. In this paper, we propose an interferometric calibration method based on independent parameter decomposition (IPD). Firstly, the parameters related to the interferometric SAR measurement are determined based on the three-dimensional reconstruction model. Secondly, the sensitivity of interferometric parameters is quantitatively analyzed after the geometric parameters are completely decomposed. Finally, each interferometric parameter is calculated based on IPD and interferometric calibration model is established. We take Weinan of Shanxi province as an example and choose 4 TerraDEM-X image pairs to carry out interferometric calibration experiment. The results show that the elevation accuracy of all SAR images is better than 2.54 m after interferometric calibration. Furthermore, the proposed method can obtain the accuracy of DEM products better than 2.43 m in the flat area and 6.97 m in the mountainous area, which can prove the correctness and effectiveness of the proposed IPD based interferometric calibration method. The results provide a technical basis for topographic mapping of 1 : 50000 and even larger scale in the flat area and mountainous area.
NASA Astrophysics Data System (ADS)
2014-08-01
A scientific session of the Physical Sciences Division of the Russian Academy of Sciences (RAS), entitled 'Superconductivity in iron-based compounds', was held on 29 January 2014 at the conference hall of the Lebedev Physical Institute, RAS. The agenda of the session, announced on the website http://www.gpad.ac.ru of the RAS Physical Sciences Division listed the following reports: (1) Eremin I M (Institut für Theoretische Physik III, Ruhr-Universität Bochum, Bochum, Deutschland; Kazan (Volga region) Federal University, Kazan, Russian Federation) "Antiferromagnetism in iron-based superconductors: interaction of the magnetic, orbital, and lattice degrees of freedom"; (2) Korshunov M M (Kirenskii Institute of Physics, Siberian Branch of the Russian Academy of Sciences, Krasnoyarsk) "Superconducting state in iron-based materials and spin-fluctuation pairing theory"; (3) Kuzmicheva T E (Lebedev Physical Institute, Russian Academy of Sciences, Moscow; Lomonosov Moscow State University) "Andreev spectroscopy of iron-based superconductors: temperature dependence of the order parameters and scaling of Δ_L, S with T_C"; (4) Eltsev Yu F (Lebedev Physical Institute, Russian Academy of Sciences, Moscow) "Synthesis and study of the magnetic and transport properties of iron-based superconductors of the 122 family". Papers written on the basis of oral presentations 1-4 are published below. • Antiferromagnetism in iron-based superconductors: magnetic order in the model of delocalized electrons, I M Eremin Physics-Uspekhi, 2014, Volume 57, Number 8, Pages 807-813 • Superconducting state in iron-based materials and spin-fluctuation pairing theory, M M Korshunov Physics-Uspekhi, 2014, Volume 57, Number 8, Pages 813-819 • Andreev spectroscopy of iron-based superconductors: temperature dependence of the order parameters and scaling of Δ_L, S with T_C, T E Kuzmicheva, S A Kuzmichev, M G Mikheev, Ya G Ponomarev, S N Tchesnokov, V M Pudalov, E P Khlybov, N D Zhigadlo Physics-Uspekhi, 2014, Volume 57, Number 8, Pages 819-827 • Magnetic and transport properties of single crystals of Fe-based superconductors of the 122 family, Yu F Eltsev, K S Pervakov, V A Vlasenko, S Yu Gavrilkin, E P Khlybov, V M Pudalov Physics-Uspekhi, 2014, Volume 57, Number 8, Pages 827-832
NASA Astrophysics Data System (ADS)
Galy, Jean; Matar, Samir F.
2017-02-01
The stereochemistry of ns2np4 (n = 4, 5) lone pair LP characterizing noble gas Kr and Xe (labeled M*) in M*F2 difluorides is examined within coherent crystal chemistry and ab initio visualizations. M*2+ in such oxidation state brings three lone pairs (E) and difluorides are formulated M*F2E3. The analyses use electron localization function (ELF) obtained within density functional theory calculations showing the development of the LP triplets whirling {E3} quantified in the relevant chemical systems. Detailed ELF data analyses allowed showing that in α KrF2E3 and isostructural XeF2E3 difluorides the three E electronic clouds merge or hybridize into a torus and adopt a perfect gyration circle with an elliptical section, while in β KrF2 the network architecture deforms the whole torus into an ellipsoid shape. Original precise metrics are provided for the torus in the different compounds under study. In KrF2 the geometric changes upon β → α phase transition is schematized and mechanisms for the transformation with temperature or pressure are proposed. The results are further highlighted by electronic band structure calculations which show similar features of equal band gaps of 3 eV in both α and β KrF2 and a reorganization of frontier orbitals due to the different orientations of the F-Kr-F linear molecule in the two tetragonal structures.
Gianfrani, Livio; Castrillo, Antonio; Fasci, Eugenio; Galzerano, Gianluca; Casa, Giovanni; Laporta, Paolo
2010-10-11
We describe a continuous-wave diode laser spectrometer for water-vapour precision spectroscopy at 1.38 μm. The spectrometer is based upon the use of a simple scheme for offset-frequency locking of a pair of extended-cavity diode lasers that allows to achieve unprecedented accuracy and reproducibility levels in measuring molecular absorption. When locked to the master laser with an offset frequency of 1.5 GHz, the slave laser exhibits residual frequency fluctuations of 1 kHz over a time interval of 25 minutes, for a 1-s integration time. The slave laser could be continuously tuned up to 3 GHz, the scan showing relative deviations from linearity below the 10{-6} level. Simultaneously, a capture range of the order of 1 GHz was obtained. Quantitative spectroscopy was also demonstrated by accurately determining relevant spectroscopic parameters for the 22,1→22,0line of the H2(18)O v1+v3 band at 1384.6008 nm.
Wu, Hanzhong; Zhang, Fumin; Liu, Tingyang; Li, Jianshuang; Qu, Xinghua
2016-10-17
Two-color interferometry is powerful for the correction of the air refractive index especially in the turbulent air over long distance, since the empirical equations could introduce considerable measurement uncertainty if the environmental parameters cannot be measured with sufficient precision. In this paper, we demonstrate a method for absolute distance measurement with high-accuracy correction of air refractive index using two-color dispersive interferometry. The distances corresponding to the two wavelengths can be measured via the spectrograms captured by a CCD camera pair in real time. In the long-term experiment of the correction of air refractive index, the experimental results show a standard deviation of 3.3 × 10-8 for 12-h continuous measurement without the precise knowledge of the environmental conditions, while the variation of the air refractive index is about 2 × 10-6. In the case of absolute distance measurement, the comparison with the fringe counting interferometer shows an agreement within 2.5 μm in 12 m range.
Ayaz, Shirazi Muhammad; Kim, Min Young
2018-01-01
In this article, a multi-view registration approach for the 3D handheld profiling system based on the multiple shot structured light technique is proposed. The multi-view registration approach is categorized into coarse registration and point cloud refinement using the iterative closest point (ICP) algorithm. Coarse registration of multiple point clouds was performed using relative orientation and translation parameters estimated via homography-based visual navigation. The proposed system was evaluated using an artificial human skull and a paper box object. For the quantitative evaluation of the accuracy of a single 3D scan, a paper box was reconstructed, and the mean errors in its height and breadth were found to be 9.4 μm and 23 μm, respectively. A comprehensive quantitative evaluation and comparison of proposed algorithm was performed with other variants of ICP. The root mean square error for the ICP algorithm to register a pair of point clouds of the skull object was also found to be less than 1 mm. PMID:29642552
Helix-coil transition of a four-way DNA junction observed by multiple fluorescence parameters.
Vámosi, György; Clegg, Robert M
2008-10-16
The thermal denaturation of immobile four-way DNA ("Holliday-") junctions with 17 base pair arms was studied via fluorescence spectroscopic measurements. Two arms of the molecule were labeled at the 5'-end with fluorescein and tetramethylrhodamine, respectively. Melting was monitored by the fluorescence intensity of the dyes, the fluorescence anisotropy of tetramethylrhodamine, and Forster resonance energy transfer (FRET) between fluorescein and rhodamine. To fit the thermal denaturation curves of the four-way junctions, two basic thermodynamic models were tested: (1) all-or-none transitions assuming a molecularity of one, two, or four and (2) a statistical "zipper" model. The all-or-none models correspond to reaction mechanisms assuming that the cooperative melting unit (that is, the structure changing from complete helix to complete coil) consists of (1) one arm, (2) two neighboring arms (which have one continuous strand common to the two arms), or (3) all four arms. In each case, the melting of the cooperative unit takes place in a single step. The tetramolecular reaction model (four-arm melting) yielded unrealistically low van't Hoff enthalpy and entropy values, whereas the monomolecular model (one-arm melting) resulted in a poor fit to the experimental data. The all-or-none bimolecular (two neighboring arm model) fit gave intermediate standard enthalpy change (Delta H) values between those expected for the melting of a duplex with a total length between the helix lengths of one and two arms (17 and 34 base pairs). Simulations according to the zipper model fit the experimental curves best when the length of the simulated duplex was assumed to be 34 base pairs, the length of a single strand. This suggests that the most important parameter determining the melting behavior of the molecule is the end-to-end distance of the strands (34 bases) rather than the length of the individual arms (17 base pairs) and that the equilibrium concentration of partially denatured intermediate states has to be taken into account. These findings are in good agreement with results obtained for three-way DNA junctions ( Stuhmeier, F. ; Lilley, D. M. ; Clegg, R. M. Biochemistry 1997, 36, 13539 ). An interesting result is that the extent-of-melting curves derived from the fluorescence intensity and anisotropy nearly agree, whereas the curve derived from the FRET data shows a change prior to the melting. This may be an indication of a conformational change leaving the double-stranded structure intact but changing the end-to-end distance of the different arms in a way consistent with the transition to the extended square configuration ( Clegg, R. M. ; Murchie, A. I. ; Lilley, D. M. Biophys. J. 1994, 66, 99 ) of this branched molecule.
Hamiltonian thermodynamics of charged three-dimensional dilatonic black holes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dias, Goncalo A. S.; Lemos, Jose P. S.; Centro Multidisciplinar de Astrofisica-CENTRA, Departamento de Fisica, Instituto Superior Tecnico-IST, Universidade Tecnica de Lisboa-UTL, Avenida Rovisco Pais 1, 1049-001 Lisboa
2008-10-15
The action for a class of three-dimensional dilaton-gravity theories, with an electromagnetic Maxwell field and a cosmological constant, can be recast in a Brans-Dicke-Maxwell type action, with its free {omega} parameter. For a negative cosmological constant, these theories have static, electrically charged, and spherically symmetric black hole solutions. Those theories with well formulated asymptotics are studied through a Hamiltonian formalism, and their thermodynamical properties are found out. The theories studied are general relativity ({omega}{yields}{+-}{infinity}), a dimensionally reduced cylindrical four-dimensional general relativity theory ({omega}=0), and a theory representing a class of theories ({omega}=-3), all with a Maxwell term. The Hamiltonian formalismmore » is set up in three dimensions through foliations on the right region of the Carter-Penrose diagram, with the bifurcation 1-sphere as the left boundary, and anti-de Sitter infinity as the right boundary. The metric functions on the foliated hypersurfaces and the radial component of the vector potential one-form are the canonical coordinates. The Hamiltonian action is written, the Hamiltonian being a sum of constraints. One finds a new action which yields an unconstrained theory with two pairs of canonical coordinates (M,P{sub M};Q,P{sub Q}), where M is the mass parameter, which for {omega}<-(3/2) and for {omega}={+-}{infinity} needs a careful renormalization, P{sub M} is the conjugate momenta of M, Q is the charge parameter, and P{sub Q} is its conjugate momentum. The resulting Hamiltonian is a sum of boundary terms only. A quantization of the theory is performed. The Schroedinger evolution operator is constructed, the trace is taken, and the partition function of the grand canonical ensemble is obtained, where the chemical potential is the scalar electric field {phi}. Like the uncharged cases studied previously, the charged black hole entropies differ, in general, from the usual quarter of the horizon area due to the dilaton.« less
USDA-ARS?s Scientific Manuscript database
This study examined the relative influence of genetic versus environmental factors on specific aspects of eating behavior. Adult monozygotic twins (22 pairs and 3 singleton reared apart, 38 pairs and 9 singleton reared together, age 18-76 years, BMI 17-43 kg/m2) completed the Three Factor Eating Que...
A system for extracting 3-dimensional measurements from a stereo pair of TV cameras
NASA Technical Reports Server (NTRS)
Yakimovsky, Y.; Cunningham, R.
1976-01-01
Obtaining accurate three-dimensional (3-D) measurement from a stereo pair of TV cameras is a task requiring camera modeling, calibration, and the matching of the two images of a real 3-D point on the two TV pictures. A system which models and calibrates the cameras and pairs the two images of a real-world point in the two pictures, either manually or automatically, was implemented. This system is operating and provides three-dimensional measurements resolution of + or - mm at distances of about 2 m.
Optical properties of marine stratocumulus clouds modified by ships
DOE Office of Scientific and Technical Information (OSTI.GOV)
King, M.D.; Radke, L.F.; Hobbs, P.V.
1993-02-20
The angular distribution of scattered radiation deep within a cloud layer was measured in marine stratocumulus clouds modified by the emissions from ships. These observations, obtained at 13 discrete wavelengths between 0.5 and 2.3 [mu]m, were acquired as the University of Washington C-131A aircraft flew through a pair of roughly parallel ship track signatures produced in clouds off the coast of southern California on July 10, 1987. In the first of these ship tracks, the nadir (upwelling) intensity increased from 40 to 110 W m[sup [minus]2] [mu]m[sup [minus]1] sr[sup [minus]1] at 0.744 [mu]m. The second ship track produced a lessmore » dramatic, but more uniform, increase in the upwelling intensity. In contrast, the nadir intensity at 2.20 [mu]m decreased from 1 to 0.13 W m[sup [minus]2] [mu]m[sup [minus]1] sr[sup [minus]1] in the first ship track and to 0.6 W m[sup [minus]2] [mu]m[sup [minus]1] sr[sup [minus]1] in the second ship track. The relative angular distribution of the intensity field at each wavelength was used to determine the similarity parameter, and hence single scattering albedo, of the cloud using the diffusion domain method. Besides the spectral similarity parameter, these measurements provide a good estimate of the optical depth of the cloud layer both above and below the aircraft. Results of this analysis are presented for a 120-km section of marine stratocumulus cloud including both ship tracks. This analysis shows that the total optical thickness of the cloud layer increased in the ship tracks, in contrast to the similarity parameter which decreased. The decrease in absorption was a direct consequence of the reduction in cloud droplet size that occurred within the ship tracks. 34 refs., 11 figs., 2 tabs.« less
NASA Astrophysics Data System (ADS)
Wang, Yao; Chen, Mei-Dan; Li, Xian; Li, Biao
2017-05-01
Through Hirota bilinear transformation and symbolic computation with Maple, a class of lump solutions, rationally localised in all directions in the space, to a reduced generalised (3+1)-dimensional shallow water wave (SWW) equation are prensented. The resulting lump solutions all contain six parameters, two of which are free due to the translation invariance of the SWW equation and the other four of which must satisfy a nonzero determinant condition guaranteeing analyticity and rational localisation of the solutions. Then we derived the interaction solutions for lump solutions and one stripe soliton and the result shows that the particular lump solutions with specific values of the involved parameters will be drowned or swallowed by the stripe soliton. Furthermore, we extend this method to a more general combination of positive quadratic function and hyperbolic functions. Especially, it is interesting that a rogue wave is found to be aroused by the interaction between lump solutions and a pair of resonance stripe solitons. By choosing the values of the parameters, the dynamic properties of lump solutions, interaction solutions for lump solutions and one stripe soliton and interaction solutions for lump solutions and a pair of resonance solitons, are shown by dynamic graphs.
A dynamical study of the multiple system 17 Cygni ABFG
NASA Astrophysics Data System (ADS)
Romanenko, L. G.
2017-03-01
Adynamical study of the relative motions of the components of the inner pairs AB (ADS 12913) and FG (ADS 12889) of the quadruple heirarchical system 17 Cygni (WDS 19464+3344) is presented, as well as analysis of themotions of the outer pair AB-FG. The study is based on CCD observations obtained on the 26-inch refractor of the Pulkovo Observatory (2003-2013), position observations from the WDS catalog, Hipparcos parallaxes, and radial velocities of the components from literature data. A family of orbits for 17 Cyg AB is obtained for the first time, and has a most probable period of 6200 yrs. The apparent motion parameters (AMP) method is used, since the entire visible arc of the orbit over 1832-2013 is only 4°. The AMP method is also used to calculate the orbit of the 17 Cyg FG pair, which has a period of 238 yrs, yielding results in good agreement with the orbits derived in other studies. The ephemerides of the obtained AMP orbits, the position data for the AF pair from the WDS catalog (11 positions during 1893-2002), and Pulkovo CCD observations for 2007-2013 are used to calculate the apparent motion parameters of AB-FG outer pair, as well as a family of close-to-parabolic orbits with periods of 3.7 million years ormore. All the orbits (for both the inner and the outer pairs) are steeply inclined to theGalactic plane. Monte Carlo simulations are used to compute the probability that the outer pair is gravitationally bound, which is 47%. The similarity of the proper motions and radial velocities of all the components provides evidence that they all belong to a single stellar stream. Data from the CNS3 catalog are used to compose a list of candidate members of this stream.
NASA Astrophysics Data System (ADS)
Zhao, Ze; Wang, Shuang
2018-03-01
The main purpose of this work is to distinguish various holographic type dark energy (DE) models, including the ΛHDE, HDE, NADE, and RDE model, by using various diagnostic tools. The first diagnostic tool is the Statefinder hierarchy, in which the evolution of Statefinder hierarchy parmeter S (1) 3( z) and S (1) 4( z) are studied. The second is composite null diagnostic (CND), in which the trajectories of { S (1) 3, ɛ} and { S (1) 4, ɛ} are investigated, where ɛ is the fractional growth parameter. The last is w-w' analysis, where w is the equation of state for DE and the prime denotes derivative with respect to ln a. In the analysis we consider two cases: varying current fractional DE density Ω de0 and varying DE model parameter C. We find that: (1) both the Statefinder hierarchy and the CND have qualitative impact on ΛHDE, but only have quantitative impact on HDE. (2) S (1) 4 can lead to larger differences than S (1) 3, while the CND pair has a stronger ability to distinguish different models than the Statefinder hierarchy. (3) For the case of varying C, the { w,w'} pair has qualitative impact on ΛHDE; for the case of varying Ω de0, the { w, w'} pair only has quantitative impact; these results are different from the cases of HDE, RDE, and NADE, in which the {w,w'} pair only has quantitative impact on these models. In conclusion, compared with HDE, RDE, and NADE, the ΛHDE model can be easily distinguished by using these diagnostic tools.
Significant evidence for linkage disequilibrium over a 5-cM region among Afrikaners.
Gordon, D; Simonic, I; Ott, J
2000-05-15
We explore the extent of deviations from Hardy-Weinberg equilibrium (HWE) at a marker locus and linkage disequilibrium (LD) between pairs of marker loci in the Afrikaner population of South Africa. DNA samples were used for genotyping of 23 loci on six chromosomes. The samples were collected from 91 healthy unrelated Afrikaner adults. Exact tests were used to determine evidence for deviations from HWE at a single marker locus or LD between pairs of marker loci. At the 0.05 level of significance, evidence was found for deviation from HWE at only one of the 23 loci. At the same level of significance, LD was found among 8 of the 34 intrachromosomal pairs of loci. On chromosome 21, there was evidence for LD (P = 0.02) between a pair of loci with a genetic distance of 5.51 cM. On chromosome 2, there was evidence for LD between a pair of loci with a genetic distance of 5.28 cM (P = 0.002) and a pair of loci with a genetic distance of 3.68 cM (P = 0.0004). Detailed analysis of LD for one locus pair indicated that only a few of all alleles participated in the LD and that strong LD was most often positive. Our findings indicate that Afrikaans-speaking Afrikaners represent one of those special populations deemed particularly suitable for disequilibrium mapping. Copyright 2000 Academic Press.
Pair luminescence in Cr3+ -doped Ba2Mg(BO3)2
NASA Astrophysics Data System (ADS)
Bondzior, Bartosz; Miniajluk, Natalia; Dereń, Przemysław J.
2018-05-01
Cr3+ ions were introduced to the Ba2Mg(BO3)2 host to provide information about the site occupation, crystal field strength, and the site symmetry. The samples were synthesized by solid-state reaction. Emission observed under 440 nm excitation was characteristic for Cr3+ ions in strong octahedral ligand field with Dq/B parameter ratio 2.74 and sharp R line at 698 nm. The charge mismatch between Cr3+ dopant and Mg2+ host ion is compensated by the creation of Cr3+ pair in the vicinity of Ba or Mg vacancy. The emission decay curve is bi-exponential with decay times 1.2 and 13.3 ms.
NASA Astrophysics Data System (ADS)
Mantha, Kameswara Bharadwaj; McIntosh, Daniel H.; Brennan, Ryan; Ferguson, Henry C.; Kodra, Dritan; Newman, Jeffrey A.; Rafelski, Marc; Somerville, Rachel S.; Conselice, Christopher J.; Cook, Joshua S.; Hathi, Nimish P.; Koo, David C.; Lotz, Jennifer M.; Simmons, Brooke D.; Straughn, Amber N.; Snyder, Gregory F.; Wuyts, Stijn; Bell, Eric F.; Dekel, Avishai; Kartaltepe, Jeyhan; Kocevski, Dale D.; Koekemoer, Anton M.; Lee, Seong-Kook; Lucas, Ray A.; Pacifici, Camilla; Peth, Michael A.; Barro, Guillermo; Dahlen, Tomas; Finkelstein, Steven L.; Fontana, Adriano; Galametz, Audrey; Grogin, Norman A.; Guo, Yicheng; Mobasher, Bahram; Nayyeri, Hooshang; Pérez-González, Pablo G.; Pforr, Janine; Santini, Paola; Stefanon, Mauro; Wiklind, Tommy
2018-04-01
The rate of major galaxy-galaxy merging is theoretically predicted to steadily increase with redshift during the peak epoch of massive galaxy development (1 ≤ z ≤ 3). We use close-pair statistics to objectively study the incidence of massive galaxies (stellar M1 > 2 × 1010 M⊙) hosting major companions (1 ≤ M1/M2 ≤ 4; i.e. <4:1) at six epochs spanning 0 < z < 3. We select companions from a nearly complete, mass-limited (≥5 × 109 M⊙) sample of 23 696 galaxies in the five Cosmic Assembly Near-Infrared Deep Extragalactic Legacy Survey fields and the Sloan Digital Sky Survey. Using 5-50 kpc projected separation and close redshift proximity criteria, we find that the major companion fraction fmc(z) based on stellar mass-ratio (MR) selection increases from 6 per cent (z ˜ 0) to 16 per cent (z ˜ 0.8), then turns over at z ˜ 1 and decreases to 7 per cent (z ˜ 3). Instead, if we use a major F160W flux-ratio (FR) selection, we find that fmc(z) increases steadily until z = 3 owing to increasing contamination from minor (MR > 4:1) companions at z > 1. We show that these evolutionary trends are statistically robust to changes in companion proximity. We find disagreements between published results are resolved when selection criteria are closely matched. If we compute merger rates using constant fraction-to-rate conversion factors (Cmerg,pair = 0.6 and Tobs,pair = 0.65 Gyr), we find that MR rates disagree with theoretical predictions at z > 1.5. Instead, if we use an evolving Tobs,pair(z) ∝ (1 + z)-2 from Snyder et al., our MR-based rates agree with theory at 0 < z < 3. Our analysis underscores the need for detailed calibration of Cmerg,pair and Tobs,pair as a function of redshift, mass, and companion selection criteria to better constrain the empirical major merger history.
Tevatron Run II Combination of the Effective Leptonic Electroweak Mixing Angle
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aaltonen, Timo Antero; et al.
Drell-Yan lepton pairs produced in the processmore » $$p \\bar{p} \\rightarrow \\ell^+\\ell^- + X$$ through an intermediate $$\\gamma^*/Z$$ boson have an asymmetry in their angular distribution related to the spontaneous symmetry breaking of the electroweak force and the associated mixing of its neutral gauge bosons. The CDF and D0 experiments have measured the effective-leptonic electroweak mixing parameter $$\\sin^2\\theta^{\\rm lept}_{\\rm eff}$$ using electron and muon pairs selected from the full Tevatron proton-antiproton data sets collected in 2001-2011, corresponding to 9-10 fb$$^{-1}$$ of integrated luminosity. The combination of these measurements yields the most precise result from hadron colliders, $$\\sin^2 \\theta^{\\rm lept}_{\\rm eff} = 0.23148 \\pm 0.00033$$. This result is consistent with, and approaches in precision, the best measurements from electron-positron colliders. The standard model inference of the on-shell electroweak mixing parameter $$\\sin^2\\theta_W$$, or equivalently the $W$-boson mass $$M_W$$, using the \\textsc{zfitter} software package yields $$\\sin^2 \\theta_W = 0.22324 \\pm 0.00033$$ or equivalently, $$M_W = 80.367 \\pm 0.017 \\;{\\rm GeV}/c^2$$.« less
Bajar, Bryce T.; Wang, Emily S.; Lam, Amy J.; Kim, Bongjae B.; Jacobs, Conor L.; Howe, Elizabeth S.; Davidson, Michael W.; Lin, Michael Z.; Chu, Jun
2016-01-01
Many genetically encoded biosensors use Förster resonance energy transfer (FRET) to dynamically report biomolecular activities. While pairs of cyan and yellow fluorescent proteins (FPs) are most commonly used as FRET partner fluorophores, respectively, green and red FPs offer distinct advantages for FRET, such as greater spectral separation, less phototoxicity, and lower autofluorescence. We previously developed the green-red FRET pair Clover and mRuby2, which improves responsiveness in intramolecular FRET reporters with different designs. Here we report the engineering of brighter and more photostable variants, mClover3 and mRuby3. mClover3 improves photostability by 60% and mRuby3 by 200% over the previous generation of fluorophores. Notably, mRuby3 is also 35% brighter than mRuby2, making it both the brightest and most photostable monomeric red FP yet characterized. Furthermore, we developed a standardized methodology for assessing FP performance in mammalian cells as stand-alone markers and as FRET partners. We found that mClover3 or mRuby3 expression in mammalian cells provides the highest fluorescence signals of all jellyfish GFP or coral RFP derivatives, respectively. Finally, using mClover3 and mRuby3, we engineered an improved version of the CaMKIIα reporter Camuiα with a larger response amplitude. PMID:26879144
Charges on Strange Quark Nuggets in Space
NASA Technical Reports Server (NTRS)
Teplitz, v.; Bhatia, A.; Abers, E.; Dicus, D.; Repko, Wayne; Rosenbaum, D.
2008-01-01
Witten (1984): 3 quark flavors implies same P.E., but less K.E. by Pauli Principle. Farhi and Jaffe find SQN B.E./q rises to asymptotic value as N=A/3 rises. A. De Rujula and S. Glashow identify bunch of methods of detecting SQNs. M. Alford, K.Rajagopa1, and F.Wilczek find Cooper pairing of SQN q's. Primordial: depends on cooling by evaporation being less than cooling by neutrino emission and any other mechanisms. Evap approx. MA(sup 2/3); neutrinos NM. M>10{20} works. Collisions of SQS's from NS binaries. Explosive events could give trifecta: gamma absorption for E>2m(e); emission at 2m(e); and emission at m(e-) from e+ production. There are questions of e+ production in COG, and of pair instability Sne. SQM roles possible. Possible detection of SQN emission line from e- capture during X-ray flare needs estimate.
Search for dark Higgsstrahlung in e+e- → μ+μ- and missing energy events with the KLOE experiment
NASA Astrophysics Data System (ADS)
Anastasi, A.; Babusci, D.; Bencivenni, G.; Berlowski, M.; Bloise, C.; Bossi, F.; Branchini, P.; Budano, A.; Caldeira Balkeståhl, L.; Cao, B.; Ceradini, F.; Ciambrone, P.; Curciarello, F.; Czerwiński, E.; D'Agostini, G.; Danè, E.; De Leo, V.; De Lucia, E.; De Santis, A.; De Simone, P.; Di Cicco, A.; Di Domenico, A.; Di Salvo, R.; Domenici, D.; D'Uffizi, A.; Fantini, A.; Felici, G.; Fiore, S.; Gajos, A.; Gauzzi, P.; Giardina, G.; Giovannella, S.; Graziani, E.; Happacher, F.; Heijkenskjöld, L.; Ikegami Andersson, W.; Johansson, T.; Kamińska, D.; Krzemien, W.; Kupsc, A.; Loffredo, S.; Mandaglio, G.; Martini, M.; Mascolo, M.; Messi, R.; Miscetti, S.; Morello, G.; Moricciani, D.; Moskal, P.; Nguyen, F.; Palladino, A.; Passeri, A.; Patera, V.; Perez del Rio, E.; Ranieri, A.; Santangelo, P.; Sarra, I.; Schioppa, M.; Silarski, M.; Sirghi, F.; Tortora, L.; Venanzoni, G.; Wiślicki, W.; Wolke, M.
2015-07-01
We searched for evidence of a Higgsstrahlung process in a secluded sector, leading to a final state with a dark photon U and a dark Higgs boson h‧, with the KLOE detector at DAΦNE. We investigated the case of h‧ lighter than U, with U decaying into a muon pair and h‧ producing a missing energy signature. We found no evidence of the process and set upper limits to its parameters in the range 2mμ
Ouzon-Shubeita, Hala; Lee, Seongmin
2014-01-01
N7-Methyl-2′-deoxyguanosine (m7dG) is the predominant lesion formed by methylating agents. A systematic investigation on the effect of m7dG on DNA replication has been difficult due to the chemical instability of m7dG. To gain insights into the m7dG effect, we employed a 2′-fluorine-mediated transition-state destabilzation strategy. Specifically, we determined kinetic parameters for dCTP insertion opposite a chemically stable m7dG analogue, 2′-fluoro-m7dG (Fm7dG), by human DNA polymerase β (polβ) and solved three X-ray structures of polβ in complex with the templating Fm7dG paired with incoming dCTP or dTTP analogues. The kinetic studies reveal that the templating Fm7dG slows polβ catalysis ∼300-fold, suggesting that m7dG in genomic DNA may impede replication by some DNA polymerases. The structural analysis reveals that Fm7dG forms a canonical Watson–Crick base pair with dCTP, but metal ion coordination is suboptimal for catalysis in the polβ-Fm7dG:dCTP complex, which partially explains the slow insertion of dCTP opposite Fm7dG by polβ. In addition, the polβ-Fm7dG:dTTP structure shows open protein conformations and staggered base pair conformations, indicating that N7-methylation of dG does not promote a promutagenic replication. Overall, the first systematic studies on the effect of m7dG on DNA replication reveal that polβ catalysis across m7dG is slow, yet highly accurate. PMID:24966350
NASA Technical Reports Server (NTRS)
Eagles, D. M.
1993-01-01
Electronic specific heats and thermodynamic critical fields are calculated in a mean-field version of an induced-pairing model for superconductivity, and compared with results of Loram et al. (1990) on YBa2(Cu(1-y)Zn(y))3O(7-x). This model involves induction of pairing of holes in a wideband by strongly bound electronlike pairs. It is assumed that the planar hole concentration for no Zn addition is close to, but slightly higher than, that for the maximum Tc, and that it increases by 0.015 per planar Cu ion for each increase of y by 0.01. Parameters of the model are taken to be the same as in a previous publication in which energy gaps were discussed, except that an effective hybridization parameter is adjusted for each Zn concentration to give agreement with the observed Tc. Results are presented for y = 0.0, 0.01, and 0.03. The agreement with experiment is good for thermodynamic critical fields, and is fair for specific heats. For specimens with larger y, with relatively low T(c)s, it is argued that the model should be supplemented to include effects of a BCS-type interaction amongst the wideband carriers.
Search for neutral MSSM Higgs bosons decaying into a pair of bottom quarks
Khachatryan, Vardan
2015-11-11
A search for neutral Higgs bosons decaying into a bb¯ quark pair and produced in association with at least one additional b quark is presented. This signature is sensitive to the Higgs sector of the minimal supersymmetric standard model (MSSM) with large values of the parameter tan β. The analysis is based on data from proton-proton collisions at a center-of-mass energy of 8 TeV collected with the CMS detector at the LHC, corresponding to an integrated luminosity of 19.7 fb –1. The results are combined with a previous analysis based on 7 TeV data. No signal is observed. Stringent uppermore » limits on the cross section times branching fraction are derived for Higgs bosons with masses up to 900 GeV, and the results are interpreted within different MSSM benchmark scenarios, m h max, m h mod+, m h mod–, light-stau and light-stop. Observed 95% confidence level upper limits on tan β, ranging from 14 to 50, are obtained in the m h mod+ benchmark scenario.« less
Vihma, Veera; Naukkarinen, Jussi; Turpeinen, Ursula; Hämäläinen, Esa; Kaprio, Jaakko; Rissanen, Aila; Heinonen, Sini; Hakkarainen, Antti; Lundbom, Jesper; Lundbom, Nina; Mikkola, Tomi S; Tikkanen, Matti J; Pietiläinen, Kirsi H
2017-09-01
Obesity and ageing are associated with lower serum testosterone levels in men. How fat distribution or adipose tissue metabolism, independent of genetic factors and age, are related to sex steroid metabolism is less clear. We studied the associations between adiposity and serum sex hormone concentrations, and mRNA expression of genes regulating sex hormone metabolism in adipose tissue in young adult male monozygotic (MZ) twin pairs. The subjects [n=18 pairs; mean age, 32 years; individual body mass indexes (BMIs) 22-36kg/m 2 ] included 9 male MZ twin pairs discordant for BMI [intra-pair difference (Δ) in BMI ≥3kg/m 2 ]. Sex steroid concentrations were determined by liquid chromatography-tandem mass spectrometry, body composition by dual-energy X-ray absorptiometry and magnetic resonance imaging, and mRNA expressions from subcutaneous adipose tissue by Affymetrix. In BMI-discordant pairs (mean ΔBMI=5.9kg/m 2 ), serum dihydrotestosterone (DHT) was lower [mean 1.9 (SD 0.7) vs. 2.4 (1.0) nmol/l, P=0.040] and mRNA expressions of DHT-inactivating AKR1C2 (P=0.021) and cortisol-producing HSD11B1 (P=0.008) higher in the heavier compared to the leaner co-twins. Serum free 17β-estradiol (E2) was higher [2.3 (0.5) vs. 1.9 (0.5) pmol/l, P=0.028], and in all twin pairs, serum E2 and estrone concentrations were higher in the heavier than in the leaner co-twins [107 (28) vs. 90 (22) pmol/l, P=0.006; and 123 (43) vs. 105 (27) pmol/l, P=0.025]. Within all twin pairs, i.e. independent of genetic effects and age, 1) the amount of subcutaneous fat inversely correlated with serum total and free testosterone, DHT, and sex hormone-binding globulin (SHBG) concentrations (P<0.01 for all), 2) intra-abdominal fat with total testosterone and SHBG (P<0.05), and 3) liver fat with SHBG (P=0.006). Also, 4) general and intra-abdominal adiposity correlated positively with mRNA expressions of AKR1C2, HSD11B1, and aromatase in adipose tissue (P<0.05). In conclusion, acquired adiposity was associated with decreased serum DHT and increased estrogen concentrations, independent of genetic factors and age. The reduction of DHT could be linked to its increased degradation (by AKR1C2 and HSD11B1) and increased estrogen levels to increased adiposity-related expression of aromatase in adipose tissue. Copyright © 2017 Elsevier Ltd. All rights reserved.
PM 10 levels in communities close to and away from opencast coal mining sites in Northeast England
NASA Astrophysics Data System (ADS)
Pless-Mulloli, Tanja; King, Andrew; Howel, Denise; Stone, Ian; Merefield, John
Concerns about levels of particulate matter of less than 10 μm (PM 10) and their potential health effects have been raised by residents living near opencast coal mining sites in the UK. PM 10 levels were measured by TEOM in 5 matched pairs of communities in northeast England, 5 near active opencast sites and 5 further away, to characterise the PM 10 exposure of residents. 14 609 paired 30-min TEOM readings, and weather data were collected during 1996-97, over 6 weeks each in four pairs and for 24 weeks in one pair. Co-located samplers collected PM 10 on an approximately weekly basis and samples were analysed using scanning electron microscopy with energy dispersive analysis (SEM-EDS). The patterns of PM 10 levels over time were similar in Opencast and Control Communities and were mostly similar to readings from nearby automated urban network stations. This suggested regional influences on PM 10 levels. The geometric mean PM 10 was 17.0 μg m -3 in Opencast and 14.9 μg m -3 in Control Communities (arithmetic mean 22.1 μg m -3 in Opencast 18.2 μg m -3 in Control Communities): Opencast Communities thus had 14% higher PM 10 levels than Control Communities on average. While the size distribution and proportion of shale particles indicated the opencast site as contributor to the PM 10 load in adjacent communities, elevated PM 10 levels in Opencast Communities were not positively linked with permitted working hours or wind direction being from the site to the community. No consistent relationship was found between PM 10 levels and wind speed or day of the week.
Condensed Matter Theories - Volume 22
NASA Astrophysics Data System (ADS)
Reinholz, Heidi; Röpke, Gerd; de Llano, Manuel
2007-09-01
pt. A. Fermi liquids. Pressure comparison between the spherical cellular model and the Thomas-Fermi model / G.A. Baker, Jr. Pair excitations and vertex corrections in Fermi fluids and the dynamic structure function of two-dimension 3He / H.M. Böhm, H. Godfrin, E. Krotscheck, H.J. Lauter, M. Meschke and M. Panholzer. Condensation of helium in wedges / E.S. Hernádez ... [et al.]. Non-Fermi liquid behavior from the Fermi-liquid approach / V.A. Khodel ... [et al.]. Theory of third sound and stability of thin 3He-4He superfluid films / E. Krotscheck and M.D. Miller. Pairing in asymmetrical Fermi systems / K.F. Quader and R. Liao. Ground-state properties of small 3He drops from quantum Monte Carlo simulations / E. Sola, J. Casulleras and J. Boronat. Ground-state energy and compressibility of a disordered two-dimensional electron gas / Tanatar ... [et al.]. Quasiexcitons in photoluminescence of incompressible quantum liquids / A. Wójs, A.G ladysiewicz and J.J. Quinn -- pt. B. Bose liquids. Quantum Boltzmann liquids / K.A. Gernoth, M L. Ristig and T. Lindenau. Condensate fraction in the dynamic structure function of Bose fluids / M. Saarela, F. Mazzanti and V. Apaja -- pt. C. Strongly-correlated electronic systems. Electron gas in high-field nanoscopic transport: metallic carbon nanotubes / F. Green and D. Neilson. Evolution and destruction of the Kondo effect in a capacitively coupled double dot system / D.E. Logan and M.R. Galpin. The method of increments-a wavefunction-based Ab-Initio correlation method for solids / B. Paulus. Fractionally charged excitations on frustrated lattices / E. Runge, F. Pollmann and P. Fulde. 5f Electrons in actinides: dual nature and photoemission spectra / G. Zwicknagl -- pt. D. Magnetism. Magnetism in disordered two-dimensional Kondo-Necklace / W. Brenig. On the de Haas-can Alphen oscillation in 2D / S. Fujita and D.L. Morabito. Dynamics in one-dimensional spin systems-density matrix reformalization group study / S. Nishimoto and M. Arikawa. Frustrated quantum antiferromagnets: application of high-order coupled cluster method / J. Richter ... [et al.]. Vorticity and antivorticity in submicron ferromagnetic films / H. Wang, M. Yan and C.E. Campbell -- pt. E. Conductivity. D-wave checkerboard bose condensate of mobile bipolarons / A.S. Alexandrov. Five possible reasons why high-Tc superconductivity is stalled / M. Grether and M. de Llano. Multistability and Multi 2[Pie symbol]-Kinks in the Frenkel-Kontorova model: an application to arrays of Josephson junctions / K.E. Kürten and C. Krattenthaler. Lowering of Boson-Fermion system energy with a gapped cooper resonant-pair dispersion relation / T.A. Mamedov and M. de Llano. The concept of correlated density and its application / K. Morawetz ... [et al.]. Competing local and non-local phase correlations in Fermionic systems with resonant pairing: the Boson-Fermion scenario / J. Ranninger. Superconducting order parameters in the extended Hubbard model: a simple mean-field study / J.S. Thakur and M.P. Das -- pt. F. Nuclear systems. Distribution of maxima of the antisymmetized wave function for the nucleons of a closed-shell and for the nucleons of all closed-shells in a nucleus / G.S. Anagnostatos. Pairing of strongly correlated nucleons / W.H. Dickhoff. Short range correlations in relativistic nuclear models / P.K. Panda, C. Providência and J. da Providência. Quartetting in attractive Fermi-systems and alpha particle condensation in nuclear systems / P. Schuck ... [et al.]. Alpha-alpha and Alpha-nucleus potentials: an energy-density fucntional approach / Z.F. Shehadeh ... [et al.]. -- pt. G. Density functional theory and MD simulations. Dynamics of metal clusters in rare gas clusters / M. Baer ... [et al.]. Reinhard and E. Suraud. Kohn-Sham calculations combined with an average pair-density functional theory / P. Gori-Giorgi and A. Savin. Correlations, collision frequency and optical properties in laser excited clusters / H. Reinholz, T. Raitza and G. Röpke -- pt. H. Biophysics. Condensed matter physics of biomolecule systems in a differential geometric framework / H. Bohr, J.I. Ipsen and S. Markvorsen. The brain's view of the natural world in motion: computing structure from function using directional Fourier transformations / B.K. Dellen, J.W. Clark and R. Wessel -- pt. I. Quantum information. Control and error prevention in condensed matter quantum computing devices / M.S. Byrd and L.A. Wu. Maxent approaches to qubits / C.M. Sarris, A.N. Proto and F B. Malik -- pt. J. New formalisms. Thermal coherent states, a broader class of mixed coherent states, and generalized thermo-field dynamics / R.F. Bishop and A. Vourdas. Ergodic condition and magnetic models / M. Howard Lee. From thermodynamics to Maxent / A. Plastino and E. M.F. Curado. Recent progress in the density-matrix renormalization group / U. Schollwöck.
Cheng, Heyong; Chen, Xiaopan; Shen, Lihuan; Wang, Yuanchao; Xu, Zigang; Liu, Jinhua
2018-01-05
Most of analytical community is focused on reversed phase high performance liquid chromatography (RP-HPLC) for mercury speciation by employing mobile phases comprising of high salts and moderate amounts of organic solvents. This study aims at rapid mercury speciation analysis by ion-pairing RP-HPLC with inductively coupled plasma mass spectrometry (ICP-MS) detection only using low salts for the sake of green analytical chemistry. Two ion-pairing HPLC methods were developed on individual usage of positively and negatively charged ion-pairing reagents (tetrabutylammonium hydroxide -TBAH and sodium dodecylbenzene sulfonate -SDBS), where sodium 3-mercapto-1-propysulfonate (MPS) and l-cysteine (Cys) were individually added in mobile phases to transform mercury species into negative and positive Hg-complexes for good resolution. Addition of phenylalanine was also utilized for rapid baseline separation in combination of short C 18 guard columns. Optimum mobile phases of 2.0mM SDBS+2.0mM Cys+1.0mM Phe (pH 3.0) and 4.0mM TBAH+2.0mM MPS+2.0mM Phe (pH 6.0) both achieved baseline separation of inorganic mercury (Hg 2+ ), methylmercury (MeHg), ethylmercury (EtHg) and phenylmercury (PhHg) on two consecutive 12.5-mm C 18 columns. The former mobile phase was selected for mercury speciation in freshwater fish because of short separation time (3.0min). Detection limits of 0.015 for Hg 2+ , 0.014 for MeHg, 0.028 for EtHg and 0.042μgL -1 for PhHg were obtained along with satisfactory precisions of peak height and area (1.0-2.8% for 5.0μgL -1 Hg-mixture standard). Good accordance of determined values of MeHg and total mercury in certified reference materials of fish tissue (GBW 10029) and tuna fish (BCR-463) with certified values as well as good recoveries (91-106%) proved good accuracy of the proposed method. An example application to freshwater fish indicated its potential in routine analysis, where MeHg was presented at 3.7-20.3μgkg -1 as the dominate species. Copyright © 2017 Elsevier B.V. All rights reserved.
Suppression of back-to-back hadron pairs at forward rapidity in d+Au collisions at √s(NN)=200 GeV.
Adare, A; Afanasiev, S; Aidala, C; Ajitanand, N N; Akiba, Y; Al-Bataineh, H; Alexander, J; Angerami, A; Aoki, K; Apadula, N; Aramaki, Y; Atomssa, E T; Averbeck, R; Awes, T C; Azmoun, B; Babintsev, V; Bai, M; Baksay, G; Baksay, L; Barish, K N; Bassalleck, B; Basye, A T; Bathe, S; Baublis, V; Baumann, C; Bazilevsky, A; Belikov, S; Belmont, R; Bennett, R; Berdnikov, A; Berdnikov, Y; Bhom, J H; Blau, D S; Bok, J S; Boyle, K; Brooks, M L; Buesching, H; Bumazhnov, V; Bunce, G; Butsyk, S; Campbell, S; Caringi, A; Chen, C-H; Chi, C Y; Chiu, M; Choi, I J; Choi, J B; Choudhury, R K; Christiansen, P; Chujo, T; Chung, P; Chvala, O; Cianciolo, V; Citron, Z; Cole, B A; Conesa del Valle, Z; Connors, M; Csanád, M; Csörgo, T; Dahms, T; Dairaku, S; Danchev, I; Das, K; Datta, A; David, G; Dayananda, M K; Denisov, A; Deshpande, A; Desmond, E J; Dharmawardane, K V; Dietzsch, O; Dion, A; Donadelli, M; Drapier, O; Drees, A; Drees, K A; Durham, J M; Durum, A; Dutta, D; D'Orazio, L; Edwards, S; Efremenko, Y V; Ellinghaus, F; Engelmore, T; Enokizono, A; En'yo, H; Esumi, S; Fadem, B; Fields, D E; Finger, M; Finger, M; Fleuret, F; Fokin, S L; Fraenkel, Z; Frantz, J E; Franz, A; Frawley, A D; Fujiwara, K; Fukao, Y; Fusayasu, T; Garishvili, I; Glenn, A; Gong, H; Gonin, M; Goto, Y; Granier de Cassagnac, R; Grau, N; Greene, S V; Grim, G; Grosse Perdekamp, M; Gunji, T; Gustafsson, H-Å; Haggerty, J S; Hahn, K I; Hamagaki, H; Hamblen, J; Han, R; Hanks, J; Haslum, E; Hayano, R; He, X; Heffner, M; Hemmick, T K; Hester, T; Hill, J C; Hohlmann, M; Holzmann, W; Homma, K; Hong, B; Horaguchi, T; Hornback, D; Huang, S; Ichihara, T; Ichimiya, R; Ikeda, Y; Imai, K; Inaba, M; Isenhower, D; Ishihara, M; Issah, M; Isupov, A; Ivanischev, D; Iwanaga, Y; Jacak, B V; Jia, J; Jiang, X; Jin, J; Johnson, B M; Jones, T; Joo, K S; Jouan, D; Jumper, D S; Kajihara, F; Kamin, J; Kang, J H; Kapustinsky, J; Karatsu, K; Kasai, M; Kawall, D; Kawashima, M; Kazantsev, A V; Kempel, T; Khanzadeev, A; Kijima, K M; Kikuchi, J; Kim, A; Kim, B I; Kim, D J; Kim, E J; Kim, Y-J; Kinney, E; Kiss, Á; Kistenev, E; Kochenda, L; Komkov, B; Konno, M; Koster, J; Král, A; Kravitz, A; Kunde, G J; Kurita, K; Kurosawa, M; Kwon, Y; Kyle, G S; Lacey, R; Lai, Y S; Lajoie, J G; Lebedev, A; Lee, D M; Lee, J; Lee, K B; Lee, K S; Leitch, M J; Leite, M A L; Li, X; Lichtenwalner, P; Liebing, P; Linden Levy, L A; Liška, T; Litvinenko, A; Liu, H; Liu, M X; Love, B; Lynch, D; Maguire, C F; Makdisi, Y I; Malakhov, A; Malik, M D; Manko, V I; Mannel, E; Mao, Y; Masui, H; Matathias, F; McCumber, M; McGaughey, P L; Means, N; Meredith, B; Miake, Y; Mibe, T; Mignerey, A C; Miki, K; Milov, A; Mitchell, J T; Mohanty, A K; Moon, H J; Morino, Y; Morreale, A; Morrison, D P; Moukhanova, T V; Murakami, T; Murata, J; Nagamiya, S; Nagle, J L; Naglis, M; Nagy, M I; Nakagawa, I; Nakamiya, Y; Nakamura, K R; Nakamura, T; Nakano, K; Nam, S; Newby, J; Nguyen, M; Nihashi, M; Nouicer, R; Nyanin, A S; Oakley, C; O'Brien, E; Oda, S X; Ogilvie, C A; Oka, M; Okada, K; Onuki, Y; Oskarsson, A; Ouchida, M; Ozawa, K; Pak, R; Pantuev, V; Papavassiliou, V; Park, I H; Park, S K; Park, W J; Pate, S F; Pei, H; Peng, J-C; Pereira, H; Peresedov, V; Peressounko, D Yu; Petti, R; Pinkenburg, C; Pisani, R P; Proissl, M; Purschke, M L; Qu, H; Rak, J; Ravinovich, I; Read, K F; Reygers, K; Riabov, V; Riabov, Y; Richardson, E; Roach, D; Roche, G; Rolnick, S D; Rosati, M; Rosen, C A; Rosendahl, S S E; Rukoyatkin, P; Ružička, P; Sahlmueller, B; Saito, N; Sakaguchi, T; Sakashita, K; Samsonov, V; Sano, S; Sato, T; Sawada, S; Sedgwick, K; Seele, J; Seidl, R; Seto, R; Sharma, D; Shein, I; Shibata, T-A; Shigaki, K; Shimomura, M; Shoji, K; Shukla, P; Sickles, A; Silva, C L; Silvermyr, D; Silvestre, C; Sim, K S; Singh, B K; Singh, C P; Singh, V; Slunečka, M; Soltz, R A; Sondheim, W E; Sorensen, S P; Sourikova, I V; Stankus, P W; Stenlund, E; Stoll, S P; Sugitate, T; Sukhanov, A; Sziklai, J; Takagui, E M; Taketani, A; Tanabe, R; Tanaka, Y; Taneja, S; Tanida, K; Tannenbaum, M J; Tarafdar, S; Taranenko, A; Themann, H; Thomas, D; Thomas, T L; Togawa, M; Toia, A; Tomášek, L; Torii, H; Towell, R S; Tserruya, I; Tsuchimoto, Y; Vale, C; Valle, H; van Hecke, H W; Vazquez-Zambrano, E; Veicht, A; Velkovska, J; Vértesi, R; Virius, M; Vrba, V; Vznuzdaev, E; Wang, X R; Watanabe, D; Watanabe, K; Watanabe, Y; Wei, F; Wei, R; Wessels, J; White, S N; Winter, D; Woody, C L; Wright, R M; Wysocki, M; Yamaguchi, Y L; Yamaura, K; Yang, R; Yanovich, A; Ying, J; Yokkaichi, S; You, Z; Young, G R; Younus, I; Yushmanov, I E; Zajc, W A; Zhou, S; Zolin, L
2011-10-21
Back-to-back hadron pair yields in d+Au and p+p collisions at √s(NN)=200 GeV were measured with the PHENIX detector at the Relativistic Heavy Ion Collider. Rapidity separated hadron pairs were detected with the trigger hadron at pseudorapidity |η|<0.35 and the associated hadron at forward rapidity (deuteron direction, 3.0<η<3.8). Pairs were also detected with both hadrons measured at forward rapidity; in this case, the yield of back-to-back hadron pairs in d+Au collisions with small impact parameters is observed to be suppressed by a factor of 10 relative to p+p collisions. The kinematics of these pairs is expected to probe partons in the Au nucleus with a low fraction x of the nucleon momenta, where the gluon densities rise sharply. The observed suppression as a function of nuclear thickness, p(T), and η points to cold nuclear matter effects arising at high parton densities. © 2011 American Physical Society
NASA Astrophysics Data System (ADS)
Holland, D. M. P.; Powis, I.; Trofimov, A. B.; Menzies, R. C.; Potts, A. W.; Karlsson, L.; Badsyuk, I. L.; Moskovskaya, T. E.; Gromov, E. V.; Schirmer, J.
2017-10-01
The valence shell photoelectron spectra of 2-chloropyridine and 3-chloropyridine have been studied both experimentally and theoretically. Synchrotron radiation has been employed to record angle resolved photoelectron spectra in the photon energy range 20-100 eV, and these have enabled anisotropy parameters and branching ratios to be derived. The experimental results have been compared with theoretical predictions obtained using the continuum multiple scattering Xα approach. This comparison shows that the anisotropy parameter associated with the nominally chlorine lone-pair orbital lying in the molecular plane is strongly affected by the atomic Cooper minimum. In contrast, the photoionization dynamics of the second lone-pair orbital, orientated perpendicular to the molecular plane, seem relatively unaffected by this atomic phenomenon. The outer valence ionization has been studied theoretically using the third-order algebraic-diagrammatic construction (ADC(3)) approximation scheme for the one-particle Green's function, the outer valence Green's function method, and the equation-of-motion (EOM) coupled cluster (CC) theory at the level of the EOM-IP-CCSD and EOM-EE-CC3 models. The convergence of the results to the complete basis set limit has been investigated. The ADC(3) method has been employed to compute the complete valence shell ionization spectra of 2-chloropyridine and 3-chloropyridine. The relaxation mechanism for ionization of the nitrogen σ-type lone-pair orbital (σN LP) has been found to be different to that for the corresponding chlorine lone-pair (σCl LP). For the σN LP orbital, π-π* excitations play the main role in the screening of the lone-pair hole. In contrast, excitations localized at the chlorine site involving the chlorine πCl LP lone-pair and the Cl 4p Rydberg orbital are the most important for the σCl LP orbital. The calculated photoelectron spectra have allowed assignments to be proposed for most of the structure observed in the experimental spectra. The theoretical work also highlights the formation of satellite states, due to the breakdown of the single particle model of ionization, in the inner valence region.
Holland, D M P; Powis, I; Trofimov, A B; Menzies, R C; Potts, A W; Karlsson, L; Badsyuk, I L; Moskovskaya, T E; Gromov, E V; Schirmer, J
2017-10-28
The valence shell photoelectron spectra of 2-chloropyridine and 3-chloropyridine have been studied both experimentally and theoretically. Synchrotron radiation has been employed to record angle resolved photoelectron spectra in the photon energy range 20-100 eV, and these have enabled anisotropy parameters and branching ratios to be derived. The experimental results have been compared with theoretical predictions obtained using the continuum multiple scattering Xα approach. This comparison shows that the anisotropy parameter associated with the nominally chlorine lone-pair orbital lying in the molecular plane is strongly affected by the atomic Cooper minimum. In contrast, the photoionization dynamics of the second lone-pair orbital, orientated perpendicular to the molecular plane, seem relatively unaffected by this atomic phenomenon. The outer valence ionization has been studied theoretically using the third-order algebraic-diagrammatic construction (ADC(3)) approximation scheme for the one-particle Green's function, the outer valence Green's function method, and the equation-of-motion (EOM) coupled cluster (CC) theory at the level of the EOM-IP-CCSD and EOM-EE-CC3 models. The convergence of the results to the complete basis set limit has been investigated. The ADC(3) method has been employed to compute the complete valence shell ionization spectra of 2-chloropyridine and 3-chloropyridine. The relaxation mechanism for ionization of the nitrogen σ-type lone-pair orbital (σ N LP ) has been found to be different to that for the corresponding chlorine lone-pair (σ Cl LP ). For the σ N LP orbital, π-π* excitations play the main role in the screening of the lone-pair hole. In contrast, excitations localized at the chlorine site involving the chlorine π Cl LP lone-pair and the Cl 4p Rydberg orbital are the most important for the σ Cl LP orbital. The calculated photoelectron spectra have allowed assignments to be proposed for most of the structure observed in the experimental spectra. The theoretical work also highlights the formation of satellite states, due to the breakdown of the single particle model of ionization, in the inner valence region.
Sanan, Reshu; Mahajan, Rakesh Kumar
2013-03-15
With an aim to characterize the micellar aggregates of imidazolium based ionic liquids, a new potentiometric PVC sensor based on neutral ion-pair complexes of dodecylmethylimidazolium bromide-sodium dodecylsulfate (C12MeIm(+)DS(-)) has been developed. The electrode exhibited a linear response for the concentration range of 7.9×10(-5)-9.8×10(-3) M with a super-Nernstian slope of 92.94 mV/decade, a response time of 5 s and critical micellar concentration (cmc) of 10.09 mM for C12MeImBr. The performance of the electrode in investigating the cmc of C12MeImBr in the presence of two drugs [promazine hydrochloride (PMZ) and promethazine hydrochloride (PMT)] and three triblock copolymers (P123, L64 and F68) has been found to be satisfactory on comparison with conductivity measurements. Various micellar parameters have been evaluated for the binary mixtures of C12MeImBr with drugs and triblock copolymers using Clint's, Rubingh's, and Motomura's approach. Thus the electrode offers a simple, straightforward and relatively fast technique for the characterization of micellar aggregates of C12MeImBr, complementing existing conventional techniques. Further, the analytical importance of proposed C12MeIm(+)-ISE as end point indicator in potentiometric titrations and for direct determination of cationic surfactants [cetylpyridinium chloride (CPC), tetradecyltrimethylammonium bromide (TTAB), benzalkonium chloride (BC)] in some commercial products was judged by comparing statistically with classical two-phase titration methods. Copyright © 2013 Elsevier Inc. All rights reserved.
Statistical deprojection of galaxy pairs
NASA Astrophysics Data System (ADS)
Nottale, Laurent; Chamaraux, Pierre
2018-06-01
Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.
NASA Astrophysics Data System (ADS)
Riedel, Sebastian; Janas, Joanna; Gege, Peter; Oppelt, Natascha
2017-10-01
Uncertainties of aerosol parameters are the limiting factor for atmospheric correction over inland and coastal waters. For validating remote sensing products from these optically complex and spatially inhomogeneous waters the spatial resolution of automated sun photometer networks like AERONET is too coarse and additional measurements on the test site are required. We have developed a method which allows the derivation of aerosol parameters from measurements with any spectrometer with suitable spectral range and resolution. This method uses a pair of downwelling irradiance and sky radiance measurements for the extraction of the turbidity coefficient and aerosol Ångström exponent. The data can be acquired fast and reliable at almost any place during a wide range of weather conditions. A comparison to aerosol parameters measured with a Cimel sun photometer provided by AERONET shows a reasonable agreement for the Ångström exponent. The turbidity coefficient did not agree well with AERONET values due to fit ambiguities, indicating that future research should focus on methods to handle parameter correlations within the underlying model.
Preliminary GAOFEN-3 Insar dem Accuracy Analysis
NASA Astrophysics Data System (ADS)
Chen, Q.; Li, T.; Tang, X.; Gao, X.; Zhang, X.
2018-04-01
GF-3 satellite, the first C band and full-polarization SAR satellite of China with spatial resolution of 1 m, was successfully launched in August 2016. We analyze the error sources of GF-3 satellite in this paper, and provide the interferometric calibration model based on range function, Doppler shift equation and interferometric phase function, and interferometric parameters calibrated using the three-dimensional coordinates of ground control points. Then, we conduct the experimental two pairs of images in fine stripmap I mode covering Songshan of Henan Province and Tangshan of Hebei Province, respectively. The DEM data are assessed using SRTM DEM, ICESat-GLAS points, and ground control points database obtained using ZY-3 satellite to validate the accuracy of DEM elevation. The experimental results show that the accuracy of DEM extracted from GF-3 satellite SAR data can meet the requirements of topographic mapping in mountain and alpine regions at the scale of 1 : 50000 in China. Besides, it proves that GF-3 satellite has the potential of interferometry.
Two-Drug Antimicrobial Chemotherapy: A Mathematical Model and Experiments with Mycobacterium marinum
Ankomah, Peter; Levin, Bruce R.
2012-01-01
Multi-drug therapy is the standard-of-care treatment for tuberculosis. Despite this, virtually all studies of the pharmacodynamics (PD) of mycobacterial drugs employed for the design of treatment protocols are restricted to single agents. In this report, mathematical models and in vitro experiments with Mycobacterium marinum and five antimycobacterial drugs are used to quantitatively evaluate the pharmaco-, population and evolutionary dynamics of two-drug antimicrobial chemotherapy regimes. Time kill experiments with single and pairs of antibiotics are used to estimate the parameters and evaluate the fit of Hill-function-based PD models. While Hill functions provide excellent fits for the PD of each single antibiotic studied, rifampin, amikacin, clarithromycin, streptomycin and moxifloxacin, two-drug Hill functions with a unique interaction parameter cannot account for the PD of any of the 10 pairs of these drugs. If we assume two antibiotic-concentration dependent functions for the interaction parameter, one for sub-MIC and one for supra-MIC drug concentrations, the modified biphasic Hill function provides a reasonably good fit for the PD of all 10 pairs of antibiotics studied. Monte Carlo simulations of antibiotic treatment based on the experimentally-determined PD functions are used to evaluate the potential microbiological efficacy (rate of clearance) and evolutionary consequences (likelihood of generating multi-drug resistance) of these different drug combinations as well as their sensitivity to different forms of non-adherence to therapy. These two-drug treatment simulations predict varying outcomes for the different pairs of antibiotics with respect to the aforementioned measures of efficacy. In summary, Hill functions with biphasic drug-drug interaction terms provide accurate analogs for the PD of pairs of antibiotics and M. marinum. The models, experimental protocols and computer simulations used in this study can be applied to evaluate the potential microbiological and evolutionary efficacy of two-drug therapy for any bactericidal antibiotics and bacteria that can be cultured in vitro. PMID:22253599
Connections between the dynamical symmetries in the microscopic shell model
DOE Office of Scientific and Technical Information (OSTI.GOV)
Georgieva, A. I., E-mail: anageorg@issp.bas.bg; Drumev, K. P.
2016-03-25
The dynamical symmetries of the microscopic shell model appear as the limiting cases of a symmetry adapted Pairing-Plus-Quadrupole Model /PQM/, with a Hamiltonian containing isoscalar and isovector pairing and quadrupole interactions. We establish a correspondence between each of the three types of pairing bases and Elliott’s SU(3) basis, that describes collective rotation of nuclear systems with quadrupole deformation. It is derived from their complementarity to the same LS coupling chain of the shell model number conserving algebra. The probability distribution of the S U(3) basis states within the pairing eigenstates is also obtained through a numerical diagonalization of the PQMmore » Hamiltonian in each limit. We introduce control parameters, which define the phase diagram of the model and determine the role of each term of the Hamiltonian in the correct reproduction of the experimental data for the considered nuclei.« less
Hau Fung Cheung, Rodney; Morrison, Paul D; Small, Darryl M; Marriott, Philip J
2008-12-05
A single enzyme treatment with alpha-amylase, prior to the quantification of added folic acid (FA) in fortified instant fried Asian noodles with analysis performed by capillary zone electrophoresis (CZE) and reversed-phase high performance liquid chromatography (RP-HPLC) with UV detection, is described. The method was validated and optimized for capillary electrophoresis (CE) with separation achieved using a 8 mM phosphate-12 mM borate run buffer with 5% MeOH at pH 9.5. FA was well separated from matrix components with nicotinic acid (NA) employed as an internal standard. In a comparative study, separation of FA was performed using HPLC with a mobile phase consisting of 27% MeOH (v/v) in aqueous potassium phosphate buffer (3.5 mM KH(2)PO(4) and 3.2 mM K(2)HPO(4)), pH 8.5, and containing 5 mM tetrabutylammonium dihydrogen phosphate as an ion-pairing agent. For both methods, excellent results were obtained for various analytical parameters including linearity, accuracy and precision. The limit of detection was calculated to be 2.2 mg/L for CE without sample stacking and 0.10 mg/L with high performance liquid chromatography (HPLC). Sample extraction involved homogenization and enzymatic extraction with alpha-amylase. Results indicated that FA was stable during four main stages of instant fried noodle manufacturing (dough crumbs, cut sheets, steaming and frying).
Park, HaJeung; González, Àlex L; Yildirim, Ilyas; Tran, Tuan; Lohman, Jeremy R; Fang, Pengfei; Guo, Min; Disney, Matthew D
2015-06-23
Spinocerebellar ataxia type 10 (SCA10) is caused by a pentanucleotide repeat expansion of r(AUUCU) within intron 9 of the ATXN10 pre-mRNA. The RNA causes disease by a gain-of-function mechanism in which it inactivates proteins involved in RNA biogenesis. Spectroscopic studies showed that r(AUUCU) repeats form a hairpin structure; however, there were no high-resolution structural models prior to this work. Herein, we report the first crystal structure of model r(AUUCU) repeats refined to 2.8 Å and analysis of the structure via molecular dynamics simulations. The r(AUUCU) tracts adopt an overall A-form geometry in which 3 × 3 nucleotide (5')UCU(3')/(3')UCU(5') internal loops are closed by AU pairs. Helical parameters of the refined structure as well as the corresponding electron density map on the crystallographic model reflect dynamic features of the internal loop. The computational analyses captured dynamic motion of the loop closing pairs, which can form single-stranded conformations with relatively low energies. Overall, the results presented here suggest the possibility for r(AUUCU) repeats to form metastable A-from structures, which can rearrange into single-stranded conformations and attract proteins such as heterogeneous nuclear ribonucleoprotein K (hnRNP K). The information presented here may aid in the rational design of therapeutics targeting this RNA.
Park, HaJeung; González, Àlex L.; Yildirim, Ilyas; Tran, Tuan; Lohman, Jeremy R.; Fang, Pengfei; Guo, Min; Disney, Matthew D.
2016-01-01
Spinocerebellar ataxia type 10 (SCA10) is caused by a pentanucleotide repeat expansion of r(AUUCU) within intron 9 of the ATXN10 pre-mRNA. The RNA causes disease by a gain-of-function mechanism in which it inactivates proteins involved in RNA biogenesis. Spectroscopic studies showed that r(AUUCU) repeats form a hairpin structure; however, there were no high-resolution structural models prior to this work. Herein, we report the first crystal structure of model r(AUUCU) repeats refined to 2.8 Å and analysis of the structure via molecular dynamics simulations. The r(AUUCU) tracts adopt an overall A-form geometry in which 3 × 3 nucleotide 5′UCU3′/3′UCU5′ internal loops are closed by AU pairs. Helical parameters of the refined structure as well as the corresponding electron density map on the crystallographic model reflect dynamic features of the internal loop. The computational analyses captured dynamic motion of the loop closing pairs, which can form single-stranded conformations with relatively low energies. Overall, the results presented here suggest the possibility for r(AUUCU) repeats to form metastable A-from structures, which can rearrange into single-stranded conformations and attract proteins such as heterogeneous nuclear ribonucleoprotein K (hnRNP K). The information presented here may aid in the rational design of therapeutics targeting this RNA. PMID:26039897
Emission dynamics of hybrid plasmonic gold/organic GaN nanorods
NASA Astrophysics Data System (ADS)
Mohammadi, F.; Schmitzer, H.; Kunert, G.; Hommel, D.; Ge, J.; Duscher, G.; Langbein, W.; Wagner, H. P.
2017-12-01
We studied the emission of bare and aluminum quinoline (Alq3)/gold coated wurtzite GaN nanorods by temperature- and intensity-dependent time-integrated and time-resolved photoluminescence (PL). The GaN nanorods of ˜1.5 μm length and ˜250 nm diameter were grown by plasma-assisted molecular beam epitaxy. Gold/Alq3 coated GaN nanorods were synthesized by organic molecular beam deposition. The near band-edge and donor-acceptor pair luminescence was investigated in bare GaN nanorods and compared with multilevel model calculations providing the dynamical parameters for electron-hole pairs, excitons, impurity bound excitons, donors and acceptors. Subsequently, the influence of a 10 nm gold coating without and with an Alq3 spacer layer was studied and the experimental results were analyzed with the multilevel model. Without a spacer layer, a significant PL quenching and lifetime reduction of the near band-edge emission is found. The behavior is attributed to surface band-bending and Förster energy transfer from excitons to surface plasmons in the gold layer. Inserting a 5 nm Alq3 spacer layer reduces the PL quenching and lifetime reduction which is consistent with a reduced band-bending and Förster energy transfer. Increasing the spacer layer to 30 nm results in lifetimes which are similar to uncoated structures, showing a significantly decreased influence of the gold coating on the excitonic dynamics.
Emission dynamics of hybrid plasmonic gold/organic GaN nanorods.
Mohammadi, F; Schmitzer, H; Kunert, G; Hommel, D; Ge, J; Duscher, G; Langbein, W; Wagner, H P
2017-12-15
We studied the emission of bare and aluminum quinoline (Alq 3 )/gold coated wurtzite GaN nanorods by temperature- and intensity-dependent time-integrated and time-resolved photoluminescence (PL). The GaN nanorods of ∼1.5 μm length and ∼250 nm diameter were grown by plasma-assisted molecular beam epitaxy. Gold/Alq 3 coated GaN nanorods were synthesized by organic molecular beam deposition. The near band-edge and donor-acceptor pair luminescence was investigated in bare GaN nanorods and compared with multilevel model calculations providing the dynamical parameters for electron-hole pairs, excitons, impurity bound excitons, donors and acceptors. Subsequently, the influence of a 10 nm gold coating without and with an Alq 3 spacer layer was studied and the experimental results were analyzed with the multilevel model. Without a spacer layer, a significant PL quenching and lifetime reduction of the near band-edge emission is found. The behavior is attributed to surface band-bending and Förster energy transfer from excitons to surface plasmons in the gold layer. Inserting a 5 nm Alq 3 spacer layer reduces the PL quenching and lifetime reduction which is consistent with a reduced band-bending and Förster energy transfer. Increasing the spacer layer to 30 nm results in lifetimes which are similar to uncoated structures, showing a significantly decreased influence of the gold coating on the excitonic dynamics.
Performance of prototype high-flow inhalable dust sampler in a livestock production facility.
Anthony, T Renée; Cai, Changjie; Mehaffy, John; Sleeth, Darrah; Volckens, John
2017-05-01
A high-flow inhalable sampler, designed for operational flow rates up to 10 L/min using computer simulations and examined in wind tunnel experiments, was evaluated in the field. This prototype sampler was deployed in collocation with an IOM (the benchmark standard sampler) in a swine farrowing building to examine the sampling performance for assessing concentrations of inhalable particulate mass and endotoxin. Paired samplers were deployed for 24 hr on 19 days over a 3-month period. On each sampling day, the paired samplers were deployed at three fixed locations and data were analyzed to identify agreement and to examine systematic biases between concentrations measured by these samplers. Thirty-six paired gravimetric samples were analyzed; insignificant, unsubstantial differences between concentrations were identified between the two samplers (p = 0.16; mean difference 0.03 mg/m 3 ). Forty-four paired samples were available for endotoxin analysis, and a significant (p = 0.001) difference in endotoxin concentration was identified: the prototype sampler, on average, had 120 EU/m 3 more endotoxin than did the IOM samples. Since the same gravimetric samples were analyzed for endotoxin content, the endotoxin difference is likely attributable to differences in endotoxin extraction. The prototype's disposable thin-film polycarbonate capsule was included with the filter in the 1-hr extraction procedure while the internal plastic cassette of the IOM required a rinse procedure that is susceptible to dust losses. Endotoxin concentrations measured with standard plastic IOM inserts that follow this rinsing procedure may underestimate the true endotoxin exposure concentrations. The maximum concentrations in the study (1.55 mg/m 3 gravimetric, 2328 EU/m 3 endotoxin) were lower than other agricultural or industrial environments. Future work should explore the performance of the prototype sampler in dustier environments, where concentrations approach particulates not otherwise specified (PNOS) limits of 10 mg/m 3 , including using the prototype as a personal sampler.
Schüler, Torben; Kronschnabl, Gerhard; Plötz, Christian; Neidhardt, Alexander; Bertarini, Alessandra; Bernhart, Simone; la Porta, Laura; Halsig, Sebastian; Nothnagel, Axel
2015-01-01
Geodetic Very Long Baseline Interferometry (VLBI) uses radio telescopes as sensor networks to determine Earth orientation parameters and baseline vectors between the telescopes. The TWIN Telescope Wettzell 1 (TTW1), the first of the new 13.2 m diameter telescope pair at the Geodetic Observatory Wettzell, Germany, is currently in its commissioning phase. The technology behind this radio telescope including the receiving system and the tri-band feed horn is depicted. Since VLBI telescopes must operate at least in pairs, the existing 20 m diameter Radio Telescope Wettzell (RTW) is used together with TTW1 for practical tests. In addition, selected long baseline setups are investigated. Correlation results portraying the data quality achieved during first initial experiments are discussed. Finally, the local 123 m baseline between the old RTW telescope and the new TTW1 is analyzed and compared with an existing high-precision local survey. Our initial results are very satisfactory for X-band group delays featuring a 3D distance agreement between VLBI data analysis and local ties of 1 to 2 mm in the majority of the experiments. However, S-band data, which suffer much from local radio interference due to WiFi and mobile communications, are about 10 times less precise than X-band data and require further analysis, but evidence is provided that S-band data are well-usable over long baselines where local radio interference patterns decorrelate. PMID:26263991
Xiong, Gang; Guo, Hong; Ge, Xiaodong; Xu, Xueqing; Yang, Xiaoya; Yang, Kang; Jiang, Yaoguang; Bai, Yun
2011-03-01
Decoy receptor 3 (DcR3) is a soluble receptor, which can bind to and inactivate the apoptosis-inducing ligands. We studied a possible association between DcR3 expression and clinicopathologic features in patients with esophageal squamous cell carcinoma (ESCC). The mRNA expression of DcR3 was examined by RT-PCR in 109 primary ESCC patients. For the 52 pairs of DcR3 positive tissues, the protein expression was determined by immunohistochemistry. There was a strong correlation among DcR3 mRNA expression and tumor invasion (P=0.01) and lymph node metastasis (P=0.036). We also found that there was a correlation between DcR3 overexpression with lymph node metastasis (P=0.014) in 52 pairs of DCR3 mRNA positive tissues. Our finding suggested that the overexpression of DcR3 is significantly related with ESCC clinical staging. DcR3 might be a candidate as a tumor specific biomarker for ESCC.
Log-amplitude variance and wave structure function: A new perspective for Gaussian beams
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, W.B.; Ricklin, J.C.; Andrews, L.C.
1993-04-01
Two naturally linked pairs of nondimensional parameters are identified such that either pair, together with wavelength and path length, completely specifies the diffractive propagation environment for a lowest-order paraxial Gaussian beam. Both parameter pairs are intuitive, and within the context of locally homogeneous and isotropic turbulence they reflect the long-recognized importance of the Fresnel zone size in the behavior of Rytov propagation statistics. These parameter pairs, called, respectively, the transmitter and receiver parameters, also provide a change in perspective in the analysis of optical turbulence effects on Gaussian beams by unifying a number of behavioral traits previously observed or predicted,more » and they create an environment in which the determination of limiting interrelationships between beam forms is especially simple. The fundamental nature of the parameter pairs becomes apparent in the derived analytical expressions for the log-amplitude variance and the wave structure function. These expressions verify general optical turbulence-related characteristics predicted for Gaussian beams, provide additional insights into beam-wave behavior, and are convenient tools for beam-wave analysis. 22 refs., 10 figs., 2 tabs.« less
OPTIMASS: a package for the minimization of kinematic mass functions with constraints
NASA Astrophysics Data System (ADS)
Cho, Won Sang; Gainer, James S.; Kim, Doojin; Lim, Sung Hak; Matchev, Konstantin T.; Moortgat, Filip; Pape, Luc; Park, Myeonghun
2016-01-01
Reconstructed mass variables, such as M 2, M 2 C , M T * , and M T2 W , play an essential role in searches for new physics at hadron colliders. The calculation of these variables generally involves constrained minimization in a large parameter space, which is numerically challenging. We provide a C++ code, O ptimass, which interfaces with the M inuit library to perform this constrained minimization using the Augmented Lagrangian Method. The code can be applied to arbitrarily general event topologies, thus allowing the user to significantly extend the existing set of kinematic variables. We describe this code, explain its physics motivation, and demonstrate its use in the analysis of the fully leptonic decay of pair-produced top quarks using M 2 variables.
NASA Astrophysics Data System (ADS)
Sun, Changchun; Chen, Zhongtang; Xu, Qicheng
2017-12-01
An original three-dimensional (3D) smooth continuous chaotic system and its mirror-image system with eight common parameters are constructed and a pair of symmetric chaotic attractors can be generated simultaneously. Basic dynamical behaviors of two 3D chaotic systems are investigated respectively. A double-scroll chaotic attractor by connecting the pair of mutual mirror-image attractors is generated via a novel planar switching control approach. Chaos can also be controlled to a fixed point, a periodic orbit and a divergent orbit respectively by switching between two chaotic systems. Finally, an equivalent 3D chaotic system by combining two 3D chaotic systems with a switching law is designed by utilizing a sign function. Two circuit diagrams for realizing the double-scroll attractor are depicted by employing an improved module-based design approach.
Transfer impedances of balanced shielded cables
NASA Astrophysics Data System (ADS)
Hardiguian, M.
1982-07-01
The transfer impedance concept is extended to balanced shielded cables, e.g., shielded pairs and twinax in which the actual voltage developed at the load, between the two wires of a pair is emphasized. This parameter can be computed by a separate knowledge of the shield, and the shield-to-pair coupling (i.e., the pair unbalance ratio). Thus, a unique parameter called shield coupling evolves which relates directly the shield current to the differential output voltage. Conditions of cable pair and harness shielding and the impact of grounding at one or both ends are discussed.
Kaon femtoscopy in Au+Au collisions at √SNN = 200 GeV at the STAR experiment
NASA Astrophysics Data System (ADS)
Lidrych, Jindřich
2018-02-01
In this proceedings, the STAR preliminary results on femtoscopic correlations of identical kaons from Au+Au collisions at =200 GeV are presented. The measured kaon source radii are studied as a function of collision energy as well as centrality and transverse pair mass mT. In addition, extracted kaon blast-wave freeze-out parameters are presented.
Song, Bin; Molinero, Valeria
2013-08-07
Hydrophobic interactions are responsible for water-driven processes such as protein folding and self-assembly of biomolecules. Microscopic theories and molecular simulations have been used to study association of a pair of methanes in water, the paradigmatic example of hydrophobic attraction, and determined that entropy is the driving force for the association of the methane pair, while the enthalpy disfavors it. An open question is to which extent coarse-grained water models can still produce correct thermodynamic and structural signatures of hydrophobic interaction. In this work, we investigate the hydrophobic interaction between a methane pair in water at temperatures from 260 to 340 K through molecular dynamics simulations with the coarse-grained monatomic water model mW. We find that the coarse-grained model correctly represents the free energy of association of the methane pair, the temperature dependence of free energy, and the positive change in entropy and enthalpy upon association. We investigate the relationship between thermodynamic signatures and structural order of water through the analysis of the spatial distribution of the density, energy, and tetrahedral order parameter Qt of water. The simulations reveal an enhancement of tetrahedral order in the region between the first and second hydration shells of the methane molecules. The increase in tetrahedral order, however, is far from what would be expected for a clathrate-like or ice-like shell around the solutes. This work shows that the mW water model reproduces the key signatures of hydrophobic interaction without long ranged electrostatics or the need to be re-parameterized for different thermodynamic states. These characteristics, and its hundred-fold increase in efficiency with respect to atomistic models, make mW a promising water model for studying water-driven hydrophobic processes in more complex systems.
Li, Anqin; Xing, Wei; Li, Haojie; Hu, Yao; Hu, Daoyu; Li, Zhen; Kamel, Ihab R
2018-05-29
The purpose of this article is to evaluate the utility of volumetric histogram analysis of apparent diffusion coefficient (ADC) derived from reduced-FOV DWI for small (≤ 4 cm) solid renal mass subtypes at 3-T MRI. This retrospective study included 38 clear cell renal cell carcinomas (RCCs), 16 papillary RCCs, 18 chromophobe RCCs, 13 minimal fat angiomyolipomas (AMLs), and seven oncocytomas evaluated with preoperative MRI. Volumetric ADC maps were generated using all slices of the reduced-FOV DW images to obtain histogram parameters, including mean, median, 10th percentile, 25th percentile, 75th percentile, 90th percentile, and SD ADC values, as well as skewness, kurtosis, and entropy. Comparisons of these parameters were made by one-way ANOVA, t test, and ROC curves analysis. ADC histogram parameters differentiated eight of 10 pairs of renal tumors. Three subtype pairs (clear cell RCC vs papillary RCC, clear cell RCC vs chromophobe RCC, and clear cell RCC vs minimal fat AML) were differentiated by mean ADC. However, five other subtype pairs (clear cell RCC vs oncocytoma, papillary RCC vs minimal fat AML, papillary RCC vs oncocytoma, chromophobe RCC vs minimal fat AML, and chromophobe RCC vs oncocytoma) were differentiated by histogram distribution parameters exclusively (all p < 0.05). Mean ADC, median ADC, 75th and 90th percentile ADC, SD ADC, and entropy of malignant tumors were significantly higher than those of benign tumors (all p < 0.05). Combination of mean ADC with histogram parameters yielded the highest AUC (0.851; sensitivity, 80.0%; specificity, 86.1%). Quantitative volumetric ADC histogram analysis may help differentiate various subtypes of small solid renal tumors, including benign and malignant lesions.
3D Printing — The Basins of Tristability in the Lorenz System
NASA Astrophysics Data System (ADS)
Xiong, Anda; Sprott, Julien C.; Lyu, Jingxuan; Wang, Xilu
The famous Lorenz system is studied and analyzed for a particular set of parameters originally proposed by Lorenz. With those parameters, the system has a single globally attracting strange attractor, meaning that almost all initial conditions in its 3D state space approach the attractor as time advances. However, with a slight change in one of the parameters, the chaotic attractor coexists with a symmetric pair of stable equilibrium points, and the resulting tri-stable system has three intertwined basins of attraction. The advent of 3D printers now makes it possible to visualize the topology of such basins of attraction as the results presented here illustrate.
NASA Astrophysics Data System (ADS)
Anick, David J.
2010-04-01
For (H2O)20X water clusters consisting of X enclosed by the 512 dodecahedral cage, X=empty, H2O, NH3, and H3O+, databases are made consisting of 55-82 isomers optimized via B3LYP/6-311++G∗∗. Correlations are explored between ground state electronic energy (Ee) or electronic energy plus zero point energy (Ee+ZPE) and the clusters' topology, defined as the set of directed H-bonds. Linear regression is done to identify topological features that correlate with cluster energy. For each X, variables are found that account for 99% of the variance in Ee and predict it with a rms error under 0.2 kcal/mol. The method of analysis emphasizes the importance of an intermediate level of structure, the "O-topology," consisting of O-types and a list of O pairs that are bonded but omitting H-bond directions, as a device to organize the databases and reduce the number of structures one needs to consider. Relevant variables include three parameters, which count the number of H-bonds having particular donor and acceptor types; |M|2, where M is the cluster's vector dipole moment; and the projection of M onto the symmetry axis of X. Scatter diagrams for Ee or Ee+ZPE versus |M| show that clusters fall naturally into "families" defined by the values of certain discrete parameters, the "major parameters," for each X. Combining "family" analysis and O-topologies, a small group of clusters is identified for each X that are candidates to be the global minimum, and the minimum is determined. For X=H3O+, one cluster with central hydronium lies just 2.08 kcal/mol above the lowest isomer with surface hydronium. Implications of the methodology for dodecahedral (H2O)20(NH4+) and (H2O)20(NH4+)(OH-) are discussed, and new lower energy isomers are found. For MP2/TZVP, the lowest-energy (H2O)20(NH4+) isomer features a trifurcated H-bond. The results suggest a much more efficient and comprehensive way of seeking low-energy water cluster geometries that may have wide applicability.
Anick, David J
2010-04-28
For (H(2)O)(20)X water clusters consisting of X enclosed by the 5(12) dodecahedral cage, X = empty, H(2)O, NH(3), and H(3)O(+), databases are made consisting of 55-82 isomers optimized via B3LYP/6-311++G(**). Correlations are explored between ground state electronic energy (Ee) or electronic energy plus zero point energy (Ee+ZPE) and the clusters' topology, defined as the set of directed H-bonds. Linear regression is done to identify topological features that correlate with cluster energy. For each X, variables are found that account for 99% of the variance in Ee and predict it with a rms error under 0.2 kcal/mol. The method of analysis emphasizes the importance of an intermediate level of structure, the "O-topology," consisting of O-types and a list of O pairs that are bonded but omitting H-bond directions, as a device to organize the databases and reduce the number of structures one needs to consider. Relevant variables include three parameters, which count the number of H-bonds having particular donor and acceptor types; absolute value(M)(2), where M is the cluster's vector dipole moment; and the projection of M onto the symmetry axis of X. Scatter diagrams for Ee or Ee+ZPE versus absolute value(M) show that clusters fall naturally into "families" defined by the values of certain discrete parameters, the "major parameters," for each X. Combining "family" analysis and O-topologies, a small group of clusters is identified for each X that are candidates to be the global minimum, and the minimum is determined. For X = H(3)O(+), one cluster with central hydronium lies just 2.08 kcal/mol above the lowest isomer with surface hydronium. Implications of the methodology for dodecahedral (H(2)O)(20)(NH(4)(+)) and (H(2)O)(20)(NH(4)(+))(OH(-)) are discussed, and new lower energy isomers are found. For MP2/TZVP, the lowest-energy (H(2)O)(20)(NH(4)(+)) isomer features a trifurcated H-bond. The results suggest a much more efficient and comprehensive way of seeking low-energy water cluster geometries that may have wide applicability.
Siminiak, Tomasz; Dankowski, Rafał; Baszko, Artur; Lee, Christopher; Firek, Ludwik; Kałmucki, Piotr; Szyszka, Andrzej; Groothuis, Adam
2013-01-01
Functional mitral regurgitation (FMR) is known to contribute to a poor prognosis in patients with heart failure (HF). Current guidelines do not recommend cardiac surgery in patients with FMR and impaired ejection fraction due to the high procedural risk. Percutaneous techniques aimed at mitral valve repair may constitute an alternative to currently used routine medical treatment. To provide a description of a novel percutaneous suture-based technique of direct mitral annuloplasty using the Mitralign Bident system, as well as report our first case successfully treated with this method. A deflectable guiding catheter is advanced via the femoral route across the aortic valve to the posterior wall of the ventricle. A nested deflectable catheter is advanced through the guide toward the mitral annulus that allows the advancement of an insulated radiofrequency wire to cross the annulus. The wire is directed across the annulus in a target area that is 2-5 mm from the base of the leaflet into the annulus, as assessed by real-time 3D transoesophageal echocardiography. After placement of the first wire, another wire is positioned using a duel lumen bident delivery catheter, which provides a predetermined separation between wires (i.e. 14, 17 or 21 mm). Each wire provides a guide rail for implantation of sutured pledget implants within the annulus. Two pairs of pledgets are implanted, one pair in each of the P1 and P3 scallop regions of the posterior mitral annulus. A dedicated plication lock device is used to provide a means for plication of the annulus within each pair of the pledgets, and to retain the plication by delivering a suture locking implant. The plications result in improved leaflet coaptation and a reduction of the regurgitant orifice area. A 60-year-old female with diagnosed dilated cardiomyopathy, concomitant FMR class III and congestive HF was successfully treated with the Mitralign Bident system. Two pairs of pledgets were implanted resulting in an improvement of transoesophageal echocardiographic parameters, including proximal isovelocity surface area radius (0.7 cm to 0.4 cm), effective regurgitant orfice area (0.3 cm² to 0.1 cm²) and mitral regurgitant volume (49 mL to 10 mL). Percutaneous mitral annuloplasty with the Mitralign Bident system is feasible. Future clinical trials are needed to assess its safety and efficacy.
Electron-positron pair production in ion collisions at low velocity beyond Born approximation
NASA Astrophysics Data System (ADS)
Lee, R. N.; Milstein, A. I.
2016-10-01
We derive the spectrum and the total cross section of electromagnetic e+e- pair production in the collisions of two nuclei at low relative velocity β. Both free-free and bound-free e+e- pair production is considered. The parameters ηA,B =ZA,B α are assumed to be small compared to unity but arbitrary compared to β (ZA,B are the charge numbers of the nuclei and α is the fine structure constant). Due to a suppression of the Born term by high power of β, the first Coulomb correction to the amplitude appears to be important at ηA,B ≳ β. The effect of a finite nuclear mass is discussed. In contrast to the result obtained in the infinite nuclear mass limit, the terms ∝M-2 are not suppressed by the high power of β and may easily dominate at sufficiently small velocities.
Lopez, Steven A; Houk, K N
2014-07-03
Transition structures for the conrotatory electrocyclic ring-opening reactions of N-substituted 2-azetines were computed with the density functional M06-2X/6-31+G(d,p). A wide range of substituents from π acceptors (e.g., CHO, CN) to π donors (NMe2, OMe) was explored. Acceptor substituents delocalize the nitrogen lone pair and stabilize the reactant state of 2-azetines, while donors destabilize the 2-azetine reactant state. The conrotatory ring-opening is torquoselective, and the transition state for the outward rotation of the N-substituent and inward rotation of the nitrogen lone pair is preferred. This transition structure is stabilized by an interaction between the nitrogen lone pair and the vacant π* orbital. The activation free energies are linearly related to the reaction free energies and the Taft σR(0) parameter.
Metabolome and fecal microbiota in monozygotic twin pairs discordant for weight: a Big Mac challenge
Bondia-Pons, Isabel; Maukonen, Johanna; Mattila, Ismo; Rissanen, Aila; Saarela, Maria; Kaprio, Jaakko; Hakkarainen, Antti; Lundbom, Jesper; Lundbom, Nina; Hyötyläinen, Tuulia; Pietiläinen, Kirsi H.; Orešič, Matej
2014-01-01
Postprandial responses to food are complex, involving both genetic and environmental factors. We studied postprandial responses to a Big Mac meal challenge in monozygotic co-twins highly discordant for body weight. This unique design allows assessment of the contribution of obesity, independent of genetic liability. Comprehensive metabolic profiling using 3 analytical platforms was applied to fasting and postprandial serum samples from 16 healthy monozygotic twin pairs discordant for weight (body mass index difference >3 kg/m2). Nine concordant monozygotic pairs were examined as control pairs. Fecal samples were analyzed to assess diversity of the major bacterial groups by using 5 different validated bacterial group specific denaturing gradient gel electrophoresis methods. No differences in fecal bacterial diversity were detected when comparing co-twins discordant for weight (ANOVA, P<0.05). We found that within-pair similarity is a dominant factor in the metabolic postprandial response, independent of acquired obesity. Branched chain amino acids were increased in heavier as compared with leaner co-twins in the fasting state, but their levels converged postprandially (paired t tests, FDR q<0.05). We also found that specific bacterial groups were associated with postprandial changes of specific metabolites. Our findings underline important roles of genetic and early life factors in the regulation of postprandial metabolite levels.—Bondia-Pons, I., Maukonen, J., Mattila, I., Rissanen, A., Saarela, M., Kaprio, J., Hakkarainen, A., Lundbom, J., Lundbom, N., Hyötyläinen, T., Pietiläinen, K. H., Orešič, M. Metabolome and fecal microbiota in monozygotic twin pairs discordant for weight: a Big Mac challenge. PMID:24846387
Synthesis and evaluation of fluorogenic triglycerides as lipase assay substrates.
Andersen, Rokhsana J; Brask, Jesper
2016-06-01
Three racemic fluorogenic triglycerides are synthesized and evaluated as lipase assay substrates. The presented synthesis route goes through a key triglyceride intermediate which can be chemoselectively functionalized with a wide range of different probes. Hence the substrate can be tailor-made for a specific assay, or focus can be on low cost in larger scale for applications in high-throughput screening (HTS) assays. In the specific examples, TG-ED, TG-FD and TG-F2 are assembled with the Edans-Dabcyl or the fluorescein-Dabcyl FRET pair, or relying on fluorescein self-quenching, respectively. Proof-of-concept assays allowed determination of 1st order kinetic parameters (kcat/KM) of 460s(-1)M(-1), 59s(-1)M(-1) and 346s(-1)M(-1), respectively, for the three substrates. Commercially available EnzChek lipase substrate provided 204s(-1)M(-1). Substrate concentration was identified as a critical parameter, with measured reaction rates decreasing at higher concentrations when intermolecular quenching becomes significant. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Del Bene, Janet E; Alkorta, Ibon; Elguero, José
2015-11-11
Ab initio MP2/aug'-cc-pVTZ calculations have been carried out to investigate the properties of complexes formed between H2XP, for X = F, Cl, NC, OH, CN, CCH, CH3, and H, and the possible bridging molecules HN[double bond, length as m-dash]NH, FN[double bond, length as m-dash]NH, and HN[double bond, length as m-dash]CHOH. H2XP:HNNH and H2XP:FNNH complexes are stabilized by PN pnicogen bonds, except for H2(CH3)P:FNNH and H3P:FNNH which are stabilized by N-HP hydrogen bonds. H2XP:HNCHOH complexes are stabilized by PN pnicogen bonds and nonlinear O-HP hydrogen bonds. For a fixed H2XP molecule, binding energies decrease in the order HNCHOH > HNNH > FNNH, except for the binding energies of H2(CH3)P and H3P with HNNH and FNNH. Binding energies of complexes with HNCHOH and HNNH increase as the P-N1 distance decreases, but binding energies of complexes with FNNH show little dependence on this distance. The large binding energies of H2XP:HNCHOH complexes arise from a cooperative effect involving electron-pair acceptance by P to form a pnicogen bond, and electron-pair donation by P to form a hydrogen bond. The dominant charge-transfer interaction in these complexes involves electron-pair donation by N across the pnicogen bond, except for complexes in which X is one of the more electropositive substituents, CCH, CH3, and H. For these, lone-pair donation by P across the hydrogen bond dominates. AIM and NBO data for these complexes are consistent with their bonding characteristics, showing molecular graphs with bond critical points and charge-transfer interactions associated with hydrogen and pnicogen bonds. EOM-CCSD spin-spin coupling constants (1p)J(P-N) across the pnicogen bond for each series of complexes correlate with the P-N distance. In contrast, (2h)J(O-P) values for complexes H2XP:HNCHOH do not correlate with the O-P distance, a consequence of the nonlinearity of these hydrogen bonds.
Do dissociated or associated phoria predict the comfortable prism?
Otto, Joanna M. N.; Kromeier, Miriam; Bach, Michael
2008-01-01
Background Dissociated and associated phoria are measures of latent strabismus under artificial viewing conditions. We examined to what extent dissociated and associated phoria predict the “comfortable prism”, i.e. the prism that appears most comfortable under natural viewing conditions. Methods For associated phoria, a configuration resembling the Mallett test was employed: both eyes were presented with a fixation cross, surrounded by fusionable objects. Nonius lines served as monocular markers. For dissociated phoria, the left eye was presented with all the Mallett elements, while only a white spot was presented to the right eye. To determine the comfortable prism, all the Mallett elements, including the Nonius lines, were shown to both eyes. In each of the three tests, the observer had to adjust a pair of counterrotating prisms. To avoid any (possibly prejudiced) influence of the experimenter, the prismatic power was recorded with a potentiometer. Twenty non-strabismic subjects with a visual acuity of ≥1.0 in each eye were examined. Results The range of the intertrial mean was for dissociated phoria from +9.3 eso to −5.9 cm/m exo, for associated phoria from +11.2 eso to −3.3 cm/m exo, and for the comfortable prism from +4.8 eso to −4.1 cm/m exo (cm/m = prism dioptre). In most observers, the phoria parameters differed greatly from the comfortable prism. On average, the phoria values were shifted about 2 cm/m towards the eso direction in relation to the comfortable prism (associated phoria not less than dissociated phoria). Conclusions The deviation of both, dissociated and associated phoria, from the comfortable prism suggests that the abnormal viewing conditions under which the phoria parameters are determined induce artefacts. Accordingly, the findings cast doubt on current textbook recommendations to use dissociated or associated phoria as a basis for therapeutic prisms. Rather, patients should be allowed to determine their comfortable prism under natural viewing conditions. PMID:18379816
Performance of Prototype High-Flow Inhalable Dust Sampler in a Livestock Production Facility
Anthony, T. Renée; Cai, Changjie; Mehaffy, John; Sleeth, Darrah; Volckens, John
2017-01-01
A high-flow inhalable sampler, designed for operational flow rates up to 10 L/min using computer simulations and examined in wind tunnel experiments, was evaluated in the field. This prototype sampler was deployed in collocation with an IOM (the benchmark standard sampler) in a swine farrowing building to examine the sampling performance for assessing concentrations of inhalable particulate mass and endotoxin. Paired samplers were deployed for 24-hours on 19 days over a three-month period. On each sampling day, the paired samplers were deployed at three fixed locations and data were analyzed to identify agreement and to examine systematic biases between concentrations measured by these samplers. Thirty-six paired gravimetric samples were analyzed; insignificant, unsubstantial differences between concentrations were identified between the two samplers (p=0.16; mean difference 0.03 mg/m3). Forty-four paired samples were available for endotoxin analysis, and a significant (p=0.001) difference in endotoxin concentration was identified: the prototype sampler, on average, had 120 EU/m3 more endotoxin than did the IOM samples. Since the same gravimetric samples were analyzed for endotoxin content, the endotoxin difference is likely attributable to differences in endotoxin extraction. The prototype’s disposable thin-film polycarbonate capsule was included with the filter in the 1-hour extraction procedure while the internal plastic cassette of the IOM required a rinse procedure that is susceptible to dust losses. Endotoxin concentrations measured with standard plastic IOM inserts that follow this rinsing procedure may underestimate the true endotoxin exposure concentrations. The maximum concentrations in the study (1.55 mg/m3 gravimetric, 2328 EU/m3 endotoxin) were lower than other agricultural or industrial environments. Future work should explore the performance of the prototype sampler in dustier environments, where concentrations approach particulates not otherwise specified (PNOS) limits of 10 mg/m3, including using the prototype as a personal sampler. PMID:27792469
Kim, Yune; Kim, Nam; Chung, Youngjoo; Paek, Un-Chul; Han, Won-Taek
2004-02-23
We propose a new fiber-type all-optical switching device based on the optical nonlinearity of Yb(3+) doped fiber and a long-period fiber gratings(LPG) pair. The all-optical ON-OFF switching with the continuous wave laser signal at ~1556nm in the LPG pair including the 25.5cm long Yb(3+) doped fiber was demonstrated up to ~200Hz upon pumping with the modulated square wave pulses at 976nm, where a full optical switching with the ~18dB extinction ratio was obtained at the launched pump power of ~35mW.
THE ROLE OF THERMOHALINE MIXING IN INTERMEDIATE- AND LOW-METALLICITY GLOBULAR CLUSTERS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Angelou, George C.; Stancliffe, Richard J.; Church, Ross P.
It is now widely accepted that globular cluster red giant branch (RGB) stars owe their strange abundance patterns to a combination of pollution from progenitor stars and in situ extra mixing. In this hybrid theory a first generation of stars imprints abundance patterns into the gas from which a second generation forms. The hybrid theory suggests that extra mixing is operating in both populations and we use the variation of [C/Fe] with luminosity to examine how efficient this mixing is. We investigate the observed RGBs of M3, M13, M92, M15, and NGC 5466 as a means to test a theorymore » of thermohaline mixing. The second parameter pair M3 and M13 are of intermediate metallicity and our models are able to account for the evolution of carbon along the RGB in both clusters, although in order to fit the most carbon-depleted main-sequence stars in M13 we require a model whose initial [C/Fe] abundance leads to a carbon abundance lower than is observed. Furthermore, our results suggest that stars in M13 formed with some primary nitrogen (higher C+N+O than stars in M3). In the metal-poor regime only NGC 5466 can be tentatively explained by thermohaline mixing operating in multiple populations. We find thermohaline mixing unable to model the depletion of [C/Fe] with magnitude in M92 and M15. It appears as if extra mixing is occurring before the luminosity function bump in these clusters. To reconcile the data with the models would require first dredge-up to be deeper than found in extant models.« less
Control of myogenesis by rodent SINE-containing lncRNAs
Wang, Jiashi; Gong, Chenguang; Maquat, Lynne E.
2013-01-01
Staufen1-mediated mRNA decay (SMD) degrades mRNAs that harbor a Staufen1-binding site (SBS) in their 3′ untranslated regions (UTRs). Human SBSs can form by intermolecular base-pairing between a 3′ UTR Alu element and an Alu element within a long noncoding RNA (lncRNA) called a ½-sbsRNA. Since Alu elements are confined to primates, it was unclear how SMD occurs in rodents. Here we identify mouse mRNA 3′ UTRs and lncRNAs that contain a B1, B2, B4, or identifier (ID) element. We show that SMD occurs in mouse cells via mRNA–lncRNA base-pairing of partially complementary elements and that mouse ½-sbsRNA (m½-sbsRNA)-triggered SMD regulates C2C12 cell myogenesis. Our findings define new roles for lncRNAs as well as B and ID short interspersed elements (SINEs) in mice that undoubtedly influence many developmental and homeostatic pathways. PMID:23558772
LHC vector resonance searches in the t\\overline{t}Z final state
NASA Astrophysics Data System (ADS)
Backović, Mihailo; Flacke, Thomas; Jain, Bithika; Lee, Seung J.
2017-03-01
LHC searches for BSM resonances in l + l - , jj, t\\overline{t} , γγ and VV final states have so far not resulted in discovery of new physics. Current results set lower limits on mass scales of new physics resonances well into the O(1) TeV range, assuming that the new resonance decays dominantly to a pair of Standard Model particles. While the SM pair searches are a vital probe of possible new physics, it is important to re-examine the scope of new physics scenarios probed with such final states. Scenarios where new resonances decay dominantly to final states other than SM pairs, even though well theoretically motivated, lie beyond the scope of SM pair searches. In this paper we argue that LHC searches for (vector) resonances beyond two particle final states would be useful complementary probes of new physics scenarios. As an example, we consider a class of composite Higgs models, and identify specific model parameter points where the color singlet, electrically neutral vector resonance ρ0 decays dominantly not to a pair of SM particles, but to a fermionic top partner T f1 and a top quark, with T f1 → tZ. We show that dominant decays of ρ 0 → T f1 t in the context of Composite Higgs models are possible even when the decay channel to a pair of T f1 is kinematically open. Our analysis deals with scenarios where both m ρ and {m}_T{{}{_f}}{_1} are of O(1) TeV, leading to highly boosted t\\overline{t}Z final state topologies. We show that the particular composite Higgs scenario we consider is discoverable at the LHC13 with as little as 30 fb-1, while being allowed by other existing experimental constraints.
Heydari, Rouhollah; Elyasi, Najmeh S
2014-10-01
A novel, simple, and effective ion-pair cloud-point extraction coupled with a gradient high-performance liquid chromatography method was developed for determination of thiamine (vitamin B1 ), niacinamide (vitamin B3 ), pyridoxine (vitamin B6 ), and riboflavin (vitamin B2 ) in plasma and urine samples. The extraction and separation of vitamins were achieved based on an ion-pair formation approach between these ionizable analytes and 1-heptanesulfonic acid sodium salt as an ion-pairing agent. Influential variables on the ion-pair cloud-point extraction efficiency, such as the ion-pairing agent concentration, ionic strength, pH, volume of Triton X-100, extraction temperature, and incubation time have been fully evaluated and optimized. Water-soluble vitamins were successfully extracted by 1-heptanesulfonic acid sodium salt (0.2% w/v) as ion-pairing agent with Triton X-100 (4% w/v) as surfactant phase at 50°C for 10 min. The calibration curves showed good linearity (r(2) > 0.9916) and precision in the concentration ranges of 1-50 μg/mL for thiamine and niacinamide, 5-100 μg/mL for pyridoxine, and 0.5-20 μg/mL for riboflavin. The recoveries were in the range of 78.0-88.0% with relative standard deviations ranging from 6.2 to 8.2%. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Basic electronic properties of iron selenide under variation of structural parameters
NASA Astrophysics Data System (ADS)
Guterding, Daniel; Jeschke, Harald O.; Valentí, Roser
2017-09-01
Since the discovery of high-temperature superconductivity in the thin-film FeSe /SrTiO3 system, iron selenide and its derivates have been intensively scrutinized. Using ab initio density functional theory calculations we review the electronic structures that could be realized in iron selenide if the structural parameters could be tuned at liberty. We calculate the momentum dependence of the susceptibility and investigate the symmetry of electron pairing within the random phase approximation. Both the susceptibility and the symmetry of electron pairing depend on the structural parameters in a nontrivial way. These results are consistent with the known experimental behavior of binary iron chalcogenides and, at the same time, reveal two promising ways of tuning superconducting transition temperatures in these materials: on one hand by expanding the iron lattice of FeSe at constant iron-selenium distance and, on the other hand, by increasing the iron-selenium distance with unchanged iron lattice.
Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.
Paukku, Y; Hill, G
2011-05-12
Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.
NASA Astrophysics Data System (ADS)
Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing
2018-01-01
The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Antao, Sytle M.
2012-10-23
The crystal structure of tin (II) sulphate, SnSO{sub 4}, was obtained by Rietveld refinement using synchrotron high-resolution powder X-ray diffraction (HRPXRD) data. The structure was refined in space group Pbnm. The unit-cell parameters for SnSO{sub 4} are a = 7.12322(1), b = 8.81041(1), c = 5.32809(1) {angstrom}, and V = 334.383(1) {angstrom}{sup 3}. The average
DOE Office of Scientific and Technical Information (OSTI.GOV)
Acosta, D.; Affolder, Anthony A.; Albrow, M.G.
2005-06-01
A search for direct production of Higgs bosons in the di-tau decay mode is performed with 86.3 {+-} 3.5 pb{sup -1} of data collected with the Collider Detector at Fermilab during the 1994-1995 data taking period of the Tevatron. We search for events where one tau decays to an electron plus neutrinos and the other tau decays hadronically. We perform a counting experiment and set limits on the cross section for supersymmetric Higgs boson production where tan {beta} is large and m{sub A} is small. For a benchmark parameter space point where m{sub A{sup 0}} = 100 GeV/c{sup 2} andmore » tan {beta} = 50, we limit the production cross section multiplied by the branching ratio to be less than 77.9 pb at the 95% confidence level compared to theoretically predicted value of 11.0 pb. This is the first search for Higgs bosons decaying to tau pairs at a hadron collider.« less
Hamiltonian thermodynamics of three-dimensional dilatonic black holes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dias, Goncalo A. S.; Lemos, Jose P. S.
2008-08-15
The action for a class of three-dimensional dilaton-gravity theories with a negative cosmological constant can be recast in a Brans-Dicke type action, with its free {omega} parameter. These theories have static spherically symmetric black holes. Those with well formulated asymptotics are studied through a Hamiltonian formalism, and their thermodynamical properties are found out. The theories studied are general relativity ({omega}{yields}{infinity}), a dimensionally reduced cylindrical four-dimensional general relativity theory ({omega}=0), and a theory representing a class of theories ({omega}=-3). The Hamiltonian formalism is set up in three dimensions through foliations on the right region of the Carter-Penrose diagram, with the bifurcationmore » 1-sphere as the left boundary, and anti-de Sitter infinity as the right boundary. The metric functions on the foliated hypersurfaces are the canonical coordinates. The Hamiltonian action is written, the Hamiltonian being a sum of constraints. One finds a new action which yields an unconstrained theory with one pair of canonical coordinates (M,P{sub M}), M being the mass parameter and P{sub M} its conjugate momenta The resulting Hamiltonian is a sum of boundary terms only. A quantization of the theory is performed. The Schroedinger evolution operator is constructed, the trace is taken, and the partition function of the canonical ensemble is obtained. The black hole entropies differ, in general, from the usual quarter of the horizon area due to the dilaton.« less
NASA Astrophysics Data System (ADS)
Khalili, Behzad; Rimaz, Mehdi
2017-06-01
In this study the different class of tunable and high nitrogen content ionic liquids termed TAMATILs (Tunable Aryl Methyl Amino Tetrazolium based Ionic Liquids) were designed. The physicochemical properties of the nanostructured TAMATILs composed of para substituted phenyl methyl amino tetrazolium cations [(4-X)PMAT]+ (X = H, Me, OCH3, OH, NH2, NO2, F, CN, CHO, CF3, COMe and CO2Me) and dicyanimide anion [N(CN)2]- were fully investigated using M06-2X functional in conjunction with the 6-311++G(2d,2p) basis set. For all of the studied nanostructured ILs the structural parameters, interaction energy, cation's enthalpy of formation, natural charges, charge transfer values and topological properties were calculated and discussed. The substituent effect on the interaction energy and physicochemical properties also is taking into account. The results showed that the strength of interaction has a linear correlation with electron content of the phenyl ring in a way the substituents with electron withdrawing effects lead to make more stable ion pairs with higher interaction energies. Some of the main physical properties of ILs such as surface tension, melting point, critical-point temperature, electrochemical stability and conductivity are discussed and estimated for studying ion pairs using quantum chemical computationally obtained thermochemical data. Finally the enthalpy and Gibbs free energy of formation for twelve nanostructured individual cations with the general formula of [(4-X)PMAT]+ (X = 4-H, 4-Me, 4-OMe, 4-OH, 4-NH2, 4-NO2, 4-F, 4-CN, 4-CHO, 4-CF3, 4-COMe and 4-CO2Me) are calculated.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Chang, E-mail: chang.sun@anu.edu.au; Rougieux, Fiacre E.; Macdonald, Daniel
2014-06-07
Injection-dependent lifetime spectroscopy of both n- and p-type, Cr-doped silicon wafers with different doping levels is used to determine the defect parameters of Cr{sub i} and CrB pairs, by simultaneously fitting the measured lifetimes with the Shockley-Read-Hall model. A combined analysis of the two defects with the lifetime data measured on both n- and p-type samples enables a significant tightening of the uncertainty ranges of the parameters. The capture cross section ratios k = σ{sub n}/σ{sub p} of Cr{sub i} and CrB are determined as 3.2 (−0.6, +0) and 5.8 (−3.4, +0.6), respectively. Courtesy of a direct experimental comparison of the recombinationmore » activity of chromium in n- and p-type silicon, and as also suggested by modelling results, we conclude that chromium has a greater negative impact on carrier lifetimes in p-type silicon than n-type silicon with similar doping levels.« less
NASA Astrophysics Data System (ADS)
Bruce, Ellen E.; van der Vegt, Nico F. A.
2018-06-01
Non-polarizable force fields for hydrated ions not always accurately describe short-range ion-ion interactions, frequently leading to artificial ion clustering in bulk aqueous solutions. This can be avoided by adjusting the nonbonded anion-cation or cation-water Lennard-Jones parameters. This approach has been successfully applied to different systems, but the parameterization is demanding owing to the necessity of separate investigations of each ion pair. Alternatively, polarization effects may effectively be accounted for using the electronic continuum correction (ECC) of Leontyev et al. [J. Chem. Phys. 119, 8024 (2003)], which involves scaling the ionic charges with the inverse square-root of the water high-frequency dielectric permittivity. ECC has proven to perform well for monovalent salts as well as for divalent salts in water. Its performance, however, for multivalent salts with higher valency remains unexplored. The present work illustrates the applicability of the ECC model to trivalent K3PO4 and divalent K2HPO4 in water. We demonstrate that the ECC models, without additional tuning of force field parameters, provide an accurate description of water-mediated interactions between salt ions. This results in predictions of the osmotic coefficients of aqueous K3PO4 and K2HPO4 solutions in good agreement with experimental data. Analysis of ion pairing thermodynamics in terms of contact ion pair (CIP), solvent-separated ion pair, and double solvent-separated ion pair contributions shows that potassium-phosphate CIP formation is stronger with trivalent than with divalent phosphate ions.
Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.
Kimoto, Michiko; Hirao, Ichiro
2017-10-20
Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.
Beyond triplet: Unconventional superconductivity in a spin-3/2 topological semimetal
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Hyunsoo; Wang, Kefeng; Nakajima, Yasuyuki
In all known fermionic super fluids, Cooper pairs are composed of spin-1/2 quasi-particles that pair to form either spin-singlet or spin-triplet bound states. The "spin" of a Bloch electron, however, is xed by the symmetries of the crystal and the atomic orbitals from which it is derived, and in some cases can behave as if it were a spin-3/2 particle. The superconducting state of such a system allows pairing beyond spin-triplet, with higher spin quasi-particles combining to form quintet or even septet pairs. Here, we report evidence of unconventional superconductivity emerging from a spin-3/2 quasiparticle electronic structure in the half-Heuslermore » semimetal YPtBi, a low-carrier density noncentrosymmetric cubic material with a high symmetry that preserves the p-like j = 3/2 manifold in the Bi-based Γ 8 band in the presence of strong spin-orbit coupling. With a striking linear temperature dependence of the London penetration depth, the existence of line nodes in the superconducting order parameter Δ is directly explained by a mixed-parity Cooper pairing model with high total angular momentum, consistent with a high-spin fermionic super fluid state. We propose a k ∙ p model of the j = 3/2 fermions to explain how a dominant J=3 septet pairing state is the simplest solution that naturally produces nodes in the mixed even-odd parity gap. Together with the underlying topologically non-trivial band structure, the unconventional pairing in this system represents a truly novel form of super fluidity that has strong potential for leading the development of a new generation of topological superconductors.« less
Beyond triplet: Unconventional superconductivity in a spin-3/2 topological semimetal
Kim, Hyunsoo; Wang, Kefeng; Nakajima, Yasuyuki; ...
2018-04-06
In all known fermionic super fluids, Cooper pairs are composed of spin-1/2 quasi-particles that pair to form either spin-singlet or spin-triplet bound states. The "spin" of a Bloch electron, however, is xed by the symmetries of the crystal and the atomic orbitals from which it is derived, and in some cases can behave as if it were a spin-3/2 particle. The superconducting state of such a system allows pairing beyond spin-triplet, with higher spin quasi-particles combining to form quintet or even septet pairs. Here, we report evidence of unconventional superconductivity emerging from a spin-3/2 quasiparticle electronic structure in the half-Heuslermore » semimetal YPtBi, a low-carrier density noncentrosymmetric cubic material with a high symmetry that preserves the p-like j = 3/2 manifold in the Bi-based Γ 8 band in the presence of strong spin-orbit coupling. With a striking linear temperature dependence of the London penetration depth, the existence of line nodes in the superconducting order parameter Δ is directly explained by a mixed-parity Cooper pairing model with high total angular momentum, consistent with a high-spin fermionic super fluid state. We propose a k ∙ p model of the j = 3/2 fermions to explain how a dominant J=3 septet pairing state is the simplest solution that naturally produces nodes in the mixed even-odd parity gap. Together with the underlying topologically non-trivial band structure, the unconventional pairing in this system represents a truly novel form of super fluidity that has strong potential for leading the development of a new generation of topological superconductors.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cawkwell, Marc Jon
2016-09-09
The MC3 code is used to perform Monte Carlo simulations in the isothermal-isobaric ensemble (constant number of particles, temperature, and pressure) on molecular crystals. The molecules within the periodic simulation cell are treated as rigid bodies, alleviating the requirement for a complex interatomic potential. Intermolecular interactions are described using generic, atom-centered pair potentials whose parameterization is taken from the literature [D. E. Williams, J. Comput. Chem., 22, 1154 (2001)] and electrostatic interactions arising from atom-centered, fixed, point partial charges. The primary uses of the MC3 code are the computation of i) the temperature and pressure dependence of lattice parameters andmore » thermal expansion coefficients, ii) tensors of elastic constants and compliances via the Parrinello and Rahman’s fluctuation formula [M. Parrinello and A. Rahman, J. Chem. Phys., 76, 2662 (1982)], and iii) the investigation of polymorphic phase transformations. The MC3 code is written in Fortran90 and requires LAPACK and BLAS linear algebra libraries to be linked during compilation. Computationally expensive loops are accelerated using OpenMP.« less
Nature of superconductor-insulator transition at LaAlO{sub 3}/SrTiO{sub 3} interface
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohanta, N., E-mail: nmohanta@phy.iitkgp.ernet.in; Taraphder, A.; Centre for Theoretical Studies, Indian Institute of Technology Kharagpur, W. B. 721302
2015-05-15
The two-dimensional electron liquid, at the interface between two band insulators LaAlO{sub 3} and SrTiO{sub 3}, exhibits novel, unconventional superconductivity below 200 mK. One of the remarkable properties of the two-dimensional superconductor is its fantastic tunability by external parameters such as gate-voltage or magnetic field. We study the superconductor to insulator transition induced by gate-voltage by employing a self-consistent, mean-field Bogoliubov-de Gennes treatment based on an effective model. We show that the non-monotonic behaviour of the superconductivity with respect to gate-voltage is intrinsically due to the Rashba spin-orbit coupling. With increasing gate-voltage both the electron concentration and Rashba spin-orbit splittingmore » increases. Elevated electron filling boosts superconductivity whereas enhanced spin-orbit splitting annihilates electron-pairing. The non-monotonicity is a result of this competition. The device application of the superconductor-insulator transition in this interface is discussed.« less
Star formation history: Modeling of visual binaries
NASA Astrophysics Data System (ADS)
Gebrehiwot, Y. M.; Tessema, S. B.; Malkov, O. Yu.; Kovaleva, D. A.; Sytov, A. Yu.; Tutukov, A. V.
2018-05-01
Most stars form in binary or multiple systems. Their evolution is defined by masses of components, orbital separation and eccentricity. In order to understand star formation and evolutionary processes, it is vital to find distributions of physical parameters of binaries. We have carried out Monte Carlo simulations in which we simulate different pairing scenarios: random pairing, primary-constrained pairing, split-core pairing, and total and primary pairing in order to get distributions of binaries over physical parameters at birth. Next, for comparison with observations, we account for stellar evolution and selection effects. Brightness, radius, temperature, and other parameters of components are assigned or calculated according to approximate relations for stars in different evolutionary stages (main-sequence stars, red giants, white dwarfs, relativistic objects). Evolutionary stage is defined as a function of system age and component masses. We compare our results with the observed IMF, binarity rate, and binary mass-ratio distributions for field visual binaries to find initial distributions and pairing scenarios that produce observed distributions.
NASA Astrophysics Data System (ADS)
Sussmann, Ralf
1999-01-01
Vertical dispersion of contrails in the vortex regime is investigated by focusing on the role of entrainment and detrainment of exhaust with respect to the pair of trailing vortices. A ground-based backscatter-depolarization lidar with an integrated CCD camera provides information on optical and geometrical parameters of the contrail in the time span between 5.7 and 50.3 s behind a B747-400 aircraft. This is combined with coincident airborne in situ measurements of turbulence and the vertical profiles of temperature and wind speed in a case study. The two wingtip vortices, separated by 47 m, are descending with an increasing speed (2.5-3.1 m/s for 10.8-47.8 s behind aircraft) in the weakly non-stably-stratified atmosphere. The turbulent vertical dissipation rate on the day of the study above southern Germany is a factor of 1000 higher than found typically above oceans at cruising altitude. At 4.2 s behind the aircraft, a diffuse secondary wake starts to evolve above the two wingtip vortices. After ≈ 50 s the secondary wake encloses a cross-sectional area (4410 m2) comparable to that of the primary wake (4620 m2) and a relative ice surface area of 1:5. The observed early onset of the secondary wake is conjectured to be due to turbulent detrainment of fluid out of the primary wake which can be enhanced by detrainment due to baroclinic forces later in the vortex regime evolution. By exclusion of other mechanisms of secondary wake formation, detrainment of fluid from the primary wake is concluded to be the precondition for secondary wake formation. Detrainment due to baroclinic forces, shear or turbulence is, in general, unlikely to be absent for typical atmospheric conditions. It is suggested that the ambient humidity level may determine when a secondary wake is visible above a vortex pair and when it is not.
Park, Eonyoung; Maquat, Lynne E.
2013-01-01
Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base-pairing of 3'UTR sequences or by intermolecular base-pairing of 3'UTR sequences with a long noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Since both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1, SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. PMID:23681777
NASA Astrophysics Data System (ADS)
Oh, Semyeong; Price-Whelan, Adrian M.; Brewer, John M.; Hogg, David W.; Spergel, David N.; Myles, Justin
2018-02-01
We report and discuss the discovery of a significant difference in the chemical abundances of a comoving pair of bright solar-type stars, HD 240430 and HD 240429. The two stars have an estimated 3D separation of ≈0.6 pc (≈0.01 pc projected) at a distance of r ≈ 100 pc with nearly identical 3D velocities, as inferred from Gaia TGAS parallaxes and proper motions, and high-precision radial velocity measurements. Stellar parameters determined from high-resolution spectra obtained with the High Resolution Echelle Spectrometer (HIRES) at the Keck Observatory indicate that the two stars are ∼4 Gyr old. The more metal-rich of the two, HD 240430, shows an enhancement of refractory ({T}C> 1200 K) elements by ≈0.2 dex and a marginal enhancement of (moderately) volatile elements ({T}C< 1200 K; {{C}}, {{N}}, {{O}}, {Na}, and {Mn}). This is the largest metallicity difference found in a wide binary pair to date. Additionally, HD 240430 shows an anomalously high surface lithium abundance (A({Li})=2.75), higher than its cooler companion by 0.5 dex. The proximity in phase-space and ages between the two stars suggests that they formed together with the same composition, which is at odds with the observed differences in metallicity and abundance patterns. We therefore suggest that the star HD 240430, “Kronos,” accreted 15 {M}\\oplus of rocky material after birth, selectively enhancing the refractory elements as well as lithium in its surface and convective envelope.
NASA Astrophysics Data System (ADS)
Sagar, Elle; Mahesh, R.; Pavan Kumar, N.; Venugopal Reddy, P.
2017-11-01
Electronic band structure, ferroelectric and ferromagnetic properties of Cubic, Tetragonal and Rhombohedral (hexagonal axis) phases of multiferroic BiFeO3 compound has been investigated using first-principles calculations under the generalized gradient (GGA) and TB-mBJ semi local (Tran-Blaha modified Becke-Johnson) potential approximations using WIEN2k code. For this purpose, the total energies were calculated as a function of reduced volumes and the data were fitted to Brich Murnaghan equation. The estimated ground state parameters are found to be comparable with those of experimental ones. The semiconducting behavior of the material was obtained using TB-mBJ method in the spin polarized mode. Analysis of the density of states indicates that the valence band consists of Fe-d and O-p states, while the conduction band is composed of Fe-d and Bi-p states. The analysis of electron localization function shows that stereochemically active lone-pair electrons are present at Bi sites of Rhombohedral and Tetragonal phases and are responsible for the displacements of Bi atoms from the centro-symmetric to the non-centrosymmetric structure leading to the exhibition of ferroelectricity. Further, it has been concluded that the "lone pair" may have been formed due to the hybridization of 6s and 6p atomic orbitals with 6s2 electrons filling one of the resulting orbitals in Bi. The Polarization and the magnetic properties including susceptibility were obtained. The calculated magnetic moments at the iron sites are not integer values, since Fe electrons have a hybridization interaction with the neighboring O ions.
Lee, Soo-Ung; Park, Gab-Man; Chai, Jong-Yil
1999-01-01
In order to analyze chromosome numbers and karyotypes of intestinal trematodes belonging to the genus, Metagonimus, the gonad tissues of M. takahashii, M. miyatai, and M. yokogawai were prepared and examined. The number of bivalents in the first meiotic division of M. takahashii was nine (n=9). The diploid number of M. miyatai was observed to be eighteen (2n=18) and their chromosomes consisted of one pair of metacentric, 7 pairs of submetacentric, and one pair of telocentric chromosomes. The diploid number of M. yokogawai was thirty-two (2n=32) and the chromosome complements were composed of two pairs of metacentric, 11 pairs of submetacentric, and three pairs of subtelocentric chromosomes. These results could be a supporting evidence for the validity of the new species, M. miyatai, distinct from M. yokogawai PMID:10634039
NASA Astrophysics Data System (ADS)
Chen, X.; Abercrombie, R. E.; Pennington, C.
2017-12-01
Recorded seismic waveforms include contributions from earthquake source properties and propagation effects, leading to long-standing trade-off problems between site/path effects and source effects. With near-field recordings, the path effect is relatively small, so the trade-off problem can be simplified to between source and site effects (commonly referred as "kappa value"). This problem is especially significant for small earthquakes where the corner frequencies are within similar ranges of kappa values, so direct spectrum fitting often leads to systematic biases due to corner frequency and magnitude. In response to the significantly increased seismicity rate in Oklahoma, several local networks have been deployed following major earthquakes: the Prague, Pawnee and Fairview earthquakes. Each network provides dense observations within 20 km surrounding the fault zone, recording tens of thousands of aftershocks between M1 to M3. Using near-field recordings in the Prague area, we apply a stacking approach to separate path/site and source effects. The resulting source parameters are consistent with parameters derived from ground motion and spectral ratio methods from other studies; they exhibit spatial coherence within the fault zone for different fault patches. We apply these source parameter constraints in an analysis of kappa values for stations within 20 km of the fault zone. The resulting kappa values show significantly reduced variability compared to those from direct spectral fitting without constraints on the source spectrum; they are not biased by earthquake magnitudes. With these improvements, we plan to apply the stacking analysis to other local arrays to analyze source properties and site characteristics. For selected individual earthquakes, we will also use individual-pair empirical Green's function (EGF) analysis to validate the source parameter estimations.
Effects of Density Fluctuations on Weakly Nonlinear Alfven Waves: An IST Perspective
NASA Astrophysics Data System (ADS)
Hamilton, R.; Hadley, N.
2012-12-01
The effects of random density fluctuations on oblique, 1D, weakly nonlinear Alfven waves is examined through a numerical study of an analytical model developed by Ruderman [M.S. Ruderman, Phys. Plasmas, 9 (7), pp. 2940-2945, (2002).]. Consistent with Ruderman's application to the one-parameter dark soliton, the effects on both one-parameter bright and dark solitons, the two-parameter soliton as well as pairs of one-parameter solitons were similar to that of Ohmic dissipation found by Hamilton et al. [R. Hamilton, D. Peterson, and S. Libby, J. Geophys. Res 114, A03104,doi:10.1029/2008JA013582 (2009).] It was found in all cases where bright or two-parameter solitons are present initially, that the effects of density fluctuations results in the eventual damping of such compressive wave forms and the formation of a train of dark solitons, or magnetic depressions.
Rapid mixing with high-throughput in a semi-active semi-passive micromixer.
Kunti, Golak; Bhattacharya, Anandaroop; Chakraborty, Suman
2017-05-01
In this paper, we investigate a novel alternating current electrothermal (ACET) micromixer driven by a high efficiency ACET micropump. The micromixer consists of thin film asymmetric pairs of electrodes on the microgrooved channel floor and array of electrode pairs fabricated on the top wall. By connecting electrodes with AC voltage, ACET forces are induced. Asymmetric microgrooved electrodes force the fluids along the channel, while lateral vortex pairs are generated by symmetric electrode pairs located on the top wall. Waviness of the floor increases contact area between two confluent streams within a narrow confinement. An active mixer operates as a semi active semi passive mixer. Effects of various parameters are investigated in details in order to arrive at an optimal configuration that provides for efficient mixing as well as appreciable transport. It is found that using a specific design, uniform and homogeneous mixing quality with mixing efficiency of 97.25% and flow rate of 1.794μm2/ min per unit width of the channel can be achieved. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
McDaniel, Alex; Jeltema, Tesla; Profumo, Stefano
2018-05-01
Indirect detection of dark matter (DM) by multiwavelength astronomical observations provides a promising avenue for probing the particle nature of DM. In the case of DM consisting of weakly interacting massive particles (WIMPs), self-annihilation ultimately produces various observable products including e± pairs and gamma rays. The gamma rays can be detected directly, while the e± pairs can be detected by radio emission from synchrotron radiation or X rays and soft gamma rays from inverse Compton scattering. An intriguing region to search for astrophysical signs of DM is the Galactic center (GC) of the Milky Way, due in part to an observed excess of gamma rays that could be DM. A recent observation by the Fermi-LAT collaboration of a similar excess in the central region of the Andromeda galaxy (M31) leads us to explore the possibility of a DM-induced signal there as well. We use the RX-DMFIT tool to perform a multifrequency analysis of potential DM annihilation emissions in M31. We consider WIMP particle models consistent with the GC excess and calculate the expected emission across the electromagnetic spectrum in comparison with available observational data from M31. We find that the particle models that best fit the M31 excess favor lower masses than the GC excess. The best-fitting models are for a b b ¯ final state with Mχ=11 GeV and ⟨σ v ⟩ =2.6 ×10-26 cm3 s-1 , as well as an evenly mixed b b ¯ /τ+τ- final state with Mχ=5.8 GeV and ⟨σ v ⟩=2.03 ×10-26 cm3 s-1 . For conservative estimates of the diffusion and magnetic field models the expected radio emissions appear to be in tension with currently available data in the central region of M31, although this constraint has a fairly strong dependence on the values chosen for parameters describing the magnetic field strength and geometry.
Dirty two-band superconductivity with interband pairing order
NASA Astrophysics Data System (ADS)
Asano, Yasuhiro; Sasaki, Akihiro; Golubov, Alexander A.
2018-04-01
We study theoretically the effects of random nonmagnetic impurities on the superconducting transition temperature T c in a two-band superconductor characterized by an equal-time s-wave interband pairing order parameter. Because of the two-band degree of freedom, it is possible to define a spin-triplet s-wave pairing order parameter as well as a spin-singlet s-wave order parameter. The former belongs to odd-band-parity symmetry class, whereas the latter belongs to even-band-parity symmetry class. In a spin-singlet superconductor, T c is insensitive to the impurity concentration when we estimate the self-energy due to the random impurity potential within the Born approximation. On the other hand in a spin-triplet superconductor, T c decreases with the increase of the impurity concentration. We conclude that Cooper pairs belonging to odd-band-parity symmetry class are fragile under the random impurity potential even though they have s-wave pairing symmetry.
Two-step forecast of geomagnetic storm using coronal mass ejection and solar wind condition
Kim, R-S; Moon, Y-J; Gopalswamy, N; Park, Y-D; Kim, Y-H
2014-01-01
To forecast geomagnetic storms, we had examined initially observed parameters of coronal mass ejections (CMEs) and introduced an empirical storm forecast model in a previous study. Now we suggest a two-step forecast considering not only CME parameters observed in the solar vicinity but also solar wind conditions near Earth to improve the forecast capability. We consider the empirical solar wind criteria derived in this study (Bz ≤ −5 nT or Ey ≥ 3 mV/m for t≥ 2 h for moderate storms with minimum Dst less than −50 nT) and a Dst model developed by Temerin and Li (2002, 2006) (TL model). Using 55 CME-Dst pairs during 1997 to 2003, our solar wind criteria produce slightly better forecasts for 31 storm events (90%) than the forecasts based on the TL model (87%). However, the latter produces better forecasts for 24 nonstorm events (88%), while the former correctly forecasts only 71% of them. We then performed the two-step forecast. The results are as follows: (i) for 15 events that are incorrectly forecasted using CME parameters, 12 cases (80%) can be properly predicted based on solar wind conditions; (ii) if we forecast a storm when both CME and solar wind conditions are satisfied (∩), the critical success index becomes higher than that from the forecast using CME parameters alone, however, only 25 storm events (81%) are correctly forecasted; and (iii) if we forecast a storm when either set of these conditions is satisfied (∪), all geomagnetic storms are correctly forecasted. PMID:26213515
Two-step forecast of geomagnetic storm using coronal mass ejection and solar wind condition.
Kim, R-S; Moon, Y-J; Gopalswamy, N; Park, Y-D; Kim, Y-H
2014-04-01
To forecast geomagnetic storms, we had examined initially observed parameters of coronal mass ejections (CMEs) and introduced an empirical storm forecast model in a previous study. Now we suggest a two-step forecast considering not only CME parameters observed in the solar vicinity but also solar wind conditions near Earth to improve the forecast capability. We consider the empirical solar wind criteria derived in this study ( B z ≤ -5 nT or E y ≥ 3 mV/m for t ≥ 2 h for moderate storms with minimum Dst less than -50 nT) and a Dst model developed by Temerin and Li (2002, 2006) (TL model). Using 55 CME- Dst pairs during 1997 to 2003, our solar wind criteria produce slightly better forecasts for 31 storm events (90%) than the forecasts based on the TL model (87%). However, the latter produces better forecasts for 24 nonstorm events (88%), while the former correctly forecasts only 71% of them. We then performed the two-step forecast. The results are as follows: (i) for 15 events that are incorrectly forecasted using CME parameters, 12 cases (80%) can be properly predicted based on solar wind conditions; (ii) if we forecast a storm when both CME and solar wind conditions are satisfied (∩), the critical success index becomes higher than that from the forecast using CME parameters alone, however, only 25 storm events (81%) are correctly forecasted; and (iii) if we forecast a storm when either set of these conditions is satisfied (∪), all geomagnetic storms are correctly forecasted.
Hultgren, Sofie; Larsson, Niklas; Nilsson, Bo F; Jönsson, Jan Ake
2009-02-01
A two-phase hollow-fiber (HF) liquid-phase microextraction (LPME) method was developed for determination of a quaternary ammonium compound surfactant, dicocodimethylammonium chloride, in aqueous samples. The porous HF was fixed on a metal rod support and was impregnated with approximately 6.6 microL of organic extractant, which was immobilized in the HF pores. Surfactant extraction was facilitated by addition of carboxylic acid to the sample forming neutral ion pairs with the quaternary ammonium compound. After extraction, the analyte was transferred from the organic extractant in the fiber pores by dissolving the 1-octanol into 100 microL methanol. The methanol extract was analyzed by liquid chromatography-mass spectrometry. The method was optimized (with optimized parameters in brackets) with regard to type of organic extractant (1-octanol), fiber length (2 cm), choice and concentration of anionic carrier (600 microg L(-1) octanoate), procedure of transfer to methanol (15-min sonication), sample volume (250 mL), extraction time (17 h), pH (10), and ionic strength (50 mM carbonate). Aspects influencing repeatability in LPME of (quaternary ammonium) surfactants are discussed. The enrichment factor achieved in 250-mL carbonate buffer was around 400. Due to matrix effects, the enrichment factors achieved when industrial process water was analyzed were 120 or about 30% of that in carbonate buffer. Detection limits of 0.3 microg L(-1) in carbonate buffer and 0.9 microg L(-1) in industrial process water were obtained. If the studied compound is seen as a model substance representing quaternary dialkylated dimethylated ammonium surfactants in general, the developed method may be applied to other quaternary ammonium surfactants.
NASA Astrophysics Data System (ADS)
Tarasov, Yury I.; Kochikov, Igor V.
2018-06-01
Dynamic analysis of the molecules with large-amplitude motions (LAM) based on the pseudo-conformer approach has been successfully applied to various molecules. Floppy linear molecules present a special class of molecular structures that possess a pair of conjugate LAM coordinates but allow one-dimensional treatment. In this paper, previously developed treatment for the semirigid molecules is applied to the carbon suboxide molecule. This molecule characterized by the extremely large CCC bending has been thoroughly investigated by spectroscopic and ab initio methods. However, the earlier electron diffraction investigations were performed within a static approach, obtaining thermally averaged parameters. In this paper we apply a procedure aimed at obtaining the short list of self-consistent reference geometry parameters of a molecule, while all thermally averaged parameters are calculated based on reference geometry, relaxation dependencies and quadratic and cubic force constants. We show that such a model satisfactorily describes available electron diffraction evidence with various QC bending potential energy functions when r.m.s. CCC angle is in the interval 151 ± 2°. This leads to a self-consistent molecular model satisfying spectroscopic and GED data. The parameters for linear reference geometry have been defined as re(CO) = 1.161(2) Å and re(CC) = 1.273(2) Å.
Conditioned place preferences in humans using virtual reality.
Astur, Robert S; Carew, Andrew W; Deaton, Bonnie E
2014-07-01
To extend a standard paradigm of conditioning in nonhumans to humans, we created a virtual reality (VR) conditioned place preference task, with real-life food rewards. Undergraduates were placed into a VR environment consisting of 2 visually distinct rooms. On Day 1, participants underwent 6 pairing sessions in which they were confined into one of the two rooms and explored the VR environment. Room A was paired with real-life M&Ms for 3 sessions, and Room B was paired with no food for 3 sessions. Day 2 was the test day, administered the next day, and participants were given free access to the entire VR environment for 5min. In experiment 1, participants were food restricted, and we observed that on the test day, participants display a significant conditioned place preference for the VR room previously paired with food (p<0.001). Additionally, they display a significant explicit preference for the M&M-paired room in a forced-choice of "Which room do you like best?". In experiment 2, when participants were not food restricted, there was no evidence of a place preference, either implicitly (e.g. dwell time) or explicitly. Hence, we show that we can reliably establish a place preference in humans, but that the preference is contingent on the participants' hunger state. Future research will examine the extent to which these preferences can be blocked or extinguished as well as whether these preferences are evident using other reinforcers. Copyright © 2014 Elsevier B.V. All rights reserved.
Nute, Jessica L; Jacobsen, Megan C; Stefan, Wolfgang; Wei, Wei; Cody, Dianna D
2018-04-01
A prototype QC phantom system and analysis process were developed to characterize the spectral capabilities of a fast kV-switching dual-energy computed tomography (DECT) scanner. This work addresses the current lack of quantitative oversight for this technology, with the goal of identifying relevant scan parameters and test metrics instrumental to the development of a dual-energy quality control (DEQC). A prototype elliptical phantom (effective diameter: 35 cm) was designed with multiple material inserts for DECT imaging. Inserts included tissue equivalent and material rods (including iodine and calcium at varying concentrations). The phantom was scanned on a fast kV-switching DECT system using 16 dual-energy acquisitions (CTDIvol range: 10.3-62 mGy) with varying pitch, rotation time, and tube current. The circular head phantom (22 cm diameter) was scanned using a similar protocol (12 acquisitions; CTDIvol range: 36.7-132.6 mGy). All acquisitions were reconstructed at 50, 70, 110, and 140 keV and using a water-iodine material basis pair. The images were evaluated for iodine quantification accuracy, stability of monoenergetic reconstruction CT number, noise, and positional constancy. Variance component analysis was used to identify technique parameters that drove deviations in test metrics. Variances were compared to thresholds derived from manufacturer tolerances to determine technique parameters that had a nominally significant effect on test metrics. Iodine quantification error was largely unaffected by any of the technique parameters investigated. Monoenergetic HU stability was found to be affected by mAs, with a threshold under which spectral separation was unsuccessful, diminishing the utility of DECT imaging. Noise was found to be affected by CTDIvol in the DEQC body phantom, and CTDIvol and mA in the DEQC head phantom. Positional constancy was found to be affected by mAs in the DEQC body phantom and mA in the DEQC head phantom. A streamlined scan protocol was developed to further investigate the effects of CTDIvol and rotation time while limiting data collection to the DEQC body phantom. Further data collection will be pursued to determine baseline values and statistically based failure thresholds for the validation of long-term DECT scanner performance. © 2018 American Association of Physicists in Medicine.
NASA Astrophysics Data System (ADS)
Derras, Boumédiène; Bard, Pierre-Yves; Cotton, Fabrice
2017-09-01
The aim of this paper is to investigate the ability of various site-condition proxies (SCPs) to reduce ground-motion aleatory variability and evaluate how SCPs capture nonlinearity site effects. The SCPs used here are time-averaged shear-wave velocity in the top 30 m ( V S30), the topographical slope (slope), the fundamental resonance frequency ( f 0) and the depth beyond which V s exceeds 800 m/s ( H 800). We considered first the performance of each SCP taken alone and then the combined performance of the 6 SCP pairs [ V S30- f 0], [ V S30- H 800], [ f 0-slope], [ H 800-slope], [ V S30-slope] and [ f 0- H 800]. This analysis is performed using a neural network approach including a random effect applied on a KiK-net subset for derivation of ground-motion prediction equations setting the relationship between various ground-motion parameters such as peak ground acceleration, peak ground velocity and pseudo-spectral acceleration PSA ( T), and M w, R JB, focal depth and SCPs. While the choice of SCP is found to have almost no impact on the median ground-motion prediction, it does impact the level of aleatory uncertainty. V S30 is found to perform the best of single proxies at short periods ( T < 0.6 s), while f 0 and H 800 perform better at longer periods; considering SCP pairs leads to significant improvements, with particular emphasis on [ V S30- H 800] and [ f 0-slope] pairs. The results also indicate significant nonlinearity on the site terms for soft sites and that the most relevant loading parameter for characterising nonlinear site response is the "stiff" spectral ordinate at the considered period.[Figure not available: see fulltext.
NASA Technical Reports Server (NTRS)
Sutton, S. R.; Walker, R. M.
1986-01-01
Thermoluminescence (TL) is a promising technique for rapid screening of the large numbers of Antarctic meteorites, permitting identification of interesting specimens that can then be studied in detail by other, more definite techniques. Specifically, TL permits determination of rough terrestrial age, identification of potential paired groups and location of specimens with unusual pre-fall histories. Meteorites with long terrestrial ages are particularly valuable for studying transport and weathering mechanisms. Pairing studies are possible because TL variations among meteorites are large compared to variations within individual objects, especially for natural TL. Available TL data for several L3 fragments, three of which were paired by other techniques, are presented as an example of the use of TL parameters in pairing studies. Additional TL measurements, specifically a blind test, are recommended to satisfactorily establish the reliability of this pairing property. The TL measurements also identify fragments with unusual pre-fall histories, such an near-Sun orbits.
NASA Astrophysics Data System (ADS)
Livio, Mario; Villaver, Eva
2009-11-01
Participants; Preface Mario Livio and Eva Villaver; 1. High-mass star formation by gravitational collapse of massive cores M. R. Krumholz; 2. Observations of massive star formation N. A. Patel; 3. Massive star formation in the Galactic center D. F. Figer; 4. An X-ray tour of massive star-forming regions with Chandra L. K. Townsley; 5. Massive stars: feedback effects in the local universe M. S. Oey and C. J. Clarke; 6. The initial mass function in clusters B. G. Elmegreen; 7. Massive stars and star clusters in the Antennae galaxies B. C. Whitmore; 8. On the binarity of Eta Carinae T. R. Gull; 9. Parameters and winds of hot massive stars R. P. Kudritzki and M. A. Urbaneja; 10. Unraveling the Galaxy to find the first stars J. Tumlinson; 11. Optically observable zero-age main-sequence O stars N. R. Walborn; 12. Metallicity-dependent Wolf-Raynet winds P. A. Crowther; 13. Eruptive mass loss in very massive stars and Population III stars N. Smith; 14. From progenitor to afterlife R. A. Chevalier; 15. Pair-production supernovae: theory and observation E. Scannapieco; 16. Cosmic infrared background and Population III: an overview A. Kashlinsky.
Magma rheology from 3D geometry of martian lava flows
NASA Astrophysics Data System (ADS)
Allemand, P.; Deschamps, A.; Lesaout, M.; Delacourt, C.; Quantin, C.; Clenet, H.
2012-04-01
Volcanism is an important geologic agent which has been recently active at the surface of Mars. The composition of individual lava flows is difficult to infer from spectroscopic data because of the absence of crystallized minerals and the possible cover of the flows by dust. The 3D geometry of lava flows provides an interesting alternative to infer the chemical composition of lavas and effusion rates. Indeed, chemical composition exerts a strong control on the viscosity and yield strength of the magma and global geometry of lava flow reflects its emplacement rate. Until recently, these studies where realized from 2D data. The third dimension, which is a key parameter, was deduced or supposed from local shadow measurements on MGS Themis IR images with an uncertainty of more than 500%. Recent CTX data (MRO mission) allow to compute Digital Elevation Model at a resolution of 1 or 2 pixels (5 to 10 m) with the help of Isis and the Ames Stereo Pipeline pipe line. The CTX images are first transformed in format readable by Isis. The external geometric parameters of the CTX camera are computed and added to the image header with Isis. During a correlation phase, the homologous pixels are searched on the pair of stereo images. Finally, the DEM is computed from the position of the homologous pixels and the geometrical parameters of the CTX camera. Twenty DEM have been computed from stereo images showing lava flows of various ages on the region of Cerberus, Elyseum, Daedalia and Amazonis planitia. The 3D parameters of the lava flows have been measured on the DEMs and tested against shadows measurement. These 3D parameters have been inverted to estimate the viscosity and the yield strength of the flow. The effusion rate has also been estimated. These parameters have been compared to those of similar lava flows of the East Pacific rise.
Improving hot region prediction by parameter optimization of density clustering in PPI.
Hu, Jing; Zhang, Xiaolong
2016-11-01
This paper proposed an optimized algorithm which combines density clustering of parameter selection with feature-based classification for hot region prediction. First, all the residues are classified by SVM to remove non-hot spot residues, then density clustering of parameter selection is used to find hot regions. In the density clustering, this paper studies how to select input parameters. There are two parameters radius and density in density-based incremental clustering. We firstly fix density and enumerate radius to find a pair of parameters which leads to maximum number of clusters, and then we fix radius and enumerate density to find another pair of parameters which leads to maximum number of clusters. Experiment results show that the proposed method using both two pairs of parameters provides better prediction performance than the other method, and compare these two predictive results, the result by fixing radius and enumerating density have slightly higher prediction accuracy than that by fixing density and enumerating radius. Copyright © 2016. Published by Elsevier Inc.
Badocco, Denis; Di Marco, Valerio; Venzo, Alfonso; Frasconi, Marco; Frezzato, Diego; Pastore, Paolo
2017-10-12
The ability of aliphatic amines (AAs), namely, tripropylamine (TPrA), trisobutylamine (TisoBuA), and tributylamine (TBuA), to form ion pairs with perchlorate anion (ClO 4 - ) in biphasic aqueous/dichloromethane (CH 2 Cl 2 ) mixtures containing ClO 4 - 0.1 M has been demonstrated by GC with flame ionization (FID) and mass detectors (MS) and by NMR measurements. The extraction efficiency of the AAs to the organic phase was modeled by equations that were used to fit the experimental GC data, allowing us to determine values for K P (partition constant of the free AA), K IP (formation constant of the ion pair), and K P IP (partition constant of the ion pair) for TPrA, TisoBuA, and TBuA at 25 °C. Ion pairs were shown to form in CH 2 Cl 2 also when ClO 4 - is replaced by other inorganic anions, like NO 3 - , ClO 3 - , Cl - , H 2 PO 4 - , and IO 3 - . No ion pairs formed when CH 2 Cl 2 was replaced by n-hexane, suggesting that aliphatic amine ion pairs can form in polar organic solvents but not in nonpolar ones.
Correlations among Galaxy Properties from the Sloan Digital Sky Survey
NASA Astrophysics Data System (ADS)
Li, Zhongmu; Mao, Caiyan
2013-07-01
Galaxies are complex systems with many properties. Correlations among galaxy properties can supply important clues for studying the formation and evolution of galaxies. Using principal component analysis and least-squares fitting, this paper investigates the correlations among galactic parameters involving more properties (color, morphology, stellar population, and absolute magnitude) than previous studies. We use a volume-limited sample (whole sample) of 75,423 galaxies that was selected from the Sloan Digital Sky Survey Data Release 2 and divided into two subsamples (blue and red samples) using a critical color of (g - r) = 0.70 mag. In addition to recovering some previous results, we also obtain some new results. First, all separators for dividing galaxies into two groups can be related via good parameter-first principal component (PC1) correlations. A critical PC1 that indicates whether or not stellar age (or the evolution of a stellar population over time) is important can be used to separate galaxies. This suggests that a statistical parameter, PC1, is helpful in understanding the physical separators of galaxies. In addition, stellar age is shown to be unimportant for red galaxies, while both stellar age and mass are dominating parameters of blue galaxies. This suggests that the various numbers of dominating parameters of galaxies may result from the use of different samples. Finally, some parameters are shown to be correlated, and quantitative fits for a few correlations are obtained, e.g., log(t) = 8.57 + 1.65 (g - r) for the age (log t) and color (g - r) of blue galaxies and log (M *) = 4.31 - 0.30 M r for the stellar mass (log M *) and absolute magnitude (M r) of red galaxies. The median relationships between various parameter pairs are also presented for comparison.
Magnetic field exposure and behavioral monitoring system.
Thomas, A W; Drost, D J; Prato, F S
2001-09-01
To maximize the availability and usefulness of a small magnetic field exposure laboratory, we designed a magnetic field exposure system that has been used to test human subjects, caged or confined animals, and cell cultures. The magnetic field exposure system consists of three orthogonal pairs of coils 2 m square x 1 m separation, 1.751 m x 0.875 m separation, and 1.5 m x 0.75 m separation. Each coil consisted of ten turns of insulated 8 gauge stranded copper conductor. Each of the pairs were driven by a constant-current amplifier via digital to analog (D/A) converter. A 9 pole zero-gain active Bessel low-pass filter (1 kHz corner frequency) before the amplifier input attenuated the expected high frequencies generated by the D/A conversion. The magnetic field was monitored with a 3D fluxgate magnetometer (0-3 kHz, +/- 1 mT) through an analog to digital converter. Behavioral monitoring utilized two monochrome video cameras (viewing the coil center vertically and horizontally), both of which could be video recorded and real-time digitally Moving Picture Experts Group (MPEG) encoded to CD-ROM. Human postural sway (standing balance) was monitored with a 3D forceplate mounted on the floor, connected to an analog to digital converter. Lighting was provided by 12 offset overhead dimmable fluorescent track lights and monitored using a digitally connected spectroradiometer. The dc resistance, inductance of each coil pair connected in series were 1.5 m coil (0.27 Omega, 1.2 mH), 1.75 m coil (0.32 Omega, 1.4 mH), and 2 m coil (0.38 Omega, 1.6 mH). The frequency response of the 1.5 m coil set was 500 Hz at +/- 463 microT, 1 kHz at +/- 232 microT, 150 micros rise time from -200 microT(pk) to + 200 microT(pk) (square wave) and is limited by the maximum voltage ( +/- 146 V) of the amplifier (Bessel filter bypassed). Copyright 2001 Wiley-Liss, Inc.
NASA Astrophysics Data System (ADS)
Lefebvre, Eric; Helleur, Christopher; Kashyap, Nathan
2008-03-01
Maritime surveillance of coastal regions requires operational staff to integrate a large amount of information from a variety of military and civilian sources. The diverse nature of the information sources makes complete automation difficult. The volume of vessels tracked and the number of sources makes it difficult for the limited operation centre staff to fuse all the information manually within a reasonable timeframe. In this paper, a conceptual decision space is proposed to provide a framework for automating the process of operators integrating the sources needed to maintain Maritime Domain Awareness. The decision space contains all potential pairs of ship tracks that are candidates for fusion. The location of the candidate pairs in this defined space depends on the value of the parameters used to make a decision. In the application presented, three independent parameters are used: the source detection efficiency, the geo-feasibility, and the track quality. One of three decisions is applied to each candidate track pair based on these three parameters: 1. to accept the fusion, in which case tracks are fused in one track, 2. to reject the fusion, in which case the candidate track pair is removed from the list of potential fusion, and 3. to defer the fusion, in which case no fusion occurs but the candidate track pair remains in the list of potential fusion until sufficient information is provided. This paper demonstrates in an operational setting how a proposed conceptual space is used to optimize the different thresholds for automatic fusion decision while minimizing the list of unresolved cases when the decision is left to the operator.
Mercer, Kelly E; Wynne, Rebecca A; Lazarenko, Oxana P; Lumpkin, Charles K; Hogue, William R; Suva, Larry J; Chen, Jin-Ran; Mason, Andrew Z; Badger, Thomas M; Ronis, Martin J J
2012-11-01
Chronic alcohol abuse results in decreased bone mineral density (BMD), which can lead to increased fracture risk. In contrast, low levels of alcohol have been associated with increased BMD in epidemiological studies. Alcohol's toxic skeletal effects have been suggested to involve impaired vitamin D/calcium homeostasis. Therefore, dietary vitamin D supplementation may be beneficial in reducing bone loss associated with chronic alcohol consumption. Six-week-old female C57BL/6J mice were pair-fed ethanol (EtOH)-containing liquid diets (10 or 36% total calories) for 78 days. EtOH exposure at 10% calories had no effects on any measured bone or serum parameter. EtOH consumption at 36% of calories reduced BMD and bone strength (P<0.05), decreased osteoblastogenesis, increased osteoclastogenesis, suppressed 1,25-hydroxyvitamin D3 [1,25(OH)2D3] serum concentrations (P<0.05), and increased apoptosis in bone cells compared with pair-fed controls. In a second study, female mice were pair-fed 30% EtOH diets with or without dietary supplementation with vitamin D3 (cholecalciferol; VitD) for 40 days. VitD supplementation in the EtOH diet protected against cortical bone loss, normalized alcohol-induced hypocalcaemia, and suppressed EtOH-induced expression of receptor of nuclear factor-κB ligand mRNA in bone. In vitro, pretreatment of 1,25(OH)2D3 in osteoblastic cells inhibited EtOH-induced apoptosis. In EtOH/VitD mice circulating 1,25(OH)2D3 was lower compared with mice receiving EtOH alone (P<0.05), suggesting increased sensitivity to feedback control of VitD metabolism in the kidney. These findings suggest dietary VitD supplementation may prevent skeletal toxicity in chronic drinkers by normalizing calcium homeostasis, preventing apoptosis, and suppressing EtOH-induced increases in bone resorption.
OPTIMASS: A package for the minimization of kinematic mass functions with constraints
Cho, Won Sang; Gainer, James S.; Kim, Doojin; ...
2016-01-07
Reconstructed mass variables, such as M 2, M 2C, M* T, and M T2 W, play an essential role in searches for new physics at hadron colliders. The calculation of these variables generally involves constrained minimization in a large parameter space, which is numerically challenging. We provide a C++ code, Optimass, which interfaces with the Minuit library to perform this constrained minimization using the Augmented Lagrangian Method. The code can be applied to arbitrarily general event topologies, thus allowing the user to significantly extend the existing set of kinematic variables. Here, we describe this code, explain its physics motivation, andmore » demonstrate its use in the analysis of the fully leptonic decay of pair-produced top quarks using M 2 variables.« less
Mogo, S; Cachorro, V E; de Frutos, A; Rodrigues, A
2012-12-01
A field campaign was conducted from October 2009 to July 2010 at Covilhã, a small town located in the region of Beira Interior (Portugal) in the interior of the Iberian Peninsula. The ambient light-absorption coefficient, σ(a) (522 nm), obtained from a Particle Soot Absorption Photometer (PSAP), presented a daily mean value of 12.1 Mm⁻¹ (StD = 7.3 Mm⁻¹). The wavelength dependence of aerosol light absorption is investigated through the Ångström parameter, α(a). The α(a) values for the pair of wavelengths 470-660 nm ranged from 0.86 to 1.47 during the period of measurements. The PSAP data were used to infer the mass of light absorbing carbon (LAC) and the daily mean varied from 0.1 to 6.8 μg m⁻³. A detailed study of special events with different aerosol characteristics is carried out and, to support data interpretation, air masses trajectory analysis is performed.
NASA Astrophysics Data System (ADS)
Taniguchi, Daisuke; Matsunaga, Noriyuki; Kobayashi, Naoto; Fukue, Kei; Hamano, Satoshi; Ikeda, Yuji; Kawakita, Hideyo; Kondo, Sohei; Sameshima, Hiroaki; Yasui, Chikako
2018-02-01
The effective temperature, one of the most fundamental atmospheric parameters of a star, can be estimated using various methods; here, we focus on a method using line-depth ratios (LDRs). This method combines low- and high-excitation lines and makes use of relations between LDRs of these line pairs and the effective temperature. It has an advantage, for example, of being minimally affected by interstellar reddening, which changes stellar colours. We report 81 relations between LDRs and effective temperature established with high-resolution, λ/Δλ ∼ 28 000, spectra of nine G- to M-type giants in the Y and J bands. Our analysis gives the first comprehensive set of LDR relations for this wavelength range. The combination of all these relations can be used to determine the effective temperatures of stars that have 3700 < Teff < 5400 K and -0.5 < [Fe/H] < +0.3 dex, to a precision of ±10 K in the best cases.
Sanborn, B.; Song, B.; Nishida, E.
2017-11-02
In order to understand interfacial interaction of a bi-material during an impact loading event, the dynamic friction coefficient is one of the key parameters that must be characterized and quantified. In this study, a new experimental method to determine the dynamic friction coefficient between two metals was developed by using a Kolsky tension bar and a custom-designed friction fixture. Polyvinylidene fluoride (PVDF) force sensors were used to measure the normal force applied to the friction tribo pairs and the friction force was measured with conventional Kolsky tension bar method. To evaluate the technique, the dynamic friction coefficient between 4340 steelmore » and 7075-T6 aluminum was investigated at an impact speed of approximately 8 m/s. Additionally, the dynamic friction coefficient of the tribo pairs with varied surface roughness was also investigated. The data suggest that higher surface roughness leads to higher friction coefficients at the same speed of 8 m/s.« less
Scacchetti, Priscilla Cardim; Pansonato-Alves, José Carlos; Utsunomia, Ricardo; Oliveira, Claudio; Foresti, Fausto
2011-01-01
Abstract Conventional (Giemsa, C-Banding, Ag-NORs, CMA3) and molecular (5S rDNA, 18S rDNA, telomeric sequences) cytogenetic studies were carried out in specimens of ten distinct fish populations of the genus Gymnotus (Gymnotus sylvius Albert and Fernandes-Matioli, 1999, Gymnotus inaequilabiatus Valenciennes, 1839, Gymnotus pantherinus Steindachner, 1908, and G. cf. carapo Linnaeus, 1758) from different Brazilian hydrographic basins. Gymnotus sylvius presented a diploid number of 40 chromosomes (22m+12sm+6st), Gymnotus pantherinus presented 52 chromosomes (32m+18sm+2st), while Gymnotus inaequilabiatus (42m+10sm+2a)and Gymnotus cf. carapo (38m+12sm+4st) presented 54 chromosomes. The C-banding technique revealed centromeric marks in all chromosomes of all species. Besides that, conspicuous blocks of heterochromatin were found interstitially on the chromosomes of Gymnotus inaequilabiatus, Gymnotus cf. carapo,and Gymnotus pantherinus. All four species showed single nucleolus organizing regions confirmed by results obtained through Ag-NORs and FISH experiments using 18S rDNA probes, which showed the NORs localized on the first chromosome pair in Gymnotus inaequilabiatus, Gymnotus cf. carapo,and Gymnotus pantherinus, and on pair 2 in Gymnotus sylvius. CMA3 staining revealed additional unrelated NORs marks in Gymnotus sylvius and Gymnotus pantherinus. The 5S rDNA probes revealed signals on one pair in Gymnotus sylvius and two pairs in Gymnotus pantherinus; Gymnotus inaequilabiatus had about seventeen pairs marked, and Gymnotus cf. carapo had about fifteen pairs marked. It is considered that the high amount of heterochromatin identified in the chromosomes of Gymnotus inaequilabiatus and Gymnotus cf. carapo could have facilitated the dispersion of 5S rDNA in these species. Interstitial signals were detected on the first metacentric pair of Gymnotus sylvius by telomeric probes (TTAGGG)n indicating the possible occurrence of chromosomal fusions in this species. The present study reveals valuable cytotaxonomic markers for this group and allows a more precise evaluation of the processes involved in the karyotype differentiation and the interrelationships among different species of the genus Gymnotus. PMID:24260631
Imanishi, K.; Takeo, M.; Ellsworth, W.L.; Ito, H.; Matsuzawa, T.; Kuwahara, Y.; Iio, Y.; Horiuchi, S.; Ohmi, S.
2004-01-01
We use an inversion method based on stopping phases (Imanishi and Takeo, 2002) to estimate the source dimension, ellipticity, and rupture velocity of microearthquakes and investigate the scaling relationships between source parameters. We studied 25 earthquakes, ranging in size from M 1.3 to M 2.7, that occurred between May and August 1999 at the western Nagano prefecture, Japan, which is characterized by a high rate of shallow earthquakes. The data consist of seismograms recorded in an 800-m borehole and at 46 surface and 2 shallow borehole seismic stations whose spacing is a few kilometers. These data were recorded with a sampling frequency of 10 kHz. In particular, the 800-m-borehole data provide a wide frequency bandwidth with greatly reduced ground noise and coda wave amplitudes compared with surface recordings. High-frequency stopping phases appear in the body waves in Hilbert transform pairs and are readily detected on seismograms recorded in the 800-m borehole. After correcting both borehole and surface data for attenuation, we also measure the rise time, which is defined as the interval from the arrival time of the direct wave to the timing of the maximum amplitude in the displacement pulse. The differential time of the stopping phases and the rise times were used to obtain source parameters. We found that several microearthquakes propagated unilaterally, suggesting that all microearthquakes cannot be modeled as a simple circular crack model. Static stress drops range from approximately 0.1 to 2 MPa and do not vary with seismic moment. It seems that the breakdown in stress drop scaling seen in previous studies using surface data is simply an artifact of attenuation in the crust. The average value of rupture velocity does not depend on earthquake size and is similar to those reported for moderate and large earthquakes. It is likely that earthquakes are self-similar over a wide range of earthquake size and that the dynamics of small and large earthquakes are similar.
Deuchars, J; West, D C; Thomson, A M
1994-01-01
1. Double intracellular recordings were made from 1163 pairs of pyramidal neurones in layer V-VI of the rat somatomotor cortex in vitro using sharp electrodes filled with biocytin. Monosynaptically connected pairs of cells were identified when an action potential in one could elicit a constant latency excitatory postsynaptic potential (EPSP) in the other and the cells were filled with biocytin. Labelled cells were subsequently identified histologically with avidin-horseradish peroxidase. 2. Thirty-four pairs of cells were found to be monosynaptically connected. Fifteen of these pairs were sufficiently stable for electrophysiological recordings and three of these were recovered sufficiently to permit full morphological reconstruction. 3. The EPSP recorded between the first pair of pyramids varied in amplitude between 0 and 3 mV (mean 1.33 +/- 1.06 mV) and fluctuated considerably (coefficient of variation, 0.796). This was largely due to a high incidence of apparent failures of transmission. On reconstruction two boutons from the presynaptic pyramid axon were in close apposition to the proximal portions of basal dendrites of the postsynaptic cell. 4. In the second pair of pyramids the EPSP had a mean amplitude of 1.06 mV, and displayed a 10-90% rise time of 2.8 ms and a width at half-amplitude of 23 ms. This EPSP did not alter significantly with changes in membrane potential at the soma. The presynaptic axon closely apposed the distal apical dendrite of the postsynaptic cell in eight places. 5. In the third pair of pyramids, the EPSPs, recorded at a relatively depolarized membrane potential, were long lasting and could elicit slow dendritic spikes with long and variable latencies. These slow spikes suggested that the postsynaptic recording site was dendritic and on reconstruction a possible location was identified on the apical dendrite. A total of five presynaptic boutons closely apposed three separate, proximal branches of the postsynaptic apical dendrite. 6. These results provide the first illustration of a morphological basis for variations in functional properties of pyramid-pyramid connections in the neocortex. Images Figure 1 Figure 3 Figure 5 PMID:7965856
Atiyah classes and dg-Lie algebroids for matched pairs
NASA Astrophysics Data System (ADS)
Batakidis, Panagiotis; Voglaire, Yannick
2018-01-01
For every Lie pair (L , A) of algebroids we construct a dg-manifold structure on the Z-graded manifold M = L [ 1 ] ⊕ L / A such that the inclusion ι : A [ 1 ] → M and the projection p : M → L [ 1 ] are morphisms of dg-manifolds. The vertical tangent bundle Tp M then inherits a structure of dg-Lie algebroid over M. When the Lie pair comes from a matched pair of Lie algebroids, we show that the inclusion ι induces a quasi-isomorphism that sends the Atiyah class of this dg-Lie algebroid to the Atiyah class of the Lie pair. We also show how (Atiyah classes of) Lie pairs and dg-Lie algebroids give rise to (Atiyah classes of) dDG-algebras.
NASA Astrophysics Data System (ADS)
Hou, Zhishuai; Wen, Haishen; Li, Jifang; He, Feng; Liu, Qun; Wang, Jinhuan; Guan, Biao; Wang, Qinglong
2017-01-01
The primary goal of this study was to assess the effect of varying densities on serum reproductive parameters of immature rainbow trout Oncorhynchus mykiss. Experimental trout were maintained in intensive, pen-reared farms for 300 days in fresh water reservoirs. Initial densities were 4.6, 6.6, and 8.6 kg/m3 (40, 60, 80 ind./m3), indicated as SD1, SD2, SD3, and final densities were 31.1, 40.6, 49.3 kg/m3, respectively. A summary of the ovarian stages were observed by histological examination. Serum E2 (estradiol), T (testosterone) were evaluated by radioimmunoassay and FSH (follicle-stimulating-hormone), LH (luteinizing-hormone), vitellogenin, 17α,20β-P (17α,20βdihydroxy4-pregnen-3-one) were measured by enzyme-linked immunosorbent assay. Our findings demonstrated that ovarian development were retarded (from stage III to stage IV) at highest rearing density (SD3) after 180 days of intensive culture (over 40.6 kg/m3). In addition, we observed an inverse relationship between serum reproductive parameters and rearing density. Furthermore, compared to serum reproductive parameters of SD1, E2, T, FSH, vitellogenin, 17α,20β-P, GSI and LH of two higher density groups decreased firstly and significantly at 60 (over 15.9 kg/m 3 ), 180 (over 31.7 kg/m 3 ), 180 (over 40.6 kg/m3), 240 (over 36 kg/m3), 240 (over 36 kg/m3), 240 (over 45 kg/m3) and 300 (over 49.3 kg/m3) days, respectively. Comparing serum reproductive parameters within the same ovarian development stage of rainbow trout from varying densities revealed that higher population density also led to significantly lower overall serum reproductive parameters. Overall, this study presents the reproductive, endocrinological parameters of juvenile female rainbow trout at high rearing densities and indicates the need for rainbow trout (114.44±5.21 g, 19.69±0.31 cm) that are initially stocked at 6.6 or 8.6 kg/m3 should be classified and subdivided into lower density after 180 days of farming (not over 31.7 kg/m3).
Stringent Nucleotide Recognition by the Ribosome at the Middle Codon Position.
Liu, Wei; Shin, Dongwon; Ng, Martin; Sanbonmatsu, Karissa Y; Tor, Yitzhak; Cooperman, Barry S
2017-08-29
Accurate translation of the genetic code depends on mRNA:tRNA codon:anticodon base pairing. Here we exploit an emissive, isosteric adenosine surrogate that allows direct measurement of the kinetics of codon:anticodon University of California base formation during protein synthesis. Our results suggest that codon:anticodon base pairing is subject to tighter constraints at the middle position than at the 5'- and 3'-positions, and further suggest a sequential mechanism of formation of the three base pairs in the codon:anticodon helix.
Quality assessment of MEG-to-MRI coregistrations
NASA Astrophysics Data System (ADS)
Sonntag, Hermann; Haueisen, Jens; Maess, Burkhard
2018-04-01
For high precision in source reconstruction of magnetoencephalography (MEG) or electroencephalography data, high accuracy of the coregistration of sources and sensors is mandatory. Usually, the source space is derived from magnetic resonance imaging (MRI). In most cases, however, no quality assessment is reported for sensor-to-MRI coregistrations. If any, typically root mean squares (RMS) of point residuals are provided. It has been shown, however, that RMS of residuals do not correlate with coregistration errors. We suggest using target registration error (TRE) as criterion for the quality of sensor-to-MRI coregistrations. TRE measures the effect of uncertainty in coregistrations at all points of interest. In total, 5544 data sets with sensor-to-head and 128 head-to-MRI coregistrations, from a single MEG laboratory, were analyzed. An adaptive Metropolis algorithm was used to estimate the optimal coregistration and to sample the coregistration parameters (rotation and translation). We found an average TRE between 1.3 and 2.3 mm at the head surface. Further, we observed a mean absolute difference in coregistration parameters between the Metropolis and iterative closest point algorithm of (1.9 +/- 15){\\hspace{0pt}}\\circ and (1.1 +/- 9) m. A paired sample t-test indicated a significant improvement in goal function minimization by using the Metropolis algorithm. The sampled parameters allowed computation of TRE on the entire grid of the MRI volume. Hence, we recommend the Metropolis algorithm for head-to-MRI coregistrations.
PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3′ UTRs and coding sequences
Šulc, Miroslav; Marín, Ray M.; Robins, Harlan S.; Vaníček, Jiří
2015-01-01
The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3′ untranslated regions (3′ UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3′ UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA–mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA–mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. PMID:25948580
Mapping interactions between the RNA chaperone FinO and its RNA targets
Arthur, David C.; Tsutakawa, Susan; Tainer, John A.; Frost, Laura S.; Glover, J. N. Mark
2011-01-01
Bacterial conjugation is regulated by two-component repression comprising the antisense RNA FinP, and its protein co-factor FinO. FinO mediates base-pairing of FinP to the 5′-untranslated region (UTR) of traJ mRNA, which leads to translational inhibition of the transcriptional activator TraJ and subsequent down regulation of conjugation genes. Yet, little is known about how FinO binds to its RNA targets or how this interaction facilitates FinP and traJ mRNA pairing. Here, we use solution methods to determine how FinO binds specifically to its minimal high affinity target, FinP stem–loop II (SLII), and its complement SLIIc from traJ mRNA. Ribonuclease footprinting reveals that FinO contacts the base of the stem and the 3′ single-stranded tails of these RNAs. The phosphorylation or oxidation of the 3′-nucleotide blocks FinO binding, suggesting FinO binds the 3′-hydroxyl of its RNA targets. The collective results allow the generation of an energy-minimized model of the FinO–SLII complex, consistent with small-angle X-ray scattering data. The repression complex model was constrained using previously reported cross-linking data and newly developed footprinting results. Together, these data lead us to propose a model of how FinO mediates FinP/traJ mRNA pairing to down regulate bacterial conjugation. PMID:21278162
Sidey, Vasyl
2008-08-01
Applicability of the Wang-Liebau polyhedron eccentricity parameter in the bond-valence model [Wang & Liebau (2007). Acta Cryst. B63, 216-228] has been found to be doubtful: the correlations between the values of the polyhedron eccentricity parameters and the bond-valence sums calculated for the cations with one lone electron pair are probably an artifact of the poorly determined bond-valence parameters.
3D scanning electron microscopy applied to surface characterization of fluorosed dental enamel.
Limandri, Silvina; Galván Josa, Víctor; Valentinuzzi, María Cecilia; Chena, María Emilia; Castellano, Gustavo
2016-05-01
The enamel surfaces of fluorotic teeth were studied by scanning electron stereomicroscopy. Different whitening treatments were applied to 25 pieces to remove stains caused by fluorosis and their surfaces were characterized by stereomicroscopy in order to obtain functional and amplitude parameters. The topographic features resulting for each treatment were determined through these parameters. The results obtained show that the 3D reconstruction achieved from the SEM stereo pairs is a valuable potential alternative for the surface characterization of this kind of samples. Copyright © 2016 Elsevier Ltd. All rights reserved.
Petrenko, Y M
2015-01-01
Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.
Model of electron pairs in electron-doped cuprates
NASA Astrophysics Data System (ADS)
Singh, R. J.; Khan, Shakeel
2016-07-01
In the order parameter of hole-doped cuprate superconductors in the pseudogap phase, two holes enter the order parameter from opposite sides and pass through various CuO2 cells jumping from one O2- to the other under the influence of magnetic field offered by the Cu2+ ions in that CuO2 cell and thus forming hole pairs. In the pseudogap phase of electron-doped cuprates, two electrons enter the order parameter at Cu2+ sites from opposite ends and pass from one Cu2+ site to the diagonally opposite Cu2+ site. Following this type of path, they are subjected to high magnetic fields from various Cu2+ ions in that cell. They do not travel from one Cu2+ site to the other along straight path but by helical path. As they pass through the diagonal, they face high to low to very high magnetic field. Therefore, frequency of helical motion and pitch goes on changing with the magnetic field. Just before reaching the Cu2+ ions at the exit points of all the cells, the pitch of the helical motion is enormously decreased and thus charge density at these sites is increased. So the velocity of electrons along the diagonal path is decreased. Consequently, transition temperature of electron-doped cuprates becomes less than that of hole-doped cuprates. Symmetry of the order parameter of the electron-doped cuprates has been found to be of 3dx2-y2 + iS type. It has been inferred that internal magnetic field inside the order parameter reconstructs the Fermi surface, which is requisite for superconductivity to take place. Electron pairs formed in the pseudogap phase are the precursors of superconducting order parameter when cooled below Tc.
Paired termini stabilize antisense RNAs and enhance conditional gene silencing in Escherichia coli
Nakashima, Nobutaka; Tamura, Tomohiro; Good, Liam
2006-01-01
Reliable methods for conditional gene silencing in bacteria have been elusive. To improve silencing by expressed antisense RNAs (asRNAs), we systematically altered several design parameters and targeted multiple reporter and essential genes in Escherichia coli. A paired termini (PT) design, where flanking inverted repeats create paired dsRNA termini, proved effective. PTasRNAs targeted against the ackA gene within the acetate kinase-phosphotransacetylase operon (ackA-pta) triggered target mRNA decay and a 78% reduction in AckA activity with high genetic penetrance. PTasRNAs are abundant and stable and function through an RNase III independent mechanism that requires a large stoichiometric excess of asRNA. Conditional ackA silencing reduced carbon flux to acetate and increased heterologous gene expression. The PT design also improved silencing of the essential fabI gene. Full anti-fabI PTasRNA induction prevented growth and partial induction sensitized cells to a FabI inhibitor. PTasRNAs have potential for functional genomics, antimicrobial discovery and metabolic flux control. PMID:17062631
Paired termini stabilize antisense RNAs and enhance conditional gene silencing in Escherichia coli.
Nakashima, Nobutaka; Tamura, Tomohiro; Good, Liam
2006-01-01
Reliable methods for conditional gene silencing in bacteria have been elusive. To improve silencing by expressed antisense RNAs (asRNAs), we systematically altered several design parameters and targeted multiple reporter and essential genes in Escherichia coli. A paired termini (PT) design, where flanking inverted repeats create paired dsRNA termini, proved effective. PTasRNAs targeted against the ackA gene within the acetate kinase-phosphotransacetylase operon (ackA-pta) triggered target mRNA decay and a 78% reduction in AckA activity with high genetic penetrance. PTasRNAs are abundant and stable and function through an RNase III independent mechanism that requires a large stoichiometric excess of asRNA. Conditional ackA silencing reduced carbon flux to acetate and increased heterologous gene expression. The PT design also improved silencing of the essential fabI gene. Full anti-fabI PTasRNA induction prevented growth and partial induction sensitized cells to a FabI inhibitor. PTasRNAs have potential for functional genomics, antimicrobial discovery and metabolic flux control.
Park, Eonyoung; Maquat, Lynne E
2013-01-01
Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'-UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base pairing of 3'-UTR sequences or by intermolecular base pairing of 3'-UTR sequences with a long-noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Because both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1; SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. Copyright © 2013 John Wiley & Sons, Ltd.
Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.
Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P
1997-05-16
The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.
Saxion cosmology for thermalized gravitino dark matter
Co, Raymond T.; D’Eramo, Francesco; Hall, Lawrence J.; ...
2017-07-26
In all supersymmetric theories, gravitinos, with mass suppressed by the Planck scale, are an obvious candidate for dark matter; but if gravitinos ever reached thermal equilibrium, such dark matter is apparently either too abundant or too hot, and is excluded. However, in theories with an axion, a saxion condensate is generated during an early era of cosmological history and its late decay dilutes dark matter. We show that such dilution allows previously thermalized gravitinos to account for the observed dark matter over very wide ranges of gravitino mass, keV < m 3/2 < TeV, axion decay constant, 10 9 GeVmore » < f a < 10 16 GeV, and saxion mass, 10 MeV < m s < 100 TeV. Constraints on this parameter space are studied from BBN, supersymmetry breaking, gravitino and axino production from freeze-in and saxion decay, and from axion production from both misalignment and parametric resonance mechanisms. Large allowed regions of (m 3/2, f a, m s) remain, but differ for DFSZ and KSVZ theories. Superpartner production at colliders may lead to events with displaced vertices and kinks, and may contain saxions decaying to (WW, ZZ, hh), gg, γγ or a pair of Standard Model fermions. In conclusion, freeze-in may lead to a sub-dominant warm component of gravitino dark matter, and saxion decay to axions may lead to dark radiation.« less
Saxion cosmology for thermalized gravitino dark matter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Co, Raymond T.; D’Eramo, Francesco; Hall, Lawrence J.
In all supersymmetric theories, gravitinos, with mass suppressed by the Planck scale, are an obvious candidate for dark matter; but if gravitinos ever reached thermal equilibrium, such dark matter is apparently either too abundant or too hot, and is excluded. However, in theories with an axion, a saxion condensate is generated during an early era of cosmological history and its late decay dilutes dark matter. We show that such dilution allows previously thermalized gravitinos to account for the observed dark matter over very wide ranges of gravitino mass, keV < m 3/2 < TeV, axion decay constant, 10 9 GeVmore » < f a < 10 16 GeV, and saxion mass, 10 MeV < m s < 100 TeV. Constraints on this parameter space are studied from BBN, supersymmetry breaking, gravitino and axino production from freeze-in and saxion decay, and from axion production from both misalignment and parametric resonance mechanisms. Large allowed regions of (m 3/2, f a, m s) remain, but differ for DFSZ and KSVZ theories. Superpartner production at colliders may lead to events with displaced vertices and kinks, and may contain saxions decaying to (WW, ZZ, hh), gg, γγ or a pair of Standard Model fermions. In conclusion, freeze-in may lead to a sub-dominant warm component of gravitino dark matter, and saxion decay to axions may lead to dark radiation.« less
Popov, Alexey A; Dunsch, Lothar
2007-09-26
Extensive semiempirical calculations of the hexaanions of IPR (isolated pentagon rule) and non-IPR isomers of C(68)-C(88) and IPR isomers of C(90)-C(98) followed by DFT calculations of the lowest energy structures were performed to find the carbon cages that can provide the most stable isomers of M(3)N@C(2n) clusterfullerenes (M = Sc, Y) with Y as a model for rare earth ions. DFT calculations of isomers of M(3)N@C(2n) (M = Sc, Y; 2n = 68-98) based on the most stable C(2n)(6-) cages were also performed. The lowest energy isomers found by this methodology for Sc(3)N@C(68), Sc(3)N@C(78), Sc(3)N@C(80), Y(3)N@C(78), Y(3)N@C(80), Y(3)N@C(84), Y(3)N@C(86), and Y(3)N@C(88) are those that have been shown to exist by single-crystal X-ray studies as Sc(3)N@C(2n) (2n = 68, 78, 80), Dy(3)N@C(80), and Tb(3)N@C(2n) (2n = 80, 84, 86, 88) clusterfullerenes. Reassignment of the carbon cage of Sc(2)@C(76) to the non-IPR Cs: 17490 isomer is also proposed. The stability of nitride clusterfullerenes was found to correlate well with the stability of the empty 6-fold charged cages. However, the dimensions of the cage in terms of its ability to encapsulate M(3)N clusters were also found to be an important factor, especially for the medium size cages and the large Y(3)N cluster. In some cases the most stable structures are based on the different cage isomers for Sc(3)N and Y(3)N clusters. Up to the cage size of C(84), non-IPR isomers of C(2n)(6-) and M(3)N@C(2n) were found to compete with or to be even more stable than IPR isomers. However, the number of adjacent pentagon pairs in the most stable non-IPR isomers decreases as cage size increases: the most stable M(3)N@C(2n) isomers have three such pairs for 2n = 68-72, two pairs for n = 74-80, and only one pair for n = 82, 84. For C(86) and C(88) the lowest energy IPR isomers are much more stable than any non-IPR isomer. The trends in the stability of the fullerene isomers and the cluster-cage binding energies are discussed, and general rules for stability of clusterfullerenes are established. Finally, the high yield of M(3)N@C(80) (Ih) clusterfullerenes for any metal is explained by the exceptional stability of the C(80)(6-) (Ih: 31924) cage, rationalized by the optimum distribution of the pentagons leading to the minimization of the steric strain, and structural similarities of C(80) (Ih: 31924) with the lowest energy non-IPR isomers of C(760(6-), C(78)(6-), C(82)(6-), and C(84)(6-) pointed out.
3DNALandscapes: a database for exploring the conformational features of DNA.
Zheng, Guohui; Colasanti, Andrew V; Lu, Xiang-Jun; Olson, Wilma K
2010-01-01
3DNALandscapes, located at: http://3DNAscapes.rutgers.edu, is a new database for exploring the conformational features of DNA. In contrast to most structural databases, which archive the Cartesian coordinates and/or derived parameters and images for individual structures, 3DNALandscapes enables searches of conformational information across multiple structures. The database contains a wide variety of structural parameters and molecular images, computed with the 3DNA software package and known to be useful for characterizing and understanding the sequence-dependent spatial arrangements of the DNA sugar-phosphate backbone, sugar-base side groups, base pairs, base-pair steps, groove structure, etc. The data comprise all DNA-containing structures--both free and bound to proteins, drugs and other ligands--currently available in the Protein Data Bank. The web interface allows the user to link, report, plot and analyze this information from numerous perspectives and thereby gain insight into DNA conformation, deformability and interactions in different sequence and structural contexts. The data accumulated from known, well-resolved DNA structures can serve as useful benchmarks for the analysis and simulation of new structures. The collective data can also help to understand how DNA deforms in response to proteins and other molecules and undergoes conformational rearrangements.
Oluwajoba, Solakunmi O; Akinyosoye, Felix A; Oyetayo, Olusegun V
2013-01-01
This study evaluated the sensory properties, proximate composition, and overall consumer acceptability of kunu-zaki using germinated and ungerminated Sorghum bicolor (sorghum), Pennisetum americanum (millet), and Digitaria exilis (acha) cereal grains. The three cereal grains were used in nongerminated and germinated composite and noncomposite proportions coded A (Acha), S (Sorghum), M (Millet), AS (Acha–Sorghum), AM (Acha–Millet), SM (Sorghum–Millet), ASG (Acha–Sorghum Germinated), AMG (Acha–Millet Germinated), and SMG (Sorghum–Millet Germinated). Proximate analysis determined the moisture content, ash, crude fiber, fat, and crude protein content of the fermented grains. The 9-point hedonic scale was used to judge the sensory parameters of taste, color, and aroma. The paired comparison test was used to judge consumer preference between kunu-zaki made from germinated grains and the ungerminated counterpart. Scores were statistically analyzed using the Kruskal–Wallis test in the SPSS analytical software package. Panelists ranked the ASG-coded drink highest in terms of taste and aroma, the AMG-coded drink highest in terms of color. SM ranked least in terms of taste; SMG ranked least in terms of aroma; and AM ranked the least in terms of color. Preference for each parameter was significantly different (P < 0.001). Panelists ranked overall preference for the drinks from the most liked to the least liked in the order ASG>AMG>A>AS>S>M>SMG>AM>SM. The overall preference for the drinks was also significantly different (P < 0.001). Panelists pairing both ungerminated drinks with the germinated drinks ranked the ungerminated drink AS as most preferred in terms of taste, color, and aroma above its germinated counterpart ASG with preference not significantly dependent on the parameters (P = 0.065 > 0.05). Ungerminated AM was also preferred above the germinated counterpart AMG in terms of taste, color, and aroma with preference not significantly dependent on parameters (P = 0.055 > 0.05). However, panelists showed preference for the taste and aroma of the germinated drink SMG but more preference for the color of the ungerminated drink SM with preference significantly dependent on the parameters (P = 0.028 < 0.05). Crude fiber values were higher – 11.3%, 13.1%, and 17.37% for SMG, AMG and ASG, respectively. Germination increased %Fat values slightly but the %Ash was relatively stable in both germinated and ungerminated drinks. Addition of germinated acha cereal grains to either sorghum or millet prior to fermentation offers desirable sensory and nutritional quality attributes in kunu-zaki. PMID:24804038
Oluwajoba, Solakunmi O; Akinyosoye, Felix A; Oyetayo, Olusegun V
2013-07-01
This study evaluated the sensory properties, proximate composition, and overall consumer acceptability of kunu-zaki using germinated and ungerminated Sorghum bicolor (sorghum), Pennisetum americanum (millet), and Digitaria exilis (acha) cereal grains. The three cereal grains were used in nongerminated and germinated composite and noncomposite proportions coded A (Acha), S (Sorghum), M (Millet), AS (Acha-Sorghum), AM (Acha-Millet), SM (Sorghum-Millet), ASG (Acha-Sorghum Germinated), AMG (Acha-Millet Germinated), and SMG (Sorghum-Millet Germinated). Proximate analysis determined the moisture content, ash, crude fiber, fat, and crude protein content of the fermented grains. The 9-point hedonic scale was used to judge the sensory parameters of taste, color, and aroma. The paired comparison test was used to judge consumer preference between kunu-zaki made from germinated grains and the ungerminated counterpart. Scores were statistically analyzed using the Kruskal-Wallis test in the SPSS analytical software package. Panelists ranked the ASG-coded drink highest in terms of taste and aroma, the AMG-coded drink highest in terms of color. SM ranked least in terms of taste; SMG ranked least in terms of aroma; and AM ranked the least in terms of color. Preference for each parameter was significantly different (P < 0.001). Panelists ranked overall preference for the drinks from the most liked to the least liked in the order ASG>AMG>A>AS>S>M>SMG>AM>SM. The overall preference for the drinks was also significantly different (P < 0.001). Panelists pairing both ungerminated drinks with the germinated drinks ranked the ungerminated drink AS as most preferred in terms of taste, color, and aroma above its germinated counterpart ASG with preference not significantly dependent on the parameters (P = 0.065 > 0.05). Ungerminated AM was also preferred above the germinated counterpart AMG in terms of taste, color, and aroma with preference not significantly dependent on parameters (P = 0.055 > 0.05). However, panelists showed preference for the taste and aroma of the germinated drink SMG but more preference for the color of the ungerminated drink SM with preference significantly dependent on the parameters (P = 0.028 < 0.05). Crude fiber values were higher - 11.3%, 13.1%, and 17.37% for SMG, AMG and ASG, respectively. Germination increased %Fat values slightly but the %Ash was relatively stable in both germinated and ungerminated drinks. Addition of germinated acha cereal grains to either sorghum or millet prior to fermentation offers desirable sensory and nutritional quality attributes in kunu-zaki.
1989-10-30
assembled pair is tumble lapped. Tumble lapping is a process in which Mechanically, the 1.5-inch diameter rotors a a weighted lapping element and slurry of...parameter met AGTF requirements at that site. Weighting factors were than assigned to each parameter as an indication of importance of the parameter to...AGTF. The weighted score was determined by multiplying the score by the weighting factor. The weighted scores were then totaled for each site to
VizieR Online Data Catalog: SLoWPoKES-II catalog (Dhital+, 2015)
NASA Astrophysics Data System (ADS)
Dhital, S.; West, A. A.; Stassun, K. G.; Schluns, K. J.; Massey, A. P.
2015-11-01
We have identified the Sloan Low-mass Wide Pairs of Kinematically Equivalent Systems (SLoWPoKES)-II catalog of 105537 wide, low-mass binaries without using proper motions. We extend the SLoWPoKES catalog (Paper I; Dhital et al. 2010, cat. J/AJ/139/2566) by identifying binary systems with angular separations of 1-20'' based entirely on SDSS photometry and astrometry. As in Paper I, we used the Catalog Archive Server query tool (CasJobs6; http://skyserver.sdss3.org/CasJobs/) to select the sample of low-mass stars from the SDSS-DR8 star table as having r-i>=0.3 and i-z>=0.2, consistent with spectral types of K5 or later. Following Paper I (Dhital et al. 2010, cat. J/AJ/139/2566) we classified candidate pairs with a probability of chance alignment Pf{<=}0.05 as real binaries. We note that this limit does not have any physical motivation but was chosen to minimize the number of spurious pairs. This cut results in 105537 M dwarf (dM)+MS (see Table3), 78 white dwarf (WD)+dM (see Table5), and 184 sdM+sdM (see Table6) binary systems with separations of 1-20''. Of the dM+MS binaries, 44 are very low-mass (VLM) binary candidates (see Table4), with colors redder than the median M7 dwarf for both components. This represents a significant increase over the SLoWPoKES catalog of 1342 common proper motion (CPM) binaries that we presented in Paper I (Dhital et al. 2010, cat. J/AJ/139/2566). The SLoWPoKES and SLoWPoKES-II catalogs are available on the Filtergraph portal (http://slowpokes.vanderbilt.edu/). (4 data files).
BCS to BEC evolution for mixtures of fermions with unequal masses
NASA Astrophysics Data System (ADS)
de Melo, Carlos A. R. Sa
2009-03-01
I discuss the zero and finite temperature phase diagrams of a mixture of fermions with unequal masses with and without population imbalance, which may correspond for example to mixtures of ^6Li and ^40K, ^6Li and ^87Sr, or ^40K and ^87Sr in the context of ultracold atoms. At zero temperature and when excess fermions are present, at least three phases may occur as the interaction parameter is changed from the BCS to the BEC regime. These phases correspond to normal, phase separation, or superfluid with coexistence between paired and excess fermions. The zero temperature phase diagram of population imbalance versus interaction parameter presents a remarkable asymmetry between the cases involving excess lighter or heavier fermions [1, 2], in sharp contrast with the symmetric phase diagram corresponding to the case of equal masses. At finite temperatures, the phase separation region of the phase diagram competes with superfluid regions possessing gapless elementary excitations [3] for certain ranges of the interaction parameter depending on the mass ratio. Furthermore, a phase transition may take place between two superfluid phases which are topologically distinct. The precise location of such transition is sensitive to the mass ratio between the two species of fermions. Signatures of this possible topological transition are present in the momentum distribution or structure factor, which may be measured experimentally in time-of-flight or through Bragg scattering, respectively. Lastly, throughout the evolution from BCS to BEC, I discuss the critical current and sound velocity for unequal mass systems as a function of interaction parameter and mass ratio. These quantities may also be measured via the same techniques already used in mixtures of fermions with equal masses. [1] M. Iskin, and C. A. R. Sa de Melo, Phys. Rev. Lett. 97, 100404 (2006). [2] M. Iskin and C. A. R. Sa de Melo, Phys. Rev. A 76, 013601 (2007). [3] Li Han, and C. A. R. Sa de Melo, arXiv:0812.xxxx
Direct search for charged higgs bosons in decays of top quarks.
Abazov, V M; Abbott, B; Abdesselam, A; Abolins, M; Abramov, V; Acharya, B S; Adams, D L; Adams, M; Ahmed, S N; Alexeev, G D; Alves, G A; Amos, N; Anderson, E W; Baarmand, M M; Babintsev, V V; Babukhadia, L; Bacon, T C; Baden, A; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begel, M; Belyaev, A; Beri, S B; Bernardi, G; Bertram, I; Besson, A; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Bhattacharjee, M; Blazey, G; Blessing, S; Boehnlein, A; Bojko, N I; Borcherding, F; Bos, K; Brandt, A; Breedon, R; Briskin, G; Brock, R; Brooijmans, G; Bross, A; Buchholz, D; Buehler, M; Buescher, V; Burtovoi, V S; Butler, J M; Canelli, F; Carvalho, W; Casey, D; Casilum, Z; Castilla-Valdez, H; Chakraborty, D; Chan, K M; Chekulaev, S V; Cho, D K; Choi, S; Chopra, S; Christenson, J H; Chung, M; Claes, D; Clark, A R; Cochran, J; Coney, L; Connolly, B; Cooper, W E; Coppage, D; Cummings, M A C; Cutts, D; Davis, G A; Davis, K; De, K; de Jong, S J; Del Signore, K; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Di Loreto, G; Doulas, S; Draper, P; Ducros, Y; Dudko, L V; Duensing, S; Duflot, L; Dugad, S R; Dyshkant, A; Edmunds, D; Ellison, J; Elvira, V D; Engelmann, R; Eno, S; Eppley, G; Ermolov, P; Eroshin, O V; Estrada, J; Evans, H; Evdokimov, V N; Fahland, T; Feher, S; Fein, D; Ferbel, T; Filthaut, F; Fisk, H E; Fisyak, Y; Flattum, E; Fleuret, F; Fortner, M; Frame, K C; Fuess, S; Gallas, E; Galyaev, A N; Gao, M; Gavrilov, V; Genik, R J; Genser, K; Gerber, C E; Gershtein, Y; Gilmartin, R; Ginther, G; Gómez, B; Gómez, G; Goncharov, P I; González Solís, J L; Gordon, H; Goss, L T; Gounder, K; Goussiou, A; Graf, N; Graham, G; Grannis, P D; Green, J A; Greenlee, H; Grinstein, S; Groer, L; Grünendahl, S; Gupta, A; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Hadley, N J; Haggerty, H; Hagopian, S; Hagopian, V; Hall, R E; Hanlet, P; Hansen, S; Hauptman, J M; Hays, C; Hebert, C; Hedin, D; Heinson, A P; Heintz, U; Heuring, T; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Huang, Y; Illingworth, R; Ito, A S; Jaffré, M; Jain, S; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jones, M; Jöstlein, H; Juste, A; Kahn, S; Kajfasz, E; Kalinin, A M; Karmanov, D; Karmgard, D; Kehoe, R; Kharchilava, A; Kim, S K; Klima, B; Knuteson, B; Ko, W; Kohli, J M; Kostritskiy, A V; Kotcher, J; Kotwal, A V; Kozelov, A V; Kozlovsky, E A; Krane, J; Krishnaswamy, M R; Krivkova, P; Krzywdzinski, S; Kubantsev, M; Kuleshov, S; Kulik, Y; Kunori, S; Kupco, A; Kuznetsov, V E; Landsberg, G; Leflat, A; Leggett, C; Lehner, F; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipton, R; Lucotte, A; Lueking, L; Lundstedt, C; Luo, C; Maciel, A K A; Madaras, R J; Malyshev, V L; Manankov, V; Mao, H S; Marshall, T; Martin, M I; Martin, R D; Mauritz, K M; May, B; Mayorov, A A; McCarthy, R; McDonald, J; McMahon, T; Melanson, H L; Merkin, M; Merritt, K W; Miao, C; Miettinen, H; Mihalcea, D; Mishra, C S; Mokhov, N; Mondal, N K; Montgomery, H E; Moore, R W; Mostafa, M; da Motta, H; Nagy, E; Nang, F; Narain, M; Narasimham, V S; Neal, H A; Negret, J P; Negroni, S; Nunnemann, T; O'Neil, D; Oguri, V; Olivier, B; Oshima, N; Padley, P; Pan, L J; Papageorgiou, K; Para, A; Parashar, N; Partridge, R; Parua, N; Paterno, M; Patwa, A; Pawlik, B; Perkins, J; Peters, M; Peters, O; Pétroff, P; Piegaia, R; Piekarz, H; Pope, B G; Popkov, E; Prosper, H B; Protopopescu, S; Qian, J; Raja, R; Rajagopalan, S; Ramberg, E; Rapidis, P A; Reay, N W; Reucroft, S; Rha, J; Ridel, M; Rijssenbeek, M; Rockwell, T; Roco, M; Rubinov, P; Ruchti, R; Rutherfoord, J; Sabirov, B M; Santoro, A; Sawyer, L; Schamberger, R D; Schellman, H; Schwartzman, A; Sen, N; Shabalina, E; Shivpuri, R K; Shpakov, D; Shupe, M; Sidwell, R A; Simak, V; Singh, H; Singh, J B; Sirotenko, V; Slattery, P; Smith, E; Smith, R P; Snihur, R; Snow, G R; Snow, J; Snyder, S; Solomon, J; Sorín, V; Sosebee, M; Sotnikova, N; Soustruznik, K; Souza, M; Stanton, N R; Steinbrück, G; Stephens, R W; Stichelbaut, F; Stoker, D; Stolin, V; Stoyanova, D A; Strauss, M; Strovink, M; Stutte, L; Sznajder, A; Taylor, W; Tentindo-Repond, S; Tripathi, S M; Trippe, T G; Turcot, A S; Tuts, P M; van Gemmeren, P; Vaniev, V; Van Kooten, R; Varelas, N; Vertogradov, L S; Volkov, A A; Vorobiev, A P; Wahl, H D; Wang, H; Wang, Z-M; Warchol, J; Watts, G; Wayne, M; Weerts, H; White, A; White, J T; Whiteson, D; Wightman, J A; Wijngaarden, D A; Willis, S; Wimpenny, S J; Womersley, J; Wood, D R; Yamada, R; Yamin, P; Yasuda, T; Yatsunenko, Y A; Yip, K; Youssef, S; Yu, J; Yu, Z; Zanabria, M; Zheng, H; Zhou, Z; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G; Zylberstejn, A
2002-04-15
We present a search for charged Higgs bosons in decays of pair-produced top quarks in pp collisions at sqrt[s] = 1.8 TeV recorded by the D0 detector at the Fermilab Tevatron collider. With no evidence for signal, we exclude most regions of the ( M(H+/-),tan(beta)) parameter space where the decay t--> H(+)b has a branching fraction >0.36 and B(H+/--->tau(nu)(tau)) is large.
NASA Technical Reports Server (NTRS)
Zdziarski, Andrzej A.; Coppi, Paolo S.
1991-01-01
In the present study of the formation of steep soft X-ray excesses that are superposed on flatter, hard X-ray power-law spectra in nonthermal electron-positron pair cascade sources, the soft excess in pair-cascade AGN models appears as a steep power law superposed on the tail of the UV bump and the flat nonthermal (hard X-ray) power law. The model-parameter space in which an excess in soft X-rays is visible is ascertained, and the time-variability of soft excesses in pair cascade models is examined. It is established that the parameter space in which soft excesses appear encompasses the range of preferred input parameters for a recently development Compton reflection model of UV and X-ray emission from the central engine of an AGN.
Gaing, Byron; Sigmund, Eric E; Huang, William C; Babb, James S; Parikh, Nainesh S; Stoffel, David; Chandarana, Hersh
2015-03-01
The aim of this study was to determine if voxel-based histogram analysis of intravoxel incoherent motion imaging (IVIM) parameters can differentiate various subtypes of renal tumors, including benign and malignant lesions. A total of 44 patients with renal tumors who underwent surgery and had histopathology available were included in this Health Insurance Portability and Accountability Act-compliant, institutional review board-approved, single-institution prospective study. In addition to routine renal magnetic resonance imaging examination performed on a 1.5-T system, all patients were imaged with axial diffusion-weighted imaging using 8 b values (range, 0-800 s/mm). A biexponential model was fitted to the diffusion signal data using a segmented algorithm to extract the IVIM parameters perfusion fraction (fp), tissue diffusivity (Dt), and pseudodiffusivity (Dp) for each voxel. Mean and histogram measures of heterogeneity (standard deviation, skewness, and kurtosis) of IVIM parameters were correlated with pathology results of tumor subtype using unequal variance t tests to compare subtypes in terms of each measure. Correction for multiple comparisons was accomplished using the Tukey honestly significant difference procedure. A total of 44 renal tumors including 23 clear cell (ccRCC), 4 papillary (pRCC), 5 chromophobe, and 5 cystic renal cell carcinomas, as well as benign lesions, 4 oncocytomas (Onc) and 3 angiomyolipomas (AMLs), were included in our analysis. Mean IVIM parameters fp and Dt differentiated 8 of 15 pairs of renal tumors. Histogram analysis of IVIM parameters differentiated 9 of 15 subtype pairs. One subtype pair (ccRCC vs pRCC) was differentiated by mean analysis but not by histogram analysis. However, 2 other subtype pairs (AML vs Onc and ccRCC vs Onc) were differentiated by histogram distribution parameters exclusively. The standard deviation of Dt [σ(Dt)] differentiated ccRCC (0.362 ± 0.136 × 10 mm/s) from AML (0.199 ± 0.043 × 10 mm/s) (P = 0.002). Kurtosis of fp separated Onc (2.767 ± 1.299) from AML (-0.325 ± 0.279; P = 0.001), ccRCC (0.612 ± 1.139; P = 0.042), and pRCC (0.308 ± 0.730; P = 0.025). Intravoxel incoherent motion imaging parameters with inclusion of histogram measures of heterogeneity can help differentiate malignant from benign lesions as well as various subtypes of renal cancers.
The Evolution and Physical Parameters of WN3/O3s: A New Type of Wolf-Rayet Star
NASA Astrophysics Data System (ADS)
Neugent, Kathryn F.; Massey, Philip; Hillier, D. John; Morrell, Nidia
2017-05-01
As part of a search for Wolf-Rayet (WR) stars in the Magellanic Clouds, we have discovered a new type of WR star in the Large Magellanic Cloud (LMC). These stars have both strong emission lines, as well as He II and Balmer absorption lines and spectroscopically resemble a WN3 and O3V binary pair. However, they are visually too faint to be WN3+O3V binary systems. We have found nine of these WN3/O3s, making up ˜6% of the population of LMC WRs. Using cmfgen, we have successfully modeled their spectra as single stars and have compared the physical parameters with those of more typical LMC WNs. Their temperatures are around 100,000 K, a bit hotter than the majority of WN stars (by around 10,000 K), though a few hotter WNs are known. The abundances are what you would expect for CNO equilibrium. However, most anomalous are their mass-loss rates, which are more like that of an O-type star than a WN star. While their evolutionary status is uncertain, their low mass-loss rates and wind velocities suggest that they are not products of homogeneous evolution. It is possible instead that these stars represent an intermediate stage between O stars and WNs. Since WN3/O3 stars are unknown in the Milky Way, we suspect that their formation depends upon metallicity, and we are investigating this further by a deep survey in M33, which possesses a metallicity gradient. This paper includes data gathered with the 6.5 m Magellan Telescopes located at Las Campanas Observatory, Chile. It is additionally based on observations made with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555. These observations were associated with program GO-13780.
NASA Astrophysics Data System (ADS)
Prabhu, David; Mehanna, Emile; Gargesha, Madhusudhana; Wen, Di; Brandt, Eric; van Ditzhuijzen, Nienke S.; Chamie, Daniel; Yamamoto, Hirosada; Fujino, Yusuke; Farmazilian, Ali; Patel, Jaymin; Costa, Marco; Bezerra, Hiram G.; Wilson, David L.
2016-03-01
High resolution, 100 frames/sec intravascular optical coherence tomography (IVOCT) can distinguish plaque types, but further validation is needed, especially for automated plaque characterization. We developed experimental and 3D registration methods, to provide validation of IVOCT pullback volumes using microscopic, brightfield and fluorescent cryoimage volumes, with optional, exactly registered cryo-histology. The innovation was a method to match an IVOCT pullback images, acquired in the catheter reference frame, to a true 3D cryo-image volume. Briefly, an 11-parameter, polynomial virtual catheter was initialized within the cryo-image volume, and perpendicular images were extracted, mimicking IVOCT image acquisition. Virtual catheter parameters were optimized to maximize cryo and IVOCT lumen overlap. Local minima were possible, but when we started within reasonable ranges, every one of 24 digital phantom cases converged to a good solution with a registration error of only +1.34+/-2.65μm (signed distance). Registration was applied to 10 ex-vivo cadaver coronary arteries (LADs), resulting in 10 registered cryo and IVOCT volumes yielding a total of 421 registered 2D-image pairs. Image overlays demonstrated high continuity between vascular and plaque features. Bland- Altman analysis comparing cryo and IVOCT lumen area, showed mean and standard deviation of differences as 0.01+/-0.43 mm2. DICE coefficients were 0.91+/-0.04. Finally, visual assessment on 20 representative cases with easily identifiable features suggested registration accuracy within one frame of IVOCT (+/-200μm), eliminating significant misinterpretations introduced by 1mm errors in the literature. The method will provide 3D data for training of IVOCT plaque algorithms and can be used for validation of other intravascular imaging modalities.
Effects of molecular elongation on liquid crystalline phase behaviour: isotropic-nematic transition
NASA Astrophysics Data System (ADS)
Singh, Ram Chandra; Ram, Jokhan
2003-08-01
We present the density-functional approach to study the isotropic-nematic transitions and calculate the values of freezing parameters of the Gay-Berne liquid crystal model, concentrating on the effects of varying the molecular elongation, x0. For this, we have solved the Percus-Yevick integral equation theory to calculate the pair-correlation functions of a fluid the molecules of which interact via a Gay-Berne pair potential. These results have been used in the density-functional theory as an input to locate the isotropic-nematic transition and calculate freezing parameters for a range of length-to-width parameters 3.0⩽ x0⩽4.0 at reduced temperatures 0.95 and 1.25. We observed that as x0 is increased, the isotropic-nematic transition is seen to move to lower density at a given temperature. We find that the density-functional theory is good to study the freezing transitions in such fluids. We have also compared our results with computer simulation results wherever they are available.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brason, J G
1977-05-01
Inclusive muon pair production by 225 GeV/c ..pi../sup +/, ..pi../sup -/ and proton beams incident upon carbon and tin targets was measured over a large range of kinematic variables (2m/sub ..mu../ < m/sub ..mu mu.. < 1 GeV/c/sup 2/, 0 < x/sub F/ < 1, P/sub perpendicular to/ < 4 GeV/c and vertical bar cos theta* vertical bar < .3). The value of the invariant cross section E d/sup 4/sigma/dmdx/sub f/dp/sup 2//sub perpendicular to/ is presented as a function of these variables. The vector mesons rho, ..omega.., phi, J and psi' appear in the data along with apparently nonresonant ..mu..-pairs.more » By looking for additional muons accompanying J ..-->.. ..mu../sup +/..mu../sup -/ events, a 1.0% upper limit on production of pairs of charmed particles in association with the J is obtained. Aspects of the continuum muon pair data are compared to Drell-Yan model calculations. The ratio of ..mu..-pairs produced by ..pi../sup +/ beam particles to ..mu..-pairs produced by ..pi../sup -/ beam particles supports electromagnetic production at high mass.« less
The effectiveness of propolis on gingivitis: a randomized controlled trial.
Bretz, Walter A; Paulino, Niraldo; Nör, Jacques E; Moreira, Alexandre
2014-12-01
A randomized, double-blind, controlled clinical trial was conducted to evaluate the effectiveness of a propolis rinse on induced gingivitis by using the co-twin study design. Twenty-one twin pairs (n=42) were enrolled in a gingivitis study with oral hygiene promotion (14 days) and gingivitis induction (21 days). During the gingivitis induction phase, one member of the twin pair was randomly assigned to a 2% typified propolis rinse, and the other was assigned a color-matched 0.05% sodium fluoride plus 0.05% cetylpyridinium chloride rinse (positive control). Patients rinsed twice daily with 20 mL for 30 seconds for 21 days. Gingivitis was measured on days -14 (baseline), 0 (after hygiene phase), and 21 (after no-hygiene phase) by using the Papillary Bleeding Score (PBS) and by standard digital imaging of the gum tissues (G-parameter). The 38 persons who completed the study (age 13-22 years) were well balanced according to PBS at baseline and G-parameter after the initial hygiene phase. After 21 days without oral hygiene, the propolis rinse and positive control rinse groups did not differ significantly for average PBS measurements or G-parameter. Use of a 2% typified propolis rinse was equivalent to a positive control rinse during a 21-day no-hygiene period.
Radial Velocities of 41 Kepler Eclipsing Binaries
NASA Astrophysics Data System (ADS)
Matson, Rachel A.; Gies, Douglas R.; Guo, Zhao; Williams, Stephen J.
2017-12-01
Eclipsing binaries are vital for directly determining stellar parameters without reliance on models or scaling relations. Spectroscopically derived parameters of detached and semi-detached binaries allow us to determine component masses that can inform theories of stellar and binary evolution. Here we present moderate resolution ground-based spectra of stars in close binary systems with and without (detected) tertiary companions observed by NASA’s Kepler mission and analyzed for eclipse timing variations. We obtain radial velocities and spectroscopic orbits for five single-lined and 35 double-lined systems, and confirm one false positive eclipsing binary. For the double-lined spectroscopic binaries, we also determine individual component masses and examine the mass ratio {M}2/{M}1 distribution, which is dominated by binaries with like-mass pairs and semi-detached classical Algol systems that have undergone mass transfer. Finally, we constrain the mass of the tertiary component for five double-lined binaries with previously detected companions.
NASA Astrophysics Data System (ADS)
Ni, Fang; Nakatsukasa, Takashi
2018-04-01
To describe quantal collective phenomena, it is useful to requantize the time-dependent mean-field dynamics. We study the time-dependent Hartree-Fock-Bogoliubov (TDHFB) theory for the two-level pairing Hamiltonian, and compare results of different quantization methods. The one constructing microscopic wave functions, using the TDHFB trajectories fulfilling the Einstein-Brillouin-Keller quantization condition, turns out to be the most accurate. The method is based on the stationary-phase approximation to the path integral. We also examine the performance of the collective model which assumes that the pairing gap parameter is the collective coordinate. The applicability of the collective model is limited for the nuclear pairing with a small number of single-particle levels, because the pairing gap parameter represents only a half of the pairing collective space.
NASA Astrophysics Data System (ADS)
Frandsen, Benjamin A.
Mott insulators are materials in which strong correlations among the electrons induce an unconventional insulating state. Rich interplay between the structural, magnetic, and electronic degrees of freedom resulting from the electron correlation can lead to unusual complexity of Mott materials on the atomic scale, such as microscopically heterogeneous phases or local structural correlations that deviate significantly from the average structure. Such behavior must be studied by suitable experimental techniques, i.e. "local probes", that are sensitive to this local behavior rather than just the bulk, average properties. In this thesis, I will present results from our studies of multiple families of Mott insulators using two such local probes: muon spin relaxation (muSR), a probe of local magnetism; and pair distribution function (PDF) analysis of x-ray and neutron total scattering, a probe of local atomic structure. In addition, I will present the development of magnetic pair distribution function analysis, a novel method for studying local magnetic correlations that is highly complementary to the muSR and atomic PDF techniques. We used muSR to study the phase transition from Mott insulator to metal in two archetypal Mott insulating systems: RENiO3 (RE = rare earth element) and V2O3. In both of these systems, the Mott insulating state can be suppressed by tuning a nonthermal parameter, resulting in a "quantum" phase transition at zero temperature from the Mott insulating state to a metallic state. In RENiO3, this occurs through variation of the rare-earth element in the chemical composition; in V 2O3, through the application of hydrostatic pressure. Our results show that the metallic and Mott insulating states unexpectedly coexist in phase-separated regions across a large portion of parameter space near the Mott quantum phase transition and that the magnitude of the ordered antiferromagnetic moment remains constant across the phase diagram until it is abruptly destroyed at the quantum phase transition. Taken together, these findings point unambiguously to a first-order quantum phase transition in these systems. We also conducted x-ray and neutron PDF experiments, which suggest that the distinct atomic structures associated with the insulating and metallic phases similarly coexist near the quantum phase transition. These results have significant implications for our understanding of the Mott metal-insulator quantum phase transition in real materials. The second part of this thesis centers on the derivation and development of the magnetic pair distribution function (mPDF) technique and its application to the antiferromagnetic Mott insulator MnO. The atomic PDF method involves Fourier transforming the x-ray or neutron total scattering intensity from reciprocal space into real space to directly reveal the local atomic correlations in a material, which may deviate significantly from the average crystallographic structure of that material. Likewise, the mPDF method involves Fourier transforming the magnetic neutron total scattering intensity to probe the local correlations of magnetic moments in the material, which may exist on short length scales even when the material has no long-range magnetic order. After deriving the fundamental mPDF equations and providing a proof-of-principle by recovering the known magnetic structure of antiferromagnetic MnO, we used this technique to investigate the short-range magnetic correlations that persist well into the paramagnetic phase of MnO. By combining the mPDF measurements with ab initio calculations of the spin-spin correlation function in paramagnetic MnO, we were able to quantitatively account for the observed mPDF. We also used the mPDF data to evaluate competing ab initio theories, thereby resolving some longstanding questions about the magnetic exchange interactions in MnO.
Lost Chevalier Pairs - A Followup
2012-01-01
included only if they have been corrected in some manner. As a part of this check, new matches against 2MASS ( Cutrie et aL 2003) were made to the L...against 2MASS which instead found random faint pairs which agreed within search parameters. : In checking Berko’s matches, it was noticed that...CHE 1 000851.85+ 141505.7 11.0 13.2 1910.90 39.2 3.7 Che1910 00199+2633 CHE4 001956.81+263340.8 12.8 14.1 1998.02 204.0 4.16 2MASS 00204+2617 CHE6
Barnard, G F; Staniunas, R J; Mori, M; Puder, M; Jessup, M J; Steele, G D; Chen, L B
1993-09-01
The levels of a number of ribosomal protein mRNAs are reported to be increased in human colon cancer. We have assessed whether selected ribosomal protein mRNAs are overexpressed in other gastrointestinal malignancies, namely gastric and hepatocellular carcinomas. Subtracted complementary DNA libraries were generated from paired samples of human (a) colorectal carcinoma minus adjacent normal colonic mucosa and (b) hepatocellular carcinoma minus adjacent normal liver. Screening of approximately 3% of these library clones determined that ribosomal protein mRNAs encoding L18 and L37 (not previously reported) and P0 and S6 were overexpressed in one or the other library. Their complementary DNA inserts were then used as probes to evaluate their expression in a larger number of paired tumor/normal surgical samples of human colonic, gastric, and hepatocellular carcinomas, by Northern hybridization. The mRNA signal was greater in the colonic carcinoma than in paired adjacent normal colonic mucosa in 38 of 42 cases for P0 [tumor/normal (T/N) ratio = 3.0 +/- 0.3, mean +/- SE, P < 0.001] (G. F. Barnard, R. J. Staniunas, S. Bao, K. Mafune, J. L. Gollan, G. D. Steele, Jr., and L. B. Chen, Cancer Res., 52: 3067-3072, 1992), in 25 of 28 cases for L18 (T/N ratio = 3.7 +/- 0.5, P < 0.001), in 27 of 28 cases for L37 (T/N ratio = 5.3 +/- 0.4, P < 0.001), and in 24 of 28 cases for S6 (T/N ratio = 3.1 +/- 0.5, P < 0.01). The level of mRNA overexpression of L18 and S6 did not correlate with the Dukes' stage of disease. In hepatocellular carcinoma samples, using the same four ribosomal protein complementary DNA probes, only P0 mRNA was significantly increased (T/N ratio = 2.8 +/- 0.4, n = 6, P = 0.047). In gastric carcinoma samples, none of these mRNAs was increased (mean T/N ratios = 0.9-1.2, n = 6). Therefore, gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein mRNAs as do colonic carcinoma.
NASA Astrophysics Data System (ADS)
Shen, Fahua; Wang, Bangxin; Shi, Wenjuan; Zhuang, Peng; Zhu, Chengyun; Xie, Chenbo
2018-04-01
A novel design of the 532 nm Rayleigh-Mie Doppler lidar receiving system is carried out. The use of polarization isolation technology to effectively improve the receiving system optical reception efficiency, suppress the background noise, not only improves the system wind field detection accuracy, while achieving a high-accuracy temperature measurement. The wind speed and temperature measurement principle of the system are discussed in detail, and the triple Fabry-Perot etalon parameters are optimized. Utilizing the overall design parameters of the system, the system detection performance is simulated. The simulation results show that from 5 to 50 km altitude with vertical resolution of 0.1 km@5 ∼20 km, 0.5 km@20 ∼40 km, 1 km@40 ∼50 km, by using the laser with single pulse energy of 600 mJ, repetition frequency of 50 Hz and the receiving telescope with aperture of 0.8 m, with 2min integration time and in ±50 m/s radial wind speed range, the radial wind speed measurement accuracies of our designed lidar in the day and night are better than 2.6 m/s and 0.9 m/s respectively, and its performance is obviously superior to that of traditional system 5.6 m/s and 1.4 m/s wind speed accuracies; with 10min integration time and in 210 ∼280 K temperature range, the temperature measurement accuracies of the system in the day and night are better than 3.4 K and 1.2 K respectively; since the wind speed sensitivities of the Mie and Rayleigh scattering signals are not exactly the same, in ±50 m/s radial wind speed range, the wind speed bias induced by Mie signal is less than 1 m/s in the temperature range of 210-290 K and in the backscatter ratio range of 1-1.5 for pair measurement.
Holmans, Peter; Zubenko, George S; Crowe, Raymond R; DePaulo, J Raymond; Scheftner, William A; Weissman, Myrna M; Zubenko, Wendy N; Boutelle, Sandra; Murphy-Eberenz, Kathleen; MacKinnon, Dean; McInnis, Melvin G; Marta, Diana H; Adams, Philip; Knowles, James A; Gladis, Madeleine; Thomas, Jo; Chellis, Jennifer; Miller, Erin; Levinson, Douglas F
2004-06-01
A genome scan was performed on the first phase sample of the Genetics of Recurrent Early-Onset Depression (GenRED) project. The sample consisted of 297 informative families containing 415 independent affected sibling pairs (ASPs), or, counting all possible pairs, 685 informative affected relative pairs (555 ASPs and 130 other pair types). Affected cases had recurrent major depressive disorder (MDD) with onset before age 31 years for probands or age 41 years for other affected relatives; the mean age at onset was 18.5 years, and the mean number of depressive episodes was 7.3. The Center for Inherited Disease Research genotyped 389 microsatellite markers (mean spacing of 9.3 cM). The primary linkage analysis considered allele sharing in all possible affected relative pairs with the use of the Z(lr) statistic computed by the ALLEGRO program. A secondary logistic regression analysis considered the effect of the sex of the pair as a covariate. Genomewide significant linkage was observed on chromosome 15q25.3-26.2 (Zlr=4.14, equivalent LOD = 3.73, empirical genomewide P=.023). The linkage was not sex specific. No other suggestive or significant results were observed in the primary analysis. The secondary analysis produced three regions of suggestive linkage, but these results should be interpreted cautiously because they depended primarily on the small subsample of 42 male-male pairs. Chromosome 15q25.3-26.2 deserves further study as a candidate region for susceptibility to MDD.
Kurtz, Tanja; Mogle, Jacqueline; Sliwinski, Martin J.; Hofer, Scott M.
2013-01-01
Background The role of processing speed and working memory was investigated in terms of individual differences in task-specific paired associates learning in a sample of older adults. Task-specific learning, as distinct from content-oriented item-specific learning, refers to gains in performance due to repeated practice on a learning task in which the to-be-learned material changes over trials. Methods Learning trajectories were modeled within an intensive repeated-measures design based on participants obtained from an opt-in internet-based sampling service (Mage = 65.3, SD = 4.81). Participants completed an eight-item paired associates task daily over a seven-day period. Results Results indicated that a three-parameter hyperbolic model (i.e., initial level, learning rate, and asymptotic performance) best described learning trajectory. After controlling for age-related effects, both higher working memory and higher processing speed had a positive effect on all three learning parameters. Conclusion These results emphasize the role of cognitive abilities for individual differences in task-specific learning of older adults. PMID:24151913
Loop induced single top partner production and decay at the LHC
NASA Astrophysics Data System (ADS)
Kim, Jeong Han; Lewis, Ian M.
2018-05-01
Most searches for top partners, T , are concerned with top partner pair production. However, as these bounds become increasingly stringent, the LHC energy will saturate and single top partner production will become more important. In this paper we study the novel signature of the top partner produced in association with the SM top, pp\\to T\\overline{t}+t\\overline{T} , in a model where the Standard Model (SM) is extended by a vector-like SU(2) L singlet fermion top partner and a real, SM gauge singlet scalar, S. In this model, pp\\to T\\overline{t}+t\\overline{T} production is possible through loops mediated by the scalar singlet. We find that, with reasonable coupling strengths, the production rate of this channel can dominate top partner pair production at top partner masses of m T ≳ 1 .5 TeV. In addition, this model allows for the exotic decay modes T → tg, T → tγ, and T → tS. In much of the parameter space the loop induced decay T → tg dominates and the top partner is quite long lived. New search strategies are necessary to cover these decay modes. We project the the sensitivity of the high luminosity LHC to pp\\to T\\overline{t}+t\\overline{T} via a realistic collider study. We find with 3 ab-1, the LHC is sensitive to this process for masses m T ≲ 2 TeV. In addition, we provide appendices detailing the renormalization of this model.
Corona emission thresholds for three types of hydrometeor interaction in thunderclouds
NASA Astrophysics Data System (ADS)
Blyth, A. M.; Christian, H. J.; Latham, J.
1998-06-01
Laboratory studies have been conducted of the conditions under which glancing collisions, at relative velocities V characteristic of those occurring in thunderstorms, of three types of hydrometeor pairs of precipitation dimension (such as (1) warm drop pairs, (2) supercooled drop pairs, and (3) a supercooled drop and a graupel pellet) produce a corona discharge in an electric field E. In each case, the observed corona is emitted at the tip of an ephemeral liquid filament, of length greater than the dimensions of the interacting hydrometeors, drawn out during each interaction. For each type of hydrometeor pair, the probability f that corona was produced during an interaction increased steadily from zero for increasing values of E above about 150 kV/m, and was significantly in excess of 50% for values of E = 400 kV/m, which is probably about the maximum ambient value occurring in a thunderstorm. We conclude that if the associated hydrometeors are present in strongly electrified regions of thunderstorms (unlikely for interaction type 1 but manifestly possible for types 2 and 3, corona initiation leading to the production of lightning could result from each of the three types of interaction studied.
NASA Astrophysics Data System (ADS)
Naik, Lohit; Deshapande, Narahari; Khazi, Imtiyaz Ahamed M.; Malimath, G. H.
2018-02-01
In the present work, we have carried out energy transfer studies using newly synthesised derivatives of thiophene substituted 1,3,4-oxadiazoles namely, 2-(-4-(thiophene-3-yl)phenyl)-5-(5-(thiophene-3-yl)thiophene-2-yl)-1,3,4-oxadiazole [TTO], 2-(-4-(benzo[b]thiophene-2-yl)phenyl)-5-(5-(benzo[b]thiophene-2-yl)-1,3,4-oxadiozole [TBO] and 2-(4-(4-(trifluoromethyl)phenyl)phenyl)-5-(5-(4-(trifluoromethyl)phenyl)thiophen-2-yl)-1,3,4-oxadiazole [TMO] as donors and laser dye coumarin-334 as acceptor in ethanol and dye-doped polymer (poly(methyl methacrylate) (PMMA)) media following steady-state and time-resolved fluorescence methods. Bimolecular quenching constant ( k q), translation diffusion rate parameter ( k d), diffusion length ( D l), critical transfer distance ( R 0), donor- acceptor distance ( r) and energy transfer efficiency ( E T) are calculated. It is observed that, critical transfer distance is more than the diffusion length for all the pairs. Further, bimolecular quenching constant is also more than the translation diffusion rate parameter. Hence, our experimental findings suggest that overall energy transfer is due to Förster resonance energy transfer (FRET) between donor and acceptor in both the media and for all the pairs. In addition, considerable increase in fluorescence intensity and energy transfer efficiency is observed in dye-doped polymer matrix systems as compared to liquid media. This suggests that, these donor-acceptor pairs doped in PMMA matrix may be used for applications such as energy transfer dye lasers (ETDL) to improve the efficiency and photostability, to enhance tunability and for plastic scintillation detectors.
NASA Astrophysics Data System (ADS)
Al-Durgham, Kaleel; Lichti, Derek D.; Kuntze, Gregor; Ronsky, Janet
2017-06-01
High-speed biplanar videoradiography, or clinically referred to as dual fluoroscopy (DF), imaging systems are being used increasingly for skeletal kinematics analysis. Typically, a DF system comprises two X-ray sources, two image intensifiers and two high-speed video cameras. The combination of these elements provides time-series image pairs of articulating bones of a joint, which permits the measurement of bony rotation and translation in 3D at high temporal resolution (e.g., 120-250 Hz). Assessment of the accuracy of 3D measurements derived from DF imaging has been the subject of recent research efforts by several groups, however with methodological limitations. This paper presents a novel and simple accuracy assessment procedure based on using precise photogrammetric tools. We address the fundamental photogrammetry principles for the accuracy evaluation of an imaging system. Bundle adjustment with selfcalibration is used for the estimation of the system parameters. The bundle adjustment calibration uses an appropriate sensor model and applies free-network constraints and relative orientation stability constraints for a precise estimation of the system parameters. A photogrammetric intersection of time-series image pairs is used for the 3D reconstruction of a rotating planar object. A point-based registration method is used to combine the 3D coordinates from the intersection and independently surveyed coordinates. The final DF accuracy measure is reported as the distance between 3D coordinates from image intersection and the independently surveyed coordinates. The accuracy assessment procedure is designed to evaluate the accuracy over the full DF image format and a wide range of object rotation. Experiment of reconstruction of a rotating planar object reported an average positional error of 0.44 +/- 0.2 mm in the derived 3D coordinates (minimum 0.05 and maximum 1.2 mm).
Costa, Luciano T; Ribeiro, Mauro C C
2007-10-28
Dynamical properties of polymer electrolytes based on poly(ethylene oxide) (PEO) and ionic liquids of 1-alkyl-3-methylimidazolium cations were calculated by molecular dynamics simulations with previously proposed models [L. T. Costa and M. C. Ribeiro, J. Chem. Phys. 124, 184902 (2006)]. The effect of changing the ionic liquid concentration, temperature, and the 1-alkyl-chain lengths, [1,3-dimethylimidazolium]PF(6) and [1-butyl-3-methylimidazolium]PF(6) ([dmim]PF(6) and [bmim]PF(6)), was investigated. Cation diffusion coefficient is higher than those of anion and oxygen atoms of PEO chains. Ionic mobility in PEO[bmim]PF(6) is higher than in PEO[dmim]PF(6), so that the ionic conductivity kappa of the former is approximately ten times larger than the latter. The ratio between kappa and its estimate from the Nernst-Einstein equation kappa/kappa(NE), which is inversely proportional to the strength of ion pairs, is higher in ionic liquid polymer electrolytes than in polymer electrolytes based on inorganic salts with Li(+) cations. Calculated time correlation functions corroborate previous evidence from the analysis of equilibrium structure that the ion pairs in ionic liquid polymer electrolytes are relatively weak. Structural relaxation at distinct spatial scales is revealed by the calculation of the intermediate scattering function at different wavevectors. These data are reproduced with stretched exponential functions, so that temperature and wavevector dependences of best fit parameters can be compared with corresponding results for polymer electrolytes containing simpler ions.
Sakalauskaitė, Jurga; Viskelis, Pranas; Dambrauskienė, Edita; Sakalauskienė, Sandra; Samuolienė, Giedrė; Brazaitytė, Aušra; Duchovskis, Pavelas; Urbonavičienė, Dalia
2013-04-01
The effects of short-term ultraviolet B (UV-B) irradiation on sweet basil (Ocimum basilicum L. cv. Cinnamon) plants at the 3-4 leaf pair and flowering stages were examined in controlled environment growth chambers. Plants were exposed to 0 (reference), 2 and 4 kJ UV-B m(-2) day(-1) over 7 days. Exposure of basil plants to supplementary UV-B light resulted in increased assimilating leaf area, fresh biomass and dry biomass. Stimulation of physiological functions in young basil plants under either applied UV-B dose resulted in increased total chlorophyll content but no marked variation in carotenoid content. At the flowering stage the chlorophyll and carotenoid contents of basil were affected by supplementary UV-B radiation, decreasing with enhanced UV-B exposure. Both total antioxidant activity (2,2-diphenyl-1-picrylhydrazyl free radical assay) and total phenolic compound content were increased by UV-B light supplementation. Young and mature basil plants differed in their ascorbic acid content, which was dependent on UV-B dose and plant age. UV-B radiation resulted in decreased nitrate content in young basil plants (3-4 leaf pair stage). These results indicate that the application of short-exposure UV-B radiation beneficially influenced both growth parameters and biochemical constituents in young and mature basil plants. © 2012 Society of Chemical Industry.
Roth, Jonathan D; Hughes, Heather; Kendall, Eric; Baron, Alain D; Anderson, Christen M
2006-12-01
Effects of amylin and pair feeding (PF) on body weight and metabolic parameters were characterized in diet-induced obesity-prone rats. Peripherally administered rat amylin (300 microg/kg.d, 22d) reduced food intake and slowed weight gain: approximately 10% (P<0.05), similar to PF. Fat loss was 3-fold greater in amylin-treated rats vs. PF (P<0.05). Whereas PF decreased lean tissue (P<0.05 vs. vehicle controls; VEH), amylin did not. During wk 1, amylin and PF reduced 24-h respiratory quotient (mean+/-se, 0.82+/-0.0, 0.81+/-0.0, respectively; P<0.05) similar to VEH (0.84+/-0.01). Energy expenditure (EE mean+/-se) tended to be reduced by PF (5.67+/-0.1 kcal/h.kg) and maintained by amylin (5.86+/-0.1 kcal/h.kg) relative to VEH (5.77+/-0.0 kcal/h.kg). By wk 3, respiratory quotient no longer differed; however, EE increased with amylin treatment (5.74+/-0.09 kcal/.kg; P<0.05) relative to VEH (5.49+/-0.06) and PF (5.38+/-0.07 kcal/h.kg). Differences in EE, attributed to differences in lean mass, argued against specific amylin-induced thermogenesis. Weight loss in amylin and pair-fed rats was accompanied by similar increases arcuate neuropeptide Y mRNA (P<0.05). Amylin treatment, but not PF, increased proopiomelanocortin mRNA levels (P<0.05 vs. VEH). In a rodent model of obesity, amylin reduced body weight and body fat, with relative preservation of lean tissue, through anorexigenic and specific metabolic effects.
Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P
2015-02-10
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.
Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...
2015-01-29
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less
2016-01-01
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825
NASA Astrophysics Data System (ADS)
Mathai, Varghese; Zhu, Xiaojue; Sun, Chao; Lohse, Detlef
2017-08-01
In this Letter, we study the motion and wake patterns of freely rising and falling cylinders in quiescent fluid. We show that the amplitude of oscillation and the overall system dynamics are intricately linked to two parameters: the particle's mass density relative to the fluid m*≡ρp/ρf and its relative moment of inertia I*≡Ip/If. This supersedes the current understanding that a critical mass density (m*≈0.54 ) alone triggers the sudden onset of vigorous vibrations. Using over 144 combinations of m* and I*, we comprehensively map out the parameter space covering very heavy (m*>10 ) to very buoyant (m*<0.1 ) particles. The entire data collapse into two scaling regimes demarcated by a transitional Strouhal number Stt≈0.17 . Stt separates a mass-dominated regime from a regime dominated by the particle's moment of inertia. A shift from one regime to the other also marks a gradual transition in the wake-shedding pattern: from the classical two-single (2 S ) vortex mode to a two-pair (2 P ) vortex mode. Thus, autorotation can have a significant influence on the trajectories and wakes of freely rising isotropic bodies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vera, D.R.; Woodle, E.S.; Stadalnik, R.C.
1989-09-01
Kinetic sensitivity is the ability of a physiochemical parameter to alter the time-activity curve of a radiotracer. The kinetic sensitivity of liver and blood time-activity data resulting from a single bolus injection of ({sup 99m}Tc)galactosyl-neoglycoalbumin (( Tc)NGA) into healthy pigs was examined. Three parameters, hepatic plasma flow scaled as flow per plasma volume, ligand-receptor affinity, and total receptor concentration, were tested using (Tc)NGA injections of various molar doses and affinities. Simultaneous measurements of plasma volume (iodine-125 human serum albumin dilution), and hepatic plasma flow (indocyanine green extraction) were performed during 12 (Tc)NGA studies. Paired data sets demonstrated differences (P(chi v2)more » less than 0.01) in liver and blood time-activity curves in response to changes in each of the tested parameters. We conclude that the (Tc)NGA radiopharmacokinetic system is therefore sensitive to hepatic plasma flow, ligand-receptor affinity, and receptor concentration. In vivo demonstration of kinetic sensitivity permits delineation of the physiologic parameters that determine the biodistribution of a radiopharmaceutical. This delineation is a prerequisite to a valid analytic assessment of receptor biochemistry via kinetic modeling.« less
NASA Astrophysics Data System (ADS)
Warncke, Kurt
2009-03-01
Challenges to the understanding of how protein structure and dynamics contribute to catalysis in enzymes, and the use of time-resolved electron paramagnetic resonance (EPR) spectroscopic techniques to address the challenges, are examined in the context of the coenzyme B12-dependent enzyme, ethanolamine ammonia-lyase (EAL), from Salmonella typhimurium. EAL conducts the homolytic cleavage of the coenzyme cobalt-carbon bond, intraprotein radical migration (5-6 å), and hydrogen atom transfers, which enable the core radical-mediated rearrangement reaction. Thermodynamic and activation parameters are measured in two experimental systems, which were developed to isolate sub-sequences from the multi-step catalytic cycle, as follows: (1) A dimethylsulfoxide (DMSO)/water cryosolvent system is used to prepare the kinetically-arrested enzyme/coenzyme/substrate ternary complex in fluid solution at 230 K.[1] Temperature-step initiated cobalt-carbon bond cleavage and radical pair separation to form the Co(II)-substrate radical pair are monitored by using time-resolved, full-spectrum EPR spectroscopy (234<=T<=250 K).[1] (2) The Co(II)-substrate radical pair is cryotrapped in frozen aqueous solution at T<150 K, and then promoted to react by a temperature step. The reaction of the substrate radical along the native pathway to form the diamagnetic bound products is monitored by using time-resolved, full-spectrum EPR spectroscopy (187<=T<=217 K).[2] High temporal resolution is achieved, because the reactions are dramatically slowed at the low temperatures, relative to the initiation and spectrum acquistion times. The results are combined with high resolution structures of the reactant centers, obtained by pulsed-EPR spectroscopies,[3] and the protein, obtained by structural proteomics[4] and EPR and electron spin echo envelope modulation (ESEEM) in combination with site directed mutagenesis,[5] to approach a molecular level description of protein contributions to catalysis in EAL. [4pt] [1] Wang, M. & Warncke, K. J. Am. Chem. Soc. 2008, 130, 4846. [0pt] [2] Chen, Z. and Warncke, K. Biophys. J. 2008, 95 (December) [0pt] [3] Canfield, J. M. and Warncke, K. J. Phys. Chem. B 2002, 106, 8831. [0pt] [4] Sun, L. and Warncke, K. Proteins 2006, 64, 308. [0pt] [5] Sun, L., Groover, O., Canfield, J. M., and Warncke, K. Biochemistry 2008, 47, 5523.
The eclipsing system V404 Lyr: Light-travel times and γ Doradus pulsations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jae Woo; Kim, Seung-Lee; Hong, Kyeongsoo
We present the physical properties of V404 Lyr exhibiting eclipse timing variations and multiperiodic pulsations from all historical data including the Kepler and SuperWASP observations. Detailed analyses of 2922 minimum epochs showed that the orbital period has varied through a combination of an upward-opening parabola and two sinusoidal variations, with periods of P {sub 3} = 649 days and P {sub 4} = 2154 days and semi-amplitudes of K {sub 3} = 193 s and K {sub 4} = 49 s, respectively. The secular period increase at a rate of +1.41 × 10{sup –7} days yr{sup –1} could be interpretedmore » as a combination of the secondary to primary mass transfer and angular momentum loss. The most reasonable explanation for both sinusoids is a pair of light-travel-time effects due to two circumbinary objects with projected masses of M {sub 3} = 0.47 M {sub ☉} and M {sub 4} = 0.047 M {sub ☉}. The third-body parameters are consistent with those calculated using the Wilson-Devinney binary code. For the orbital inclinations i {sub 4} ≳ 43°, the fourth component has a mass within the hydrogen-burning limit of ∼0.07 M {sub ☉}, which implies that it is a brown dwarf. A satisfactory model for the Kepler light curves was obtained by applying a cool spot to the secondary component. The results demonstrate that the close eclipsing pair is in a semi-detached, but near-contact, configuration; the primary fills approximately 93% of its limiting lobe and is larger than the lobe-filling secondary. Multiple frequency analyses were applied to the light residuals after subtracting the synthetic eclipsing curve from the Kepler data. This revealed that the primary component of V404 Lyr is a γ Dor type pulsating star, exhibiting seven pulsation frequencies in the range of 1.85-2.11 day{sup –1} with amplitudes of 1.38-5.72 mmag and pulsation constants of 0.24-0.27 days. The seven frequencies were clearly identified as high-order low-degree gravity-mode oscillations which might be excited through tidal interaction. Only eight eclipsing binaries have been known to contain γ Dor pulsating components and, therefore, V404 Lyr will be an important test bed for investigating these rare and interesting objects.« less
First Impressions of CARTOSAT-1
NASA Technical Reports Server (NTRS)
Lutes, James
2007-01-01
CARTOSAT-1 RPCs need special handling. Absolute accuracy of uncontrolled scenes is poor (biases > 300 m). Noticeable cross-track scale error (+/- 3-4 m across stereo pair). Most errors are either biases or linear in line/sample (These are easier to correct with ground control).
NASA Astrophysics Data System (ADS)
Hao, Qing-Hai; You, Yu-Wei; Kong, Xiang-Shan; Liu, C. S.
2013-03-01
The microscopic structure and dynamics of liquid MgxBi1-x(x = 0.5, 0.6, 0.7) alloys together with pure liquid Mg and Bi metals were investigated by means of ab initio molecular dynamics simulations. We present results of structure properties including pair correlation function, structural factor, bond-angle distribution function and bond order parameter, and their composition dependence. The dynamical and electronic properties have also been studied. The structure factor and pair correlation function are in agreement with the available experimental data. The calculated bond-angle distribution function and bond order parameter suggest that the stoichiometric composition Mg3Bi2 exhibits a different local structure order compared with other concentrations, which help us understand the appearance of the minimum electronic conductivity at this composition observed in previous experiments.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
Population dynamics and life history of a geographically restricted seahorse, Hippocampus whitei.
Harasti, D; Martin-Smith, K; Gladstone, W
2012-09-01
The aim of this study was to collect data on population dynamics and life history for White's seahorse Hippocampus whitei, a geographically restricted species that is listed as data deficient under the IUCN Red List. Data from H. whitei populations were collected from two regions, Port Stephens (north) and Sydney Harbour (south) in New South Wales, Australia, covering most of the known range of H. whitei, from 2005 to 2010. Over 1000 individuals were tagged using fluorescent elastomer and on subsequent recaptures were re-measured for growth data that were used in a forced Gulland-Holt plot to develop growth parameters for use in a specialized von Bertalanffy growth-function model. Growth parameters for Port Stephens were: females L(∞) = 149·2 mm and K = 2·034 per year and males L(∞) = 147·9 mm and K = 2·520 per year compared with estimates from Sydney Harbour: females L(∞) = 139·8 mm and K = 1·285 per year and males L(∞) = 141·6 mm and K = 1·223 per year. Whilst there was no significant difference in growth between sexes for each region, H. whitei in Port Stephens grew significantly quicker and larger and matured and reproduced at a younger age than those from Sydney Harbour. The life span of H. whitei is at least 5 years in the wild with six individuals recorded reaching this age. Data collected on breeding pairs found that H. whitei displays life-long monogamy with three pairs observed remaining pair bonded over three consecutive breeding years. Baseline population densities were derived for two Port Stephens' sites (0·035 and 0·110 m(-2)) and for Manly in Sydney Harbour (1·050 m(-2)). Even though the life-history parameters of H. whitei suggest it may be reasonably resilient, precaution should be taken in its future management as a result of its limited geographical distribution and increasing pressures from anthropogenic sources on its habitats. © 2012 The Authors. Journal of Fish Biology © 2012 The Fisheries Society of the British Isles.
A FEROS Survey of Hot Subdwarf Stars
NASA Astrophysics Data System (ADS)
Vennes, Stéphane; Németh, Péter; Kawka, Adela
2018-02-01
We have completed a survey of twenty-two ultraviolet-selected hot subdwarfs using the Fiber-fed Extended Range Optical Spectrograph (FEROS) and the 2.2-m telescope at La Silla. The sample includes apparently single objects as well as hot subdwarfs paired with a bright, unresolved companion. The sample was extracted from our GALEX catalogue of hot subdwarf stars. We identified three new short-period systems (P = 3.5 hours to 5 days) and determined the orbital parameters of a long-period (P = 62d.66) sdO plus G III system. This particular system should evolve into a close double degenerate system following a second common envelope phase.We also conducted a chemical abundance study of the subdwarfs: Some objects show nitrogen and argon abundance excess with respect to oxygen. We present key results of this programme.
A monostable piezoelectric energy harvester for broadband low-level excitations
NASA Astrophysics Data System (ADS)
Fan, Kangqi; Tan, Qinxue; Zhang, Yiwei; Liu, Shaohua; Cai, Meiling; Zhu, Yingmin
2018-03-01
This letter presents a monostable piezoelectric energy harvester (PEH) for achieving enhanced energy extraction from low-level excitations. The proposed PEH is realized by introducing symmetric magnetic attraction to a piezoelectric cantilever beam and a pair of stoppers to confine the maximum deflection of the beam. The lumped parameter model of such a system is presented and experimentally validated. Theoretical simulations and experimental measurements demonstrate that the proposed design can bring about a wider operating bandwidth and higher output voltage than the linear PEH. Under a sinusoidal vibration with an amplitude of 3 m/s2, a 54% increase in the operating bandwidth and a 253% increase in the magnitude of output power are achieved compared to its linear counterpart. Moreover, the proposed PEH exhibits rich dynamic features, including the tunable operating bandwidth, adjustable voltage and power levels, and softening hysteresis.
Mo, Z; Long, X; Zhang, M
1999-03-01
Fundamentals of ion-pair flow injection with piezoelectric detection were investigated experimentally and theoretically for the adsorption of dodecyl phenylsulfonate and interfacial ion-pair formation with epinephrine and l-dopa on silver electrode of quartz crystal microbalance. The influences of sulfonate concentration and operating parameters on the frequency response were demonstrated and provided the possibility for the discriminating determination of mixtures. The selected system of ion-pair flow injection with piezoelectric detection was applied to the determination of epinephrine and l-dopa. Calibration curves were linear in ranges 4.00-850 and 3.50-730 mug ml(-1), with detection limits of 1.22 and 1.05 mug ml(-1) and sampling frequencies of 120 samples h(-1), for epinephrine and l-dopa, respectively. The method has been satisfactorily applied to the determination of catecholamines in pharmaceutical preparations.
Self-assembly of dendronized perylene bisimides into complex helical columns.
Percec, Virgil; Peterca, Mihai; Tadjiev, Timur; Zeng, Xiangbing; Ungar, Goran; Leowanawat, Pawaret; Aqad, Emad; Imam, Mohammad R; Rosen, Brad M; Akbey, Umit; Graf, Robert; Sekharan, Sivakumar; Sebastiani, Daniel; Spiess, Hans W; Heiney, Paul A; Hudson, Steven D
2011-08-10
The synthesis of perylene 3,4:9,10-tetracarboxylic acid bisimides (PBIs) dendronized with first-generation dendrons containing 0 to 4 methylenic units (m) between the imide group and the dendron, (3,4,5)12G1-m-PBI, is reported. Structural analysis of their self-organized arrays by DSC, X-ray diffraction, molecular modeling, and solid-state (1)H NMR was carried out on oriented samples with heating and cooling rates of 20 to 0.2 °C/min. At high temperature, (3,4,5)12G1-m-PBI self-assemble into 2D-hexagonal columnar phases with intracolumnar order. At low temperature, they form orthorhombic (m = 0, 2, 3, 4) and monoclinic (m = 1) columnar arrays with 3D periodicity. The orthorhombic phase has symmetry close to hexagonal. For m = 0, 2, 3, 4 ,they consist of tetramers as basic units. The tetramers contain a pair of two molecules arranged side by side and another pair in the next stratum of the column, turned upside-down and rotated around the column axis at different angles for different m. In contrast, for m = 1, there is only one molecule in each stratum, with a four-strata 2(1) helical repeat. All molecules face up in one column, and down in the second column, of the monoclinic cell. This allows close and extended π-stacking, unlike in the disruptive up-down alteration from the case of m = 0, 2, 3, 4. Most of the 3D structures were observed only by cooling at rates of 1 °C/min or less. This complex helical self-assembly is representative for other classes of dendronized PBIs investigated for organic electronics and solar cells. © 2011 American Chemical Society
A quasi-dense matching approach and its calibration application with Internet photos.
Wan, Yanli; Miao, Zhenjiang; Wu, Q M Jonathan; Wang, Xifu; Tang, Zhen; Wang, Zhifei
2015-03-01
This paper proposes a quasi-dense matching approach to the automatic acquisition of camera parameters, which is required for recovering 3-D information from 2-D images. An affine transformation-based optimization model and a new matching cost function are used to acquire quasi-dense correspondences with high accuracy in each pair of views. These correspondences can be effectively detected and tracked at the sub-pixel level in multiviews with our neighboring view selection strategy. A two-layer iteration algorithm is proposed to optimize 3-D quasi-dense points and camera parameters. In the inner layer, different optimization strategies based on local photometric consistency and a global objective function are employed to optimize the 3-D quasi-dense points and camera parameters, respectively. In the outer layer, quasi-dense correspondences are resampled to guide a new estimation and optimization process of the camera parameters. We demonstrate the effectiveness of our algorithm with several experiments.
Stringent Nucleotide Recognition by the Ribosome at the Middle Codon Position
Liu, Wei; Shin, Dongwon; Ng, Martin; Sanbonmatsu, Karissa Y.; Tor, Yitzhak; Cooperman, Barry S.
2017-01-01
Accurate translation of the genetic code depends on mRNA:tRNA codon:anticodon base pairing. Here we exploit an emissive, isosteric adenosine surrogate that allows direct measurement of the kinetics of codon:anticodon base formation during protein synthesis. Our results suggest that codon:anticodon base pairing is subject to tighter constraints at the middle position than at the 5′- and 3′-positions, and further suggest a sequential mechanism of formation of the three base pairs in the codon:anticodon helix. PMID:28850078
Operation REDWING, Report of the Manager Albuquerque Operations
1983-01-31
on their experience in three previous operations (IVY, GREENHOUSE , and CASTLE) AEC authorized, and Holmes & Narver pur chased and shipped to the...Operation GREENHOUSE and one 51-pair cable installed prior to REDWING. One of the 16-pair cables developed shorted and opened pairs. When an...refrigerators, dehumidification units, 20’ ■.r.. i..jjj||.t.^. .M , ., ». i .. —■■■"■= •>•■•— :- •’ ■’ ■■-■■ ■- ’■ • APPENDIX lII-3.10-l
Castro-Chavez, Fernando
2012-01-01
Background Three binary representations of the genetic code according to the ancient I Ching of Fu-Xi will be presented, depending on their defragging capabilities by pairing based on three biochemical properties of the nucleic acids: H-bonds, Purine/Pyrimidine rings, and the Keto-enol/Amino-imino tautomerism, yielding the last pair a 32/32 single-strand self-annealed genetic code and I Ching tables. Methods Our working tool is the ancient binary I Ching's resulting genetic code chromosomes defragged by vertical and by horizontal pairing, reverse engineered into non-binaries of 2D rotating 4×4×4 circles and 8×8 squares and into one 3D 100% symmetrical 16×4 tetrahedron coupled to a functional tetrahedron with apical signaling and central hydrophobicity (codon formula: 4[1(1)+1(3)+1(4)+4(2)]; 5:5, 6:6 in man) forming a stella octangula, and compared to Nirenberg's 16×4 codon table (1965) pairing the first two nucleotides of the 64 codons in axis y. Results One horizontal and one vertical defragging had the start Met at the center. Two, both horizontal and vertical pairings produced two pairs of 2×8×4 genetic code chromosomes naturally arranged (M and I), rearranged by semi-introversion of central purines or pyrimidines (M' and I') and by clustering hydrophobic amino acids; their quasi-identity was disrupted by amino acids with odd codons (Met and Tyr pairing to Ile and TGA Stop); in all instances, the 64-grid 90° rotational ability was restored. Conclusions We defragged three I Ching representations of the genetic code while emphasizing Nirenberg's historical finding. The synthetic genetic code chromosomes obtained reflect the protective strategy of enzymes with a similar function, having both humans and mammals a biased G-C dominance of three H-bonds in the third nucleotide of their most used codons per amino acid, as seen in one chromosome of the i, M and M' genetic codes, while a two H-bond A-T dominance was found in their complementary chromosome, as seen in invertebrates and plants. The reverse engineering of chromosome I' into 2D rotating circles and squares was undertaken, yielding a 100% symmetrical 3D geometry which was coupled to a previously obtained genetic code tetrahedron in order to differentiate the start methionine from the methionine that is acting as a codifying non-start codon. PMID:23431415
New binaries among UV-selected, hot subdwarf stars and population properties
NASA Astrophysics Data System (ADS)
Kawka, A.; Vennes, S.; O'Toole, S.; Németh, P.; Burton, D.; Kotze, E.; Buckley, D. A. H.
2015-07-01
We have measured the orbital parameters of seven close binaries, including six new objects, in a radial velocity survey of 38 objects comprising a hot subdwarf star with orbital periods ranging from ˜0.17 to 3 d. One new system, GALEX J2205-3141, shows reflection on an M dwarf companion. Three other objects show significant short-period variations, but their orbital parameters could not be constrained. Two systems comprising a hot subdwarf paired with a bright main-sequence/giant companion display short-period photometric variations possibly due to irradiation or stellar activity and are also short-period candidates. All except two candidates were drawn from a selection of subluminous stars in the Galaxy Evolution Explorer ultraviolet sky survey. Our new identifications also include a low-mass subdwarf B star and likely progenitor of a low-mass white dwarf (GALEX J0805-1058) paired with an unseen, possibly substellar, companion. The mass functions of the newly identified binaries imply minimum secondary masses ranging from 0.03 to 0.39 M⊙. Photometric time series suggest that, apart from GALEX J0805-1058 and J2205-3141, the companions are most likely white dwarfs. We update the binary population statistics: close to 40 per cent of hot subdwarfs have a companion. Also, we found that the secondary mass distribution shows a low-mass peak attributed to late-type dwarfs, and a higher mass peak and tail distribution attributed to white dwarfs and a few spectroscopic composites. Also, we found that the population kinematics imply an old age and include a few likely halo population members.
Pairing induced superconductivity in holography
NASA Astrophysics Data System (ADS)
Bagrov, Andrey; Meszena, Balazs; Schalm, Koenraad
2014-09-01
We study pairing induced superconductivity in large N strongly coupled systems at finite density using holography. In the weakly coupled dual gravitational theory the mechanism is conventional BCS theory. An IR hard wall cut-off is included to ensure that we can controllably address the dynamics of a single confined Fermi surface. We address in detail the interplay between the scalar order parameter field and fermion pairing. Adding an explicitly dynamical scalar operator with the same quantum numbers as the fermion-pair, the theory experiences a BCS/BEC crossover controlled by the relative scaling dimensions. We find the novel result that this BCS/BEC crossover exposes resonances in the canonical expectation value of the scalar operator. This occurs not only when the scaling dimension is degenerate with the Cooper pair, but also with that of higher derivative paired operators. We speculate that a proper definition of the order parameter which takes mixing with these operators into account stays finite nevertheless.
Early Days of Superfluid ^3He: An Experimenter's View
NASA Astrophysics Data System (ADS)
Lee, David
2010-03-01
The formulation of the BCS theory led theorists to investigate possible non-S-wave pairing in liquid ^3He. Unfortunately as time went on, estimates for the pairing temperature became unattainably low. Nevertheless, the push to lower temperatures by experimentalists continued and was facilitated by the invention of the dilution refrigerator. Nuclear adiabatic demagnetization could then be used to cool liquid ^3He to ˜1 mK as demonstrated by Goodkind. An alternate approach, suggested by Pomeranchuk, involved adiabatic compression of liquid ^3He into the solid phase. Efforts to develop this technique at the Kapitza Institute, La Jolla and Cornell achieved success in demonstrating cooling of mixtures of liquid and solid ^3He to ˜ 1 mK following dilution refrigerator pre-cooling. Although there was great pessimism regarding the possible observation of pairing in liquid ^3He, the unsettled problem of magnetic ordering in solid ^3He beckoned. Ultimately two phase transition along the melting curve were observed by Osheroff et al at Cornell. Although first associated with solid ^3He, extensive NMR studies showed them to be two new phases of liquid ^3He. A brief history of experiments at various laboratories following the discovery is given, along with early interpretations given by Anderson and Morel and Balian and Werthamer. The key role of Leggett's spin dynamics is also discussed.
Electron—phonon Coupling and the Superconducting Phase Diagram of the LaAlO3—SrTiO3 Interface
Boschker, Hans; Richter, Christoph; Fillis-Tsirakis, Evangelos; Schneider, Christof W.; Mannhart, Jochen
2015-01-01
The superconductor at the LaAlO3—SrTiO3 interface provides a model system for the study of two-dimensional superconductivity in the dilute carrier density limit. Here we experimentally address the pairing mechanism in this superconductor. We extract the electron—phonon spectral function from tunneling spectra and conclude, without ruling out contributions of further pairing channels, that electron—phonon mediated pairing is strong enough to account for the superconducting critical temperatures. Furthermore, we discuss the electron—phonon coupling in relation to the superconducting phase diagram. The electron—phonon spectral function is independent of the carrier density, except for a small part of the phase diagram in the underdoped region. The tunneling measurements reveal that the increase of the chemical potential with increasing carrier density levels off and is zero in the overdoped region of the phase diagram. This indicates that the additionally induced carriers do not populate the band that hosts the superconducting state and that the superconducting order parameter therefore is weakened by the presence of charge carriers in another band. PMID:26169351
PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences.
Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří
2015-07-01
The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
NASA Astrophysics Data System (ADS)
Ryabov, I. D.
2012-10-01
Electron paramagnetic resonance (EPR) study of single crystals of forsterite co-doped with chromium and scandium has revealed, apart from the known paramagnetic centers Cr3+( M1) and Cr3+( M1)- V_{{{{Mg}}^{2 + } }} ( M2) (Ryabov in Phys Chem Miner 38:177-184, 2011), a new center Cr3+( M1)- V_{{{{Mg}}^{2 + } }} ( M2)-Sc3+ formed by a Cr3+ ion substituting for Mg2+ at the M1 structural position with a nearest-neighbor Mg2+ vacancy at the M2 position and a Sc3+ ion presumably at the nearest-neighbor M1 position. For this center, the conventional zero-field splitting parameters D and E and the principal g values have been determined as follows: D = 33,172(29) MHz, E = 8,482(13) MHz, g = [1.9808(2), 1.9778(2), 1.9739(2)]. The center has been compared with the known ion pair Cr3+( M1)-Al3+ (Bershov et al. in Phys Chem Miner 9:95-101, 1983), for which the refined EPR data have been obtained. Based on these data, the known sharp M1″ line at 13,967 cm-1 (with the splitting of 1.8 cm-1), observed in low-temperature luminescence spectra of chromium-doped forsterite crystals (Glynn et al. in J Lumin 48, 49:541-544, 1991), has been ascribed to the Cr3+( M1)-Al3+ center. It has been found that the concentration of the new center increases from 0 up to 4.4 × 1015 mg-1, whereas that of the Cr3+( M1) and Cr3+( M1)- V_{{{{Mg}}^{2 + } }} ( M2) centers quickly decreases from 7.4 × 1015 mg-1 down to 3 × 1015 mg-1 and from 2.7 × 1015 mg-1 down to 0.5 × 1015 mg-1, i.e., by a factor of 2.5 and 5.4, respectively, with an increase of the Sc content from 0 up to 0.22 wt % (at the same Cr content 0.25 wt %) in the melt. When the Sc content exceeds that of Cr, the concentration of the new center decreases most likely due to the formation of the Sc3+( M1)- V_{{{{Mg}}^{2 + } }} ( M2)-Sc3+ complex instead of the Cr3+( M1)- V_{{{{Mg}}^{2 + } }} ( M2)-Sc3+ center. The formation of such ordered neutral complex is in agreement with the experimental results, concerning the incorporation of Sc into olivine, recently obtained by Grant and Wood (Geochim Cosmochim Acta 74:2412-2428, 2010).
Wilson, Deborah J.; Lyver, Phil O'B.; Greene, Terry C.; Whitehead, Amy L.; Dugger, Catherine; Karl, Brian J.; Barringer, James R. F.; McGarry, Roger; Pollard, Annie M.; Ainley, David G.
2017-01-01
In the Ross Sea region, most South Polar Skuas (Stercorarius maccormicki) nest near Adélie Penguin (Pygoscelis adeliae) colonies, preying and scavenging on fish, penguins, and other carrion. To derive a relationship to predict skua numbers from better-quantified penguin numbers, we used distance sampling to estimate breeding skua numbers within 1000 m of 5 penguin nesting locations (Cape Crozier, Cape Royds, and 3 Cape Bird locations) on Ross Island in 3 consecutive years. Estimated numbers of skua breeding pairs were highest at Cape Crozier (270,000 penguin pairs; 1099 and 1347 skua pairs in 2 respective years) and lowest at Cape Royds (3000 penguin pairs; 45 skua pairs). The log–log linear relationship (R2 = 0.98) between pairs of skuas and penguins was highly significant, and most historical estimates of skua and penguin numbers in the Ross Sea were within 95 % prediction intervals of the regression. Applying our regression model to current Adélie Penguin colony sizes at 23 western Ross Sea locations predicted that 4635 pairs of skuas now breed within 1000 m of penguin colonies in the Ross Island metapopulation (including Beaufort Island) and northern Victoria Land. We estimate, using published skua estimates for elsewhere in Antarctica, that the Ross Sea South Polar Skua population comprises ~50 % of the world total, although this may be an overestimate because of incomplete data elsewhere. To improve predictions and enable measurement of future skua population change, we recommend additional South Polar Skua surveys using consistent distance-sampling methods at penguin colonies of a range of sizes.
The Evolution and Physical Parameters of WN3/O3s: A New Type of Wolf–Rayet Star
DOE Office of Scientific and Technical Information (OSTI.GOV)
Neugent, Kathryn F.; Massey, Philip; Hillier, D. John
As part of a search for Wolf–Rayet (WR) stars in the Magellanic Clouds, we have discovered a new type of WR star in the Large Magellanic Cloud (LMC). These stars have both strong emission lines, as well as He ii and Balmer absorption lines and spectroscopically resemble a WN3 and O3V binary pair. However, they are visually too faint to be WN3+O3V binary systems. We have found nine of these WN3/O3s, making up ∼6% of the population of LMC WRs. Using cmfgen, we have successfully modeled their spectra as single stars and have compared the physical parameters with those ofmore » more typical LMC WNs. Their temperatures are around 100,000 K, a bit hotter than the majority of WN stars (by around 10,000 K), though a few hotter WNs are known. The abundances are what you would expect for CNO equilibrium. However, most anomalous are their mass-loss rates, which are more like that of an O-type star than a WN star. While their evolutionary status is uncertain, their low mass-loss rates and wind velocities suggest that they are not products of homogeneous evolution. It is possible instead that these stars represent an intermediate stage between O stars and WNs. Since WN3/O3 stars are unknown in the Milky Way, we suspect that their formation depends upon metallicity, and we are investigating this further by a deep survey in M33, which possesses a metallicity gradient.« less
Radial symmetry in a chimeric glutamate receptor pore
NASA Astrophysics Data System (ADS)
Wilding, Timothy J.; Lopez, Melany N.; Huettner, James E.
2014-02-01
Ionotropic glutamate receptors comprise two conformationally different A/C and B/D subunit pairs. Closed channels exhibit fourfold radial symmetry in the transmembrane domain (TMD) but transition to twofold dimer-of-dimers symmetry for extracellular ligand binding and N-terminal domains. Here, to evaluate symmetry in open pores we analysed interaction between the Q/R editing site near the pore loop apex and the transmembrane M3 helix of kainate receptor subunit GluK2. Chimeric subunits that combined the GluK2 TMD with extracellular segments from NMDA receptors, which are obligate heteromers, yielded channels made up of A/C and B/D subunit pairs with distinct substitutions along M3 and/or Q/R site editing status, in an otherwise identical homotetrameric TMD. Our results indicate that Q/R site interaction with M3 occurs within individual subunits and is essentially the same for both A/C and B/D subunit conformations, suggesting that fourfold pore symmetry persists in the open state.
Sweiry, J H; Page, K R; Dacke, C G; Abramovich, D R; Yudilevich, D L
1986-12-01
Rapid uptake and efflux of 45Ca2+ and [3H]choline at the maternal and fetal interfaces of the syncytiotrophoblast in the dually-perfused human placenta was investigated by application of the single circulation paired-tracer dilution method (Yudilevich, Eaton, Short & Leichtweiss 1979). Cotyledons were perfused with Krebs-bicarbonate containing dextran (30 g/l; MW = 60-70,000) at 20 and 6 ml/min on maternal and fetal sides, respectively. The paired-tracer (test substrate and extracellular marker) technique consisted of an intra-arterial injection of a tracer bolus, followed by venous sampling over 5-6 min. There was a rapid (sec) uptake of 45Ca2+, followed by backflux (efflux into the ipsilateral circulation) which, over 5-6 min, was 59-100% on the fetal side. It was more variable but generally lower on the maternal interface. At 0.1 mM calcium, 45Ca2+ maximal uptake (Umax) was about 53% on the fetal side but on the maternal side it was variable and averaged 17%. At 2.4 mM calcium fetal side Umax was reduced to 40%. However, on the maternal side the effect was not consistent. Unidirectional influx (nmol/min per g) appeared to be not different on the two sides of the placenta. For [3H]choline (in choline-free perfusates) Umax was about 50% and 30% on fetal and maternal sides, respectively; tracer backflux was variable on the maternal side and averaged 50% on the fetal side. [3H]Choline uptake was highly inhibited by either 1.0 mM choline or the specific competitive inhibitor, hemicholinium-3 (0.1 mM). Specific transplacental transfer of 45Ca2+ (i.e. in excess of the extracellular marker) was not significant in either direction. For [3H]choline there was an apparent small excess (about 4%) preferential towards the fetal circulation. These findings in the human placenta are similar to those demonstrated previously in the guinea-pig placenta which suggested the existence of specific transport systems for choline and calcium on both sides of the syncytiotrophoblast.
Prieto-Blanco, M C; Alpendurada, M F; López-Mahía, P; Muniategui-Lorenzo, S; Prada-Rodríguez, D; Machado, S; Gonçalves, C
2012-05-30
Haloacetic acids (HAAs) are organic pollutants originated from the drinking water disinfection process, which ought to be controlled and minimized. In this work a method for monitoring haloacetic acids (HAAs) in water samples is proposed, which can be used in quality control laboratories using the techniques most frequently available. Among its main advantages we may highlight its automated character, including minimal steps of sample preparation, and above all, its improved selectivity and sensitivity in the analysis of real samples. Five haloacetic acids (HAA5) were analyzed using solid-phase extraction (SPE) combined with ion-pair liquid chromatography and tandem mass spectrometry. For the optimization of the chromatographic separation, two amines (triethylamine, TEA and dibutylamine, DBA) as ion pair reagents were compared, and a better selectivity and sensitivity was obtained using DBA, especially for monohaloacetic acids. SPE conditions were optimized using different polymeric adsorbents. The electrospray source parameters were studied for maximum precursor ion accumulation, while the collision cell energy of the triple quadrupole mass spectrometer was adjusted for optimum fragmentation. Precursor ions detected were deprotonated, dimeric and decarboxylated ions. The major product ions formed were: ionized halogen atom (chloride and bromide) and decarboxylated ions. After enrichment of the HAAs in Lichrolut EN adsorbent, the limits of detection obtained by LC-MS/MS analysis (between 0.04 and 0.3 ng mL(-1)) were comparable to those obtained by GC-MS after derivatization. Linearity with good correlation coefficients was obtained over two orders of magnitude irrespective of the compound. Adequate recoveries were achieved (60-102%), and the repeatability and intermediate precision were in the range of 2.4-6.6% and 3.8-14.8%, respectively. In order to demonstrate the usefulness of the method for routine HAAs monitoring, different types of water samples were analyzed. In swimming pool water samples the ∑HAAs were determined between 76 and 154 ng mL(-1). Copyright © 2012 Elsevier B.V. All rights reserved.
García-Marco, Sonia; Torreblanca, Ana; Lucena, Juan J
2006-02-22
EDDHA/Fe3+ chelates are the most common fertilizers used to solve Fe chlorosis in established crops. Commercial products contain two regioisomers, ethylenediamine-N,N'-bis(o-hydroxyphenylacetic) acid (o,o-EDDHA)/Fe3+ and ethylenediamine-N-(o-hydroxyphenylacetic)-N'-(p-hydroxyphenylacetic) acid (o,p-EDDHA)/Fe3+. Although several chromatographic methods exist for the determination of Fe3+ chelated by the o,o-EDDHA isomer, no method has been described for the quantification of Fe3+ chelated by o,p-EDDHA. In this work, factors that affect the behavior of o,p-EDDHA/Fe3+ in ion pair chromatography are reviewed: pH, ion pair reagent, and organic modifier. The best chromatographic performance was obtained with an aqueous mobile phase at pH 6.0 containing 35% acetonitrile and 5 mM tetrabutylammonium hydroxide under isocratic elution conditions. This method was applied to the quantification of commercial samples.
Feng, Lihui; Rutherford, Steven T; Papenfort, Kai; Bagert, John D; van Kessel, Julia C; Tirrell, David A; Wingreen, Ned S; Bassler, Bonnie L
2015-01-15
Quorum sensing is a cell-cell communication process that bacteria use to transition between individual and social lifestyles. In vibrios, homologous small RNAs called the Qrr sRNAs function at the center of quorum-sensing pathways. The Qrr sRNAs regulate multiple mRNA targets including those encoding the quorum-sensing regulatory components luxR, luxO, luxM, and aphA. We show that a representative Qrr, Qrr3, uses four distinct mechanisms to control its particular targets: the Qrr3 sRNA represses luxR through catalytic degradation, represses luxM through coupled degradation, represses luxO through sequestration, and activates aphA by revealing the ribosome binding site while the sRNA itself is degraded. Qrr3 forms different base-pairing interactions with each mRNA target, and the particular pairing strategy determines which regulatory mechanism occurs. Combined mathematical modeling and experiments show that the specific Qrr regulatory mechanism employed governs the potency, dynamics, and competition of target mRNA regulation, which in turn, defines the overall quorum-sensing response. Copyright © 2015 Elsevier Inc. All rights reserved.
Evidence for inflation in an axion landscape
NASA Astrophysics Data System (ADS)
Nath, Pran; Piskunov, Maksim
2018-03-01
We discuss inflation models within supersymmetry and supergravity frameworks with a landscape of chiral superfields and one U(1) shift symmetry which is broken by non-perturbative symmetry breaking terms in the superpotential. We label the pseudo scalar component of the chiral fields axions and their real parts saxions. Thus in the models only one combination of axions will be a pseudo-Nambu-Goldstone-boson which will act as the inflaton. The proposed models constitute consistent inflation for the following reasons: the inflation potential arises dynamically with stabilized saxions, the axion decay constant can lie in the sub-Planckian region, and consistency with the Planck data is achieved. The axion landscape consisting of m axion pairs is assumed with the axions in each pair having opposite charges. A fast roll-slow roll splitting mechanism for the axion potential is proposed which is realized with a special choice of the axion basis. In this basis the 2 m coupled equations split into 2 m - 1 equations which enter in the fast roll and there is one unique linear combination of the 2 m fields which controls the slow roll and thus the power spectrum of curvature and tensor perturbations. It is shown that a significant part of the parameter space exists where inflation is successful, i.e., N pivot = [50, 60], the spectral index n s of curvature perturbations, and the ratio r of the power spectrum of tensor perturbations and curvature perturbations, lie in the experimentally allowed regions given by the Planck experiment. Further, it is shown that the model allows for a significant region of the parameter space where the effective axion decay constant can lie in the sub-Planckian domain. An analysis of the tensor spectral index n t is also given and the future experimental data which constraints n t will further narrow down the parameter space of the proposed inflationary models. Topics of further interest include implications of the model for gravitational waves and non-Gaussianities in the curvature perturbations. Also of interest is embedding of the model in strings which are expected to possess a large axionic landscape.
Evolution of the major merger galaxy pair fraction at z < 1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Keenan, R. C.; Hsieh, B. C.; Lin, L.
We present a study of the largest available sample of near-infrared selected (i.e., stellar mass selected) dynamically close pairs of galaxies at low redshifts (z < 0.3). We combine this sample with new estimates of the major merger pair fraction for stellar mass selected galaxies at z < 0.8, from the Red Sequence Cluster Survey (RCS1). We construct our low-redshift K-band selected sample using photometry from the UKIRT Infrared Deep Sky Survey and the Two Micron All Sky Survey (2MASS) in the K band (∼2.2 μm). Combined with all available spectroscopy, our K-band selected sample contains ∼250, 000 galaxies andmore » is >90% spectroscopically complete. The depth and large volume of this sample allow us to investigate the low-redshift pair fraction and merger rate of galaxies over a wide range in K-band luminosity. We find the major merger pair fraction to be flat at ∼2% as a function of K-band luminosity for galaxies in the range 10{sup 8}-10{sup 12} L {sub ☉}, in contrast to recent results from studies in the local group that find a substantially higher low-mass pair fraction. This low-redshift major merger pair fraction is ∼40%-50% higher than previous estimates drawn from K-band samples, which were based on 2MASS photometry alone. Combining with the RCS1 sample, we find a much flatter evolution (m = 0.7 ± 0.1) in the relation f {sub pair}∝(1 + z) {sup m} than indicated in many previous studies. These results indicate that a typical L ∼ L* galaxy has undergone ∼0.2-0.8 major mergers since z = 1 (depending on the assumptions of merger timescale and percentage of pairs that actually merge).« less
Yin, Gang; Cheng, Xiaolan; Tao, Weiwei; Dong, Yu; Bian, Yong; Zang, Wenhua; Tang, Decai
2018-01-30
The herb-pair, Astragali Radix (AR) and Curcumae Rhizoma (CR), often occurs in traditional herbal prescriptions used for cancer treatment in Asian areas. In clinical application, the AR-CR herb pair was often produced by different preparation methods or with raw materials from different sources, which raised a challenge for quality control of the herb-pair medicines. In this paper, ultra high performance liquid chromatography coupled to triple quadrupole tandem mass spectrometry method (UPLC-QQQ-MS) was applied for the first time to simultaneously determine 17 main bioactive components for quality control of AR-CR herb pair. The chromatographic separation was studied on an ACQUITY UPLC BEH C 18 column (100mm×2.1mm, 1.7μm) with a mobile phase composed of 0.1% aqueous formic acid and acetonitrile using a gradient elution in 12min. The proposed method was optimized and validated by good linearity (r 2 >0.9970), limit of detection (0.33-10.78ng/mL), limit of quantification (0.81-2.54ng/mL), intra- and inter-day precisions (RSD≤3.64%, RSD≤5.68%), stability (RSD≤4.29%), repeatability (RSD≤5.98%), recovery (90.20-107.60%). The established method was successfully applied to comparative analysis of main bioactive components in AR-CR herb pair and its single herbs, and quality evaluation of different batches of clinical dispensing granules. Compared to the single herb, the content of most liposoluble constituents such as curcumenol, curdione, isocurcumenol, furanodienone, curcumol, and germacrone were remarkable increased in their herb pair, suggesting mixed preparation produced synergistic effects on promoting the extraction of bioactive ingredients. This study is the first time to report the rapid and simultaneous analysis of 17 compounds in AR-CR herb pair by UPLC-QQQ-MS, and provides a feasible method for holistic quality control of preparations containing AR-CR herb-pair. Copyright © 2017 Elsevier B.V. All rights reserved.
On the mass of the local group
DOE Office of Scientific and Technical Information (OSTI.GOV)
González, Roberto E.; Kravtsov, Andrey V.; Gnedin, Nickolay Y., E-mail: regonzar@astro.puc.cl
2014-10-01
We use recent proper motion measurements of the tangential velocity of M31, along with its radial velocity and distance, to derive the likelihood of the sum of halo masses of the Milky Way and M31. This is done using a sample of halo pairs in the Bolshoi cosmological simulation of ΛCDM cosmology selected to match the properties and the environment of the Local Group. The resulting likelihood gives an estimate of the sum of the masses of M {sub MW,} {sub 200c} + M {sub M31,} {sub 200c} = 2.40{sub −1.05}{sup +1.95}×10{sup 12} M{sub ⊙} (90% confidence interval). This estimatemore » is consistent with individual mass estimates for the Milky Way and M31 and is consistent, albeit somewhat on the low side, with the mass estimated using the timing argument. We show that although the timing argument is unbiased on average for all pairs, for pairs constrained to have radial and tangential velocities similar to that of the Local Group the argument overestimates the sum of masses by a factor of 1.6. Using similar technique, we estimate the total dark matter mass enclosed within 1 Mpc from the Local Group barycenter to be M{sub LG}(r<1 Mpc)=4.2{sub −2.0}{sup +3.4}×10{sup 12} M{sub ⊙} (90% confidence interval).« less
Structural insight into the Ragulator complex which anchors mTORC1 to the lysosomal membrane
Mu, Zongkai; Wang, Lei; Deng, Wei; Wang, Jiawei; Wu, Geng
2017-01-01
The mechanistic target of rapamycin (mTOR) signal-transduction pathway plays a key role in regulating many aspects of metabolic processes. The central player of the mTOR signaling pathway, mTOR complex 1 (mTORC1), is recruited by the pentameric Ragulator complex and the heterodimeric Rag GTPase complex to the lysosomal membrane and thereafter activated. Here, we determined the crystal structure of the human Ragulator complex, which shows that Lamtor1 possesses a belt-like shape and wraps the other four subunits around. Extensive hydrophobic interactions occur between Lamtor1 and the Lamtor2-Lamtor3, Lamtor4-Lamtor5 roadblock domain protein pairs, while there is no substantial contact between Lamtor2-Lamtor3 and Lamtor4-Lamtor5 subcomplexes. Interestingly, an α-helix from Lamtor1 occupies each of the positions on Lamtor4 and Lamtor5 equivalent to the α3-helices of Lamtor2 and Lamtor3, thus stabilizing Lamtor4 and Lamtor5. Structural comparison between Ragulator and the yeast Ego1-Ego2-Ego3 ternary complex (Ego-TC) reveals that Ego-TC only corresponds to half of the Ragulator complex. Coupling with the fact that in the Ego-TC structure, Ego2 and Ego3 are lone roadblock domain proteins without another roadblock domain protein pairing with them, we suggest that additional components of the yeast Ego complex might exist. PMID:29285400
Evaluation of hirst-type spore trap to monitor environmental fungal load in hospital
Gustin, Marie-Paule; Cassier, Pierre; Loeffert, Sophie Tiphaine; Thibaudon, Michel; Bénet, Thomas; Vanhems, Philippe
2017-01-01
The main purpose was to validate the use of outdoor-indoor volumetric impaction sampler with Hirst-type spore traps (HTSTs) to continuously monitor fungal load in order to prevent invasive fungal infections during major structural work in hospital settings. For 4 weeks, outdoor fungal loads were quantified continuously by 3 HTSTs. Indoor air was sampled by both HTST and viable impaction sampler. Results were expressed as particles/m3 (HTST) or colony-forming units (CFU)/m3 (biocollector). Paired comparisons by day were made with Wilcoxon’s paired signed-rank test or paired Student’s t-test as appropriate. Paired airborne spore levels were correlated 2 by 2, after log-transformation with Pearson’s cross-correlation. Concordance was calculated with kappa coefficient (κ). Median total fungal loads (TFLs) sampled by the 3 outdoor HTSTs were 3,025.0, 3,287.5 and 3,625.0 particles/m3 (P = 0.6, 0.6 and 0.3).—Concordance between Aspergillaceae fungal loads (AFLs, including Aspergillus spp. + Penicillium spp.) was low (κ = 0.2). A low positive correlation was found between TFLs sampled with outdoor HTST and indoor HTST with applying a 4-hour time lag, r = 0.30, 95% CI (0.23–0.43), P<0.001. In indoor air, Aspergillus spp. were detected by the viable impaction sampler on 63.1% of the samples, whereas AFLs were found by HTST-I on only 3.6% of the samples. Concordance between Aspergillus spp. loads and AFLs sampled with the 2 methods was very low (κ = 0.1). This study showed a 4-hour time lag between increase of outdoor and indoor TFLs, possibly due to insulation and aeraulic flow of the building. Outdoor HTSTs may permit to quickly identify (after 48 hours) time periods with high outdoor fungal loads. An identified drawback is that a too low sample area read did not seem to enable detection of Aspergillaceae spores efficiently. Indoor HTSTs may not be recommended at this time, and outdoor HTSTs need further study. Air sampling by viable impaction sampler remains the reference tool for quantifying fungal contamination of indoor air in hospitals. PMID:28486534
Evaluation of hirst-type spore trap to monitor environmental fungal load in hospital.
Dananché, Cédric; Gustin, Marie-Paule; Cassier, Pierre; Loeffert, Sophie Tiphaine; Thibaudon, Michel; Bénet, Thomas; Vanhems, Philippe
2017-01-01
The main purpose was to validate the use of outdoor-indoor volumetric impaction sampler with Hirst-type spore traps (HTSTs) to continuously monitor fungal load in order to prevent invasive fungal infections during major structural work in hospital settings. For 4 weeks, outdoor fungal loads were quantified continuously by 3 HTSTs. Indoor air was sampled by both HTST and viable impaction sampler. Results were expressed as particles/m3 (HTST) or colony-forming units (CFU)/m3 (biocollector). Paired comparisons by day were made with Wilcoxon's paired signed-rank test or paired Student's t-test as appropriate. Paired airborne spore levels were correlated 2 by 2, after log-transformation with Pearson's cross-correlation. Concordance was calculated with kappa coefficient (κ). Median total fungal loads (TFLs) sampled by the 3 outdoor HTSTs were 3,025.0, 3,287.5 and 3,625.0 particles/m3 (P = 0.6, 0.6 and 0.3).-Concordance between Aspergillaceae fungal loads (AFLs, including Aspergillus spp. + Penicillium spp.) was low (κ = 0.2). A low positive correlation was found between TFLs sampled with outdoor HTST and indoor HTST with applying a 4-hour time lag, r = 0.30, 95% CI (0.23-0.43), P<0.001. In indoor air, Aspergillus spp. were detected by the viable impaction sampler on 63.1% of the samples, whereas AFLs were found by HTST-I on only 3.6% of the samples. Concordance between Aspergillus spp. loads and AFLs sampled with the 2 methods was very low (κ = 0.1). This study showed a 4-hour time lag between increase of outdoor and indoor TFLs, possibly due to insulation and aeraulic flow of the building. Outdoor HTSTs may permit to quickly identify (after 48 hours) time periods with high outdoor fungal loads. An identified drawback is that a too low sample area read did not seem to enable detection of Aspergillaceae spores efficiently. Indoor HTSTs may not be recommended at this time, and outdoor HTSTs need further study. Air sampling by viable impaction sampler remains the reference tool for quantifying fungal contamination of indoor air in hospitals.
Exotic colored scalars at the LHC
NASA Astrophysics Data System (ADS)
Blum, Kfir; Efrati, Aielet; Frugiuele, Claudia; Nir, Yosef
2017-02-01
We study the phenomenology of exotic color-triplet scalar particles X with charge | Q| = 2 /3 , 4 /3 , 5 /3 , 7 /3 , 8 /3 and 10 /3. If X is an SU(2) W -non-singlet, mass splitting within the multiplet allows for cascade decays of the members into the lightest state. We study examples where the lightest state, in turn, decays into a three-body W ± jj final state, and show that in such case the entire multiplet is compatible with indirect precision tests and with direct collider searches for continuum pair production of X down to m X ˜ 250 GeV. However, bound states S, made of XX † pairs at m S ≈ 2 m X , form under rather generic conditions and their decay to diphoton can be the first discovery channel of the model. Furthermore, for SU(2) W -non-singlets, the mode S → W + W - may be observable and the width of S → γγ and S → jj may appear large as a consequence of mass splittings within the X-multiplet. As an example we study in detail the case of an SU(2) W -quartet, finding that m X ≃ 450 GeV is allowed by all current searches.
da Silva, Patrícia Corrêa; Nagamachi, Cleusa Yoshiko; Silva, Danillo dos Santos; Milhomem, Susana Suely Rodrigues; Cardoso, Adauto Lima; de Oliveira, Jonas Alves; Pieczarka, Julio Cesar
2013-01-01
Abstract The family Rhamphichthyidae includes three genera: Rhamphichthys Müller et Troschel, 1846, Gymnorhamphichthys M. M. Ellis, 1912 and Iracema Triques, 1996. From this family, only the species Rhamphichthys hanni Meinken, 1937 has had its karyotype described. Here, we describe the karyotypes of two additional Rhamphichthys species: Rhamphichthys marmoratus Castelnau, 1855 from the Reserva de Desenvolvimento Sustentável Mamirauá, Amazonas state and Rhamphichthys prope rostratus Linnaeus, 1766 from Pará state, both in Brazil. Our karyotypic analyses demonstrated that the diploid number is conserved for the genus (2n = 50), but the karyotypic formulas (KFs) differed between Rhamphichthys marmoratus (44m/sm+6a) and Rhamphichthys prope rostratus (42m/sm+8a). In both species, the constitutive heterochromatin (CH) was located in the centromeric region of most chromosomes. Large heterochromatic blocks were found on the long arms of pairs 4 and 14 in Rhamphichthys marmoratus and on chromosomes 3, 4 and 19 in Rhamphichthys prope rostratus, which also has a heteromorphism in chromosome pair 1. The CH was DAPI positive, indicating that it is rich in AT base pairs. The Nucleolus Organizer Region (NOR) showed staining at a single location in both species: the long arm of pair 1 in Rhamphichthys marmoratus and the long arm of pair 12 in Rhamphichthys prope rostratus, where it showed a size heteromorphism. CMA3 staining coincided with that of Ag-NOR, indicating that the ribosomal genes contain interspaced GC-rich sequences. FISH with an 18S rDNA probe confirmed that there is only one NOR site in each species. These results can be used as potential cytogenetic markers for fish populations, and comparative analysis of the karyotypes of Hypopygus Hoedman, 1962, Rhamphichthys and Steatogenys Boulenger, 1898 suggests that the first two genera diverged later that the third. PMID:24455102
Ssengooba, Willy; de Jong, Bouke C; Joloba, Moses L; Cobelens, Frank G; Meehan, Conor J
2016-08-05
In the context of advanced immunosuppression, M. tuberculosis is known to cause detectable mycobacteremia. However, little is known about the intra-patient mycobacterial microevolution and the direction of seeding between the sputum and blood compartments. From a diagnostic study of HIV-infected TB patients, 51 pairs of concurrent blood and sputum M. tuberculosis isolates from the same patient were available. In a previous analysis, we identified a subset with genotypic concordance, based on spoligotyping and 24 locus MIRU-VNTR. These paired isolates with identical genotypes were analyzed by whole genome sequencing and phylogenetic analysis. Of the 25 concordant pairs (49 % of the 51 paired isolates), 15 (60 %) remained viable for extraction of high quality DNA for whole genome sequencing. Two patient pairs were excluded due to poor quality sequence reads. The median CD4 cell count was 32 (IQR; 16-101)/mm(3) and ten (77 %) patients were on ART. No drug resistance mutations were identified in any of the sequences analyzed. Three (23.1 %) of 13 patients had SNPs separating paired isolates from blood and sputum compartments, indicating evidence of microevolution. Using a phylogenetic approach to identify the ancestral compartment, in two (15 %) patients the blood isolate was ancestral to the sputum isolate, in one (8 %) it was the opposite, and ten (77 %) of the pairs were identical. Among HIV-infected patients with poor cellular immunity, infection with multiple strains of M. tuberculosis was found in half of the patients. In those patients with identical strains, whole genome sequencing indicated that M. tuberculosis intra-patient microevolution does occur in a few patients, yet did not reveal a consistent direction of spread between sputum and blood. This suggests that these compartments are highly connected and potentially seed each other repeatedly.
Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang
2018-06-08
A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.
Walimbe, Vivek; Shekhar, Raj
2006-12-01
We present an algorithm for automatic elastic registration of three-dimensional (3D) medical images. Our algorithm initially recovers the global spatial mismatch between the reference and floating images, followed by hierarchical octree-based subdivision of the reference image and independent registration of the floating image with the individual subvolumes of the reference image at each hierarchical level. Global as well as local registrations use the six-parameter full rigid-body transformation model and are based on maximization of normalized mutual information (NMI). To ensure robustness of the subvolume registration with low voxel counts, we calculate NMI using a combination of current and prior mutual histograms. To generate a smooth deformation field, we perform direct interpolation of six-parameter rigid-body subvolume transformations obtained at the last subdivision level. Our interpolation scheme involves scalar interpolation of the 3D translations and quaternion interpolation of the 3D rotational pose. We analyzed the performance of our algorithm through experiments involving registration of synthetically deformed computed tomography (CT) images. Our algorithm is general and can be applied to image pairs of any two modalities of most organs. We have demonstrated successful registration of clinical whole-body CT and positron emission tomography (PET) images using this algorithm. The registration accuracy for this application was evaluated, based on validation using expert-identified anatomical landmarks in 15 CT-PET image pairs. The algorithm's performance was comparable to the average accuracy observed for three expert-determined registrations in the same 15 image pairs.
Xu, Ming-Yi; Jia, Xiao-Fang; Qu, Ying; Zheng, Rui-Dan; Yuan, Zheng-Hong; Weng, Hong-Lei; Dooley, Steven; Wang, Xing-Peng; Zhang, Li-Jun; Lu, Lun-Gen
2013-09-27
Due to known limitations of liver biopsy, reliable non-invasive serum biomarkers for chronic liver diseases are needed. We performed serum peptidomics for such investigation in compensated chronic hepatitis B (CHB) patients. Liquid chromatography combined with tandem mass spectrometry (LC-MS/MS) was used to identify differentially expressed peptides in sera from 40 CHB patients (20 with S0G0-S1G1 and 20 with S3G3-S4G4). Ion pair quantification from differentially expressed peptides in a validation set of sera from 86 CHB patients was done with multiple reaction monitoring (MRM). 21 differentially represented peptide peaks were found through LC-MS/MS. Ion pairs generated from eleven of these peptides (m/z < 800) were quantified by MRM. Summed peak area ratios of 6 ion pairs from peptide m/z 520.3 (176.1, 353.7, 459.8, 503.3, 351.3, 593.1), which was identified as dihydroxyacetone kinase (DAK) fragment, decreased from mild to advanced stages of fibrosis or inflammation. Area Under Receiver Operating Characteristic Curves (AUROCs) of five ion models discriminating fibrosis degrees were 0.871 ~ 0.915 (S2-4 versus S0-1) and 0.804 ~ 0.924 (S3-4 versus S0-2). AUROCs discriminating inflammation grades were 0.840 ~ 0.902 (G2-4 versus G0-1) and 0.787 ~ 0.888 (G3-4 versus G0-2). The diagnostic power of these models provides improved sensitivity and specificity for predicting disease progression as compared to aspartate aminotransferase to platelet ratio index (APRI), FIB-4, Forn's index and serum DAK protein. The peptide fragment (m/z 520.3) of DAK is a promising biomarker to guide timing of antiviral treatment and to avoid liver biopsy in compensated CHB patients.
2013-01-01
Background & aim Due to known limitations of liver biopsy, reliable non-invasive serum biomarkers for chronic liver diseases are needed. We performed serum peptidomics for such investigation in compensated chronic hepatitis B (CHB) patients. Methods Liquid chromatography combined with tandem mass spectrometry (LC-MS/MS) was used to identify differentially expressed peptides in sera from 40 CHB patients (20 with S0G0-S1G1 and 20 with S3G3-S4G4). Ion pair quantification from differentially expressed peptides in a validation set of sera from 86 CHB patients was done with multiple reaction monitoring (MRM). Results 21 differentially represented peptide peaks were found through LC-MS/MS. Ion pairs generated from eleven of these peptides (m/z < 800) were quantified by MRM. Summed peak area ratios of 6 ion pairs from peptide m/z 520.3 (176.1, 353.7, 459.8, 503.3, 351.3, 593.1), which was identified as dihydroxyacetone kinase (DAK) fragment, decreased from mild to advanced stages of fibrosis or inflammation. Area Under Receiver Operating Characteristic Curves (AUROCs) of five ion models discriminating fibrosis degrees were 0.871 ~ 0.915 (S2-4 versus S0-1) and 0.804 ~ 0.924 (S3-4 versus S0-2). AUROCs discriminating inflammation grades were 0.840 ~ 0.902 (G2-4 versus G0-1) and 0.787 ~ 0.888 (G3-4 versus G0-2). The diagnostic power of these models provides improved sensitivity and specificity for predicting disease progression as compared to aspartate aminotransferase to platelet ratio index (APRI), FIB-4, Forn’s index and serum DAK protein. Conclusions The peptide fragment (m/z 520.3) of DAK is a promising biomarker to guide timing of antiviral treatment and to avoid liver biopsy in compensated CHB patients. PMID:24289155
Lee, Ji-Hyun; Kim, Su-Jin; Lee, Sul; Rhee, Jin-Kyu; Lee, Soo Young; Na, Yun-Cheol
2017-09-01
A sensitive and selective capillary electrophoresis-mass spectrometry (CE-MS) method for determination of saturated fatty acids (FAs) was developed by using dicationic ion-pairing reagents forming singly charged complexes with anionic FAs. For negative ESI detection, 21 anionic FAs at pH 10 were separated using ammonium formate buffer containing 40% acetonitrile modifier in normal polarity mode in CE by optimizing various parameters. This method showed good separation efficiency, but the sensitivity of the method to short-chain fatty acids was quite low, causing acetic and propionic acids to be undetectable even at 100 mgL -1 in negative ESI-MS detection. Out of the four dicationic ion-pairing reagents tested, N,N'-dibutyl 1,1'-pentylenedipyrrolidium infused through a sheath-liquid ion source during CE separation was the best reagent regarding improved sensitivity and favorably complexed with anionic FAs for detection in positive ion ESI-MS. The monovalent complex showed improved ionization efficiency, providing the limits of detection (LODs) for 15 FAs ranging from 0.13 to 2.88 μg/mL and good linearity (R 2 > 0.99) up to 150 μg/mL. Compared to the negative detection results, the effect was remarkable for the detection of short- and medium-chain fatty acids. The optimized CE-paired ion electrospray (PIESI)-MS method was utilized for the determination of FAs in cheese and coffee with simple pretreatment. This method may be extended for sensitive analysis of unsaturated fatty acids. Copyright © 2017 Elsevier B.V. All rights reserved.
Aaltonen, T.; Amerio, S.; Amidei, D.; ...
2016-06-28
Here, at the Fermilab Tevatron proton-antiproton (pmore » $$\\bar{p}$$) collider, Drell-Yan lepton pairs are produced in the process p$$\\bar{p}$$→e +e -+X through an intermediate γ*/Z boson. The forward-backward asymmetry in the polar-angle distribution of the e - as a function of the e +e --pair mass is used to obtain sin 2θ$$lept\\atop{eff}$$, the effective leptonic determination of the electroweak-mixing parameter sin2θW. The measurement sample, recorded by the Collider Detector at Fermilab (CDF), corresponds to 9.4 fb -1 of integrated luminosity from p$$\\bar{p}$$ collisions at a center-of-momentum energy of 1.96 TeV, and is the full CDF Run II data set. The value of sin 2θ$$lept\\atop{eff}$$ is found to be 0.23248±0.00053. The combination with the previous CDF measurement based on μ +μ - pairs yields sin 2θ$$lept\\atop{eff}$$=0.23221±0.00046. This result, when interpreted within the specified context of the standard model assuming sin 2θW=1-M$$2\\atop{W}$$/M$$2\\atop{Z}$$ and that the W- and Z-boson masses are on-shell, yields sin 2θW=0.22400±0.00045, or equivalently a W-boson mass of 80.328±0.024 GeV/c 2.« less
Validation of ERS-1 environmental data products
NASA Technical Reports Server (NTRS)
Goodberlet, Mark A.; Swift, Calvin T.; Wilkerson, John C.
1994-01-01
Evaluation of the launch-version algorithms used by the European Space Agency (ESA) to derive wind field and ocean wave estimates from measurements of sensors aboard the European Remote Sensing satellite, ERS-1, has been accomplished through comparison of the derived parameters with coincident measurements made by 24 open ocean buoys maintained by the National Oceanic and Atmospheric Administration). During the period from November 1, 1991 through February 28, 1992, data bases with 577 and 485 pairs of coincident sensor/buoy wind and wave measurements were collected for the Active Microwave Instrument (AMI) and Radar Altimeter (RA) respectively. Based on these data, algorithm retrieval accuracy is estimated to be plus or minus 4 m/s for AMI wind speed, plus or minus 3 m/s for RA wind speed and plus or minus 0.6 m for RA wave height. After removing 180 degree ambiguity errors, the AMI wind direction retrieval accuracy was estimated at plus or minus 28 degrees. All of the ERS-1 wind and wave retrievals are relatively unbiased. These results should be viewed as interim since improved algorithms are under development. As final versions are implemented, additional assessments should be conducted to complete the validation.
Effect of diet on dental development in four species of catarrhine primates.
Dirks, Wendy
2003-09-01
In this study, dental development is described in two pairs of closely related catarrhine primate species that differ in their degree of folivory: 1) Hylobates lar and Symphalangus syndactylus, and 2) Papio hamadryas hamadryas and Semnopithecus entellus. Growth increments in histological thin sections are used to reconstruct the chronology of dental development to determine how dental development is accelerated in the more folivorous species of each pair. Although anterior tooth formation appears to be unrelated to diet, both S. syndactylus and S. entellus initiate the slowest-forming molar earlier than the related less-folivorous species, which supports the hypothesis that dental acceleration is related to food processing. S. syndactylus initiates M2 crown formation at an earlier age than H. lar, and S. entellus initiates and completes M3 at an earlier age than P. h. hamadryas. Similar stages of M3 eruption occur earlier in the more folivorous species; however, the sex of the individual may also play a role in creating such differences. Although the age at M3 emergence is close to that reported for the end of body mass growth in lar gibbons, hamadryas baboons, and Hanuman langurs, M3 emergence may not be coupled to body mass growth in siamangs. Copyright 2003 Wiley-Liss, Inc.
Feature Positioning on Google Street View Panoramas
NASA Astrophysics Data System (ADS)
Tsai, V. J. D.; Chang, C.-T.
2012-07-01
Location-based services (LBS) on web-based maps and images have come into real-time since Google launched its Street View imaging services in 2007. This research employs Google Maps API and Web Service, GAE for JAVA, AJAX, Proj4js, CSS and HTML in developing an internet platform for accessing the orientation parameters of Google Street View (GSV) panoramas in order to determine the three dimensional position of interest features that appear on two overlapping panoramas by geometric intersection. A pair of GSV panoramas was examined using known points located on the Library Building of National Chung Hsing University (NCHU) with the root-mean-squared errors of ±0.522m, ±1.230m, and ±5.779m for intersection and ±0.142m, ±1.558m, and ±5.733m for resection in X, Y, and h (elevation), respectively. Potential error sources in GSV positioning were analyzed and illustrated that the errors in Google provided GSV positional parameters dominate the errors in geometric intersection. The developed system is suitable for data collection in establishing LBS applications integrated with Google Maps and Google Earth in traffic sign and infrastructure inventory by adding automatic extraction and matching techniques for points of interest (POI) from GSV panoramas.
Statistical analysis of aerosol species, trace gasses, and meteorology in Chicago.
Binaku, Katrina; O'Brien, Timothy; Schmeling, Martina; Fosco, Tinamarie
2013-09-01
Both canonical correlation analysis (CCA) and principal component analysis (PCA) were applied to atmospheric aerosol and trace gas concentrations and meteorological data collected in Chicago during the summer months of 2002, 2003, and 2004. Concentrations of ammonium, calcium, nitrate, sulfate, and oxalate particulate matter, as well as, meteorological parameters temperature, wind speed, wind direction, and humidity were subjected to CCA and PCA. Ozone and nitrogen oxide mixing ratios were also included in the data set. The purpose of statistical analysis was to determine the extent of existing linear relationship(s), or lack thereof, between meteorological parameters and pollutant concentrations in addition to reducing dimensionality of the original data to determine sources of pollutants. In CCA, the first three canonical variate pairs derived were statistically significant at the 0.05 level. Canonical correlation between the first canonical variate pair was 0.821, while correlations of the second and third canonical variate pairs were 0.562 and 0.461, respectively. The first canonical variate pair indicated that increasing temperatures resulted in high ozone mixing ratios, while the second canonical variate pair showed wind speed and humidity's influence on local ammonium concentrations. No new information was uncovered in the third variate pair. Canonical loadings were also interpreted for information regarding relationships between data sets. Four principal components (PCs), expressing 77.0 % of original data variance, were derived in PCA. Interpretation of PCs suggested significant production and/or transport of secondary aerosols in the region (PC1). Furthermore, photochemical production of ozone and wind speed's influence on pollutants were expressed (PC2) along with overall measure of local meteorology (PC3). In summary, CCA and PCA results combined were successful in uncovering linear relationships between meteorology and air pollutants in Chicago and aided in determining possible pollutant sources.
A phenomenological continuum model for force-driven nano-channel liquid flows
NASA Astrophysics Data System (ADS)
Ghorbanian, Jafar; Celebi, Alper T.; Beskok, Ali
2016-11-01
A phenomenological continuum model is developed using systematic molecular dynamics (MD) simulations of force-driven liquid argon flows confined in gold nano-channels at a fixed thermodynamic state. Well known density layering near the walls leads to the definition of an effective channel height and a density deficit parameter. While the former defines the slip-plane, the latter parameter relates channel averaged density with the desired thermodynamic state value. Definitions of these new parameters require a single MD simulation performed for a specific liquid-solid pair at the desired thermodynamic state and used for calibration of model parameters. Combined with our observations of constant slip-length and kinematic viscosity, the model accurately predicts the velocity distribution and volumetric and mass flow rates for force-driven liquid flows in different height nano-channels. Model is verified for liquid argon flow at distinct thermodynamic states and using various argon-gold interaction strengths. Further verification is performed for water flow in silica and gold nano-channels, exhibiting slip lengths of 1.2 nm and 15.5 nm, respectively. Excellent agreements between the model and the MD simulations are reported for channel heights as small as 3 nm for various liquid-solid pairs.
Perspectives on continuum flow models for force-driven nano-channel liquid flows
NASA Astrophysics Data System (ADS)
Beskok, Ali; Ghorbanian, Jafar; Celebi, Alper
2017-11-01
A phenomenological continuum model is developed using systematic molecular dynamics (MD) simulations of force-driven liquid argon flows confined in gold nano-channels at a fixed thermodynamic state. Well known density layering near the walls leads to the definition of an effective channel height and a density deficit parameter. While the former defines the slip-plane, the latter parameter relates channel averaged density with the desired thermodynamic state value. Definitions of these new parameters require a single MD simulation performed for a specific liquid-solid pair at the desired thermodynamic state and used for calibration of model parameters. Combined with our observations of constant slip-length and kinematic viscosity, the model accurately predicts the velocity distribution and volumetric and mass flow rates for force-driven liquid flows in different height nano-channels. Model is verified for liquid argon flow at distinct thermodynamic states and using various argon-gold interaction strengths. Further verification is performed for water flow in silica and gold nano-channels, exhibiting slip lengths of 1.2 nm and 15.5 nm, respectively. Excellent agreements between the model and the MD simulations are reported for channel heights as small as 3 nm for various liquid-solid pairs.
Coupling Molecular Beacons to Barcoded Metal Nanowires for Multiplexed, Sealed Chamber DNA Bioassays
Stoermer, Rebecca L.; Cederquist, Kristin B.; McFarland, Sean K.; Sha, Michael Y.; Penn, Sharron G.
2010-01-01
We have combined molecular beacon (MB) probes with barcoded metal nanowires to enable no-wash, sealed chamber, multiplexed detection of nucleic acids. Probe design and experimental parameters important in nanowire-based MB assays are discussed. Loop regions of 24 bases and 5 base pair stem regions in the beacon probes gave optimal performance. Our results suggest that thermodynamic predictions for secondary structure stability of solution-phase MB can guide probe design for nanowire-based assays. Dengue virus-specific probes with predicted solution-phase ΔG of folding in 500 mM buffered NaCl of approximately −4 kcal/mol performed better than those with ΔG > −2 or < −6 kcal/mol. Buffered 300–500 mM NaCl was selected after comparison of several buffers previously reported for similar types of assays, and 200–500 mM NaCl was found to be the optimal ionic strength for the hybridization temperatures (25 and 50 °C) and probe designs used here. Target binding to the surface as a function of solution concentration fit a Sips isotherm with Kd = 1.7 ± 0.3 nM. The detection limit was ∼100 pM, limited by incomplete quenching. Single base mismatches could be discriminated from fully complementary targets. Oligonucleotide target sequences specific for human immunodeficiency, hepatitis C, and severe acute respiratory viruses were assayed simultaneously in a no-wash, sealed chamber, multiplexed experiment in which each of three probe sequences was attached to a different pattern of encoded nanowires. Finally, we demonstrated that probe-coated nanowires retain their selectivity and sensitivity in a triplexed assay after storage for over 3 months. PMID:17177440
Sun, Jiannan; Wang, Dan; Cheng, Heyong; Liu, Jinhua; Wang, Yuanchao; Xu, Zigang
2015-01-30
This study achieved resolution improvement for iodine speciation in the presence of an ion-pairing reagent by a pressure-driven capillary electrophoresis (CE) system. Addition of 0.01mM tetrabutyl ammonium hydroxide (TBAH) as the ion-pairing reagent into the electrophoretic buffer resulted in the complete separation of four iodine species (I(-), IO3(-), mono-iodothyrosine-MIT and di-iodothyrosine-DIT), because of the electrostatic interaction between TBAH and the negatively charged analytes. A +16kV separation voltage was applied along the separation capillary (50μm i.d., 80cm total and 60cm effective) with the inlet grounded. The detection wavelength was fixed at 210nm, and the pressure-driven flow rate was set at 0.12mLmin(-1) with an injected volume of 2μL. The optimal electrolyte consisted of 2mM borate, 2mM TBAH and 80% methanol with pH adjusted to 8.5. Baseline separation of iodine species was achieved within 7min. The detection limits for I(-), IO3(-), MIT and DIT were 0.052, 0.040, 0.032 and 0.025mgL(-1), respectively. The relative standard deviations of peak heights and areas were all below 3% for 5mgL(-1) and 5% for 1mgL(-1). Application of the proposed method was demonstrated by speciation analysis of iodine in two seaweed samples. The developed method offered satisfactory recoveries in the 91-99% range and good precisions (<5%). Good agreement between the determined values by the proposed CE method and the HPLC-ICP-MS method was also obtained. All results proved its great potential in routine analysis of iodine speciation in environmental, food and biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.
First-order kinetic gas generation model parameters for wet landfills.
Faour, Ayman A; Reinhart, Debra R; You, Huaxin
2007-01-01
Landfill gas collection data from wet landfill cells were analyzed and first-order gas generation model parameters were estimated for the US EPA landfill gas emissions model (LandGEM). Parameters were determined through statistical comparison of predicted and actual gas collection. The US EPA LandGEM model appeared to fit the data well, provided it is preceded by a lag phase, which on average was 1.5 years. The first-order reaction rate constant, k, and the methane generation potential, L(o), were estimated for a set of landfills with short-term waste placement and long-term gas collection data. Mean and 95% confidence parameter estimates for these data sets were found using mixed-effects model regression followed by bootstrap analysis. The mean values for the specific methane volume produced during the lag phase (V(sto)), L(o), and k were 33 m(3)/Megagrams (Mg), 76 m(3)/Mg, and 0.28 year(-1), respectively. Parameters were also estimated for three full scale wet landfills where waste was placed over many years. The k and L(o) estimated for these landfills were 0.21 year(-1), 115 m(3)/Mg, 0.11 year(-1), 95 m(3)/Mg, and 0.12 year(-1) and 87 m(3)/Mg, respectively. A group of data points from wet landfills cells with short-term data were also analyzed. A conservative set of parameter estimates was suggested based on the upper 95% confidence interval parameters as a k of 0.3 year(-1) and a L(o) of 100 m(3)/Mg if design is optimized and the lag is minimized.
Singh, Yuvraj; Chandrashekar, Anumandla; Pawar, Vivek K; Saravanakumar, Veeramuthu; Meher, Jayagopal; Raval, Kavit; Singh, Pankaj; Kumar, R Dinesh; Chourasia, Manish K
2017-01-01
Ion pair chromatography was used for quantifying bendamustine hydrochloride (BH) in its marketed vial. The permissive objective was to investigate time duration for which highly susceptible drug content of the marketed vial remained stable after reconstitution. However, the method could also be used to measure extremely low levels of drug in rat plasma and a pharmacokinetic study was accordingly conducted to further showcase method's applicability. Optimized separation was achieved on C-18 Purospher ® STAR (250 mm × 4.6 mm, 5 μm particle size) column. Mobile phase flowing at 1.5 mL/min consisted of 5 mM sodium salt of octane sulfonic acid dissolved in methanol, water and glacial acetic acid (55:45:0.075) maintained at pH 6. Detection was carried out at 233 nm with BH eluting after 7.8 min. Validation parameters were determined as per ICH guidelines. Limit of detection and limit of quantification were found to be 0.1 µg/mL and 0.33 µg/mL, respectively. The recoveries were 98-102% in bulk and 85-91% in plasma. The developed method was specific for BH, and utilized for assessing its short-term stability in physiologic solvents and forced degradation products in acid, base, oxidative, light and temperature induced stress environments. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
The circumbinary dusty disk around the hydrogen-deficient binary star υ Sagittarii
NASA Astrophysics Data System (ADS)
Netolický, M.; Bonneau, D.; Chesneau, O.; Harmanec, P.; Koubský, P.; Mourard, D.; Stee, P.
2009-06-01
Aims: The aim of this paper is to determine the properties of the dusty environment of the hydrogen-deficient binary system υ Sgr, whose binary properties and other characteristics are poorly known. Methods: We obtained the first mid-IR interferometric observations of υ Sgr using the instrument MIDI of the VLTI used with different pairs of 1.8 m and 8 m telescopes. The calibrated visibilities, the N band spectrum, and the SED were compared with disk models computed with the MC3D code to determine the geometry and chemical composition of the envelope. Results: υ Sgr is unresolved with an 8 m telescope at 8.7 μm. We propose a disk model that agrees with the measured visibilities and the SED, consisting of a geometrically thin disk with an inner radius R_in = 6.0+0.5-1.5 AU and a scale height h100 = 3.5+2.0-1.5 AU. The chemical composition of the dust is approximately 60% of carbon dust and 40% of silicate dust, as a consequence of several episodes of mass transfers, whose chemistry was imprinted in the dust composition. We also constrain the inclination of the disk i = 50°+10°-20° and its orientation position angle PA = 80°+10°-5°. Conclusions: The mid-infrared interferometric observations of the binary star υ Sgr allowed us to constrain the geometry of the circumbinary dusty envelope. By defining the inclination and PA of the system with better accuracy than before, these observations restrict the parameter space for the orbital parameters and thus the nature of the stars orbiting in this system. Based on observations made with the Very Large Telescope Interferometer at Paranal Observatory under program 079.D-0115. Visibility data are only available in electronic form at the CDS website.
A Model for the Vortex Pair Associated with a Jet in a Cross Flow
NASA Technical Reports Server (NTRS)
Sellers, William L.
1975-01-01
A model is presented for the contrarotating vortex pair that is formed by a round, turbulent, subsonic jet directed normally into a uniform, subsonic cross flow. The model consists of a set of algebraic equations that describe the properties of the vortex pair as a function of their location in the jet plume. The parameters of the model are physical characteristics of the vortices such as the vortex strength, spacing, and core size. These parameters are determined by velocity measurements at selective points in the jet plume.
Superconductivity in the Penson-Kolb Model on a Triangular Lattice
NASA Astrophysics Data System (ADS)
Ptok, A.; Mierzejewski, M.
2008-07-01
We investigate properties of the two-dimensional Penson-Kolb model with repulsive pair hopping interaction. In the case of a bipartite square lattice this interaction may lead to the η-type pairing, when the phase of superconducting order parameter changes from one lattice site to the neighboring one. We show that this interaction may be responsible for the onset of superconductivity also for a triangular lattice. We discuss the spatial dependence of the superconducting order parameter and demonstrate that the total momentum of the paired electrons is determined by the lattice geometry.
Wang, Ji-Rui; Xu, Zhi-Hong; Du, Yu-Zhou
2017-01-01
Abstract A new whitefly species, Aleuromarginatus dielsianae Wang & Xu, sp. n. collected from Millettia dielsiana Harms (Rosales: Fabaceae) in Jiangshan (28°40'N, 118°40'E, 512 m) and Xinchang (29°22'N, 120°46'E, 308 m), Zhejiang, China, is described and illustrated. This new species is characterized by the dark brown lateral margin area and a pair of longitudinal furrows extending from the cephalothorax to the vasiform orifice. The submargin has an elongate-oval fold at the base of each marginal tooth and with 3-4 rows of irregular shaped papillae, nine pairs submedian setae and 13 pairs submarginal setae. Thoracic and caudal tracheal folds and pores discernible. An identification key and checklist of species of Aleuromarginatus known from China are provided. PMID:28769724
Alivernini, Stefano; Pugliese, Daniela; Tolusso, Barbara; Bui, Laura; Petricca, Luca; Guidi, Luisa; Mirone, Luisa; Rapaccini, Gian Ludovico; Federico, Francesco; Ferraccioli, Gianfranco; Armuzzi, Alessandro; Gremese, Elisa
2018-01-01
Paradoxical arthritis under tumour necrosis factor inhibitor (TNF-i) for inflammatory bowel disease (IBD) has been described. This study aims to evaluate the histological features of paired synovial tissue (ST) and colonic mucosa (CM) tissue in patients with IBD developing paradoxical arthritis under TNF-i. Patients with IBD without history of coexisting joint involvement who developed arthritis under TNF-i were enrolled. Each patient underwent ST biopsy and ileocolonoscopy with CM biopsies. ST and CM paired samples were stained through immunohistochemistry (IHC) for CD68, CD21, CD20, CD3 and CD117. Clinical and immunological parameters (anticitrullinated peptides antibodies (ACPA)-immunoglobulin (Ig)M/IgA rheumatoid factor (RF)) were collected. Psoriatic arthritis (PsA) and ACPA/IgM-RF/IgA-RF negative rheumatoid arthritis (RA) were enrolled as comparison. 10 patients with IBD (age 46.0±9.7 years, 13.2±9.9 years of disease duration, 2.5±1.6 years of TNF-i exposure, six with Crohn's disease and four with ulcerative colitis, respectively) were studied. At ST level, IHC revealed that patients with IBD with paradoxical arthritis showed more similar histological findings in terms of synovial CD68 + , CD21 + , CD20 + , CD3 + and CD117 + cells compared with PsA than ACPA/IgM-RF/IgA-RF negative RA. Analysing the CM specimens, patients with IBD showed the presence of CD68 + , CD3 + , CD117 + and CD20 + cells in 100%, 70%, 60% and 50% of cases, respectively, despite endoscopic remission. Finally, addition of conventional disease-modifying antirheumatic drugs and switch to ustekinumab were more effective than swapping into different TNF-i in patients with IBD with paradoxical arthritis. Patients with IBD may develop histologically proven synovitis during TNF-i, comparable to PsA. The inhibition of inflammatory pathways alternative to TNF (IL12/1L23) may be an effective therapeutic option for severe paradoxical articular manifestations.
Alivernini, Stefano; Pugliese, Daniela; Tolusso, Barbara; Bui, Laura; Petricca, Luca; Guidi, Luisa; Mirone, Luisa; Rapaccini, Gian Ludovico; Federico, Francesco; Ferraccioli, Gianfranco; Armuzzi, Alessandro; Gremese, Elisa
2018-01-01
Objective Paradoxical arthritis under tumour necrosis factor inhibitor (TNF-i) for inflammatory bowel disease (IBD) has been described. This study aims to evaluate the histological features of paired synovial tissue (ST) and colonic mucosa (CM) tissue in patients with IBD developing paradoxical arthritis under TNF-i. Methods Patients with IBD without history of coexisting joint involvement who developed arthritis under TNF-i were enrolled. Each patient underwent ST biopsy and ileocolonoscopy with CM biopsies. ST and CM paired samples were stained through immunohistochemistry (IHC) for CD68, CD21, CD20, CD3 and CD117. Clinical and immunological parameters (anticitrullinated peptides antibodies (ACPA)-immunoglobulin (Ig)M/IgA rheumatoid factor (RF)) were collected. Psoriatic arthritis (PsA) and ACPA/IgM-RF/IgA-RF negative rheumatoid arthritis (RA) were enrolled as comparison. Results 10 patients with IBD (age 46.0±9.7 years, 13.2±9.9 years of disease duration, 2.5±1.6 years of TNF-i exposure, six with Crohn’s disease and four with ulcerative colitis, respectively) were studied. At ST level, IHC revealed that patients with IBD with paradoxical arthritis showed more similar histological findings in terms of synovial CD68+, CD21+, CD20+, CD3+ and CD117+ cells compared with PsA than ACPA/IgM-RF/IgA-RF negative RA. Analysing the CM specimens, patients with IBD showed the presence of CD68+, CD3+, CD117+ and CD20+ cells in 100%, 70%, 60% and 50% of cases, respectively, despite endoscopic remission. Finally, addition of conventional disease-modifying antirheumatic drugs and switch to ustekinumab were more effective than swapping into different TNF-i in patients with IBD with paradoxical arthritis. Conclusion Patients with IBD may develop histologically proven synovitis during TNF-i, comparable to PsA. The inhibition of inflammatory pathways alternative to TNF (IL12/1L23) may be an effective therapeutic option for severe paradoxical articular manifestations. PMID:29657833
The Statistical Power of the Cluster Randomized Block Design with Matched Pairs--A Simulation Study
ERIC Educational Resources Information Center
Dong, Nianbo; Lipsey, Mark
2010-01-01
This study uses simulation techniques to examine the statistical power of the group- randomized design and the matched-pair (MP) randomized block design under various parameter combinations. Both nearest neighbor matching and random matching are used for the MP design. The power of each design for any parameter combination was calculated from…
A pair of new moisture-dynamic diagnostic parameters for heavy rain location
NASA Astrophysics Data System (ADS)
Yuan, Kai; Zhu, Zhiwei; Li, Ming
2018-06-01
In this study, the regional persistent heavy rain process occurred in the middle and lower reaches of the Yangtze River valley from 30 June 2016 to 7 July 2016 is analyzed. We find that the pure dynamic parameters [e.g., vorticity ( V) and divergence ( D)] and two-dimensional moisture-dynamic parameters [e.g., moist vorticity ( MV), moist divergence ( MD)] have difficulty in capturing the rainfall location during such a critical process. Given the poor performance of these traditional parameters, a pair of new parameters [namely, one-dimensional moist vorticity ( ODMV) and one-dimensional moist divergence ( ODMD)] based on low-level jet is proposed for diagnosing heavy rain location. The results show that (1) ODMV and ODMD have better relations with rain belt in terms of spatial distribution. Precipitation occurs in positive (negative) region of ODMV ( ODMD), and heavy rainfall accurately locates in the positive (negative) center of ODMV ( ODMD); (2) ODMV and ODMD also have good correlation with the precipitation in terms of temporal variation (significant at the 99% confidence level). When ODMV ( ODMD) is in strong positive (negative) phase, precipitation is large, and vice versa; (3) the threat score of ODMV and ODMD for the areal-mean rainfall is improved by 119% and 16%, respectively, compared to V/ D and MV/ MD. It is anticipated that the proposed new parameters would facilitate the skills of diagnosing and forecasting the heavy rainfall.
Acoustic Analysis of Nasal Vowels in Monguor Language
NASA Astrophysics Data System (ADS)
Zhang, Hanbin
2017-09-01
The purpose of the study is to analyze the spectrum characteristics and acoustic features for the nasal vowels [ɑ˜] and [ɔ˜] in Monguor language. On the base of acoustic parameter database of the Monguor speech, the study finds out that there are five main zero-pole pairs appearing for the nasal vowel [ɔ˜] and two zero-pole pairs appear for the nasal vowel [ɔ˜]. The results of regression analysis demonstrate that the duration of the nasal vowel [ɔ˜] or the nasal vowel [ɔ˜] can be predicted by its F1, F2 and F3 respectively.
Jung, Hyung-Sup; Lee, Won-Jin; Zhang, Lei
2014-01-01
The measurement of precise along-track displacements has been made with the multiple-aperture interferometry (MAI). The empirical accuracies of the MAI measurements are about 6.3 and 3.57 cm for ERS and ALOS data, respectively. However, the estimated empirical accuracies cannot be generalized to any interferometric pair because they largely depend on the processing parameters and coherence of the used SAR data. A theoretical formula is given to calculate an expected MAI measurement accuracy according to the system and processing parameters and interferometric coherence. In this paper, we have investigated the expected MAI measurement accuracy on the basis of the theoretical formula for the existing X-, C- and L-band satellite SAR systems. The similarity between the expected and empirical MAI measurement accuracies has been tested as well. The expected accuracies of about 2–3 cm and 3–4 cm (γ = 0.8) are calculated for the X- and L-band SAR systems, respectively. For the C-band systems, the expected accuracy of Radarsat-2 ultra-fine is about 3–4 cm and that of Sentinel-1 IW is about 27 cm (γ = 0.8). The results indicate that the expected MAI measurement accuracy of a given interferometric pair can be easily calculated by using the theoretical formula. PMID:25251408
Motion estimation in the frequency domain using fuzzy c-planes clustering.
Erdem, C E; Karabulut, G Z; Yanmaz, E; Anarim, E
2001-01-01
A recent work explicitly models the discontinuous motion estimation problem in the frequency domain where the motion parameters are estimated using a harmonic retrieval approach. The vertical and horizontal components of the motion are independently estimated from the locations of the peaks of respective periodogram analyses and they are paired to obtain the motion vectors using a procedure proposed. In this paper, we present a more efficient method that replaces the motion component pairing task and hence eliminates the problems of the pairing method described. The method described in this paper uses the fuzzy c-planes (FCP) clustering approach to fit planes to three-dimensional (3-D) frequency domain data obtained from the peaks of the periodograms. Experimental results are provided to demonstrate the effectiveness of the proposed method.
Phase-incoherent superconducting pairs in the normal state of Ba(Fe(1-x)Co(x))₂As₂.
Sheet, Goutam; Mehta, Manan; Dikin, D A; Lee, S; Bark, C W; Jiang, J; Weiss, J D; Hellstrom, E E; Rzchowski, M S; Eom, C B; Chandrasekhar, V
2010-10-15
The normal state properties of the recently discovered ferropnictide superconductors might hold the key to understanding their exotic superconductivity. Using point-contact spectroscopy we show that Andreev reflection between an epitaxial thin film of Ba(Fe(0.92)Co(0.08))₂As₂ and a silver tip can be seen in the normal state of the film up to temperature T∼1.3T(c), where T(c) is the critical temperature of the superconductor. Andreev reflection far above T(c) can be understood only when superconducting pairs arising from strong fluctuation of the phase of the complex superconducting order parameter exist in the normal state. Our results provide spectroscopic evidence of phase-incoherent superconducting pairs in the normal state of the ferropnictide superconductors.
Control of the Ability of Profilin to Bind and Facilitate Nucleotide Exchange from G-actin*
Wen, Kuo-Kuang; McKane, Melissa; Houtman, Jon C. D.; Rubenstein, Peter A.
2008-01-01
A major factor in profilin regulation of actin cytoskeletal dynamics is its facilitation of G-actin nucleotide exchange. However, the mechanism of this facilitation is unknown. We studied the interaction of yeast (YPF) and human profilin 1 (HPF1) with yeast and mammalian skeletal muscle actins. Homologous pairs (YPF and yeast actin, HPF1 and muscle actin) bound more tightly to one another than heterologous pairs. However, with saturating profilin, HPF1 caused a faster etheno-ATP exchange with both yeast and muscle actins than did YPF. Based on the -fold change in ATP exchange rate/Kd, however, the homologous pairs are more efficient than the heterologous pairs. Thus, strength of binding of profilin to actin and nucleotide exchange rate are not tightly coupled. Actin/HPF interactions were entropically driven, whereas YPF interactions were enthalpically driven. Hybrid yeast actins containing subdomain 1 (sub1) or subdomain 1 and 2 (sub12) muscle actin residues bound more weakly to YPF than did yeast actin (Kd = 2 μm versus 0.6 μm). These hybrids bound even more weakly to HPF than did yeast actin (Kd = 5 μm versus 3.2 μm). sub1/YPF interactions were entropically driven, whereas the sub12/YPF binding was enthalpically driven. Compared with WT yeast actin, YPF binding to sub1 occurred with a 5 times faster koff and a 2 times faster kon. sub12 bound with a 3 times faster koff and a 1.5 times slower kon. Profilin controls the energetics of its interaction with nonhybrid actin, but interactions between actin subdomains 1 and 2 affect the topography of the profilin binding site. PMID:18223293
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aaltonen, T.; Amerio, S.; Amidei, D.
Here, at the Fermilab Tevatron proton-antiproton (pmore » $$\\bar{p}$$) collider, Drell-Yan lepton pairs are produced in the process p$$\\bar{p}$$→e +e -+X through an intermediate γ*/Z boson. The forward-backward asymmetry in the polar-angle distribution of the e - as a function of the e +e --pair mass is used to obtain sin 2θ$$lept\\atop{eff}$$, the effective leptonic determination of the electroweak-mixing parameter sin2θW. The measurement sample, recorded by the Collider Detector at Fermilab (CDF), corresponds to 9.4 fb -1 of integrated luminosity from p$$\\bar{p}$$ collisions at a center-of-momentum energy of 1.96 TeV, and is the full CDF Run II data set. The value of sin 2θ$$lept\\atop{eff}$$ is found to be 0.23248±0.00053. The combination with the previous CDF measurement based on μ +μ - pairs yields sin 2θ$$lept\\atop{eff}$$=0.23221±0.00046. This result, when interpreted within the specified context of the standard model assuming sin 2θW=1-M$$2\\atop{W}$$/M$$2\\atop{Z}$$ and that the W- and Z-boson masses are on-shell, yields sin 2θW=0.22400±0.00045, or equivalently a W-boson mass of 80.328±0.024 GeV/c 2.« less
Rosokha, Sergiy V; Lü, Jian-Ming; Newton, Marshall D; Kochi, Jay K
2005-05-25
Definitive X-ray structures of "separated" versus "contact" ion pairs, together with their spectral (UV-NIR, ESR) characterizations, provide the quantitative basis for evaluating the complex equilibria and intrinsic (self-exchange) electron-transfer rates for the potassium salts of p-dinitrobenzene radical anion (DNB(-)). Three principal types of ion pairs, K(L)(+)DNB(-), are designated as Classes S, M, and C via the specific ligation of K(+) with different macrocyclic polyether ligands (L). For Class S, the self-exchange rate constant for the separated ion pair (SIP) is essentially the same as that of the "free" anion, and we conclude that dinitrobenzenide reactivity is unaffected when the interionic distance in the separated ion pair is r(SIP) > or =6 Angstroms. For Class M, the dynamic equilibrium between the contact ion pair (with r(CIP) = 2.7 Angstroms) and its separated ion pair is quantitatively evaluated, and the rather minor fraction of SIP is nonetheless the principal contributor to the overall electron-transfer kinetics. For Class C, the SIP rate is limited by the slow rate of CIP right arrow over left arrow SIP interconversion, and the self-exchange proceeds via the contact ion pair by default. Theoretically, the electron-transfer rate constant for the separated ion pair is well-accommodated by the Marcus/Sutin two-state formulation when the precursor in Scheme 2 is identified as the "separated" inner-sphere complex (IS(SIP)) of cofacial DNB(-)/DNB dyads. By contrast, the significantly slower rate of self-exchange via the contact ion pair requires an associative mechanism (Scheme 3) in which the electron-transfer rate is strongly governed by cationic mobility of K(L)(+) within the "contact" precursor complex (IS(CIP)) according to the kinetics in Scheme 4.
Effect of particle moment of inertia on the dynamics and wakes of freely rising cylinders
NASA Astrophysics Data System (ADS)
Mathai, Varghese; Zhu, Xiaojue; Sun, Chao; Lohse, Detlef
2017-11-01
We perform a numerical study on the two-dimensional motions and wakes of freely rising and falling circular cylinders in quiescent fluid. We show that the amplitude of oscillation and the overall system-dynamics are intricately linked to two parameters: the particle's mass-density relative to the fluid m* ≡ρp /ρf , and its relative moment-of-inertia I* ≡Ip /If . Using over 144 combinations of m* and I*, we comprehensively map out the parameter space covering very heavy (m* > 10) to very buoyant (m* < 0.1) particles at fixed Galileo number (Ga = 500). The entire data collapses into two scaling regimes demarcated by a transitional Strouhal number, Stt 0.17 . Stt separates a mass-dominated regime from a regime dominated by the particle's moment of inertia. A shift from one regime to the other also marks a gradual transition in the wake-shedding pattern: from the classical 2 S (2-Single) vortex mode to a 2 P (2-Pairs) mode of wake vortices. Thus, autorotation, triggered by moment of inertia reduction, can significantly enhance the translational oscillations of freely rising isotropic bodies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Xiao, E-mail: liuxiao0105@163.com
2016-12-15
Uniaxial compression tests were carried out at 350 °C and a strain rate of 0.3 s{sup −1} on as-extruded AZ31 magnesium alloy samples. At a true strain of − 0.1, extension twin pairs in a grain and twin chains across adjacent grains were detected. The orientation of selected twins and their host grains were determined by electron backscattered diffraction (EBSD) techniques. The Schmid factors (SFs), accommodation strains and geometric compatibility factors (m{sup ′}) were calculated. Analysis of the data indicated that the formation of twin pair and twin chain was related to the SF and m{sup ′}. Regarding to twinmore » chain across adjacent grains, accommodation strain was also involved. The selection of twin variants in twin chain was generally determined by m{sup ′}. When the twins required the operation of pyramidal slip or twinning in adjacent grain, the corresponding connected twins with a relative high m{sup ′} were selected in this adjacent grain. - Highlights: •The formation of paired twins is studied during high temperature deformation. •The initiation of twinning in twin pair and twin chain obeys the Schmid law. •The twin variants' selection in twin chain is related to the geometric compatibility factor. •The accommodation strain plays an important role on the formation of twin chain.« less
The APOSTLE project: Local Group kinematic mass constraints and simulation candidate selection
NASA Astrophysics Data System (ADS)
Fattahi, Azadeh; Navarro, Julio F.; Sawala, Till; Frenk, Carlos S.; Oman, Kyle A.; Crain, Robert A.; Furlong, Michelle; Schaller, Matthieu; Schaye, Joop; Theuns, Tom; Jenkins, Adrian
2016-03-01
We use a large sample of isolated dark matter halo pairs drawn from cosmological N-body simulations to identify candidate systems whose kinematics match that of the Local Group (LG) of galaxies. We find, in agreement with the `timing argument' and earlier work, that the separation and approach velocity of the Milky Way (MW) and Andromeda (M31) galaxies favour a total mass for the pair of ˜5 × 1012 M⊙. A mass this large, however, is difficult to reconcile with the small relative tangential velocity of the pair, as well as with the small deceleration from the Hubble flow observed for the most distant LG members. Halo pairs that match these three criteria have average masses a factor of ˜2 times smaller than suggested by the timing argument, but with large dispersion. Guided by these results, we have selected 12 halo pairs with total mass in the range 1.6-3.6 × 1012 M⊙ for the APOSTLE project (A Project Of Simulating The Local Environment), a suite of hydrodynamical resimulations at various numerical resolution levels (reaching up to ˜104 M⊙ per gas particle) that use the subgrid physics developed for the EAGLE project. These simulations reproduce, by construction, the main kinematics of the MW-M31 pair, and produce satellite populations whose overall number, luminosities, and kinematics are in good agreement with observations of the MW and M31 companions. The APOSTLE candidate systems thus provide an excellent testbed to confront directly many of the predictions of the Λ cold dark matter cosmology with observations of our local Universe.
Contacts between the factor TUF and RPG sequences.
Vignais, M L; Huet, J; Buhler, J M; Sentenac, A
1990-08-25
The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.
NASA Astrophysics Data System (ADS)
Namysłowska-Wilczyńska, Barbara
2016-04-01
This paper presents selected results of research connected with the development of a (3D) geostatistical hydrogeochemical model of the Klodzko Drainage Basin, dedicated to the spatial and time variation in the selected quality parameters of underground water in the Klodzko water intake area (SW part of Poland). The research covers the period 2011÷2012. Spatial analyses of the variation in various quality parameters, i.e, contents of: ammonium ion [gNH4+/m3], NO3- (nitrate ion) [gNO3/m3], PO4-3 (phosphate ion) [gPO4-3/m3], total organic carbon C (TOC) [gC/m3], pH redox potential and temperature C [degrees], were carried out on the basis of the chemical determinations of the quality parameters of underground water samples taken from the wells in the water intake area. Spatial and time variation in the quality parameters was analyzed on the basis of archival data (period 1977÷1999) for 22 (pump and siphon) wells with a depth ranging from 9.5 to 38.0 m b.g.l., later data obtained (November 2011) from tests of water taken from 14 existing wells. The wells were built in the years 1954÷1998. The water abstraction depth (difference between the terrain elevation and the dynamic water table level) is ranged from 276÷286 m a.s.l., with an average of 282.05 m a.s.l. Dynamic water table level is contained between 6.22 m÷16.44 m b.g.l., with a mean value of 9.64 m b.g.l. The latest data (January 2012) acquired from 3 new piezometers, with a depth of 9÷10m, which were made in other locations in the relevant area. Thematic databases, containing original data on coordinates X, Y (latitude, longitude) and Z (terrain elevation and time - years) and on regionalized variables, i.e. the underground water quality parameters in the Klodzko water intake area determined for different analytical configurations (22 wells, 14 wells, 14 wells + 3 piezometers), were created. Both archival data (acquired in the years 1977÷1999) and the latest data (collected in 2011÷2012) were analyzed. These data were subjected to spatial analyses using statistical and geostatistical methods. The evaluation of basic statistics of the investigated quality parameters, including their histograms of distributions, scatter diagrams between these parameters and also correlation coefficients r were presented in this article. The directional semivariogram function and the ordinary (block) kriging procedure were used to build the 3D geostatistical model. The geostatistical parameters of the theoretical models of directional semivariograms of the studied water quality parameters, calculated along the time interval and along the wells depth (taking into account the terrain elevation), were used in the ordinary (block) kriging estimation. The obtained results of estimation, i.e. block diagrams allowed to determine the levels of increased values Z* of studied underground water quality parameters. Analysis of the variability in the selected quality parameters of underground water for an analyzed area in Klodzko water intake was enriched by referring to the results of geostatistical studies carried out for underground water quality parameters and also for a treated water and in Klodzko water supply system (iron Fe, manganese Mn, ammonium ion NH4+ contents), discussed in earlier works. Spatial and time variation in the latter-mentioned parameters was analysed on the basis of the data (2007÷2011, 2008÷2011). Generally, the behaviour of the underground water quality parameters has been found to vary in space and time. Thanks to the spatial analyses of the variation in the quality parameters in the Kłodzko underground water intake area some regularities (trends) in the variation in water quality have been identified.
Controlling the transmitted information of a multi-photon interacting with a single-Cooper pair box
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kadry, Heba, E-mail: hkadry1@yahoo.com; Abdel-Aty, Abdel-Haleem, E-mail: hkadry1@yahoo.com; Zakaria, Nordin, E-mail: hkadry1@yahoo.com
2014-10-24
We study a model of a multi-photon interaction of a single Cooper pair box with a cavity field. The exchange of the information using this system is studied. We quantify the fidelity of the transmitted information. The effect of the system parameters (detuning parameter, field photons, state density and mean photon number) in the fidelity of the transmitted information is investigated. We found that the fidelity of the transmitted information can be controlled using the system parameters.
Judy Walter, Lee-Anne; Schmitz, Angela Nicole; Nichols, Wade Taylor; Hutcheson, John Paul; Lawrence, Ty Ellis
2018-05-04
A trial was conducted to examine live growth efficiency, harvest yields, and carcass grading performance of steers fed at maintenance (M) or at ad libitum (A) level of intake during zilpaterol hydrochloride (Z) supplementation. Single-sired, beef steers (n = 56; start of trial BW 590 ± 36 kg) blocked (n = 2) by weight and terminal implant were sorted into pairs (n = 14 per block) by weight. Pairs of steers were initially assigned to 0, 28, or 56 d of feeding. Within 28 or 56 d, pairs were assigned to M or A intake. Steers within a pair assigned to 56 d of feeding were randomly assigned to either 20 d of Z supplementation (90 mg/d per steer) with a 4 d withdrawal period prior to slaughter or to no ZH supplementation (C). Steers were housed and fed in individual pens. Weights of all non-carcass and carcass components were recorded at slaughter; carcasses were graded 24-h postmortem. Data were analyzed via a mixed model; the fixed effect was treatment combination with random effects of block and pair. Live growth data used harvest day as the repeated measure and animal as the subject. Single df contrasts were constructed for day 0 vs. day 28, day 0 vs. day 56, day 28 vs. day 56, M vs. A, and C vs. Z. Treatment impacted (P ≤ 0.05) live ADG; contrasts indicated A (1.33) was greater than M (0.14 kg), and Z (1.12) was greater than C (0.82 kg). Similarly, carcass ADG differences (P < 0.01) indicated A (1.04) was greater than M (0.36 kg), and Z (1.35) was greater than C (0.71 kg). Intake level altered BW and empty body weight (EBW); M cattle had reduced BW and EBW (P < 0.01, 585 and 540 kg) than A cattle (647 and 597 kg). Cattle fed at M had less carcass and internal cavity mass (P < 0.01, 359 and 79.4 kg) than A cattle (394 and 93.5 kg). Liver mass was reduced by M feeding (P < 0.01; M-5.03, A-6.69 kg) and Z treatment (P < 0.01; Z-5.64, C-6.06 kg). Moreover, mass of total splanchnic tissue was less (P < 0.01) for M cattle than A cattle (59.8 vs. 72.5 kg). Dressed carcass yield was greater (P < 0.01) for Z than C cattle (63.5 vs. 61.6%). Cattle fed at M had less 12th rib s.c. fat, lower numerical U.S. yield grades (P < 0.01; M-1.71 cm and 3.3, A-2.46 cm and 4.3) and lower numerical Canadian yield grades (P < 0.01; 51.9 vs. 53.9% for M and A, respectively) than A cattle. Results indicate that energy intake level and Z supplementation influence live and carcass growth, carcass transfer, kill yields, and carcass characteristics across time.
Colour pairs for constraining the age and metallicity of stellar populations
NASA Astrophysics Data System (ADS)
Li, Zhongmu; Han, Zhanwen
2008-04-01
Using a widely used stellar-population synthesis model, we study the possibility of using pairs of AB system colours to break the well-known stellar age-metallicity degeneracy and to give constraints on two luminosity-weighted stellar-population parameters (age and metallicity). We present the relative age and metallicity sensitivities of the AB system colours that relate to the u,B,g,V,r,R,i, I,z,J,H and K bands, and we quantify the ability of various colour pairs to break the age-metallicity degeneracy. Our results suggest that a few pairs of colours can be used to constrain the above two stellar-population parameters. This will be very useful for exploring the stellar populations of distant galaxies. In detail, colour pairs [(r-K), (u-R)] and [(r-K), (u-r)] are shown to be the best pairs for estimating the luminosity-weighted stellar ages and metallicities of galaxies. They can constrain two stellar-population parameters on average with age uncertainties less than 3.89 Gyr and metallicity uncertainties less than 0.34 dex for typical colour uncertainties. The typical age uncertainties for young populations (age < 4.6 Gyr) and metal-rich populations (Z >= 0.001) are small (about 2.26 Gyr) while those for old populations (age >= 4.6 Gyr) and metal-poor populations (Z < 0.001) are much larger (about 6.88 Gyr). However, the metallicity uncertainties for metal-poor populations (about 0.0024) are much smaller than for other populations (about 0.015). Some other colour pairs can also possibly be used for constraining the two parameters. On the whole, the estimation of stellar-population parameters is likely to be reliable only for early-type galaxies with small colour errors and globular clusters, because such objects contain less dust. In fact, no galaxy is totally dust-free and early-type galaxies are also likely have some dust [e.g. E(B- V) ~ 0.05], which can change the stellar ages by about 2.5 Gyr and metallicities (Z) by about 0.015. When we compare the photometric estimates with previous spectroscopic estimates, we find some differences, especially when comparing the stellar ages determined by two methods. The differences mainly result from the young populations of galaxies. Therefore, it is difficult to obtain the absolute values of stellar ages and metallicities, but the results are useful for obtaining some relative values. In addition, our results suggest that colours relating to both UBVRIJHK and ugriz magnitudes are much better than either UBVRIJHK or ugriz colours for breaking the well-known degeneracy. The results also show that the stellar ages and metallicities of galaxies observed by the Sloan Digital Sky Survey and the Two-Micron All-Sky Survey can be estimated via photometry data. The data are available at the Centre de Données astronomiques de Strabourg (CDS) or on request to the authors. E-mail: zhongmu.li@gmail.com
Creighton, Chad J; Hernandez-Herrera, Anadulce; Jacobsen, Anders; Levine, Douglas A; Mankoo, Parminder; Schultz, Nikolaus; Du, Ying; Zhang, Yiqun; Larsson, Erik; Sheridan, Robert; Xiao, Weimin; Spellman, Paul T; Getz, Gad; Wheeler, David A; Perou, Charles M; Gibbs, Richard A; Sander, Chris; Hayes, D Neil; Gunaratne, Preethi H
2012-01-01
The Cancer Genome Atlas (TCGA) Network recently comprehensively catalogued the molecular aberrations in 487 high-grade serous ovarian cancers, with much remaining to be elucidated regarding the microRNAs (miRNAs). Here, using TCGA ovarian data, we surveyed the miRNAs, in the context of their predicted gene targets. Integration of miRNA and gene patterns yielded evidence that proximal pairs of miRNAs are processed from polycistronic primary transcripts, and that intronic miRNAs and their host gene mRNAs derive from common transcripts. Patterns of miRNA expression revealed multiple tumor subtypes and a set of 34 miRNAs predictive of overall patient survival. In a global analysis, miRNA:mRNA pairs anti-correlated in expression across tumors showed a higher frequency of in silico predicted target sites in the mRNA 3'-untranslated region (with less frequency observed for coding sequence and 5'-untranslated regions). The miR-29 family and predicted target genes were among the most strongly anti-correlated miRNA:mRNA pairs; over-expression of miR-29a in vitro repressed several anti-correlated genes (including DNMT3A and DNMT3B) and substantially decreased ovarian cancer cell viability. This study establishes miRNAs as having a widespread impact on gene expression programs in ovarian cancer, further strengthening our understanding of miRNA biology as it applies to human cancer. As with gene transcripts, miRNAs exhibit high diversity reflecting the genomic heterogeneity within a clinically homogeneous disease population. Putative miRNA:mRNA interactions, as identified using integrative analysis, can be validated. TCGA data are a valuable resource for the identification of novel tumor suppressive miRNAs in ovarian as well as other cancers.
Yang, Jenn-Ming; Yang, Shwu-Huey; Huang, Wen-Chen; Tzeng, Chii-Ruey
2013-07-01
To determine morphologic differences between Monarc and TVT-O procedures in axial and coronal planes by three- and four-dimensional (3D and 4D) ultrasound. Retrospective chart audits and ultrasound analyses were conducted on 128 women who had undergone either Monarc or TVT-O procedures for urodynamic stress incontinence. Thirty matched pairs of the two successful procedures were randomly selected and compared. Matched variables were age, parity, body mass index, cesarean status, menopausal status, and primary surgeries. Six-month postoperative 3D and 4D ultrasound results obtained at rest, on straining, and during coughing in these 60 women were analyzed. Assessed ultrasound parameters included the axial tape urethral distance (aTUD), axial central urethral echolucent area (aUCEA), axial tape angle (aTA), and coronal tape angle (cTA), all of which were measured at three equidistant points along the tapes. Paired t-tests were used to compare differences in ultrasound parameters between women after the two procedures and a P value <0.004 was considered significant after Bonferroni correction. At rest, women subjected to Monarc procedures had a significantly wider aTA at one-fourth of the tape and a wider cTA at one-, two-, and three-fourths of the tape than did those subjected to TVT-O procedures. There were no significant differences in other resting ultrasound parameters between these two procedures. Additionally, after both procedures women had comparable straining and coughing ultrasound manifestations as well as respective dynamic changes. Despite flatter resting tape angulations in women following Monarc procedures, both Monarc and TVT-O tapes had equivalent dynamic patterns and changes assessed by 4D ultrasound. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
The Effectiveness of Propolis on Gingivitis: A Randomized Controlled Trial
Paulino, Niraldo; Nör, Jacques E.; Moreira, Alexandre
2014-01-01
Abstract Background: A randomized, double-blind, controlled clinical trial was conducted to evaluate the effectiveness of a propolis rinse on induced gingivitis by using the co-twin study design. Methods: Twenty-one twin pairs (n=42) were enrolled in a gingivitis study with oral hygiene promotion (14 days) and gingivitis induction (21 days). During the gingivitis induction phase, one member of the twin pair was randomly assigned to a 2% typified propolis rinse, and the other was assigned a color-matched 0.05% sodium fluoride plus 0.05% cetylpyridinium chloride rinse (positive control). Patients rinsed twice daily with 20 mL for 30 seconds for 21 days. Gingivitis was measured on days −14 (baseline), 0 (after hygiene phase), and 21 (after no-hygiene phase) by using the Papillary Bleeding Score (PBS) and by standard digital imaging of the gum tissues (G-parameter). Results: The 38 persons who completed the study (age 13–22 years) were well balanced according to PBS at baseline and G-parameter after the initial hygiene phase. After 21 days without oral hygiene, the propolis rinse and positive control rinse groups did not differ significantly for average PBS measurements or G-parameter. Conclusions: Use of a 2% typified propolis rinse was equivalent to a positive control rinse during a 21-day no-hygiene period. PMID:25380344
A Comparison of Four Gravimetric Fine Particle Sampling Methods.
Yanosky, Jeff D; Maclntosh, David L
2001-06-01
A study was conducted to compare four gravimetric methods of measuring fine particle (PM 2.5 ) concentrations in air: the BGI, Inc. PQ200 Federal Reference Method PM 2.5 (FRM) sampler; the Harvard-Marple Impactor (HI); the BGI, Inc. GK2.05 KTL Respirable/Thoracic Cyclone (KTL); and the AirMetrics MiniVol (MiniVol). Pairs of FRM, HI, and KTL samplers and one MiniVol sampler were collocated and 24-hr integrated PM 2.5 samples were collected on 21 days from January 6 through April 9, 2000. The mean and standard deviation of PM 2.5 levels from the FRM samplers were 13.6 and 6.8 μg/m 3 , respectively. Significant systematic bias was found between mean concentrations from the FRM and the MiniVol (1.14 μg/m 3 , p = 0.0007), the HI and the MiniVol (0.85 μg/m 3 , p = 0.0048), and the KTL and the MiniVol (1.23 μg/m 3 , p = 0.0078) according to paired t test analyses. Linear regression on all pairwise combinations of the sampler types was used to evaluate measurements made by the samplers. None of the regression intercepts was significantly different from 0, and only two of the regression slopes were significantly different from 1, that for the FRM and the MiniVol [β 1 = 0.91, 95% CI (0.83-0.99)] and that for the KTL and the MiniVol [ = 0.88, 95% CI (0.78-0.98)]. Regression R 2 terms were 0.96 or greater between all pairs of samplers, and regression root mean square error terms (RMSE) were 1.65 μg/m 3 or less. These results suggest that the MiniVol will underestimate measurements made by the FRM, the HI, and the KTL by an amount proportional to PM 2.5 concentration. Nonetheless, these results indicate that all of the sampler types are comparable if ~10% variation on the mean levels and on individual measurement levels is considered acceptable and the actual concentration is within the range of this study (5-35 μg/m 3 ).
A comparison of four gravimetric fine particle sampling methods.
Yanosky, J D; MacIntosh, D L
2001-06-01
A study was conducted to compare four gravimetric methods of measuring fine particle (PM2.5) concentrations in air: the BGI, Inc. PQ200 Federal Reference Method PM2.5 (FRM) sampler; the Harvard-Marple Impactor (HI); the BGI, Inc. GK2.05 KTL Respirable/Thoracic Cyclone (KTL); and the AirMetrics MiniVol (MiniVol). Pairs of FRM, HI, and KTL samplers and one MiniVol sampler were collocated and 24-hr integrated PM2.5 samples were collected on 21 days from January 6 through April 9, 2000. The mean and standard deviation of PM2.5 levels from the FRM samplers were 13.6 and 6.8 microg/m3, respectively. Significant systematic bias was found between mean concentrations from the FRM and the MiniVol (1.14 microg/m3, p = 0.0007), the HI and the MiniVol (0.85 microg/m3, p = 0.0048), and the KTL and the MiniVol (1.23 microg/m3, p = 0.0078) according to paired t test analyses. Linear regression on all pairwise combinations of the sampler types was used to evaluate measurements made by the samplers. None of the regression intercepts was significantly different from 0, and only two of the regression slopes were significantly different from 1, that for the FRM and the MiniVol [beta1 = 0.91, 95% CI (0.83-0.99)] and that for the KTL and the MiniVol [beta1 = 0.88, 95% CI (0.78-0.98)]. Regression R2 terms were 0.96 or greater between all pairs of samplers, and regression root mean square error terms (RMSE) were 1.65 microg/m3 or less. These results suggest that the MiniVol will underestimate measurements made by the FRM, the HI, and the KTL by an amount proportional to PM2.5 concentration. Nonetheless, these results indicate that all of the sampler types are comparable if approximately 10% variation on the mean levels and on individual measurement levels is considered acceptable and the actual concentration is within the range of this study (5-35 microg/m3).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smylie, M. P.; Claus, H.; Welp, U.
2016-11-01
The low-temperature variation of the London penetration depth lambda(T) in the candidate topological superconductor NbxBi2Se3 (x = 0.25) is reported for several crystals. The measurements were carried out by means of a tunnel-diode oscillator technique in both field orientations (H-rf || c and H-rf || ab planes). All samples exhibited power-law behavior at low temperatures (Delta lambda similar to T-2) clearly indicating the presence of point nodes in the superconducting order parameter. The results presented here are consistent with a nematic odd-parity spin-triplet E-u pairing state in NbxBi2Se3.
Results on angular distributions of thermal dileptons in nuclear collisions
NASA Astrophysics Data System (ADS)
Usai, Gianluca; NA60 Collaboration
2009-11-01
The NA60 experiment at the CERN SPS has studied dimuon production in 158 AGeV In-In collisions. The strong pair excess above the known sources found in the mass region 0.2
Entanglement entropy for 2D gauge theories with matters
NASA Astrophysics Data System (ADS)
Aoki, Sinya; Iizuka, Norihiro; Tamaoka, Kotaro; Yokoya, Tsuyoshi
2017-08-01
We investigate the entanglement entropy in 1 +1 -dimensional S U (N ) gauge theories with various matter fields using the lattice regularization. Here we use extended Hilbert space definition for entanglement entropy, which contains three contributions; (1) classical Shannon entropy associated with superselection sector distribution, where sectors are labeled by irreducible representations of boundary penetrating fluxes, (2) logarithm of the dimensions of their representations, which is associated with "color entanglement," and (3) EPR Bell pairs, which give "genuine" entanglement. We explicitly show that entanglement entropies (1) and (2) above indeed appear for various multiple "meson" states in gauge theories with matter fields. Furthermore, we employ transfer matrix formalism for gauge theory with fundamental matter field and analyze its ground state using hopping parameter expansion (HPE), where the hopping parameter K is roughly the inverse square of the mass for the matter. We evaluate the entanglement entropy for the ground state and show that all (1), (2), (3) above appear in the HPE, though the Bell pair part (3) appears in higher order than (1) and (2) do. With these results, we discuss how the ground state entanglement entropy in the continuum limit can be understood from the lattice ground state obtained in the HPE.
Sun, Zheng; Yang, Ping; Liang, Li-yuan; Zhang, Tong; Zhang, Wei-jian; Cao, Jie
2012-11-01
To investigate the expression of connective tissue growth factor (CTGF) in colorectal cancer(CRC) and its association with clinicopathologic parameters and overall survival rate. Fresh tumor tissues and matched distal normal colon tissues were collected from 92 patients diagnosed as CRC by surgical operation. The expression level of CTGF mRNA was quantified by quantitative reverse transcription PCR. Thirty out of 92 pairs of tissue specimens were selected randomly to detect CTGF protein by immunohistochemistry. All the cases were followed up to identify prognostic factors for survival. CTGF mRNA expression was up-regulated in CRC. The positive rate of CTGF protein expression tissues (73.3%) was significantly higher than that in the corresponding normal tissues (23.3%, P<0.01). CTGF expression was lower in patients with lymphatic metastasis or stage III/IIII disease (all P<0.05). A negative association was also observed between the CTGF protein positive rate and tumor infiltration depth (P<0.05). The relative expression of CTGF mRNA in tumor tissues was classified into high and low expression groups. The 5-year cumulative survival rate was lower in patients with low CTGF expression (29.3%) as compared to those with high CTGF expressions (68.3%) (P<0.01). Cox regression analysis revealed that the relative expression level of CTGF was independent factor of overall survival (RR=2.960, 95%CI:1.491-1.587, P<0.01). ROC curve analysis showed that sensitivity and specificity of CTGF mRNA expression for prediction of 5-year survival were 64.9% and 74.5%, respectively. The aberrant expression of CTGF is associated with the malignant biological behaviors of CRC. Low expression of CTGF is associated with worse prognosis of CRC.
Skegro, Darko; Stutz, Cian; Ollier, Romain; Svensson, Emelie; Wassmann, Paul; Bourquin, Florence; Monney, Thierry; Gn, Sunitha; Blein, Stanislas
2017-06-09
Bispecific antibodies (bsAbs) are of significant importance to the development of novel antibody-based therapies, and heavy chain (Hc) heterodimers represent a major class of bispecific drug candidates. Current technologies for the generation of Hc heterodimers are suboptimal and often suffer from contamination by homodimers posing purification challenges. Here, we introduce a new technology based on biomimicry wherein the protein-protein interfaces of two different immunoglobulin (Ig) constant domain pairs are exchanged in part or fully to design new heterodimeric domains. The method can be applied across Igs to design Fc heterodimers and bsAbs. We investigated interfaces from human IgA CH3, IgD CH3, IgG1 CH3, IgM CH4, T-cell receptor (TCR) α/β, and TCR γ/δ constant domain pairs, and we found that they successfully drive human IgG1 CH3 or IgM CH4 heterodimerization to levels similar to or above those of reference methods. A comprehensive interface exchange between the TCR α/β constant domain pair and the IgG1 CH3 homodimer was evidenced by X-ray crystallography and used to engineer examples of bsAbs for cancer therapy. Parental antibody pairs were rapidly reformatted into scalable bsAbs that were free of homodimer traces by combining interface exchange, asymmetric Protein A binding, and the scFv × Fab format. In summary, we successfully built several new CH3- or CH4-based heterodimers that may prove useful for designing new bsAb-based therapeutics, and we anticipate that our approach could be broadly implemented across the Ig constant domain family. To our knowledge, CH4-based heterodimers have not been previously reported. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Yang, Jian-Feng; Zhao, Zhen-Hua; Zhang, Yu; Zhao, Li; Yang, Li-Ming; Zhang, Min-Ming; Wang, Bo-Yin; Wang, Ting; Lu, Bao-Chun
2016-04-07
To investigate the feasibility of a dual-input two-compartment tracer kinetic model for evaluating tumorous microvascular properties in advanced hepatocellular carcinoma (HCC). From January 2014 to April 2015, we prospectively measured and analyzed pharmacokinetic parameters [transfer constant (Ktrans), plasma flow (Fp), permeability surface area product (PS), efflux rate constant (kep), extravascular extracellular space volume ratio (ve), blood plasma volume ratio (vp), and hepatic perfusion index (HPI)] using dual-input two-compartment tracer kinetic models [a dual-input extended Tofts model and a dual-input 2-compartment exchange model (2CXM)] in 28 consecutive HCC patients. A well-known consensus that HCC is a hypervascular tumor supplied by the hepatic artery and the portal vein was used as a reference standard. A paired Student's t-test and a nonparametric paired Wilcoxon rank sum test were used to compare the equivalent pharmacokinetic parameters derived from the two models, and Pearson correlation analysis was also applied to observe the correlations among all equivalent parameters. The tumor size and pharmacokinetic parameters were tested by Pearson correlation analysis, while correlations among stage, tumor size and all pharmacokinetic parameters were assessed by Spearman correlation analysis. The Fp value was greater than the PS value (FP = 1.07 mL/mL per minute, PS = 0.19 mL/mL per minute) in the dual-input 2CXM; HPI was 0.66 and 0.63 in the dual-input extended Tofts model and the dual-input 2CXM, respectively. There were no significant differences in the kep, vp, or HPI between the dual-input extended Tofts model and the dual-input 2CXM (P = 0.524, 0.569, and 0.622, respectively). All equivalent pharmacokinetic parameters, except for ve, were correlated in the two dual-input two-compartment pharmacokinetic models; both Fp and PS in the dual-input 2CXM were correlated with Ktrans derived from the dual-input extended Tofts model (P = 0.002, r = 0.566; P = 0.002, r = 0.570); kep, vp, and HPI between the two kinetic models were positively correlated (P = 0.001, r = 0.594; P = 0.0001, r = 0.686; P = 0.04, r = 0.391, respectively). In the dual input extended Tofts model, ve was significantly less than that in the dual input 2CXM (P = 0.004), and no significant correlation was seen between the two tracer kinetic models (P = 0.156, r = 0.276). Neither tumor size nor tumor stage was significantly correlated with any of the pharmacokinetic parameters obtained from the two models (P > 0.05). A dual-input two-compartment pharmacokinetic model (a dual-input extended Tofts model and a dual-input 2CXM) can be used in assessing the microvascular physiopathological properties before the treatment of advanced HCC. The dual-input extended Tofts model may be more stable in measuring the ve; however, the dual-input 2CXM may be more detailed and accurate in measuring microvascular permeability.
Increasing cardiopulmonary emergency visits by long-range transported Asian dust storms in Taiwan.
Chan, Chang-Chuan; Chuang, Kai-Jen; Chen, Wen-Jone; Chang, Wei-Tien; Lee, Chung-Te; Peng, Chi-Ming
2008-03-01
This study aims to explore whether Asian dust storms can affect health after 4000 km long-range transport from their origins to downwind areas. Asian dust storms reaching Taipei, Taiwan are tracked by satellite images and confirmed by backward trajectory analysis and ground air pollution monitoring between 1995 and 2002. Our outcome variables include emergency visits for ischaemic heart diseases (ICD-9-CM 410-411, 414), cerebrovascular diseases (ICD-9-CM 430-437), and chronic obstructive pulmonary diseases (COPD) (ICD-9-CM 493, 496) from the National Taiwan University Hospital (NTUH). We use simple paired t-test and Poisson regression models to compare difference in emergency visits, air pollution levels and meteorological conditions for the pairs of Asian dust events and pre-dust periods. There were 39 high dust events with PM(10) greater than 90 microg/m(3) and another 46 low dust events with PM(10) less than 90 microg/m(3). Compared to their pre-dust periods, PM(10) concentrations are significantly increased by 77 microg/m(3) per event for the high dust events. Asian dust storms increase cardiopulmonary emergency visits during storm-affecting periods in Taipei when ambient PM(10) concentrations are above 90 microg/m(3). Compared to their pre-dust periods, emergency visits for ischaemic heart diseases, cerebrovascular diseases, and COPD during high dust events are increased by 0.7 case (35%), 0.7 case (20%), and 0.9 case (20%) per event, respectively, by paired t-tests. By comparing the model-predicted to the observed emergency visits, we find emergency visits for cardiovascular diseases (ICD-9-CM 410-411, 414, 430-437) were significantly increased by 2.9 cases (67%) per event for the 39 high Asian dust events.
Out-of-equilibrium Sm Fe based phases
NASA Astrophysics Data System (ADS)
Djéga-Mariadassou, C.; Bessais, L.
2008-02-01
Structure and magnetic properties of nanocrystalline P6/mmm out-of-equilibrium precursors of hard magnetic R-3m Sm2(Fe,M)17C (M=Ga,Si,) and I4/mmm Sm(Fe,Co,Ti)11 equilibrium phases, are presented. Their structure is explained with a model ground on the R1 - s T5 + 2 s formula (R=rare-earth, s=vacancy rate, T=transition metal) where s Sm atoms are statistically substituted by s transition metal pairs. The Rietveld analysis (RA) provides the stoichiometry of the precursors, 1:9 and 1:10, respectively precursor of 2:17 and 1:12 phases. The interpretation of the Mössbauer spectra of the 1:9 and 1:10 phases, is based on the correlation between δ and the Wigner Seitz Cell volumes, calculated from the structural parameters. The δ behaviour of each crystallographic site versus Co content, defines the Co location while it confirms that of Si and Ga obtained by RA. Substitution occurs in 3 g site, whatever Co or M. The Sm(Fe,Co,Ti)10 and Sm(Fe,M)9C Curie temperature (Tc) are compared to those of the equilibrium phases, the effects of Fe substitution and C addition are discussed. The maximum μ 0Hc is obtained for low M or Co content, for auto-coherent diffraction domain size ˜30 nm. SmFe8.75Ga0.25C and SmFe8.75Si0.25C with Tc of 680 and 690 K, show respectively Mr and μ 0Hc of 58 emu/g, 27 kOe and 95 emu/g, 15 kOe, values higher than those obtained for Sm2(Fe,M)17 carbides.
Inhomogeneous ensembles of radical pairs in chemical compasses
Procopio, Maria; Ritz, Thorsten
2016-01-01
The biophysical basis for the ability of animals to detect the geomagnetic field and to use it for finding directions remains a mystery of sensory biology. One much debated hypothesis suggests that an ensemble of specialized light-induced radical pair reactions can provide the primary signal for a magnetic compass sensor. The question arises what features of such a radical pair ensemble could be optimized by evolution so as to improve the detection of the direction of weak magnetic fields. Here, we focus on the overlooked aspect of the noise arising from inhomogeneity of copies of biomolecules in a realistic biological environment. Such inhomogeneity leads to variations of the radical pair parameters, thereby deteriorating the signal arising from an ensemble and providing a source of noise. We investigate the effect of variations in hyperfine interactions between different copies of simple radical pairs on the directional response of a compass system. We find that the choice of radical pair parameters greatly influences how strongly the directional response of an ensemble is affected by inhomogeneity. PMID:27804956
Inhomogeneous ensembles of radical pairs in chemical compasses
NASA Astrophysics Data System (ADS)
Procopio, Maria; Ritz, Thorsten
2016-11-01
The biophysical basis for the ability of animals to detect the geomagnetic field and to use it for finding directions remains a mystery of sensory biology. One much debated hypothesis suggests that an ensemble of specialized light-induced radical pair reactions can provide the primary signal for a magnetic compass sensor. The question arises what features of such a radical pair ensemble could be optimized by evolution so as to improve the detection of the direction of weak magnetic fields. Here, we focus on the overlooked aspect of the noise arising from inhomogeneity of copies of biomolecules in a realistic biological environment. Such inhomogeneity leads to variations of the radical pair parameters, thereby deteriorating the signal arising from an ensemble and providing a source of noise. We investigate the effect of variations in hyperfine interactions between different copies of simple radical pairs on the directional response of a compass system. We find that the choice of radical pair parameters greatly influences how strongly the directional response of an ensemble is affected by inhomogeneity.
Reimus, Paul W; Callahan, Timothy J; Ware, S Doug; Haga, Marc J; Counce, Dale A
2007-08-15
Diffusion cell experiments were conducted to measure nonsorbing solute matrix diffusion coefficients in forty-seven different volcanic rock matrix samples from eight different locations (with multiple depth intervals represented at several locations) at the Nevada Test Site. The solutes used in the experiments included bromide, iodide, pentafluorobenzoate (PFBA), and tritiated water ((3)HHO). The porosity and saturated permeability of most of the diffusion cell samples were measured to evaluate the correlation of these two variables with tracer matrix diffusion coefficients divided by the free-water diffusion coefficient (D(m)/D*). To investigate the influence of fracture coating minerals on matrix diffusion, ten of the diffusion cells represented paired samples from the same depth interval in which one sample contained a fracture surface with mineral coatings and the other sample consisted of only pure matrix. The log of (D(m)/D*) was found to be positively correlated with both the matrix porosity and the log of matrix permeability. A multiple linear regression analysis indicated that both parameters contributed significantly to the regression at the 95% confidence level. However, the log of the matrix diffusion coefficient was more highly-correlated with the log of matrix permeability than with matrix porosity, which suggests that matrix diffusion coefficients, like matrix permeabilities, have a greater dependence on the interconnectedness of matrix porosity than on the matrix porosity itself. The regression equation for the volcanic rocks was found to provide satisfactory predictions of log(D(m)/D*) for other types of rocks with similar ranges of matrix porosity and permeability as the volcanic rocks, but it did a poorer job predicting log(D(m)/D*) for rocks with lower porosities and/or permeabilities. The presence of mineral coatings on fracture walls did not appear to have a significant effect on matrix diffusion in the ten paired diffusion cell experiments.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Straatman, Caroline M. S.; Labbé, Ivo; Van Houdt, Josha
The FourStar galaxy evolution survey (ZFOURGE) is a 45 night legacy program with the FourStar near-infrared camera on Magellan and one of the most sensitive surveys to date. ZFOURGE covers a total of 400 arcmin{sup 2} in cosmic fields CDFS, COSMOS and UDS, overlapping CANDELS. We present photometric catalogs comprising >70,000 galaxies, selected from ultradeep K {sub s} -band detection images (25.5–26.5 AB mag, 5 σ , total), and >80% complete to K {sub s} < 25.3–25.9 AB. We use 5 near-IR medium-bandwidth filters ( J {sub 1}, J {sub 2}, J {sub 3}, H {sub s} , H {submore » l} ) as well as broad-band K {sub s} at 1.05–2.16 μ m to 25–26 AB at a seeing of ∼0.″5. Each field has ancillary imaging in 26–40 filters at 0.3–8 μ m. We derive photometric redshifts and stellar population properties. Comparing with spectroscopic redshifts indicates a photometric redshift uncertainty σ {sub z} = 0.010, 0.009, and 0.011 in CDFS, COSMOS, and UDS. As spectroscopic samples are often biased toward bright and blue sources, we also inspect the photometric redshift differences between close pairs of galaxies, finding σ {sub z} {sub ,pairs} = 0.01–0.02 at 1 < z < 2.5. We quantify how σ {sub z} {sub ,pairs} depends on redshift, magnitude, spectral energy distribution type, and the inclusion of FourStar medium bands. σ {sub z} {sub ,pairs} is smallest for bright, blue star-forming samples, while red star-forming galaxies have the worst σ {sub z} {sub ,pairs}. Including FourStar medium bands reduces σ {sub z} {sub ,pairs} by 50% at 1.5 < z < 2.5. We calculate star formation rates (SFRs) based on ultraviolet and ultradeep far-IR Spitzer /MIPS and Herschel /PACS data. We derive rest-frame U − V and V − J colors, and illustrate how these correlate with specific SFR and dust emission to z = 3.5. We confirm the existence of quiescent galaxies at z ∼ 3, demonstrating their SFRs are suppressed by > ×15.« less
A Few New 2+1-Dimensional Nonlinear Dynamics and the Representation of Riemann Curvature Tensors
NASA Astrophysics Data System (ADS)
Wang, Yan; Zhang, Yufeng; Zhang, Xiangzhi
2016-09-01
We first introduced a linear stationary equation with a quadratic operator in ∂x and ∂y, then a linear evolution equation is given by N-order polynomials of eigenfunctions. As applications, by taking N=2, we derived a (2+1)-dimensional generalized linear heat equation with two constant parameters associative with a symmetric space. When taking N=3, a pair of generalized Kadomtsev-Petviashvili equations with the same eigenvalues with the case of N=2 are generated. Similarly, a second-order flow associative with a homogeneous space is derived from the integrability condition of the two linear equations, which is a (2+1)-dimensional hyperbolic equation. When N=3, the third second flow associative with the homogeneous space is generated, which is a pair of new generalized Kadomtsev-Petviashvili equations. Finally, as an application of a Hermitian symmetric space, we established a pair of spectral problems to obtain a new (2+1)-dimensional generalized Schrödinger equation, which is expressed by the Riemann curvature tensors.
NASA Astrophysics Data System (ADS)
Zhang, Xiaoen; Chen, Yong
2017-11-01
In this paper, a combination of stripe soliton and lump soliton is discussed to a reduced (3+1)-dimensional Jimbo-Miwa equation, in which such solution gives rise to two different excitation phenomena: fusion and fission. Particularly, a new combination of positive quadratic functions and hyperbolic functions is considered, and then a novel nonlinear phenomenon is explored. Via this method, a pair of resonance kink stripe solitons and rogue wave is studied. Rogue wave is triggered by the interaction between lump soliton and a pair of resonance kink stripe solitons. It is exciting that rogue wave must be attached to the stripe solitons from its appearing to disappearing. The whole progress is completely symmetry, the rogue wave starts itself from one stripe soliton and lose itself in another stripe soliton. The dynamic properties of the interaction between one stripe soliton and lump soliton, rogue wave are discussed by choosing appropriate parameters.
Evaluation of an interview process for admission into a school of pharmacy.
Kelsch, Michael P; Friesner, Daniel L
2012-03-12
To evaluate the doctor of pharmacy (PharmD) admissions interview process at North Dakota State University (NDSU). Faculty pairs interviewed candidates using a standardized grading rubric to evaluate qualitative parameters or attributes such as ethics, relevant life and work experience, emotional maturity, commitment to patient care, leadership, and understanding of the pharmacy profession. Total interview scores, individual attribute domain scores, and the consistency and reliability of the interviewers were assessed. The total mean interview score for the candidate pool was 17.4 of 25 points. Mean scores for individual domains ranged from 2.3 to 3.0 on a Likert-scale of 0-4. Nine of the 11 faculty pairs showed no mean differences from their interview partner in total interview scores given. Evaluations by 8 of the 11 faculty pairs produced high interrater reliability. The current interview process is generally consistent and reliable; however, future improvements such as additional interviewer training and adoption of a multiple mini-interview format could be made.
Gamow-Teller transitions and neutron-proton-pair transfer reactions
NASA Astrophysics Data System (ADS)
Van Isacker, P.; Macchiavelli, A. O.
2018-05-01
We propose a schematic model of nucleons moving in spin-orbit partner levels, j = l ± 1/2, to explain Gamow-Teller and two-nucleon transfer data in N = Z nuclei above 40Ca. Use of the LS coupling scheme provides a more transparent approach to interpret the structure and reaction data. We apply the model to the analysis of charge-exchange, 42Ca(3He,t)42Sc, and np-transfer, 40Ca(3He,p)42Sc, reactions data to define the elementary modes of excitation in terms of both isovector and isoscalar pairs, whose properties can be determined by adjusting the parameters of the model (spin-orbit splitting, isovector pairing strength and quadrupole matrix element) to the available data. The overall agreement with experiment suggests that the approach captures the main physics ingredients and provides the basis for a boson approximation that can be extended to heavier nuclei. Our analysis also reveals that the SU(4)-symmetry limit is not realized in 42Sc.
Evaluation of an Interview Process for Admission Into a School of Pharmacy
Friesner, Daniel L.
2012-01-01
Objective. To evaluate the doctor of pharmacy (PharmD) admissions interview process at North Dakota State University (NDSU). Methods. Faculty pairs interviewed candidates using a standardized grading rubric to evaluate qualitative parameters or attributes such as ethics, relevant life and work experience, emotional maturity, commitment to patient care, leadership, and understanding of the pharmacy profession. Total interview scores, individual attribute domain scores, and the consistency and reliability of the interviewers were assessed. Results. The total mean interview score for the candidate pool was 17.4 of 25 points. Mean scores for individual domains ranged from 2.3 to 3.0 on a Likert-scale of 0-4. Nine of the 11 faculty pairs showed no mean differences from their interview partner in total interview scores given. Evaluations by 8 of the 11 faculty pairs produced high interrater reliability. Conclusions. The current interview process is generally consistent and reliable; however, future improvements such as additional interviewer training and adoption of a multiple mini-interview format could be made. PMID:22438594
NASA Astrophysics Data System (ADS)
Mantha, Kameswara; McIntosh, Daniel H.; Conselice, Christopher; Cook, Joshua S.; Croton, Darren J.; Dekel, Avishai; Ferguson, Henry C.; Hathi, Nimish; Kodra, Dritan; Koo, David C.; Lotz, Jennifer M.; Newman, Jeffrey A.; Popping, Gergo; Rafelski, Marc; Rodriguez-Gomez, Vicente; Simmons, Brooke D.; Somerville, Rachel; Straughn, Amber N.; Snyder, Gregory; Wuyts, Stijn; Yu, Lu; Cosmic Assembly Near-Infrared Deep Extragalactic Legacy Survey (CANDELS) Team
2018-01-01
Cosmological simulations predict that the rate of merging between similar-mass massive galaxies should increase towards early cosmic-time. We study the incidence of major (stellar mass ratio SMR<4) close-pairs among log(Mstellar/Msun) > 10.3 galaxies spanning 0
Yin, Yuan; Shi, Deheng; Sun, Jinfeng; Zhu, Zunlue
2017-11-02
This work investigates the spectroscopic parameters, vibrational levels, and transition probabilities of 12 low-lying states, which are generated from the first dissociation limit, Br( 2 P u ) + O - ( 2 P u ), of the BrO - anion. The 12 states are X 1 Σ + , 2 1 Σ + , 1 1 Σ - , 1 1 Π, 2 1 Π, 1 1 Δ, a 3 Π, 1 3 Σ + , 2 3 Σ + , 1 3 Σ - , 2 3 Π, and 1 3 Δ. The potential energy curves are calculated with the complete active-space self-consistent field method, which is followed by the internally contracted multireference configuration interaction approach with Davidson modification. The dissociation energy D 0 of X 1 Σ + state is determined to be approximately 26876.44 cm -1 , which agrees well with the experimental one of 26494.50 cm -1 . Of these 12 states, the 2 1 Σ + , 1 1 Σ - , 2 1 Π, 1 1 Δ, 1 3 Σ + , 2 3 Σ + , 2 3 Π, and 1 3 Δ states are very weakly bound states, whose well depths are only several-hundred cm -1 . The a 3 Π, 2 3 Π, and 1 3 Δ states are inverted and account for the spin-orbit coupling effect. No states are repulsive regardless of whether the spin-orbit coupling effect is included. The spectroscopic parameters and vibrational levels are determined. The transition dipole moments of 12-pair electronic states are calculated. Franck-Condon factors of a number of transitions of more than 20-pair electronic states are evaluated. The electronic transitions are discussed. The spin-orbit coupling effect on the spectroscopic parameters and vibrational properties is profound for all the states except for X 1 Σ + , a 3 Π, and 1 1 Π. The spectroscopic parameters and transition probabilities obtained in this paper can provide some powerful guidelines for observing these states in a proper spectroscopy experiment, in particular the states that have very shallow potential wells.
Reversed field pinch operation with intelligent shell feedback control in EXTRAP T2R
NASA Astrophysics Data System (ADS)
Brunsell, P. R.; Kuldkepp, M.; Menmuir, S.; Cecconello, M.; Hedqvist, A.; Yadikin, D.; Drake, J. R.; Rachlew, E.
2006-11-01
Discharges in the thin shell reversed field pinch (RFP) device EXTRAP T2R without active feedback control are characterized by growth of non-resonant m = 1 unstable resistive wall modes (RWMs) in agreement with linear MHD theory. Resonant m = 1 tearing modes (TMs) exhibit initially fast rotation and the associated perturbed radial fields at the shell are small, but eventually TMs wall-lock and give rise to a growing radial field. The increase in the radial field at the wall due to growing RWMs and wall-locked TMs is correlated with an increase in the toroidal loop voltage, which leads to discharge termination after 3-4 wall times. An active magnetic feedback control system has been installed in EXTRAP T2R. A two-dimensional array of 128 active saddle coils (pair-connected into 64 independent m = 1 coils) is used with intelligent shell feedback control to suppress the m = 1 radial field at the shell. With feedback control, active stabilization of the full toroidal spectrum of 16 unstable m = 1 non-resonant RWMs is achieved, and TM wall locking is avoided. A three-fold extension of the pulse length, up to the power supply limit, is observed. Intelligent shell feedback control is able to maintain the plasma equilibrium for 10 wall times, with plasma confinement parameters sustained at values comparable to those obtained in thick shell devices of similar size.
Li, Cuiqin; Zhang, Fuhao; Gao, Zexin; He, Laping; Zeng, Xuefeng; Zhu, Qiujin; Yu, Lijuan
2018-01-01
We previously screened a whole-cell lipase EC 3.1.1.3 from the novel strain Aspergillus niger GZUF36, which exhibited 1,3-selectivity in the synthesis of 1,3-diacylglycerol via glycerolysis. However, the mechanism of lipase selectively in catalyzing the sn-1,3 position remains ambiguous. This work was performed to investigate the 1,3-selective mechanism of lipase using glycerolysis to synthesize 1,3-diacylglycerol (1,3-DG) as a model reaction by changing solvent(s) and water activity (a w ), and addition of salt hydrate pair. The measured diacylglycerol yield was also used to examine lipase activity. Results indicated that not only organic solvent and a w have strong effect on the sn-1,3 selectivity, but also ions of salt hydrate pair also affected selectivity. Lipase conformation was altered by hydrophobic interactions of the solvent, a w , or ions of salt hydrate, resulting in distinct sn-1,3 selectivity of the lipase. The salt hydrate pair changed the lipase conformation and selectivity not only by a w but also by static interactions, which was rarely reported. These parameters also affected lipase activity. The lipase displayed the highest selectivity (about 88%) and activity in solvents of t-butanol and n-hexane (1:29, v/v) at a w 0.43. The results demonstrated that the sn-1,3 selectivity and activity of the lipase from A. niger GZUF36 may be improved by control of some crucial factors. This work laid a foundation for the application of lipase in the synthesis of 1,3-DG and other structural and functional lipids.
Exceptionally high levels of recombination across the honey bee genome.
Beye, Martin; Gattermeier, Irene; Hasselmann, Martin; Gempe, Tanja; Schioett, Morten; Baines, John F; Schlipalius, David; Mougel, Florence; Emore, Christine; Rueppell, Olav; Sirviö, Anu; Guzmán-Novoa, Ernesto; Hunt, Greg; Solignac, Michel; Page, Robert E
2006-11-01
The first draft of the honey bee genome sequence and improved genetic maps are utilized to analyze a genome displaying 10 times higher levels of recombination (19 cM/Mb) than previously analyzed genomes of higher eukaryotes. The exceptionally high recombination rate is distributed genome-wide, but varies by two orders of magnitude. Analysis of chromosome, sequence, and gene parameters with respect to recombination showed that local recombination rate is associated with distance to the telomere, GC content, and the number of simple repeats as described for low-recombining genomes. Recombination rate does not decrease with chromosome size. On average 5.7 recombination events per chromosome pair per meiosis are found in the honey bee genome. This contrasts with a wide range of taxa that have a uniform recombination frequency of about 1.6 per chromosome pair. The excess of recombination activity does not support a mechanistic role of recombination in stabilizing pairs of homologous chromosome during chromosome pairing. Recombination rate is associated with gene size, suggesting that introns are larger in regions of low recombination and may improve the efficacy of selection in these regions. Very few transposons and no retrotransposons are present in the high-recombining genome. We propose evolutionary explanations for the exceptionally high genome-wide recombination rate.
Synthetic Superconductivity in Single-Layer Crystals
NASA Astrophysics Data System (ADS)
Levitov, Leonid; Borgnia, Dan; Lee, Patrick
2015-03-01
Electronic states in atomically thin 2D crystals are fully exposed and can couple to extrinsic degrees of freedom via long-range Coulomb interactions. Novel many-body effects in such systems can be engineered by embedding them in a polar environment. Superconducting pairing interaction induced in this way can enhance the intrinsic electron-phonon pairing mechanism. We take on this notion, which was around since the 60's (''excitonic superconductivity''), and consider synthetic superconductivity (SSC) induced in 2D crystals by a polar environment. One interesting aspect of this scenario is that Coulomb repulsion acts as superconductivity friend rather than a foe. Such repulsion-to-attraction transmutation allows to access strong-coupling superconductivity regime even when intrinsic pairing interaction is weak. We analyze pairing interaction in 2D crystals placed atop a highly polarizable dielectric with dispersive permittivity ɛ (ω) and predict that by optimizing system parameters a substantial enhancement can be achieved. We also argue that the SSC mechanism can be responsible, at least in part, for 100 K superconductivity recently observed in FeSe monolayers grown on SrTiO3 substrate, with Tc more than 10 times larger than in bulk 3D FeSe crystals, arxiv:1406.3435.
A resolution measure for three-dimensional microscopy
Chao, Jerry; Ram, Sripad; Abraham, Anish V.; Ward, E. Sally; Ober, Raimund J.
2009-01-01
A three-dimensional (3D) resolution measure for the conventional optical microscope is introduced which overcomes the drawbacks of the classical 3D (axial) resolution limit. Formulated within the context of a parameter estimation problem and based on the Cramer-Rao lower bound, this 3D resolution measure indicates the accuracy with which a given distance between two objects in 3D space can be determined from the acquired image. It predicts that, given enough photons from the objects of interest, arbitrarily small distances of separation can be estimated with prespecified accuracy. Using simulated images of point source pairs, we show that the maximum likelihood estimator is capable of attaining the accuracy predicted by the resolution measure. We also demonstrate how different factors, such as extraneous noise sources and the spatial orientation of the imaged object pair, can affect the accuracy with which a given distance of separation can be determined. PMID:20161040
van Dongen, Jenny; Willemsen, Gonneke; Heijmans, Bastiaan T.; Neuteboom, Jacoline; Kluft, Cornelis; Jansen, Rick; Penninx, Brenda W.J.; Slagboom, P. Eline; de Geus, Eco J.C.; Boomsma, Dorret I.
2015-01-01
Background BMI discordant monozygotic (MZ) twins allows an examination of the causes and consequences of adiposity in a genetically controlled design. Few studies have examined longitudinal BMI discordance in MZ pairs. Objectives To study the development over time of BMI discordance in adolescent and adult MZ twin pairs, and to examine lifestyle, metabolic, inflammatory, and gene expression differences associated with concurrent and long-term BMI discordance in MZ pairs. Subjects/Methods BMI data from 2775 MZ twin pairs, collected in eight longitudinal surveys and a biobank project between 1991 and 2011, were analyzed to characterize longitudinal discordance. Lifestyle characteristics were compared within discordant pairs (ΔBMI ≥ 3 kg/m2) and biomarkers (lipids, glucose, insulin, CRP, fibrinogen, IL-6, TNF-α and sIL-6R and liver enzymes AST, ALT and GGT) and gene expression were compared in peripheral blood from discordant pairs who participated in the NTR biobank project. Results The prevalence of discordance ranged from 3.2% in 1991 (mean age=17, SD=2.4) to 17.4% (N=202 pairs) in 2009 (mean age=35, SD=15), and was 16.5% (N=174) among pairs participating in the biobank project (mean age=35, SD=12). Of 699 MZ with BMI data from 3-5 time points, 17 pairs (2.4%) were long-term discordant (at all available time points; mean follow-up range=6.4 years). Concurrently discordant pairs showed significant differences in self-ratings of which twin eats most (p=2.3×10−13), but not in leisure time exercise activity (p=0.28) and smoking (p>0.05). Ten out of 14 biomarkers showed significantly more unfavorable levels in the heavier of twin of the discordant pairs (p-values < 0.001); most of these biomarker differences were largest in longitudinally discordant pairs. No significant gene expression differences were identified, although high ranking genes were enriched for Gene Ontology (GO) terms highlighting metabolic gene regulation and inflammation pathways. Conclusions BMI discordance is uncommon in adolescent identical pairs but increases with higher pair-mean of BMI at older ages, although long-term BMI discordance is rare. In discordant pairs, the heavier twin had a more unfavorable blood biomarker profile than the genetically matched leaner twin, in support of causal effects of obesity. PMID:25765203
Probing the central engine and environment of AGN using ARIES 1.3-m and 3.6-m telescopes
NASA Astrophysics Data System (ADS)
Chand, Hum; Rakshit, Suvendu; Jalan, Priyanka; Ojha, Vineet; Srianand, Raghunathan; Vivek, Mariappan; Mishra, Sapna; Omar, Amitesh; Kumar, Parveen; Joshi, Ravi; Gopal-Krishna; Kumar, Rathna
2018-04-01
We discuss three long term observational programmes to probe the central engine and environment of active galactic nuclei (AGN) using the recently installed ARIES 1.3-m and 3.6-m telescopes. The first programme is on the photometric reverberation mapping of low luminosity AGN by mainly using the ARIES 1.3-m telescope. The major impact of this programme other than to estimate the black hole mass will be to extend the broad line region (BLR) radius-luminosity (RBLR-LAGN) relation to the unexplored low luminosity regime, and to constrain the AGN broad line region geometry. The second programme is to use long slit spectroscopy on the ARIES 3.6-m telescope to discover new high redshift quasar pairs with angular separation less than 1-arcmin. Here, the background QSOs sight-line will be used to probe the environment of the foreground QSOs at kpc-Mpc scales. The major impact of this programme will be on the discovery of new pairs which have been missed in the SDSS survey due to fiber collision below 1-arcmin separation, and use them to understand about any excess overdensity around the QSO, any anisotropic emission of QSOs, and/or any episodic activity of QSOs. The third programme is related to spectral variability studies of the C IV broad absorption line (BAL) QSOs, based on low resolution spectroscopy using the ARIES 3.6-m telescope. Here, those most interesting cases will be monitored, where the BAL flow emerges afresh or disappears completely in the C IV trough of BAL QSOs sample as seen in SDSS multi-epoch observations. Continuous monitoring of such a sample will be important for our understanding of the nature and origin of the flow, along with their stability and dynamical evolution.
Extracting accurate and precise topography from LROC narrow angle camera stereo observations
NASA Astrophysics Data System (ADS)
Henriksen, M. R.; Manheim, M. R.; Burns, K. N.; Seymour, P.; Speyerer, E. J.; Deran, A.; Boyd, A. K.; Howington-Kraus, E.; Rosiek, M. R.; Archinal, B. A.; Robinson, M. S.
2017-02-01
The Lunar Reconnaissance Orbiter Camera (LROC) includes two identical Narrow Angle Cameras (NAC) that each provide 0.5 to 2.0 m scale images of the lunar surface. Although not designed as a stereo system, LROC can acquire NAC stereo observations over two or more orbits using at least one off-nadir slew. Digital terrain models (DTMs) are generated from sets of stereo images and registered to profiles from the Lunar Orbiter Laser Altimeter (LOLA) to improve absolute accuracy. With current processing methods, DTMs have absolute accuracies better than the uncertainties of the LOLA profiles and relative vertical and horizontal precisions less than the pixel scale of the DTMs (2-5 m). We computed slope statistics from 81 highland and 31 mare DTMs across a range of baselines. For a baseline of 15 m the highland mean slope parameters are: median = 9.1°, mean = 11.0°, standard deviation = 7.0°. For the mare the mean slope parameters are: median = 3.5°, mean = 4.9°, standard deviation = 4.5°. The slope values for the highland terrain are steeper than previously reported, likely due to a bias in targeting of the NAC DTMs toward higher relief features in the highland terrain. Overlapping DTMs of single stereo sets were also combined to form larger area DTM mosaics that enable detailed characterization of large geomorphic features. From one DTM mosaic we mapped a large viscous flow related to the Orientale basin ejecta and estimated its thickness and volume to exceed 300 m and 500 km3, respectively. Despite its ∼3.8 billion year age the flow still exhibits unconfined margin slopes above 30°, in some cases exceeding the angle of repose, consistent with deposition of material rich in impact melt. We show that the NAC stereo pairs and derived DTMs represent an invaluable tool for science and exploration purposes. At this date about 2% of the lunar surface is imaged in high-resolution stereo, and continued acquisition of stereo observations will serve to strengthen our knowledge of the Moon and geologic processes that occur across all of the terrestrial planets.
Carreira, Guido Correia; Gemeinhardt, Ole; Gorenflo, Rudolf; Beyersdorff, Dirk; Franiel, Tobias; Plendl, Johanna; Lüdemann, Lutz
2011-06-01
Dynamic contrast-enhanced magnetic resonance imaging commonly uses compartment models to estimate tissue parameters in general and perfusion parameters in particular. Compartment models assume a homogeneous distribution of the injected tracer throughout the compartment volume. Since tracer distribution within a compartment cannot be assessed, the parameters obtained by means of a compartment model might differ from the actual physical values. This work systematically examines the widely used permeability-surface-limited one-compartment model to determine the reliability of the parameters obtained by comparing them with their actual values. A computer simulation was used to model spatial tracer distribution within the interstitial volume using diffusion of contrast agent in tissue. Vascular parameters were varied as well as tissue parameters. The vascular parameters used were capillary radius (4 and 12 μm), capillary permeability (from 0.03 to 3.3 μm/s) and intercapillary distances from 30 to 300 μm. The tissue parameters used were tortuosity (λ), porosity (α) and interstitial volume fraction (v(e)). Our results suggest that the permeability-surface-limited compartment model generally underestimates capillary permeability for capillaries with a radius of 4 μm by factors from ≈0.03 for α=0.04, to ≈ 0.1 for α=0.2, to ≈ 0.5 for α=1.0. An overestimation of actual capillary permeability for capillaries with a radius of 12 μm by a factor of ≥1.3 was found for α=1.0, while α=0.2 yielded an underestimation by a factor of ≈0.3 and α=0.04 by a factor of ≈ 0.03. The interstitial volume fraction, v(e), obtained by the compartment model differed with increasing intercapillary distances and for low vessel permeability, whereas v(e) was found to be estimated approximately accurately for P=0.3 μm/s and P=3.3 μm/s for vessel distances <100 μm. Copyright © 2011 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Cheng, Qifa; Xu, Jing; Wang, Tao; Fan, Ling; Ma, Ruifang; Yu, Xinzhi; Zhu, Jian; Xu, Zhi; Lu, Bingan
2017-11-01
Photoelectrocatalysis (PEC) has been demonstrated as a promising technique for hydrogen production. However, the high over-potential and high recombination rate of photo-induced electron-hole pairs lead to poor hydrogen production efficiency. In order to overcome these problems, TiO2 and Au dual quantum dots (QDs) on three-dimensional graphene flowers (Au@TiO2@3DGFs) was synthesized by an electro-deposition strategy. The combination of Au and TiO2 modulates the band gap of TiO2, shifts the absorption to visible lights and improves the utilization efficiency of solar light. Simultaneously, the size-quantization TiO2 on 3DGFs not only achieves a larger specific surface area over conventional nanomaterials, but also promotes the separation of the photo-induced electron-hole pairs. Besides, the 3DGFs as a scaffold for QDs can provide more active sites and stable structure. Thus, the newly-developed Au@TiO2@3DGFs composite exhibited an impressive PEC activity and excellent durability. Under -240 mV potential (vs. RHE), the photoelectric current density involved visible light illumination (100 mW cm-2) reached 90 mA cm-2, which was about 3.6 times of the natural current density (without light, only 25 mA cm-2). It worth noting that the photoelectric current density did not degrade and even increased to 95 mA cm-2 over 90 h irradiation, indicating an amazing chemical stability.
Mechanistic, Mutational, and Structural Evaluation of a Taxus Phenylalanine Aminomutase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feng, Lei; Wanninayake, Udayanga; Strom, Susan
The structure of a phenylalanine aminomutase (TcPAM) from Taxus canadensis has been determined at 2.4 {angstrom} resolution. The active site of the TcPAM contains the signature 4-methylidene-1H-imidazol-5(4H)-one prosthesis, observed in all catalysts of the class I lyase-like family. This catalyst isomerizes (S)-{alpha}-phenylalanine to the (R)-{beta}-isomer by exchange of the NH{sub 2}/H pair. The stereochemistry of the TcPAM reaction product is opposite of the (S)-{beta}-tyrosine made by the mechanistically related tyrosine aminomutase (SgTAM) from Streptomyces globisporus. Since TcPAM and SgTAM share similar tertiary- and quaternary-structures and have several highly conserved aliphatic residues positioned analogously in their active sites for substrate recognition,more » the divergent product stereochemistries of these catalysts likely cannot be explained by differences in active site architecture. The active site of the TcPAM structure also is in complex with (E)-cinnamate; the latter functions as both a substrate and an intermediate. To account for the distinct (3R)-{beta}-amino acid stereochemistry catalyzed by TcPAM, the cinnamate skeleton must rotate the C{sub 1}-C{sub {alpha}} and C{sub ipso}-C{sub {beta}} bonds 180{sup o} in the active site prior to exchange and rebinding of the NH{sub 2}/H pair to the cinnamate, an event that is not required for the corresponding acrylate intermediate in the SgTAM reaction. Moreover, the aromatic ring of the intermediate makes only one direct hydrophobic interaction with Leu-104. A L104A mutant of TcPAM demonstrated an 1.5-fold increase in k{sub cat} and a decrease in K{sub M} values for sterically demanding 3'-methyl-{alpha}-phenylalanine and styryl-{alpha}-alanine substrates, compared to the kinetic parameters for TcPAM. These parameters did not change significantly for the mutant with 4'-methyl-{alpha}-phenylalanine compared to those for TcPAM.« less
Vasbinder, E; Van der Weken, G; Vander Heyden, Y; Baeyens, W R G; Debunne, A; Remon, J P; García-Campaña, A M
2004-01-01
An ion-pair high performance liquid chromatographic method was developed for the simultaneous determination of p-aminosalicylic acid (PAS) and its degradation product m-aminophenol (MAP) in a newly developed multiparticular drug delivery system. Owing to the concentration differences of PAS and MAP, acetanilide and sulfanilic acid were used as internal standards, respectively. The separation was performed on a Chromolith SpeedROD RP-18e column, a new packing material consisting of monolithic rods of highly porous silica. The mobile phase composition was of 20 mm phosphate buffer, 20 mm tetrabutylammonium hydrogen sulphate and 16% (v/v) methanol adjusted to pH 6.8, at a flow-rate of 1.0 mL/min, resulting in a run-time of about 6 min. Detection was by UV at 233 nm. The method was validated and proved to be useful for stability testing of the new dosage form. Separation efficiency was compared between the new packing material Chromolith SpeedROD RP-18e and the conventional reversed-phase cartridge LiChroCART 125-4 (5 microm). A robustness test was carried out on both columns and different separation parameters (retention, resolution, run time, temperature) were determined. Copyright 2004 John Wiley & Sons, Ltd.
Jeridi, Mouna; Bakry, Frédéric; Escoute, Jacques; Fondi, Emmanuel; Carreel, Françoise; Ferchichi, Ali; D'Hont, Angélique; Rodier-Goud, Marguerite
2011-01-01
Background and Aims Most cooking banana and several desert bananas are interspecific triploid hybrids between Musa acuminata (A genome) and Musa balbisiana (B genome). In addition, M. balbisiana has agronomical characteristics such as resistance to biotic and abiotic stresses that could be useful to improve monospecific acuminata cultivars. To develop efficient breeding strategies for improving Musa cultivars, it is therefore important to understand the possibility of chromosome exchange between these two species. Methods A protocol was developed to prepare chromosome at meiosis metaphase I suitable for genomic in situ hybridization. A series of technical challenges were encountered, the main ones being the hardness of the cell wall and the density of the microsporocyte's cytoplasm, which hampers accessibility of the probes to the chromosomes. Key parameters in solving these problems were addition of macerozyme in the enzyme mix, the duration of digestion and temperature during the spreading phase. Results and Conclusions This method was applied to analyse chromosome pairing in metaphase from triploid interspecific cultivars, and it was clearly demonstrated that interspecific recombinations between M. acuminata and M. balbisiana chromosomes do occur and may be frequent in triploid hybrids. These results provide new insight into Musa cultivar evolution and have important implications for breeding. PMID:21835815
Speckle Interferometry at the Blanco and SOAR Telescopes in 2008 and 2009
NASA Technical Reports Server (NTRS)
Tokovinin, Andrei; Mason, Brian D.; Hartkopf, William I.
2010-01-01
The results of speckle interferometric measurements of binary and multiple stars conducted in 2008 and 2009 at the Blanco and Southern Astrophysical Research (SOAR) 4 m telescopes in Chile are presented. A tot al of 1898 measurements of 1189 resolved pairs or sub-systems and 394 observations of 285 un-resolved targets are listed. We resolved for the first time 48 new pairs, 21 of which are new sub-systems in close visual multiple stars. Typical internal measurement precision is 0.3 mas in both coordinates, typical companion detection capability is delta m approximately 4.2 at 0.15 degree separation. These data were obtained with a new electron-multiplication CCD camera; data processing is described in detail, including estimation of magnitude difference, observational errors, detection limits, and analysis of artifacts. We comment on some newly discovered pairs and objects of special interest.
SPECKLE INTERFEROMETRY AT THE BLANCO AND SOAR TELESCOPES IN 2008 AND 2009
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tokovinin, Andrei; Mason, Brian D.; Hartkopf, William I.
2010-02-15
The results of speckle interferometric measurements of binary and multiple stars conducted in 2008 and 2009 at the Blanco and SOAR 4 m telescopes in Chile are presented. A total of 1898 measurements of 1189 resolved pairs or sub-systems and 394 observations of 285 un-resolved targets are listed. We resolved for the first time 48 new pairs, 21 of which are new sub-systems in close visual multiple stars. Typical internal measurement precision is 0.3 mas in both coordinates, typical companion detection capability is {delta}m {approx} 4.2 at 0.''15 separation. These data were obtained with a new electron-multiplication CCD camera; datamore » processing is described in detail, including estimation of magnitude difference, observational errors, detection limits, and analysis of artifacts. We comment on some newly discovered pairs and objects of special interest.« less
Gardiner, Bruce S; Thompson, Sarah L; Ngo, Jennifer P; Smith, David W; Abdelkader, Amany; Broughton, Brad R S; Bertram, John F; Evans, Roger G
2012-09-01
To understand how geometric factors affect arterial-to-venous (AV) oxygen shunting, a mathematical model of diffusive oxygen transport in the renal cortex was developed. Preglomerular vascular geometry was investigated using light microscopy (providing vein shape, AV separation, and capillary density near arteries) and published micro-computed tomography (CT) data (providing vessel size and AV separation; Nordsletten DA, Blackett S, Bentley MD, Ritman EL, Smith NP. IUPS Physiome Project. http://www.physiome.org.nz/publications/nordsletten_blackett_ritman_bentley_smith_2005/folder_contents). A "U-shaped" relationship was observed between the arterial radius and the distance between the arterial and venous lumens. Veins were found to partially wrap around the artery more consistently for larger rather than smaller arteries. Intrarenal arteries were surrounded by an area of fibrous tissue, lacking capillaries, the thickness of which increased from ∼5 μm for the smallest arteries (<16-μm diameter) to ∼20 μm for the largest arteries (>200-μm diameter). Capillary density was greater near smaller arteries than larger arteries. No capillaries were observed between wrapped AV vessel pairs. The computational model comprised a single AV pair in cross section. Geometric parameters critical in renal oxygen transport were altered according to variations observed by CT and light microscopy. Lumen separation and wrapping of the vein around the artery were found to be the critical geometric factors determining the amount of oxygen shunted between AV pairs. AV oxygen shunting increases both as lumen separation decreases and as the degree of wrapping increases. The model also predicts that capillaries not only deliver oxygen, but can also remove oxygen from the cortical parenchyma close to an AV pair. Thus the presence of oxygen sinks (capillaries or tubules) near arteries would reduce the effectiveness of AV oxygen shunting. Collectively, these data suggest that AV oxygen shunting would be favored in larger vessels common to the cortical and medullary circulations (i.e., arcuate and proximal interlobular arteries) rather than the smaller vessels specific to the cortical circulation (distal interlobular arteries and afferent arterioles).
Pourcain, Beate St.; Smith, George Davey; York, Timothy P.; Evans, David M.
2014-01-01
Genome wide complex trait analysis (GCTA) is extended to include environmental effects of the maternal genotype on offspring phenotype (“maternal effects”, M-GCTA). The model includes parameters for the direct effects of the offspring genotype, maternal effects and the covariance between direct and maternal effects. Analysis of simulated data, conducted in OpenMx, confirmed that model parameters could be recovered by full information maximum likelihood (FIML) and evaluated the biases that arise in conventional GCTA when indirect genetic effects are ignored. Estimates derived from FIML in OpenMx showed very close agreement to those obtained by restricted maximum likelihood using the published algorithm for GCTA. The method was also applied to illustrative perinatal phenotypes from ∼4,000 mother-offspring pairs from the Avon Longitudinal Study of Parents and Children. The relative merits of extended GCTA in contrast to quantitative genetic approaches based on analyzing the phenotypic covariance structure of kinships are considered. PMID:25060210
NASA Astrophysics Data System (ADS)
Mardirossian, Narbe; Head-Gordon, Martin
2015-02-01
A meta-generalized gradient approximation density functional paired with the VV10 nonlocal correlation functional is presented. The functional form is selected from more than 1010 choices carved out of a functional space of almost 1040 possibilities. Raw data come from training a vast number of candidate functional forms on a comprehensive training set of 1095 data points and testing the resulting fits on a comprehensive primary test set of 1153 data points. Functional forms are ranked based on their ability to reproduce the data in both the training and primary test sets with minimum empiricism, and filtered based on a set of physical constraints and an often-overlooked condition of satisfactory numerical precision with medium-sized integration grids. The resulting optimal functional form has 4 linear exchange parameters, 4 linear same-spin correlation parameters, and 4 linear opposite-spin correlation parameters, for a total of 12 fitted parameters. The final density functional, B97M-V, is further assessed on a secondary test set of 212 data points, applied to several large systems including the coronene dimer and water clusters, tested for the accurate prediction of intramolecular and intermolecular geometries, verified to have a readily attainable basis set limit, and checked for grid sensitivity. Compared to existing density functionals, B97M-V is remarkably accurate for non-bonded interactions and very satisfactory for thermochemical quantities such as atomization energies, but inherits the demonstrable limitations of existing local density functionals for barrier heights.
Williams, Phillip N; McGarry, Michelle H; Ihn, Hansel; Schulz, Brian M; Limpisvasti, Orr; ElAttrache, Neal S; Lee, Thay Q
2018-05-07
The original 2-strand docking technique for elbow ulnar collateral ligament reconstruction has recently been modified to use a 3-strand graft. To date, no biomechanical study has compared the 2 techniques. We hypothesized that the 3-strand docking technique would restore valgus laxity to its native state, with comparable load-to-failure characteristics to the 2-strand docking technique. Sixteen fresh cadaveric elbows were matched to the corresponding contralateral side from the same individual to create 8 matched pairs and were then randomized to undergo ulnar collateral ligament reconstruction using either the 2- or 3-strand technique. Valgus laxity and rotation measurements were quantified using a MicroScribe 3DLX digitizer at various flexion angles for the native state, transected state, and 1 of the 2 tested reconstructed ligaments. Each reconstruction was then tested to failure. Valgus laxity for the intact state at elbow flexion angles of 30°, 60°, 90°, and 120° was 7° ± 2°, 7° ± 2°, 6° ± 1°, and 5° ± 2°, respectively. These values were similar to those of both reconstruction techniques. On load-to-failure testing, there was no significant difference in any parameter recorded. Yield torques for the 3- and 2-strand reconstructions were 13.4 ± 4.80 N/m and 11.8 ± 4.76 N/m, respectively (P = .486). The ultimate torques were 15.7 ± 6.10 N/m and 14.4 ± 5.58 N/m for the 3- and 2-strand techniques, respectively (P = .582). The 3-strand docking technique was able to restore valgus laxity to the native state, with similar load-to-failure characteristics to the 2-strand docking technique. Copyright © 2018 Journal of Shoulder and Elbow Surgery Board of Trustees. All rights reserved.
Lim, Hyun-Hee; Shin, Ho-Sang
2014-09-26
A liquid chromatography-tandem mass spectrometry method (LC-MS/MS) was developed in order to determine the amount of acrylamide in foods after derivatization with d-cysteine. The sulfhydryl group of d-cysteine was added at the β-site double bond of acrylamide to form 2-amino-3-(3-amino-3-oxo-propyl)sulfanyl-propanoic acid. Deuterated acrylamide (acrylamide-d3) was chosen as the internal standard (IS) for analyzing the food samples. Acrylamide was extracted from 2.0 g of food sample with 6 mL of methylene chloride, and the organic extract was diluted with 3 mL of hexane, and then the analyte was back-extracted with 0.5 mL of pure water. The derivatization of acrylamide was performed in the water extract. The best reaction conditions (3.0mg of d-cysteine, a pH 6.5, a reaction temperature of 90°C, and a heating time of 50 min) were established by the variation of parameters. The formed derivative was injected into the LC-MS/MS without further extraction or purification procedures. Separation and detection were improved with the use of an ion-pairing reagent of perfluorooctanoic acid. Under the established conditions, the limits of detection and the limits of quantification were 0.04 μg/kg and 0.14 μg/kg, respectively, and the inter-day relative standard deviation was less than 8% at concentrations of 20 and 100 μg/kg. The method was successfully applied to determine the amount of acrylamide in potato chips, French fries, and coffee. Copyright © 2014 Elsevier B.V. All rights reserved.
Fraser, Graham M; Goldman, Daniel; Ellis, Christopher G
2013-11-01
We compare RMN to PCA under several simulated physiological conditions to determine how the use of different vascular geometry affects oxygen transport solutions. Three discrete networks were reconstructed from intravital video microscopy of rat skeletal muscle (84 × 168 × 342 μm, 70 × 157 × 268 μm, and 65 × 240 × 571 μm), and hemodynamic measurements were made in individual capillaries. PCAs were created based on statistical measurements from RMNs. Blood flow and O₂ transport models were applied, and the resulting solutions for RMN and PCA models were compared under four conditions (rest, exercise, ischemia, and hypoxia). Predicted tissue PO₂ was consistently lower in all RMN simulations compared to the paired PCA. PO₂ for 3D reconstructions at rest were 28.2 ± 4.8, 28.1 ± 3.5, and 33.0 ± 4.5 mmHg for networks I, II, and III compared to the PCA mean values of 31.2 ± 4.5, 30.6 ± 3.4, and 33.8 ± 4.6 mmHg. Simulated exercise yielded mean tissue PO₂ in the RMN of 10.1 ± 5.4, 12.6 ± 5.7, and 19.7 ± 5.7 mmHg compared to 15.3 ± 7.3, 18.8 ± 5.3, and 21.7 ± 6.0 in PCA. These findings suggest that volume matched PCA yield different results compared to reconstructed microvascular geometries when applied to O₂ transport modeling; the predominant characteristic of this difference being an over estimate of mean tissue PO₂. Despite this limitation, PCA models remain important for theoretical studies as they produce PO₂ distributions with similar shape and parameter dependence as RMN. © 2013 John Wiley & Sons Ltd.
Rodrigues, Roberta R; Cheema, Hammad; Delcamp, Jared H
2018-05-04
The development of high voltage solar cells is an attractive way to use sunlight for solar-to-fuel devices, multijunction solar-to-electric systems, and to power limited-area consumer electronics. By designing a low-oxidation-potential organic dye (RR9)/redox shuttle (Fe(bpy) 3 3+/2+ ) pair for dye-sensitized solar-cell (DSSC) devices, the highest single device photovoltage (1.42 V) has been realized for a DSSC not relying on doped TiO 2 . Additionally, Fe(bpy) 3 3+/2+ offers a robust, readily tunable ligand platform for redox potential tuning. RR9 can be regenerated with a low driving force (190 mV), and by utilizing the RR9/Fe(bpy) 3 3+/2+ redox shuttle pair in a subcell for a sequential series multijunction (SSM)-DSSC system, one of the highest known three subcell photovoltage was attained for any solar-cell technology (3.34 V, >1.0 V per subcell). © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Chudinova, G. K.; Nagovitsyn, I. A.; Karpov, R. E.; Savranskii, V. V.
2003-09-01
A method is developed for detecting protein antigens for fluorescent immunoassay using a model system based on the technique for preparation of Langmuir films. Fluorescein isothiocyanate and donor-acceptor energy-transfer pairs of markers (the Yb complex of tetraphenyl porphyrin — benzoyl trifluoroacetoneisothiocyanate and derivatives of tetra(carboxyphenyl) porphyrin — cyanine dye containing a five-membered polyene chain), which were nor studied earlier, were used as markers for detecting the binding of an antigen on the surface of Langmuir films of antibodies. Fluorescence was detected in the near-IR region (for the first pair) and in the visible spectral range (for the second pair). To reduce the nonspecific sorption of a protein (antigen), a method was proposed for the preparation of a nonpolar surface by applying an even number of layers of stearic acid as a substrate for the Langmuir — Blodgett film. A high sensitivity of model systems to a protein antigen in solution was achieved (~10-11 M), the assay time being 6 — 8 min. The model system with the first donor — acceptor pair was tested in analysis of the blood plasma. The fluorescence of the Dy3+, Tm3+, and Yb3+ complexes of tetraphenyl porphyrin sensitised by diketonate complexes of lanthanides was studied for the first time and the enhancement of the IR fluorescence of these complexes in a Langmuir film was demonstrated.
Fluvial disturbance patches and cottonwood recruitment along the Upper Missouri River, Montana
Auble, G.T.; Scott, M.L.
1998-01-01
The disturbance patches most suitable for seedling establishment of pioneer riparian trees are also subject to future disturbances that produce high seedling mortality. We are monitoring plains cottonwood seedling establishment and mortality along the Wild and Scenic reach of the Missouri River upstream of Fort Peck Reservoir, Montana at four sites subject to livestock grazing and four paired, ungrazed exclosures. New seedlings at these sites were largely restricted to surfaces inundated by spring and summer flows. Winter ice drives and livestock grazing are important mortality factors along the study reach. Livestock grazing reduced seedling densities, although the position of these seedlings in normal flow years means it is unlikely that they will survive future disturbance. Average values of the maximum density parameter of a Gaussian curve of seedling distribution along a hydraulic gradient of inundating discharge were 30 and 114 seedlings/m2 on ungrazed sites in 1996 and 1997, compared to 19 and 18 seedlings/m2 for grazed sites. Water-surface elevations produced by ice drives and damming in the severe winter of 1995-1996 corresponded to inundating discharges of 1,670 to 4,580 m3/s. No existing trees at the study sites occurred at inundating discharges below 1,625 m3/s. Seedlings established as a result of maximum summer flows of 827 and 1,201 m3/s in 1996 and 1997 were all below the elevation of the 10-year return flow of 1,495 m3/s. Recruitment of plains cottonwood trees along this reach of the Missouri River is strongly dependent on infrequent high flows that position moist, bare disturbed patches high enough for seedlings to establish and survive subsequent flooding and ice scour, in contrast to other reaches and streams where hydrogeomophic processes of channel meandering and narrowing produce different patterns of disturbance patches.
Heterogeneous Defensive Naval Weapon Assignment To Swarming Threats In Real Time
2016-03-01
threat Damage potential of target t if it hits the ship [integer from 0 to 3] _ ttarget phit Probability that target t hits the ship [probability...secondary weapon systems on target t [integer] _ tsec phit Probability that secondary weapon systems launched from target t hit the ship...pairing. These parameters are calculated as follows: 310 _ _t t tpriority target threat target phit = × × (3.1) 3_ 10 _ _t t tsec priority sec
Singh, Saurabh Kumar; Vignesh, Kuduva R; Archana, Velloth; Rajaraman, Gopalan
2016-05-10
Density functional calculations have been performed on a series of {Re(IV)-M(II)} (M = Mn(), Fe(), Co(), Ni(), Cu()) complexes to compute the magnetic exchange interaction between the Re(IV) and M(II) ions, and understand the mechanism of magnetic coupling in this series. DFT calculations yield J values of -5.54 cm(-1), +0.44 cm(-1), +10.5 cm(-1), +4.54 cm(-1) and +19 cm(-1) for complexes respectively, and these estimates are in general agreement with the experimental reports. Using molecular orbital (MO) and overlap integral analysis, we have established a mechanism of coupling for a {3d-5d} pair and the proposed mechanism rationalises both the sign and the magnitude of J values observed in this series. Our proposed mechanism of coupling has five contributing factors: (i) (Re)dyz-dyz(3d) overlap, (ii) (Re)dxz-dxz(3d) overlap, (iii) (Re)dxy-dxy(3d) overlap, (iv) (Re)eg-t2g(3d) overlaps and (v) (Re)eg-eg(3d) overlaps. Here, the first two terms are found to contribute to the antiferromagnetic part of the exchange, while the other three contribute to the ferromagnetic part. The last two terms correspond to the cross-interactions and also contribute to the ferromagnetic part of the exchange. A record high ferromagnetic J value observed for the {Re(IV)-Cu(II)} pair in complex is found to be due to a significant cross interaction between the dz(2) orbital of the Re(IV) ion and the dx(2)-y(2) orbital of the Cu(ii) ion. Magneto-structural correlations are developed for Re-C and M-N bond lengths and Re-C-N and M-N-C bond angles. Among the developed correlations, the M-N-C bond angle is found to be the most sensitive parameter which influences the sign and strength of J values in this series. The J values are found to be more positive (or less negative) as the angle increases, indicating stronger ferromagnetic coupling at linear M-N-C angles. Apart from the magnetic exchange interaction, we have also estimated the magnetic anisotropy of [ReCl4(CN)2](2-) and [(DMF)4(CN)M(II)(CN)] (M(II)-Fe(II), Co(II) and Ni(II)) units using the state-of-the-art ab initio CASSCF/PT2/RASSI-SO/SINGLE_ANISO approach. The calculated D and E values for these building units are found to be in agreement with the available experimental results. Particularly a large positive D computed for the [ReCl4(CN)2](2-) unit was found to arise from dxz/dyz → dxy excitations corresponding to the low-lying doublet states. Similarly, a very large positive D value computed for Fe(II) and Co(II) units are also rationalised based on the corresponding ground state electronic configurations computed. The non-collinearity of the Re(IV) ion and the M(II) ion axial anisotropy (DZZ) axis are found to diminish the anisotropy of the building unit, leading to the observation of moderate relaxation barriers for these molecules.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fabrycky, Daniel C.; Lissauer, Jack J.; Ragozzine, Darin
Having discovered 885 planet candidates in 361 multiple-planet systems, Kepler has made transits a powerful method for studying the statistics of planetary systems. The orbits of only two pairs of planets in these candidate systems are apparently unstable. This indicates that a high percentage of the candidate systems are truly planets orbiting the same star, motivating physical investigations of the population. Pairs of planets in this sample are typically not in orbital resonances. However, pairs with orbital period ratios within a few percent of a first-order resonance (e.g. 2:1, 3:2) prefer orbital spacings just wide of the resonance and avoidmore » spacings just narrow of the resonance. Finally, we investigate mutual inclinations based on transit duration ratios. We infer that the inner planets of pairs tend to have a smaller impact parameter than their outer companions, suggesting these planetary systems are typically coplanar to within a few degrees.« less
Evidence for the 125 GeV Higgs boson decaying to a pair of $$\\tau$$ leptons
Chatrchyan, Serguei
2014-01-20
A search for a standard model Higgs boson decaying into a pair of tau leptons is performed using events recorded by the CMS experiment at the LHC in 2011 and 2012. The dataset corresponds to an integrated luminosity of 4.9 inverse femtobarns at a centre-of-mass energy of 7 TeV and 19.7 inverse femtobarns at 8 TeV. Each tau lepton decays hadronically or leptonically to an electron or a muon, leading to six different final states for the tau-lepton pair, all considered in this analysis. An excess of events is observed over the expected background contributions, with a local significance largermore » than 3 standard deviations for m[H] values between 115 and 130 GeV. The best fit of the observed H to tau tau signal cross section for m[H] = 125 GeV is 0.78 +- 0.27 times the standard model expectation. These observations constitute evidence for the 125 GeV Higgs boson decaying to a pair of tau leptons.« less
NASA Astrophysics Data System (ADS)
Muckenhuber, Stefan; Sandven, Stein
2017-04-01
An open-source sea ice drift algorithm for Sentinel-1 SAR imagery is introduced based on the combination of feature-tracking and pattern-matching. A computational efficient feature-tracking algorithm produces an initial drift estimate and limits the search area for the pattern-matching, that provides small to medium scale drift adjustments and normalised cross correlation values as quality measure. The algorithm is designed to utilise the respective advantages of the two approaches and allows drift calculation at user defined locations. The pre-processing of the Sentinel-1 data has been optimised to retrieve a feature distribution that depends less on SAR backscatter peak values. A recommended parameter set for the algorithm has been found using a representative image pair over Fram Strait and 350 manually derived drift vectors as validation. Applying the algorithm with this parameter setting, sea ice drift retrieval with a vector spacing of 8 km on Sentinel-1 images covering 400 km x 400 km, takes less than 3.5 minutes on a standard 2.7 GHz processor with 8 GB memory. For validation, buoy GPS data, collected in 2015 between 15th January and 22nd April and covering an area from 81° N to 83.5° N and 12° E to 27° E, have been compared to calculated drift results from 261 corresponding Sentinel-1 image pairs. We found a logarithmic distribution of the error with a peak at 300 m. All software requirements necessary for applying the presented sea ice drift algorithm are open-source to ensure free implementation and easy distribution.
Colour Reconnection in WW Events
NASA Astrophysics Data System (ADS)
D'Hondt, J.
2003-07-01
Preliminary results are presented for a measurement of the κ parameter used in the JETSET SK-I model of Colour Reconnection in {W}+{W}^- -> qbar {q}'bar {q}q^' events at LEP2. An update on the investigation of Colour Reconnection effects in hadronic decays of W pairs, using the particle flow in DELPHI is presented. A second method is based on the observation that two different mW estimators have different sensitivity to the parametrised Colour Reconnection effect. Hence the difference between them is an observable with information content about κ.
Hickey, James P.
1996-01-01
This chapter provides a listing of the increasing variety of organic moieties and heteroatom group for which Linear Solvation Energy Relationship (LSER) values are available, and the LSER variable estimation rules. The listings include values for typical nitrogen-, sulfur- and phosphorus-containing moieties, and general organosilicon and organotin groups. The contributions by an ion pair situation to the LSER values are also offered in Table 1, allowing estimation of parameters for salts and zwitterions. The guidelines permit quick estimation of values for the four primary LSER variables Vi/100, π*, Βm, and αm by summing the contribtuions from its components. The use of guidelines and Table 1 significantly simplifies computation of values for the LSER variables for most possible organic comppounds in the environment, including the larger compounds of environmental and biological interest.
Orbit IMU alinement interpretation of onboard display data
NASA Technical Reports Server (NTRS)
Corson, R.
1978-01-01
The space shuttle inertial measurement unit (IMU) alinement algorith was examined to determine the most important alinement starpair selection criterion. Three crew displayed parameters were considered: (1) the results of the separation angle difference (SAD) check for each starpair; (2) the separation angle of each starpair; and (3) the age of each star measurement. It was determined that the SAD for each pair cannot be used to predict the IMu alinement accuracy. If the age of each star measurement is less than approximately 30 minutes, time is a relatively unimportant factor and the most important alinement pair selection criterion is the starpair separation angle. Therefore, when there are three available alinement starpairs and all measurements were taken within the last 30 minutes, the pair with the separation angle closest to 90 degrees should be selected for IMU alinement.
Enhancement of Electrokinetically-Driven Flow Mixing in Microchannel with Added Side Channels
NASA Astrophysics Data System (ADS)
Yang, Ruey-Jen; Wu, Chien-Hsien; Tseng, Tzu-I; Huang, Sung-Bin; Lee, Gwo-Bin
2005-10-01
Electroosmotic flow (EOF) in microchannels is restricted to low Reynolds number regimes. Since the inertial forces are extremely weak in such regimes, turbulent conditions do not readily develop. Therefore, species mixing occurs primarily via diffusion, with the result that extended mixing channels are generally required. The present study considers a T-shaped microchannel configuration with a mixing channel of width W=280 μm. Computational fluid dynamics simulations and experiments were performed to investigate the influence on the mixing efficiency of various geometrical parameters, including the side-channel width, the side-channel separation, and the number of side-channel pairs. The influence of different applied voltages is also considered. The numerical results reveal that the mixing efficiency can be enhanced to yield a fourfold improvement by incorporating two pairs of side channels into the mixing channel. It was also found that the mixing performance depends significantly upon the magnitudes of the applied voltages.
Hibio, Naoki; Hino, Kimihiro; Shimizu, Eigo; Nagata, Yoshiro; Ui-Tei, Kumiko
2012-01-01
MicroRNAs (miRNAs) are key regulators of sequence-specific gene silencing. However, crucial factors that determine the efficacy of miRNA-mediated target gene silencing are poorly understood. Here we mathematized base-pairing stability and showed that miRNAs with an unstable 5′ terminal duplex and stable seed-target duplex exhibit strong silencing activity. The results are consistent with the previous findings that an RNA strand with unstable 5′ terminal in miRNA duplex easily loads onto the RNA-induced silencing complex (RISC), and miRNA recognizes target mRNAs with seed-complementary sequences to direct posttranscriptional repression. Our results suggested that both the unwinding and target recognition processes of miRNAs could be proficiently controlled by the thermodynamics of base-pairing in protein-free condition. Interestingly, such thermodynamic parameters might be evolutionarily well adapted to the body temperatures of various species. PMID:23251782
Aad, G.; Abbott, B.; Abdallah, J.; ...
2011-10-05
Here, a search for neutral Higgs bosons decaying to pairs of τ leptons with the ATLAS detector at the LHC is presented. The analysis is based on proton–proton collisions at a center-of-mass energy of 7 TeV, recorded in 2010 and corresponding to an integrated luminosity of 36 pb –1. After signal selection, 276 events are observed in this data sample. The observed number of events is consistent with the total expected background of 269 ± 36 events. Exclusion limits at the 95% confidence level are derived for the production cross section of a generic Higgs boson Φ as a functionmore » of the Higgs boson mass and for A/H/h production in the Minimal Supersymmetric Standard Model (MSSM) as a function of the parameters mA and tan β.« less
Liao, Guan-Bo; Chen, Yin-Quan; Bareil, Paul B; Sheng, Yunlong; Chiou, Arthur; Chang, Ming-Shien
2014-10-01
We calculated the three-dimensional optical stress distribution and the resulting deformation on a biconcave human red blood cell (RBC) in a pair of parallel optical trap. We assumed a Gaussian intensity distribution with a spherical wavefront for each trapping beam and calculated the optical stress from the momentum transfer associated with the reflection and refraction of the incident photons at each interface. The RBC was modelled as a biconcave thin elastic membrane with uniform elasticity and a uniform thickness of 0.25 μm. The resulting cell deformation was determined from the optical stress distribution by finite element software, Comsol Structure Mechanics Module, with Young's modulus (E) as a fitting parameter in order to fit the theoretical results for cell elongation to our experimental data. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cord blood level of insulin-like growth factor-1 and IGF binding protein-3 in monochorionic twins.
Teng, Ru-Jeng; Wu, Tzong-Jin; Hsieh, Fon-Jou
2015-04-01
Insulin-like growth factors (IGFs) and their binding proteins (IGFBPs) are known to modulate fetal growth but their role in intrauterine growth of monochorionic twins (MCT) has not been studied. Cord venous blood was collected directly after birth. IGF-1 and IGFBP-3 in the cord venous blood were quantified by radioimmunoassay. Birth weights (BWs) were obtained electronically. Placentas were examined for chorionicity. Cord blood was collected in 37 pairs of MCT (15 pairs were males). BWs ranged from 564 to 3240 g, and gestational ages (GAs) were between 24 weeks and 39 weeks. There was a correlation between BW and cord venous blood IGFBP-3 concentration (r = 0.28, p = 0.015), but not between BW and cord venous blood IGF-1 level. There was no difference in IGF-1 between the heavier twins (30.8 ± 61.8 ng/mL) and lighter twins (33.2 ± 63.7 ng/mL), but a trend (p = 0.096) of higher IGFBP-3 level was demonstrated in heavier twins (3.14 ± 1.23 μg/mL) than in lighter twins (2.71 ± 1.19 μg/mL). The IGFBP-3 levels were higher (p = 0.042) in female twins (3.20 ± 1.33 μg/mL) than in male twins (2.64 ± 1.04 μg/mL). The IGF-1 level of the heavier twins correlated significantly to their lighter co-twin (r = 0.73, p < 0.001). Our data showed that cord venous blood IGF-1 level might be controlled mainly by genetic factors. IGFBP-3 might play an important role in fetal growth. Copyright © 2013. Published by Elsevier B.V.
Wang, Rui; Hu, Die; Zong, Xuncheng; Li, Jinping; Ding, Lei; Wu, Minchen; Li, Jianfang
2017-12-01
To prepare (R)-phenyl-1,2-ethanediol ((R)-PED) with high enantiomeric excess (ee p ) and yield from racemic styrene oxide (rac-SO) at high concentration by bi-enzymatic catalysis. The bi-enzymatic catalysis was designed for enantioconvergent hydrolysis of rac-SO by a pair of novel epoxide hydrolases (EHs), a Vigna radiata EH3 (VrEH3) and a variant (AuEH2 A250I ) of Aspergillus usamii EH2. The simultaneous addition mode of VrEH3 and AuEH2 A250I , exhibiting the highest average turnover frequency (aTOF) of 0.12 g h -1 g -1 , was selected, by which rac-SO (10 mM) was converted into (R)-PED with 92.6% ee p and 96.3% yield. Under the optimized reaction conditions: dry weight ratio 14:1 of VrEH3-expressing E. coli/vreh3 to AuEH2 A250I -expressing E. coli/Aueh2 A250I and reaction at 20 °C, rac-SO (10 mM) was completely hydrolyzed in 2.3 h, affording (R)-PED with 98% ee p . At the weight ratio 0.8:1 of rac-SO to two mixed dry cells, (R)-PED with 97.4% ee p and 98.7% yield was produced from 200 mM (24 mg/ml) rac-SO in 10.5 h. Enantioconvergent hydrolysis of rac-SO at high concentration catalyzed by both VrEH3 and AuEH2 A250I is an effective method for preparing (R)-PED with high ee p and yield.
Sun, Zhiwei; Wang, Xiaoxiang; Cai, Yiping; Fu, Junqing; You, Jinmao
2014-03-01
A new pair of derivatization reagents, d0-4-(1-methyl-1H-phenanthro[9,10-d]imidazol-2-yl)phenlamine (d0-MPIA) and d3-4-(1-methyl-1H-phenanthro[9,10-d]imidazol-2-yl)phenlamine (d3-MPIA) have been designed and synthesized. It was successfully used to label aliphatic aldehydes and the aldehyde derivatives were analyzed by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS). The new isotope-coded reagents could easily label aldehydes under acidic conditions in the presence of NaCNBH3. The target derivatives exhibited intense [M+H](+) and regular product ions with electrospray ionization source in positive mode. The d0/d3-MPIA-aldehydes were monitored by the transitions of [M+H](+)→m/z 322 and [M+H](+)→m/z 165, and the obtained detection limits were in the range of 0.18-15.9 pg/mL at signal to noise ratio of 3. The global isotope internal standard technology was employed for quantification analysis with d3-MPIA-aldehyde as internal standard for corresponding d0-MPIA-aldehyde. Excellent linear responses for relative quantification were observed in the range of 1/10-10/1 with coefficients >0.998. The developed method has been applied to the quantification of aliphatic aldehydes in selected aquatic products with RSD<3.6% and recoveries >85.2%. © 2013 Elsevier B.V. All rights reserved.
Tecer, Lokman Hakan; Süren, Pinar; Alagha, Omar; Karaca, Ferhat; Tuncel, Gürdal
2008-04-01
In this work, the effect of meteorological parameters and local topography on mass concentrations of fine (PM2.5) and coarse (PM2.5-10) particles and their seasonal behavior was investigated. A total of 236 pairs of samplers were collected using an Anderson Dichotomous sampler between December 2004 and October 2005. The average mass concentrations of PM2.5, PM2.5-10, and particulate matter less than 10 microm in aerodynamic diameter (PM10) were found to be 29.38, 23.85, and 53.23 microg/m3, respectively. The concentrations of PM2.5 and PM10 were found to be higher in heating seasons (December to May) than in summer. The increase of relative humidity, cloudiness, and lower temperature was found to be highly related to the increase of particulate matter (PM) episodic events. During non-rainy days, the episodic events for PM2.5 and PM10 were increased by 30 and 10.7%, respectively. This is a result of the extensive use of fuel during winter for heating purposes and also because of stagnant air masses formed because of low temperature and low wind speed over the study area.
Perioperative Characteristics of Siblings Undergoing Liver or Kidney Transplant.
Ersoy, Zeynep; Ozdemirkan, Aycan; Pirat, Arash; Torgay, Adnan; Arslan, Gulnaz; Haberal, Mehmet
2015-11-01
Reasons for chronic liver and kidney failure may vary; sometimes more than 1 family member may be affected, and may require a transplant. The aim of this study was to examine the similarities or differences between the perioperative characteristics of siblings undergoing liver or kidney transplant. The medical records of 6 pairs of siblings who underwent liver transplant and 4 pairs of siblings who underwent kidney transplant at Baskent University Hospital between 1989 and 2014 were retrospectively analyzed. Collected data included demographic features; comorbidities; reasons for liver and kidney failure; perioperative laboratory values; intraoperative hemodynamic parameters; use and volume of crystalloids, colloids, blood products, cell saver system, and albumin; duration of anesthesia; urine output; and postoperative follow-up data. The mean age of the 6 sibling pairs who underwent liver transplant was 16.3 ± 12.2 years. All 12 patients had Child-Pugh grade B cirrhosis, with mean disease duration of 7.8 ± 3.9 years. There were no significant differences between siblings with respect to intraoperative blood product transfusion, crystalloid and colloid fluid replacements, hypotension frequency, blood gas analyses, urinary output, duration of anhepatic phase, inotropic agent administration, postoperative laboratory values, need for mechanical ventilation and vasopressors, occurrence of acute renal failure and infections, and duration intensive care unit stay (P > .05). The mean age of the 4 sibling pairs who underwent kidney transplant was 21.3 ± 6.4 years, with mean duration of renal insufficiency of 2.2 ± 1.6 years. There were no significant differences between siblings with respect to intraoperative crystalloid and colloid fluid administration, duration of anesthesia, intraoperative mannitol and furosemide administration, and postoperative laboratory values (P > .05). In conclusion, the 6 sibling pairs who underwent liver transplant and 4 sibling pairs who underwent kidney transplant in our cohort had similar perioperative characteristics.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less
Jalem, Randy; Kimura, Mayumi; Nakayama, Masanobu; Kasuga, Toshihiro
2015-06-22
The ongoing search for fast Li-ion conducting solid electrolytes has driven the deployment surge on density functional theory (DFT) computation and materials informatics for exploring novel chemistries before actual experimental testing. Existing structure prototypes can now be readily evaluated beforehand not only to map out trends on target properties or for candidate composition selection but also for gaining insights on structure-property relationships. Recently, the tavorite structure has been determined to be capable of a fast Li ion insertion rate for battery cathode applications. Taking this inspiration, we surveyed the LiMTO4F tavorite system (M(3+)-T(5+) and M(2+)-T(6+) pairs; M is nontransition metals) for solid electrolyte use, identifying promising compositions with enormously low Li migration energy (ME) and understanding how structure parameters affect or modulate ME. We employed a combination of DFT computation, variable interaction analysis, graph theory, and a neural network for building a crystal structure-based ME prediction model. Candidate compositions that were predicted include LiGaPO4F (0.25 eV), LiGdPO4F (0.30 eV), LiDyPO4F (0.30 eV), LiMgSO4F (0.21 eV), and LiMgSeO4F (0.11 eV). With chemical substitutions at M and T sites, competing effects among Li pathway bottleneck size, polyanion covalency, and local lattice distortion were determined to be crucial for controlling ME. A way to predict ME for multiple structure types within the neural network framework was also explored.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolstov, Alexey; Nomoto, Ken’ichi; Blinnikov, Sergei
2017-02-01
Being a superluminous supernova, PTF12dam can be explained by a {sup 56}Ni-powered model, a magnetar-powered model, or an interaction model. We propose that PTF12dam is a pulsational pair-instability supernova, where the outer envelope of a progenitor is ejected during the pulsations. Thus, it is powered by a double energy source: radioactive decay of {sup 56}Ni and a radiative shock in a dense circumstellar medium. To describe multicolor light curves and spectra, we use radiation-hydrodynamics calculations of the STELLA code. We found that light curves are well described in the model with 40 M {sub ⊙} ejecta and 20–40 M {submore » ⊙} circumstellar medium. The ejected {sup 56}Ni mass is about 6 M {sub ⊙}, which results from explosive nucleosynthesis with large explosion energy (2–3)×10{sup 52} erg. In comparison with alternative scenarios of pair-instability supernova and magnetar-powered supernova, in the interaction model, all the observed main photometric characteristics are well reproduced: multicolor light curves, color temperatures, and photospheric velocities.« less
NASA Astrophysics Data System (ADS)
Trajano, L. A. S. N.; Trajano, E. T. L.; Thomé, A. M. C.; Sergio, L. P. S.; Mencalha, A. L.; Stumbo, A. C.; Fonseca, A. S.
2017-10-01
Satellite cells are present in skeletal muscle functioning in the repair and regeneration of muscle injury. Activation of these cells depends on the expression of myogenic factor 5 (Myf5), myogenic determination factor 1(MyoD), myogenic regulatory factor 4 (MRF4), myogenin (MyoG), paired box transcription factors 3 (Pax3), and 7 (Pax7). Low-level laser irradiation accelerates the repair of muscle injuries. However, data from the expression of myogenic factors have been controversial. Furthermore, the effects of different laser beam powers on the repair of muscle injuries have been not evaluated. The aim of this study was to evaluate the effects of low-level infrared laser at different powers and in pulsed emission mode on the expression of myogenic regulatory factors and on Pax3 and Pax7 in injured skeletal muscle from Wistar rats. Animals that underwent cryoinjury were divided into three groups: injury, injury laser 25 Mw, and injury laser 75 mW. Low-level infrared laser irradiation (904 nm, 3 J cm-2, 5 kHz) was carried out at 25 and 75 mW. After euthanasia, skeletal muscle samples were withdrawn and the total RNA was extracted for the evaluation of mRNA levels from the MyoD, MyoG, MRF4, Myf5, Pax3, and Pax7 gene. Pax 7 mRNA levels did not alter, but Pax3 mRNA levels increased in the injured and laser-irradiated group at 25 mW. MyoD, MyoG, and MYf5 mRNA levels increased in the injured and laser-irradiated animals at both powers, and MRF4 mRNA levels decreased in the injured and laser-irradiated group at 75 mW. In conclusion, exposure to pulsed low-level infrared laser, by power-dependent effect, could accelerate the muscle repair process altering mRNA levels from paired box transcription factors and myogenic regulatory factors.
Lemos, Carolina; Coelho, Teresa; Alves-Ferreira, Miguel; Martins-da-Silva, Ana; Sequeiros, Jorge; Mendonça, Denisa; Sousa, Alda
2014-03-01
Early-onset (≤40 years) and later-onset (≥50 years) cases of familial amyloid polyneuropathy (FAP) ATTRV30M are not different entities, often coexisting in the same family, and showing anticipation (earlier age-at-onset (AO) in younger generations, usually associated with more severe phenotype). Historically, anticipation has been ascribed to ascertainment biases. Our aim was to study anticipation in a very large number of FAP kindreds, removing possible biases, and gain further insight into parent-of-origin effects. We analysed 926 parent-offspring pairs (from the Unidade Clínica de Paramiloidose roster, collected in 70 years), both clinically observed and had well-established AO, correcting for intrafamilial correlations. Women had a significantly higher AO, either for daughters (mean: 33.70, SD: 6.84) vs sons (29.43, 6.08); or mothers (39.57, 11.75) vs. fathers (35.62, 11.62). Also, 291 pairs showed marked anticipation (≥10 years); the transmitting parent was the mother in 203 pairs. Mother-son pairs showed larger anticipation (10.43, 9.34), while father-daughter pairs showed only a residual anticipation (1.23, 9.77). Gender of offspring and parents was highly significant (with no interaction). To remove possible biases, we repeated analyses: (1) excluding the proband; (2) removing pairs with simultaneous onset; and (3) excluding offspring born after 1960. Anticipation was found in all subsamples, with the same trend for a parent-of-origin effect. Noteworthy, parents with AO ≤40 years never had offspring with AO ≥50. These findings confirm anticipation as a true biological phenomenon, also in FAP ATTRV30M. Acknowledgment of anticipation may have important clinical implications in genetic counselling of offspring and in follow-up of mutation carriers.
Kuzmin, Michael G; Soboleva, Irina V; Dolotova, Elena V
2007-01-18
Exciplex emission spectra and rate constants of their decay via internal conversion and intersystem crossing are studied and discussed in terms of conventional radiationless transition approach. Exciplexes of 9-cyanophenanthrene with 1,2,3-trimethoxybenzene and 1,3,5-trimethoxybenzene were studied in heptane, toluene, butyl acetate, dichloromethane, butyronitrile, and acetonitrile. A better description of spectra and rate constants is obtained using 0-0 transition energy and Gauss broadening of vibrational bands rather than the free energy of electron transfer and reorganization energy. The coincidence of parameters describing exciplex emission spectra and dependence of exciplex decay rate constants on energy gap gives the evidence of radiationless quantum transition mechanism rather than thermally activated medium reorganization mechanism of charge recombination in exciplexes and excited charge transfer complexes (contact radical ion pairs) as well as in solvent separated radical ion pairs. Radiationless quantum transition mechanism is shown to provide an appropriate description also for the main features of exergonic excited-state charge separation reactions if fast mutual transformations of loose and tight pairs of reactants are considered. In particular, very fast electron transfer (ET) in tight pairs of reactants with strong electronic coupling of locally excited and charge transfer states can prevent the observation of an inverted region in bimolecular excited-state charge separation even for highly exergonic reactions.
NASA Astrophysics Data System (ADS)
Heymann, Gunter; Niehaus, Oliver; Krüger, Hannes; Selter, Philipp; Brunklaus, Gunther; Pöttgen, Rainer
2016-10-01
The new lithium transition-metal sulfides Li2M3S4 (M=Pd, Pt) were obtained via multianvil high-pressure/high-temperature syntheses at 8 GPa and 1150 °C starting from a stoichiometric mixture of lithium nitride, sulfur, and palladium or platinum. Single crystal structure analyses indicated the space group P21/c (no. 14) with the following lattice parameters and refinement results: a=492.9(1), b=1005.9(2), c=614.9(2) pm, β=110.9 (1)°, R1=0.0165, wR2=0.0308 (all data) for Li2Pd3S4 and a=498.2(1), b=1005.5(2), c=613.0(2) pm, β=110.8(1)°, R1=0.0215, wR2=0.0450 (all data) for Li2Pt3S4. The crystal structures are built up from two distinct Pd/Pt sites, one of which is a special position (0,0,0), two sulfur sites, and one lithium site. The atoms Pd2/Pt2 form isolated square planar PdS4/PtS4 units, whereas the Pd1/Pt1 atoms form pairs of square planar PdS4/PtS4 units, which are connected via a common edge. These two structural motives built up a three-dimensional network structure by linking through common corners. The lithium atoms are positioned inside of the so formed channels. Li2M3S4 (M=Pd, Pt) are isostructural to the minerals jaguéite, Cu2Pd3Se4 and chrisstanleyite, Ag2Pd3Se4, which are up to now the only representatives of this structure type. Both compounds were studied with respect to their magnetic properties and can be classified as Pauli paramagnetic or diamagnetic. Regarding the possibility of lithium mobility inside the channels, of the structure, solid state 7Li NMR and high-temperature single crystal investigations revealed localization of the lithium atoms on their crystallographic sites.
Sound Velocities of Iron-Nickel and Iron-Nickel-Silicon Alloys at High Pressure
NASA Astrophysics Data System (ADS)
Miller, R. A.; Jackson, J. M.; Sturhahn, W.; Zhao, J.; Murphy, C. A.
2014-12-01
Seismological and cosmochemical studies suggest Earth's core is primarily composed of iron with ~5 to 10 wt% nickel and some light elements [e.g. 1]. To date, the concentration of nickel and the amount and identity of light elements remain poorly constrained due in part to the difficulty of conducting experimental measurements at core conditions. The vibrational properties of a variety iron alloys paired with seismic observations can help better constrain the composition of the core. We directly measured the partial phonon density of states of bcc- and hcp-structured Fe0.9Ni0.1 and Fe0.85Ni0.1Si0.05 at high pressures. The samples were compressed using a panoramic diamond anvil cell. A subset of the experiments were conducted using neon as a pressure transmitting medium. Measurements of high statistical quality were performed with nuclear resonant inelastic x-ray scattering (NRIXS) at sector 3-ID-B of the Advanced Photon Source [2, 3, 4]. The unit cell volume of each sample was determined at each compression point with in-situ x-ray diffraction at sector 3-ID-B before and after each NRIXS measurement. The Debye, compressional, and shear sound velocities were determined from the low energy region of the partial phonon density of states paired with the volume measurements. We will present partial phonon density of states and sound velocities for Fe0.9Ni0.1 and Fe0.85Ni0.1Si0.05 at high-pressure and compare with those of pure iron. References: [1] McDonough, W.F. (2004): Compositional Model for the Earth's Core. Elsevier Ltd., Oxford. [2] Murphy, C.A., J.M. Jackson, W. Sturhahn, and B. Chen (2011): Melting and thermal pressure of hcp-Fe from the phonon density of states, Phys. Earth Planet. Int., doi:10.1016/j.pepi.2011.07.001. [3] Murphy, C.A., J.M. Jackson, W. Sturhahn, and B. Chen (2011): Grüneisen parameter of hcp-Fe to 171 GPa, Geophys. Res. Lett., doi:10.1029/2011GL049531. [4] Murphy, C.A., J.M. Jackson, and W. Sturhahn (2013): Experimental constraints on the thermodynamics and sound velocities of hcp-Fe to core pressures, J. Geophys. Res., doi:10.1002/jgrb.50166.
Enhanced sampling simulations of DNA step parameters.
Karolak, Aleksandra; van der Vaart, Arjan
2014-12-15
A novel approach for the selection of step parameters as reaction coordinates in enhanced sampling simulations of DNA is presented. The method uses three atoms per base and does not require coordinate overlays or idealized base pairs. This allowed for a highly efficient implementation of the calculation of all step parameters and their Cartesian derivatives in molecular dynamics simulations. Good correlation between the calculated and actual twist, roll, tilt, shift, and slide parameters is obtained, while the correlation with rise is modest. The method is illustrated by its application to the methylated and unmethylated 5'-CATGTGACGTCACATG-3' double stranded DNA sequence. One-dimensional umbrella simulations indicate that the flexibility of the central CG step is only marginally affected by methylation. © 2014 Wiley Periodicals, Inc.
Godsey, Brian; Heiser, Diane; Civin, Curt
2012-01-01
MicroRNAs (miRs) are known to play an important role in mRNA regulation, often by binding to complementary sequences in "target" mRNAs. Recently, several methods have been developed by which existing sequence-based target predictions can be combined with miR and mRNA expression data to infer true miR-mRNA targeting relationships. It has been shown that the combination of these two approaches gives more reliable results than either by itself. While a few such algorithms give excellent results, none fully addresses expression data sets with a natural ordering of the samples. If the samples in an experiment can be ordered or partially ordered by their expected similarity to one another, such as for time-series or studies of development processes, stages, or types, (e.g. cell type, disease, growth, aging), there are unique opportunities to infer miR-mRNA interactions that may be specific to the underlying processes, and existing methods do not exploit this. We propose an algorithm which specifically addresses [partially] ordered expression data and takes advantage of sample similarities based on the ordering structure. This is done within a Bayesian framework which specifies posterior distributions and therefore statistical significance for each model parameter and latent variable. We apply our model to a previously published expression data set of paired miR and mRNA arrays in five partially ordered conditions, with biological replicates, related to multiple myeloma, and we show how considering potential orderings can improve the inference of miR-mRNA interactions, as measured by existing knowledge about the involved transcripts.
Auger parameter and Wagner plot studies of small copper clusters
NASA Astrophysics Data System (ADS)
Moretti, Giuliano; Palma, Amedeo; Paparazzo, Ernesto; Satta, Mauro
2016-04-01
We discuss application of the Auger parameter and Wagner plot concepts to the study of small copper clusters deposited on various supports such as C(graphite), SiO2 and Al2O3. We demonstrate that the cluster size and the electronic properties of the support influence the shifts of both the binding energy of the Cu 2p3/2 transition and the kinetic energy of the Cu L3M45M45; 1G Auger transition. We find that the Cu L3M45M45; 1G-2p3/2 Auger parameter and Wagner plot allow one to single out and measure both initial- and final-state effects with a detail which is superior to that achieved in photoemission studies.
Effect of kangaroo mother care on vital physiological parameters of the low birth weight newborn.
Bera, Alpanamayi; Ghosh, Jagabandhu; Singh, Arun Kumarendu; Hazra, Avijit; Som, Tapas; Munian, Dinesh
2014-10-01
Low birth weight (LBW; <2500 g), which is often associated with preterm birth, is a common problem in India. Both are recognized risk factors for neonatal mortality. Kangaroo mother care (KMC) is a non-conventional, low-cost method for newborn care based upon intimate skin-to-skin contact between mother and baby. Our objective was to assess physiological state of LBW babies before and after KMC in a teaching hospital setting. Study cohort comprised in-born LBW babies and their mothers - 300 mother-baby pairs were selected through purposive sampling. Initially, KMC was started for 1 hour duration (at a stretch) on first day and then increased by 1 hour each day for next 2 days. Axillary temperature, respiration rate (RR/ min), heart rate (HR/ min), and oxygen saturation (SpO2) were assessed for 3 consecutive days, immediately before and after KMC. Data from 265 mother-baby pairs were analyzed. Improvements occurred in all 4 recorded physiological parameters during the KMC sessions. Mean temperature rose by about 0.4°C, RR by 3 per minute, HR by 5 bpm, and SpO2 by 5% following KMC sessions. Although modest, these changes were statistically significant on all 3 days. Individual abnormalities (e.g. hypothermia, bradycardia, tachycardia, low SpO2) were often corrected during the KMC sessions. Babies receiving KMC showed modest but statistically significant improvement in vital physiological parameters on all 3 days. Thus, without using special equipment, the KMC strategy can offer improved care to LBW babies. These findings support wider implementation of this strategy.
Asherson, P; Zhou, K; Anney, R J L; Franke, B; Buitelaar, J; Ebstein, R; Gill, M; Altink, M; Arnold, R; Boer, F; Brookes, K; Buschgens, C; Butler, L; Cambell, D; Chen, W; Christiansen, H; Feldman, L; Fleischman, K; Fliers, E; Howe-Forbes, R; Goldfarb, A; Heise, A; Gabriëls, I; Johansson, L; Lubetzki, I; Marco, R; Medad, S; Minderaa, R; Mulas, F; Müller, U; Mulligan, A; Neale, B; Rijsdijk, F; Rabin, K; Rommelse, N; Sethna, V; Sorohan, J; Uebel, H; Psychogiou, L; Weeks, A; Barrett, R; Xu, X; Banaschewski, T; Sonuga-Barke, E; Eisenberg, J; Manor, I; Miranda, A; Oades, R D; Roeyers, H; Rothenberger, A; Sergeant, J; Steinhausen, H-C; Taylor, E; Thompson, M; Faraone, S V
2008-05-01
As part of the International Multi-centre ADHD Genetics project we completed an affected sibling pair study of 142 narrowly defined Diagnostic and Statistical Manual of Mental Disorders, fourth edition combined type attention deficit hyperactivity disorder (ADHD) proband-sibling pairs. No linkage was observed on the most established ADHD-linked genomic regions of 5p and 17p. We found suggestive linkage signals on chromosomes 9 and 16, respectively, with the highest multipoint nonparametric linkage signal on chromosome 16q23 at 99 cM (log of the odds, LOD=3.1) overlapping data published from the previous UCLA (University of California, Los Angeles) (LOD>1, approximately 95 cM) and Dutch (LOD>1, approximately 100 cM) studies. The second highest peak in this study was on chromosome 9q22 at 90 cM (LOD=2.13); both the previous UCLA and German studies also found some evidence of linkage at almost the same location (UCLA LOD=1.45 at 93 cM; German LOD=0.68 at 100 cM). The overlap of these two main peaks with previous findings suggests that loci linked to ADHD may lie within these regions. Meta-analysis or reanalysis of the raw data of all the available ADHD linkage scan data may help to clarify whether these represent true linked loci.
Rustum, A M
1989-01-01
The determination of acetaminophen in biological samples of humans who have ingested normal and overdosage of the drug is necessary to understand the clinical pharmacokinetics of acetaminophen and to determine its distribution and toxicokinetic parameters. This paper describes a rapid, simple, and sensitive high-performance liquid chromatographic method for determining acetaminophen in human plasma. Acetaminophen is isolated from plasma by adding approximately 200 microL of acetonitrile and 50 mg of solid zinc sulfate to each milliliter of plasma. A short column (60 mm x 4.6 mm) slurry packed with 5.0-microns PRP-1 particles is used with an isocratic elution of 5.0 mM dibasic potassium phosphate and 5.0 mM tetrabutylammonium hydroxide/methanol, 70:30 (v/v). The flow rate is 1.0 mL/min. The acetaminophen peak is detected with a variable wavelength ultraviolet/visible detector at 250 nm and 0.50 to 0.002 AUFS. The analysis time of the assay is less than 15 min, and the limit of detection is 20 ng/mL for an 80-microL injection volume. The pharmacokinetics of acetaminophen in plasma from a subject who had orally ingested 975 mg of the drug in tablet form is conducted using this method, and various pharmacokinetic parameters are determined.
NASA Astrophysics Data System (ADS)
Zhao, Yun-wei; Zhu, Zi-qiang; Lu, Guang-yin; Han, Bo
2018-03-01
The sine and cosine transforms implemented with digital filters have been used in the Transient electromagnetic methods for a few decades. Kong (2007) proposed a method of obtaining filter coefficients, which are computed in the sample domain by Hankel transform pair. However, the curve shape of Hankel transform pair changes with a parameter, which usually is set to be 1 or 3 in the process of obtaining the digital filter coefficients of sine and cosine transforms. First, this study investigates the influence of the parameter on the digital filter algorithm of sine and cosine transforms based on the digital filter algorithm of Hankel transform and the relationship between the sine, cosine function and the ±1/2 order Bessel function of the first kind. The results show that the selection of the parameter highly influences the precision of digital filter algorithm. Second, upon the optimal selection of the parameter, it is found that an optimal sampling interval s also exists to achieve the best precision of digital filter algorithm. Finally, this study proposes four groups of sine and cosine transform digital filter coefficients with different length, which may help to develop the digital filter algorithm of sine and cosine transforms, and promote its application.
NASA Astrophysics Data System (ADS)
Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Hartl, C.; Hörmann, N.; Hrubec, J.; Jeitler, M.; König, A.; Krätschmer, I.; Liko, D.; Matsushita, T.; Mikulec, I.; Rabady, D.; Rad, N.; Rahbaran, B.; Rohringer, H.; Schieck, J.; Strauss, J.; Waltenberger, W.; Wulz, C.-E.; Chekhovsky, V.; Dvornikov, O.; Dydyshka, Y.; Emeliantchik, I.; Litomin, A.; Makarenko, V.; Mossolov, V.; Stefanovitch, R.; Suarez Gonzalez, J.; Zykunov, V.; Shumeiko, N.; Alderweireldt, S.; De Wolf, E. A.; Janssen, X.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Van Spilbeeck, A.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; Daci, N.; De Bruyn, I.; Deroover, K.; Lowette, S.; Moortgat, S.; Moreels, L.; Olbrechts, A.; Python, Q.; Skovpen, K.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Léonard, A.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Vannerom, D.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Garcia, G.; Gul, M.; Khvastunov, I.; Poyraz, D.; Salva, S.; Schöfbeck, R.; Tytgat, M.; Van Driessche, W.; Yazgan, E.; Zaganidis, N.; Bakhshiansohi, H.; Beluffi, C.; Bondu, O.; Brochet, S.; Bruno, G.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Francois, B.; Giammanco, A.; Jafari, A.; Jez, P.; Komm, M.; Krintiras, G.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Nuttens, C.; Piotrzkowski, K.; Quertenmont, L.; Selvaggi, M.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; De Oliveira Martins, C.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Matos Figueiredo, D.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Prado Da Silva, W. L.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; Dogra, S.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Moon, C. S.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Rodozov, M.; Stoykova, S.; Sultanov, G.; Vutova, M.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Cheng, T.; Jiang, C. H.; Leggat, D.; Liu, Z.; Romeo, F.; Ruan, M.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Zhang, H.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; Gomez, J. P.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Sanabria, J. C.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Sculac, T.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Mesic, B.; Micanovic, S.; Sudic, L.; Susa, T.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Tsiakkouri, D.; Finger, M.; Finger, M.; Carrera Jarrin, E.; Assran, Y.; Elkafrawy, T.; Mahrous, A.; Kadastik, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Järvinen, T.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Tuominiemi, J.; Tuovinen, E.; Wendland, L.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Fabbro, B.; Faure, J. L.; Favaro, C.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Rander, J.; Rosowsky, A.; Titov, M.; Zghiche, A.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Chapon, E.; Charlot, C.; Davignon, O.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Miné, P.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Regnard, S.; Salerno, R.; Sirois, Y.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Agram, J.-L.; Andrea, J.; Aubin, A.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Le Bihan, A.-C.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Carrillo Montoya, C. A.; Chierici, R.; Contardo, D.; Courbon, B.; Depasse, P.; El Mamouni, H.; Fan, J.; Fay, J.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sabes, D.; Sordini, V.; Vander Donckt, M.; Verdier, P.; Viret, S.; Khvedelidze, A.; Tsamalaidze, Z.; Autermann, C.; Beranek, S.; Feld, L.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Preuten, M.; Schomakers, C.; Schulz, J.; Verlage, T.; Albert, A.; Brodski, M.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Olschewski, M.; Padeken, K.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Sonnenschein, L.; Teyssier, D.; Thüer, S.; Cherepanov, V.; Flügge, G.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Müller, T.; Nehrkorn, A.; Nowack, A.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Arndt, T.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Bin Anuar, A. A.; Borras, K.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Diez Pardos, C.; Dolinska, G.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Eren, E.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Grados Luyando, J. M.; Grohsjean, A.; Gunnellini, P.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Karacheban, O.; Kasemann, M.; Keaveney, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Leonard, J.; Lipka, K.; Lobanov, A.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Ntomari, E.; Pitzl, D.; Placakyte, R.; Raspereza, A.; Roland, B.; Sahin, M. Ö.; Saxena, P.; Schoerner-Sadenius, T.; Seitz, C.; Spannagel, S.; Stefaniuk, N.; Van Onsem, G. P.; Walsh, R.; Wissing, C.; Blobel, V.; Centis Vignali, M.; Draeger, A. R.; Dreyer, T.; Garutti, E.; Gonzalez, D.; Haller, J.; Hoffmann, M.; Junkes, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Lapsien, T.; Lenz, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Poehlsen, J.; Sander, C.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Akbiyik, M.; Barth, C.; Baur, S.; Baus, C.; Berger, J.; Butz, E.; Caspart, R.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Fink, S.; Freund, B.; Friese, R.; Giffels, M.; Gilbert, A.; Goldenzweig, P.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Katkov, I.; Kudella, S.; Mildner, H.; Mozer, M. U.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Röcker, S.; Roscher, F.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Tziaferi, E.; Evangelou, I.; Flouris, G.; Foudas, C.; Kokkas, P.; Loukas, N.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Filipovic, N.; Bencze, G.; Hajdu, C.; Horvath, D.; Sikler, F.; Veszpremi, V.; Vesztergombi, G.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Bahinipati, S.; Choudhury, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Bhawandeep, U.; Chawla, R.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Kumari, P.; Mehta, A.; Mittal, M.; Singh, J. B.; Walia, G.; Kumar, Ashok; Bhardwaj, A.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Malhotra, S.; Naimuddin, M.; Nishu, N.; Ranjan, K.; Sharma, R.; Sharma, V.; Bhattacharya, R.; Bhattacharya, S.; Chatterjee, K.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Kole, G.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Parida, B.; Sur, N.; Sutar, B.; Banerjee, S.; Bhowmik, S.; Dewanjee, R. K.; Ganguly, S.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Pandey, S.; Rane, A.; Sharma, S.; Chenarani, S.; Eskandari Tadavani, E.; Etesami, S. M.; Fahim, A.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Caputo, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Fiore, L.; Iaselli, G.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Sharma, A.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Brigliadori, L.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Lenzi, P.; Meschini, M.; Paoletti, S.; Sguazzoni, G.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Lo Vetere, M.; Monge, M. R.; Robutti, E.; Tosi, S.; Brianza, L.; Brivio, F.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malberti, M.; Malvezzi, S.; Manzoni, R. A.; Menasce, D.; Moroni, L.; Paganoni, M.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; De Nardo, G.; Di Guida, S.; Fabozzi, F.; Fienga, F.; Iorio, A. O. M.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Benato, L.; Bisello, D.; Boletti, A.; Carlin, R.; Carvalho Antunes De Oliveira, A.; Checchia, P.; Dall'Osso, M.; De Castro Manzano, P.; Dorigo, T.; Dosselli, U.; Gasparini, F.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Margoni, M.; Meneguzzo, A. T.; Pazzini, J.; Pozzobon, N.; Ronchese, P.; Simonetto, F.; Torassa, E.; Zanetti, M.; Zotto, P.; Zumerle, G.; Braghieri, A.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Alunni Solestizi, L.; Bilei, G. M.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Mantovani, G.; Menichelli, M.; Saha, A.; Santocchia, A.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Bernardini, J.; Boccali, T.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Donato, S.; Fedi, G.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; Del Re, D.; Diemoz, M.; Gelli, S.; Longo, E.; Margaroli, F.; Marzocchi, B.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Cenna, F.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Finco, L.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Monteno, M.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Shchelina, K.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, S.; Lee, S. W.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Kim, H.; Brochero Cifuentes, J. A.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, B.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Lee, H.; Oh, S. B.; Radburn-Smith, B. C.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Ryu, G.; Ryu, M. S.; Choi, Y.; Goh, J.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Komaragiri, J. R.; Md Ali, M. A. B.; Mohamad Idris, F.; Wan Abdullah, W. A. T.; Yusli, M. N.; Zolkapli, Z.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Hernandez-Almada, A.; Lopez-Fernandez, R.; Magaña Villalba, R.; Mejia Guisao, J.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Oropeza Barrera, C.; Vazquez Valencia, F.; Carpinteyro, S.; Pedraza, I.; Salazar Ibarguen, H. A.; Uribe Estrada, C.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Khan, W. A.; Saddique, A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Romanowska-Rybinska, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Walczak, M.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Calpas, B.; Di Francesco, A.; Faccioli, P.; Ferreira Parracho, P. G.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nemallapudi, M. V.; Rodrigues Antunes, J.; Seixas, J.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Vischia, P.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Palichik, V.; Perelygin, V.; Savina, M.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Chtchipounov, L.; Golovtsov, V.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Murzin, V.; Oreshkin, V.; Sulimov, V.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Bylinkin, A.; Chadeeva, M.; Danilov, M.; Rusinov, V.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Leonidov, A.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Bunichev, V.; Dubinin, M.; Dudko, L.; Ershov, A.; Gribushin, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Petrushanko, S.; Savrin, V.; Blinov, V.; Skovpen, Y.; Shtol, D.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Krychkine, V.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Barrio Luna, M.; Calvo, E.; Cerrada, M.; Chamizo Llatas, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Navarro De Martino, E.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; de Trocóniz, J. F.; Missiroli, M.; Moran, D.; Cuevas, J.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Suárez Andrés, I.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Castiñeiras De Saa, J. R.; Curras, E.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Martinez Rivero, C.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Auzinger, G.; Bachtis, M.; Baillon, P.; Ball, A. H.; Barney, D.; Bloch, P.; Bocci, A.; Bonato, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; Chen, Y.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Roeck, A.; Di Marco, E.; Dobson, M.; Dorney, B.; du Pree, T.; Duggan, D.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Everaerts, P.; Fartoukh, S.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Girone, M.; Glege, F.; Gulhan, D.; Gundacker, S.; Guthoff, M.; Hammer, J.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Kieseler, J.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Kousouris, K.; Krammer, M.; Lange, C.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Merlin, J. A.; Mersi, S.; Meschi, E.; Milenovic, P.; Moortgat, F.; Morovic, S.; Mulders, M.; Neugebauer, H.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Sakulin, H.; Sauvan, J. B.; Schäfer, C.; Schwick, C.; Seidel, M.; Sharma, A.; Silva, P.; Sphicas, P.; Steggemann, J.; Stoye, M.; Takahashi, Y.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Veres, G. I.; Verweij, M.; Wardle, N.; Wöhri, H. K.; Zagozdzinska, A.; Zeuner, W. D.; Bertl, W.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Bachmair, F.; Bäni, L.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Lecomte, P.; Lustermann, W.; Mangano, B.; Marionneau, M.; Martinez Ruiz del Arbol, P.; Masciovecchio, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Rossini, M.; Schönenberger, M.; Starodumov, A.; Tavolaro, V. R.; Theofilatos, K.; Wallny, R.; Aarrestad, T. K.; Amsler, C.; Caminada, L.; Canelli, M. F.; De Cosa, A.; Galloni, C.; Hinzmann, A.; Hreus, T.; Kilminster, B.; Ngadiuba, J.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Yang, Y.; Zucchetta, A.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Konyushikhin, M.; Kuo, C. M.; Lin, W.; Lu, Y. J.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chang, Y. H.; Chang, Y. W.; Chao, Y.; Chen, K. F.; Chen, P. H.; Dietz, C.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Miñano Moya, M.; Paganis, E.; Psallidas, A.; Tsai, J. f.; Tzeng, Y. M.; Asavapibhop, B.; Singh, G.; Srimanobhas, N.; Suwonjandee, N.; Adiguzel, A.; Bakirci, M. N.; Cerci, S.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Dumanoglu, I.; Girgis, S.; Gokbulut, G.; Guler, Y.; Hos, I.; Kangal, E. E.; Kara, O.; Kayis Topaksu, A.; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Tali, B.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Bilmis, S.; Isildak, B.; Karapinar, G.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Yetkin, E. A.; Yetkin, T.; Cakir, A.; Cankocak, K.; Sen, S.; Grynyov, B.; Levchuk, L.; Sorokin, P.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Baber, M.; Bainbridge, R.; Buchmuller, O.; Bundock, A.; Burton, D.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Di Maria, R.; Dunne, P.; Elwood, A.; Futyan, D.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lucas, R.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Nash, J.; Nikitenko, A.; Pela, J.; Penning, B.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Seez, C.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Leslie, D.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Cooper, S. I.; Henderson, C.; Rumerio, P.; West, C.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Jesus, O.; Kwok, K. H. M.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Piperov, S.; Sagir, S.; Spencer, E.; Syarif, R.; Breedon, R.; Breto, G.; Burns, D.; Calderon De La Barca Sanchez, M.; Chauhan, S.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Shalhout, S.; Smith, J.; Squires, M.; Stolp, D.; Tripathi, M.; Bravo, C.; Cousins, R.; Dasgupta, A.; Florent, A.; Hauser, J.; Ignatenko, M.; Mccoll, N.; Saltzberg, D.; Schnaible, C.; Takasugi, E.; Valuev, V.; Weber, M.; Bouvier, E.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Ghiasi Shirazi, S. M. A.; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Olmedo Negrete, M.; Paneva, M. I.; Shrinivas, A.; Si, W.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cerati, G. B.; Cittolin, S.; Derdzinski, M.; Gerosa, R.; Holzner, A.; Klein, D.; Krutelyov, V.; Letts, J.; Macneill, I.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Welke, C.; Wood, J.; Würthwein, F.; Yagil, A.; Zevi Della Porta, G.; Amin, N.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Franco Sevilla, M.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mullin, S. D.; Ovcharova, A.; Qu, H.; Richman, J.; Stuart, D.; Suarez, I.; Yoo, J.; Anderson, D.; Bendavid, J.; Bornheim, A.; Bunn, J.; Duarte, J.; Lawhorn, J. M.; Mott, A.; Newman, H. B.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhu, R. Y.; Andrews, M. B.; Ferguson, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Weinberg, M.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Nicolas Kaufman, G.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Winn, D.; Abdullin, S.; Albrow, M.; Apollinari, G.; Apresyan, A.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Cheung, H. W. K.; Chlebana, F.; Cihangir, S.; Cremonesi, M.; Elvira, V. D.; Fisk, I.; Freeman, J.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Hare, D.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Linacre, J.; Lincoln, D.; Lipton, R.; Liu, M.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strait, J.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Wu, Y.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Das, S.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Low, J. F.; Ma, P.; Matchev, K.; Mei, H.; Mitselmakher, G.; Rank, D.; Shchutska, L.; Sperka, D.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Linn, S.; Markowitz, P.; Martinez, G.; Rodriguez, J. L.; Ackert, A.; Adams, T.; Askew, A.; Bein, S.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Prosper, H.; Santra, A.; Yohay, R.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Bucinskaite, I.; Cavanaugh, R.; Evdokimov, O.; Gauthier, L.; Gerber, C. E.; Hofman, D. J.; Jung, K.; Sandoval Gonzalez, I. D.; Varelas, N.; Wang, H.; Wu, Z.; Zakaria, M.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Anderson, I.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Martin, C.; Osherson, M.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; Xin, Y.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Boren, S.; Bowen, J.; Bruner, C.; Castle, J.; Forthomme, L.; Kenny, R. P.; Khalil, S.; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Sanders, S.; Stringer, R.; Tapia Takaki, J. D.; Wang, Q.; Ivanov, A.; Kaadze, K.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Gomez, J. A.; Hadley, N. J.; Jabeen, S.; Kellogg, R. G.; Kolberg, T.; Kunkle, J.; Lu, Y.; Mignerey, A. C.; Ricci-Tam, F.; Shin, Y. H.; Skuja, A.; Tonjes, M. B.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Apyan, A.; Azzolini, V.; Barbieri, R.; Baty, A.; Bi, R.; Bierwagen, K.; Brandt, S.; Busza, W.; Cali, I. A.; D'Alfonso, M.; Demiragli, Z.; Di Matteo, L.; Gomez Ceballos, G.; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Krajczar, K.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Maier, B.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Tatar, K.; Varma, M.; Velicanu, D.; Veverka, J.; Wang, J.; Wang, T. W.; Wyslouch, B.; Yang, M.; Zhukova, V.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Finkel, A.; Gude, A.; Hansen, P.; Kalafut, S.; Kao, S. C.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Tambe, N.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bartek, R.; Bloom, K.; Claes, D. R.; Dominguez, A.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Kravchenko, I.; Malta Rodrigues, A.; Meier, F.; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Alyari, M.; Dolen, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Kaisen, J.; Kharchilava, A.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wang, R.-J.; Wood, D.; Bhattacharya, S.; Charaf, O.; Hahn, K. A.; Kubik, A.; Kumar, A.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Hurtado Anampa, K.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Hughes, R.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Lange, D.; Luo, J.; Marlow, D.; Medvedeva, T.; Mei, K.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Svyatkovskiy, A.; Tully, C.; Malik, S.; Barker, A.; Barnes, V. E.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Khatiwada, A.; Miller, D. H.; Neumeister, N.; Schulte, J. F.; Shi, X.; Sun, J.; Wang, F.; Xie, W.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Betchart, B.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Agapitos, A.; Chou, J. P.; Contreras-Campana, E.; Gershtein, Y.; Gómez Espinosa, T. A.; Halkiadakis, E.; Heindl, M.; Hidas, D.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Kyriacou, S.; Lath, A.; Nash, K.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Delannoy, A. G.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Juska, E.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Cowden, C.; Damgov, J.; De Guio, F.; Dragoiu, C.; Dudero, P. R.; Faulkner, J.; Gurpinar, E.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Peltola, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Goodell, J.; Hirosky, R.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Sun, X.; Wang, Y.; Wolfe, E.; Xia, F.; Clarke, C.; Harr, R.; Karchin, P. E.; Sturdy, J.; Belknap, D. A.; Buchanan, J.; Caillol, C.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Ojalvo, I.; Perry, T.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.; CMS Collaboration
2017-10-01
Results are presented from a search for production of Higgs boson pairs (H H ) where one boson decays to a pair of b quarks and the other to a τ lepton pair. This work is based on proton-proton collision data collected by the CMS experiment at √{s }=8 TeV , corresponding to an integrated luminosity of 18.3 fb-1 . Resonant and nonresonant modes of H H production have been probed and no significant excess relative to the background-only hypotheses has been found in either mode. Upper limits on cross sections of the two H H production modes have been set. The results have been combined with previously published searches at √{s }=8 TeV , in decay modes to two photons and two b quarks, as well as to four b quarks, which also show no evidence for a signal. Limits from the combination have been set on resonant H H production by an unknown particle X in the mass range mX=300 GeV to mX=1000 GeV . For resonant production of spin 0 (spin 2) particles, the observed 95% CL upper limit is 1.13 pb (1.09 pb) at mX=300 GeV and to 21 fb (18 fb) at mX=1000 GeV . For nonresonant H H production, a limit of 43 times the rate predicted by the standard model has been set.
Phase-driven collapse of the Cooper condensate in a nanosized superconductor
NASA Astrophysics Data System (ADS)
Ronzani, Alberto; D'Ambrosio, Sophie; Virtanen, Pauli; Giazotto, Francesco; Altimiras, Carles
2017-12-01
Superconductivity can be understood in terms of a phase transition from an uncorrelated electron gas to a condensate of Cooper pairs in which the relative phases of the constituent electrons are coherent over macroscopic length scales. The degree of correlation is quantified by a complex-valued order parameter, whose amplitude is proportional to the strength of the pairing potential in the condensate. Supercurrent-carrying states are associated with nonzero values of the spatial gradient of the phase. The pairing potential and several physical observables of the Cooper condensate can be manipulated by means of temperature, current bias, dishomogeneities in the chemical composition, or application of a magnetic field. Here we show evidence of complete suppression of the energy gap in the local density of quasiparticle states (DOS) of a superconducting nanowire upon establishing a phase difference equal to π over a length scale comparable to the superconducting coherence length. These observations are consistent with a complete collapse of the pairing potential in the center of the wire, in accordance with theoretical modeling based on the quasiclassical theory of superconductivity in diffusive systems. Our spectroscopic data, fully exploring the phase-biased states of the condensate, highlight the profound effect that extreme phase gradients exert on the amplitude of the pairing potential. Moreover, the sharp magnetic response (up to 27 mV/Φ0) observed near the onset of the superconducting gap collapse regime is exploited to realize magnetic flux detectors with noise-equivalent resolution as low as 260 n Φ0/√{Hz} .
Two-Step Forecast of Geomagnetic Storm Using Coronal Mass Ejection and Solar Wind Condition
NASA Technical Reports Server (NTRS)
Kim, R.-S.; Moon, Y.-J.; Gopalswamy, N.; Park, Y.-D.; Kim, Y.-H.
2014-01-01
To forecast geomagnetic storms, we had examined initially observed parameters of coronal mass ejections (CMEs) and introduced an empirical storm forecast model in a previous study. Now we suggest a two-step forecast considering not only CME parameters observed in the solar vicinity but also solar wind conditions near Earth to improve the forecast capability. We consider the empirical solar wind criteria derived in this study (Bz = -5 nT or Ey = 3 mV/m for t = 2 h for moderate storms with minimum Dst less than -50 nT) (i.e. Magnetic Field Magnitude, B (sub z) less than or equal to -5 nanoTeslas or duskward Electrical Field, E (sub y) greater than or equal to 3 millivolts per meter for time greater than or equal to 2 hours for moderate storms with Minimum Disturbance Storm Time, Dst less than -50 nanoTeslas) and a Dst model developed by Temerin and Li (2002, 2006) (TL [i.e. Temerin Li] model). Using 55 CME-Dst pairs during 1997 to 2003, our solar wind criteria produce slightly better forecasts for 31 storm events (90 percent) than the forecasts based on the TL model (87 percent). However, the latter produces better forecasts for 24 nonstorm events (88 percent), while the former correctly forecasts only 71 percent of them. We then performed the two-step forecast. The results are as follows: (i) for 15 events that are incorrectly forecasted using CME parameters, 12 cases (80 percent) can be properly predicted based on solar wind conditions; (ii) if we forecast a storm when both CME and solar wind conditions are satisfied (n, i.e. cap operator - the intersection set that is comprised of all the elements that are common to both), the critical success index becomes higher than that from the forecast using CME parameters alone, however, only 25 storm events (81 percent) are correctly forecasted; and (iii) if we forecast a storm when either set of these conditions is satisfied (?, i.e. cup operator - the union set that is comprised of all the elements of either or both), all geomagnetic storms are correctly forecasted.
KIC 4150611: a rare multi-eclipsing quintuple with a hybrid pulsator
NASA Astrophysics Data System (ADS)
Hełminiak, K. G.; Ukita, N.; Kambe, E.; Kozłowski, S. K.; Pawłaszek, R.; Maehara, H.; Baranec, C.; Konacki, M.
2017-06-01
Aims: We aim to analyse KIC 4150611 (HD 181469) - an interesting, bright quintuple system that includes a hybrid δ Sct/γ Dor pulsator. Four periods of eclipses - 94.2, 8.65, 1.52 and 1.43 d - have been observed by the Kepler satellite, and three point sources (A, B, and C) are seen in high angular resolution images. Methods: From spectroscopic observations made with the HIDES spectrograph attached to the 1.88-m telescope of the Okayama Astrophysical Observatory (OAO), we have calculated for the first time radial velocities (RVs) of the component B - a pair of G-type stars - and combined them with Kepler photometry in order to obtain absolute physical parameters of this pair. We also managed to directly measure RVs of the pulsator, for the first time. Additionally, we modelled the light curves of the 1.52 and 1.43-day pairs, and measured their eclipse timing variations (ETVs). We also performed relative astrometry and photometry of three sources seen on the images taken with the NIRC2 camera of the Keck II telescope. Finally, we compared our results with theoretical isochrones. Results: The brightest component Aa is the hybrid pulsator, transited every 94.2 days by a pair of K/M-type stars (Ab1+Ab2), which themselves form a 1.52-day eclipsing binary. The components Ba and Bb are late G-type stars, forming another eclipsing pair with a 8.65 day period. Their masses and radii are MBa = 0.894 ± 0.010 M⊙, RBa = 0.802 ± 0.044 R⊙ for the primary, and MBb = 0.888 ± 0.010 M⊙, RBb = 0.856 ± 0.038 R⊙ for the secondary. The remaining period of 1.43 days is possibly related to a faint third star C, which itself is most likely a background object. The system's properties are well-represented by a 35 Myr isochrone, basing on which the masses of the pulsator and the 1.52-day pair are MAa = 1.64(6) M⊙, and MAb,tot = 0.90(13) M⊙, respectively. There are also suggestions of additional bodies in the system.
NASA Astrophysics Data System (ADS)
Straatman, Caroline M. S.; Spitler, Lee R.; Quadri, Ryan F.; Labbé, Ivo; Glazebrook, Karl; Persson, S. Eric; Papovich, Casey; Tran, Kim-Vy H.; Brammer, Gabriel B.; Cowley, Michael; Tomczak, Adam; Nanayakkara, Themiya; Alcorn, Leo; Allen, Rebecca; Broussard, Adam; van Dokkum, Pieter; Forrest, Ben; van Houdt, Josha; Kacprzak, Glenn G.; Kawinwanichakij, Lalitwadee; Kelson, Daniel D.; Lee, Janice; McCarthy, Patrick J.; Mehrtens, Nicola; Monson, Andrew; Murphy, David; Rees, Glen; Tilvi, Vithal; Whitaker, Katherine E.
2016-10-01
The FourStar galaxy evolution survey (ZFOURGE) is a 45 night legacy program with the FourStar near-infrared camera on Magellan and one of the most sensitive surveys to date. ZFOURGE covers a total of 400 arcmin2 in cosmic fields CDFS, COSMOS and UDS, overlapping CANDELS. We present photometric catalogs comprising >70,000 galaxies, selected from ultradeep K s -band detection images (25.5-26.5 AB mag, 5σ, total), and >80% complete to K s < 25.3-25.9 AB. We use 5 near-IR medium-bandwidth filters (J 1, J 2, J 3, H s , H l ) as well as broad-band K s at 1.05-2.16 μm to 25-26 AB at a seeing of ˜0.″5. Each field has ancillary imaging in 26-40 filters at 0.3-8 μm. We derive photometric redshifts and stellar population properties. Comparing with spectroscopic redshifts indicates a photometric redshift uncertainty σ z = 0.010, 0.009, and 0.011 in CDFS, COSMOS, and UDS. As spectroscopic samples are often biased toward bright and blue sources, we also inspect the photometric redshift differences between close pairs of galaxies, finding σ z,pairs = 0.01-0.02 at 1 < z < 2.5. We quantify how σ z,pairs depends on redshift, magnitude, spectral energy distribution type, and the inclusion of FourStar medium bands. σ z,pairs is smallest for bright, blue star-forming samples, while red star-forming galaxies have the worst σ z,pairs. Including FourStar medium bands reduces σ z,pairs by 50% at 1.5 < z < 2.5. We calculate star formation rates (SFRs) based on ultraviolet and ultradeep far-IR Spitzer/MIPS and Herschel/PACS data. We derive rest-frame U - V and V - J colors, and illustrate how these correlate with specific SFR and dust emission to z = 3.5. We confirm the existence of quiescent galaxies at z ˜ 3, demonstrating their SFRs are suppressed by > ×15. This paper contains data gathered with the 6.5 meter Magellan Telescopes located at Las Campanas observatory, Chile
Low dose CT perfusion in acute ischemic stroke.
Murphy, Amanda; So, Aaron; Lee, Ting-Yim; Symons, Sean; Jakubovic, Raphael; Zhang, Liying; Aviv, Richard I
2014-12-01
The purpose of this investigation is to determine if CT perfusion (CTP) measurements at low doses (LD = 20 or 50 mAs) are similar to those obtained at regular doses (RD = 100 mAs), with and without the addition of adaptive statistical iterative reconstruction (ASIR). A single-center, prospective study was performed in patients with acute ischemic stroke (n = 37; 54% male; age = 74 ± 15 years). Two CTP scans were performed on each subject: one at 100 mAs (RD) and one at either 50 or 20 mAs (LD). CTP parameters were compared between the RD and LD scans in regions of ischemia, infarction, and normal tissue. Differences were determined using a within-subjects ANOVA (p < 0.05) followed by a paired t test post hoc analysis (p < 0.01). At 50 mAs, there was no significant difference between cerebral blood flow (CBF), cerebral blood volume (CBV), or time to maximum enhancement (Tmax) values for the RD and LD scans in the ischemic, infarcted, or normal contralateral regions (p < 0.05). At 20 mAs, there were significant differences between the RD and LD scans for all parameters in the ischemic and normal tissue regions (p > 0.05). CTP-derived CBF and CBV are not different at 50 mAs compared to 100 mAs, even without the addition of ASIR. Current CTP protocols can be modified to reduce the effective dose by 50 % without altering CTP measurements.
Investigation of statistical iterative reconstruction for dedicated breast CT
Makeev, Andrey; Glick, Stephen J.
2013-01-01
Purpose: Dedicated breast CT has great potential for improving the detection and diagnosis of breast cancer. Statistical iterative reconstruction (SIR) in dedicated breast CT is a promising alternative to traditional filtered backprojection (FBP). One of the difficulties in using SIR is the presence of free parameters in the algorithm that control the appearance of the resulting image. These parameters require tuning in order to achieve high quality reconstructions. In this study, the authors investigated the penalized maximum likelihood (PML) method with two commonly used types of roughness penalty functions: hyperbolic potential and anisotropic total variation (TV) norm. Reconstructed images were compared with images obtained using standard FBP. Optimal parameters for PML with the hyperbolic prior are reported for the task of detecting microcalcifications embedded in breast tissue. Methods: Computer simulations were used to acquire projections in a half-cone beam geometry. The modeled setup describes a realistic breast CT benchtop system, with an x-ray spectra produced by a point source and an a-Si, CsI:Tl flat-panel detector. A voxelized anthropomorphic breast phantom with 280 μm microcalcification spheres embedded in it was used to model attenuation properties of the uncompressed woman's breast in a pendant position. The reconstruction of 3D images was performed using the separable paraboloidal surrogates algorithm with ordered subsets. Task performance was assessed with the ideal observer detectability index to determine optimal PML parameters. Results: The authors' findings suggest that there is a preferred range of values of the roughness penalty weight and the edge preservation threshold in the penalized objective function with the hyperbolic potential, which resulted in low noise images with high contrast microcalcifications preserved. In terms of numerical observer detectability index, the PML method with optimal parameters yielded substantially improved performance (by a factor of greater than 10) compared to FBP. The hyperbolic prior was also observed to be superior to the TV norm. A few of the best-performing parameter pairs for the PML method also demonstrated superior performance for various radiation doses. In fact, using PML with certain parameter values results in better images, acquired using 2 mGy dose, than FBP-reconstructed images acquired using 6 mGy dose. Conclusions: A range of optimal free parameters for the PML algorithm with hyperbolic and TV norm-based potentials is presented for the microcalcification detection task, in dedicated breast CT. The reported values can be used as starting values of the free parameters, when SIR techniques are used for image reconstruction. Significant improvement in image quality can be achieved by using PML with optimal combination of parameters, as compared to FBP. Importantly, these results suggest improved detection of microcalcifications can be obtained by using PML with lower radiation dose to the patient, than using FBP with higher dose. PMID:23927318
Calcium induced ATP synthesis: Isotope effect, magnetic parameters and mechanism
NASA Astrophysics Data System (ADS)
Buchachenko, A. L.; Kuznetsov, D. A.; Breslavskaya, N. N.; Shchegoleva, L. N.; Arkhangelsky, S. E.
2011-03-01
ATP synthesis by creatine kinase with calcium ions is accompanied by 43Ca/ 40Ca isotope effect: the enzyme with 43Ca 2+ was found to be 2.0 ± 0.3 times more active than enzymes, in which Ca 2+ ions have nonmagnetic nuclei 40Ca. The effect demonstrates that primary reaction in ATP synthesis is electron transfer between reaction partners, Сa( HO)n2+ ( n ⩽ 3) and Ca 2+(ADP) 3-. It generates ion-radical pair, in which spin conversion results in the isotope effect. Magnetic parameters (g-factors and HFC constants a( 43Ca) and a( 31P)) confirm that namely terminal oxygen atom of the ADP ligand in the complex Ca 2+(ADP) 3- donates electron to the Ca( HO)n2+ ion.
Accurate Nanoscale Crystallography in Real-Space Using Scanning Transmission Electron Microscopy.
Dycus, J Houston; Harris, Joshua S; Sang, Xiahan; Fancher, Chris M; Findlay, Scott D; Oni, Adedapo A; Chan, Tsung-Ta E; Koch, Carl C; Jones, Jacob L; Allen, Leslie J; Irving, Douglas L; LeBeau, James M
2015-08-01
Here, we report reproducible and accurate measurement of crystallographic parameters using scanning transmission electron microscopy. This is made possible by removing drift and residual scan distortion. We demonstrate real-space lattice parameter measurements with <0.1% error for complex-layered chalcogenides Bi2Te3, Bi2Se3, and a Bi2Te2.7Se0.3 nanostructured alloy. Pairing the technique with atomic resolution spectroscopy, we connect local structure with chemistry and bonding. Combining these results with density functional theory, we show that the incorporation of Se into Bi2Te3 causes charge redistribution that anomalously increases the van der Waals gap between building blocks of the layered structure. The results show that atomic resolution imaging with electrons can accurately and robustly quantify crystallography at the nanoscale.
NASA Astrophysics Data System (ADS)
Ferreras, I.; Hopkins, A. M.; Gunawardhana, M. L. P.; Sansom, A. E.; Owers, M. S.; Driver, S.; Davies, L.; Robotham, A.; Taylor, E. N.; Konstantopoulos, I.; Brough, S.; Norberg, P.; Croom, S.; Loveday, J.; Wang, L.; Bremer, M.
2017-06-01
The merging history of galaxies can be traced with studies of dynamically close pairs. These consist of a massive primary galaxy and a less massive secondary (or satellite) galaxy. The study of the stellar populations of secondary (lower mass) galaxies in close pairs provides a way to understand galaxy growth by mergers. Here we focus on systems involving at least one massive galaxy - with stellar mass above 1011M⊙ in the highly complete Galaxy and Mass Assembly (GAMA) survey. Our working sample comprises 2692 satellite galaxy spectra (0.1 ≤ z ≤ 0.3). These spectra are combined into high S/N stacks, and binned according to both an 'internal' parameter, the stellar mass of the satellite galaxy (I.e. the secondary), and an 'external' parameter, selecting either the mass of the primary in the pair, or the mass of the corresponding dark matter halo. We find significant variations in the age of the populations with respect to environment. At fixed mass, satellites around the most massive galaxies are older and possibly more metal-rich, with age differences ˜1-2 Gyr within the subset of lower mass satellites (˜1010 M⊙). These variations are similar when stacking with respect to the halo mass of the group where the pair is embedded. The population trends in the lower mass satellites are consistent with the old stellar ages found in the outer regions of massive galaxies.
Zero-range effective field theory for resonant wino dark matter. Part III. Annihilation effects
NASA Astrophysics Data System (ADS)
Braaten, Eric; Johnson, Evan; Zhang, Hong
2018-05-01
Near a critical value of the wino mass where there is a zero-energy S-wave resonance at the neutral-wino-pair threshold, low-energy winos can be described by a zero-range effective field theory (ZREFT) in which the winos interact nonperturbatively through a contact interaction and through Coulomb interactions. The effects of wino-pair annihilation into electroweak gauge bosons are taken into account through the analytic continuation of the real parameters for the contact interaction to complex values. The parameters of ZREFT can be determined by matching wino-wino scattering amplitudes calculated by solving the Schrödinger equation for winos interacting through a real potential due to the exchange of electroweak gauge bosons and an imaginary potential due to wino-pair annihilation into electroweak gauge bosons. ZREFT at leading order gives an accurate analytic description of low-energy wino-wino scattering, inclusive wino-pair annihilation, and a wino-pair bound state. ZREFT can also be applied to partial annihilation rates, such as the Sommerfeld enhancement of the annihilation rate of wino pairs into monochromatic photons.
Development of a fast temperature sensor for combustion gases using a single tunable diode laser
NASA Astrophysics Data System (ADS)
Zhou, X.; Jeffries, J. B.; Hanson, R. K.
2005-09-01
The 12 best NIR water transition line pairs for temperature measurements with a single DFB laser in flames are determined by systematic analysis of the HITRAN simulation of the water spectra in the 1-2 μm spectral region. A specific line pair near 1.4 μm was targeted for non-intrusive measurements of gas temperature in combustion systems using a scanned-wavelength technique with wavelength modulation and 2f detection. This sensor uses a single diode laser (distributed-feedback), operating near 1.4 μm and is wavelength scanned over a pair of H2O absorption transitions (7154.354 cm-1 & 7153.748 cm-1) at a 2 kHz repetition rate. The wavelength is modulated (f=500 kHz) with modulation amplitude a=0.056 cm-1. Gas temperature is inferred from the ratio of the second harmonic signals of the two selected H2O transitions. The fiber-coupled-single-laser design makes the system compact, rugged, low cost and simple to assemble. As part of the sensor development effort, design rules were applied to optimize the line selection, and fundamental spectroscopic parameters of the selected transitions were determined via laboratory measurements including the temperature-dependent line strength, self-broadening coefficients, and air-broadening coefficients. The new sensor design includes considerations of hardware and software to enable fast data acquisition and analysis; a temperature readout rate of 2 kHz was demonstrated for measurements in a laboratory flame at atmospheric pressure. The combination of scanned-wavelength and wavelength-modulation minimizes interference from emission and beam steering, resulting in a robust temperature sensor that is promising for combustion control applications.
High-Speed Quantum Key Distribution Using Photonic Integrated Circuits
2013-01-01
protocol [14] that uses energy-time entanglement of pairs of photons. We are employing the QPIC architecture to implement a novel high-dimensional disper...continuous Hilbert spaces using measures of the covariance matrix. Although we focus the discussion on a scheme employing entangled photon pairs...is the probability that parameter estimation fails [20]. The parameter ε̄ accounts for the accuracy of estimating the smooth min- entropy , which
Synchrotron Self-Compton Emission from the Crab and Other Pulsars
NASA Astrophysics Data System (ADS)
Harding, Alice K.; Kalapotharakos, Constantinos
2015-09-01
Results of a simulation of synchrotron self-Compton (SSC) emission from a rotation-powered pulsar are presented. The radiating particles are assumed to be both accelerated primary electrons and a spectrum of electron-positron pairs produced in cascades near the polar cap. They follow trajectories in a slot gap using 3D force-free magnetic field geometry, gaining pitch angles through resonant cyclotron absorption of radio photons, radiating and scattering synchrotron emission at high altitudes out to and beyond the light cylinder. Full angular dependence of the synchrotron photon density is simulated in the scattering and all processes are treated in the inertial observer frame. Spectra for the Crab and Vela pulsars as well as two energetic millisecond pulsars, B1821-24 and B1937+21, are simulated using this model. The simulation of the Crab pulsar radiation can reproduce both the flux level and the shape of the observed optical to hard X-ray emission assuming a pair multiplicity of {M}+=3× {10}5, as well as the very-high-energy emission above 50 GeV detected by MAGIC and VERITAS, with both the synchrotron and SSC components reflecting the shape of the pair spectrum. Simulations of Vela, B1821-24, and B1937+21, for {M}+ up to 105, do not produce pair SSC emission that is detectable by current telescopes, indicating that only Crab-like pulsars produce significant SSC components. The pair synchrotron emission matches the observed X-ray spectrum of the millisecond pulsars, and the predicted peak of this emission at 1-10 MeV would be detectable with planned Compton telescopes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hróðmarsson, Helgi Rafn; Wang, Huasheng; Kvaran, Ágúst, E-mail: agust@hi.is
2014-06-28
Mass resolved resonance enhanced multiphoton ionization data for hydrogen iodide (HI), for two-photon resonance excitation to Rydberg and ion-pair states in the 69 600–72 400 cm{sup −1} region were recorded and analyzed. Spectral perturbations due to homogeneous and heterogeneous interactions between Rydberg and ion-pair states, showing as deformations in line-positions, line-intensities, and line-widths, were focused on. Parameters relevant to photodissociation processes, state interaction strengths and spectroscopic parameters for deperturbed states were derived. Overall interaction and dynamical schemes to describe the observations are proposed.
The loss of a hydrogen bond: Thermodynamic contributions of a non-standard nucleotide
Jolley, Elizabeth A.
2017-01-01
Abstract Non-standard nucleotides are ubiquitous in RNA. Thermodynamic studies with RNA duplexes containing non-standard nucleotides, whether incorporated naturally or chemically, can provide insight into the stability of Watson–Crick pairs and the role of specific functional groups in stabilizing a Watson–Crick pair. For example, an A-U, inosine•U and pseudouridine•A pair each form two hydrogen bonds. However, an RNA duplex containing a central I•U pair or central Ψ•A pair is 2.4 kcal/mol less stable or 1.7 kcal/mol more stable, respectively, than the corresponding duplex containing an A-U pair. In the non-standard nucleotide purine, hydrogen replaces the exocyclic amino group of A. This replacement results in a P•U pair containing only one hydrogen bond. Optical melting studies were performed with RNA duplexes containing P•U pairs adjacent to different nearest neighbors. The resulting thermodynamic parameters were compared to RNA duplexes containing A-U pairs in order to determine the contribution of the hydrogen bond involving the exocyclic amino group. Results indicate a loss of 1.78 kcal/mol, on average, when an internal P•U replaces A-U in an RNA duplex. This value is compared to the thermodynamics of a hydrogen bond determined by similar methods. Nearest neighbor parameters were derived for use in free energy and secondary structure prediction software. PMID:28180321
Perturbation analysis of the limit cycle of the free van der Pol equation
NASA Technical Reports Server (NTRS)
Dadfar, M. B.; Geer, J.; Anderson, C. M.
1983-01-01
A power series expansion in the damping parameter, epsilon, of the limit cycle of the free van der Pol equation is constructed and analyzed. Coefficients in the expansion are computed in exact rational arithmetic using the symbolic manipulation system MACSYMA and using a FORTRAN program. The series is analyzed using Pade approximants. The convergence of the series for the maximum amplitude of the limit cycle is limited by two pair of complex conjugate singularities in the complex epsilon-plane. A new expansion parameter is introduced which maps these singularities to infinity and leads to a new expansion for the amplitude which converges for all real values of epsilon. Amplitudes computed from this transformed series agree very well with reported numerical and asymptotic results. For the limit cycle itself, convergence of the series expansion is limited by three pair of complex conjugate branch point singularities. Two pair remain fixed throughout the cycle, and correspond to the singularities found in the maximum amplitude series, while the third pair moves in the epsilon-plane as a function of t from one of the fixed pairs to the other. The limit cycle series is transformed using a new expansion parameter, which leads to a new series that converges for larger values of epsilon.
Louarn, Gaëtan; Lecoeur, Jérémie; Lebon, Eric
2008-01-01
Background and Aims In grapevine, canopy-structure-related variations in light interception and distribution affect productivity, yield and the quality of the harvested product. A simple statistical model for reconstructing three-dimensional (3D) canopy structures for various cultivar–training system (C × T) pairs has been implemented with special attention paid to balance the time required for model parameterization and accuracy of the representations from organ to stand scales. Such an approach particularly aims at overcoming the weak integration of interplant variability using the usual direct 3D measurement methods. Model This model is original in combining a turbid-medium-like envelope enclosing the volume occupied by vine shoots with the use of discrete geometric polygons representing leaves randomly located within this volume to represent plant structure. Reconstruction rules were adapted to capture the main determinants of grapevine shoot architecture and their variability. Using a simplified set of parameters, it was possible to describe (1) the 3D path of the main shoot, (2) the volume occupied by the foliage around this path and (3) the orientation of individual leaf surfaces. Model parameterization (estimation of the probability distribution for each parameter) was carried out for eight contrasting C × T pairs. Key Results and Conclusions The parameter values obtained in each situation were consistent with our knowledge of grapevine architecture. Quantitative assessments for the generated virtual scenes were carried out at the canopy and plant scales. Light interception efficiency and local variations of light transmittance within and between experimental plots were correctly simulated for all canopies studied. The approach predicted these key ecophysiological variables significantly more accurately than the classical complete digitization method with a limited number of plants. In addition, this model accurately reproduced the characteristics of a wide range of individual digitized plants. Simulated leaf area density and the distribution of light interception among leaves were consistent with measurements. However, at the level of individual organs, the model tended to underestimate light interception. PMID:18202006
NASA Astrophysics Data System (ADS)
Jang, J. H.; Nemer, M.
2015-12-01
The U.S. DOE Waste Isolation Pilot Plant (WIPP) is a deep underground repository for the permanent disposal of transuranic (TRU) radioactive waste. The WIPP is located in the Permian Delaware Basin near Carlsbad, New Mexico, U.S.A. The TRU waste includes, but is not limited to, iron-based alloys and the complexing agent, citric acid. Iron is also present from the steel used in the waste containers. The objective of this analysis is to derive the Pitzer activity coefficients for the pair of Na+ and FeCit- complex to expand current WIPP thermodynamic database. An aqueous model for the dissolution of Fe(OH)2(s) in a Na3Cit solution was fitted to the experimentally measured solubility data. The aqueous model consists of several chemical reactions and related Pitzer interaction parameters. Specifically, Pitzer interaction parameters for the Na+ and FeCit- pair (β(0), β(1), and Cφ) plus the stability constant for species of FeCit- were fitted to the experimental data. Anoxic gloveboxes were used to keep the oxygen level low (<1 ppm) throughout the experiments due to redox sensitivity. EQ3NR, a computer program for geochemical aqueous speciation-solubility calculations, packaged in EQ3/6 v.8.0a, calculates the aqueous speciation and saturation index using an aqueous model addressed in EQ3/6's database. The saturation index indicates how far the system is from equilibrium with respect to the solid of interest. Thus, the smaller the sum of squared saturation indices that the aqueous model calculates for the given number of experiments, the more closely the model attributes equilibrium to each individual experiment with respect to the solid of interest. The calculation of aqueous speciation and saturation indices was repeated by adjusting stability constant of FeCit-, β(0), β(1), and Cφ in the database until the values are found that make the sum of squared saturation indices the smallest for the given number of experiments. Results will be presented at the time of conference.
Piirtola, Maarit; Kaprio, Jaakko; Waller, Katja; Heikkilä, Kauko; Koskenvuo, Markku; Svedberg, Pia; Silventoinen, Karri; Kujala, Urho M; Ropponen, Annina
2017-02-01
We investigated the stability and change of leisure-time physical inactivity in adult men and women during a 35-year follow-up. We also analysed the impact of long-term physical inactivity on the development of body mass index (BMI). : In this population-based cohort study, 5254 Finnish twin individuals (59% women) participated in four surveys in 1975, 1981, 1990 and 2011. Mean age at baseline was 23.9 years. Individual long-term leisure-time physical activity (LTPA) was categorized into seven classes varying from 'persistently inactive' to 'persistently active'. We used the multivariate multilevel mixed-effects linear regression model and paired-sample t-test in the analyses. Co-twin control design was used for examining within-pair associations. : Of men 11%, and of women 8%, were persistently inactive. Among both sexes, the mean BMI slope trajectories were steeper among the persistently inactive and those who became inactive than among those who were persistently active. Overall, the inactive participants gained 1.4 kg/m 2 [95% confidence interval (CI) 1.2 to 1.7] more in weight than did the active participants from 1975 to 2011. Among twin pairs discordant for LTPA, the corresponding difference was 1.4 kg/m 2 (95% CI 0.83 to 2.0) in dizygotic pairs and 0.68 kg/m 2 (95% CI 0.05 to1.3) in monozygotic pairs. Over a 35-year time span from young adulthood, persistently inactive participants and those who had become inactive had greater weight increases than those who were persistently active. This association was also found in twin-pair analyses, although attenuated in monozygotic pairs. This may support the importance of LTPA in weight management, although further causal inference is required. © The Author 2016; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association
NASA Astrophysics Data System (ADS)
Chen, R.; Chen, S.; He, L.; Yao, H.; Li, H.; Xi, X.; Zhao, X.
2017-12-01
EM method plays a key role in volcanic massive sulfide (VMS) deposit which is with high grade and high economic value. However, the performance of high density 3D AMT in detecting deep concealed VMS targets is not clear. The size of a typical VMS target is less than 100 m x 100 m x 50 m, it's a challenge task to find it with large depth. We carried a test in a VMS Pb-Zn deposit using high density 3D AMT with site spacing as 20 m and profile spacing as 40 - 80 m. About 2000 AMT sites were acquired in an area as 2000 m x 1500 m. Then we used a sever with 8 CPUs (Intel Xeon E7-8880 v3, 2.3 GHz, 144 cores), 2048 GB RAM, and 40 TB disk array to invert above 3D AMT sites using integral equation forward modeling and re-weighted conjugated-gradient inversion. The depth of VMS ore body is about 600 m and the size of the ore body is about 100 x 100 x 20m with dip angle about 45 degree. We finds that it's very hard to recover the location and shape of the ore body by 3D AMT inversion even using the data of all AMT sites and frequencies. However, it's possible to recover the location and shape of the deep concealed ore body if we adjust the inversion parameters carefully. A new set of inversion parameter needs to be find for high density 3D AMT data set and the inversion parameters working good for Dublin Secret Model II (DSM 2) is not suitable for our real data. This problem may be caused by different data density and different number of frequency. We find a set of good inversion parameter by comparing the shape and location of ore body with inversion result and trying different inversion parameters. And the application of new inversion parameter in nearby area with high density AMT sites shows that the inversion result is improved greatly.
NASA Astrophysics Data System (ADS)
Lei, Po-Hsun; Wang, Shun-Hsi; Juang, Fuh Shyang; Tseng, Yung-Hsin; Chung, Meng-Jung
2010-05-01
In this article, we report on the effect of SiO 2/Si 3N 4 dielectric distributed Bragg reflectors (DDBRs) for Alq 3/NPB thin-film resonant cavity organic light emitting diode (RCOLED) in increasing the light output intensity and reducing the linewidth of spontaneous emission spectrum. The optimum DDBR number is found as 3 pairs. The device performance will be bad by further increasing or decreasing the number of DDBR. As compared to the conventional Alq 3/NPB thin-film organic light emitting diode (OLED), the Alq 3/NPB thin-film RCOLED with 3-pair DDBRs has the superior electrical and optical characteristics including a forward voltage of 6 V, a current efficiency of 3.4 cd/A, a luminance of 2715 cd/m 2 under the injection current density of 1000 A/m 2, and a full width at half maximum (FWHM) of 12 nm for emission spectrum over the 5-9 V bias range. These results represent that the Alq 3/NPB thin-film OLED with DDBRs shows a potential as the light source for plastic optical fiber (POF) communication system.
A study of parton fragmentation in hadronic Z 0 decays using Λ Λ correlations
NASA Astrophysics Data System (ADS)
OPAL Collaboration; Abbiendi, G.; et al.
2000-03-01
The correlated production of Λ and Λ baryons has been studied using 4.3 million multihadronic Z0 decays recorded with the Opal detector at Lep. Lambda pairs were investigated in the full data sample and for the first time also in 2-jet and 3-jet events selected with the k⊥ algorithm. The distributions of rapidity differences from correlated Λ Λ pairs exhibit short-range, local correlations and prove to be a sensitive tool to test models, particularly for 2-jet events. The Jetset model describes the data best but some extra parameter tuning is needed to improve agreement with the experimental results in the rates and the rapidity spectra simultaneously. The recently developed modification of Jetset, the MOdified Popcorn Scenarium (Mops), and also Herwig do not give satisfactory results. This study of di-lambda production in 2- and 3-jet events supports the short-range compensation of quantum numbers.
Spectroscopic study on the iodine molecule by a sequential three-photon excitation
NASA Astrophysics Data System (ADS)
Ishiwata, Takashi; Ohtoshi, Hirokazu; Sakaki, Mamoru; Tanaka, Ikuzo
1984-02-01
A three-photon absorption technique which utilizes a visible B 3Π0+u-X 1Σ+g transition followed by a simultaneous two-photon absorption was applied to study an ion-pair state of molecular iodine. The derived molecular parameters were Te=51 707 cm-1, ωe=131 cm-1, and Be=0.021 90 cm-1 for the F'(0+u) ion-pair state, which dissociates to I-(1S)+I+(1D). The excitation of I2 to a single rovibronic level of the F' state was achieved and its fluorescence spectrum showed two discrete band systems corresponding to the transitions to: (1) the ground state at higher vibrational levels; and (2) the weakly bound state (Te=19 286 cm-1, ωe=64 cm-1, and re=3.65 Å) converging to the I(2P3/2)+I(2P1/2) products.
Spectral Line Shapes in the ν_3 Q Branch of ^{12}CH_4 Near 3.3 μm
NASA Astrophysics Data System (ADS)
Devi, V. Malathy; Benner, D. Chris; Gamache, Robert R.; Smith, Mary Ann H.; Sams, Robert L.
2017-06-01
Detailed knowledge of spectroscopic parameters for prominent Q branches of methane is necessary for interpretation and modeling of high resolution infrared spectra of terrestrial and planetary atmospheres. We have measured air-broadened line shape parameters in the Q branch of ^{12}CH_4 in the ν_3 fundamental band for a large number of transitions in the 3000 to 3023 cm^{-1} region by analyzing 13 room-temperature laboratory absorption spectra. Twelve of these spectra were recorded with 0.01 cm^{-1} resolution using the McMath-Pierce Fourier transform spectrometer (FTS) of the National Solar Observatory (NSO) on Kitt Peak, and one higher-resolution (˜0.0011 cm^{-1}) low pressure (˜1 Torr) spectrum of methane was obtained using the Bruker IFS 120HR FTS at the Pacific Northwest National Laboratory (PNNL) in Richland, WA. The air-broadened spectra were recorded using various absorption cells with path lengths of 5, 20, 25, and 150 cm, total sample pressures between 50 and 500 Torr, and CH_4 volume mixing ratios of 0.01 or less. All 13 spectra were fit simultaneously covering the 3000-3023 cm^{-1} spectral region using a multispectrum nonlinear least squares technique to retrieve accurate line positions, absolute intensities, Lorentz air-broadened widths and pressure-shift coefficients. Line mixing using the off-diagonal relaxation matrix element formalism was measured for a number of pairs of transitions for the CH_4-air collisional system. The results will be compared to values reported in the literature. D. C. Benner, C. P. Rinsland, V. Malathy Devi, M. A. H. Smith, D. Atkins, JQSRT 53 (1995) 705-721. A. Levy, N. Lacome, C. Chackerian, Collisional line mixing, in Spectroscopy of the Earth's Atmosphere and Interstellar Medium, Academic Press, Inc., Boston (1992) 261-337.
Discovery of an H I-rich Gas Reservoir in the Outskirts of SZ-effect-selected Clusters
NASA Astrophysics Data System (ADS)
Muzahid, Sowgat; Charlton, Jane; Nagai, Daisuke; Schaye, Joop; Srianand, Raghunathan
2017-09-01
We report on the detection of three strong H I absorbers originating in the outskirts (I.e., impact parameter, {ρ }{cl} ≈ (1.6-4.7)r 500) of three massive ({M}500˜ 3× {10}14 M ⊙) clusters of galaxies at redshift {z}{cl}≈ 0.46, in the Hubble Space Telescope Cosmic Origins Spectrograph (HST/COS) spectra of three background UV-bright quasars. These clusters were discovered by the 2500 deg2 South Pole Telescope Sunyaev-Zel’dovich (SZ) effect survey. All three COS spectra show a partial Lyman limit absorber with N(H I) > 1016.5 cm-2 near the photometric redshifts (| {{Δ }}z/(1+z)| ≈ 0.03) of the clusters. The compound probability of the random occurrence of all three absorbers is <0.02%, indicating that the absorbers are most likely related to the targeted clusters. We find that the outskirts of these SZ-selected clusters are remarkably rich in cool gas compared to existing observations of other clusters in the literature. The effective Doppler parameters of the Lyman series lines, obtained using a single-cloud curve-of-growth (COG) analysis, suggest a nonthermal/turbulent velocity of a few×10 km s-1 in the absorbing gas. We emphasize the need for uniform galaxy surveys around these fields and for more UV observations of quasar-cluster pairs in general in order to improve the statistics and gain further insights into the unexplored territory of the largest collapsed cosmic structures.
Razzoli, M; Valsecchi, P; Palanza, P
2005-04-15
Estrogenic endocrine disruptors, synthetic or naturally occurring substances found in the environment, can interfere with the vertebrate endocrine system and, mimicking estrogens, interact with the neuroendocrine substrates of behavior. Since species vary in their sensitivity to steroids, it is of great interest to widen the range of species included in the researches on neurobehavioral effects of estrogenic endocrine disruptors. We examined socio-sexual and exploratory behavior of Mongolian gerbil females (Meriones unguiculatus), a monogamous rodent, in response to chronic exposure to the estrogenic endocrine disruptor bisphenol A. Paired females were daily administered with one of the following treatments: bisphenol A (2 or 20 microg/kg body weight/day); 17alpha-ethynil estradiol (0.04 microg/kg body weight/day 17alphaE); oil (vehicle). Females were treated for 3 weeks after pairing. Starting on day of pairing, social interactions within pairs were daily recorded. Three weeks after pairing, females were individually tested in a free exploratory paradigm. Bisphenol A and 17alphaE affected male-female social interactions by increasing social investigation. Bisphenol A reduced several exploratory parameters, indicating a decreased exploratory propensity of females. These results highlight the sensitivity of adult female gerbils to bisphenol A during the hormonally sensitive period of pair formation, also considering that the bisphenol A doses tested are well below the suggested human tolerable daily intake.
Adaptive echolocation behavior in bats for the analysis of auditory scenes
Chiu, Chen; Xian, Wei; Moss, Cynthia F.
2009-01-01
Summary Echolocating bats emit sonar pulses and listen to returning echoes to probe their surroundings. Bats adapt their echolocation call design to cope with dynamic changes in the acoustic environment, including habitat change or the presence of nearby conspecifics/heterospecifics. Seven pairs of big brown bats, Eptesicus fuscus, were tested in this study to examine how they adjusted their echolocation calls when flying and competing with a conspecific for food. Results showed that differences in five call parameters, start/end frequencies, duration, bandwidth and sweep rate, significantly increased in the two-bat condition compared with the baseline data. In addition, the magnitude of spectral separation of calls was negatively correlated with the baseline call design differences in individual bats. Bats with small baseline call frequency differences showed larger increases in call frequency separation when paired than those with large baseline call frequency differences, suggesting that bats actively change their sonar call structure if pre-existing differences in call design are small. Call design adjustments were also influenced by physical spacing between two bats. Calls of paired bats exhibited the largest design separations when inter-bat distance was shorter than 0.5 m, and the separation decreased as the spacing increased. All individuals modified at least one baseline call parameter in response to the presence of another conspecific. We propose that dissimilarity between the time–frequency features of sonar calls produced by different bats aids each individual in segregating echoes of its own sonar vocalizations from the acoustic signals of neighboring bats. PMID:19376960
An All-Solution-Based Hybrid CMOS-Like Quantum Dot/Carbon Nanotube Inverter.
Shulga, Artem G; Derenskyi, Vladimir; Salazar-Rios, Jorge Mario; Dirin, Dmitry N; Fritsch, Martin; Kovalenko, Maksym V; Scherf, Ullrich; Loi, Maria A
2017-09-01
The development of low-cost, flexible electronic devices is subordinated to the advancement in solution-based and low-temperature-processable semiconducting materials, such as colloidal quantum dots (QDs) and single-walled carbon nanotubes (SWCNTs). Here, excellent compatibility of QDs and SWCNTs as a complementary pair of semiconducting materials for fabrication of high-performance complementary metal-oxide-semiconductor (CMOS)-like inverters is demonstrated. The n-type field effect transistors (FETs) based on I - capped PbS QDs (V th = 0.2 V, on/off = 10 5 , S S-th = 114 mV dec -1 , µ e = 0.22 cm 2 V -1 s -1 ) and the p-type FETs with tailored parameters based on low-density random network of SWCNTs (V th = -0.2 V, on/off > 10 5 , S S-th = 63 mV dec -1 , µ h = 0.04 cm 2 V -1 s -1 ) are integrated on the same substrate in order to obtain high-performance hybrid inverters. The inverters operate in the sub-1 V range (0.9 V) and have high gain (76 V/V), large maximum-equal-criteria noise margins (80%), and peak power consumption of 3 nW, in combination with low hysteresis (10 mV). © 2017 The Authors. Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Bundy, Kevin; Fukugita, Masataka; Ellis, Richard S.; Targett, Thomas A.; Belli, Sirio; Kodama, Tadayuki
2009-06-01
Using deep infrared observations conducted with the MOIRCS imager on the Subaru Telescope in the northern GOODS field combined with public surveys in GOODS-S, we investigate the dependence on stellar mass, M *, and galaxy type of the close pair fraction (5 h -1 kpc < r sep < 20 h -1 kpc) and implied merger rate. In terms of combined depth and survey area, our publicly available mass-limited sample represents a significant improvement over earlier infrared surveys used for this purpose. In common with some recent studies, we find that the fraction of paired systems that could result in major mergers is low (~4%) and does not increase significantly with redshift to z ≈ 1.2, with vprop(1 + z)1.6±1.6. Our key finding is that massive galaxies with M *>1011 M sun are more likely to host merging companions than less massive systems (M * ~ 1010 M sun). We find evidence for a higher pair fraction for red, spheroidal hosts compared to blue, late-type systems, in line with expectations based on clustering at small scales. The so-called "dry" mergers between early-type galaxies devoid of star formation (SF) represent nearly 50% of close pairs with M *>3 × 1010 M sun at z ~ 0.5, but less than 30% at z ~ 1. This result can be explained by the increasing abundance of red, early-type galaxies at these masses. We compare the volumetric merger rate of galaxies with different masses to mass-dependent trends in galaxy evolution. Our results reaffirm the conclusion of Bundy et al. that major mergers do not fully account for the formation of spheroidal galaxies since z ~ 1. In terms of mass assembly, major mergers contribute little to galaxy growth below M * ~ 3 × 1010 M sun but play a more significant role among galaxies with M * gsim 1011 M sun ~ 30% of which have undergone mostly dry mergers over the observed redshift range. Overall, the relatively rapid and recent coalescence of high-mass galaxies mirrors the expected hierarchical growth of halos and is consistent with recent model predictions, even if the top-down suppression of SF and morphological evolution (i.e., "downsizing") involves additional physical processes. Based on observations collected at the Subaru Telescope, which is operated by the National Astronomical Observatory of Japan, and with the NASA/ESA HST, obtained at STScI, which is operated by AURA, under NASA contract NAS5-26555.
Computer simulation of liquid-vapor coexistence of confined quantum fluids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trejos, Víctor M.; Gil-Villegas, Alejandro, E-mail: gil@fisica.ugto.mx; Martinez, Alejandro
2013-11-14
The liquid-vapor coexistence (LV) of bulk and confined quantum fluids has been studied by Monte Carlo computer simulation for particles interacting via a semiclassical effective pair potential V{sub eff}(r) = V{sub LJ} + V{sub Q}, where V{sub LJ} is the Lennard-Jones 12-6 potential (LJ) and V{sub Q} is the first-order Wigner-Kirkwood (WK-1) quantum potential, that depends on β = 1/kT and de Boer's quantumness parameter Λ=h/σ√(mε), where k and h are the Boltzmann's and Planck's constants, respectively, m is the particle's mass, T is the temperature of the system, and σ and ε are the LJ potential parameters. The non-conformalmore » properties of the system of particles interacting via the effective pair potential V{sub eff}(r) are due to Λ, since the LV phase diagram is modified by varying Λ. We found that the WK-1 system gives an accurate description of the LV coexistence for bulk phases of several quantum fluids, obtained by the Gibbs Ensemble Monte Carlo method (GEMC). Confinement effects were introduced using the Canonical Ensemble (NVT) to simulate quantum fluids contained within parallel hard walls separated by a distance L{sub p}, within the range 2σ ⩽ L{sub p} ⩽ 6σ. The critical temperature of the system is reduced by decreasing L{sub p} and increasing Λ, and the liquid-vapor transition is not longer observed for L{sub p}/σ < 2, in contrast to what has been observed for the classical system.« less