Coding of level of ambiguity within neural systems mediating choice

PubMed Central

Lopez-Paniagua, Dan; Seger, Carol A.

2013-01-01

Data from previous neuroimaging studies exploring neural activity associated with uncertainty suggest varying levels of activation associated with changing degrees of uncertainty in neural regions that mediate choice behavior. The present study used a novel task that parametrically controlled the amount of information hidden from the subject; levels of uncertainty ranged from full ambiguity (no information about probability of winning) through multiple levels of partial ambiguity, to a condition of risk only (zero ambiguity with full knowledge of the probability of winning). A parametric analysis compared a linear model in which weighting increased as a function of level of ambiguity, and an inverted-U quadratic models in which partial ambiguity conditions were weighted most heavily. Overall we found that risk and all levels of ambiguity recruited a common “fronto—parietal—striatal” network including regions within the dorsolateral prefrontal cortex, intraparietal sulcus, and dorsal striatum. Activation was greatest across these regions and additional anterior and superior prefrontal regions for the quadratic function which most heavily weighs trials with partial ambiguity. These results suggest that the neural regions involved in decision processes do not merely track the absolute degree ambiguity or type of uncertainty (risk vs. ambiguity). Instead, recruitment of prefrontal regions may result from greater degree of difficulty in conditions of partial ambiguity: when information regarding reward probabilities important for decision making is hidden or not easily obtained the subject must engage in a search for tractable information. Additionally, this study identified regions of activity related to the valuation of potential gains associated with stimuli or options (including the orbitofrontal and medial prefrontal cortices and dorsal striatum) and related to winning (including orbitofrontal cortex and ventral striatum). PMID:24367286

Integrated Geophysical and Geological Study of Earthquakes in Normally Aseismic Areas

DTIC Science & Technology

1974-09-01

preparing to engage in field research in Taiwan with partial support by NSF. Although Taiwan is not strictly an intraplate region, this study should...Prepared for: Air Force Office of Scientific Research Advanced Research Projects Agency September 1974 DISTRIBUTED BY: um National Technical... RESEARCH from CORNELL UNIVERSITY DEPARTMENT OF GEOTOGICAL SCIENCES Title of Proposal: Sponsored by: Program Code: Effective Date of Contract

The mitochondrial genome of Polistes jokahamae and a phylogenetic analysis of the Vespoidea (Insecta: Hymenoptera).

PubMed

Song, Sheng-Nan; Chen, Peng-Yan; Wei, Shu-Jun; Chen, Xue-Xin

2016-07-01

The mitochondrial genome sequence of Polistes jokahamae (Radoszkowski, 1887) (Hymenoptera: Vespidae) (GenBank accession no. KR052468) was sequenced. The current length with partial A + T-rich region of this mitochondrial genome is 16,616 bp. All the typical mitochondrial genes were sequenced except for three tRNAs (trnI, trnQ, and trnY) located between the A + T-rich region and nad2. At least three rearrangement events occurred in the sequenced region compared with the pupative ancestral arrangement of insects, corresponding to the shuffling of trnK and trnD, translocation or remote inversion of tnnY and translocation of trnL1. All protein-coding genes start with ATN codons. Eleven, one, and another one protein-coding genes stop with termination codon TAA, TA, and T, respectively. Phylogenetic analysis using the Bayesian method based on all codon positions of the 13 protein-coding genes supports the monophyly of Vespidae and Formicidae. Within the Formicidae, the Myrmicinae and Formicinae form a sister lineage and then sister to the Dolichoderinae, while within the Vespidae, the Eumeninae is sister to the lineage of Vespinae + Polistinae.

Some partial-unit-memory convolutional codes

NASA Technical Reports Server (NTRS)

Abdel-Ghaffar, K.; Mceliece, R. J.; Solomon, G.

1991-01-01

The results of a study on a class of error correcting codes called partial unit memory (PUM) codes are presented. This class of codes, though not entirely new, has until now remained relatively unexplored. The possibility of using the well developed theory of block codes to construct a large family of promising PUM codes is shown. The performance of several specific PUM codes are compared with that of the Voyager standard (2, 1, 6) convolutional code. It was found that these codes can outperform the Voyager code with little or no increase in decoder complexity. This suggests that there may very well be PUM codes that can be used for deep space telemetry that offer both increased performance and decreased implementational complexity over current coding systems.

Detection of hyper-conserved regions in hepatitis B virus X gene potentially useful for gene therapy.

PubMed

González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco

2018-05-21

To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.

A partial deletion within foot-and-mouth disease virus non-structural protein 3A causes clinical attenuation in cattle but does not prevent subclinical infection

USDA-ARS?s Scientific Manuscript database

Deletions within the 3A coding region of foot-and-mouth disease virus (FMDV) are associated with decreased virulence in cattle; however, the mechanisms are unknown. We compared experimental infection of cattle with virulent FMDV O1Campos (O1Ca) and a mutant derivative (O1Ca-delta3A) lacking residues...

Transfer Function Bounds for Partial-unit-memory Convolutional Codes Based on Reduced State Diagram

NASA Technical Reports Server (NTRS)

Lee, P. J.

1984-01-01

The performance of a coding system consisting of a convolutional encoder and a Viterbi decoder is analytically found by the well-known transfer function bounding technique. For the partial-unit-memory byte-oriented convolutional encoder with m sub 0 binary memory cells and (k sub 0 m sub 0) inputs, a state diagram of 2(K) (sub 0) was for the transfer function bound. A reduced state diagram of (2 (m sub 0) +1) is used for easy evaluation of transfer function bounds for partial-unit-memory codes.

Simulations of Hall reconnection in partially ionized plasmas

NASA Astrophysics Data System (ADS)

Innocenti, Maria Elena; Jiang, Wei; Lapenta, Giovanni

2017-04-01

Magnetic reconnection occurs in the Hall, partially ionized regime in environments as diverse as molecular clouds, protostellar disks and regions of the solar chromosphere. While much is known about Hall reconnection in fully ionized plasmas, Hall reconnection in partially ionized plasmas is, in comparison, still relatively unexplored. This notwithstanding the fact that partial ionization is expected to affect fundamental processes in reconnection such as the transition from the slow, fluid to the fast, kinetic regime, the value of the reconnection rate and the dimensions of the diffusion regions [Malyshkin and Zweibel 2011 , Zweibel et al. 2011]. We present here the first, to our knowledge, fully kinetic simulations of Hall reconnection in partially ionized plasmas. The interaction of electrons and ions with the neutral background is realistically modelled via a Monte Carlo plug-in coded into the semi-implicit, fully kinetic code iPic3D [Markidis 2010]. We simulate a plasma with parameters compatible with the MRX experiments illustrated in Zweibel et al. 2011 and Lawrence et al. 2013, to be able to compare our simulation results with actual experiments. The gas and ion temperature is T=3 eV, the ion to electron temperature ratio is Tr=0.44, ion and electron thermal velocities are calculated accordingly resorting to a reduced mass ratio and a reduced value of the speed of light to reduce the computational costs of the simulations. The initial density of the plasma is set at n= 1.1 1014 cm-3 and is then left free to change during the simulation as a result of gas-plasma interaction. A set of simulations with initial ionisation percentage IP= 0.01, 0.1, 0.2, 0.6 is presented and compared with a reference simulation where no background gas is present (full ionization). In this first set of simulations, we assume to be able to externally control the initial relative densities of gas and plasma. Within this parameter range, the ion but not the electron population is heavily affected by collisions with the neutrals. In line with experimental results, we observe reduction of the reconnection rate and no variation of the half-thickness of the ion diffusion region with decreasing IP (increasing gas density). Contrarily to the experiments, we can confidently state that these effects are not influenced by boundary constraints. We then provide an explanation for the behaviour observed.

Can poison control data be used for pharmaceutical poisoning surveillance?

PubMed

Naun, Christopher A; Olsen, Cody S; Dean, J Michael; Olson, Lenora M; Cook, Lawrence J; Keenan, Heather T

2011-05-01

To determine the association between the frequencies of pharmaceutical exposures reported to a poison control center (PCC) and those seen in the emergency department (ED). A statewide population-based retrospective comparison of frequencies of ED pharmaceutical poisonings with frequencies of pharmaceutical exposures reported to a regional PCC. ED poisonings, identified by International Classification of Diseases, Version 9 (ICD-9) codes, were grouped into substance categories. Using a reproducible algorithm facilitated by probabilistic linkage, codes from the PCC classification system were mapped into the same categories. A readily identifiable subset of PCC calls was selected for comparison. Correlations between frequencies of quarterly exposures by substance categories were calculated using Pearson correlation coefficients and partial correlation coefficients with adjustment for seasonality. PCC reported exposures correlated with ED poisonings in nine of 10 categories. Partial correlation coefficients (r(p)) indicated strong associations (r(p)>0.8) for three substance categories that underwent large changes in their incidences (opiates, benzodiazepines, and muscle relaxants). Six substance categories were moderately correlated (r(p)>0.6). One category, salicylates, showed no association. Limitations Imperfect overlap between ICD-9 and PCC codes may have led to miscategorization. Substances without changes in exposure frequency have inadequate variability to detect association using this method. PCC data are able to effectively identify trends in poisonings seen in EDs and may be useful as part of a pharmaceutical poisoning surveillance system. The authors developed an algorithm-driven technique for mapping American Association of Poison Control Centers codes to ICD-9 codes and identified a useful subset of poison control exposures for analysis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andrews, Nathan; Faucett, Christopher; Haskin, Troy Christopher

Following the conclusion of the first phase of the crosswalk analysis, one of the key unanswered questions was whether or not the deviations found would persist during a partially recovered accident scenario, similar to the one that occurred in TMI - 2. In particular this analysis aims to compare the impact of core degradation morphology on quenching models inherent within the two codes and the coolability of debris during partially recovered accidents. A primary motivation for this study is the development of insights into how uncertainties in core damage progression models impact the ability to assess the potential for recoverymore » of a degraded core. These quench and core recovery models are of the most interest when there is a significant amount of core damage, but intact and degraded fuel still remain in the cor e region or the lower plenum. Accordingly this analysis presents a spectrum of partially recovered accident scenarios by varying both water injection timing and rate to highlight the impact of core degradation phenomena on recovered accident scenarios. This analysis uses the newly released MELCOR 2.2 rev. 966 5 and MAAP5, Version 5.04. These code versions, which incorporate a significant number of modifications that have been driven by analyses and forensic evidence obtained from the Fukushima - Daiichi reactor site.« less

Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

PubMed

Kanai, T H; Ueda, S; Nakamura, T

2000-01-31

Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

Frequency Hopping, Multiple Frequency-Shift Keying, Coding, and Optimal Partial-Band Jamming.

DTIC Science & Technology

1982-08-01

receivers appropriate for these two strategies. Each receiver is noncoherent (a coherent receiver is generally impractical) and implements hard...Advances in Coding and Modulation for Noncoherent Channels Affected by Fading, Partial Band, and Multiple- . Access Interference, in A. J. Viterbi...Modulation for Noncoherent Channels Affected by Fading, Partial Band, and Multiple-Access interference, in A. J. Viterbi, ed., Advances in Coumunication

Comparative sequence analysis of acid sensitive/resistance proteins in Escherichia coli and Shigella flexneri

PubMed Central

Manikandan, Selvaraj; Balaji, Seetharaaman; Kumar, Anil; Kumar, Rita

2007-01-01

The molecular basis for the survival of bacteria under extreme conditions in which growth is inhibited is a question of great current interest. A preliminary study was carried out to determine residue pattern conservation among the antiporters of enteric bacteria, responsible for extreme acid sensitivity especially in Escherichia coli and Shigella flexneri. Here we found the molecular evidence that proved the relationship between E. coli and S. flexneri. Multiple sequence alignment of the gadC coded acid sensitive antiporter showed many conserved residue patterns at regular intervals at the N-terminal region. It was observed that as the alignment approaches towards the C-terminal, the number of conserved residues decreases, indicating that the N-terminal region of this protein has much active role when compared to the carboxyl terminal. The motif, FHLVFFLLLGG, is well conserved within the entire gadC coded protein at the amino terminal. The motif is also partially conserved among other antiporters (which are not coded by gadC) but involved in acid sensitive/resistance mechanism. Phylogenetic cluster analysis proves the relationship of Escherichia coli and Shigella flexneri. The gadC coded proteins are converged as a clade and diverged from other antiporters belongs to the amino acid-polyamine-organocation (APC) superfamily. PMID:21670792

Underwater partial polarization signatures from the shallow water real-time imaging polarimeter (SHRIMP)

NASA Astrophysics Data System (ADS)

Taylor, James S., Jr.; Davis, P. S.; Wolff, Lawrence B.

2003-09-01

Research has shown that naturally occurring light outdoors and underwater is partially linearly polarized. The polarized components can be combined to form an image that describes the polarization of the light in the scene. This image is known as the degree of linear polarization (DOLP) image or partial polarization image. These naturally occurring polarization signatures can provide a diver or an unmanned underwater vehicle (UUV) with more information to detect, classify, and identify threats such as obstacles and/or mines in the shallow water environment. The SHallow water Real-time IMaging Polarimeter (SHRIMP), recently developed under sponsorship of Dr. Tom Swean at the Office of Naval Research (Code 321OE), can measure underwater partial polarization imagery. This sensor is a passive, three-channel device that simultaneously measures the three components of the Stokes vector needed to determine the partial linear polarization of the scene. The testing of this sensor has been completed and the data has been analyzed. This paper presents performance results from the field-testing and quantifies the gain provided by the partial polarization signature of targets in the Very Shallow Water (VSW) and Surf Zone (SZ) regions.

The clinical and molecular spectrum of androgen insensitivity syndromes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hiort, O.; Sinnecker, G.H.G.; Holterhus, P.M.

1996-05-03

Androgen insensitivity syndromes (AIS) are due to end-organ resistance to androgenic steroids in males leading to defective virilization of the external genitalia. The phenotype encompasses a wide array of genital ambiguity and may range from completely female to undervirilized but unequivocally male with infertility. This disorder is caused by mutations of the androgen receptor and is an X-linked recessive trait. We have studied 47 patients with AIS and have characterized the underlying molecular abnormality in the androgen receptor gene. Twenty patients had complete AIS and twenty-seven had partial AIS. Of the latter, 11 were of predominantly female phenotypic appearance andmore » gender was assigned accordingly, while 16 were raised as males. Within the group of complete AIS, two patients had gross deletions within the gene, one had a small deletion, and one had an insertion. In the other patients with complete AIS, as well as all individuals with partial AIS, single nucleotide substitutions within the coding region were detected, each leading to an amino acid alteration. Seven codons were involved in more than one mutation in different cases. In addition, in one patient with spinal and bulbar muscular atrophy, an elongation of a glutamine-repeat was characterized. We conclude that mutations in the androgen receptor gene may be present throughout the whole coding region. However, our study provides evidence that several mutational hot spots exist. 18 refs., 2 figs.« less

Chromosomal localization and partial genomic structure of the human peroxisome proliferator activated receptor-gamma (hPPAR gamma) gene.

PubMed

Beamer, B A; Negri, C; Yen, C J; Gavrilova, O; Rumberger, J M; Durcan, M J; Yarnall, D P; Hawkins, A L; Griffin, C A; Burns, D K; Roth, J; Reitman, M; Shuldiner, A R

1997-04-28

We determined the chromosomal localization and partial genomic structure of the coding region of the human PPAR gamma gene (hPPAR gamma), a nuclear receptor important for adipocyte differentiation and function. Sequence analysis and long PCR of human genomic DNA with primers that span putative introns revealed that intron positions and sizes of hPPAR gamma are similar to those previously determined for the mouse PPAR gamma gene[13]. Fluorescent in situ hybridization localized hPPAR gamma to chromosome 3, band 3p25. Radiation hybrid mapping with two independent primer pairs was consistent with hPPAR gamma being within 1.5 Mb of marker D3S1263 on 3p25-p24.2. These sequences of the intron/exon junctions of the 6 coding exons shared by hPPAR gamma 1 and hPPAR gamma 2 will facilitate screening for possible mutations. Furthermore, D3S1263 is a suitable polymorphic marker for linkage analysis to evaluate PPAR gamma's potential contribution to genetic susceptibility to obesity, lipoatrophy, insulin resistance, and diabetes.

Performance of Low-Density Parity-Check Coded Modulation

NASA Astrophysics Data System (ADS)

Hamkins, J.

2011-02-01

This article presents the simulated performance of a family of nine AR4JA low-density parity-check (LDPC) codes when used with each of five modulations. In each case, the decoder inputs are codebit log-likelihood ratios computed from the received (noisy) modulation symbols using a general formula which applies to arbitrary modulations. Suboptimal soft-decision and hard-decision demodulators are also explored. Bit-interleaving and various mappings of bits to modulation symbols are considered. A number of subtle decoder algorithm details are shown to affect performance, especially in the error floor region. Among these are quantization dynamic range and step size, clipping degree-one variable nodes, "Jones clipping" of variable nodes, approximations of the min* function, and partial hard-limiting messages from check nodes. Using these decoder optimizations, all coded modulations simulated here are free of error floors down to codeword error rates below 10^{-6}. The purpose of generating this performance data is to aid system engineers in determining an appropriate code and modulation to use under specific power and bandwidth constraints, and to provide information needed to design a variable/adaptive coded modulation (VCM/ACM) system using the AR4JA codes. IPNPR Volume 42-185 Tagged File.txt

COMOC: Three dimensional boundary region variant, programmer's manual

NASA Technical Reports Server (NTRS)

Orzechowski, J. A.; Baker, A. J.

1974-01-01

The three-dimensional boundary region variant of the COMOC computer program system solves the partial differential equation system governing certain three-dimensional flows of a viscous, heat conducting, multiple-species, compressible fluid including combustion. The solution is established in physical variables, using a finite element algorithm for the boundary value portion of the problem description in combination with an explicit marching technique for the initial value character. The computational lattice may be arbitrarily nonregular, and boundary condition constraints are readily applied. The theoretical foundation of the algorithm, a detailed description on the construction and operation of the program, and instructions on utilization of the many features of the code are presented.

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

Semantic representations in the temporal pole predict false memories

PubMed Central

Chadwick, Martin J.; Anjum, Raeesa S.; Kumaran, Dharshan; Schacter, Daniel L.; Spiers, Hugo J.; Hassabis, Demis

2016-01-01

Recent advances in neuroscience have given us unprecedented insight into the neural mechanisms of false memory, showing that artificial memories can be inserted into the memory cells of the hippocampus in a way that is indistinguishable from true memories. However, this alone is not enough to explain how false memories can arise naturally in the course of our daily lives. Cognitive psychology has demonstrated that many instances of false memory, both in the laboratory and the real world, can be attributed to semantic interference. Whereas previous studies have found that a diverse set of regions show some involvement in semantic false memory, none have revealed the nature of the semantic representations underpinning the phenomenon. Here we use fMRI with representational similarity analysis to search for a neural code consistent with semantic false memory. We find clear evidence that false memories emerge from a similarity-based neural code in the temporal pole, a region that has been called the “semantic hub” of the brain. We further show that each individual has a partially unique semantic code within the temporal pole, and this unique code can predict idiosyncratic patterns of memory errors. Finally, we show that the same neural code can also predict variation in true-memory performance, consistent with an adaptive perspective on false memory. Taken together, our findings reveal the underlying structure of neural representations of semantic knowledge, and how this semantic structure can both enhance and distort our memories. PMID:27551087

Semantic representations in the temporal pole predict false memories.

PubMed

Chadwick, Martin J; Anjum, Raeesa S; Kumaran, Dharshan; Schacter, Daniel L; Spiers, Hugo J; Hassabis, Demis

2016-09-06

Recent advances in neuroscience have given us unprecedented insight into the neural mechanisms of false memory, showing that artificial memories can be inserted into the memory cells of the hippocampus in a way that is indistinguishable from true memories. However, this alone is not enough to explain how false memories can arise naturally in the course of our daily lives. Cognitive psychology has demonstrated that many instances of false memory, both in the laboratory and the real world, can be attributed to semantic interference. Whereas previous studies have found that a diverse set of regions show some involvement in semantic false memory, none have revealed the nature of the semantic representations underpinning the phenomenon. Here we use fMRI with representational similarity analysis to search for a neural code consistent with semantic false memory. We find clear evidence that false memories emerge from a similarity-based neural code in the temporal pole, a region that has been called the "semantic hub" of the brain. We further show that each individual has a partially unique semantic code within the temporal pole, and this unique code can predict idiosyncratic patterns of memory errors. Finally, we show that the same neural code can also predict variation in true-memory performance, consistent with an adaptive perspective on false memory. Taken together, our findings reveal the underlying structure of neural representations of semantic knowledge, and how this semantic structure can both enhance and distort our memories.

Clique-Based Neural Associative Memories with Local Coding and Precoding.

PubMed

Mofrad, Asieh Abolpour; Parker, Matthew G; Ferdosi, Zahra; Tadayon, Mohammad H

2016-08-01

Techniques from coding theory are able to improve the efficiency of neuroinspired and neural associative memories by forcing some construction and constraints on the network. In this letter, the approach is to embed coding techniques into neural associative memory in order to increase their performance in the presence of partial erasures. The motivation comes from recent work by Gripon, Berrou, and coauthors, which revisited Willshaw networks and presented a neural network with interacting neurons that partitioned into clusters. The model introduced stores patterns as small-size cliques that can be retrieved in spite of partial error. We focus on improving the success of retrieval by applying two techniques: doing a local coding in each cluster and then applying a precoding step. We use a slightly different decoding scheme, which is appropriate for partial erasures and converges faster. Although the ideas of local coding and precoding are not new, the way we apply them is different. Simulations show an increase in the pattern retrieval capacity for both techniques. Moreover, we use self-dual additive codes over field [Formula: see text], which have very interesting properties and a simple-graph representation.

The Complete Sequence of a Human Parainfluenzavirus 4 Genome

PubMed Central

Yea, Carmen; Cheung, Rose; Collins, Carol; Adachi, Dena; Nishikawa, John; Tellier, Raymond

2009-01-01

Although the human parainfluenza virus 4 (HPIV4) has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada). The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97%) with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized. PMID:21994536

Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

PubMed Central

Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

2006-01-01

Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

Widespread signatures of local mRNA folding structure selection in four Dengue virus serotypes

PubMed Central

2015-01-01

Background It is known that mRNA folding can affect and regulate various gene expression steps both in living organisms and in viruses. Previous studies have recognized functional RNA structures in the genome of the Dengue virus. However, these studies usually focused either on the viral untranslated regions or on very specific and limited regions at the beginning of the coding sequences, in a limited number of strains, and without considering evolutionary selection. Results Here we performed the first large scale comprehensive genomics analysis of selection for local mRNA folding strength in the Dengue virus coding sequences, based on a total of 1,670 genomes and 4 serotypes. Our analysis identified clusters of positions along the coding regions that may undergo a conserved evolutionary selection for strong or weak local folding maintained across different viral variants. Specifically, 53-66 clusters for strong folding and 49-73 clusters for weak folding (depending on serotype) aggregated of positions with a significant conservation of folding energy signals (related to partially overlapping local genomic regions) were recognized. In addition, up to 7% of these positions were found to be conserved in more than 90% of the viral genomes. Although some of the identified positions undergo frequent synonymous / non-synonymous substitutions, the selection for folding strength therein is preserved, and thus cannot be trivially explained based on sequence conservation alone. Conclusions The fact that many of the positions with significant folding related signals are conserved among different Dengue variants suggests that a better understanding of the mRNA structures in the corresponding regions may promote the development of prospective anti- Dengue vaccination strategies. The comparative genomics approach described here can be employed in the future for detecting functional regions in other pathogens with very high mutations rates. PMID:26449467

Spatially invariant coding of numerical information in functionally defined subregions of human parietal cortex.

PubMed

Eger, E; Pinel, P; Dehaene, S; Kleinschmidt, A

2015-05-01

Macaque electrophysiology has revealed neurons responsive to number in lateral (LIP) and ventral (VIP) intraparietal areas. Recently, fMRI pattern recognition revealed information discriminative of individual numbers in human parietal cortex but without precisely localizing the relevant sites or testing for subregions with different response profiles. Here, we defined the human functional equivalents of LIP (feLIP) and VIP (feVIP) using neurophysiologically motivated localizers. We applied multivariate pattern recognition to investigate whether both regions represent numerical information and whether number codes are position specific or invariant. In a delayed number comparison paradigm with laterally presented numerosities, parietal cortex discriminated between numerosities better than early visual cortex, and discrimination generalized across hemifields in parietal, but not early visual cortex. Activation patterns in the 2 parietal regions of interest did not differ in the coding of position-specific or position-independent number information, but in the expression of a numerical distance effect which was more pronounced in feLIP. Thus, the representation of number in parietal cortex is at least partially position invariant. Both feLIP and feVIP contain information about individual numerosities in humans, but feLIP hosts a coarser representation of numerosity than feVIP, compatible with either broader tuning or a summation code. © The Author 2013. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Strategic and Tactical Decision-Making Under Uncertainty

DTIC Science & Technology

2006-01-03

message passing algorithms. In recent work we applied this method to the problem of joint decoding of a low-density parity-check ( LDPC ) code and a partial...Joint Decoding of LDPC Codes and Partial-Response Channels." IEEE Transactions on Communications. Vol. 54, No. 7, 1149-1153, 2006. P. Pakzad and V...Michael I. Jordan PAGES U U U SAPR 20 19b. TELEPHONE NUMBER (Include area code ) 510/642-3806 Standard Form 298 (Rev. 8/98) Prescribed by ANSI Std. Z39.18

The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

1994-12-31

Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

Detonation Velocity Calculations of Explosives with Slowly-Burning Constituents

NASA Astrophysics Data System (ADS)

Howard, W. Michael; Souers, P. Clark; Fried, Laurence E.

1997-07-01

The thermochemical code Equilbrium CHEETAH has been modified to allow partial reaction of constituents and partial flow of heat. Solid or liquid reactants are described by Einstein oscillators, whose temperatures can be changed to allow heat transfer. Hydroxy-terminated-poly-budadiene, mixed with RDX or HMX, does not react, as shown by the effect on the calculated detonation velocity. Aluminum and ammonium perchlorate in composites also do not react. Only partial heat flow also takes place in the unreacted materials. These results show that the usual assumption of total burn in a thermochemical code is probably incorrect, at least in the sonic reaction zone that drives the detonation velocity. A kinetic code would be the logical extension of this work.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene

PubMed Central

Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281

Two-dimensional Radiative Magnetohydrodynamic Simulations of Partial Ionization in the Chromosphere. II. Dynamics and Energetics of the Low Solar Atmosphere

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martínez-Sykora, Juan; Pontieu, Bart De; Hansteen, Viggo H.

2017-09-20

We investigate the effects of interactions between ions and neutrals on the chromosphere and overlying corona using 2.5D radiative MHD simulations with the Bifrost code. We have extended the code capabilities implementing ion–neutral interaction effects using the generalized Ohm’s law, i.e., we include the Hall term and the ambipolar diffusion (Pedersen dissipation) in the induction equation. Our models span from the upper convection zone to the corona, with the photosphere, chromosphere, and transition region partially ionized. Our simulations reveal that the interactions between ionized particles and neutral particles have important consequences for the magnetothermodynamics of these modeled layers: (1) ambipolarmore » diffusion increases the temperature in the chromosphere; (2) sporadically the horizontal magnetic field in the photosphere is diffused into the chromosphere, due to the large ambipolar diffusion; (3) ambipolar diffusion concentrates electrical currents, leading to more violent jets and reconnection processes, resulting in (3a) the formation of longer and faster spicules, (3b) heating of plasma during the spicule evolution, and (3c) decoupling of the plasma and magnetic field in spicules. Our results indicate that ambipolar diffusion is a critical ingredient for understanding the magnetothermodynamic properties in the chromosphere and transition region. The numerical simulations have been made publicly available, similar to previous Bifrost simulations. This will allow the community to study realistic numerical simulations with a wider range of magnetic field configurations and physics modules than previously possible.« less

Two-dimensional Radiative Magnetohydrodynamic Simulations of Partial Ionization in the Chromosphere. II. Dynamics and Energetics of the Low Solar Atmosphere

NASA Astrophysics Data System (ADS)

Martínez-Sykora, Juan; De Pontieu, Bart; Carlsson, Mats; Hansteen, Viggo H.; Nóbrega-Siverio, Daniel; Gudiksen, Boris V.

2017-09-01

We investigate the effects of interactions between ions and neutrals on the chromosphere and overlying corona using 2.5D radiative MHD simulations with the Bifrost code. We have extended the code capabilities implementing ion-neutral interaction effects using the generalized Ohm’s law, I.e., we include the Hall term and the ambipolar diffusion (Pedersen dissipation) in the induction equation. Our models span from the upper convection zone to the corona, with the photosphere, chromosphere, and transition region partially ionized. Our simulations reveal that the interactions between ionized particles and neutral particles have important consequences for the magnetothermodynamics of these modeled layers: (1) ambipolar diffusion increases the temperature in the chromosphere; (2) sporadically the horizontal magnetic field in the photosphere is diffused into the chromosphere, due to the large ambipolar diffusion; (3) ambipolar diffusion concentrates electrical currents, leading to more violent jets and reconnection processes, resulting in (3a) the formation of longer and faster spicules, (3b) heating of plasma during the spicule evolution, and (3c) decoupling of the plasma and magnetic field in spicules. Our results indicate that ambipolar diffusion is a critical ingredient for understanding the magnetothermodynamic properties in the chromosphere and transition region. The numerical simulations have been made publicly available, similar to previous Bifrost simulations. This will allow the community to study realistic numerical simulations with a wider range of magnetic field configurations and physics modules than previously possible.

Complete mitochondrial genome of the versicoloured emerald hummingbird Amazilia versicolor, a polymorphic species.

PubMed

Prosdocimi, Francisco; Souto, Helena Magarinos; Ruschi, Piero Angeli; Furtado, Carolina; Jennings, W Bryan

2016-09-01

The genome of the versicoloured emerald hummingbird (Amazilia versicolor) was partially sequenced in one-sixth of an Illumina HiSeq lane. The mitochondrial genome was assembled using MIRA and MITObim software, yielding a circular molecule of 16,861 bp in length and deposited in GenBank under the accession number KF624601. The mitogenome contained 13 protein-coding genes, 22 transfer tRNAs, 2 ribosomal RNAs and 1 non-coding control region. The molecule was assembled using 21,927 sequencing reads of 100 bp each, resulting in ∼130 × coverage of uniformly distributed reads along the genome. This is the forth mitochondrial genome described for this highly diverse family of birds and may benefit further phylogenetic, phylogeographic, population genetic and species delimitation studies of hummingbirds.

Ideal form of optical plasma lenses

NASA Astrophysics Data System (ADS)

Gordon, D. F.; Stamm, A. B.; Hafizi, B.; Johnson, L. A.; Kaganovich, D.; Hubbard, R. F.; Richardson, A. S.; Zhigunov, D.

2018-06-01

The canonical form of an optical plasma lens is a parabolic density channel. This form suffers from spherical aberrations, among others. Spherical aberration is partially corrected by adding a quartic term to the radial density profile. Ideal forms which lead to perfect focusing or imaging are obtained. The fields at the focus of a strong lens are computed with high accuracy and efficiency using a combination of eikonal and full Maxwell descriptions of the radiation propagation. The calculations are performed using a new computer propagation code, SeaRay, which is designed to transition between various solution methods as the beam propagates through different spatial regions. The calculations produce the full Maxwell vector fields in the focal region.

The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

PubMed

Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

2018-05-17

Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Analysis of CHRNA7 rare variants in autism spectrum disorder susceptibility.

PubMed

Bacchelli, Elena; Battaglia, Agatino; Cameli, Cinzia; Lomartire, Silvia; Tancredi, Raffaella; Thomson, Susanne; Sutcliffe, James S; Maestrini, Elena

2015-04-01

Chromosome 15q13.3 recurrent microdeletions are causally associated with a wide range of phenotypes, including autism spectrum disorder (ASD), seizures, intellectual disability, and other psychiatric conditions. Whether the reciprocal microduplication is pathogenic is less certain. CHRNA7, encoding for the alpha7 subunit of the neuronal nicotinic acetylcholine receptor, is considered the likely culprit gene in mediating neurological phenotypes in 15q13.3 deletion cases. To assess if CHRNA7 rare variants confer risk to ASD, we performed copy number variant analysis and Sanger sequencing of the CHRNA7 coding sequence in a sample of 135 ASD cases. Sequence variation in this gene remains largely unexplored, given the existence of a fusion gene, CHRFAM7A, which includes a nearly identical partial duplication of CHRNA7. Hence, attempts to sequence coding exons must distinguish between CHRNA7 and CHRFAM7A, making next-generation sequencing approaches unreliable for this purpose. A CHRNA7 microduplication was detected in a patient with autism and moderate cognitive impairment; while no rare damaging variants were identified in the coding region, we detected rare variants in the promoter region, previously described to functionally reduce transcription. This study represents the first sequence variant analysis of CHRNA7 in a sample of idiopathic autism. © 2015 Wiley Periodicals, Inc.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Speed-dependent collision effects on radar back-scattering from the ionosphere

NASA Technical Reports Server (NTRS)

Theimer, O.

1981-01-01

A computer code to accurately compute the fluctuation spectrum for linearly speed dependent collision frequencies was developed. The effect of ignoring the speed dependence on the estimates of ionospheric parameters was determined. It is shown that disagreements between the rocket and the incoherent scatter estimates could be partially resolved if the correct speed dependence of the i-n collision frequency is not ignored. This problem is also relevant to the study of ionospheric irregularities in the auroral E-region and their effects on the radio communication with satellites.

Hidden Genetic Variation in LCA9-Associated Congenital Blindness Explained by 5'UTR Mutations and Copy-Number Variations of NMNAT1.

PubMed

Coppieters, Frauke; Todeschini, Anne Laure; Fujimaki, Takuro; Baert, Annelot; De Bruyne, Marieke; Van Cauwenbergh, Caroline; Verdin, Hannah; Bauwens, Miriam; Ongenaert, Maté; Kondo, Mineo; Meire, Françoise; Murakami, Akira; Veitia, Reiner A; Leroy, Bart P; De Baere, Elfride

2015-12-01

Leber congenital amaurosis (LCA) is a severe autosomal-recessive retinal dystrophy leading to congenital blindness. A recently identified LCA gene is NMNAT1, located in the LCA9 locus. Although most mutations in blindness genes are coding variations, there is accumulating evidence for hidden noncoding defects or structural variations (SVs). The starting point of this study was an LCA9-associated consanguineous family in which no coding mutations were found in the LCA9 region. Exploring the untranslated regions of NMNAT1 revealed a novel homozygous 5'UTR variant, c.-70A>T. Moreover, an adjacent 5'UTR variant, c.-69C>T, was identified in a second consanguineous family displaying a similar phenotype. Both 5'UTR variants resulted in decreased NMNAT1 mRNA abundance in patients' lymphocytes, and caused decreased luciferase activity in human retinal pigment epithelial RPE-1 cells. Second, we unraveled pseudohomozygosity of a coding NMNAT1 mutation in two unrelated LCA patients by the identification of two distinct heterozygous partial NMNAT1 deletions. Molecular characterization of the breakpoint junctions revealed a complex Alu-rich genomic architecture. Our study uncovered hidden genetic variation in NMNAT1-associated LCA and emphasized a shift from coding to noncoding regulatory mutations and repeat-mediated SVs in the molecular pathogenesis of heterogeneous recessive disorders such as hereditary blindness. © 2015 The Authors. **Human Mutation published by Wiley Periodicals, Inc.

24 CFR 200.926c - Model code provisions for use in partially accepted code jurisdictions.

Code of Federal Regulations, 2014 CFR

2014-04-01

... jurisdictions. If a lender or other interested party is notified that a State or local building code has been... in accordance with the applicable State or local building code, plus those additional requirements... 24 Housing and Urban Development 2 2014-04-01 2014-04-01 false Model code provisions for use in...

24 CFR 200.926c - Model code provisions for use in partially accepted code jurisdictions.

Code of Federal Regulations, 2013 CFR

2013-04-01

... jurisdictions. If a lender or other interested party is notified that a State or local building code has been... in accordance with the applicable State or local building code, plus those additional requirements... 24 Housing and Urban Development 2 2013-04-01 2013-04-01 false Model code provisions for use in...

24 CFR 200.926c - Model code provisions for use in partially accepted code jurisdictions.

Code of Federal Regulations, 2012 CFR

2012-04-01

... jurisdictions. If a lender or other interested party is notified that a State or local building code has been... in accordance with the applicable State or local building code, plus those additional requirements... 24 Housing and Urban Development 2 2012-04-01 2012-04-01 false Model code provisions for use in...

Analysis of the complete genome of the first Irkut virus isolate from China: comparison across the Lyssavirus genus.

PubMed

Liu, Ye; Li, Nan; Zhang, Shoufeng; Zhang, Fei; Lian, Hai; Wang, Ying; Zhang, Jinxia; Hu, Rongliang

2013-12-01

The genome of Irkut virus, isolate IRKV-THChina12, the first non-rabies lyssavirus from China (of bat origin), has been completely sequenced. In general, coding and non-coding regions of this viral genome are similar to those of other lyssaviruses. However, alignment of the deduced amino acid sequences of the structural proteins of IRKV-THChina12 with those of other lyssavirus representatives revealed significant variability between viral species. The nucleoprotein and matrix protein were found to be the most conserved, followed by the large protein, glycoprotein and phosphoprotein. Differences in the antigenic sites in glycoprotein may result in only partial protection of the available rabies biologics against Irkut virus, which is of particular concern for pre- and post-exposure rabies prophylaxis. Copyright © 2013 Elsevier Inc. All rights reserved.

Police accident report forms: safety device coding and enacted laws.

PubMed

Brock, K; Lapidus, G

2008-12-01

Safety device coding on state police accident report (PAR) forms was compared with provisions in state traffic safety laws. PAR forms were obtained from all 50 states and the District of Columbia (states/DC). For seat belts, 22 states/DC had a primary seat belt enforcement law vs 50 with a PAR code. For car seats, all 51 states/DC had a law and a PAR code. For booster seats, 39 states/DC had a law vs nine with a PAR code. For motorcycle helmets, 21 states/DC had an all-age rider helmet law and another 26 a partial-age law vs 50 with a PAR code. For bicycle helmets, 21 states/DC had a partial-age rider helmet law vs 48 with a PAR code. Therefore gaps in the ability of states to fully record accident data reflective of existing state traffic safety laws are revealed. Revising the PAR forms in all states to include complete variables for safety devices should be an important priority, independent of the laws.

Cluster Analysis of Rat Olfactory Bulb Responses to Diverse Odorants

PubMed Central

Falasconi, Matteo; Leon, Michael; Johnson, Brett A.; Marco, Santiago

2012-01-01

In an effort to deepen our understanding of mammalian olfactory coding, we have used an objective method to analyze a large set of odorant-evoked activity maps collected systematically across the rat olfactory bulb to determine whether such an approach could identify specific glomerular regions that are activated by related odorants. To that end, we combined fuzzy c-means clustering methods with a novel validity approach based on cluster stability to evaluate the significance of the fuzzy partitions on a data set of glomerular layer responses to a large diverse group of odorants. Our results confirm the existence of glomerular response clusters to similar odorants. They further indicate a partial hierarchical chemotopic organization wherein larger glomerular regions can be subdivided into smaller areas that are rather specific in their responses to particular functional groups of odorants. These clusters bear many similarities to, as well as some differences from, response domains previously proposed for the glomerular layer of the bulb. These data also provide additional support for the concept of an identity code in the mammalian olfactory system. PMID:22459165

Coding For Compression Of Low-Entropy Data

NASA Technical Reports Server (NTRS)

Yeh, Pen-Shu

1994-01-01

Improved method of encoding digital data provides for efficient lossless compression of partially or even mostly redundant data from low-information-content source. Method of coding implemented in relatively simple, high-speed arithmetic and logic circuits. Also increases coding efficiency beyond that of established Huffman coding method in that average number of bits per code symbol can be less than 1, which is the lower bound for Huffman code.

Partial Adaptation of Obtained and Observed Value Signals Preserves Information about Gains and Losses

PubMed Central

Baddeley, Michelle; Tobler, Philippe N.; Schultz, Wolfram

2016-01-01

Given that the range of rewarding and punishing outcomes of actions is large but neural coding capacity is limited, efficient processing of outcomes by the brain is necessary. One mechanism to increase efficiency is to rescale neural output to the range of outcomes expected in the current context, and process only experienced deviations from this expectation. However, this mechanism comes at the cost of not being able to discriminate between unexpectedly low losses when times are bad versus unexpectedly high gains when times are good. Thus, too much adaptation would result in disregarding information about the nature and absolute magnitude of outcomes, preventing learning about the longer-term value structure of the environment. Here we investigate the degree of adaptation in outcome coding brain regions in humans, for directly experienced outcomes and observed outcomes. We scanned participants while they performed a social learning task in gain and loss blocks. Multivariate pattern analysis showed two distinct networks of brain regions adapt to the most likely outcomes within a block. Frontostriatal areas adapted to directly experienced outcomes, whereas lateral frontal and temporoparietal regions adapted to observed social outcomes. Critically, in both cases, adaptation was incomplete and information about whether the outcomes arose in a gain block or a loss block was retained. Univariate analysis confirmed incomplete adaptive coding in these regions but also detected nonadapting outcome signals. Thus, although neural areas rescale their responses to outcomes for efficient coding, they adapt incompletely and keep track of the longer-term incentives available in the environment. SIGNIFICANCE STATEMENT Optimal value-based choice requires that the brain precisely and efficiently represents positive and negative outcomes. One way to increase efficiency is to adapt responding to the most likely outcomes in a given context. However, too strong adaptation would result in loss of precise representation (e.g., when the avoidance of a loss in a loss-context is coded the same as receipt of a gain in a gain-context). We investigated an intermediate form of adaptation that is efficient while maintaining information about received gains and avoided losses. We found that frontostriatal areas adapted to directly experienced outcomes, whereas lateral frontal and temporoparietal regions adapted to observed social outcomes. Importantly, adaptation was intermediate, in line with influential models of reference dependence in behavioral economics. PMID:27683899

Multiple copies of a bile acid-inducible gene in Eubacterium sp. strain VPI 12708.

PubMed Central

Gopal-Srivastava, R; Mallonee, D H; White, W B; Hylemon, P B

1990-01-01

Eubacterium sp. strain VPI 12708 is an anaerobic intestinal bacterium which possesses inducible bile acid 7-dehydroxylation activity. Several new polypeptides are produced in this strain following induction with cholic acid. Genes coding for two copies of a bile acid-inducible 27,000-dalton polypeptide (baiA1 and baiA2) have been previously cloned and sequenced. We now report on a gene coding for a third copy of this 27,000-dalton polypeptide (baiA3). The baiA3 gene has been cloned in lambda DASH on an 11.2-kilobase DNA fragment from a partial Sau3A digest of the Eubacterium DNA. DNA sequence analysis of the baiA3 gene revealed 100% homology with the baiA1 gene within the coding region of the 27,000-dalton polypeptides. The baiA2 gene shares 81% sequence identity with the other two genes at the nucleotide level. The flanking nucleotide sequences associated with the baiA1 and baiA3 genes are identical for 930 bases in the 5' direction from the initiation codon and for at least 325 bases in the 3' direction from the stop codon, including the putative promoter regions for the genes. An additional open reading frame (occupying from 621 to 648 bases, depending on the correct start codon) was found in the identical 5' regions associated with the baiA1 and baiA3 clones. The 5' sequence 930 bases upstream from the baiA1 and baiA3 genes was totally divergent. The baiA2 gene, which is part of a large bile acid-inducible operon, showed no homology with the other two genes either in the 5' or 3' direction from the polypeptide coding region, except for a 15-base-pair presumed ribosome-binding site in the 5' region. These studies strongly suggest that a gene duplication (baiA1 and baiA3) has occurred and is stably maintained in this bacterium. Images PMID:2376563

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerr, J.M.; Fisher, L.W.; Termine, J.D.

The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less

Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

PubMed Central

Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

2015-01-01

Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

Fast gravity, gravity partials, normalized gravity, gravity gradient torque and magnetic field: Derivation, code and data

NASA Technical Reports Server (NTRS)

Gottlieb, Robert G.

1993-01-01

Derivation of first and second partials of the gravitational potential is given in both normalized and unnormalized form. Two different recursion formulas are considered. Derivation of a general gravity gradient torque algorithm which uses the second partial of the gravitational potential is given. Derivation of the geomagnetic field vector is given in a form that closely mimics the gravitational algorithm. Ada code for all algorithms that precomputes all possible data is given. Test cases comparing the new algorithms with previous data are given, as well as speed comparisons showing the relative efficiencies of the new algorithms.

Genomic clones for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kott, M.; Venta, P.J.; Larsen, J.

1987-05-01

A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Multiplexed pyrosequencing of nine sea anemone (Cnidaria: Anthozoa: Hexacorallia: Actiniaria) mitochondrial genomes.

PubMed

Foox, Jonathan; Brugler, Mercer; Siddall, Mark Edward; Rodríguez, Estefanía

2016-07-01

Six complete and three partial actiniarian mitochondrial genomes were amplified in two semi-circles using long-range PCR and pyrosequenced in a single run on a 454 GS Junior, doubling the number of complete mitogenomes available within the order. Typical metazoan mtDNA features included circularity, 13 protein-coding genes, 2 ribosomal RNA genes, and length ranging from 17,498 to 19,727 bp. Several typical anthozoan mitochondrial genome features were also observed including the presence of only two transfer RNA genes, elevated A + T richness ranging from 54.9 to 62.4%, large intergenic regions, and group 1 introns interrupting NADH dehydrogenase subunit 5 and cytochrome c oxidase subunit I, the latter of which possesses a homing endonuclease gene. Within the sea anemone Alicia sansibarensis, we report the first mitochondrial gene order rearrangement within the Actiniaria, as well as putative novel non-canonical protein-coding genes. Phylogenetic analyses of all 13 protein-coding and 2 ribosomal genes largely corroborated current hypotheses of sea anemone interrelatedness, with a few lower-level differences.

Measurements of angular flux on surface of Li/sub 2/O slab assemblies and their analysis by a direct integration transport code ''BERMUDA''

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maekawa, H.; Oyama, Y.

1983-09-01

Angle-dependent neutron leakage spectra above 0.5 MeV from Li/sub 2/O slab assemblies were measured accurately by the time-of-flight method. The measured angles were 0/sup 0/, 12.2/sup 0/, 24.9/sup 0/, 41.8/sup 0/ and 66.8/sup 0/. The sizes of Li/sub 2/O assemblies were 31.4 cm in equivalent radius and 5.06, 20.24 and 40.48 cm in thickness. The data were analyzed by a new transport code ''BERMUDA-2DN''. Time-independent transport equation is solved for two-dimensional, cylindrical, multi-regional geometry using the direct integration method in a multi-group model. The group transfer kernels are accurately obtained from the double-differential cross section data without using Legendre expansion.more » The results were compared absolutely. While there exist discrepancies partially, the calculational spectra agree well with the experimental ones as a whole. The BERMUDA code was demonstrated to be useful for the analyses of the fusion neutronics and shielding.« less

Partial Picture Effects on Children's Memory for Sentences Containing Implicit Information.

ERIC Educational Resources Information Center

Miller, Gloria E.; Pressley, Michael

1987-01-01

Two experiments were conducted examining the effects of partial picture adjuncts on young children's coding of information implied in sentences. Developmental differences were found in whether (l) partial pictures facilitated inferencing and (2) pictures containing information not explicitly stated in sentences promoted cue recall of the…

24 CFR 200.926 - Minimum property standards for one and two family dwellings.

Code of Federal Regulations, 2012 CFR

2012-04-01

... property is to be located. (c) Standard for evaluating local or state building codes. The Secretary shall compare a local building code submitted under paragraph (d) of this section or a State code to the list of... each area and subarea on the list. (2) A State or local building code will be partially accepted if it...

24 CFR 200.926 - Minimum property standards for one and two family dwellings.

Code of Federal Regulations, 2014 CFR

2014-04-01

... property is to be located. (c) Standard for evaluating local or state building codes. The Secretary shall compare a local building code submitted under paragraph (d) of this section or a State code to the list of... each area and subarea on the list. (2) A State or local building code will be partially accepted if it...

24 CFR 200.926 - Minimum property standards for one and two family dwellings.

Code of Federal Regulations, 2013 CFR

2013-04-01

... property is to be located. (c) Standard for evaluating local or state building codes. The Secretary shall compare a local building code submitted under paragraph (d) of this section or a State code to the list of... each area and subarea on the list. (2) A State or local building code will be partially accepted if it...

An improved algorithm for evaluating trellis phase codes

NASA Technical Reports Server (NTRS)

Mulligan, M. G.; Wilson, S. G.

1982-01-01

A method is described for evaluating the minimum distance parameters of trellis phase codes, including CPFSK, partial response FM, and more importantly, coded CPM (continuous phase modulation) schemes. The algorithm provides dramatically faster execution times and lesser memory requirements than previous algorithms. Results of sample calculations and timing comparisons are included.

An improved algorithm for evaluating trellis phase codes

NASA Technical Reports Server (NTRS)

Mulligan, M. G.; Wilson, S. G.

1984-01-01

A method is described for evaluating the minimum distance parameters of trellis phase codes, including CPFSK, partial response FM, and more importantly, coded CPM (continuous phase modulation) schemes. The algorithm provides dramatically faster execution times and lesser memory requirements than previous algorithms. Results of sample calculations and timing comparisons are included.

Magnetic Feature Tracking in the SDO Era: Past Sacrifices, Recent Advances, and Future Possibilities

NASA Astrophysics Data System (ADS)

Lamb, D. A.; DeForest, C. E.; Van Kooten, S.

2014-12-01

When implementing computer vision codes, a common reaction to the high angular resolution and the high cadence of SDO's image products has been to reduce the resolution and cadence of the data so that it "looks like" SOHO data. This can be partially justified on physical grounds: if the phenomenon that a computer vision code is trying to detect was characterized in low-resolution, low cadence data, then the higher quality data may not be needed. But sacrificing at least two, and sometimes all four main advantages of SDO's imaging data (the other two being a higher duty cycle and additional data products) threatens to also discard the perhaps more subtle discoveries waiting to be made: a classic baby-with-the-bath-water situation. In this presentation, we discuss some of the sacrifices made in implementing SWAMIS-EF, an automatic emerging magnetic flux region detection code for SDO/HMI, and how those sacrifices simultaneously simplified and complicated development of the code. SWAMIS-EF is a feature-finding code, and we will describe some situations and analyses in which a feature-finding code excels, and some in which a different type of algorithm may produce more favorable results. In particular, because the solar magnetic field is irreducibly complex at the currently observed spatial scales, searching for phenomena such as flux emergence using even semi-strict physical criteria often leads to large numbers of false or missed detections. This undesirable behavior can be mitigated by relaxing the imposed physical criteria, but here too there are tradeoffs: decreased numbers of missed detections may increase the number of false detections if the selection criteria are not both sensitive and specific to the searched-for phenomenon. Finally, we describe some recent steps we have taken to overcome these obstacles, by fully embracing the high resolution, high cadence SDO data, optimizing and partially parallelizing our existing code as a first step to allow fast magnetic feature tracking of full resolution HMI magnetograms. Even with the above caveats, if used correctly such a tool can provide a wealth of information on the positions, motions, and patterns of features, enabling large, cross-scale analyses that can answer important questions related to the solar dynamo and to coronal heating.

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae).

PubMed

Pan, Hong-Chun; Fang, Hong-Yan; Li, Shi-Wei; Liu, Jun-Hong; Wang, Ying; Wang, An-Tai

2014-12-01

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae) is composed of two linear DNA molecules. The mitochondrial DNA (mtDNA) molecule 1 is 8010 bp long and contains six protein-coding genes, large subunit rRNA, methionine and tryptophan tRNAs, two pseudogenes consisting respectively of a partial copy of COI, and terminal sequences at two ends of the linear mtDNA, while the mtDNA molecule 2 is 7576 bp long and contains seven protein-coding genes, small subunit rRNA, methionine tRNA, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mtDNA. COI gene begins with GTG as start codon, whereas other 12 protein-coding genes start with a typical ATG initiation codon. In addition, all protein-coding genes are terminated with TAA as stop codon.

Nebo: An efficient, parallel, and portable domain-specific language for numerically solving partial differential equations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Earl, Christopher; Might, Matthew; Bagusetty, Abhishek

This study presents Nebo, a declarative domain-specific language embedded in C++ for discretizing partial differential equations for transport phenomena on multiple architectures. Application programmers use Nebo to write code that appears sequential but can be run in parallel, without editing the code. Currently Nebo supports single-thread execution, multi-thread execution, and many-core (GPU-based) execution. With single-thread execution, Nebo performs on par with code written by domain experts. With multi-thread execution, Nebo can linearly scale (with roughly 90% efficiency) up to 12 cores, compared to its single-thread execution. Moreover, Nebo’s many-core execution can be over 140x faster than its single-thread execution.

Nebo: An efficient, parallel, and portable domain-specific language for numerically solving partial differential equations

DOE PAGES

Earl, Christopher; Might, Matthew; Bagusetty, Abhishek; ...

2016-01-26

This study presents Nebo, a declarative domain-specific language embedded in C++ for discretizing partial differential equations for transport phenomena on multiple architectures. Application programmers use Nebo to write code that appears sequential but can be run in parallel, without editing the code. Currently Nebo supports single-thread execution, multi-thread execution, and many-core (GPU-based) execution. With single-thread execution, Nebo performs on par with code written by domain experts. With multi-thread execution, Nebo can linearly scale (with roughly 90% efficiency) up to 12 cores, compared to its single-thread execution. Moreover, Nebo’s many-core execution can be over 140x faster than its single-thread execution.

A volcanic activity alert-level system for aviation: Review of its development and application in Alaska

USGS Publications Warehouse

Guffanti, Marianne C.; Miller, Thomas

2013-01-01

An alert-level system for communicating volcano hazard information to the aviation industry was devised by the Alaska Volcano Observatory (AVO) during the 1989–1990 eruption of Redoubt Volcano. The system uses a simple, color-coded ranking that focuses on volcanic ash emissions: Green—normal background; Yellow—signs of unrest; Orange—precursory unrest or minor ash eruption; Red—major ash eruption imminent or underway. The color code has been successfully applied on a regional scale in Alaska for a sustained period. During 2002–2011, elevated color codes were assigned by AVO to 13 volcanoes, eight of which erupted; for that decade, one or more Alaskan volcanoes were at Yellow on 67 % of days and at Orange or Red on 12 % of days. As evidence of its utility, the color code system is integrated into procedures of agencies responsible for air-traffic management and aviation meteorology in Alaska. Furthermore, it is endorsed as a key part of globally coordinated protocols established by the International Civil Aviation Organization to provide warnings of ash hazards to aviation worldwide. The color code and accompanying structured message (called a Volcano Observatory Notice for Aviation) comprise an effective early-warning message system according to the United Nations International Strategy for Disaster Reduction. The aviation color code system currently is used in the United States, Russia, New Zealand, Iceland, and partially in the Philippines, Papua New Guinea, and Indonesia. Although there are some barriers to implementation, with continued education and outreach to Volcano Observatories worldwide, greater use of the aviation color code system is achievable.

A volcanic activity alert-level system for aviation: review of its development and application in Alaska

USGS Publications Warehouse

Guffanti, Marianne; Miller, Thomas P.

2013-01-01

An alert-level system for communicating volcano hazard information to the aviation industry was devised by the Alaska Volcano Observatory (AVO) during the 1989–1990 eruption of Redoubt Volcano. The system uses a simple, color-coded ranking that focuses on volcanic ash emissions: Green—normal background; Yellow—signs of unrest; Orange—precursory unrest or minor ash eruption; Red—major ash eruption imminent or underway. The color code has been successfully applied on a regional scale in Alaska for a sustained period. During 2002–2011, elevated color codes were assigned by AVO to 13 volcanoes, eight of which erupted; for that decade, one or more Alaskan volcanoes were at Yellow on 67 % of days and at Orange or Red on 12 % of days. As evidence of its utility, the color code system is integrated into procedures of agencies responsible for air-traffic management and aviation meteorology in Alaska. Furthermore, it is endorsed as a key part of globally coordinated protocols established by the International Civil Aviation Organization to provide warnings of ash hazards to aviation worldwide. The color code and accompanying structured message (called a Volcano Observatory Notice for Aviation) comprise an effective early-warning message system according to the United Nations International Strategy for Disaster Reduction. The aviation color code system currently is used in the United States, Russia, New Zealand, Iceland, and partially in the Philippines, Papua New Guinea, and Indonesia. Although there are some barriers to implementation, with continued education and outreach to Volcano Observatories worldwide, greater use of the aviation color code system is achievable.

Methodology for fast detection of false sharing in threaded scientific codes

DOEpatents

Chung, I-Hsin; Cong, Guojing; Murata, Hiroki; Negishi, Yasushi; Wen, Hui-Fang

2014-11-25

A profiling tool identifies a code region with a false sharing potential. A static analysis tool classifies variables and arrays in the identified code region. A mapping detection library correlates memory access instructions in the identified code region with variables and arrays in the identified code region while a processor is running the identified code region. The mapping detection library identifies one or more instructions at risk, in the identified code region, which are subject to an analysis by a false sharing detection library. A false sharing detection library performs a run-time analysis of the one or more instructions at risk while the processor is re-running the identified code region. The false sharing detection library determines, based on the performed run-time analysis, whether two different portions of the cache memory line are accessed by the generated binary code.

Adaptive partially hidden Markov models with application to bilevel image coding.

PubMed

Forchhammer, S; Rasmussen, T S

1999-01-01

Partially hidden Markov models (PHMMs) have previously been introduced. The transition and emission/output probabilities from hidden states, as known from the HMMs, are conditioned on the past. This way, the HMM may be applied to images introducing the dependencies of the second dimension by conditioning. In this paper, the PHMM is extended to multiple sequences with a multiple token version and adaptive versions of PHMM coding are presented. The different versions of the PHMM are applied to lossless bilevel image coding. To reduce and optimize the model cost and size, the contexts are organized in trees and effective quantization of the parameters is introduced. The new coding methods achieve results that are better than the JBIG standard on selected test images, although at the cost of increased complexity. By the minimum description length principle, the methods presented for optimizing the code length may apply as guidance for training (P)HMMs for, e.g., segmentation or recognition purposes. Thereby, the PHMM models provide a new approach to image modeling.

The Use of Coding Methods to Estimate the Social Behavior Directed toward Peers and Adults of Preschoolers with ASD in TEACCH, LEAP, and Eclectic ''BAU'' Classrooms

ERIC Educational Resources Information Center

Sam, Ann; Reszka, Stephanie; Odom, Samuel; Hume, Kara; Boyd, Brian

2015-01-01

Momentary time sampling, partial-interval recording, and event coding are observational coding methods commonly used to examine the social and challenging behaviors of children at risk for or with developmental delays or disabilities. Yet there is limited research comparing the accuracy of and relationship between these three coding methods. By…

Low Diversity in the Mitogenome of Sperm Whales Revealed by Next-Generation Sequencing

PubMed Central

Alexander, Alana; Steel, Debbie; Slikas, Beth; Hoekzema, Kendra; Carraher, Colm; Parks, Matthew; Cronn, Richard; Baker, C. Scott

2013-01-01

Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20 mitogenomes from 17 sperm whales representative of worldwide diversity using Next Generation Sequencing (NGS) technologies (Illumina GAIIx, Roche 454 GS Junior). Resequencing of three individuals with both NGS platforms and partial Sanger sequencing showed low discrepancy rates (454-Illumina: 0.0071%; Sanger-Illumina: 0.0034%; and Sanger-454: 0.0023%) confirming suitability of both NGS platforms for investigating low mitogenomic diversity. Using the 17 sperm whale mitogenomes in a phylogenetic reconstruction with 41 other species, including 11 new dolphin mitogenomes, we tested two hypotheses for the low CR diversity. First, the hypothesis that CR-specific constraints have reduced diversity solely in the CR was rejected as diversity was low throughout the mitogenome, not just in the CR (overall diversity π = 0.096%; protein-coding 3rd codon = 0.22%; CR = 0.35%), and CR phylogenetic signal was congruent with protein-coding regions. Second, the hypothesis that slow substitution rates reduced diversity throughout the sperm whale mitogenome was rejected as sperm whales had significantly higher rates of CR evolution and no evidence of slow coding region evolution relative to other cetaceans. The estimated time to most recent common ancestor for sperm whale mitogenomes was 72,800 to 137,400 years ago (95% highest probability density interval), consistent with previous hypotheses of a bottleneck or selective sweep as likely causes of low mitogenome diversity. PMID:23254394

Low diversity in the mitogenome of sperm whales revealed by next-generation sequencing.

PubMed

Alexander, Alana; Steel, Debbie; Slikas, Beth; Hoekzema, Kendra; Carraher, Colm; Parks, Matthew; Cronn, Richard; Baker, C Scott

2013-01-01

Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20 mitogenomes from 17 sperm whales representative of worldwide diversity using Next Generation Sequencing (NGS) technologies (Illumina GAIIx, Roche 454 GS Junior). Resequencing of three individuals with both NGS platforms and partial Sanger sequencing showed low discrepancy rates (454-Illumina: 0.0071%; Sanger-Illumina: 0.0034%; and Sanger-454: 0.0023%) confirming suitability of both NGS platforms for investigating low mitogenomic diversity. Using the 17 sperm whale mitogenomes in a phylogenetic reconstruction with 41 other species, including 11 new dolphin mitogenomes, we tested two hypotheses for the low CR diversity. First, the hypothesis that CR-specific constraints have reduced diversity solely in the CR was rejected as diversity was low throughout the mitogenome, not just in the CR (overall diversity π = 0.096%; protein-coding 3rd codon = 0.22%; CR = 0.35%), and CR phylogenetic signal was congruent with protein-coding regions. Second, the hypothesis that slow substitution rates reduced diversity throughout the sperm whale mitogenome was rejected as sperm whales had significantly higher rates of CR evolution and no evidence of slow coding region evolution relative to other cetaceans. The estimated time to most recent common ancestor for sperm whale mitogenomes was 72,800 to 137,400 years ago (95% highest probability density interval), consistent with previous hypotheses of a bottleneck or selective sweep as likely causes of low mitogenome diversity.

A COMPARISON OF EXPERIMENTS AND THREE-DIMENSIONAL ANALYSIS TECHNIQUES. PART I. UNPOISONED UNIFORM SLAB CORE WITH A PARTIALLY INSERTED HAFNIUM ROD

DOE Office of Scientific and Technical Information (OSTI.GOV)

Renzi, N.E.; Roseberry, R.J.

>The experimental measurements and nuclear analysis of a uniformly loaded, unpoisoned slab core with a partially insented hafnium rod are described. Comparisons of experimental data with calculated results of the UFO code and flux synthesis techniques are given. It was concluded that one of the flux synthesis techniques and the UFO code are able to predict flux distributions to within approximately 5% of experiment for most cases. An error of approximately 10% was found in the synthesis technique for a channel near the partially inserted rod. The various calculations were able to predict neutron pulsed shutdowns to only approximately 30%.more » (auth)« less

Ftx is a non-coding RNA which affects Xist expression and chromatin structure within the X-inactivation center region.

PubMed

Chureau, Corinne; Chantalat, Sophie; Romito, Antonio; Galvani, Angélique; Duret, Laurent; Avner, Philip; Rougeulle, Claire

2011-02-15

X chromosome inactivation (XCI) is an essential epigenetic process which involves several non-coding RNAs (ncRNAs), including Xist, the master regulator of X-inactivation initiation. Xist is flanked in its 5' region by a large heterochromatic hotspot, which contains several transcription units including a gene of unknown function, Ftx (five prime to Xist). In this article, we describe the characterization and functional analysis of murine Ftx. We present evidence that Ftx produces a conserved functional long ncRNA, and additionally hosts microRNAs (miR) in its introns. Strikingly, Ftx partially escapes X-inactivation and is upregulated specifically in female ES cells at the onset of X-inactivation, an expression profile which closely follows that of Xist. We generated Ftx null ES cells to address the function of this gene. In these cells, only local changes in chromatin marks are detected within the hotspot, indicating that Ftx is not involved in the global maintenance of the heterochromatic structure of this region. The Ftx mutation, however, results in widespread alteration of transcript levels within the X-inactivation center (Xic) and particularly important decreases in Xist RNA levels, which were correlated with increased DNA methylation at the Xist CpG island. Altogether our results indicate that Ftx is a positive regulator of Xist and lead us to propose that Ftx is a novel ncRNA involved in XCI.

Genome level analysis of rice mRNA 3′-end processing signals and alternative polyadenylation

PubMed Central

Shen, Yingjia; Ji, Guoli; Haas, Brian J.; Wu, Xiaohui; Zheng, Jianti; Reese, Greg J.; Li, Qingshun Quinn

2008-01-01

The position of a poly(A) site of eukaryotic mRNA is determined by sequence signals in pre-mRNA and a group of polyadenylation factors. To reveal rice poly(A) signals at a genome level, we constructed a dataset of 55 742 authenticated poly(A) sites and characterized the poly(A) signals. This resulted in identifying the typical tripartite cis-elements, including FUE, NUE and CE, as previously observed in Arabidopsis. The average size of the 3′-UTR was 289 nucleotides. When mapped to the genome, however, 15% of these poly(A) sites were found to be located in the currently annotated intergenic regions. Moreover, an extensive alternative polyadenylation profile was evident where 50% of the genes analyzed had more than one unique poly(A) site (excluding microheterogeneity sites), and 13% had four or more poly(A) sites. About 4% of the analyzed genes possessed alternative poly(A) sites at their introns, 5′-UTRs, or protein coding regions. The authenticity of these alternative poly(A) sites was partially confirmed using MPSS data. Analysis of nucleotide profile and signal patterns indicated that there may be a different set of poly(A) signals for those poly(A) sites found in the coding regions. Based on the features of rice poly(A) signals, an updated algorithm termed PASS-Rice was designed to predict poly(A) sites. PMID:18411206

Cloning, overexpression and interaction of recombinant Fur from the cyanobacterium Anabaena PCC 7119 with isiB and its own promoter.

PubMed

Bes, M T; Hernández, J A; Peleato, M L; Fillat, M F

2001-01-15

A gene coding for a Fur (ferric uptake regulation) protein from the cyanobacterium Anabaena PCC 7119 has been cloned and overexpressed in Escherichia coli. DNA sequence analysis confirmed the presence of a 151-amino-acid open reading frame that showed homology with the Fur proteins reported for the unicellular cyanobacteria Synechococcus 7942 and Synechocystis PCC 6803. Two putative Fur-binding sites were detected in the promoter regions of the fur gene from Anabaena. Partially purified recombinant Fur binds to the flavodoxin promoter as well as its own promoter. This suggests that the Fur gene is autoregulated in Anabaena.

Identification of a Novel Renal Coccidian (Apicomplexa: Eimeriidae) from the Great-Horned Owl ( Bubo virginianus ), USA.

PubMed

Jankovsky, Jennie M; Brand, Mabre; Gerhold, Richard W

2017-04-01

We diagnosed renal coccidiosis in two of five Great-horned Owls ( Bubo virginianus ) examined in eastern Tennessee, US, 2007-13. Histopathologic examination of the kidneys revealed multifocal mild-to-moderate dilation and epithelial hyperplasia of collecting ducts. Renal collecting duct epithelial cells contained intracytoplasmic microgametocytes, macrogametocytes, and sporulating and sporulated oocysts. Renal coccidiosis in affected birds did not result in significant inflammation. Sequence analysis of the amplified partial 18S short subunit ribosomal RNA coding region from examination of formalin fixed tissue by using PCR disclosed a 93% identity to Eimeria reichenowi in GenBank, suggesting a novel Eimeria sp.

Operations analysis (study 2.1). Program listing for the LOVES computer code

NASA Technical Reports Server (NTRS)

Wray, S. T., Jr.

1974-01-01

A listing of the LOVES computer program is presented. The program is coded partially in SIMSCRIPT and FORTRAN. This version of LOVES is compatible with both the CDC 7600 and the UNIVAC 1108 computers. The code has been compiled, loaded, and executed successfully on the EXEC 8 system for the UNIVAC 1108.

Effects of stochastic field lines on the pressure driven MHD instabilities in the Large Helical Device

NASA Astrophysics Data System (ADS)

Ohdachi, Satoshi; Watanabe, Kiyomasa; Sakakibara, Satoru; Suzuki, Yasuhiro; Tsuchiya, Hayato; Ming, Tingfeng; Du, Xiaodi; LHD Expriment Group Team

2014-10-01

In the Large Helical Device (LHD), the plasma is surrounded by the so-called magnetic stochastic region, where the Kolmogorov length of the magnetic field lines is very short, from several tens of meters and to thousands meters. Finite pressure gradient are formed in this region and MHD instabilities localized in this region is observed since the edge region of the LHD is always unstable against the pressure driven mode. Therefore, the saturation level of the instabilities is the key issue in order to evaluate the risk of this kind of MHD instabilities. The saturation level depends on the pressure gradient and on the magnetic Reynolds number; there results are similar to the MHD mode in the closed magnetic surface region. The saturation level in the stochastic region is affected also by the stocasticity itself. Parameter dependence of the saturation level of the MHD activities in the region is discussed in detail. It is supported by NIFS budget code ULPP021, 028 and is also partially supported by the Ministry of Education, Science, Sports and Culture, Grant-in-Aid for Scientific Research 26249144, by the JSPS-NRF-NSFC A3 Foresight Program NSFC: No. 11261140328.

On Asymptotically Good Ramp Secret Sharing Schemes

NASA Astrophysics Data System (ADS)

Geil, Olav; Martin, Stefano; Martínez-Peñas, Umberto; Matsumoto, Ryutaroh; Ruano, Diego

Asymptotically good sequences of linear ramp secret sharing schemes have been intensively studied by Cramer et al. in terms of sequences of pairs of nested algebraic geometric codes. In those works the focus is on full privacy and full reconstruction. In this paper we analyze additional parameters describing the asymptotic behavior of partial information leakage and possibly also partial reconstruction giving a more complete picture of the access structure for sequences of linear ramp secret sharing schemes. Our study involves a detailed treatment of the (relative) generalized Hamming weights of the considered codes.

Partial Data Traces: Efficient Generation and Representation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, F; De Supinski, B R; McKee, S A

2001-08-20

Binary manipulation techniques are increasing in popularity. They support program transformations tailored toward certain program inputs, and these transformations have been shown to yield performance gains beyond the scope of static code optimizations without profile-directed feedback. They even deliver moderate gains in the presence of profile-guided optimizations. In addition, transformations can be performed on the entire executable, including library routines. This work focuses on program instrumentation, yet another application of binary manipulation. This paper reports preliminary results on generating partial data traces through dynamic binary rewriting. The contributions are threefold. First, a portable method for extracting precise data traces formore » partial executions of arbitrary applications is developed. Second, a set of hierarchical structures for compactly representing these accesses is developed. Third, an efficient online algorithm to detect regular accesses is introduced. The authors utilize dynamic binary rewriting to selectively collect partial address traces of regions within a program. This allows partial tracing of hot paths for only a short time during program execution in contrast to static rewriting techniques that lack hot path detection and also lack facilities to limit the duration of data collection. Preliminary results show reductions of three orders of a magnitude of inline instrumentation over a dual process approach involving context switching. They also report constant size representations for regular access patters in nested loops. These efforts are part of a larger project to counter the increasing gap between processor and main memory speeds by means of software optimization and hardware enhancements.« less

Improving early detection of gastric cancer: a novel systematic alphanumeric-coded endoscopic approach.

PubMed

Emura, Fabian; Gralnek, Ian; Baron, Todd H

2013-01-01

Despite extensive worldwide use of standard esophagogastroduodenoscopy (EGD) examinations, gastric cancer (GC) is one of the most common forms of cancer and ranks as the most common malignant tumor in East Asia, Eastern Europe and parts of Latin America. Current limitations of using non systematic examination during standard EGD could be at least partially responsible for the low incidence of early GC diagnosis in countries with a high prevalence of the disease. Originally proposed by Emura et al., systematic alphanumeric-coded endoscopy (SACE) is a novel method that facilitates complete examination of the upper GI tract based on sequential systematic overlapping photo-documentation using an endoluminal alphanumeric-coded nomenclature comprised of eight regions and 28 areas covering the entire surface upper GI surface. For precise localization or normal or abnormal areas, SACE incorporates a simple coordinate system based on the identification of certain natural axes, walls, curvatures and anatomical endoluminal landmarks. Efectiveness of SACE was recently demonstrated in a screening study that diagnosed early GC at a frequency of 0.30% (2/650) in healthy, average-risk volunteer subjects. Such a novel approach, if uniformly implemented worldwide, could significantly change the way we practice upper endoscopy in our lifetimes.

Sequence Polishing Library (SPL) v10.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oberortner, Ernst

The Sequence Polishing Library (SPL) is a suite of software tools in order to automate "Design for Synthesis and Assembly" workflows. Specifically: The SPL "Converter" tool converts files among the following sequence data exchange formats: CSV, FASTA, GenBank, and Synthetic Biology Open Language (SBOL); The SPL "Juggler" tool optimizes the codon usages of DNA coding sequences according to an optimization strategy, a user-specific codon usage table and genetic code. In addition, the SPL "Juggler" can translate amino acid sequences into DNA sequences.:The SPL "Polisher" verifies NA sequences against DNA synthesis constraints, such as GC content, repeating k-mers, and restriction sites.more » In case of violations, the "Polisher" reports the violations in a comprehensive manner. The "Polisher" tool can also modify the violating regions according to an optimization strategy, a user-specific codon usage table and genetic code;The SPL "Partitioner" decomposes large DNA sequences into smaller building blocks with partial overlaps that enable an efficient assembly. The "Partitioner" enables the user to configure the characteristics of the overlaps, which are mostly determined by the utilized assembly protocol, such as length, GC content, or melting temperature.« less

Opponent Coding of Sound Location (Azimuth) in Planum Temporale is Robust to Sound-Level Variations

PubMed Central

Derey, Kiki; Valente, Giancarlo; de Gelder, Beatrice; Formisano, Elia

2016-01-01

Coding of sound location in auditory cortex (AC) is only partially understood. Recent electrophysiological research suggests that neurons in mammalian auditory cortex are characterized by broad spatial tuning and a preference for the contralateral hemifield, that is, a nonuniform sampling of sound azimuth. Additionally, spatial selectivity decreases with increasing sound intensity. To accommodate these findings, it has been proposed that sound location is encoded by the integrated activity of neuronal populations with opposite hemifield tuning (“opponent channel model”). In this study, we investigated the validity of such a model in human AC with functional magnetic resonance imaging (fMRI) and a phase-encoding paradigm employing binaural stimuli recorded individually for each participant. In all subjects, we observed preferential fMRI responses to contralateral azimuth positions. Additionally, in most AC locations, spatial tuning was broad and not level invariant. We derived an opponent channel model of the fMRI responses by subtracting the activity of contralaterally tuned regions in bilateral planum temporale. This resulted in accurate decoding of sound azimuth location, which was unaffected by changes in sound level. Our data thus support opponent channel coding as a neural mechanism for representing acoustic azimuth in human AC. PMID:26545618

Umchs5, a gene coding for a class IV chitin synthase in Ustilago maydis.

PubMed

Xoconostle-Cázares, B; Specht, C A; Robbins, P W; Liu, Y; León, C; Ruiz-Herrera, J

1997-12-01

A fragment corresponding to a conserved region of a fifth gene coding for chitin synthase in the plant pathogenic fungus Ustilago maydis was amplified by means of the polymerase chain reaction (PCR). The amplified fragment was utilized as a probe for the identification of the whole gene in a genomic library of the fungus. The predicted gene product of Umchs5 has highest similarity with class IV chitin synthases encoded by the CHS3 genes from Saccharomyces cerevisiae and Candida albicans, chs-4 from Neurospora crassa, and chsE from Aspergillus nidulans. Umchs5 null mutants were constructed by substitution of most of the coding sequence with the hygromycin B resistance cassette. Mutants displayed significant reduction in growth rate, chitin content, and chitin synthase activity, specially in the mycelial form. Virulence to corn plantules was also reduced in the mutants. PCR was also used to obtain a fragment of a sixth chitin synthase, Umchs6. It is suggested that multigenic control of chitin synthesis in U. maydis operates as a protection mechanism for fungal viability in which the loss of one activity is partially compensated by the remaining enzymes. Copyright 1997 Academic Press.

78 FR 22529 - Notice of Intent To Grant Partially Exclusive Patent License; Max-Viz, Inc.

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-16

... Technology Applications, Space and Naval Warfare Systems Center Pacific, Code 72120, 53560 Hull St, Bldg A33... Technology Applications, Space and Naval Warfare Systems Center Pacific, Code 72120, 53560 Hull St, Bldg A33...

Dexter - A one-dimensional code for calculating thermionic performance of long converters.

NASA Technical Reports Server (NTRS)

Sawyer, C. D.

1971-01-01

This paper describes a versatile code for computing the coupled thermionic electric-thermal performance of long thermionic converters in which the temperature and voltage variations cannot be neglected. The code is capable of accounting for a variety of external electrical connection schemes, coolant flow paths and converter failures by partial shorting. Example problem solutions are given.

When Terminal Illness Is Worse Than Death: A Multicenter Study of Health-Care Providers' Resuscitation Desires.

PubMed

Chavez, Luis O; Einav, Sharon; Varon, Joseph

2017-11-01

To investigate how a terminal illness may affect the health-care providers' resuscitation preferences. We conducted a cross-sectional survey in 9 health-care institutions located in 4 geographical regions in North and Central America, investigating attitudes toward end-of-life practices in health-care providers. Statistical analysis included descriptive statistics and χ 2 test for the presence of associations ( P < 0.05 being significant) and Cramer V for the strength of the association. The main outcome measured the correlation between the respondents' present code status and their preference for cardiopulmonary resuscitation (CPR) in case of terminal illness. A total of 852 surveys were completed. Among the respondents, 21% (n = 180) were physicians, 36.9% (n = 317) were nurses, 10.5% (n = 90) were medical students, and 265 participants were other staff members of the institutions. Most respondents (58.3%; n = 500) desired "definitely full code" (physicians 73.2%; n = 131), only 13.8% of the respondents (physicians 8.33%; n = 15) desired "definitely no code" or "partial support," and 20.9% of the respondents (n = 179; among physicians 18.4%; n = 33) had never considered their code status. There was an association between current code status and resuscitation preference in case of terminal illness ( P < .001), but this association was overall quite weak (Cramer V = 0.180). Subgroup analysis revealed no association between current code status and terminal illness code preference among physicians ( P = .290) and nurses ( P = .316), whereupon other hospital workers were more consistent ( P < .01, Cramer V = .291). Doctors and nurses have different end-of-life preferences than other hospital workers. Their desire to undergo CPR may change when facing a terminal illness.

Particles climbing along a vertically vibrating tube: numerical simulation using the Discrete Element Method (DEM)

DOE PAGES

Xu, Yupeng; Musser, Jordan; Li, Tingwen; ...

2017-07-22

It has been reported experimentally that granular particles can climb along a vertically vibrating tube partially inserted inside a granular silo. Here, we use the Discrete Element Method (DEM) available in the Multiphase Flow with Interphase eXchanges (MFIX) code to investigate this phenomenon. By tracking the movement of individual particles, the climbing mechanism was illustrated and analyzed. The numerical results show that a sufficiently high vibration strength is needed to form a low solids volume fraction region inside the lower end of the vibrating tube, a dense region in the middle of the tube, and to bring the particles outsidemore » from the top layers down to fill in the void. The results also show that particle compaction in the middle section of the tube is the main cause of the climbing. Consequently, varying parameters which influence the compacted region, such as the restitution coefficient, change the climbing height.« less

Classification of functional interactions from multi-electrodes data using conditional modularity analysis

NASA Astrophysics Data System (ADS)

Makhtar, Siti Noormiza; Senik, Mohd Harizal

2018-02-01

The availability of massive amount of neuronal signals are attracting widespread interest in functional connectivity analysis. Functional interactions estimated by multivariate partial coherence analysis in the frequency domain represent the connectivity strength in this study. Modularity is a network measure for the detection of community structure in network analysis. The discovery of community structure for the functional neuronal network was implemented on multi-electrode array (MEA) signals recorded from hippocampal regions in isoflurane-anaesthetized Lister-hooded rats. The analysis is expected to show modularity changes before and after local unilateral kainic acid (KA)-induced epileptiform activity. The result is presented using color-coded graphic of conditional modularity measure for 19 MEA nodes. This network is separated into four sub-regions to show the community detection within each sub-region. The results show that classification of neuronal signals into the inter- and intra-modular nodes is feasible using conditional modularity analysis. Estimation of segregation properties using conditional modularity analysis may provide further information about functional connectivity from MEA data.

Particles climbing along a vertically vibrating tube: numerical simulation using the Discrete Element Method (DEM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Yupeng; Musser, Jordan; Li, Tingwen

It has been reported experimentally that granular particles can climb along a vertically vibrating tube partially inserted inside a granular silo. Here, we use the Discrete Element Method (DEM) available in the Multiphase Flow with Interphase eXchanges (MFIX) code to investigate this phenomenon. By tracking the movement of individual particles, the climbing mechanism was illustrated and analyzed. The numerical results show that a sufficiently high vibration strength is needed to form a low solids volume fraction region inside the lower end of the vibrating tube, a dense region in the middle of the tube, and to bring the particles outsidemore » from the top layers down to fill in the void. The results also show that particle compaction in the middle section of the tube is the main cause of the climbing. Consequently, varying parameters which influence the compacted region, such as the restitution coefficient, change the climbing height.« less

Instructions for the use of the CIVM-Jet 4C finite-strain computer code to calculate the transient structural responses of partial and/or complete arbitrarily-curved rings subjected to fragment impact

NASA Technical Reports Server (NTRS)

Rodal, J. J. A.; French, S. E.; Witmer, E. A.; Stagliano, T. R.

1979-01-01

The CIVM-JET 4C computer program for the 'finite strain' analysis of 2 d transient structural responses of complete or partial rings and beams subjected to fragment impact stored on tape as a series of individual files. Which subroutines are found in these files are described in detail. All references to the CIVM-JET 4C program are made assuming that the user has a copy of NASA CR-134907 (ASRL TR 154-9) which serves as a user's guide to (1) the CIVM-JET 4B computer code and (2) the CIVM-JET 4C computer code 'with the use of the modified input instructions' attached hereto.

Partial Least Squares with Structured Output for Modelling the Metabolomics Data Obtained from Complex Experimental Designs: A Study into the Y-Block Coding.

PubMed

Xu, Yun; Muhamadali, Howbeer; Sayqal, Ali; Dixon, Neil; Goodacre, Royston

2016-10-28

Partial least squares (PLS) is one of the most commonly used supervised modelling approaches for analysing multivariate metabolomics data. PLS is typically employed as either a regression model (PLS-R) or a classification model (PLS-DA). However, in metabolomics studies it is common to investigate multiple, potentially interacting, factors simultaneously following a specific experimental design. Such data often cannot be considered as a "pure" regression or a classification problem. Nevertheless, these data have often still been treated as a regression or classification problem and this could lead to ambiguous results. In this study, we investigated the feasibility of designing a hybrid target matrix Y that better reflects the experimental design than simple regression or binary class membership coding commonly used in PLS modelling. The new design of Y coding was based on the same principle used by structural modelling in machine learning techniques. Two real metabolomics datasets were used as examples to illustrate how the new Y coding can improve the interpretability of the PLS model compared to classic regression/classification coding.

TCOF1 gene encodes a putative nucleolar phosphoprotein that exhibits mutations in Treacher Collins Syndrome throughout its coding region.

PubMed

Wise, C A; Chiang, L C; Paznekas, W A; Sharma, M; Musy, M M; Ashley, J A; Lovett, M; Jabs, E W

1997-04-01

Treacher Collins Syndrome (TCS) is the most common of the human mandibulofacial dysostosis disorders. Recently, a partial TCOF1 cDNA was identified and shown to contain mutations in TCS families. Here we present the entire exon/intron genomic structure and the complete coding sequence of TCOF1. TCOF1 encodes a low complexity protein of 1,411 amino acids, whose predicted protein structure reveals repeated motifs that mirror the organization of its exons. These motifs are shared with nucleolar trafficking proteins in other species and are predicted to be highly phosphorylated by casein kinase. Consistent with this, the full-length TCOF1 protein sequence also contains putative nuclear and nucleolar localization signals. Throughout the open reading frame, we detected an additional eight mutations in TCS families and several polymorphisms. We postulate that TCS results from defects in a nucleolar trafficking protein that is critically required during human craniofacial development.

New Opportunities of Low-Cost Photogrammetry for Culture Heritage Preservation

NASA Astrophysics Data System (ADS)

Shults, R.

2017-05-01

In the paper, the questions of using the technologies of low-cost photogrammetry in combination with the additional capabilities of modern smartphones are considered. The research was carried out on the example of documenting the historical construction of the II World War - the Kiev Fortified Region. Brief historical information about the object of research is given. The possibilities of using modern smartphones as measuring instruments are considered. To get high-quality results, the camera of the smartphone was calibrated. The calibration results were used in the future to perform 3D modeling of defense facilities. Photographing of three defense structures in a different state: destroyed, partially destroyed and operating was carried out. Based on the results of photography using code targets, 3D object models were constructed. To verify the accuracy of the 3D modelling, control measurements of the lines between the code targets at the objects were performed. The obtained results are satisfying, and the technology considered in the paper can be recommended for use in performing archaeological and historical studies.

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius)

PubMed Central

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-01-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus. Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research (FSHR and LHR) as well as reproduction-linked polymorphisms and breeding programs. PMID:27844002

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius).

PubMed

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-06-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus . Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research ( FSHR and LHR ) as well as reproduction-linked polymorphisms and breeding programs.

A COMPARISON OF EXPERIMENTS AND THREE-DIMENSIONAL ANALYSIS TECHNIQUES. PART II. UNPOISONED UNIFORM SLAB CORE WITH A PARTIALLY INSERTED HAFNIUM ROD AND A PARTIALLY INSERTED WATER GAP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roseberry, R.J.

The experimental measurements and nuclear analysis of a uniformly loaded, unpoisoned slab core with a partially inserted hafnium rod and/or a partially inserted water gap are described. Comparisons of experimental data with calculated results of the UFO core and flux synthesis techniques are given. It is concluded that one of the flux synthesis techniques and the UFO code are able to predict flux distributions to within approximately -5% of experiment for most cases, with a maximum error of approximately -10% for a channel at the core- reflector boundary. The second synthesis technique failed to give comparable agreement with experiment evenmore » when various refinements were used, e.g. increasing the number of mesh points, performing the flux synthesis technique of iteration, and spectrum-weighting the appropriate calculated fluxes through the use of the SWAKRAUM code. These results are comparable to those reported in Part I of this study. (auth)« less

PROTEUS-SN User Manual

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shemon, Emily R.; Smith, Micheal A.; Lee, Changho

2016-02-16

PROTEUS-SN is a three-dimensional, highly scalable, high-fidelity neutron transport code developed at Argonne National Laboratory. The code is applicable to all spectrum reactor transport calculations, particularly those in which a high degree of fidelity is needed either to represent spatial detail or to resolve solution gradients. PROTEUS-SN solves the second order formulation of the transport equation using the continuous Galerkin finite element method in space, the discrete ordinates approximation in angle, and the multigroup approximation in energy. PROTEUS-SN’s parallel methodology permits the efficient decomposition of the problem by both space and angle, permitting large problems to run efficiently on hundredsmore » of thousands of cores. PROTEUS-SN can also be used in serial or on smaller compute clusters (10’s to 100’s of cores) for smaller homogenized problems, although it is generally more computationally expensive than traditional homogenized methodology codes. PROTEUS-SN has been used to model partially homogenized systems, where regions of interest are represented explicitly and other regions are homogenized to reduce the problem size and required computational resources. PROTEUS-SN solves forward and adjoint eigenvalue problems and permits both neutron upscattering and downscattering. An adiabatic kinetics option has recently been included for performing simple time-dependent calculations in addition to standard steady state calculations. PROTEUS-SN handles void and reflective boundary conditions. Multigroup cross sections can be generated externally using the MC2-3 fast reactor multigroup cross section generation code or internally using the cross section application programming interface (API) which can treat the subgroup or resonance table libraries. PROTEUS-SN is written in Fortran 90 and also includes C preprocessor definitions. The code links against the PETSc, METIS, HDF5, and MPICH libraries. It optionally links against the MOAB library and is a part of the SHARP multi-physics suite for coupled multi-physics analysis of nuclear reactors. This user manual describes how to set up a neutron transport simulation with the PROTEUS-SN code. A companion methodology manual describes the theory and algorithms within PROTEUS-SN.« less

Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

PubMed

Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

1987-07-01

Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

Molecular architecture of silk fibroin of Indian golden silkmoth, Antheraea assama.

PubMed

Gupta, Adarsh K; Mita, Kazuei; Arunkumar, Kallare P; Nagaraju, Javaregowda

2015-08-03

The golden silk spun by Indian golden silkmoth Antheraea assama, is regarded for its shimmering golden luster, tenacity and value as biomaterial. This report describes the gene coding for golden silk H-fibroin (AaFhc), its expression, full-length sequence and structurally important motifs discerning the underlying genetic and biochemical factors responsible for its much sought-after properties. The coding region, with biased isocodons, encodes highly repetitious crystalline core, flanked by a pair of 5' and 3' non-repetitious ends. AaFhc mRNA expression is strictly territorial, confined to the posterior silk gland, encoding a protein of size 230 kDa, which makes homodimers making the elementary structural units of the fibrous core of the golden silk. Characteristic polyalanine repeats that make tight β-sheet crystals alternate with non-polyalanine repeats that make less orderly antiparallel β-sheets, β-turns and partial α-helices. Phylogenetic analysis of the conserved N-terminal amorphous motif and the comparative analysis of the crystalline region with other saturniid H-fibroins reveal that AaFhc has longer, numerous and relatively uniform repeat motifs with lower serine content that assume tighter β-crystals and denser packing, which are speculated to be responsible for its acclaimed properties of higher tensile strength and higher refractive index responsible for golden luster.

Interactive Synthesis of Code Level Security Rules

DTIC Science & Technology

2017-04-01

Interactive Synthesis of Code-Level Security Rules A Thesis Presented by Leo St. Amour to The Department of Computer Science in partial fulfillment...of the requirements for the degree of Master of Science in Computer Science Northeastern University Boston, Massachusetts April 2017 DISTRIBUTION...Abstract of the Thesis Interactive Synthesis of Code-Level Security Rules by Leo St. Amour Master of Science in Computer Science Northeastern University

DEXTER: A one-dimensional code for calculating thermionic performance of long converters

NASA Technical Reports Server (NTRS)

Sawyer, C. D.

1971-01-01

A versatile code is described for computing the coupled thermionic electric-thermal performance of long thermionic converters in which the temperature and voltage variations cannot be neglected. The code is capable of accounting for a variety of external electrical connection schemes, coolant flow paths and converter failures by partial shorting. Example problem solutions are included along with a user's manual.

Method of Error Floor Mitigation in Low-Density Parity-Check Codes

NASA Technical Reports Server (NTRS)

Hamkins, Jon (Inventor)

2014-01-01

A digital communication decoding method for low-density parity-check coded messages. The decoding method decodes the low-density parity-check coded messages within a bipartite graph having check nodes and variable nodes. Messages from check nodes are partially hard limited, so that every message which would otherwise have a magnitude at or above a certain level is re-assigned to a maximum magnitude.

77 FR 5242 - Notice of Intent To Grant Partially Exclusive Patent License; Jinga-hi, Inc.

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-02

... Systems Center Pacific, Code 72120, 53560 Hull St, Bldg A33 Room 2531, San Diego, CA 92152-5001. FOR... Warfare Systems Center Pacific, Code 72120, 53560 Hull St, Bldg A33 Room 2531, San Diego, CA 92152-5001...

77 FR 69811 - Notice of Intent To Grant Partially Exclusive Patent License; Jinga-hi, Inc.

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-21

... Center Pacific, Code 72120, 53560 Hull St, Bldg A33 Room 2531, San Diego, CA 92152-5001. FOR FURTHER... Systems Center Pacific, Code 72120, 53560 Hull St, Bldg A33 Room 2531, San Diego, CA 92152-5001, telephone...

Radiation-MHD Simulations of Pillars and Globules in HII Regions

NASA Astrophysics Data System (ADS)

Mackey, J.

2012-07-01

Implicit and explicit raytracing-photoionisation algorithms have been implemented in the author's radiation-magnetohydrodynamics code. The algorithms are described briefly and their efficiency and parallel scaling are investigated. The implicit algorithm is more efficient for calculations where ionisation fronts have very supersonic velocities, and the explicit algorithm is favoured in the opposite limit because of its better parallel scaling. The implicit method is used to investigate the effects of initially uniform magnetic fields on the formation and evolution of dense pillars and cometary globules at the boundaries of HII regions. It is shown that for weak and medium field strengths an initially perpendicular field is swept into alignment with the pillar during its dynamical evolution, matching magnetic field observations of the ‘Pillars of Creation’ in M16. A strong perpendicular magnetic field remains in its initial configuration and also confines the photoevaporation flow into a bar-shaped, dense, ionised ribbon which partially shields the ionisation front.

Quantized phase coding and connected region labeling for absolute phase retrieval.

PubMed

Chen, Xiangcheng; Wang, Yuwei; Wang, Yajun; Ma, Mengchao; Zeng, Chunnian

2016-12-12

This paper proposes an absolute phase retrieval method for complex object measurement based on quantized phase-coding and connected region labeling. A specific code sequence is embedded into quantized phase of three coded fringes. Connected regions of different codes are labeled and assigned with 3-digit-codes combining the current period and its neighbors. Wrapped phase, more than 36 periods, can be restored with reference to the code sequence. Experimental results verify the capability of the proposed method to measure multiple isolated objects.

Complete genome analysis of porcine kobuviruses from the feces of pigs in Japan.

PubMed

Akagami, Masataka; Ito, Mika; Niira, Kazutaka; Kuroda, Moegi; Masuda, Tsuneyuki; Haga, Kei; Tsuchiaka, Shinobu; Naoi, Yuki; Kishimoto, Mai; Sano, Kaori; Omatsu, Tsutomu; Aoki, Hiroshi; Katayama, Yukie; Oba, Mami; Oka, Tomoichiro; Ichimaru, Toru; Yamasato, Hiroshi; Ouchi, Yoshinao; Shirai, Junsuke; Katayama, Kazuhiko; Mizutani, Tetsuya; Nagai, Makoto

2017-08-01

Porcine kobuviruses (PoKoVs) are ubiquitously distributed in pig populations worldwide and are thought to be enteric viruses in swine. Although PoKoVs have been detected in pigs in Japan, no complete genome data for Japanese PoKoVs are available. In the present study, 24 nearly complete or complete sequences of the PoKoV genome obtained from 10 diarrheic feces and 14 non-diarrheic feces of Japanese pigs were analyzed using a metagenomics approach. Japanese PoKoVs shared 85.2-100% identity with the complete coding nucleotide (nt) sequences and the closest relationship of 85.1-98.3% with PoKoVs from other countries. Twenty of 24 Japanese PoKoVs carried a deletion of 90 nt in the 2B coding region. Phylogenetic tree analyses revealed that PoKoVs were not grouped according to their geographical region of origin and the phylogenetic trees of the L, P1, P2, and P3 genetic regions showed topologies different from each other. Similarity plot analysis using strains from a single farm revealed partially different similarity patterns among strains from identical farm origins, suggesting that recombination events had occurred. These results indicate that various PoKoV strains are prevalent and not restricted geographically on pig farms worldwide and the coexistence of multiple strains leads to recombination events of PoKoVs and contributes to the genetic diversity and evolution of PoKoVs.

Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)

NASA Technical Reports Server (NTRS)

Shibata, K.; Abe, S.; Davies, E.

2001-01-01

Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.

Performance improvement of a centrifugal compressor stage by using different vaned diffusers

NASA Astrophysics Data System (ADS)

Zhang, Y. C.; Kong, X. Z.; Li, F.; Sun, W.; Chen, Q. G.

2013-12-01

The vaneless diffuser (VLD) is usually adopted in the traditional design of the multi-stage centrifugal compressor because of the stage's match problem. The drawback of the stage with vaneless diffusers is low efficiency. In order to increase the efficiency and at the same time, induce no significant decline in the operating range of the stage, three different types of vaned diffusers are designed and numerically investigated: the traditional vaned diffuser (TVD), the low-solidity cascade diffuser (LSD) and the partial-height vane diffuser (PVD). These three types of vaned diffusers have different influences on the performance of the centrifugal compressor. In the present investigation, the first part investigates the performance of a centrifugal compressor stage with three different vaned diffusers. The second part studies the influences of the height and the position of partial height vanes on the stage performance, and discusses the matching problem between the PVD and the downstream return channel. The stage investigated in this paper includes the impeller, the diffuser, the bend and the return channel. In the process of numerical investigation, the flow is assumed to be steady, and this process includes calculation and simulation. The calculation of 3-D turbulent flow in the stage uses the commercial CFD code NUMECA together with the Spalart-Allmaras turbulence model. The simulation of the computational region includes the impeller passages, the diffuser passages and return channel passages. The structure and surrounding region are assumed to have a perfect cyclic symmetry, so the single channel model and periodic boundary condition are applied at the middle of the passage, that is to reduce the calculation region to only one region. The investigation showed that the low-solidity cascade diffuser would be a better choice as a middle course for the first stage of the multistage centrifugal compressor. Besides, the influences of the height and the position of partial height vanes on the stage performance are intensively investigated and concluded at the design point, the isentropic efficiency and the static pressure ratio of the stage are improved with the increasing of the partial vane's height, and that installing the half-height vanes on the shroud side the stage would obtain a more uniform diffuser outflow and a better aerodynamic performance.

Constraint on the magma sources in Luzon Island Philippines by using P and S wave local seismic tomography

NASA Astrophysics Data System (ADS)

Nghia, N. C.; Huang, B. S.; Chen, P. F.

2017-12-01

The subduction of South China Sea beneath the Luzon Island has caused a complex setting of seismicity and magmatism because of the proposed ridge subduction and slab tearing. To constrain the validity of slab tearing induced by ridge subduction and their effect, we performed a P and S wave seismic tomography travel time inversion using LOTOS code. The dataset has been retrieved from International Seismological Centre from 1960 to 2008. A 1D velocity inverted by using VELEST with a Vp/Vs ratio of 1.74 is used as the starting input velocity for tomographic inversion. Total of 20905 P readings and 8126 S readings from 2355 earthquakes events were used to invert for velocity structure beneath Luzon Island. The horizontal tomographic results show low-velocity, high Vp/Vs regions at the shallow depth less than 50 km which are interpreted as the magmatic chambers of the volcanic system in Luzon. At the suspected region of slab tearing at 16oN to 18oN, two sources of magma have been indentified: slab window magma at shallow depth (< 50 km) and magma induced by mantle wedge partial melting from higher depth. This slab melting may have changed the composition of magmatic to become more silicic with high viscosity, which explains the volcanic gap in this region. At the region of 14oN to 15oN, large magma chambers under active volcanos are identified which explain the active volcanism in this region. Contrast to the region of slab tearing, in this region, the magma chambers are fed by only magma from partial melting of mantle wedge from the depth higher than 100 km. These observations are consistent with previous work on the slab tearing of South China Sea and the activities of volcanism in the Luzon Island.

Digital tomosynthesis mammography using a parallel maximum-likelihood reconstruction method

NASA Astrophysics Data System (ADS)

Wu, Tao; Zhang, Juemin; Moore, Richard; Rafferty, Elizabeth; Kopans, Daniel; Meleis, Waleed; Kaeli, David

2004-05-01

A parallel reconstruction method, based on an iterative maximum likelihood (ML) algorithm, is developed to provide fast reconstruction for digital tomosynthesis mammography. Tomosynthesis mammography acquires 11 low-dose projections of a breast by moving an x-ray tube over a 50° angular range. In parallel reconstruction, each projection is divided into multiple segments along the chest-to-nipple direction. Using the 11 projections, segments located at the same distance from the chest wall are combined to compute a partial reconstruction of the total breast volume. The shape of the partial reconstruction forms a thin slab, angled toward the x-ray source at a projection angle 0°. The reconstruction of the total breast volume is obtained by merging the partial reconstructions. The overlap region between neighboring partial reconstructions and neighboring projection segments is utilized to compensate for the incomplete data at the boundary locations present in the partial reconstructions. A serial execution of the reconstruction is compared to a parallel implementation, using clinical data. The serial code was run on a PC with a single PentiumIV 2.2GHz CPU. The parallel implementation was developed using MPI and run on a 64-node Linux cluster using 800MHz Itanium CPUs. The serial reconstruction for a medium-sized breast (5cm thickness, 11cm chest-to-nipple distance) takes 115 minutes, while a parallel implementation takes only 3.5 minutes. The reconstruction time for a larger breast using a serial implementation takes 187 minutes, while a parallel implementation takes 6.5 minutes. No significant differences were observed between the reconstructions produced by the serial and parallel implementations.

29 CFR 4043.24 - Termination or partial termination.

Code of Federal Regulations, 2012 CFR

2012-07-01

... REPORTABLE EVENTS AND CERTAIN OTHER NOTIFICATION REQUIREMENTS Post-Event Notice of Reportable Events § 4043.24 Termination or partial termination. (a) Reportable event. A reportable event occurs when the... within the meaning of section 411(d)(3) of the Code. (b) Waivers. Notice is waived for this event. ...

29 CFR 4043.24 - Termination or partial termination.

Code of Federal Regulations, 2014 CFR

2014-07-01

... REPORTABLE EVENTS AND CERTAIN OTHER NOTIFICATION REQUIREMENTS Post-Event Notice of Reportable Events § 4043.24 Termination or partial termination. (a) Reportable event. A reportable event occurs when the... within the meaning of section 411(d)(3) of the Code. (b) Waivers. Notice is waived for this event. ...

29 CFR 4043.24 - Termination or partial termination.

Code of Federal Regulations, 2013 CFR

2013-07-01

... REPORTABLE EVENTS AND CERTAIN OTHER NOTIFICATION REQUIREMENTS Post-Event Notice of Reportable Events § 4043.24 Termination or partial termination. (a) Reportable event. A reportable event occurs when the... within the meaning of section 411(d)(3) of the Code. (b) Waivers. Notice is waived for this event. ...

29 CFR 4043.24 - Termination or partial termination.

Code of Federal Regulations, 2011 CFR

2011-07-01

... REPORTABLE EVENTS AND CERTAIN OTHER NOTIFICATION REQUIREMENTS Post-Event Notice of Reportable Events § 4043.24 Termination or partial termination. (a) Reportable event. A reportable event occurs when the... within the meaning of section 411(d)(3) of the Code. (b) Waivers. Notice is waived for this event. ...

29 CFR 4043.24 - Termination or partial termination.

Code of Federal Regulations, 2010 CFR

2010-07-01

... REPORTABLE EVENTS AND CERTAIN OTHER NOTIFICATION REQUIREMENTS Post-Event Notice of Reportable Events § 4043.24 Termination or partial termination. (a) Reportable event. A reportable event occurs when the... within the meaning of section 411(d)(3) of the Code. (b) Waivers. Notice is waived for this event. ...

77 FR 53226 - Public Land Order No. 7792; Partial Revocation, Power Site Reserve No. 109; Montana

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-31

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [MT-LLB05000-LL14300000-FQ0000; MTM 40412] Public Land Order No. 7792; Partial Revocation, Power Site Reserve No. 109; Montana Correction In notice...:45 am] BILLING CODE 1505-01-D ...

Coordinated design of coding and modulation systems

NASA Technical Reports Server (NTRS)

Massey, J. L.

1976-01-01

Work on partial unit memory codes continued; it was shown that for a given virtual state complexity, the maximum free distance over the class of all convolutional codes is achieved within the class of unit memory codes. The effect of phase-lock loop (PLL) tracking error on coding system performance was studied by using the channel cut-off rate as the measure of quality of a modulation system. Optimum modulation signal sets for a non-white Gaussian channel considered an heuristic selection rule based on a water-filling argument. The use of error correcting codes to perform data compression by the technique of syndrome source coding was researched and a weight-and-error-locations scheme was developed that is closely related to LDSC coding.

Method for partially coating laser diode facets

NASA Technical Reports Server (NTRS)

Dholakia, Anil R. (Inventor)

1990-01-01

Bars of integral laser diode devices cleaved from a wafer are placed with their p regions abutting and n regions abutting. A thin BeCu mask having alternate openings and strips of the same width as the end facets is used to mask the n region interfaces so that multiple bars can be partially coated over their exposed p regions with a reflective or partial reflective coating. The partial coating permits identification of the emitting facet from the fully coated back facet during a later device mounting procedure.

The CORSAIR Turbomachinery Code: Status and Plans

NASA Technical Reports Server (NTRS)

Dorney, Daniel J.; Sondak, Douglas L.; Turner, James (Technical Monitor)

2002-01-01

This viewgraph presentation gives an overview of the CORSAIR turbomachinery code's status and plans. Details are provided on the CORSAIR algorithms, full- and partial-admission turbine simulations, the Simplex turbine, instantaneous Mach number, unsteady pressure admission graphs, variable fluid property RLV-133 simulations, instantaneous entropy function, pumps and inducers, and future plans.

A project based on multi-configuration Dirac-Fock calculations for plasma spectroscopy

NASA Astrophysics Data System (ADS)

Comet, M.; Pain, J.-C.; Gilleron, F.; Piron, R.

2017-09-01

We present a project dedicated to hot plasma spectroscopy based on a Multi-Configuration Dirac-Fock (MCDF) code, initially developed by J. Bruneau. The code is briefly described and the use of the transition state method for plasma spectroscopy is detailed. Then an opacity code for local-thermodynamic-equilibrium plasmas using MCDF data, named OPAMCDF, is presented. Transition arrays for which the number of lines is too large to be handled in a Detailed Line Accounting (DLA) calculation can be modeled within the Partially Resolved Transition Array method or using the Unresolved Transition Arrays formalism in jj-coupling. An improvement of the original Partially Resolved Transition Array method is presented which gives a better agreement with DLA computations. Comparisons with some absorption and emission experimental spectra are shown. Finally, the capability of the MCDF code to compute atomic data required for collisional-radiative modeling of plasma at non local thermodynamic equilibrium is illustrated. In addition to photoexcitation, this code can be used to calculate photoionization, electron impact excitation and ionization cross-sections as well as autoionization rates in the Distorted-Wave or Close Coupling approximations. Comparisons with cross-sections and rates available in the literature are discussed.

Development length of 0.6-inch prestressing strand in standard I-shaped pretensioned concrete beams

NASA Astrophysics Data System (ADS)

Barnes, Robert Wesley

The use of 0.6 in prestressing strand at a center-to-center spacing of 2 in allows for the optimal implementation of High Strength Concrete (HSC) in precast, prestressed concrete bridge superstructures. For this strand configuration, partial debonding of strands is a desirable alternative to the more traditional method of draping strands to alleviate extreme concrete stresses after prestress release. Recent experimental evidence suggests that existing code provisions addressing the anchorage of pretensioned strands do not adequately describe the behavior of these strands. In addition, the anchorage behavior of partially debonded strands is not fully understood. These uncertainties have combined to hinder the full exploitation of HSC in pretensioned concrete construction. A research study was conducted to determine the anchorage behavior of 0.6 in strands at 2 in spacing in full-size bridge members. The experimental program consisted of assessing transfer and development lengths in plant-cast AASHTO Type I I-beams. The influence of concrete compressive strengths ranging from 5700 to 14,700 psi was examined. In order to consider the full range of strand surface conditions found in practice, the prestressing strand featured either a bright mill finish or a rusted surface condition. The anchorage behavior of partially debonded strands was investigated by using a variety of strand debonding configurations---including debonded strand percentages as high as 75 percent. A limited investigation of the effect of horizontal web reinforcement on anchorage behavior was performed. Pull-out tests were performed in an attempt to correlate results with the bond quality of the strands used in the study. The correlation between strand draw-in and the anchorage behavior of prestressing strands was also examined. A review of the evolution and shortcomings of existing code provisions for the anchorage of prestressing strands is presented. Results of the experimental program are reported, along with recommended design procedures based on these results and those from other studies. The use of 0.6 in strand at 2 in spacing is concluded to be safe, and partial debonding of prestressing strands is shown to be an effective means of reducing stresses in the end regions of pretensioned girders.

Compact representations of partially coherent undulator radiation suitable for wave propagation

DOE PAGES

Lindberg, Ryan R.; Kim, Kwang -Je

2015-09-28

Undulator radiation is partially coherent in the transverse plane, with the degree of coherence depending on the ratio of the electron beam phase space area (emittance) to the characteristic radiation wavelength λ. Numerical codes used to predict x-ray beam line performance can typically only propagate coherent fields from the source to the image plane. We investigate methods for representing partially coherent undulator radiation using a suitably chosen set of coherent fields that can be used in standard wave propagation codes, and discuss such “coherent mode expansions” for arbitrary degrees of coherence. In the limit when the electron beam emittance alongmore » at least one direction is much larger than λ the coherent modes are orthogonal and therefore compact; when the emittance approaches λ in both planes we discuss an economical method of defining the relevant coherent fields that samples the electron beam phase space using low-discrepancy sequences.« less

PetIGA: A framework for high-performance isogeometric analysis

DOE PAGES

Dalcin, Lisandro; Collier, Nathaniel; Vignal, Philippe; ...

2016-05-25

We present PetIGA, a code framework to approximate the solution of partial differential equations using isogeometric analysis. PetIGA can be used to assemble matrices and vectors which come from a Galerkin weak form, discretized with Non-Uniform Rational B-spline basis functions. We base our framework on PETSc, a high-performance library for the scalable solution of partial differential equations, which simplifies the development of large-scale scientific codes, provides a rich environment for prototyping, and separates parallelism from algorithm choice. We describe the implementation of PetIGA, and exemplify its use by solving a model nonlinear problem. To illustrate the robustness and flexibility ofmore » PetIGA, we solve some challenging nonlinear partial differential equations that include problems in both solid and fluid mechanics. Lastly, we show strong scaling results on up to 4096 cores, which confirm the suitability of PetIGA for large scale simulations.« less

Techniques for the analysis of data from coded-mask X-ray telescopes

NASA Technical Reports Server (NTRS)

Skinner, G. K.; Ponman, T. J.; Hammersley, A. P.; Eyles, C. J.

1987-01-01

Several techniques useful in the analysis of data from coded-mask telescopes are presented. Methods of handling changes in the instrument pointing direction are reviewed and ways of using FFT techniques to do the deconvolution considered. Emphasis is on techniques for optimally-coded systems, but it is shown that the range of systems included in this class can be extended through the new concept of 'partial cycle averaging'.

Impacts of DNAPL Source Treatment: Experimental and Modeling Assessment of the Benefits of Partial DNAPL Source Removal

DTIC Science & Technology

2009-09-01

nuclear industry for conducting performance assessment calculations. The analytical FORTRAN code for the DNAPL source function, REMChlor, was...project. The first was to apply existing deterministic codes , such as T2VOC and UTCHEM, to the DNAPL source zone to simulate the remediation processes...but describe the spatial variability of source zones unlike one-dimensional flow and transport codes that assume homogeneity. The Lagrangian models

Partial correlation properties of pseudonoise /PN/ codes in noncoherent synchronization/detection schemes

NASA Technical Reports Server (NTRS)

Cartier, D. E.

1976-01-01

This concise paper considers the effect on the autocorrelation function of a pseudonoise (PN) code when the acquisition scheme only integrates coherently over part of the code and then noncoherently combines these results. The peak-to-null ratio of the effective PN autocorrelation function is shown to degrade to the square root of n, where n is the number of PN symbols over which coherent integration takes place.

Comparative genomics approach to detecting split-coding regions in a low-coverage genome: lessons from the chimaera Callorhinchus milii (Holocephali, Chondrichthyes).

PubMed

Dessimoz, Christophe; Zoller, Stefan; Manousaki, Tereza; Qiu, Huan; Meyer, Axel; Kuraku, Shigehiro

2011-09-01

Recent development of deep sequencing technologies has facilitated de novo genome sequencing projects, now conducted even by individual laboratories. However, this will yield more and more genome sequences that are not well assembled, and will hinder thorough annotation when no closely related reference genome is available. One of the challenging issues is the identification of protein-coding sequences split into multiple unassembled genomic segments, which can confound orthology assignment and various laboratory experiments requiring the identification of individual genes. In this study, using the genome of a cartilaginous fish, Callorhinchus milii, as test case, we performed gene prediction using a model specifically trained for this genome. We implemented an algorithm, designated ESPRIT, to identify possible linkages between multiple protein-coding portions derived from a single genomic locus split into multiple unassembled genomic segments. We developed a validation framework based on an artificially fragmented human genome, improvements between early and recent mouse genome assemblies, comparison with experimentally validated sequences from GenBank, and phylogenetic analyses. Our strategy provided insights into practical solutions for efficient annotation of only partially sequenced (low-coverage) genomes. To our knowledge, our study is the first formulation of a method to link unassembled genomic segments based on proteomes of relatively distantly related species as references.

Comparative genomics approach to detecting split-coding regions in a low-coverage genome: lessons from the chimaera Callorhinchus milii (Holocephali, Chondrichthyes)

PubMed Central

Zoller, Stefan; Manousaki, Tereza; Qiu, Huan; Meyer, Axel; Kuraku, Shigehiro

2011-01-01

Recent development of deep sequencing technologies has facilitated de novo genome sequencing projects, now conducted even by individual laboratories. However, this will yield more and more genome sequences that are not well assembled, and will hinder thorough annotation when no closely related reference genome is available. One of the challenging issues is the identification of protein-coding sequences split into multiple unassembled genomic segments, which can confound orthology assignment and various laboratory experiments requiring the identification of individual genes. In this study, using the genome of a cartilaginous fish, Callorhinchus milii, as test case, we performed gene prediction using a model specifically trained for this genome. We implemented an algorithm, designated ESPRIT, to identify possible linkages between multiple protein-coding portions derived from a single genomic locus split into multiple unassembled genomic segments. We developed a validation framework based on an artificially fragmented human genome, improvements between early and recent mouse genome assemblies, comparison with experimentally validated sequences from GenBank, and phylogenetic analyses. Our strategy provided insights into practical solutions for efficient annotation of only partially sequenced (low-coverage) genomes. To our knowledge, our study is the first formulation of a method to link unassembled genomic segments based on proteomes of relatively distantly related species as references. PMID:21712341

Opponent Coding of Sound Location (Azimuth) in Planum Temporale is Robust to Sound-Level Variations.

PubMed

Derey, Kiki; Valente, Giancarlo; de Gelder, Beatrice; Formisano, Elia

2016-01-01

Coding of sound location in auditory cortex (AC) is only partially understood. Recent electrophysiological research suggests that neurons in mammalian auditory cortex are characterized by broad spatial tuning and a preference for the contralateral hemifield, that is, a nonuniform sampling of sound azimuth. Additionally, spatial selectivity decreases with increasing sound intensity. To accommodate these findings, it has been proposed that sound location is encoded by the integrated activity of neuronal populations with opposite hemifield tuning ("opponent channel model"). In this study, we investigated the validity of such a model in human AC with functional magnetic resonance imaging (fMRI) and a phase-encoding paradigm employing binaural stimuli recorded individually for each participant. In all subjects, we observed preferential fMRI responses to contralateral azimuth positions. Additionally, in most AC locations, spatial tuning was broad and not level invariant. We derived an opponent channel model of the fMRI responses by subtracting the activity of contralaterally tuned regions in bilateral planum temporale. This resulted in accurate decoding of sound azimuth location, which was unaffected by changes in sound level. Our data thus support opponent channel coding as a neural mechanism for representing acoustic azimuth in human AC. © The Author 2015. Published by Oxford University Press.

An efficient and reliable geographic routing protocol based on partial network coding for underwater sensor networks.

PubMed

Hao, Kun; Jin, Zhigang; Shen, Haifeng; Wang, Ying

2015-05-28

Efficient routing protocols for data packet delivery are crucial to underwater sensor networks (UWSNs). However, communication in UWSNs is a challenging task because of the characteristics of the acoustic channel. Network coding is a promising technique for efficient data packet delivery thanks to the broadcast nature of acoustic channels and the relatively high computation capabilities of the sensor nodes. In this work, we present GPNC, a novel geographic routing protocol for UWSNs that incorporates partial network coding to encode data packets and uses sensor nodes' location information to greedily forward data packets to sink nodes. GPNC can effectively reduce network delays and retransmissions of redundant packets causing additional network energy consumption. Simulation results show that GPNC can significantly improve network throughput and packet delivery ratio, while reducing energy consumption and network latency when compared with other routing protocols.

Towards Just-In-Time Partial Evaluation of Prolog

NASA Astrophysics Data System (ADS)

Bolz, Carl Friedrich; Leuschel, Michael; Rigo, Armin

We introduce a just-in-time specializer for Prolog. Just-in-time specialization attempts to unify of the concepts and benefits of partial evaluation (PE) and just-in-time (JIT) compilation. It is a variant of PE that occurs purely at runtime, which lazily generates residual code and is constantly driven by runtime feedback.

RRE: a tool for the extraction of non-coding regions surrounding annotated genes from genomic datasets.

PubMed

Lazzarato, F; Franceschinis, G; Botta, M; Cordero, F; Calogero, R A

2004-11-01

RRE allows the extraction of non-coding regions surrounding a coding sequence [i.e. gene upstream region, 5'-untranslated region (5'-UTR), introns, 3'-UTR, downstream region] from annotated genomic datasets available at NCBI. RRE parser and web-based interface are accessible at http://www.bioinformatica.unito.it/bioinformatics/rre/rre.html

Objects, Numbers, Fingers, Space: Clustering of Ventral and Dorsal Functions in Young Children and Adults

ERIC Educational Resources Information Center

Chinello, Alessandro; Cattani, Veronica; Bonfiglioli, Claudia; Dehaene, Stanislas; Piazza, Manuela

2013-01-01

In the primate brain, sensory information is processed along two partially segregated cortical streams: the ventral stream, mainly coding for objects' shape and identity, and the dorsal stream, mainly coding for objects' quantitative information (including size, number, and spatial position). Neurophysiological measures indicate that such…

A new polymorphic and multicopy MHC gene family related to nonmammalian class I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leelayuwat, C.; Degli-Esposti, M.A.; Abraham, L.J.

1994-12-31

The authors have used genomic analysis to characterize a region of the central major histocompatibility complex (MHC) spanning {approximately} 300 kilobases (kb) between TNF and HLA-B. This region has been suggested to carry genetic factors relevant to the development of autoimmune diseases such as myasthenia gravis (MG) and insulin dependent diabetes mellitus (IDDM). Genomic sequence was analyzed for coding potential, using two neural network programs, GRAIL and GeneParser. A genomic probe, JAB, containing putative coding sequences (PERB11) located 60 kb centromeric of HLA-B, was used for northern analysis of human tissues. Multiple transcripts were detected. Southern analysis of genomic DNAmore » and overlapping YAC clones, covering the region from BAT1 to HLA-F, indicated that there are at least five copies of PERB11, four of which are located within this region of the MHC. The partial cDNA sequence of PERB11 was obtained from poly-A RNA derived from skeletal muscle. The putative amino acid sequence of PERB11 shares {approximately} 30% identity to MHC class I molecules from various species, including reptiles, chickens, and frogs, as well as to other MHC class I-like molecules, such as the IgG FcR of the mouse and rat and the human Zn-{alpha}2-glycoprotein. From direct comparison of amino acid sequences, it is concluded that PERB11 is a distinct molecule more closely related to nonmammalian than known mammalian MHC class I molecules. Genomic sequence analysis of PERB11 from five MHC ancestral haplotypes (AH) indicated that the gene is polymorphic at both DNA and protein level. The results suggest that the authors have identified a novel polymorphic gene family with multiple copies within the MHC. 48 refs., 10 figs., 2 tabs.« less

Transcription of a protein-coding gene on B chromosomes of the Siberian roe deer (Capreolus pygargus)

PubMed Central

2013-01-01

Background Most eukaryotic species represent stable karyotypes with a particular diploid number. B chromosomes are additional to standard karyotypes and may vary in size, number and morphology even between cells of the same individual. For many years it was generally believed that B chromosomes found in some plant, animal and fungi species lacked active genes. Recently, molecular cytogenetic studies showed the presence of additional copies of protein-coding genes on B chromosomes. However, the transcriptional activity of these genes remained elusive. We studied karyotypes of the Siberian roe deer (Capreolus pygargus) that possess up to 14 B chromosomes to investigate the presence and expression of genes on supernumerary chromosomes. Results Here, we describe a 2 Mbp region homologous to cattle chromosome 3 and containing TNNI3K (partial), FPGT, LRRIQ3 and a large gene-sparse segment on B chromosomes of the Siberian roe deer. The presence of the copy of the autosomal region was demonstrated by B-specific cDNA analysis, PCR assisted mapping, cattle bacterial artificial chromosome (BAC) clone localization and quantitative polymerase chain reaction (qPCR). By comparative analysis of B-specific and non-B chromosomal sequences we discovered some B chromosome-specific mutations in protein-coding genes, which further enabled the detection of a FPGT-TNNI3K transcript expressed from duplicated genes located on B chromosomes in roe deer fibroblasts. Conclusions Discovery of a large autosomal segment in all B chromosomes of the Siberian roe deer further corroborates the view of an autosomal origin for these elements. Detection of a B-derived transcript in fibroblasts implies that the protein coding sequences located on Bs are not fully inactivated. The origin, evolution and effect on host of B chromosomal genes seem to be similar to autosomal segmental duplications, which reinforces the view that supernumerary chromosomal elements might play an important role in genome evolution. PMID:23915065

Parallel evolution of chordate cis-regulatory code for development.

PubMed

Doglio, Laura; Goode, Debbie K; Pelleri, Maria C; Pauls, Stefan; Frabetti, Flavia; Shimeld, Sebastian M; Vavouri, Tanya; Elgar, Greg

2013-11-01

Urochordates are the closest relatives of vertebrates and at the larval stage, possess a characteristic bilateral chordate body plan. In vertebrates, the genes that orchestrate embryonic patterning are in part regulated by highly conserved non-coding elements (CNEs), yet these elements have not been identified in urochordate genomes. Consequently the evolution of the cis-regulatory code for urochordate development remains largely uncharacterised. Here, we use genome-wide comparisons between C. intestinalis and C. savignyi to identify putative urochordate cis-regulatory sequences. Ciona conserved non-coding elements (ciCNEs) are associated with largely the same key regulatory genes as vertebrate CNEs. Furthermore, some of the tested ciCNEs are able to activate reporter gene expression in both zebrafish and Ciona embryos, in a pattern that at least partially overlaps that of the gene they associate with, despite the absence of sequence identity. We also show that the ability of a ciCNE to up-regulate gene expression in vertebrate embryos can in some cases be localised to short sub-sequences, suggesting that functional cross-talk may be defined by small regions of ancestral regulatory logic, although functional sub-sequences may also be dispersed across the whole element. We conclude that the structure and organisation of cis-regulatory modules is very different between vertebrates and urochordates, reflecting their separate evolutionary histories. However, functional cross-talk still exists because the same repertoire of transcription factors has likely guided their parallel evolution, exploiting similar sets of binding sites but in different combinations.

The Use and Effectiveness of Triple Multiplex System for Coding Region Single Nucleotide Polymorphism in Mitochondrial DNA Typing of Archaeologically Obtained Human Skeletons from Premodern Joseon Tombs of Korea

PubMed Central

Oh, Chang Seok; Lee, Soong Deok; Kim, Yi-Suk; Shin, Dong Hoon

2015-01-01

Previous study showed that East Asian mtDNA haplogroups, especially those of Koreans, could be successfully assigned by the coupled use of analyses on coding region SNP markers and control region mutation motifs. In this study, we tried to see if the same triple multiplex analysis for coding regions SNPs could be also applicable to ancient samples from East Asia as the complementation for sequence analysis of mtDNA control region. By the study on Joseon skeleton samples, we know that mtDNA haplogroup determined by coding region SNP markers successfully falls within the same haplogroup that sequence analysis on control region can assign. Considering that ancient samples in previous studies make no small number of errors in control region mtDNA sequencing, coding region SNP analysis can be used as good complimentary to the conventional haplogroup determination, especially of archaeological human bone samples buried underground over long periods. PMID:26345190

Quality Assessment of Mixed and Ceramic Recycled Aggregates from Construction and Demolition Wastes in the Concrete Manufacture According to the Spanish Standard.

PubMed

Rodríguez-Robles, Desirée; García-González, Julia; Juan-Valdés, Andrés; Morán-Del Pozo, Julia Mª; Guerra-Romero, Manuel I

2014-08-13

Construction and demolition waste (CDW) constitutes an increasingly significant problem in society due to the volume generated, rendering sustainable management and disposal problematic. The aim of this study is to identify a possible reuse option in the concrete manufacturing for recycled aggregates with a significant ceramic content: mixed recycled aggregates (MixRA) and ceramic recycled aggregates (CerRA). In order to do so, several tests are conducted in accordance with the Spanish Code on Structural Concrete (EHE-08) to determine the composition in weight and physic-mechanical characteristics (particle size distributions, fine content, sand equivalent, density, water absorption, flakiness index, and resistance to fragmentation) of the samples for the partial inclusion of the recycled aggregates in concrete mixes. The results of these tests clearly support the hypothesis that this type of material may be suitable for such partial replacements if simple pretreatment is carried out. Furthermore, this measure of reuse is in line with European, national, and regional policies on sustainable development, and presents a solution to the environmental problem caused by the generation of CDW.

On fuzzy semantic similarity measure for DNA coding.

PubMed

Ahmad, Muneer; Jung, Low Tang; Bhuiyan, Md Al-Amin

2016-02-01

A coding measure scheme numerically translates the DNA sequence to a time domain signal for protein coding regions identification. A number of coding measure schemes based on numerology, geometry, fixed mapping, statistical characteristics and chemical attributes of nucleotides have been proposed in recent decades. Such coding measure schemes lack the biologically meaningful aspects of nucleotide data and hence do not significantly discriminate coding regions from non-coding regions. This paper presents a novel fuzzy semantic similarity measure (FSSM) coding scheme centering on FSSM codons׳ clustering and genetic code context of nucleotides. Certain natural characteristics of nucleotides i.e. appearance as a unique combination of triplets, preserving special structure and occurrence, and ability to own and share density distributions in codons have been exploited in FSSM. The nucleotides׳ fuzzy behaviors, semantic similarities and defuzzification based on the center of gravity of nucleotides revealed a strong correlation between nucleotides in codons. The proposed FSSM coding scheme attains a significant enhancement in coding regions identification i.e. 36-133% as compared to other existing coding measure schemes tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. Copyright © 2015 Elsevier Ltd. All rights reserved.

National Utilization of Partial Nephrectomy Pre- and Post- AUA Guidelines: Is This as Good as It Gets?

PubMed

Sorokin, Igor; Feustel, Paul J; O'Malley, Rebecca L

2017-10-01

The purpose of the study was to compare utilization and predictors of partial nephrectomy (PN) in the pre- and post-guideline eras. American Board of Urology certification/recertification operative logs were reviewed from 2003 to 2014. Nephrectomy cases were extracted using Current Procedural Terminology codes. The cases were then stratified according to pre-guidelines (2003-October 2009) and post-guidelines (November 2009-2014). Multivariable logistic regression was used to evaluate patient, surgeon, and practice characteristics as predictors of PN. A general linear model with regression analysis was used to evaluate the change in PN over time relative to the incidence of renal cell carcinoma (RCC). We identified 20,402 and 20,729 nephrectomies in the pre- and post-guidelines eras, respectively. In multivariable analysis, the post-guidelines group was more likely to undergo PN (odds ratio, 1.87; P < .001). The pre- as well as post-guidelines groups had a higher likelihood of undergoing PN with an open approach, higher-volume surgeons, and younger patient age (P < .05). Surgeon subspecialty and US region were no longer significant factors after guidelines publication. Number of PN normalized to the incidence of RCC continued to increase over time (0.14%/y; R 2  = 0.77; P < .001). Partial nephrectomy in the post-guidelines era is no longer confined to urological subspecialists or certain densely populated US regions. Although rates of PN continue to increase relative to the recently decreasing overall incidence of RCC, the slope has leveled off somewhat. This is likely related to clinical intricacies of the best treatment modality and technologic advances rather than changes related to guidelines publication. Published by Elsevier Inc.

Implementation of a flexible and scalable particle-in-cell method for massively parallel computations in the mantle convection code ASPECT

NASA Astrophysics Data System (ADS)

Gassmöller, Rene; Bangerth, Wolfgang

2016-04-01

Particle-in-cell methods have a long history and many applications in geodynamic modelling of mantle convection, lithospheric deformation and crustal dynamics. They are primarily used to track material information, the strain a material has undergone, the pressure-temperature history a certain material region has experienced, or the amount of volatiles or partial melt present in a region. However, their efficient parallel implementation - in particular combined with adaptive finite-element meshes - is complicated due to the complex communication patterns and frequent reassignment of particles to cells. Consequently, many current scientific software packages accomplish this efficient implementation by specifically designing particle methods for a single purpose, like the advection of scalar material properties that do not evolve over time (e.g., for chemical heterogeneities). Design choices for particle integration, data storage, and parallel communication are then optimized for this single purpose, making the code relatively rigid to changing requirements. Here, we present the implementation of a flexible, scalable and efficient particle-in-cell method for massively parallel finite-element codes with adaptively changing meshes. Using a modular plugin structure, we allow maximum flexibility of the generation of particles, the carried tracer properties, the advection and output algorithms, and the projection of properties to the finite-element mesh. We present scaling tests ranging up to tens of thousands of cores and tens of billions of particles. Additionally, we discuss efficient load-balancing strategies for particles in adaptive meshes with their strengths and weaknesses, local particle-transfer between parallel subdomains utilizing existing communication patterns from the finite element mesh, and the use of established parallel output algorithms like the HDF5 library. Finally, we show some relevant particle application cases, compare our implementation to a modern advection-field approach, and demonstrate under which conditions which method is more efficient. We implemented the presented methods in ASPECT (aspect.dealii.org), a freely available open-source community code for geodynamic simulations. The structure of the particle code is highly modular, and segregated from the PDE solver, and can thus be easily transferred to other programs, or adapted for various application cases.

The cDNA-derived amino acid sequence of hemoglobin II from Lucina pectinata.

PubMed

Torres-Mercado, Elineth; Renta, Jessicca Y; Rodríguez, Yolanda; López-Garriga, Juan; Cadilla, Carmen L

2003-11-01

Hemoglobin II from the clam Lucina pectinata is an oxygen-reactive protein with a unique structural organization in the heme pocket involving residues Gln65 (E7), Tyr30 (B10), Phe44 (CD1), and Phe69 (E11). We employed the reverse transcriptase-polymerase chain reaction (RT-PCR) and methods to synthesize various cDNA(HbII). An initial 300-bp cDNA clone was amplified from total RNA by RT-PCR using degenerate oligonucleotides. Gene-specific primers derived from the HbII-partial cDNA sequence were used to obtain the 5' and 3' ends of the cDNA by RACE. The length of the HbII cDNA, estimated from overlapping clones, was approximately 2114 bases. Northern blot analysis revealed that the mRNA size of HbII agrees with the estimated size using cDNA data. The coding region of the full-length HbII cDNA codes for 151 amino acids. The calculated molecular weight of HbII, including the heme group and acetylated N-terminal residue, is 17,654.07 Da.

Substitution rate and natural selection in parvovirus B19

PubMed Central

Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.

2016-01-01

The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080

Electron impact excitation of Kr XXXII

NASA Astrophysics Data System (ADS)

Aggarwal, K. M.; Keenan, F. P.; Lawson, K. D.

2009-09-01

Collision strengths (Ω) have been calculated for all 7750 transitions among the lowest 125 levels belonging to the 2s2p,2s2p,2p,2s3ℓ,2s2p3ℓ, and 2p3ℓ configurations of boron-like krypton, Kr XXXII, for which the Dirac Atomic R-matrix Code has been adopted. All partial waves with angular momentum J⩽40 have been included, sufficient for the convergence of Ω for forbidden transitions. For allowed transitions, a top-up has been included in order to obtain converged values of Ω up to an energy of 500 Ryd. Resonances in the thresholds region have been resolved in a narrow energy mesh, and results for effective collision strengths (ϒ) have been obtained after averaging the values of Ω over a Maxwellian distribution of electron velocities. Values of ϒ are reported over a wide temperature range below 107.3K, and the accuracy of the results is assessed. Values of ϒ are also listed in the temperature range 7.3⩽logTe(K)⩽9.0, obtained from the nonresonant collision strengths from the Flexible Atomic Code.

Assessment of the Partially Resolved Numerical Simulation (PRNS) Approach in the National Combustion Code (NCC) for Turbulent Nonreacting and Reacting Flows

NASA Technical Reports Server (NTRS)

Shih, Tsan-Hsing; Liu, Nan-Suey

2008-01-01

This paper describes an approach which aims at bridging the gap between the traditional Reynolds-averaged Navier-Stokes (RANS) approach and the traditional large eddy simulation (LES) approach. It has the characteristics of the very large eddy simulation (VLES) and we call this approach the partially-resolved numerical simulation (PRNS). Systematic simulations using the National Combustion Code (NCC) have been carried out for fully developed turbulent pipe flows at different Reynolds numbers to evaluate the PRNS approach. Also presented are the sample results of two demonstration cases: nonreacting flow in a single injector flame tube and reacting flow in a Lean Direct Injection (LDI) hydrogen combustor.

Feasibility and accuracy of computational robot-assisted partial nephrectomy planning by virtual partial nephrectomy analysis.

PubMed

Isotani, Shuji; Shimoyama, Hirofumi; Yokota, Isao; China, Toshiyuki; Hisasue, Shin-ichi; Ide, Hisamitsu; Muto, Satoru; Yamaguchi, Raizo; Ukimura, Osamu; Horie, Shigeo

2015-05-01

To evaluate the feasibility and accuracy of virtual partial nephrectomy analysis, including a color-coded three-dimensional virtual surgical planning and a quantitative functional analysis, in predicting the surgical outcomes of robot-assisted partial nephrectomy. Between 2012 and 2014, 20 patients underwent virtual partial nephrectomy analysis before undergoing robot-assisted partial nephrectomy. Virtual partial nephrectomy analysis was carried out with the following steps: (i) evaluation of the arterial branch for selective clamping by showing the vascular-supplied area; (ii) simulation of the optimal surgical margin in precise segmented three-dimensional model for prediction of collecting system opening; and (iii) detailed volumetric analyses and estimates of postoperative renal function based on volumetric change. At operation, the surgeon identified the targeted artery and determined the surgical margin according to the virtual partial nephrectomy analysis. The surgical outcomes between the virtual partial nephrectomy analysis and the actual robot-assisted partial nephrectomy were compared. All 20 patients had negative cancer surgical margins and no urological complications. The tumor-specific renal arterial supply areas were shown in color-coded three-dimensional model visualization in all cases. The prediction value of collecting system opening was 85.7% for sensitivity and 100% for specificity. The predicted renal resection volume was significantly correlated with actual resected specimen volume (r(2) = 0.745, P < 0.001). The predicted estimated glomerular filtration rate was significantly correlated with actual postoperative estimated glomerular filtration rate (r(2) = 0.736, P < 0.001). Virtual partial nephrectomy analysis is able to provide the identification of tumor-specific renal arterial supply, prediction of collecting system opening and prediction of postoperative renal function. This technique might allow urologists to compare various arterial clamping methods and resection margins with surgical outcomes in a non-invasive manner. © 2015 The Japanese Urological Association.

Molecular detection of bovine Noroviruses in Argentinean dairy calves: Circulation of a tentative new genotype.

PubMed

Ferragut, Fátima; Vega, Celina G; Mauroy, Axel; Conceição-Neto, Nádia; Zeller, Mark; Heylen, Elisabeth; Uriarte, Enrique Louge; Bilbao, Gladys; Bok, Marina; Matthijnssens, Jelle; Thiry, Etienne; Badaracco, Alejandra; Parreño, Viviana

2016-06-01

Bovine noroviruses are enteric pathogens detected in fecal samples of both diarrheic and non-diarrheic calves from several countries worldwide. However, epidemiological information regarding bovine noroviruses is still lacking for many important cattle producing countries from South America. In this study, three bovine norovirus genogroup III sequences were determined by conventional RT-PCR and Sanger sequencing in feces from diarrheic dairy calves from Argentina (B4836, B4848, and B4881, all collected in 2012). Phylogenetic studies based on a partial coding region for the RNA-dependent RNA polymerase (RdRp, 503 nucleotides) of these three samples suggested that two of them (B4836 and B4881) belong to genotype 2 (GIII.2) while the third one (B4848) was more closely related to genotype 1 (GIII.1) strains. By deep sequencing, the capsid region from two of these strains could be determined. This confirmed the circulation of genotype 1 (B4848) together with the presence of another sequence (B4881) sharing its highest genetic relatedness with genotype 1, but sufficiently distant to constitute a new genotype. This latter strain was shown in silico to be a recombinant: phylogenetic divergence was detected between its RNA-dependent RNA polymerase coding sequence (genotype GIII.2) and its capsid protein coding sequence (genotype GIII.1 or a potential norovirus genotype). According to this data, this strain could be the second genotype GIII.2_GIII.1 bovine norovirus recombinant described in literature worldwide. Further analysis suggested that this strain could even be a potential norovirus GIII genotype, tentatively named GIII.4. The data provides important epidemiological and evolutionary information on bovine noroviruses circulating in South America. Copyright © 2016. Published by Elsevier B.V.

THREE-DIMENSIONAL MODELING OF COHESIVE SEDIMENT TRANSPORT IN A PARTIALLY STRATIFIED MICRO-TIDAL ESTUARY TO ASSESS EFFECTIVENESS OF SEDIMENT TRAPS

EPA Science Inventory

The three-dimensional (3D) finite difference model Environmental Fluid Dynamics Code (EFDC) was used to simulate the hydrodynamics and sediment transport in a partially stratified micro-tidal estuary. The estuary modeled consisted of a 16-km reach of the St. Johns River, Florida,...

Identification of coding and non-coding mutational hotspots in cancer genomes.

PubMed

Piraino, Scott W; Furney, Simon J

2017-01-05

The identification of mutations that play a causal role in tumour development, so called "driver" mutations, is of critical importance for understanding how cancers form and how they might be treated. Several large cancer sequencing projects have identified genes that are recurrently mutated in cancer patients, suggesting a role in tumourigenesis. While the landscape of coding drivers has been extensively studied and many of the most prominent driver genes are well characterised, comparatively less is known about the role of mutations in the non-coding regions of the genome in cancer development. The continuing fall in genome sequencing costs has resulted in a concomitant increase in the number of cancer whole genome sequences being produced, facilitating systematic interrogation of both the coding and non-coding regions of cancer genomes. To examine the mutational landscapes of tumour genomes we have developed a novel method to identify mutational hotspots in tumour genomes using both mutational data and information on evolutionary conservation. We have applied our methodology to over 1300 whole cancer genomes and show that it identifies prominent coding and non-coding regions that are known or highly suspected to play a role in cancer. Importantly, we applied our method to the entire genome, rather than relying on predefined annotations (e.g. promoter regions) and we highlight recurrently mutated regions that may have resulted from increased exposure to mutational processes rather than selection, some of which have been identified previously as targets of selection. Finally, we implicate several pan-cancer and cancer-specific candidate non-coding regions, which could be involved in tumourigenesis. We have developed a framework to identify mutational hotspots in cancer genomes, which is applicable to the entire genome. This framework identifies known and novel coding and non-coding mutional hotspots and can be used to differentiate candidate driver regions from likely passenger regions susceptible to somatic mutation.

Numerical modeling of the fracture process in a three-unit all-ceramic fixed partial denture.

PubMed

Kou, Wen; Kou, Shaoquan; Liu, Hongyuan; Sjögren, Göran

2007-08-01

The main objectives were to examine the fracture mechanism and process of a ceramic fixed partial denture (FPD) framework under simulated mechanical loading using a recently developed numerical modeling code, the R-T(2D) code, and also to evaluate the suitability of R-T(2D) code as a tool for this purpose. Using the recently developed R-T(2D) code the fracture mechanism and process of a 3U yttria-tetragonal zirconia polycrystal ceramic (Y-TZP) FPD framework was simulated under static loading. In addition, the fracture pattern obtained using the numerical simulation was compared with the fracture pattern obtained in a previous laboratory test. The result revealed that the framework fracture pattern obtained using the numerical simulation agreed with that observed in a previous laboratory test. Quasi-photoelastic stress fringe pattern and acoustic emission showed that the fracture mechanism was tensile failure and that the crack started at the lower boundary of the framework. The fracture process could be followed both in step-by-step and step-in-step. Based on the findings in the current study, the R-T(2D) code seems suitable for use as a complement to other tests and clinical observations in studying stress distribution, fracture mechanism and fracture processes in ceramic FPD frameworks.

FPGA implementation of low complexity LDPC iterative decoder

NASA Astrophysics Data System (ADS)

Verma, Shivani; Sharma, Sanjay

2016-07-01

Low-density parity-check (LDPC) codes, proposed by Gallager, emerged as a class of codes which can yield very good performance on the additive white Gaussian noise channel as well as on the binary symmetric channel. LDPC codes have gained lots of importance due to their capacity achieving property and excellent performance in the noisy channel. Belief propagation (BP) algorithm and its approximations, most notably min-sum, are popular iterative decoding algorithms used for LDPC and turbo codes. The trade-off between the hardware complexity and the decoding throughput is a critical factor in the implementation of the practical decoder. This article presents introduction to LDPC codes and its various decoding algorithms followed by realisation of LDPC decoder by using simplified message passing algorithm and partially parallel decoder architecture. Simplified message passing algorithm has been proposed for trade-off between low decoding complexity and decoder performance. It greatly reduces the routing and check node complexity of the decoder. Partially parallel decoder architecture possesses high speed and reduced complexity. The improved design of the decoder possesses a maximum symbol throughput of 92.95 Mbps and a maximum of 18 decoding iterations. The article presents implementation of 9216 bits, rate-1/2, (3, 6) LDPC decoder on Xilinx XC3D3400A device from Spartan-3A DSP family.

78 FR 55687 - Notice of Intent To Grant Partially Exclusive Patent License; Silvanus, LLC

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-11

... with Naval Surface Warfare Center, Crane Div, Code OOL, Bldg 2, 300 Highway 361, Crane, IN 47522-5001. FOR FURTHER INFORMATION CONTACT: Mr. Christopher Monsey, Naval Surface Warfare Center, Crane Div, Code OOL, Bldg 2, 300 Highway 361, Crane, IN 47522-5001, telephone 812-854-4100. Authority: 35 U.S.C. 207...

76 FR 23314 - Notice of Intent To Grant Partially Exclusive Patent License; Sean Linehan

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-26

... are to be filed with Naval Surface Warfare Center, Crane Division, Code OOL, Bldg 2, 300 Highway 361, Crane, IN 47522-5001. FOR FURTHER INFORMATION CONTACT: Mr. Christopher Monsey, Naval Surface Warfare Center, Crane Division, Code OOL, Bldg 2, 300 Highway 361, Crane, IN 47522-5001, telephone 812-854-4100...

Statistical properties of DNA sequences

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

1995-01-01

We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

Genome-wide comparisons of phylogenetic similarities between partial genomic regions and the full-length genome in Hepatitis E virus genotyping.

PubMed

Wang, Shuai; Wei, Wei; Luo, Xuenong; Cai, Xuepeng

2014-01-01

Besides the complete genome, different partial genomic sequences of Hepatitis E virus (HEV) have been used in genotyping studies, making it difficult to compare the results based on them. No commonly agreed partial region for HEV genotyping has been determined. In this study, we used a statistical method to evaluate the phylogenetic performance of each partial genomic sequence from a genome wide, by comparisons of evolutionary distances between genomic regions and the full-length genomes of 101 HEV isolates to identify short genomic regions that can reproduce HEV genotype assignments based on full-length genomes. Several genomic regions, especially one genomic region at the 3'-terminal of the papain-like cysteine protease domain, were detected to have relatively high phylogenetic correlations with the full-length genome. Phylogenetic analyses confirmed the identical performances between these regions and the full-length genome in genotyping, in which the HEV isolates involved could be divided into reasonable genotypes. This analysis may be of value in developing a partial sequence-based consensus classification of HEV species.

Complete cure of persistent virus infections by antiviral siRNAs.

PubMed

Saulnier, Aure; Pelletier, Isabelle; Labadie, Karine; Colbère-Garapin, Florence

2006-01-01

Small interfering RNAs (siRNAs) have been developed as antiviral agents for mammalian cells. The capacity of specific siRNAs to prevent virus infections has been demonstrated, and there is evidence that these new antiviral agents could have a partial therapeutic effect a few days after infection. We investigated the possibility of curing a persistent infection, several months after becoming established, using an in vitro model of persistent poliovirus (PV) infection in HEp-2 cells. Despite high virus titers and the presence of PV mutants, repeated treatment with a mixture of two siRNAs targeting both noncoding and coding regions, one of them in a highly conserved region, resulted in the complete cure of the majority of persistently infected cultures. No escape mutants emerged in treated cultures. The antiviral effect of specific siRNAs, consistent with a mechanism of RNA interference, correlated with a decrease in the amount of viral RNA, until its complete disappearance, resulting in cultures cured of virions and viral RNA.

Comparison of Full and Partial Admission Flow Fields in the Simplex Turbine

NASA Technical Reports Server (NTRS)

Dorney, Daniel J.; Griffin, Lisa W.; Sondak, Douglas L.

2002-01-01

This viewgraph presentation provides information on computerized simulations of flow fields in a Simplex turbine. The motivations for the simulation were: Determining the effects of partial admission flow on rotor performance as a function of circumferential location and on unsteady rotor loading; Providing an efficient technique for determining turbine performance. The simulation used the flow code CORSAIR.

77 FR 46111 - Public Land Order No. 7792; Partial Revocation, Power Site Reserve No. 109; Montana

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-02

... DEPARTMENT OF THE INTERIOR Bureau of land management [MT-LLB05000-LL14300000-FQ0000; MTM 40412] Public Land Order No. 7792; Partial Revocation, Power Site Reserve No. 109; Montana AGENCY: Bureau of...--Policy, Management and Budget. [FR Doc. 2012-18888 Filed 8-1-12; 8:45 am] BILLING CODE 4310-DN-P ...

Genotype–phenotype correlations in Down syndrome identified by array CGH in 30 cases of partial trisomy and partial monosomy chromosome 21

PubMed Central

Lyle, Robert; Béna, Frédérique; Gagos, Sarantis; Gehrig, Corinne; Lopez, Gipsy; Schinzel, Albert; Lespinasse, James; Bottani, Armand; Dahoun, Sophie; Taine, Laurence; Doco-Fenzy, Martine; Cornillet-Lefèbvre, Pascale; Pelet, Anna; Lyonnet, Stanislas; Toutain, Annick; Colleaux, Laurence; Horst, Jürgen; Kennerknecht, Ingo; Wakamatsu, Nobuaki; Descartes, Maria; Franklin, Judy C; Florentin-Arar, Lina; Kitsiou, Sophia; Aït Yahya-Graison, Emilie; Costantine, Maher; Sinet, Pierre-Marie; Delabar, Jean M; Antonarakis, Stylianos E

2009-01-01

Down syndrome (DS) is one of the most frequent congenital birth defects, and the most common genetic cause of mental retardation. In most cases, DS results from the presence of an extra copy of chromosome 21. DS has a complex phenotype, and a major goal of DS research is to identify genotype–phenotype correlations. Cases of partial trisomy 21 and other HSA21 rearrangements associated with DS features could identify genomic regions associated with specific phenotypes. We have developed a BAC array spanning HSA21q and used array comparative genome hybridization (aCGH) to enable high-resolution mapping of pathogenic partial aneuploidies and unbalanced translocations involving HSA21. We report the identification and mapping of 30 pathogenic chromosomal aberrations of HSA21 consisting of 19 partial trisomies and 11 partial monosomies for different segments of HSA21. The breakpoints have been mapped to within ∼85 kb. The majority of the breakpoints (26 of 30) for the partial aneuploidies map within a 10-Mb region. Our data argue against a single DS critical region. We identify susceptibility regions for 25 phenotypes for DS and 27 regions for monosomy 21. However, most of these regions are still broad, and more cases are needed to narrow down the phenotypic maps to a reasonable number of candidate genomic elements per phenotype. PMID:19002211

Simultaneous perception of a spoken and a signed language: The brain basis of ASL-English code-blends

PubMed Central

Weisberg, Jill; McCullough, Stephen; Emmorey, Karen

2018-01-01

Code-blends (simultaneous words and signs) are a unique characteristic of bimodal bilingual communication. Using fMRI, we investigated code-blend comprehension in hearing native ASL-English bilinguals who made a semantic decision (edible?) about signs, audiovisual words, and semantically equivalent code-blends. English and ASL recruited a similar fronto-temporal network with expected modality differences: stronger activation for English in auditory regions of bilateral superior temporal cortex, and stronger activation for ASL in bilateral occipitotemporal visual regions and left parietal cortex. Code-blend comprehension elicited activity in a combination of these regions, and no cognitive control regions were additionally recruited. Furthermore, code-blends elicited reduced activation relative to ASL presented alone in bilateral prefrontal and visual extrastriate cortices, and relative to English alone in auditory association cortex. Consistent with behavioral facilitation observed during semantic decisions, the findings suggest that redundant semantic content induces more efficient neural processing in language and sensory regions during bimodal language integration. PMID:26177161

Optimization of a matched-filter receiver for frequency hopping code acquisition in jamming

NASA Astrophysics Data System (ADS)

Pawlowski, P. R.; Polydoros, A.

A matched-filter receiver for frequency hopping (FH) code acquisition is optimized when either partial-band tone jamming or partial-band Gaussian noise jamming is present. The receiver is matched to a segment of the FH code sequence, sums hard per-channel decisions to form a test, and uses multiple tests to verify acquisition. The length of the matched filter and the number of verification tests are fixed. Optimization is then choosing thresholds to maximize performance based upon the receiver's degree of knowledge about the jammer ('side-information'). Four levels of side-information are considered, ranging from none to complete. The latter level results in a constant-false-alarm-rate (CFAR) design. At each level, performance sensitivity to threshold choice is analyzed. Robust thresholds are chosen to maximize performance as the jammer varies its power distribution, resulting in simple design rules which aid threshold selection. Performance results, which show that optimum distributions for the jammer power over the total FH bandwidth exist, are presented.

Epidemiology of foot-and-mouth disease in Landhi Dairy Colony, Pakistan, the world largest Buffalo colony

PubMed Central

Klein, Joern; Hussain, Manzoor; Ahmad, Munir; Afzal, Muhammad; Alexandersen, Soren

2008-01-01

Background Foot-and-mouth disease (FMD) is endemic in Pakistan and causes huge economic losses. This work focus on the Landhi Dairy Colony (LDC), located in the suburbs of Karachi. LDC is the largest Buffalo colony in the world, with more than 300,000 animals (around 95% buffaloes and 5% cattle, as well as an unknown number of sheep and goats). Each month from April 2006 to April 2007 we collected mouth-swabs from apparently healthy buffaloes and cattle, applying a convenient sampling based on a two-stage random sampling scheme, in conjunction with participatory information from each selected farm. Furthermore, we also collected epithelium samples from animals with clinical disease, as well as mouth-swabs samples from those farms. In addition, we analysed a total of 180 serum samples randomly collecting 30 samples each month at the local slaughterhouse, from October 2006 to March 2007. Samples have been screened for FMDV by real-time RT-PCR and the partial or full 1D coding region of selected isolates has been sequenced. Serum samples have been analysed by applying serotype-specific antibody ELISA and non-structural proteins (NSP) antibody ELISA. Results FMDV infection prevalence at aggregate level shows an endemic occurrence of FMDV in the colony, with peaks in August 2006, December 2006 and February 2007 to March 2007. A significant association of prevalence peaks to the rainy seasons, which includes the coldest time of the year and the muslimic Eid-festival, has been demonstrated. Participatory information indicated that 88% of all questioned farmers vaccinate their animals. Analysis of the serum samples showed high levels of antibodies for serotypes O, A, Asia 1 and C. The median endpoint-titre for all tested serotypes, except serotype C, in VNT titration is at a serum dilution of equal or above 1/100. All 180 serum samples collected have been tested for antibodies against the non-structural proteins and all but four have been found positive. Out of the 106 swab-samples from apparently healthy and affected animals positive in real-time RT-PCR, we sequenced the partial or full 1D coding region from 58 samples. In addition we sequenced the full 1D coding region of 17 epithelium samples from animals with clinical signs of FMD. From all sequenced samples, swabs and epithelium, 19 belong to the regional PanAsia II lineage of serotype O and 56 to the A/Iran/2005 lineage of serotype A. Conclusion For an effective and realisable FMD control program in LDC, we suggest to introduce a twice annually mass vaccination of all buffaloes and cattle in the colony. These mass vaccinations should optimally take place shortly before the beginning of the two rainy periods, e.g. in June and September. Those vaccinations should, in our opinion, be in addition to the already individually performed vaccinations of single animals, as the latter usually targets only newly introduced animals. This suggested combination of mass vaccination of all large ruminants with the already performed individually vaccination should provide a continuous high level of herd immunity in the entire colony. Vaccines used for this purpose should contain the matching vaccine strains, i.e. as our results indicate antigens for A/Iran/2005 and the regional type of serotype O (PanAsia II), but also antigens of the, in this world region endemic, Asia 1 lineage should be included. In the long term it will be important to control the vaccine use, so that subclinical FMD will be avoided. PMID:18445264

Metalloid Aluminum Clusters with Fluorine

DTIC Science & Technology

2016-12-01

molecular dynamics, binding energy , siesta code, density of states, projected density of states 15. NUMBER OF PAGES 69 16. PRICE CODE 17. SECURITY...high energy density compared to explosives, but typically release this energy slowly via diffusion-limited combustion. There is recent interest in using...examine the cluster binding energy and electronic structure. Partial fluorine substitution in a prototypical aluminum-cyclopentadienyl cluster results

Program Code Generator for Cardiac Electrophysiology Simulation with Automatic PDE Boundary Condition Handling

PubMed Central

Punzalan, Florencio Rusty; Kunieda, Yoshitoshi; Amano, Akira

2015-01-01

Clinical and experimental studies involving human hearts can have certain limitations. Methods such as computer simulations can be an important alternative or supplemental tool. Physiological simulation at the tissue or organ level typically involves the handling of partial differential equations (PDEs). Boundary conditions and distributed parameters, such as those used in pharmacokinetics simulation, add to the complexity of the PDE solution. These factors can tailor PDE solutions and their corresponding program code to specific problems. Boundary condition and parameter changes in the customized code are usually prone to errors and time-consuming. We propose a general approach for handling PDEs and boundary conditions in computational models using a replacement scheme for discretization. This study is an extension of a program generator that we introduced in a previous publication. The program generator can generate code for multi-cell simulations of cardiac electrophysiology. Improvements to the system allow it to handle simultaneous equations in the biological function model as well as implicit PDE numerical schemes. The replacement scheme involves substituting all partial differential terms with numerical solution equations. Once the model and boundary equations are discretized with the numerical solution scheme, instances of the equations are generated to undergo dependency analysis. The result of the dependency analysis is then used to generate the program code. The resulting program code are in Java or C programming language. To validate the automatic handling of boundary conditions in the program code generator, we generated simulation code using the FHN, Luo-Rudy 1, and Hund-Rudy cell models and run cell-to-cell coupling and action potential propagation simulations. One of the simulations is based on a published experiment and simulation results are compared with the experimental data. We conclude that the proposed program code generator can be used to generate code for physiological simulations and provides a tool for studying cardiac electrophysiology. PMID:26356082

Proceedings of the 14th International Conference on the Numerical Simulation of Plasmas

NASA Astrophysics Data System (ADS)

Partial Contents are as follows: Numerical Simulations of the Vlasov-Maxwell Equations by Coupled Particle-Finite Element Methods on Unstructured Meshes; Electromagnetic PIC Simulations Using Finite Elements on Unstructured Grids; Modelling Travelling Wave Output Structures with the Particle-in-Cell Code CONDOR; SST--A Single-Slice Particle Simulation Code; Graphical Display and Animation of Data Produced by Electromagnetic, Particle-in-Cell Codes; A Post-Processor for the PEST Code; Gray Scale Rendering of Beam Profile Data; A 2D Electromagnetic PIC Code for Distributed Memory Parallel Computers; 3-D Electromagnetic PIC Simulation on the NRL Connection Machine; Plasma PIC Simulations on MIMD Computers; Vlasov-Maxwell Algorithm for Electromagnetic Plasma Simulation on Distributed Architectures; MHD Boundary Layer Calculation Using the Vortex Method; and Eulerian Codes for Plasma Simulations.

Low complexity Reed-Solomon-based low-density parity-check design for software defined optical transmission system based on adaptive puncturing decoding algorithm

NASA Astrophysics Data System (ADS)

Pan, Xiaolong; Liu, Bo; Zheng, Jianglong; Tian, Qinghua

2016-08-01

We propose and demonstrate a low complexity Reed-Solomon-based low-density parity-check (RS-LDPC) code with adaptive puncturing decoding algorithm for elastic optical transmission system. Partial received codes and the relevant column in parity-check matrix can be punctured to reduce the calculation complexity by adaptive parity-check matrix during decoding process. The results show that the complexity of the proposed decoding algorithm is reduced by 30% compared with the regular RS-LDPC system. The optimized code rate of the RS-LDPC code can be obtained after five times iteration.

Xenopus laevis ribosomal protein genes: isolation of recombinant cDNA clones and study of the genomic organization.

PubMed Central

Bozzoni, I; Beccari, E; Luo, Z X; Amaldi, F

1981-01-01

Poly-A+ mRNA from Xenopus laevis oocytes, partially enriched for r-protein coding capacity has been used as starting material for preparing a cDNA bank in plasmid pBR322. The clones containing sequences specific for r-proteins have been selected by translation of the complementary mRNAs. Clones for six different r-proteins have been identified and utilized as probes for studying their genomic organization. Two gene copies per haploid genome were found for r-proteins L1, L14, S19, and four-five for protein S1, S8 and L32. Moreover a population polymorphism has been observed for the genomic regions containing sequences for r-protein S1, S8 and L14. Images PMID:6112733

Numerical Tests of the Cosmic Censorship Conjecture with Collisionless Matter Collapse

NASA Astrophysics Data System (ADS)

Okounkova, Maria; Hemberger, Daniel; Scheel, Mark

2016-03-01

We present our results of numerical tests of the weak cosmic censorship conjecture (CCC), which states that generically, singularities of gravitational collapse are hidden within black holes, and the hoop conjecture, which states that black holes form when and only when a mass M gets compacted into a region whose circumference in every direction is C <= 4 πM . We built a smooth particle methods module in SpEC, the Spectral Einstein Code, to simultaneously evolve spacetime and collisionless matter configurations. We monitor RabcdRabcd for singularity formation, and probe for the existence of apparent horizons. We include in our simulations the prolate spheroid configurations considered in Shapiro and Teukolsky's 1991 numerical study of the CCC. This research was partially supported by the Dominic Orr Fellowship at Caltech.

Information Assurance for Network-Centric Naval Forces

DTIC Science & Technology

2010-01-01

of engineers are designing , implementing, and vigorously testing malicious codes prior to releasing them, not unlike well-funded commercial software...the likelihood that threats would partially succeed and partially degrade the system. Individual components of Aegis are designed and tested with a...of operations (CONOPS) set that is designed to work well in a low-bandwidth environment must be extensively tested and exercised within that low

Numerical Studies of Impurities in Fusion Plasmas

DOE R&D Accomplishments Database

Hulse, R. A.

1982-09-01

The coupled partial differential equations used to describe the behavior of impurity ions in magnetically confined controlled fusion plasmas require numerical solution for cases of practical interest. Computer codes developed for impurity modeling at the Princeton Plasma Physics Laboratory are used as examples of the types of codes employed for this purpose. These codes solve for the impurity ionization state densities and associated radiation rates using atomic physics appropriate for these low-density, high-temperature plasmas. The simpler codes solve local equations in zero spatial dimensions while more complex cases require codes which explicitly include transport of the impurity ions simultaneously with the atomic processes of ionization and recombination. Typical applications are discussed and computational results are presented for selected cases of interest.

Fine-scale genetic mapping of a hybrid sterility factor between Drosophila simulans and D. mauritiana: the varied and elusive functions of "speciation genes".

PubMed

Araripe, Luciana O; Montenegro, Horácio; Lemos, Bernardo; Hartl, Daniel L

2010-12-14

Hybrid male sterility (HMS) is a usual outcome of hybridization between closely related animal species. It arises because interactions between alleles that are functional within one species may be disrupted in hybrids. The identification of genes leading to hybrid sterility is of great interest for understanding the evolutionary process of speciation. In the current work we used marked P-element insertions as dominant markers to efficiently locate one genetic factor causing a severe reduction in fertility in hybrid males of Drosophila simulans and D. mauritiana. Our mapping effort identified a region of 9 kb on chromosome 3, containing three complete and one partial coding sequences. Within this region, two annotated genes are suggested as candidates for the HMS factor, based on the comparative molecular characterization and public-source information. Gene Taf1 is partially contained in the region, but yet shows high polymorphism with four fixed non-synonymous substitutions between the two species. Its molecular functions involve sequence-specific DNA binding and transcription factor activity. Gene agt is a small, intronless gene, whose molecular function is annotated as methylated-DNA-protein-cysteine S-methyltransferase activity. High polymorphism and one fixed non-synonymous substitution suggest this is a fast evolving gene. The gene trees of both genes perfectly separate D. simulans and D. mauritiana into monophyletic groups. Analysis of gene expression using microarray revealed trends that were similar to those previously found in comparisons between whole-genome hybrids and parental species. The identification following confirmation of the HMS candidate gene will add another case study leading to understanding the evolutionary process of hybrid incompatibility.

Analysis of the mitochondrial genome of cheetahs (Acinonyx jubatus) with neurodegenerative disease.

PubMed

Burger, Pamela A; Steinborn, Ralf; Walzer, Christian; Petit, Thierry; Mueller, Mathias; Schwarzenberger, Franz

2004-08-18

The complete mitochondrial genome of Acinonyx jubatus was sequenced and mitochondrial DNA (mtDNA) regions were screened for polymorphisms as candidates for the cause of a neurodegenerative demyelinating disease affecting captive cheetahs. The mtDNA reference sequences were established on the basis of the complete sequences of two diseased and two nondiseased animals as well as partial sequences of 26 further individuals. The A. jubatus mitochondrial genome is 17,047-bp long and shows a high sequence similarity (91%) to the domestic cat. Based on single nucleotide polymorphisms (SNPs) in the control region (CR) and pedigree information, the 18 myelopathic and 12 non-myelopathic cheetahs included in this study were classified into haplotypes I, II and III. In view of the phenotypic comparability of the neurodegenerative disease observed in cheetahs and human mtDNA-associated diseases, specific coding regions including the tRNAs leucine UUR, lysine, serine UCN, and partial complex I and V sequences were screened. We identified a heteroplasmic and a homoplasmic SNP at codon 507 in the subunit 5 (MTND5) of complex I. The heteroplasmic haplotype I-specific valine to methionine substitution represents a nonconservative amino acid change and was found in 11 myelopathic and eight non-myelopathic cheetahs with levels ranging from 29% to 79%. The homoplasmic conservative amino acid substitution valine to alanine was identified in two myelopathic animals of haplotype II. In addition, a synonymous SNP in the codon 76 of the MTND4L gene was found in the single haplotype III animal. The amino acid exchanges in the MTND5 gene were not associated with the occurrence of neurodegenerative disease in captive cheetahs.

The Mudawwana and Koranic Law from a Gender Perspective. The Substantial Changes in the Moroccan Family Code of 2004

ERIC Educational Resources Information Center

Cabre, Yolanda Aixela

2007-01-01

This paper shows how Koranic Law was enshrined in the Moroccan Family Code (the "Mudawwana") in its first draft between the years 1957 and 1958. The changes that were included in 1993 and especially in 2004 partially modify the philosophy of Islamic resources and give more freedom of action to women. At present, the "Mudawwana…

A critical review of measurements of water vapor absorption in the 840 to 1100 cm(-1) spectral region

NASA Technical Reports Server (NTRS)

Grant, William B.

1987-01-01

A set of eleven measurements of the water vapor continuum absorption in the 840 to 1100 sq cm spectral region is reviewed and compared with spectral models maintained by the Air Force Geophysics Laboratory. The measurements were made in four different ways: spectrometer with a White cell, CO2 laser with a White cell, CO2 laser with a spectrophone, and broadband radiation source over a long atmospheric path. Where possible, the data were selected at a water vapor partial pressure of ten torr buffered to 760 torr with N2 or synthetic air and a temperature of between 296 and 300 K. The intercomparison of the data leads to several observations and conclusions. First, there are four sets of laboratory data taken with nitrogen as the buffer gas which generally agree well mutually and with AFGL's HITRAN code. Second, there is one set of laboratory data that shows that using air as the buffer gas gives a few percent decrease in the water vapor continuum compared with using nitrogen as the buffer gas. Third, the atmospheric long-path measurements for water vapor partial pressure below about 12 torr are roughly grouped within 20 percent of the HITRAN values. Fourth, there are three sets of spectrophone data for water vapor in synthetic air which are significantly higher than any of the other measurements. This discrepancy is attributed to the effects of impurity gases in the cell.

Regional and temporal variations in coding of hospital diagnoses referring to upper gastrointestinal and oesophageal bleeding in Germany.

PubMed

Langner, Ingo; Mikolajczyk, Rafael; Garbe, Edeltraut

2011-08-17

Health insurance claims data are increasingly used for health services research in Germany. Hospital diagnoses in these data are coded according to the International Classification of Diseases, German modification (ICD-10-GM). Due to the historical division into West and East Germany, different coding practices might persist in both former parts. Additionally, the introduction of Diagnosis Related Groups (DRGs) in Germany in 2003/2004 might have changed the coding. The aim of this study was to investigate regional and temporal variations in coding of hospitalisation diagnoses in Germany. We analysed hospitalisation diagnoses for oesophageal bleeding (OB) and upper gastrointestinal bleeding (UGIB) from the official German Hospital Statistics provided by the Federal Statistical Office. Bleeding diagnoses were classified as "specific" (origin of bleeding provided) or "unspecific" (origin of bleeding not provided) coding. We studied regional (former East versus West Germany) differences in incidence of hospitalisations with specific or unspecific coding for OB and UGIB and temporal variations between 2000 and 2005. For each year, incidence ratios of hospitalisations for former East versus West Germany were estimated with log-linear regression models adjusting for age, gender and population density. Significant differences in specific and unspecific coding between East and West Germany and over time were found for both, OB and UGIB hospitalisation diagnoses, respectively. For example in 2002, incidence ratios of hospitalisations for East versus West Germany were 1.24 (95% CI 1.16-1.32) for specific and 0.67 (95% CI 0.60-0.74) for unspecific OB diagnoses and 1.43 (95% CI 1.36-1.51) for specific and 0.83 (95% CI 0.80-0.87) for unspecific UGIB. Regional differences nearly disappeared and time trends were less marked when using combined specific and unspecific diagnoses of OB or UGIB, respectively. During the study period, there were substantial regional and temporal variations in the coding of OB and UGIB diagnoses in hospitalised patients. Possible explanations for the observed regional variations are different coding preferences, further influenced by changes in coding and reimbursement rules. Analysing groups of diagnoses including specific and unspecific codes reduces the influence of varying coding practices.

Cryptic tRNAs in chaetognath mitochondrial genomes.

PubMed

Barthélémy, Roxane-Marie; Seligmann, Hervé

2016-06-01

The chaetognaths constitute a small and enigmatic phylum of little marine invertebrates. Both nuclear and mitochondrial genomes have numerous originalities, some phylum-specific. Until recently, their mitogenomes seemed containing only one tRNA gene (trnMet), but a recent study found in two chaetognath mitogenomes two and four tRNA genes. Moreover, apparently two conspecific mitogenomes have different tRNA gene numbers (one and two). Reanalyses by tRNAscan-SE and ARWEN softwares of the five available complete chaetognath mitogenomes suggest numerous additional tRNA genes from different types. Their total number never reaches the 22 found in most other invertebrates using that genetic code. Predicted error compensation between codon-anticodon mismatch and tRNA misacylation suggests translational activity by tRNAs predicted solely according to secondary structure for tRNAs predicted by tRNAscan-SE, not ARWEN. Numbers of predicted stop-suppressor (antitermination) tRNAs coevolve with predicted overlapping, frameshifted protein coding genes including stop codons. Sequence alignments in secondary structure prediction with non-chaetognath tRNAs suggest that the most likely functional tRNAs are in intergenic regions, as regular mt-tRNAs. Due to usually short intergenic regions, generally tRNA sequences partially overlap with flanking genes. Some tRNA pairs seem templated by sense-antisense strands. Moreover, 16S rRNA genes, but not 12S rRNAs, appear as tRNA nurseries, as previously suggested for multifunctional ribosomal-like protogenomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Molecular cloning and characterization of a novel RING zinc-finger protein gene up-regulated under in vitro salt stress in cassava.

PubMed

dos Reis, Sávio Pinho; Tavares, Liliane de Souza Conceição; Costa, Carinne de Nazaré Monteiro; Brígida, Aílton Borges Santa; de Souza, Cláudia Regina Batista

2012-06-01

Cassava (Manihot esculenta Crantz) is one of the world's most important food crops. It is cultivated mainly in developing countries of tropics, since its root is a major source of calories for low-income people due to its high productivity and resistance to many abiotic and biotic factors. A previous study has identified a partial cDNA sequence coding for a putative RING zinc finger in cassava storage root. The RING zinc finger protein is a specialized type of zinc finger protein found in many organisms. Here, we isolated the full-length cDNA sequence coding for M. esculenta RZF (MeRZF) protein by a combination of 5' and 3' RACE assays. BLAST analysis showed that its deduced amino acid sequence has a high level of similarity to plant proteins of RZF family. MeRZF protein contains a signature sequence motif for a RING zinc finger at its C-terminal region. In addition, this protein showed a histidine residue at the fifth coordination site, likely belonging to the RING-H2 subgroup, as confirmed by our phylogenetic analysis. There is also a transmembrane domain in its N-terminal region. Finally, semi-quantitative RT-PCR assays showed that MeRZF expression is increased in detached leaves treated with sodium chloride. Here, we report the first evidence of a RING zinc finger gene of cassava showing potential role in response to salt stress.

Implementation of the International Code of Marketing of Breastmilk Substitutes in the Eastern Mediterranean Region.

PubMed

Al Jawaldeh, Ayoub; Sayed, Ghada

2018-04-05

Optimal breastfeeding practices and appropriate complementary feeding improve child health, survival and development. The countries of the Eastern Mediterranean Region have made significant strides in formulation and implementation of legislation to protect and promote breastfeeding based on The International Code of Marketing of Breast-milk Substitutes (the Code) and subsequent relevant World Health Assembly resolutions. To assess the implementation of the Code in the Region. Assessment was conducted by the World Health Organization (WHO) Regional Office for the Eastern Mediterranean using a WHO standard questionnaire. Seventeen countries in the Region have enacted legislation to protect breastfeeding. Only 6 countries have comprehensive legislation or other legal measures reflecting all or most provisions of the Code; 4 countries have legal measures incorporating many provisions of the Code; 7 countries have legal measures that contain a few provisions of the Code; 4 countries are currently studying the issue; and only 1 country has no measures in place. Further analysis of the legislation found that the text of articles in the laws fully reflected the Code articles in only 6 countries. Most countries need to revisit and amend existing national legislation to implement fully the Code and relevant World Health Assembly resolutions, supported by systematic monitoring and reporting. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).

Improving the sensitivity and specificity of the abbreviated injury scale coding system.

PubMed Central

Kramer, C F; Barancik, J I; Thode, H C

1990-01-01

The Abbreviated Injury Scale with Epidemiologic Modifications (AIS 85-EM) was developed to make it possible to code information about anatomic injury types and locations that, although generally available from medical records, is not codable under the standard Abbreviated Injury Scale, published by the American Association for Automotive Medicine in 1985 (AIS 85). In a population-based sample of 3,223 motor vehicle trauma cases, 68 percent of the patients had one or more injuries that were coded to the AIS 85 body region nonspecific category external. When the same patients' injuries were coded using the AIS 85-EM coding procedure, only 15 percent of the patients had injuries that could not be coded to a specific body region. With AIS 85-EM, the proportion of codable head injury cases increased from 16 percent to 37 percent, thereby improving the potential for identifying cases with head and threshold brain injury. The data suggest that body region coding of all injuries is necessary to draw valid and reliable conclusions about changes in injury patterns and their sequelae. The increased specificity of body region coding improves assessments of the efficacy of injury intervention strategies and countermeasure programs using epidemiologic methodology. PMID:2116633

25 CFR 900.125 - What shall a construction contract proposal contain?

Code of Federal Regulations, 2012 CFR

2012-04-01

... tribal building codes and engineering standards; (4) Structural integrity; (5) Accountability of funds..., standards and methods (including national, regional, state, or tribal building codes or construction... methods (including national, regional, state, or tribal building codes or construction industry standards...

25 CFR 900.125 - What shall a construction contract proposal contain?

Code of Federal Regulations, 2014 CFR

2014-04-01

... tribal building codes and engineering standards; (4) Structural integrity; (5) Accountability of funds..., standards and methods (including national, regional, state, or tribal building codes or construction... methods (including national, regional, state, or tribal building codes or construction industry standards...

25 CFR 900.125 - What shall a construction contract proposal contain?

Code of Federal Regulations, 2013 CFR

2013-04-01

... tribal building codes and engineering standards; (4) Structural integrity; (5) Accountability of funds..., standards and methods (including national, regional, state, or tribal building codes or construction... methods (including national, regional, state, or tribal building codes or construction industry standards...

25 CFR 900.125 - What shall a construction contract proposal contain?

Code of Federal Regulations, 2011 CFR

2011-04-01

... tribal building codes and engineering standards; (4) Structural integrity; (5) Accountability of funds..., standards and methods (including national, regional, state, or tribal building codes or construction... methods (including national, regional, state, or tribal building codes or construction industry standards...

25 CFR 900.125 - What shall a construction contract proposal contain?

Code of Federal Regulations, 2010 CFR

2010-04-01

... tribal building codes and engineering standards; (4) Structural integrity; (5) Accountability of funds..., standards and methods (including national, regional, state, or tribal building codes or construction... methods (including national, regional, state, or tribal building codes or construction industry standards...

Quality Assessment of Mixed and Ceramic Recycled Aggregates from Construction and Demolition Wastes in the Concrete Manufacture According to the Spanish Standard †

PubMed Central

Rodríguez-Robles, Desirée; García-González, Julia; Juan-Valdés, Andrés; Pozo, Julia Mª Morán-del; Guerra-Romero, Manuel I

2014-01-01

Construction and demolition waste (CDW) constitutes an increasingly significant problem in society due to the volume generated, rendering sustainable management and disposal problematic. The aim of this study is to identify a possible reuse option in the concrete manufacturing for recycled aggregates with a significant ceramic content: mixed recycled aggregates (MixRA) and ceramic recycled aggregates (CerRA). In order to do so, several tests are conducted in accordance with the Spanish Code on Structural Concrete (EHE-08) to determine the composition in weight and physic-mechanical characteristics (particle size distributions, fine content, sand equivalent, density, water absorption, flakiness index, and resistance to fragmentation) of the samples for the partial inclusion of the recycled aggregates in concrete mixes. The results of these tests clearly support the hypothesis that this type of material may be suitable for such partial replacements if simple pretreatment is carried out. Furthermore, this measure of reuse is in line with European, national, and regional policies on sustainable development, and presents a solution to the environmental problem caused by the generation of CDW. PMID:28788164

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005

PubMed Central

Klein, Joern; Hussain, Manzoor; Ahmad, Munir; Normann, Preben; Afzal, Muhammad; Alexandersen, Soren

2007-01-01

Background According to the World Reference Laboratory for FMD, a new subtype of FMDV serotype A was detected in Iran in 2005. This subtype was designated A/IRN/2005, and rapidly spread throughout Iran and moved westwards into Saudi Arabia and Turkey where it was initially detected from August 2005 and subsequently caused major disease problems in the spring of 2006. The same subtype reached Jordan in 2007. As part of an ongoing project we have also detected this subtype in Pakistan with the first positive samples detected in April 2006. To characterise this subtype in detail, we have sequenced and analysed the complete coding sequence of three subtype A/IRN/2005 isolates collected in Pakistan in 2006, the complete coding sequence of one subtype A/IRN/2005 isolate collected during the first outbreak in Turkey in 2005 and, in addition, the partial 1D coding sequence derived from 4 epithelium samples and 34 swab-samples from Asian buffaloes or cattle subsequently found to be infected with the A/IRN/2005 subtype. Results The phylogenies of the genome regions encoding for the structural proteins, displayed, with the exception of 1A, distinct, serotype-specific clustering and an evolutionary relationship of the A/IRN/2005 sublineage with the A22 sublineage. Potential recombination events have been detected in parts of the genome region coding for the non-structural proteins of FMDV. In addition, amino acid substitutions have been detected in the deduced VP1 protein sequence, potentially related to clinical or subclinical outcome of FMD. Indications of differential susceptibility for developing a subclinical course of disease between Asian buffaloes and cattle have been detected. Furthermore, hitherto unknown insertions of 2 amino acids before the second start codon, as well as sublineage specific amino acids have been detected in the genome region encoding for the leader proteinase of A/IRN/2005 sublineage. Conclusion Our findings indicate that the A/IRN/2005 sublineage has undergone two different paths of evolution for the structural and non-structural genome regions. The structural genome regions have had their evolutionary starting point in the A22 sublineage. It can be assumed that, due to the quasispecies structure of FMDV populations and the error-prone replication process, advantageous mutations in a changed environment have been fixed and lead to the occurrence of the new A/IRN/2005 sublineage. Together with this mechanism, recombination within the non-structural genome regions, potentially modifying the virulence of the virus, may be involved in the success of this new sublineage. The possible origin of this recombinant virus may be a co-infection with Asia1 and a serotype A precursor of the A/IRN/2005 sublineage potentially within Asian Buffaloes, as these appears to relatively easy become infected, but usually without developing clinical disease and consequently showing not a strong acute inflammatory immune response against a second FMDV infection. PMID:18001482

A common class of transcripts with 5'-intron depletion, distinct early coding sequence features, and N1-methyladenosine modification.

PubMed

Cenik, Can; Chua, Hon Nian; Singh, Guramrit; Akef, Abdalla; Snyder, Michael P; Palazzo, Alexander F; Moore, Melissa J; Roth, Frederick P

2017-03-01

Introns are found in 5' untranslated regions (5'UTRs) for 35% of all human transcripts. These 5'UTR introns are not randomly distributed: Genes that encode secreted, membrane-bound and mitochondrial proteins are less likely to have them. Curiously, transcripts lacking 5'UTR introns tend to harbor specific RNA sequence elements in their early coding regions. To model and understand the connection between coding-region sequence and 5'UTR intron status, we developed a classifier that can predict 5'UTR intron status with >80% accuracy using only sequence features in the early coding region. Thus, the classifier identifies transcripts with 5 ' proximal- i ntron- m inus-like-coding regions ("5IM" transcripts). Unexpectedly, we found that the early coding sequence features defining 5IM transcripts are widespread, appearing in 21% of all human RefSeq transcripts. The 5IM class of transcripts is enriched for non-AUG start codons, more extensive secondary structure both preceding the start codon and near the 5' cap, greater dependence on eIF4E for translation, and association with ER-proximal ribosomes. 5IM transcripts are bound by the exon junction complex (EJC) at noncanonical 5' proximal positions. Finally, N 1 -methyladenosines are specifically enriched in the early coding regions of 5IM transcripts. Taken together, our analyses point to the existence of a distinct 5IM class comprising ∼20% of human transcripts. This class is defined by depletion of 5' proximal introns, presence of specific RNA sequence features associated with low translation efficiency, N 1 -methyladenosines in the early coding region, and enrichment for noncanonical binding by the EJC. © 2017 Cenik et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Determining coding CpG islands by identifying regions significant for pattern statistics on Markov chains.

PubMed

Singer, Meromit; Engström, Alexander; Schönhuth, Alexander; Pachter, Lior

2011-09-23

Recent experimental and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may be subjected to both genomic and epigenomic constraint. It is therefore of interest to identify coding CpG islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying such islands is that coding exons exhibit sequence biases determined by codon usage and constraints that must be taken into account. We present a method for finding CCGIs that showcases a novel approach we have developed for identifying regions of interest that are significant (with respect to a Markov chain) for the counts of any pattern. Our method begins with the exact computation of tail probabilities for the number of CpGs in all regions contained in coding exons, and then applies a greedy algorithm for selecting islands from among the regions. We show that the greedy algorithm provably optimizes a biologically motivated criterion for selecting islands while controlling the false discovery rate. We applied this approach to the human genome (hg18) and annotated CpG islands in coding exons. The statistical criterion we apply to evaluating islands reduces the number of false positives in existing annotations, while our approach to defining islands reveals significant numbers of undiscovered CCGIs in coding exons. Many of these appear to be examples of functional epigenetic specialization in coding exons.

User's guide to computer programs JET 5A and CIVM-JET 5B to calculate the large elastic-plastic dynamically-induced deformations of multilayer partial and/or complete structural rings

NASA Technical Reports Server (NTRS)

Wu, R. W. H.; Stagliano, T. R.; Witmer, E. A.; Spilker, R. L.

1978-01-01

These structural ring deflections lie essentially in one plane and, hence, are called two-dimensional (2-d). The structural rings may be complete or partial; the former may be regarded as representing a fragment containment ring while the latter may be viewed as a 2-d fragment-deflector structure. These two types of rings may be either free or supported in various ways (pinned-fixed, locally clamped, elastic-foundation supported, mounting-bracket supported, etc.). The initial geometry of each ring may be circular or arbitrarily curved; uniform-thickness or variable-thickness rings may be analyzed. Strain-hardening and strain-rate effects of initially-isotropic material are taken into account. An approximate analysis utilizing kinetic energy and momentum conservation relations is used to predict the after-impact velocities of each fragment and of the impact-affected region of the ring; this procedure is termed the collision-imparted velocity method (CIVM) and is used in the CIVM-JET 5 B program. This imparted-velocity information is used in conjunction with a finite-element structural response computation code to predict the transient, large-deflection, elastic-plastic responses of the ring. Similarly, the equations of motion of each fragment are solved in small steps in time. Provisions are made in the CIVM-JET 5B code to analyze structural ring response to impact attack by from 1 to 3 fragments, each with its own size, mass, translational velocity components, and rotational velocity. The effects of friction between each fragment and the impacted ring are included.

Preparation of highly multiplexed small RNA sequencing libraries.

PubMed

Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos

2017-08-01

MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.

A new user-assisted segmentation and tracking technique for an object-based video editing system

NASA Astrophysics Data System (ADS)

Yu, Hong Y.; Hong, Sung-Hoon; Lee, Mike M.; Choi, Jae-Gark

2004-03-01

This paper presents a semi-automatic segmentation method which can be used to generate video object plane (VOP) for object based coding scheme and multimedia authoring environment. Semi-automatic segmentation can be considered as a user-assisted segmentation technique. A user can initially mark objects of interest around the object boundaries and then the user-guided and selected objects are continuously separated from the unselected areas through time evolution in the image sequences. The proposed segmentation method consists of two processing steps: partially manual intra-frame segmentation and fully automatic inter-frame segmentation. The intra-frame segmentation incorporates user-assistance to define the meaningful complete visual object of interest to be segmentation and decides precise object boundary. The inter-frame segmentation involves boundary and region tracking to obtain temporal coherence of moving object based on the object boundary information of previous frame. The proposed method shows stable efficient results that could be suitable for many digital video applications such as multimedia contents authoring, content based coding and indexing. Based on these results, we have developed objects based video editing system with several convenient editing functions.

Electron impact excitation of Kr XXVIII

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aggarwal, K.M., E-mail: K.Aggarwal@qub.ac.u; Keenan, F.P.; Lawson, K.D.

2011-05-15

Collision strengths ({Omega}) are calculated for all 6328 transitions among the lowest 113 levels belonging to the 2s{sup 2}2p{sup 5},2s2p{sup 6},2s{sup 2}2p{sup 4}3l,2s2p{sup 5}3l, and 2p{sup 6}3l configurations of fluorine-like krypton, Kr XXVIII, using the Dirac Atomic R-matrix Code. All partial waves with angular momentum J{<=}40 are included, sufficient for the convergence of {Omega} for forbidden transitions. For allowed transitions a top-up is employed to obtain converged values of {Omega} up to an energy of 400 Ryd. Resonances in the thresholds region are resolved on a narrow energy mesh, and results for effective collision strengths (Y) are obtained after averagingmore » the values of {Omega} over a Maxwellian distribution of electron velocities. Values of Y are reported over a wide temperature range below 10{sup 7.1}K, and the accuracy of the results is assessed. In addition, effective collision strengths are listed for the temperature range 7.0{<=}logT{sub e}(K){<=}9.0, obtained from non-resonant collision strengths generated with the FAC code.« less

Monte Carlo Simulation Modeling of a Regional Stroke Team's Use of Telemedicine.

PubMed

Torabi, Elham; Froehle, Craig M; Lindsell, Christopher J; Moomaw, Charles J; Kanter, Daniel; Kleindorfer, Dawn; Adeoye, Opeolu

2016-01-01

The objective of this study was to evaluate operational policies that may improve the proportion of eligible stroke patients within a population who would receive intravenous recombinant tissue plasminogen activator (rt-PA) and minimize time to treatment in eligible patients. In the context of a regional stroke team, the authors examined the effects of staff location and telemedicine deployment policies on the timeliness of thrombolytic treatment, and estimated the efficacy and cost-effectiveness of six different policies. A process map comprising the steps from recognition of stroke symptoms to intravenous administration of rt-PA was constructed using data from published literature combined with expert opinion. Six scenarios were investigated: telemedicine deployment (none, all, or outer-ring hospitals only) and staff location (center of region or anywhere in region). Physician locations were randomly generated based on their zip codes of residence and work. The outcomes of interest were onset-to-treatment (OTT) time, door-to-needle (DTN) time, and the proportion of patients treated within 3 hours. A Monte Carlo simulation of the stroke team care-delivery system was constructed based on a primary data set of 121 ischemic stroke patients who were potentially eligible for treatment with rt-PA. With the physician located randomly in the region, deploying telemedicine at all hospitals in the region (compared with partial or no telemedicine) would result in the highest rates of treatment within 3 hours (80% vs. 75% vs. 70%) and the shortest OTT (148 vs. 164 vs. 176 minutes) and DTN (45 vs. 61 vs. 73 minutes) times. However, locating the on-call physician centrally coupled with partial telemedicine deployment (five of the 17 hospitals) would be most cost-effective with comparable eligibility and treatment times. Given the potential societal benefits, continued efforts to deploy telemedicine appear warranted. Aligning the incentives between those who would have to fund the up-front technology investments and those who will benefit over time from reduced ongoing health care expenses will be necessary to fully realize the benefits of telemedicine for stroke care. © 2015 by the Society for Academic Emergency Medicine.

A motion compensation technique using sliced blocks and its application to hybrid video coding

NASA Astrophysics Data System (ADS)

Kondo, Satoshi; Sasai, Hisao

2005-07-01

This paper proposes a new motion compensation method using "sliced blocks" in DCT-based hybrid video coding. In H.264 ? MPEG-4 Advance Video Coding, a brand-new international video coding standard, motion compensation can be performed by splitting macroblocks into multiple square or rectangular regions. In the proposed method, on the other hand, macroblocks or sub-macroblocks are divided into two regions (sliced blocks) by an arbitrary line segment. The result is that the shapes of the segmented regions are not limited to squares or rectangles, allowing the shapes of the segmented regions to better match the boundaries between moving objects. Thus, the proposed method can improve the performance of the motion compensation. In addition, adaptive prediction of the shape according to the region shape of the surrounding macroblocks can reduce overheads to describe shape information in the bitstream. The proposed method also has the advantage that conventional coding techniques such as mode decision using rate-distortion optimization can be utilized, since coding processes such as frequency transform and quantization are performed on a macroblock basis, similar to the conventional coding methods. The proposed method is implemented in an H.264-based P-picture codec and an improvement in bit rate of 5% is confirmed in comparison with H.264.

Validation of Multitemperature Nozzle Flow Code

NASA Technical Reports Server (NTRS)

Park, Chul; Lee, Seung -Ho.

1994-01-01

A computer code nozzle in n-temperatures (NOZNT), which calculates one-dimensional flows of partially dissociated and ionized air in an expanding nozzle, is tested against three existing sets of experimental data taken in arcjet wind tunnels. The code accounts for the differences among various temperatures, i.e., translational-rotational temperature, vibrational temperatures of individual molecular species, and electron-electronic temperature, and the effects of impurities. The experimental data considered are (1) the spectroscopic emission data; (2) electron beam data on vibrational temperature; and (3) mass-spectrometric species concentration data. It is shown that the impurities are inconsequential for the arcjet flows, and the NOZNT code is validated by numerically reproducing the experimental data.

Scaling features of noncoding DNA

NASA Technical Reports Server (NTRS)

Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.

1999-01-01

We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

Regional Haze Plan for Texas and Oklahoma

EPA Pesticide Factsheets

EPA partially approved and partially disapproved the Texas regional haze plan. EPA also finalized a plan to limit sulfur dioxide emissions from eight Texas coal-fired electricity generating facilities

ScaffoldSeq: Software for characterization of directed evolution populations.

PubMed

Woldring, Daniel R; Holec, Patrick V; Hackel, Benjamin J

2016-07-01

ScaffoldSeq is software designed for the numerous applications-including directed evolution analysis-in which a user generates a population of DNA sequences encoding for partially diverse proteins with related functions and would like to characterize the single site and pairwise amino acid frequencies across the population. A common scenario for enzyme maturation, antibody screening, and alternative scaffold engineering involves naïve and evolved populations that contain diversified regions, varying in both sequence and length, within a conserved framework. Analyzing the diversified regions of such populations is facilitated by high-throughput sequencing platforms; however, length variability within these regions (e.g., antibody CDRs) encumbers the alignment process. To overcome this challenge, the ScaffoldSeq algorithm takes advantage of conserved framework sequences to quickly identify diverse regions. Beyond this, unintended biases in sequence frequency are generated throughout the experimental workflow required to evolve and isolate clones of interest prior to DNA sequencing. ScaffoldSeq software uniquely handles this issue by providing tools to quantify and remove background sequences, cluster similar protein families, and dampen the impact of dominant clones. The software produces graphical and tabular summaries for each region of interest, allowing users to evaluate diversity in a site-specific manner as well as identify epistatic pairwise interactions. The code and detailed information are freely available at http://research.cems.umn.edu/hackel. Proteins 2016; 84:869-874. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Partially coherent wavefront propagation simulations: Mirror and monochromator crystal quality assessment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiegart, L., E-mail: lwiegart@bnl.gov; Fluerasu, A.; Chubar, O.

2016-07-27

We have applied fully-and partially-coherent synchrotron radiation wavefront propagation simulations, implemented in the “Synchrotron Radiation Workshop” (SRW) computer code, to analyse the effects of imperfect mirrors and monochromator at the Coherent Hard X-ray beamline. This beamline is designed for X-ray Photon Correlation Spectroscopy, a technique that heavily relies on the partial coherence of the X-ray beam and benefits from a careful preservation of the X-ray wavefront. We present simulations and a comparison with the measured beam profile at the sample position, which show the impact of imperfect optics on the wavefront.

Context adaptive binary arithmetic coding-based data hiding in partially encrypted H.264/AVC videos

NASA Astrophysics Data System (ADS)

Xu, Dawen; Wang, Rangding

2015-05-01

A scheme of data hiding directly in a partially encrypted version of H.264/AVC videos is proposed which includes three parts, i.e., selective encryption, data embedding and data extraction. Selective encryption is performed on context adaptive binary arithmetic coding (CABAC) bin-strings via stream ciphers. By careful selection of CABAC entropy coder syntax elements for selective encryption, the encrypted bitstream is format-compliant and has exactly the same bit rate. Then a data-hider embeds the additional data into partially encrypted H.264/AVC videos using a CABAC bin-string substitution technique without accessing the plaintext of the video content. Since bin-string substitution is carried out on those residual coefficients with approximately the same magnitude, the quality of the decrypted video is satisfactory. Video file size is strictly preserved even after data embedding. In order to adapt to different application scenarios, data extraction can be done either in the encrypted domain or in the decrypted domain. Experimental results have demonstrated the feasibility and efficiency of the proposed scheme.

Partial least squares correspondence analysis: A framework to simultaneously analyze behavioral and genetic data.

PubMed

Beaton, Derek; Dunlop, Joseph; Abdi, Hervé

2016-12-01

For nearly a century, detecting the genetic contributions to cognitive and behavioral phenomena has been a core interest for psychological research. Recently, this interest has been reinvigorated by the availability of genotyping technologies (e.g., microarrays) that provide new genetic data, such as single nucleotide polymorphisms (SNPs). These SNPs-which represent pairs of nucleotide letters (e.g., AA, AG, or GG) found at specific positions on human chromosomes-are best considered as categorical variables, but this coding scheme can make difficult the multivariate analysis of their relationships with behavioral measurements, because most multivariate techniques developed for the analysis between sets of variables are designed for quantitative variables. To palliate this problem, we present a generalization of partial least squares-a technique used to extract the information common to 2 different data tables measured on the same observations-called partial least squares correspondence analysis-that is specifically tailored for the analysis of categorical and mixed ("heterogeneous") data types. Here, we formally define and illustrate-in a tutorial format-how partial least squares correspondence analysis extends to various types of data and design problems that are particularly relevant for psychological research that include genetic data. We illustrate partial least squares correspondence analysis with genetic, behavioral, and neuroimaging data from the Alzheimer's Disease Neuroimaging Initiative. R code is available on the Comprehensive R Archive Network and via the authors' websites. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Competitive region orientation code for palmprint verification and identification

NASA Astrophysics Data System (ADS)

Tang, Wenliang

2015-11-01

Orientation features of the palmprint have been widely investigated in coding-based palmprint-recognition methods. Conventional orientation-based coding methods usually used discrete filters to extract the orientation feature of palmprint. However, in real operations, the orientations of the filter usually are not consistent with the lines of the palmprint. We thus propose a competitive region orientation-based coding method. Furthermore, an effective weighted balance scheme is proposed to improve the accuracy of the extracted region orientation. Compared with conventional methods, the region orientation of the palmprint extracted using the proposed method can precisely and robustly describe the orientation feature of the palmprint. Extensive experiments on the baseline PolyU and multispectral palmprint databases are performed and the results show that the proposed method achieves a promising performance in comparison to conventional state-of-the-art orientation-based coding methods in both palmprint verification and identification.

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

PubMed Central

Liu, X; Gorovsky, M A

1996-01-01

A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

Landing Hazard Avoidance Display

NASA Technical Reports Server (NTRS)

Abernathy, Michael Franklin (Inventor); Hirsh, Robert L. (Inventor)

2016-01-01

Landing hazard avoidance displays can provide rapidly understood visual indications of where it is safe to land a vehicle and where it is unsafe to land a vehicle. Color coded maps can indicate zones in two dimensions relative to the vehicles position where it is safe to land. The map can be simply green (safe) and red (unsafe) areas with an indication of scale or can be a color coding of another map such as a surface map. The color coding can be determined in real time based on topological measurements and safety criteria to thereby adapt to dynamic, unknown, or partially known environments.

Kranc: a Mathematica package to generate numerical codes for tensorial evolution equations

NASA Astrophysics Data System (ADS)

Husa, Sascha; Hinder, Ian; Lechner, Christiane

2006-06-01

We present a suite of Mathematica-based computer-algebra packages, termed "Kranc", which comprise a toolbox to convert certain (tensorial) systems of partial differential evolution equations to parallelized C or Fortran code for solving initial boundary value problems. Kranc can be used as a "rapid prototyping" system for physicists or mathematicians handling very complicated systems of partial differential equations, but through integration into the Cactus computational toolkit we can also produce efficient parallelized production codes. Our work is motivated by the field of numerical relativity, where Kranc is used as a research tool by the authors. In this paper we describe the design and implementation of both the Mathematica packages and the resulting code, we discuss some example applications, and provide results on the performance of an example numerical code for the Einstein equations. Program summaryTitle of program: Kranc Catalogue identifier: ADXS_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADXS_v1_0 Program obtainable from: CPC Program Library, Queen's University of Belfast, N. Ireland Distribution format: tar.gz Computer for which the program is designed and others on which it has been tested: General computers which run Mathematica (for code generation) and Cactus (for numerical simulations), tested under Linux Programming language used: Mathematica, C, Fortran 90 Memory required to execute with typical data: This depends on the number of variables and gridsize, the included ADM example requires 4308 KB Has the code been vectorized or parallelized: The code is parallelized based on the Cactus framework. Number of bytes in distributed program, including test data, etc.: 1 578 142 Number of lines in distributed program, including test data, etc.: 11 711 Nature of physical problem: Solution of partial differential equations in three space dimensions, which are formulated as an initial value problem. In particular, the program is geared towards handling very complex tensorial equations as they appear, e.g., in numerical relativity. The worked out examples comprise the Klein-Gordon equations, the Maxwell equations, and the ADM formulation of the Einstein equations. Method of solution: The method of numerical solution is finite differencing and method of lines time integration, the numerical code is generated through a high level Mathematica interface. Restrictions on the complexity of the program: Typical numerical relativity applications will contain up to several dozen evolution variables and thousands of source terms, Cactus applications have shown scaling up to several thousand processors and grid sizes exceeding 500 3. Typical running time: This depends on the number of variables and the grid size: the included ADM example takes approximately 100 seconds on a 1600 MHz Intel Pentium M processor. Unusual features of the program: based on Mathematica and Cactus

Maximum-likelihood soft-decision decoding of block codes using the A* algorithm

NASA Technical Reports Server (NTRS)

Ekroot, L.; Dolinar, S.

1994-01-01

The A* algorithm finds the path in a finite depth binary tree that optimizes a function. Here, it is applied to maximum-likelihood soft-decision decoding of block codes where the function optimized over the codewords is the likelihood function of the received sequence given each codeword. The algorithm considers codewords one bit at a time, making use of the most reliable received symbols first and pursuing only the partially expanded codewords that might be maximally likely. A version of the A* algorithm for maximum-likelihood decoding of block codes has been implemented for block codes up to 64 bits in length. The efficiency of this algorithm makes simulations of codes up to length 64 feasible. This article details the implementation currently in use, compares the decoding complexity with that of exhaustive search and Viterbi decoding algorithms, and presents performance curves obtained with this implementation of the A* algorithm for several codes.

Detecting the borders between coding and non-coding DNA regions in prokaryotes based on recursive segmentation and nucleotide doublets statistics

PubMed Central

2012-01-01

Background Detecting the borders between coding and non-coding regions is an essential step in the genome annotation. And information entropy measures are useful for describing the signals in genome sequence. However, the accuracies of previous methods of finding borders based on entropy segmentation method still need to be improved. Methods In this study, we first applied a new recursive entropic segmentation method on DNA sequences to get preliminary significant cuts. A 22-symbol alphabet is used to capture the differential composition of nucleotide doublets and stop codon patterns along three phases in both DNA strands. This process requires no prior training datasets. Results Comparing with the previous segmentation methods, the experimental results on three bacteria genomes, Rickettsia prowazekii, Borrelia burgdorferi and E.coli, show that our approach improves the accuracy for finding the borders between coding and non-coding regions in DNA sequences. Conclusions This paper presents a new segmentation method in prokaryotes based on Jensen-Rényi divergence with a 22-symbol alphabet. For three bacteria genomes, comparing to A12_JR method, our method raised the accuracy of finding the borders between protein coding and non-coding regions in DNA sequences. PMID:23282225

Numerical Tests of the Cosmic Censorship Conjecture via Event-Horizon Finding

NASA Astrophysics Data System (ADS)

Okounkova, Maria; Ott, Christian; Scheel, Mark; Szilagyi, Bela

2015-04-01

We present the current state of our research on the possibility of naked singularity formation in gravitational collapse, numerically testing both the cosmic censorship conjecture and the hoop conjecture. The former of these posits that all singularities lie behind an event horizon, while the later conjectures that this is true if collapse occurs from an initial configuration with all circumferences C <= 4 πM . We reconsider the classical Shapiro & Teukolsky (1991) prolate spheroid naked singularity scenario. Using the exponentially error-convergent Spectral Einstein Code (SpEC) we simulate the collapse of collisionless matter and probe for apparent horizons. We propose a new method to probe for the existence of an event horizon by following characteristic from regions near the singularity, using methods commonly employed in Cauchy characteristic extraction. This research was partially supported by NSF under Award No. PHY-1404569.

Analysis of partial-reflection data from the solar eclipse of 10 Jul. 1972. [ground-based experiment using vertical incident radio waves partially reflected from D region

NASA Technical Reports Server (NTRS)

Bean, T. A.; Bowhill, S. A.

1973-01-01

Partial-reflection data collected for the eclipse of July 10, 1972 as well as for July 9 and 11, 1972, are analyzed to determine eclipse effects on D-region electron densities. The partial-reflection experiment was set up to collect data using an on-line PDP-15 computer and DECtape storage. The electron-density profiles show good agreement with results from other eclipses. The partial-reflection programs were changed after the eclipse data collection to improve the operation of the partial-reflection system. These changes were mainly due to expanded computer hardware and have simplified the operations of the system considerably.

Non-linear dynamics of compound sawteeth in tokamaks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahn, J.-H., E-mail: jae-heon.ahn@polytechnique.edu; Garbet, X.; Sabot, R.

2016-05-15

Compound sawteeth is studied with the XTOR-2F code. Non-linear full 3D magnetohydrodynamic simulations show that the plasma hot core is radially displaced and rotates during the partial crash, but is not fully expelled out of the q = 1 surface. Partial crashes occur when the radius of the q = 1 surface exceeds a critical value, at fixed poloidal beta. This critical value depends on the plasma elongation. The partial crash time is larger than the collapse time of an ordinary sawtooth, likely due to a weaker diamagnetic stabilization. This suggests that partial crashes result from a competition between destabilizing effects such as themore » q = 1 radius and diamagnetic stabilization.« less

The role of partial ionization effects in the chromosphere

PubMed Central

Martínez-Sykora, Juan; De Pontieu, Bart; Hansteen, Viggo; Carlsson, Mats

2015-01-01

The energy for the coronal heating must be provided from the convection zone. However, the amount and the method by which this energy is transferred into the corona depend on the properties of the lower atmosphere and the corona itself. We review: (i) how the energy could be built in the lower solar atmosphere, (ii) how this energy is transferred through the solar atmosphere, and (iii) how the energy is finally dissipated in the chromosphere and/or corona. Any mechanism of energy transport has to deal with the various physical processes in the lower atmosphere. We will focus on a physical process that seems to be highly important in the chromosphere and not deeply studied until recently: the ion–neutral interaction effects in the chromosphere. We review the relevance and the role of the partial ionization in the chromosphere and show that this process actually impacts considerably the outer solar atmosphere. We include analysis of our 2.5D radiative magnetohydrodynamic simulations with the Bifrost code (Gudiksen et al. 2011 Astron. Astrophys. 531, A154 (doi:10.1051/0004-6361/201116520)) including the partial ionization effects on the chromosphere and corona and thermal conduction along magnetic field lines. The photosphere, chromosphere and transition region are partially ionized and the interaction between ionized particles and neutral particles has important consequences on the magneto-thermodynamics of these layers. The partial ionization effects are treated using generalized Ohm's law, i.e. we consider the Hall term and the ambipolar diffusion (Pedersen dissipation) in the induction equation. The interaction between the different species affects the modelled atmosphere as follows: (i) the ambipolar diffusion dissipates magnetic energy and increases the minimum temperature in the chromosphere and (ii) the upper chromosphere may get heated and expanded over a greater range of heights. These processes reveal appreciable differences between the modelled atmospheres of simulations with and without ion–neutral interaction effects. PMID:25897096

Role of Alternative Polyadenylation during Adipogenic Differentiation: An In Silico Approach

PubMed Central

Spangenberg, Lucía; Correa, Alejandro; Dallagiovanna, Bruno; Naya, Hugo

2013-01-01

Post-transcriptional regulation of stem cell differentiation is far from being completely understood. Changes in protein levels are not fully correlated with corresponding changes in mRNAs; the observed differences might be partially explained by post-transcriptional regulation mechanisms, such as alternative polyadenylation. This would involve changes in protein binding, transcript usage, miRNAs and other non-coding RNAs. In the present work we analyzed the distribution of alternative transcripts during adipogenic differentiation and the potential role of miRNAs in post-transcriptional regulation. Our in silico analysis suggests a modest, consistent, bias in 3′UTR lengths during differentiation enabling a fine-tuned transcript regulation via small non-coding RNAs. Including these effects in the analyses partially accounts for the observed discrepancies in relative abundance of protein and mRNA. PMID:24143171

Brief surgical procedure code lists for outcomes measurement and quality improvement in resource-limited settings.

PubMed

Liu, Charles; Kayima, Peter; Riesel, Johanna; Situma, Martin; Chang, David; Firth, Paul

2017-11-01

The lack of a classification system for surgical procedures in resource-limited settings hinders outcomes measurement and reporting. Existing procedure coding systems are prohibitively large and expensive to implement. We describe the creation and prospective validation of 3 brief procedure code lists applicable in low-resource settings, based on analysis of surgical procedures performed at Mbarara Regional Referral Hospital, Uganda's second largest public hospital. We reviewed operating room logbooks to identify all surgical operations performed at Mbarara Regional Referral Hospital during 2014. Based on the documented indication for surgery and procedure(s) performed, we assigned each operation up to 4 procedure codes from the International Classification of Diseases, 9th Revision, Clinical Modification. Coding of procedures was performed by 2 investigators, and a random 20% of procedures were coded by both investigators. These codes were aggregated to generate procedure code lists. During 2014, 6,464 surgical procedures were performed at Mbarara Regional Referral Hospital, to which we assigned 435 unique procedure codes. Substantial inter-rater reliability was achieved (κ = 0.7037). The 111 most common procedure codes accounted for 90% of all codes assigned, 180 accounted for 95%, and 278 accounted for 98%. We considered these sets of codes as 3 procedure code lists. In a prospective validation, we found that these lists described 83.2%, 89.2%, and 92.6% of surgical procedures performed at Mbarara Regional Referral Hospital during August to September of 2015, respectively. Empirically generated brief procedure code lists based on International Classification of Diseases, 9th Revision, Clinical Modification can be used to classify almost all surgical procedures performed at a Ugandan referral hospital. Such a standardized procedure coding system may enable better surgical data collection for administration, research, and quality improvement in resource-limited settings. Copyright © 2017 Elsevier Inc. All rights reserved.

Open-path FTIR data reduction algorithm with atmospheric absorption corrections: the NONLIN code

NASA Astrophysics Data System (ADS)

Phillips, William; Russwurm, George M.

1999-02-01

This paper describes the progress made to date in developing, testing, and refining a data reduction computer code, NONLIN, that alleviates many of the difficulties experienced in the analysis of open path FTIR data. Among the problems that currently effect FTIR open path data quality are: the inability to obtain a true I degree or background, spectral interferences of atmospheric gases such as water vapor and carbon dioxide, and matching the spectral resolution and shift of the reference spectra to a particular field instrument. This algorithm is based on a non-linear fitting scheme and is therefore not constrained by many of the assumptions required for the application of linear methods such as classical least squares (CLS). As a result, a more realistic mathematical model of the spectral absorption measurement process can be employed in the curve fitting process. Applications of the algorithm have proven successful in circumventing open path data reduction problems. However, recent studies, by one of the authors, of the temperature and pressure effects on atmospheric absorption indicate there exist temperature and water partial pressure effects that should be incorporated into the NONLIN algorithm for accurate quantification of gas concentrations. This paper investigates the sources of these phenomena. As a result of this study a partial pressure correction has been employed in NONLIN computer code. Two typical field spectra are examined to determine what effect the partial pressure correction has on gas quantification.

Localization of the lysine epsilon-aminotransferase (lat) and delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase (pcbAB) genes from Streptomyces clavuligerus and production of lysine epsilon-aminotransferase activity in Escherichia coli.

PubMed Central

Tobin, M B; Kovacevic, S; Madduri, K; Hoskins, J A; Skatrud, P L; Vining, L C; Stuttard, C; Miller, J R

1991-01-01

Lysine epsilon-aminotransferase (LAT) in the beta-lactam-producing actinomycetes is considered to be the first step in the antibiotic biosynthetic pathway. Cloning of restriction fragments from Streptomyces clavuligerus, a beta-lactam producer, into Streptomyces lividans, a nonproducer that lacks LAT activity, led to the production of LAT in the host. DNA sequencing of restriction fragments containing the putative lat gene revealed a single open reading frame encoding a polypeptide with an approximately Mr 49,000. Expression of this coding sequence in Escherichia coli led to the production of LAT activity. Hence, LAT activity in S. clavuligerus is derived from a single polypeptide. A second open reading frame began immediately downstream from lat. Comparison of this partial sequence with the sequences of delta-(L-alpha-aminoadipyl)-L-cysteinyl-D valine (ACV) synthetases from Penicillium chrysogenum and Cephalosporium acremonium and with nonribosomal peptide synthetases (gramicidin S and tyrocidine synthetases) found similarities among the open reading frames. Since mapping of the putative N and C termini of S. clavuligerus pcbAB suggests that the coding region occupies approximately 12 kbp and codes for a polypeptide related in size to the fungal ACV synthetases, the molecular characterization of the beta-lactam biosynthetic cluster between pcbC and cefE (approximately 25 kbp) is nearly complete. Images PMID:1917855

N-terminal Proteomics Assisted Profiling of the Unexplored Translation Initiation Landscape in Arabidopsis thaliana *

PubMed Central

Ndah, Elvis; Jonckheere, Veronique

2017-01-01

Proteogenomics is an emerging research field yet lacking a uniform method of analysis. Proteogenomic studies in which N-terminal proteomics and ribosome profiling are combined, suggest that a high number of protein start sites are currently missing in genome annotations. We constructed a proteogenomic pipeline specific for the analysis of N-terminal proteomics data, with the aim of discovering novel translational start sites outside annotated protein coding regions. In summary, unidentified MS/MS spectra were matched to a specific N-terminal peptide library encompassing protein N termini encoded in the Arabidopsis thaliana genome. After a stringent false discovery rate filtering, 117 protein N termini compliant with N-terminal methionine excision specificity and indicative of translation initiation were found. These include N-terminal protein extensions and translation from transposable elements and pseudogenes. Gene prediction provided supporting protein-coding models for approximately half of the protein N termini. Besides the prediction of functional domains (partially) contained within the newly predicted ORFs, further supporting evidence of translation was found in the recently released Araport11 genome re-annotation of Arabidopsis and computational translations of sequences stored in public repositories. Most interestingly, complementary evidence by ribosome profiling was found for 23 protein N termini. Finally, by analyzing protein N-terminal peptides, an in silico analysis demonstrates the applicability of our N-terminal proteogenomics strategy in revealing protein-coding potential in species with well- and poorly-annotated genomes. PMID:28432195

N-terminal Proteomics Assisted Profiling of the Unexplored Translation Initiation Landscape in Arabidopsis thaliana.

PubMed

Willems, Patrick; Ndah, Elvis; Jonckheere, Veronique; Stael, Simon; Sticker, Adriaan; Martens, Lennart; Van Breusegem, Frank; Gevaert, Kris; Van Damme, Petra

2017-06-01

Proteogenomics is an emerging research field yet lacking a uniform method of analysis. Proteogenomic studies in which N-terminal proteomics and ribosome profiling are combined, suggest that a high number of protein start sites are currently missing in genome annotations. We constructed a proteogenomic pipeline specific for the analysis of N-terminal proteomics data, with the aim of discovering novel translational start sites outside annotated protein coding regions. In summary, unidentified MS/MS spectra were matched to a specific N-terminal peptide library encompassing protein N termini encoded in the Arabidopsis thaliana genome. After a stringent false discovery rate filtering, 117 protein N termini compliant with N-terminal methionine excision specificity and indicative of translation initiation were found. These include N-terminal protein extensions and translation from transposable elements and pseudogenes. Gene prediction provided supporting protein-coding models for approximately half of the protein N termini. Besides the prediction of functional domains (partially) contained within the newly predicted ORFs, further supporting evidence of translation was found in the recently released Araport11 genome re-annotation of Arabidopsis and computational translations of sequences stored in public repositories. Most interestingly, complementary evidence by ribosome profiling was found for 23 protein N termini. Finally, by analyzing protein N-terminal peptides, an in silico analysis demonstrates the applicability of our N-terminal proteogenomics strategy in revealing protein-coding potential in species with well- and poorly-annotated genomes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Analysis of Defenses Against Code Reuse Attacks on Modern and New Architectures

DTIC Science & Technology

2015-09-01

soundness or completeness. An incomplete analysis will produce extra edges in the CFG that might allow an attacker to slip through. An unsound analysis...Analysis of Defenses Against Code Reuse Attacks on Modern and New Architectures by Isaac Noah Evans Submitted to the Department of Electrical...Engineering and Computer Science in partial fulfillment of the requirements for the degree of Master of Engineering in Electrical Engineering and Computer

An artificial viscosity method for the design of supercritical airfoils

NASA Technical Reports Server (NTRS)

Mcfadden, G. B.

1979-01-01

A numerical technique is presented for the design of two-dimensional supercritical wing sections with low wave drag. The method is a design mode of the analysis code H which gives excellent agreement with experimental results and is widely used in the aircraft industry. Topics covered include the partial differential equations of transonic flow, the computational procedure and results; the design procedure; a convergence theorem; and description of the code.

Direct Exploration of the Role of the Ventral Anterior Temporal Lobe in Semantic Memory: Cortical Stimulation and Local Field Potential Evidence From Subdural Grid Electrodes

PubMed Central

Shimotake, Akihiro; Matsumoto, Riki; Ueno, Taiji; Kunieda, Takeharu; Saito, Satoru; Hoffman, Paul; Kikuchi, Takayuki; Fukuyama, Hidenao; Miyamoto, Susumu; Takahashi, Ryosuke; Ikeda, Akio; Lambon Ralph, Matthew A.

2015-01-01

Semantic memory is a crucial higher cortical function that codes the meaning of objects and words, and when impaired after neurological damage, patients are left with significant disability. Investigations of semantic dementia have implicated the anterior temporal lobe (ATL) region, in general, as crucial for multimodal semantic memory. The potentially crucial role of the ventral ATL subregion has been emphasized by recent functional neuroimaging studies, but the necessity of this precise area has not been selectively tested. The implantation of subdural electrode grids over this subregion, for the presurgical assessment of patients with partial epilepsy or brain tumor, offers the dual yet rare opportunities to record cortical local field potentials while participants complete semantic tasks and to stimulate the functionally identified regions in the same participants to evaluate the necessity of these areas in semantic processing. Across 6 patients, and utilizing a variety of semantic assessments, we evaluated and confirmed that the anterior fusiform/inferior temporal gyrus is crucial in multimodal, receptive, and expressive, semantic processing. PMID:25491206

Alpha particles diffusion due to charge changes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clauser, C. F., E-mail: cesar.clauser@ib.edu.ar; Farengo, R.

2015-12-15

Alpha particles diffusion due to charge changes in a magnetized plasma is studied. Analytical calculations and numerical simulations are employed to show that this process can be very important in the pedestal-edge-SOL regions. This is the first study that presents clear evidence of the importance of atomic processes on the diffusion of alpha particles. A simple 1D model that includes inelastic collisions with plasma species, “cold” neutrals, and partially ionized species was employed. The code, which follows the exact particle orbits and includes the effect of inelastic collisions via a Monte Carlo type random process, runs on a graphic processormore » unit (GPU). The analytical and numerical results show excellent agreement when a uniform background (plasma and cold species) is assumed. The simulations also show that the gradients in the density of the plasma and cold species, which are large and opposite in the edge region, produce an inward flux of alpha particles. Calculations of the alpha particles flux reaching the walls or divertor plates should include these processes.« less

Phylogenetic Network for European mtDNA

PubMed Central

Finnilä, Saara; Lehtonen, Mervi S.; Majamaa, Kari

2001-01-01

The sequence in the first hypervariable segment (HVS-I) of the control region has been used as a source of evolutionary information in most phylogenetic analyses of mtDNA. Population genetic inference would benefit from a better understanding of the variation in the mtDNA coding region, but, thus far, complete mtDNA sequences have been rare. We determined the nucleotide sequence in the coding region of mtDNA from 121 Finns, by conformation-sensitive gel electrophoresis and subsequent sequencing and by direct sequencing of the D loop. Furthermore, 71 sequences from our previous reports were included, so that the samples represented all the mtDNA haplogroups present in the Finnish population. We found a total of 297 variable sites in the coding region, which allowed the compilation of unambiguous phylogenetic networks. The D loop harbored 104 variable sites, and, in most cases, these could be localized within the coding-region networks, without discrepancies. Interestingly, many homoplasies were detected in the coding region. Nucleotide variation in the rRNA and tRNA genes was 6%, and that in the third nucleotide positions of structural genes amounted to 22% of that in the HVS-I. The complete networks enabled the relationships between the mtDNA haplogroups to be analyzed. Phylogenetic networks based on the entire coding-region sequence in mtDNA provide a rich source for further population genetic studies, and complete sequences make it easier to differentiate between disease-causing mutations and rare polymorphisms. PMID:11349229

Method and apparatus for shadow aperture backscatter radiography (SABR) system and protocol

NASA Technical Reports Server (NTRS)

Shedlock, Daniel (Inventor); Jacobs, Alan M. (Inventor); Jacobs, Sharon Auerback (Inventor); Dugan, Edward (Inventor)

2010-01-01

A shadow aperture backscatter radiography (SABR) system includes at least one penetrating radiation source for providing a penetrating radiation field, and at least one partially transmissive radiation detector, wherein the partially transmissive radiation detector is interposed between an object region to be interrogated and the radiation source. The partially transmissive radiation detector transmits a portion of the illumination radiation field. A shadow aperture having a plurality of radiation attenuating regions having apertures therebetween is disposed between the radiation source and the detector. The apertures provide illumination regions for the illumination radiation field to reach the object region, wherein backscattered radiation from the object is detected and generates an image by the detector in regions of the detector that are shadowed by the radiation attenuation regions.

Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

NASA Technical Reports Server (NTRS)

Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.

1995-01-01

We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

An evaluation of the partial reflection technique and results from the winter 1971 - 1972 D region

NASA Technical Reports Server (NTRS)

Dasilva, L. C.; Bowhill, S. A.

1974-01-01

Fundamental physical and chemical processes, and measurement techniques on the D region are reviewed. Design considerations about a partial-reflection system are made, and the main characteristics of the partial-reflection system at the University of Illinois are presented. The nature of the partial reflections is discussed, particularly reflections produced by gradients in electron density and by random fluctuations in a locally homogeneous random medium. Possible reasons for disagreement between partial reflections and rocket measurements are discussed. Some suggestions are made to improve partial-reflection data reduction, including the use of only maximums of the reflections and deconvolution of the data. The results of partial-reflection measurements at Wallops Island, Virginia during the 1971-1972 winter are presented and compared to rocket measurements.

Constant time worker thread allocation via configuration caching

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eichenberger, Alexandre E; O'Brien, John K. P.

Mechanisms are provided for allocating threads for execution of a parallel region of code. A request for allocation of worker threads to execute the parallel region of code is received from a master thread. Cached thread allocation information identifying prior thread allocations that have been performed for the master thread are accessed. Worker threads are allocated to the master thread based on the cached thread allocation information. The parallel region of code is executed using the allocated worker threads.

SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

PubMed Central

Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.

2007-01-01

Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

Coded Cooperation for Multiway Relaying in Wireless Sensor Networks †

PubMed Central

Si, Zhongwei; Ma, Junyang; Thobaben, Ragnar

2015-01-01

Wireless sensor networks have been considered as an enabling technology for constructing smart cities. One important feature of wireless sensor networks is that the sensor nodes collaborate in some manner for communications. In this manuscript, we focus on the model of multiway relaying with full data exchange where each user wants to transmit and receive data to and from all other users in the network. We derive the capacity region for this specific model and propose a coding strategy through coset encoding. To obtain good performance with practical codes, we choose spatially-coupled LDPC (SC-LDPC) codes for the coded cooperation. In particular, for the message broadcasting from the relay, we construct multi-edge-type (MET) SC-LDPC codes by repeatedly applying coset encoding. Due to the capacity-achieving property of the SC-LDPC codes, we prove that the capacity region can theoretically be achieved by the proposed MET SC-LDPC codes. Numerical results with finite node degrees are provided, which show that the achievable rates approach the boundary of the capacity region in both binary erasure channels and additive white Gaussian channels. PMID:26131675

Coded Cooperation for Multiway Relaying in Wireless Sensor Networks.

PubMed

Si, Zhongwei; Ma, Junyang; Thobaben, Ragnar

2015-06-29

Wireless sensor networks have been considered as an enabling technology for constructing smart cities. One important feature of wireless sensor networks is that the sensor nodes collaborate in some manner for communications. In this manuscript, we focus on the model of multiway relaying with full data exchange where each user wants to transmit and receive data to and from all other users in the network. We derive the capacity region for this specific model and propose a coding strategy through coset encoding. To obtain good performance with practical codes, we choose spatially-coupled LDPC (SC-LDPC) codes for the coded cooperation. In particular, for the message broadcasting from the relay, we construct multi-edge-type (MET) SC-LDPC codes by repeatedly applying coset encoding. Due to the capacity-achieving property of the SC-LDPC codes, we prove that the capacity region can theoretically be achieved by the proposed MET SC-LDPC codes. Numerical results with finite node degrees are provided, which show that the achievable rates approach the boundary of the capacity region in both binary erasure channels and additive white Gaussian channels.

Albany v. 3.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salinger, Andrew; Phipps, Eric; Ostien, Jakob

2016-01-13

The Albany code is a general-purpose finite element code for solving partial differential equations (PDEs). Albany is a research code that demonstrates how a PDE code can be built by interfacing many of the open-source software libraries that are released under Sandia's Trilinos project. Part of the mission of Albany is to be a testbed for new Trilinos libraries, to refine their methods, usability, and interfaces. Albany includes hooks to optimization and uncertainty quantification algorithms, including those in Trilinos as well as those in the Dakota toolkit. Because of this, Albany is a desirable starting point for new code developmentmore » efforts that wish to make heavy use of Trilinos. Albany is both a framework and the host for specific finite element applications. These applications have project names, and can be controlled by configuration option when the code is compiled, but are all developed and released as part of the single Albany code base, These include LCM, QCAD, FELIX, Aeras, and ATO applications.« less

Radiant Energy Measurements from a Scaled Jet Engine Axisymmetric Exhaust Nozzle for a Baseline Code Validation Case

NASA Technical Reports Server (NTRS)

Baumeister, Joseph F.

1994-01-01

A non-flowing, electrically heated test rig was developed to verify computer codes that calculate radiant energy propagation from nozzle geometries that represent aircraft propulsion nozzle systems. Since there are a variety of analysis tools used to evaluate thermal radiation propagation from partially enclosed nozzle surfaces, an experimental benchmark test case was developed for code comparison. This paper briefly describes the nozzle test rig and the developed analytical nozzle geometry used to compare the experimental and predicted thermal radiation results. A major objective of this effort was to make available the experimental results and the analytical model in a format to facilitate conversion to existing computer code formats. For code validation purposes this nozzle geometry represents one validation case for one set of analysis conditions. Since each computer code has advantages and disadvantages based on scope, requirements, and desired accuracy, the usefulness of this single nozzle baseline validation case can be limited for some code comparisons.

Role of the UV external radiation field on the presence of astrophysical ices in protostellars environments

NASA Astrophysics Data System (ADS)

Robson Monteiro Rocha, Will; Pilling, Sergio

2016-07-01

The astrophysical ices survival is directly related with the temperature and ionizing radiation field in protostellars environments such as disks and envelopes. Computational models has shown that pure volatile molecules like CO and CH _{4} should survive only inside densest regions of molecular clouds or protoplanetary disks On the other hand, solid molecules such as H _{2}O and CH _{3}OH can be placed around 5 - 10 AU from the central protostar. Unlike of the previous models, we investigate the role of the UV external radiation field on the presence of ices in disks and envelopes. Once that a star-forming region is composed by the formation of many protostars, the external radiation field should be an important component to understand the real localization of the ices along the sight line. To address this topic it was employed the radiative transfer code RADMC-3D based on the Monte Carlo method. The code was used to model the spectrum and the near-infrared image of Elias 29. The initial parameters of the disk and envelope was taken from our previous paper (Rocha & Pilling (2015), ApJ 803:18). The opacities of the ices were calculated from the complex refractive index obtained at laboratory experiments perfomed at Grand Accélerateur National d'Íons Lourds (GANIL), by using the NKABS code from Rocha & Pilling (2014), SAA 123:436. The partial conclusions that we have obtained shows that pure CO volatile molecule cannot be placed at disk or envelope of Elias 29, unlike shown in our paper about Elias 29. Once it was observed in Elias 29 spectrum obtained with Infrared Space Observatory (ISO) between 2.5 - 190 μm, this molecule should be placed in foreground molecular clouds or trapped in the water ice matrix. The next calculations will be able to show where are placed the ices such as CH _{3}OH and CH _{3}CHO observed in Elias 29 spectrum.

Reconsideration of systematic relationships within the order Euplotida (Protista, Ciliophora) using new sequences of the gene coding for small-subunit rRNA and testing the use of combined data sets to construct phylogenies of the Diophrys-complex.

PubMed

Yi, Zhenzhen; Song, Weibo; Clamp, John C; Chen, Zigui; Gao, Shan; Zhang, Qianqian

2009-03-01

Comprehensive molecular analyses of phylogenetic relationships within euplotid ciliates are relatively rare, and the relationships among some families remain questionable. We performed phylogenetic analyses of the order Euplotida based on new sequences of the gene coding for small-subunit RNA (SSrRNA) from a variety of taxa across the entire order as well as sequences from some of these taxa of other genes (ITS1-5.8S-ITS2 region and histone H4) that have not been included in previous analyses. Phylogenetic trees based on SSrRNA gene sequences constructed with four different methods had a consistent branching pattern that included the following features: (1) the "typical" euplotids comprised a paraphyletic assemblage composed of two divergent clades (family Uronychiidae and families Euplotidae-Certesiidae-Aspidiscidae-Gastrocirrhidae), (2) in the family Uronychiidae, the genera Uronychia and Paradiophrys formed a clearly outlined, well-supported clade that seemed to be rather divergent from Diophrys and Diophryopsis, suggesting that the Diophrys-complex may have had a longer and more separate evolutionary history than previously supposed, (3) inclusion of 12 new SSrRNA sequences in analyses of Euplotidae revealed two new clades of species within the family and cast additional doubt on the present classification of genera within the family, and (4) the intraspecific divergence among five species of Aspidisca was far greater than those of closely related genera. The ITS1-5.8S-ITS2 coding regions and partial histone H4 genes of six morphospecies in the Diophrys-complex were sequenced along with their SSrRNA genes and used to compare phylogenies constructed from single data sets to those constructed from combined sets. Results indicated that combined analyses could be used to construct more reliable, less ambiguous phylogenies of complex groups like the order Euplotida, because they provide a greater amount and diversity of information.

Transient Ejector Analysis (TEA) code user's guide

NASA Technical Reports Server (NTRS)

Drummond, Colin K.

1993-01-01

A FORTRAN computer program for the semi analytic prediction of unsteady thrust augmenting ejector performance has been developed, based on a theoretical analysis for ejectors. That analysis blends classic self-similar turbulent jet descriptions with control-volume mixing region elements. Division of the ejector into an inlet, diffuser, and mixing region allowed flexibility in the modeling of the physics for each region. In particular, the inlet and diffuser analyses are simplified by a quasi-steady-analysis, justified by the assumption that pressure is the forcing function in those regions. Only the mixing region is assumed to be dominated by viscous effects. The present work provides an overview of the code structure, a description of the required input and output data file formats, and the results for a test case. Since there are limitations to the code for applications outside the bounds of the test case, the user should consider TEA as a research code (not as a production code), designed specifically as an implementation of the proposed ejector theory. Program error flags are discussed, and some diagnostic routines are presented.

Gel electrophoresis of partially denatured DNA. Retardation effect: its analysis and application.

PubMed Central

Lyamichev, V I; Panyutin, I G; Lyubchenko YuL

1982-01-01

The hypothesis about the role of partial denaturation in DNA retardation during its electrophoresis in denaturing gel /1,2/ was tested. We used partially melted DNA molecules in which the size of the melted regions and their location were known. They were obtained through glyoxal treatment of the melted regions by a procedure allowing the denatured state to be fixed at any point within the melting range. The approach and the availability of the melting maps of DNAs made it possible to investigate DNA molecules differing in length and in the size of the melted regions. The presence of a denatured region at the end of the molecule or inside of it was shown to decrease its electrophoretic mobility, the effect depending on the size of the melted region and on the DNA length. On the basis of the experimental results an explanation is proposed for the cause of retardation in the case of partially denatured DNA. Images PMID:7133999

[Population density, age distribution and urbanisation as factors influencing the frequency of home visits--an analysis for Mecklenburg-West Pomerania].

PubMed

Heymann, R; Weitmann, K; Weiss, S; Thierfelder, D; Flessa, S; Hoffmann, W

2009-07-01

This study examines and compares the frequency of home visits by general practitioners in regions with a lower population density and regions with a higher population density. The discussion centres on the hypothesis whether the number of home visits in rural and remote areas with a low population density is, in fact, higher than in urbanised areas with a higher population density. The average age of the population has been considered in both cases. The communities of Mecklenburg West-Pomerania were aggregated into postal code regions. The analysis is based on these postal code regions. The average frequency of home visits per 100 inhabitants/km2 has been calculated via a bivariate, linear regression model with the population density and the average age for the postal code region as independent variables. The results are based on billing data of the year 2006 as provided by the Association of Statutory Health Insurance Physicians of Mecklenburg-Western Pomerania. In a second step a variable which clustered the postal codes of urbanised areas was added to a multivariate model. The hypothesis of a negative correlation between the frequency of home visits and the population density of the areas examined cannot be confirmed for Mecklenburg-Western Pomerania. Following the dichotomisation of the postal code regions into sparsely and densely populated areas, only the very sparsely populated postal code regions (less than 100 inhabitants/km2) show a tendency towards a higher frequency of home visits. Overall, the frequency of home visits in sparsely populated postal code regions is 28.9% higher than in the densely populated postal code regions (more than 100 inhabitants/km2), although the number of general practitioners is approximately the same in both groups. In part this association seems to be confirmed by a positive correlation between the average age in the individual postal code regions and the number of home visits carried out in the area. As calculated on the basis of the data at hand, only the very sparsely populated areas with a still gradually decreasing population show a tendency towards a higher frequency of home visits. According to the data of 2006, the number of home visits remains high in sparsely populated areas. It may increase in the near future as the number of general practitioners in these areas will gradually decrease while the number of immobile and older inhabitants will increase.

Place of partial cutting in old-growth stands of the Douglas-fir region.

Treesearch

Leo A. Isaac

1956-01-01

During the early 1930's, as use of the logging truck and tractor increased, a form of partial harvesting mature and overmature virgin stands developed in the Douglas-fir region (2). The cutting pattern varied from taking a few scattered high-grade trees per acre to clear cutting small areas. Partial harvesting caught on quickly because at that time only the high-...

Parts, Materials, and Processes Control Program for Expendable Launch Vehicles

DTIC Science & Technology

2015-07-31

burn-in, electrical tests (DWV, room and hot IR, partial discharge when in corona region); perform DPA with SEM/EDX analysis of dielectric...life test; x-ray and vicinal illumination inspection; electrical tests (DWV, room and hot IR, partial discharge when in corona region) Termination...defects; proper voltage derating. Partial discharge testing, corona inception testing up to 60% of rated voltage; CSAM screening; voltage burn

POM-ZP3, a bipartite transcript derived from human ZP3 and a POM121 homologue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kipersztok, S.; Osawa, G.A.; Liang, L.F.

1995-01-20

Human POM-ZP3 is a novel bipartite RNA transcript that is derived from a gene homologous to rat POM121 (a nuclear pore membrane protein) and ZP3 (a sperm receptor ligand in the zona pellucida). The 5{prime} region is 77% identical to the 5{prime} end of the coding region of rat POM121 and appears to represent a partial duplication of a gene encoding a human homologue of this rodent gene. The 3{prime} end of the POM-ZP3 transcript is 99% identical to ZP3 and appears to have arisen from a duplication of the last four exons (exons 5-8) of ZP3. Using Northern blotsmore » and RT-PCR, POM-ZP3 transcripts were detected in human ovaries, testes, spleen, thymus, lymphocytes, prostate, and intestines. The longest open reading frame encodes a conceptual protein of 210 amino acids, the first 76 of which are 83% identical to residues 241-315 of rat POM121. The next 125 amino acids are 98% identical to residues 239-363 of the 424-amino-acid human ZP3 protein. By fluorescence in situ hybridization, genomic fragments of ZP3 and a human homologue of POM121 were localized to chromosome 7q11.23. Taken together, these data suggest that partial duplications of human ZP3 and a POM121-like gene have resulted in a fusion transcript, POM-ZP3, that is expressed in multiple human tissues. 24 refs., 5 figs.« less

Mitochondrial genome evolution in the Saccharomyces sensu stricto complex.

PubMed

Ruan, Jiangxing; Cheng, Jian; Zhang, Tongcun; Jiang, Huifeng

2017-01-01

Exploring the evolutionary patterns of mitochondrial genomes is important for our understanding of the Saccharomyces sensu stricto (SSS) group, which is a model system for genomic evolution and ecological analysis. In this study, we first obtained the complete mitochondrial sequences of two important species, Saccharomyces mikatae and Saccharomyces kudriavzevii. We then compared the mitochondrial genomes in the SSS group with those of close relatives, and found that the non-coding regions evolved rapidly, including dramatic expansion of intergenic regions, fast evolution of introns and almost 20-fold higher rearrangement rates than those of the nuclear genomes. However, the coding regions, and especially the protein-coding genes, are more conserved than those in the nuclear genomes of the SSS group. The different evolutionary patterns of coding and non-coding regions in the mitochondrial and nuclear genomes may be related to the origin of the aerobic fermentation lifestyle in this group. Our analysis thus provides novel insights into the evolution of mitochondrial genomes.

New advances in the partial-reflection-drifts experiment using microprocessors

NASA Technical Reports Server (NTRS)

Ruggerio, R. L.; Bowhill, S. A.

1982-01-01

Improvements to the partial reflection drifts experiment are completed. The results of the improvements include real time processing and simultaneous measurements of the D region with coherent scatter. Preliminary results indicate a positive correlation between drift velocities calculated by both methods during a two day interval. The possibility now exists for extended observations between partial reflection and coherent scatter. In addition, preliminary measurements could be performed between partial reflection and meteor radar to complete a comparison of methods used to determine velocities in the D region.

USAF Presence in Latin America in the 21st Century.

DTIC Science & Technology

1988-04-01

faculty in partial fulfillment of requirements for graduation. AIR COMMAND AND STAFF COLLEGE AIR UNIVERSITY MAXWELL AFB, AL 36112 UNCLASSIFIED SECURITY...ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) Maxwell AFB AL 36112-5542 Ba. NAME OF FUNDING /SPONSORING 8 b. OFFICE SYMBOL... Servicio Multimodal Transistmico across the Isthmus of Tehuantepec (11:28). It does, however. *%4 row:n militaiy importance. The U.S. Atlantic Command’s

Novel promoters and coding first exons in DLG2 linked to developmental disorders and intellectual disability.

PubMed

Reggiani, Claudio; Coppens, Sandra; Sekhara, Tayeb; Dimov, Ivan; Pichon, Bruno; Lufin, Nicolas; Addor, Marie-Claude; Belligni, Elga Fabia; Digilio, Maria Cristina; Faletra, Flavio; Ferrero, Giovanni Battista; Gerard, Marion; Isidor, Bertrand; Joss, Shelagh; Niel-Bütschi, Florence; Perrone, Maria Dolores; Petit, Florence; Renieri, Alessandra; Romana, Serge; Topa, Alexandra; Vermeesch, Joris Robert; Lenaerts, Tom; Casimir, Georges; Abramowicz, Marc; Bontempi, Gianluca; Vilain, Catheline; Deconinck, Nicolas; Smits, Guillaume

2017-07-19

Tissue-specific integrative omics has the potential to reveal new genic elements important for developmental disorders. Two pediatric patients with global developmental delay and intellectual disability phenotype underwent array-CGH genetic testing, both showing a partial deletion of the DLG2 gene. From independent human and murine omics datasets, we combined copy number variations, histone modifications, developmental tissue-specific regulation, and protein data to explore the molecular mechanism at play. Integrating genomics, transcriptomics, and epigenomics data, we describe two novel DLG2 promoters and coding first exons expressed in human fetal brain. Their murine conservation and protein-level evidence allowed us to produce new DLG2 gene models for human and mouse. These new genic elements are deleted in 90% of 29 patients (public and in-house) showing partial deletion of the DLG2 gene. The patients' clinical characteristics expand the neurodevelopmental phenotypic spectrum linked to DLG2 gene disruption to cognitive and behavioral categories. While protein-coding genes are regarded as well known, our work shows that integration of multiple omics datasets can unveil novel coding elements. From a clinical perspective, our work demonstrates that two new DLG2 promoters and exons are crucial for the neurodevelopmental phenotypes associated with this gene. In addition, our work brings evidence for the lack of cross-annotation in human versus mouse reference genomes and nucleotide versus protein databases.

Partial Correlation-Based Retinotopically Organized Resting-State Functional Connectivity Within and Between Areas of the Visual Cortex Reflects More Than Cortical Distance

PubMed Central

Dawson, Debra Ann; Lam, Jack; Lewis, Lindsay B.; Carbonell, Felix; Mendola, Janine D.

2016-01-01

Abstract Numerous studies have demonstrated functional magnetic resonance imaging (fMRI)-based resting-state functional connectivity (RSFC) between cortical areas. Recent evidence suggests that synchronous fluctuations in blood oxygenation level-dependent fMRI reflect functional organization at a scale finer than that of visual areas. In this study, we investigated whether RSFCs within and between lower visual areas are retinotopically organized and whether retinotopically organized RSFC merely reflects cortical distance. Subjects underwent retinotopic mapping and separately resting-state fMRI. Visual areas V1, V2, and V3, were subdivided into regions of interest (ROIs) according to quadrants and visual field eccentricity. Functional connectivity (FC) was computed based on Pearson's linear correlation (correlation), and Pearson's linear partial correlation (correlation between two time courses after the time courses from all other regions in the network are regressed out). Within a quadrant, within visual areas, all correlation and nearly all partial correlation FC measures showed statistical significance. Consistently in V1, V2, and to a lesser extent in V3, correlation decreased with increasing eccentricity separation. Consistent with previously reported monkey anatomical connectivity, correlation/partial correlation values between regions from adjacent areas (V1-V2 and V2-V3) were higher than those between nonadjacent areas (V1-V3). Within a quadrant, partial correlation showed consistent significance between regions from two different areas with the same or adjacent eccentricities. Pairs of ROIs with similar eccentricity showed higher correlation/partial correlation than pairs distant in eccentricity. Between dorsal and ventral quadrants, partial correlation between common and adjacent eccentricity regions within a visual area showed statistical significance; this extended to more distant eccentricity regions in V1. Within and between quadrants, correlation decreased approximately linearly with increasing distances separating the tested ROIs. Partial correlation showed a more complex dependence on cortical distance: it decreased exponentially with increasing distance within a quadrant, but was best fit by a quadratic function between quadrants. We conclude that RSFCs within and between lower visual areas are retinotopically organized. Correlation-based FC is nonselectively high across lower visual areas, even between regions that do not share direct anatomical connections. The mechanisms likely involve network effects caused by the dense anatomical connectivity within this network and projections from higher visual areas. FC based on partial correlation, which minimizes network effects, follows expectations based on direct anatomical connections in the monkey visual cortex better than correlation. Last, partial correlation-based retinotopically organized RSFC reflects more than cortical distance effects. PMID:26415043

Partial Correlation-Based Retinotopically Organized Resting-State Functional Connectivity Within and Between Areas of the Visual Cortex Reflects More Than Cortical Distance.

PubMed

Dawson, Debra Ann; Lam, Jack; Lewis, Lindsay B; Carbonell, Felix; Mendola, Janine D; Shmuel, Amir

2016-02-01

Numerous studies have demonstrated functional magnetic resonance imaging (fMRI)-based resting-state functional connectivity (RSFC) between cortical areas. Recent evidence suggests that synchronous fluctuations in blood oxygenation level-dependent fMRI reflect functional organization at a scale finer than that of visual areas. In this study, we investigated whether RSFCs within and between lower visual areas are retinotopically organized and whether retinotopically organized RSFC merely reflects cortical distance. Subjects underwent retinotopic mapping and separately resting-state fMRI. Visual areas V1, V2, and V3, were subdivided into regions of interest (ROIs) according to quadrants and visual field eccentricity. Functional connectivity (FC) was computed based on Pearson's linear correlation (correlation), and Pearson's linear partial correlation (correlation between two time courses after the time courses from all other regions in the network are regressed out). Within a quadrant, within visual areas, all correlation and nearly all partial correlation FC measures showed statistical significance. Consistently in V1, V2, and to a lesser extent in V3, correlation decreased with increasing eccentricity separation. Consistent with previously reported monkey anatomical connectivity, correlation/partial correlation values between regions from adjacent areas (V1-V2 and V2-V3) were higher than those between nonadjacent areas (V1-V3). Within a quadrant, partial correlation showed consistent significance between regions from two different areas with the same or adjacent eccentricities. Pairs of ROIs with similar eccentricity showed higher correlation/partial correlation than pairs distant in eccentricity. Between dorsal and ventral quadrants, partial correlation between common and adjacent eccentricity regions within a visual area showed statistical significance; this extended to more distant eccentricity regions in V1. Within and between quadrants, correlation decreased approximately linearly with increasing distances separating the tested ROIs. Partial correlation showed a more complex dependence on cortical distance: it decreased exponentially with increasing distance within a quadrant, but was best fit by a quadratic function between quadrants. We conclude that RSFCs within and between lower visual areas are retinotopically organized. Correlation-based FC is nonselectively high across lower visual areas, even between regions that do not share direct anatomical connections. The mechanisms likely involve network effects caused by the dense anatomical connectivity within this network and projections from higher visual areas. FC based on partial correlation, which minimizes network effects, follows expectations based on direct anatomical connections in the monkey visual cortex better than correlation. Last, partial correlation-based retinotopically organized RSFC reflects more than cortical distance effects.

Novel variants of the 5S rRNA genes in Eruca sativa.

PubMed

Singh, K; Bhatia, S; Lakshmikumaran, M

1994-02-01

The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

Copy number variations at the Prader-Willi syndrome region on chromosome 15 and associations with obesity in whites.

PubMed

Chen, Yuan; Liu, Yong-Jun; Pei, Yu-Fang; Yang, Tie-Lin; Deng, Fei-Yan; Liu, Xiao-Gang; Li, Ding-You; Deng, Hong-Wen

2011-06-01

Obesity is a serious health problem with strong genetic determination. Copy number variation (CNV) is a common type of genomic variant associated with some complex human diseases. However, it is not clear how CNVs contribute to the etiology of obesity. In this study, we examined 1,000 unrelated US whites to search for CNVs that may predispose to obesity. We focused our analyses on the Prader-Willi syndrome (PWS) critical region (chromosome 15q11-q13), because the PWS region is a hotspot for CNV generation and obesity is one of the major clinical manifestations for chromosome abnormalities at this region. We constructed a map containing 39 CNVs at the PWS critical region with CNV occurrence rates higher than 1%. Among them, three CNVs were significantly associated with body fat mass (P < 0.05), with a higher copy number (CN) associated with an increase of 5.08-9.77 kg in body fat mass. These three CNVs are close to two known PWS genes, NDN (necdin homolog) and C15orf2 (chromosome 15 open reading frame 2), and partially overlap with another obesity gene PWRN1 (Prader-Willi region nonprotein-coding RNA 1). Interestingly, our recently published whole genome association scan study using the same sample by examining single-nucleotide polymorphisms (SNPs) did not find any significant associations at these CNV regions, suggesting the importance of examining both CNVs and SNPs for better understanding of genetic basis of obesity. Further studies are warranted to validate these CNVs and their importance to obesity.

Unique XCI evolution in Tokudaia: initial XCI of the neo-X chromosome in Tokudaia muenninki and function loss of XIST in Tokudaia osimensis.

PubMed

Zushi, Hideki; Murata, Chie; Mizushima, Shusei; Nishida, Chizuko; Kuroiwa, Asato

2017-12-01

X chromosome inactivation (XCI) is an essential mechanism to compensate gene dosage in mammals. Here, we show that XCI has evolved differently in two species of the genus Tokudaia. The Amami spiny rat, Tokudaia osimensis, has a single X chromosome in males and females (XO/XO). By contrast, the Okinawa spiny rat, Tokudaia muenninki, has XX/XY sex chromosomes like most mammals, although the X chromosome has acquired a neo-X region by fusion with an autosome. BAC clones containing the XIST gene, which produces the long non-coding RNA XIST required for XCI, were obtained by screening of T. osimensis and T. muenninki BAC libraries. Each clone was mapped to the homologous region of the X inactivation center in the X chromosome of the two species by BAC-FISH. XIST RNAs were expressed in T. muenninki females, whereas no expression was observed in T. osimensis. The sequence of the XIST RNA was compared with that of mouse, showing that the XIST gene is highly conserved in T. muenninki. XIST RNAs were localized to the ancestral X region (Xq), to the heterochromatic region (pericentromeric region), and partially to the neo-X region (Xp). The hybridization pattern correlated with LINE-1 accumulation in Xq but not in Xp. Dosage of genes located on the neo-X chromosome was not compensated, suggesting that the neo-X region is in an early state of XCI. By contrast, many mutations were observed in the XIST gene of T. osimensis, indicating its loss of function in the XO/XO species.

Potential capabilities of Reynolds stress turbulence model in the COMMIX-RSM code

NASA Technical Reports Server (NTRS)

Chang, F. C.; Bottoni, M.

1994-01-01

A Reynolds stress turbulence model has been implemented in the COMMIX code, together with transport equations describing turbulent heat fluxes, variance of temperature fluctuations, and dissipation of turbulence kinetic energy. The model has been verified partially by simulating homogeneous turbulent shear flow, and stable and unstable stratified shear flows with strong buoyancy-suppressing or enhancing turbulence. This article outlines the model, explains the verifications performed thus far, and discusses potential applications of the COMMIX-RSM code in several domains, including, but not limited to, analysis of thermal striping in engineering systems, simulation of turbulence in combustors, and predictions of bubbly and particulate flows.

Modeling charge collection efficiency degradation in partially depleted GaAs photodiodes using the 1- and 2-carrier Hecht equations

DOE PAGES

Auden, E. C.; Vizkelethy, G.; Serkland, D. K.; ...

2017-03-24

Here, the Hecht equation can be used to model the nonlinear degradation of charge collection efficiency (CCE) in response to radiation-induced displacement damage in both fully and partially depleted GaAs photodiodes. CCE degradation is measured for laser-generated photocurrent as a function of fluence and bias in Al 0.3Ga 0.7As/GaAs/Al 0.25Ga 0.75As p-i-n photodiodes which have been irradiated with 12 MeV C and 7.5 MeV Si ions. CCE is observed to degrade more rapidly with fluence in partially depleted photodiodes than in fully depleted photodiodes. When the intrinsic GaAs layer is fully depleted, the 2-carrier Hecht equation describes CCE degradation asmore » photogenerated electrons and holes recombine at defect sites created by radiation damage in the depletion region. If the GaAs layer is partially depleted, CCE degradation is more appropriately modeled as the sum of the 2-carrier Hecht equation applied to electrons and holes generated within the depletion region and the 1-carrier Hecht equation applied to minority carriers that diffuse from the field-free (non-depleted) region into the depletion region. Enhanced CCE degradation is attributed to holes that recombine within the field-free region of the partially depleted intrinsic GaAs layer before they can diffuse into the depletion region.« less

Modeling charge collection efficiency degradation in partially depleted GaAs photodiodes using the 1- and 2-carrier Hecht equations

NASA Astrophysics Data System (ADS)

Auden, E. C.; Vizkelethy, G.; Serkland, D. K.; Bossert, D. J.; Doyle, B. L.

2017-05-01

The Hecht equation can be used to model the nonlinear degradation of charge collection efficiency (CCE) in response to radiation-induced displacement damage in both fully and partially depleted GaAs photodiodes. CCE degradation is measured for laser-generated photocurrent as a function of fluence and bias in Al0.3Ga0.7As/GaAs/Al0.25Ga0.75As p-i-n photodiodes which have been irradiated with 12 MeV C and 7.5 MeV Si ions. CCE is observed to degrade more rapidly with fluence in partially depleted photodiodes than in fully depleted photodiodes. When the intrinsic GaAs layer is fully depleted, the 2-carrier Hecht equation describes CCE degradation as photogenerated electrons and holes recombine at defect sites created by radiation damage in the depletion region. If the GaAs layer is partially depleted, CCE degradation is more appropriately modeled as the sum of the 2-carrier Hecht equation applied to electrons and holes generated within the depletion region and the 1-carrier Hecht equation applied to minority carriers that diffuse from the field-free (non-depleted) region into the depletion region. Enhanced CCE degradation is attributed to holes that recombine within the field-free region of the partially depleted intrinsic GaAs layer before they can diffuse into the depletion region.

Modeling charge collection efficiency degradation in partially depleted GaAs photodiodes using the 1- and 2-carrier Hecht equations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auden, E. C.; Vizkelethy, G.; Serkland, D. K.

Here, the Hecht equation can be used to model the nonlinear degradation of charge collection efficiency (CCE) in response to radiation-induced displacement damage in both fully and partially depleted GaAs photodiodes. CCE degradation is measured for laser-generated photocurrent as a function of fluence and bias in Al 0.3Ga 0.7As/GaAs/Al 0.25Ga 0.75As p-i-n photodiodes which have been irradiated with 12 MeV C and 7.5 MeV Si ions. CCE is observed to degrade more rapidly with fluence in partially depleted photodiodes than in fully depleted photodiodes. When the intrinsic GaAs layer is fully depleted, the 2-carrier Hecht equation describes CCE degradation asmore » photogenerated electrons and holes recombine at defect sites created by radiation damage in the depletion region. If the GaAs layer is partially depleted, CCE degradation is more appropriately modeled as the sum of the 2-carrier Hecht equation applied to electrons and holes generated within the depletion region and the 1-carrier Hecht equation applied to minority carriers that diffuse from the field-free (non-depleted) region into the depletion region. Enhanced CCE degradation is attributed to holes that recombine within the field-free region of the partially depleted intrinsic GaAs layer before they can diffuse into the depletion region.« less

78 FR 18321 - International Code Council: The Update Process for the International Codes and Standards

Federal Register 2010, 2011, 2012, 2013, 2014

2013-03-26

... for Residential Construction in High Wind Regions. ICC 700: National Green Building Standard The..., coordinated, and necessary to regulate the built environment. Federal agencies frequently use these codes and... International Codes and Standards consist of the following: ICC Codes International Building Code. International...

Analysis of localised dose distribution in human body by Monte Carlo code system for photon irradiation.

PubMed

Ohnishi, S; Odano, N; Nariyama, N; Saito, K

2004-01-01

In usual personal dosimetry, whole body irradiation is assumed. However, the opportunity of partial irradiation is increasing and the tendencies of protection quantities caused under those irradiation conditions are different. The code system has been developed and effective dose and organ absorbed doses have been calculated in the case of horizontal narrow photon beam irradiated from various directions at three representative body sections, 40, 50 and 60 cm originating from the top of the head. This work covers 24 beam directions, each 15 degrees angle ranging from 0 degrees to 345 degrees, three energy levels, 45 keV, 90 keV and 1.25 MeV, and three beam diameters of 1, 2 and 4 cm. These results show that the beam injected from diagonally front or other specific direction causes peak dose in the case of partial irradiation.

Alfvén ionization in an MHD-gas interactions code

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, A. D.; Diver, D. A.

A numerical model of partially ionized plasmas is developed in order to capture their evolving ionization fractions as a result of Alfvén ionization (AI). The mechanism of, and the parameter regime necessary for, AI is discussed and an expression for the AI rate based on fluid parameters, from a gas-MHD model, is derived. This AI term is added to an existing MHD-gas interactions' code, and the result is a linear, 2D, two-fluid model that includes momentum transfer between charged and neutral species as well as an ionization rate that depends on the velocity fields of both fluids. The dynamics ofmore » waves propagating through such a partially ionized plasma are investigated, and it is found that AI has a significant influence on the fluid dynamics as well as both the local and global ionization fraction.« less

Parts, Materials, and Processes Control Program for Expendable Launch Vehicles

DTIC Science & Technology

2015-05-21

CSAM, thermal shock, voltage burn-in, electrical tests (DWV, room and hot IR, partial discharge when in corona region); perform DPA with SEM/EDX...controls to eliminate dielectric defects; proper voltage derating. Partial discharge testing, corona inception testing up to 60% of rated voltage...voltage burn-in; DWV; room and hot IR; life test; partial discharge when in corona region B-7 Table B-5. Metallized Plastic Capacitors

Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

PubMed

Suyama, Mikita; Lathe, Warren C; Bork, Peer

2005-10-10

We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

Mobile code security

NASA Astrophysics Data System (ADS)

Ramalingam, Srikumar

2001-11-01

A highly secure mobile agent system is very important for a mobile computing environment. The security issues in mobile agent system comprise protecting mobile hosts from malicious agents, protecting agents from other malicious agents, protecting hosts from other malicious hosts and protecting agents from malicious hosts. Using traditional security mechanisms the first three security problems can be solved. Apart from using trusted hardware, very few approaches exist to protect mobile code from malicious hosts. Some of the approaches to solve this problem are the use of trusted computing, computing with encrypted function, steganography, cryptographic traces, Seal Calculas, etc. This paper focuses on the simulation of some of these existing techniques in the designed mobile language. Some new approaches to solve malicious network problem and agent tampering problem are developed using public key encryption system and steganographic concepts. The approaches are based on encrypting and hiding the partial solutions of the mobile agents. The partial results are stored and the address of the storage is destroyed as the agent moves from one host to another host. This allows only the originator to make use of the partial results. Through these approaches some of the existing problems are solved.

Genetic diversity of the HLA-G coding region in Amerindian populations from the Brazilian Amazon: a possible role of natural selection.

PubMed

Mendes-Junior, C T; Castelli, E C; Meyer, D; Simões, A L; Donadi, E A

2013-12-01

HLA-G has an important role in the modulation of the maternal immune system during pregnancy, and evidence that balancing selection acts in the promoter and 3'UTR regions has been previously reported. To determine whether selection acts on the HLA-G coding region in the Amazon Rainforest, exons 2, 3 and 4 were analyzed in a sample of 142 Amerindians from nine villages of five isolated tribes that inhabit the Central Amazon. Six previously described single-nucleotide polymorphisms (SNPs) were identified and the Expectation-Maximization (EM) and PHASE algorithms were used to computationally reconstruct SNP haplotypes (HLA-G alleles). A new HLA-G allele, which originated in Amerindian populations by a crossing-over event between two widespread HLA-G alleles, was identified in 18 individuals. Neutrality tests evidenced that natural selection has a complex part in the HLA-G coding region. Although balancing selection is the type of selection that shapes variability at a local level (Native American populations), we have also shown that purifying selection may occur on a worldwide scale. Moreover, the balancing selection does not seem to act on the coding region as strongly as it acts on the flanking regulatory regions, and such coding signature may actually reflect a hitchhiking effect.

Using the NCBI Genome Databases to Compare the Genes for Human & Chimpanzee Beta Hemoglobin

ERIC Educational Resources Information Center

Offner, Susan

2010-01-01

The beta hemoglobin protein is identical in humans and chimpanzees. In this tutorial, students see that even though the proteins are identical, the genes that code for them are not. There are many more differences in the introns than in the exons, which indicates that coding regions of DNA are more highly conserved than non-coding regions.

36 CFR 1234.20 - What rules apply if there is a conflict between NARA standards and other regulatory standards...

Code of Federal Regulations, 2014 CFR

2014-07-01

... regional building codes, the following rules of precedence apply: (1) Between differing levels of fire... cannot be reconciled with a requirement of this part, the local or regional code applies. (b) If any of... require documentation of the mandatory nature of the conflicting code and the inability to reconcile that...

36 CFR 1234.20 - What rules apply if there is a conflict between NARA standards and other regulatory standards...

Code of Federal Regulations, 2012 CFR

2012-07-01

... regional building codes, the following rules of precedence apply: (1) Between differing levels of fire... cannot be reconciled with a requirement of this part, the local or regional code applies. (b) If any of... require documentation of the mandatory nature of the conflicting code and the inability to reconcile that...

36 CFR 1234.20 - What rules apply if there is a conflict between NARA standards and other regulatory standards...

Code of Federal Regulations, 2011 CFR

2011-07-01

... regional building codes, the following rules of precedence apply: (1) Between differing levels of fire... cannot be reconciled with a requirement of this part, the local or regional code applies. (b) If any of... require documentation of the mandatory nature of the conflicting code and the inability to reconcile that...

36 CFR § 1234.20 - What rules apply if there is a conflict between NARA standards and other regulatory standards...

Code of Federal Regulations, 2013 CFR

2013-07-01

... regional building codes, the following rules of precedence apply: (1) Between differing levels of fire... cannot be reconciled with a requirement of this part, the local or regional code applies. (b) If any of... require documentation of the mandatory nature of the conflicting code and the inability to reconcile that...

From Physics Model to Results: An Optimizing Framework for Cross-Architecture Code Generation

DOE PAGES

Blazewicz, Marek; Hinder, Ian; Koppelman, David M.; ...

2013-01-01

Starting from a high-level problem description in terms of partial differential equations using abstract tensor notation, the Chemora framework discretizes, optimizes, and generates complete high performance codes for a wide range of compute architectures. Chemora extends the capabilities of Cactus, facilitating the usage of large-scale CPU/GPU systems in an efficient manner for complex applications, without low-level code tuning. Chemora achieves parallelism through MPI and multi-threading, combining OpenMP and CUDA. Optimizations include high-level code transformations, efficient loop traversal strategies, dynamically selected data and instruction cache usage strategies, and JIT compilation of GPU code tailored to the problem characteristics. The discretization ismore » based on higher-order finite differences on multi-block domains. Chemora's capabilities are demonstrated by simulations of black hole collisions. This problem provides an acid test of the framework, as the Einstein equations contain hundreds of variables and thousands of terms.« less

Toward performance portability of the Albany finite element analysis code using the Kokkos library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Demeshko, Irina; Watkins, Jerry; Tezaur, Irina K.

Performance portability on heterogeneous high-performance computing (HPC) systems is a major challenge faced today by code developers: parallel code needs to be executed correctly as well as with high performance on machines with different architectures, operating systems, and software libraries. The finite element method (FEM) is a popular and flexible method for discretizing partial differential equations arising in a wide variety of scientific, engineering, and industrial applications that require HPC. This paper presents some preliminary results pertaining to our development of a performance portable implementation of the FEM-based Albany code. Performance portability is achieved using the Kokkos library. We presentmore » performance results for the Aeras global atmosphere dynamical core module in Albany. Finally, numerical experiments show that our single code implementation gives reasonable performance across three multicore/many-core architectures: NVIDIA General Processing Units (GPU’s), Intel Xeon Phis, and multicore CPUs.« less

Toward performance portability of the Albany finite element analysis code using the Kokkos library

DOE PAGES

Demeshko, Irina; Watkins, Jerry; Tezaur, Irina K.; ...

2018-02-05

Performance portability on heterogeneous high-performance computing (HPC) systems is a major challenge faced today by code developers: parallel code needs to be executed correctly as well as with high performance on machines with different architectures, operating systems, and software libraries. The finite element method (FEM) is a popular and flexible method for discretizing partial differential equations arising in a wide variety of scientific, engineering, and industrial applications that require HPC. This paper presents some preliminary results pertaining to our development of a performance portable implementation of the FEM-based Albany code. Performance portability is achieved using the Kokkos library. We presentmore » performance results for the Aeras global atmosphere dynamical core module in Albany. Finally, numerical experiments show that our single code implementation gives reasonable performance across three multicore/many-core architectures: NVIDIA General Processing Units (GPU’s), Intel Xeon Phis, and multicore CPUs.« less

Development of a Model and Computer Code to Describe Solar Grade Silicon Production Processes

NASA Technical Reports Server (NTRS)

Srivastava, R.; Gould, R. K.

1979-01-01

Mathematical models and computer codes based on these models, which allow prediction of the product distribution in chemical reactors for converting gaseous silicon compounds to condensed-phase silicon were developed. The following tasks were accomplished: (1) formulation of a model for silicon vapor separation/collection from the developing turbulent flow stream within reactors of the Westinghouse (2) modification of an available general parabolic code to achieve solutions to the governing partial differential equations (boundary layer type) which describe migration of the vapor to the reactor walls, (3) a parametric study using the boundary layer code to optimize the performance characteristics of the Westinghouse reactor, (4) calculations relating to the collection efficiency of the new AeroChem reactor, and (5) final testing of the modified LAPP code for use as a method of predicting Si(1) droplet sizes in these reactors.

Sparse orthogonal population representation of spatial context in the retrosplenial cortex.

PubMed

Mao, Dun; Kandler, Steffen; McNaughton, Bruce L; Bonin, Vincent

2017-08-15

Sparse orthogonal coding is a key feature of hippocampal neural activity, which is believed to increase episodic memory capacity and to assist in navigation. Some retrosplenial cortex (RSC) neurons convey distributed spatial and navigational signals, but place-field representations such as observed in the hippocampus have not been reported. Combining cellular Ca 2+ imaging in RSC of mice with a head-fixed locomotion assay, we identified a population of RSC neurons, located predominantly in superficial layers, whose ensemble activity closely resembles that of hippocampal CA1 place cells during the same task. Like CA1 place cells, these RSC neurons fire in sequences during movement, and show narrowly tuned firing fields that form a sparse, orthogonal code correlated with location. RSC 'place' cell activity is robust to environmental manipulations, showing partial remapping similar to that observed in CA1. This population code for spatial context may assist the RSC in its role in memory and/or navigation.Neurons in the retrosplenial cortex (RSC) encode spatial and navigational signals. Here the authors use calcium imaging to show that, similar to the hippocampus, RSC neurons also encode place cell-like activity in a sparse orthogonal representation, partially anchored to the allocentric cues on the linear track.

Combined utilization of partial-response coding and equalization for high-speed WDM-PON with centralized lightwaves.

PubMed

Guo, Qi; Tran, An V

2012-12-17

In this paper, we investigate the transmission impairments in a high-speed single-feeder wavelength-division-multiplexed passive optical network (WDM-PON) employing low-bandwidth upstream transmitter. A 1-GHz reflective semiconductor optical amplifier (RSOA) is operated at the rates of 10 Gb/s and 20 Gb/s in the proposed WDM-PON. Since the system performance is seriously limited by its uplink in both capacity and reach owing to inter-symbol interference and reflection noise, we present a novel technique with simultaneous capability of spectral efficiency enhancement and transmission distance extension in the uplink via coding and equalization that exploit the principles of partial-response (PR) signal. It is experimentally demonstrated that the proposed system supports the delivery of 10 Gb/s and 20 Gb/s upstream signals over 75-km and 25-km bidirectional fiber, respectively. The configuration of PR equalizer is optimized for its best performance-complexity trade-off. The reflection tolerance of 10 Gb/s and 20 Gb/s channels is improved by 8 dB and 6 dB, respectively, with PR coding. The proposed cost-effective signal processing scheme has great potential for the next-generation access networks.

A single U/C nucleotide substitution changing alanine to valine in the beet necrotic yellow vein virus P25 protein promotes increased virus accumulation in roots of mechanically inoculated, partially resistant sugar beet seedlings.

PubMed

Koenig, R; Loss, S; Specht, J; Varrelmann, M; Lüddecke, P; Deml, G

2009-03-01

Beet necrotic yellow vein virus (BNYVV) A type isolates E12 and S8, originating from areas where resistance-breaking had or had not been observed, respectively, served as starting material for studying the influence of sequence variations in BNYVV RNA 3 on virus accumulation in partially resistant sugar beet varieties. Sub-isolates containing only RNAs 1 and 2 were obtained by serial local lesion passages; biologically active cDNA clones were prepared for RNAs 3 which differed in their coding sequences for P25 aa 67, 68 and 129. Sugar beet seedlings were mechanically inoculated with RNA 1+2/RNA 3 pseudorecombinants. The origin of RNAs 1+2 had little influence on virus accumulation in rootlets. E12 RNA 3 coding for V(67)C(68)Y(129) P25, however, enabled a much higher virus accumulation than S8 RNA 3 coding for A(67)H(68)H(129) P25. Mutants revealed that this was due only to the V(67) 'GUU' codon as opposed to the A(67) 'GCU' codon.

LPV control for the full region operation of a wind turbine integrated with synchronous generator.

PubMed

Cao, Guoyan; Grigoriadis, Karolos M; Nyanteh, Yaw D

2015-01-01

Wind turbine conversion systems require feedback control to achieve reliable wind turbine operation and stable current supply. A robust linear parameter varying (LPV) controller is proposed to reduce the structural loads and improve the power extraction of a horizontal axis wind turbine operating in both the partial load and the full load regions. The LPV model is derived from the wind turbine state space models extracted by FAST (fatigue, aerodynamics, structural, and turbulence) code linearization at different operating points. In order to assure a smooth transition between the two regions, appropriate frequency-dependent varying scaling parametric weighting functions are designed in the LPV control structure. The solution of a set of linear matrix inequalities (LMIs) leads to the LPV controller. A synchronous generator model is connected with the closed LPV control loop for examining the electrical subsystem performance obtained by an inner speed control loop. Simulation results of a 1.5 MW horizontal axis wind turbine model on the FAST platform illustrates the benefit of the LPV control and demonstrates the advantages of this proposed LPV controller, when compared with a traditional gain scheduling PI control and prior LPV control configurations. Enhanced structural load mitigation, improved power extraction, and good current performance were obtained from the proposed LPV control.

LPV Control for the Full Region Operation of a Wind Turbine Integrated with Synchronous Generator

PubMed Central

Grigoriadis, Karolos M.; Nyanteh, Yaw D.

2015-01-01

Wind turbine conversion systems require feedback control to achieve reliable wind turbine operation and stable current supply. A robust linear parameter varying (LPV) controller is proposed to reduce the structural loads and improve the power extraction of a horizontal axis wind turbine operating in both the partial load and the full load regions. The LPV model is derived from the wind turbine state space models extracted by FAST (fatigue, aerodynamics, structural, and turbulence) code linearization at different operating points. In order to assure a smooth transition between the two regions, appropriate frequency-dependent varying scaling parametric weighting functions are designed in the LPV control structure. The solution of a set of linear matrix inequalities (LMIs) leads to the LPV controller. A synchronous generator model is connected with the closed LPV control loop for examining the electrical subsystem performance obtained by an inner speed control loop. Simulation results of a 1.5 MW horizontal axis wind turbine model on the FAST platform illustrates the benefit of the LPV control and demonstrates the advantages of this proposed LPV controller, when compared with a traditional gain scheduling PI control and prior LPV control configurations. Enhanced structural load mitigation, improved power extraction, and good current performance were obtained from the proposed LPV control. PMID:25884036

Early penile metastasis from primary bladder cancer as the first systemic manifestation: a case report.

PubMed

Sönmez, Nurettin Cem; Coşkun, Burhan; Arisan, Serdar; Güney, Soner; Dalkiliç, Ayhan

2009-08-14

Metastatic involement of penis is an exceptionally rare condition. 77% of the metastases are originated from the pelvic region; prostate and bladder are the most frequent primary locations. Retrograde venous route, retrograde lymphatic route, arterial spread, direct extension, implantation and secondary to instrumentation are the mechanisms of metastasis. Approximately two thirds of all penile metastasis are detected at a mean time of 18 months after the detection of the primary tumor and the remaining one third is presented at the same time with primary tumor. Diagnosis is usually made by biopsy and also non invasive methods as MRI or colour-coded duplex ultrasonography. Treatment options in these patients are local excision, partial or complete penectomy, external beam radiation therapy and chemotheraphy. Despite these alternatives prognosis is usually poor.We present a case of urethelial carcinoma of the bladder and coincidental prostate adenocarcinoma with penile metastasis which is presented with priapism 6 months after radical cystectomy as the first systemic manifestation. We performed biopsy initially for staging and the patient underwent MRI showing the extension of the disease. The patient underwent radiotherapy of 56 gy and priapism partially resolved after the treatment. Chemotheraphy was also planned but the patient died 3 months following radiotheraphy.

Ubiquitin-conjugating enzyme E2-like gene associated to pathogen response in Concholepas concholepas: SNP identification and transcription expression.

PubMed

Núñez-Acuña, Gustavo; Aguilar-Espinoza, Andrea; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

2012-10-01

Ubiquitin-conjugated E2 enzyme (UBE2) is one of the main components of the proteasome degradation cascade. Previous studies have shown an increase of expression levels in individuals challenged to some pathogen organism such as virus and bacteria. The study was to characterize the immune response of UBE2 gene in the gastropod Concholepas concholepas through expression analysis and single nucleotide polymorphisms (SNP) discovery. Hence, UBE2 was identified from a cDNA library by 454 pyrosequencing, while SNP identification and validation were performed using De novo assembly and high resolution melting analysis. Challenge trials with Vibrio anguillarum was carried out to evaluate the relative transcript abundance of UBE2 gene from two to thirty-three hours post-treatment. The results showed a partial UBE2 sequence of 889 base pair (bp) with a partial coding region of 291 bp. SNP variation (A/C) was observed at the 546th position. Individuals challenged by V. anguillarum showed an overexpression of the UBE2 gene, the expression being significantly higher in homozygous individuals (AA) than (CC) or heterozygous individuals (A/C). This study contributes useful information relating to the UBE2 gene and its association with innate immune response in marine invertebrates. Copyright © 2012 Elsevier Ltd. All rights reserved.

Software Model Checking of ARINC-653 Flight Code with MCP

NASA Technical Reports Server (NTRS)

Thompson, Sarah J.; Brat, Guillaume; Venet, Arnaud

2010-01-01

The ARINC-653 standard defines a common interface for Integrated Modular Avionics (IMA) code. In particular, ARINC-653 Part 1 specifies a process- and partition-management API that is analogous to POSIX threads, but with certain extensions and restrictions intended to support the implementation of high reliability flight code. MCP is a software model checker, developed at NASA Ames, that provides capabilities for model checking C and C++ source code. In this paper, we present recent work aimed at implementing extensions to MCP that support ARINC-653, and we discuss the challenges and opportunities that consequentially arise. Providing support for ARINC-653 s time and space partitioning is nontrivial, though there are implicit benefits for partial order reduction possible as a consequence of the API s strict interprocess communication policy.

Shear Banding in a Partially Molten Mantle

NASA Astrophysics Data System (ADS)

Alisic, L.; Rudge, J. F.; Wells, G.; Katz, R. F.; Rhebergen, S.

2013-12-01

We investigate the nonlinear behaviour of partially molten mantle material under shear. Numerical models of compaction and advection-diffusion of a porous matrix with a spherical inclusion are built using the automated code generation package FEniCS. The time evolution of melt distribution with increasing shear in these models is compared to laboratory experiments that show high-porosity shear banding in the medium and pressure shadows around the inclusion. We focus on understanding the interaction between these shear bands and pressure shadows as a function of rheological parameters.

Neutron beam characterization measurements at the Manuel Lujan Jr. neutron scattering center

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mocko, Michal; Muhrer, Guenter; Daemen, Luke L

We have measured the neutron beam characteristics of neutron moderators at the Manuel Lujan Jr. Neutron Scattering Center at LANSCE. The absolute thermal neutron flux, energy spectra and time emission spectra were measured for the high resolution and high intensity decoupled water, partially coupled liquid hydrogen and partially coupled water moderators. The results of our experimental study will provide an insight into aging of different target-moderator-reflector-shield components as well as new experimental data for benchmarking of neutron transport codes.

Simulation of partially coherent light propagation using parallel computing devices

NASA Astrophysics Data System (ADS)

Magalhães, Tiago C.; Rebordão, José M.

2017-08-01

Light acquires or loses coherence and coherence is one of the few optical observables. Spectra can be derived from coherence functions and understanding any interferometric experiment is also relying upon coherence functions. Beyond the two limiting cases (full coherence or incoherence) the coherence of light is always partial and it changes with propagation. We have implemented a code to compute the propagation of partially coherent light from the source plane to the observation plane using parallel computing devices (PCDs). In this paper, we restrict the propagation in free space only. To this end, we used the Open Computing Language (OpenCL) and the open-source toolkit PyOpenCL, which gives access to OpenCL parallel computation through Python. To test our code, we chose two coherence source models: an incoherent source and a Gaussian Schell-model source. In the former case, we divided into two different source shapes: circular and rectangular. The results were compared to the theoretical values. Our implemented code allows one to choose between the PyOpenCL implementation and a standard one, i.e using the CPU only. To test the computation time for each implementation (PyOpenCL and standard), we used several computer systems with different CPUs and GPUs. We used powers of two for the dimensions of the cross-spectral density matrix (e.g. 324, 644) and a significant speed increase is observed in the PyOpenCL implementation when compared to the standard one. This can be an important tool for studying new source models.

Evidence for Coincident Fusion Products Using Silicon Surface-barrier Detectors

NASA Astrophysics Data System (ADS)

Jones, Steven; Scott, Mark; Keeney, Frank

2002-10-01

We report experimental results showing coincident proton and triton production from the reaction: d + d --> t (1.01 MeV) + p (3.02 MeV). Partially-deuterided thin titanium foils were positioned between two silicon surface-barrier detectors which were mounted in a small cylindrical vacuum chamber which also served as a Faraday cage. We performed Monte Carlo studies using the SRIM code to determine the expected energies of arriving particles after they exit the host foil. The dual-coincidence requirement reduces background to very low levels so that low yields from very thin TiD foils can be readily detected. In one sequence of experiments, we observed 74 foreground coincidences in the regions of interest compared with 24 background counts; the statistical significance is approximately ten standard deviations. A striking advance is that the repeatability from the dual-coincidence experiments is currently greater than 70%.

Detection and partial molecular characterization of atypical plum pox virus isolates from naturally infected sour cherry.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna

2013-06-01

Atypical isolates of plum pox virus (PPV) were discovered in naturally infected sour cherry in urban ornamental plantings in Moscow, Russia. The isolates were detected by polyclonal double antibody sandwich ELISA and RT-PCR using universal primers specific for the 3'-non-coding and coat protein (CP) regions of the genome but failed to be recognized by triple antibody sandwich ELISA with the universal monoclonal antibody 5B and by RT-PCR using primers specific to for PPV strains D, M, C and W. Sequence analysis of the CP genes of nine isolates revealed 99.2-100 % within-group identity and 62-85 % identity to conventional PPV strains. Phylogenetic analysis showed that the atypical isolates represent a group that is distinct from the known PPV strains. Alignment of the N-terminal amino acid sequences of CP demonstrated their close similarity to those of a new tentative PPV strain, CR.

Molecular epidemiology of eastern equine encephalitis Virus, New York

USGS Publications Warehouse

Young, David S.; Kramer, Laura D.; Maffei, Joseph G.; Dusek, Robert J.; Backenson, P. Bryon; Mores, Christopher N.; Bernard, Kristen A.; Ebel, Gregory D.

2008-01-01

Perpetuation, overwintering, and extinction of eastern equine encephalitis virus (EEEV) in northern foci are poorly understood. We therefore sought to describe the molecular epidemiology of EEEV in New York State during current and past epizootics. To determine whether EEEV overwinters, is periodically reintroduced, or both, we sequenced the E2 and partial NSP3 coding regions of 42 EEEV isolates from New York State and the Eastern Seaboard of the United States. Our phylogenetic analyses indicated that derived subclades tended to contain southern strains that had been isolated before genetically similar northern strains, suggesting southern to northern migration of EEEV along the Eastern Seaboard. Strong clustering among strains isolated during epizootics in New York from 2003–2005, as well as from 1974–1975, demonstrates that EEEV has overwintered in this focus. This study provides molecular evidence for the introduction of southern EEEV strains to New York, followed by local amplification, perpetuation, and overwintering.

FrameD: A flexible program for quality check and gene prediction in prokaryotic genomes and noisy matured eukaryotic sequences.

PubMed

Schiex, Thomas; Gouzy, Jérôme; Moisan, Annick; de Oliveira, Yannick

2003-07-01

We describe FrameD, a program that predicts coding regions in prokaryotic and matured eukaryotic sequences. Initially targeted at gene prediction in bacterial GC rich genomes, the gene model used in FrameD also allows to predict genes in the presence of frameshifts and partially undetermined sequences which makes it also very suitable for gene prediction and frameshift correction in unfinished sequences such as EST and EST cluster sequences. Like recent eukaryotic gene prediction programs, FrameD also includes the ability to take into account protein similarity information both in its prediction and its graphical output. Its performances are evaluated on different bacterial genomes. The web site (http://genopole.toulouse.inra.fr/bioinfo/FrameD/FD) allows direct prediction, sequence correction and translation and the ability to learn new models for new organisms.

Error-Rate Bounds for Coded PPM on a Poisson Channel

NASA Technical Reports Server (NTRS)

Moision, Bruce; Hamkins, Jon

2009-01-01

Equations for computing tight bounds on error rates for coded pulse-position modulation (PPM) on a Poisson channel at high signal-to-noise ratio have been derived. These equations and elements of the underlying theory are expected to be especially useful in designing codes for PPM optical communication systems. The equations and the underlying theory apply, more specifically, to a case in which a) At the transmitter, a linear outer code is concatenated with an inner code that includes an accumulator and a bit-to-PPM-symbol mapping (see figure) [this concatenation is known in the art as "accumulate-PPM" (abbreviated "APPM")]; b) The transmitted signal propagates on a memoryless binary-input Poisson channel; and c) At the receiver, near-maximum-likelihood (ML) decoding is effected through an iterative process. Such a coding/modulation/decoding scheme is a variation on the concept of turbo codes, which have complex structures, such that an exact analytical expression for the performance of a particular code is intractable. However, techniques for accurately estimating the performances of turbo codes have been developed. The performance of a typical turbo code includes (1) a "waterfall" region consisting of a steep decrease of error rate with increasing signal-to-noise ratio (SNR) at low to moderate SNR, and (2) an "error floor" region with a less steep decrease of error rate with increasing SNR at moderate to high SNR. The techniques used heretofore for estimating performance in the waterfall region have differed from those used for estimating performance in the error-floor region. For coded PPM, prior to the present derivations, equations for accurate prediction of the performance of coded PPM at high SNR did not exist, so that it was necessary to resort to time-consuming simulations in order to make such predictions. The present derivation makes it unnecessary to perform such time-consuming simulations.

Deployment of the OSIRIS EM-PIC code on the Intel Knights Landing architecture

NASA Astrophysics Data System (ADS)

Fonseca, Ricardo

2017-10-01

Electromagnetic particle-in-cell (EM-PIC) codes such as OSIRIS have found widespread use in modelling the highly nonlinear and kinetic processes that occur in several relevant plasma physics scenarios, ranging from astrophysical settings to high-intensity laser plasma interaction. Being computationally intensive, these codes require large scale HPC systems, and a continuous effort in adapting the algorithm to new hardware and computing paradigms. In this work, we report on our efforts on deploying the OSIRIS code on the new Intel Knights Landing (KNL) architecture. Unlike the previous generation (Knights Corner), these boards are standalone systems, and introduce several new features, include the new AVX-512 instructions and on-package MCDRAM. We will focus on the parallelization and vectorization strategies followed, as well as memory management, and present a detailed performance evaluation of code performance in comparison with the CPU code. This work was partially supported by Fundaçã para a Ciência e Tecnologia (FCT), Portugal, through Grant No. PTDC/FIS-PLA/2940/2014.

Recurrent and functional regulatory mutations in breast cancer.

PubMed

Rheinbay, Esther; Parasuraman, Prasanna; Grimsby, Jonna; Tiao, Grace; Engreitz, Jesse M; Kim, Jaegil; Lawrence, Michael S; Taylor-Weiner, Amaro; Rodriguez-Cuevas, Sergio; Rosenberg, Mara; Hess, Julian; Stewart, Chip; Maruvka, Yosef E; Stojanov, Petar; Cortes, Maria L; Seepo, Sara; Cibulskis, Carrie; Tracy, Adam; Pugh, Trevor J; Lee, Jesse; Zheng, Zongli; Ellisen, Leif W; Iafrate, A John; Boehm, Jesse S; Gabriel, Stacey B; Meyerson, Matthew; Golub, Todd R; Baselga, Jose; Hidalgo-Miranda, Alfredo; Shioda, Toshi; Bernards, Andre; Lander, Eric S; Getz, Gad

2017-07-06

Genomic analysis of tumours has led to the identification of hundreds of cancer genes on the basis of the presence of mutations in protein-coding regions. By contrast, much less is known about cancer-causing mutations in non-coding regions. Here we perform deep sequencing in 360 primary breast cancers and develop computational methods to identify significantly mutated promoters. Clear signals are found in the promoters of three genes. FOXA1, a known driver of hormone-receptor positive breast cancer, harbours a mutational hotspot in its promoter leading to overexpression through increased E2F binding. RMRP and NEAT1, two non-coding RNA genes, carry mutations that affect protein binding to their promoters and alter expression levels. Our study shows that promoter regions harbour recurrent mutations in cancer with functional consequences and that the mutations occur at similar frequencies as in coding regions. Power analyses indicate that more such regions remain to be discovered through deep sequencing of adequately sized cohorts of patients.

Modelling the colliding-wind spectra of the WC8d+O8-9IV binary CV Ser (WR 113)

NASA Astrophysics Data System (ADS)

Hill, G. M.; Moffat, A. F. J.; St-Louis, N.

2018-03-01

Striking profile variations of the C III λ5696 emission line are visible amongst the high signal-to-noise ratio, moderate resolution spectra of the 29.7 d WC8d+O8-9IV binary CV Ser (WR 113) presented here. Using a significantly revised code, we have modelled these variations assuming the emission originates from the undisturbed WR star wind and a colliding wind shock region that partially wraps around the O star. Changes to the modelling code are chiefly in the form of additional parameters, intended to refine the modelling and facilitate comparison with recent predictions arising from theoretical and hydrodynamical work. This modelling provides measurements of crucial parameters such as the orbital inclination (63.5° ± 2.5°) and thus, together with the RV orbits, the stellar masses (11.7 ± 0.9 M⊙ for the WR star and 33.3 ± 2.0 M⊙ for the O star). We find good agreement with expectations based on theoretical studies and hydrodynamical modelling of colliding wind systems. Moreover, it raises the exciting prospect of providing a reliable method to learn more about WR stellar masses and winds, and for studying the physics of colliding winds in massive stars.

Color identification testing device

NASA Technical Reports Server (NTRS)

Brawner, E. L.; Martin, R.; Pate, W.

1970-01-01

Testing device, which determines ability of a technician to identify color-coded electric wires, is superior to standard color blindness tests. It tests speed of wire selection, detects partial color blindness, allows rapid testing, and may be administered by a color blind person.

GBS: Global 3D simulation of tokamak edge region

NASA Astrophysics Data System (ADS)

Zhu, Ben; Fisher, Dustin; Rogers, Barrett; Ricci, Paolo

2012-10-01

A 3D two-fluid global code, namely Global Braginskii Solver (GBS), is being developed to explore the physics of turbulent transport, confinement, self-consistent profile formation, pedestal scaling and related phenomena in the edge region of tokamaks. Aimed at solving drift-reduced Braginskii equations [1] in complex magnetic geometry, the GBS is used for turbulence simulation in SOL region. In the recent upgrade, the simulation domain is expanded into close flux region with twist-shift boundary conditions. Hence, the new GBS code is able to explore global transport physics in an annular full-torus domain from the top of the pedestal into the far SOL. We are in the process of identifying and analyzing the linear and nonlinear instabilities in the system using the new GBS code. Preliminary results will be presented and compared with other codes if possible.[4pt] [1] A. Zeiler, J. F. Drake and B. Rogers, Phys. Plasmas 4, 2134 (1997)

Melt segregation from partially molten source regions - The importance of melt density and source region size

NASA Technical Reports Server (NTRS)

Stolper, E.; Hager, B. H.; Walker, D.; Hays, J. F.

1981-01-01

An investigation is conducted regarding the changes expected in the density contrast between basic melts and peridotites with increasing pressure using the limited data available on the compressibilities of silicate melts and data on the densities of mantle minerals. It is concluded that since compressibilities of silicate melts are about an order of magnitude greater than those of mantle minerals, the density contrast between basic melts and mantle minerals must diminish significantly with increasing pressure. An earlier analysis regarding the migration of liquid in partially molten source regions conducted by Walker et al. (1978) is extended, giving particular attention to the influence of the diminished density contrast between melt and residual crystals with increasing source region depth and to the influence of source region size. This analysis leads to several generalizations concerning the factors influencing the depths at which magmas will segregate from their source regions and the degrees of partial melting that can be achieved in these source regions before melt segregation occurs.

Variability and transmission by Aphis glycines of North American and Asian Soybean mosaic virus isolates.

PubMed

Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L

2003-10-01

The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.

78 FR 52477 - Promulgation of State Implementation Plan Revisions; Revision to Prevention of Significant...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-23

...), Region 8, Mail Code 8P-AR, 1595 Wynkoop Street, Denver, Colorado 80202-1129. Hand Delivery: Director, Air Program, Environmental Protection Agency (EPA), Region 8, Mail Code 8P-AR, 1595 Wynkoop Street, Denver... Agency (EPA), Region 8, 1595 Wynkoop Street, Denver, Colorado 80202-1129. EPA requests that if at all...

Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia

PubMed Central

2010-01-01

Background Newcastle disease (ND), caused by Newcastle disease virus (NDV), is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. Results The coding region of eleven NDV isolates fusion (F) gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN) gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia), Ch/2000 (China), local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. Conclusions The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases. PMID:20691110

Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia.

PubMed

Berhanu, Ayalew; Ideris, Aini; Omar, Abdul R; Bejo, Mohd Hair

2010-08-08

Newcastle disease (ND), caused by Newcastle disease virus (NDV), is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. The coding region of eleven NDV isolates fusion (F) gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN) gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia), Ch/2000 (China), local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.

A Flexible and Non-instrusive Approach for Computing Complex Structural Coverage Metrics

NASA Technical Reports Server (NTRS)

Whalen, Michael W.; Person, Suzette J.; Rungta, Neha; Staats, Matt; Grijincu, Daniela

2015-01-01

Software analysis tools and techniques often leverage structural code coverage information to reason about the dynamic behavior of software. Existing techniques instrument the code with the required structural obligations and then monitor the execution of the compiled code to report coverage. Instrumentation based approaches often incur considerable runtime overhead for complex structural coverage metrics such as Modified Condition/Decision (MC/DC). Code instrumentation, in general, has to be approached with great care to ensure it does not modify the behavior of the original code. Furthermore, instrumented code cannot be used in conjunction with other analyses that reason about the structure and semantics of the code under test. In this work, we introduce a non-intrusive preprocessing approach for computing structural coverage information. It uses a static partial evaluation of the decisions in the source code and a source-to-bytecode mapping to generate the information necessary to efficiently track structural coverage metrics during execution. Our technique is flexible; the results of the preprocessing can be used by a variety of coverage-driven software analysis tasks, including automated analyses that are not possible for instrumented code. Experimental results in the context of symbolic execution show the efficiency and flexibility of our nonintrusive approach for computing code coverage information

Aeroelastic loads prediction for an arrow wing. Task 3: Evaluation of the Boeing three-dimensional leading-edge vortex code

NASA Technical Reports Server (NTRS)

Manro, M. E.

1983-01-01

Two separated flow computer programs and a semiempirical method for incorporating the experimentally measured separated flow effects into a linear aeroelastic analysis were evaluated. The three dimensional leading edge vortex (LEV) code is evaluated. This code is an improved panel method for three dimensional inviscid flow over a wing with leading edge vortex separation. The governing equations are the linear flow differential equation with nonlinear boundary conditions. The solution is iterative; the position as well as the strength of the vortex is determined. Cases for both full and partial span vortices were executed. The predicted pressures are good and adequately reflect changes in configuration.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mebarki, F.; Forest, M.G.; Josso, N.

The androgen insensivity syndrome (AIS) is a recessive X-linked disorder resulting from a deficient function of the androgen receptor (AR). The human AR gene has 3 functional domains: N-terminal encoded by exon 1, DNA-binding domain encoded by exons 2 and 3, and androgen-binding domain encoded by exons 4 to 8. In order to characterize the molecular defects of the AR gene in AIS, the entire coding regions and the intronic bording sequences of the AR gene were amplified by PCR before automatic direct sequencing in 45 patients. Twenty seven different point mutations were found in 32 unrelated AIS patients: 18more » with a complete form (CAIS), 14 with a partial form (PAIS); 18 of these mutations are novel mutations, not published to date. Only 3 mutations were repeatedly found: R804H in 3 families; M780I in 3 families and R774C in 2 families. For 26 patients out of the 32 found to have a mutation, maternal DNA was collected and sequenced: 6 de novo mutations were detected (i.e. 23% of the cases). Finally, no mutation was detected in 13 patients (29%): 7 with CAIS and 6 familial severe PAIS. The latter all presented with perineal hypospadias, micropenis, 4 out of 6 being raised as girl. Diagnosis of AIS in these 13 families in whom no mutation was detected is supported by the following criteria: clinical data, familial history (2 or 3 index cases in the same family), familial segregation of the polymorphic CAG repeat of the AR gene. Mutations in intronic regions or the promoter of the AR gene could not explain all cases of AIS without mutations in the AR coding regions, because AR binding (performed in 9 out of 13) was normal in 6, suggesting the synthesis of an AR protein. This situation led us to speculate that another X-linked factor associated with the AR could be implicated in some cases of AIS.« less

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Enigmatic Sedimentary Deposits Within Partially Exhumed Impact Craters in the Aeolis Dorsa Region, Mars: Evidence for Past Crater Lakes

NASA Astrophysics Data System (ADS)

Peel, S. E.; Burr, D. M.

2018-06-01

We mapped enigmatic sedimentary deposits within five partially exhumed impact craters within the Aeolis Dorsa Region of Mars. Ten units have been identified and are found to be consistent with deposition within and adjacent to lacustrine systems.

Identification of common, unique and polymorphic microsatellites among 73 cyanobacterial genomes.

PubMed

Kabra, Ritika; Kapil, Aditi; Attarwala, Kherunnisa; Rai, Piyush Kant; Shanker, Asheesh

2016-04-01

Microsatellites also known as Simple Sequence Repeats are short tandem repeats of 1-6 nucleotides. These repeats are found in coding as well as non-coding regions of both prokaryotic and eukaryotic genomes and play a significant role in the study of gene regulation, genetic mapping, DNA fingerprinting and evolutionary studies. The availability of 73 complete genome sequences of cyanobacteria enabled us to mine and statistically analyze microsatellites in these genomes. The cyanobacterial microsatellites identified through bioinformatics analysis were stored in a user-friendly database named CyanoSat, which is an efficient data representation and query system designed using ASP.net. The information in CyanoSat comprises of perfect, imperfect and compound microsatellites found in coding, non-coding and coding-non-coding regions. Moreover, it contains PCR primers with 200 nucleotides long flanking region. The mined cyanobacterial microsatellites can be freely accessed at www.compubio.in/CyanoSat/home.aspx. In addition to this 82 polymorphic, 13,866 unique and 2390 common microsatellites were also detected. These microsatellites will be useful in strain identification and genetic diversity studies of cyanobacteria.

Synonymous deoptimization of the foot-and-mouth disease virus P1 coding region causes attenuation in vivo while inducing a strong neutralizing antibody response

USDA-ARS?s Scientific Manuscript database

Codon bias deoptimization has been previously used to successfully attenuate human pathogens including polio, respiratory syncytial and influenza viruses. We have applied a similar technology to deoptimize the capsid coding region (P1 region) of the cDNA infectious clone of foot-and-mouth disease vi...

Isolation of the Entomopathogenic Fungal Strain Cod-MK1201 from a Cicada Nymph and Assessment of Its Antibacterial Activities.

PubMed

Sangdee, Kusavadee; Nakbanpote, Woranan; Sangdee, Aphidech

2015-01-01

The entomopathogenic fungus Cod-MK1201 was isolated from a dead cicada nymph. Three regions of ribosomal nuclear DNA, the internal transcribed spacers of nuclear ribosomal DNA repeats (ITS), the partial small subunit of rDNA (nrSSU) , and the partial large subunit of rDNA (nrLSU), and two protein-coding regions, the elongation factor 1α (EF-1α), and the largest subunit of the RNA polymerase II (rpb1) gene, were sequenced and used for fungal identification. The phylogenetic analysis of the ITS and the combined data set of the five genes indicated that the fungal isolate Cod-MK1201 is a new strain of Cordyceps sp. that is closely related to Cordyceps nipponica and C. kanzashiana. Crude extracts of mycelium-cultured Cod-MK1201 were obtained using distilled water and 50% (v/v) ethanol, and the antibacterial activity of each was determined. Both extracts had activity against Gram-positive and Gram-negative bacteria, but the ethanol extract was the more potent of the two. The antibacterial activity of the protein fractions of these extracts was also determined. The protein fraction from the ethanol extract was more antibacterial than the protein fraction from the aqueous extract. Three antibacterial constituents including adenosine, the total phenolic content (TPC), and the total flavonoid content (TFC) was also determined. The results showed that the adenosine content, the TPC, and the TFC of the ethanol extract were more active than those of the aqueous extract. Moreover, synergism was detected between these antibacterial constituents. In conclusion, the entomopathogenic fungal isolate Cod-MK1201 represents a natural source of antibacterial agents.

77 FR 34030 - Notice of Intent To Grant Partially Exclusive Patent License; Lumedyne Technologies, Inc.

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-08

... and Technology Applications Space and Naval Warfare Systems Center Pacific, Code 72120, 53560 Hull St... Hull St, Bldg A33 Room 2531, San Diego, CA 92152-5001, telephone 619-553-5118, E-Mail: [email protected

78 FR 32380 - Notice of Intent To Grant Partially Exclusive Patent License; Lumedyne Technologies, Inc.

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-30

... Technology Applications, Space and Naval Warfare Systems Center Pacific, Code 72120, 53560 Hull St., Bldg... Hull St., Bldg. A33 Room 2531, San Diego, CA 92152-5001, telephone 619-553-5118, E-Mail: [email protected

Partial-reflection studies of D-region winter variability. [electron density measurements

NASA Technical Reports Server (NTRS)

Denny, B. W.; Bowhill, S. A.

1973-01-01

D-region electron densities were measured from December, 1972, to July, 1973, at Urbana, Illinois (latitude 40.2N) using the partial-reflection technique. During the winter, electron densities at altitudes of 72, 76.5, and 81 km show cyclical changes with a period of about 5 days that are highly correlated between these altitudes, suggesting that the mechanism responsible for the winter anomaly in D-region ionization applies throughout this height region. From January 13 to February 3, a pronounced wave-like variation occurred in the partial-reflection measurements, apparently associated with a major stratospheric warming that developed in that period. During the same time period, a traveling periodic variation is observed in the 10-mb height; it is highly correlated with the partial-reflection measurements. Electron density enhancements occur approximately at the same time as increases in the 10-mb height. Comparison of AL and A3 absorption measurements with electron density measurements below 82 km indicates that the winter anomaly in D-region ionization is divided into two types. Type 1, above about 82 km, extends horizontally for about 200 km while type 2, below about 82 km, extends for a horizontal scale of at least 1000 km.

The complete chloroplast genome sequences of Lychnis wilfordii and Silene capitata and comparative analyses with other Caryophyllaceae genomes.

PubMed

Kang, Jong-Soo; Lee, Byoung Yoon; Kwak, Myounghai

2017-01-01

The complete chloroplast genomes of Lychnis wilfordii and Silene capitata were determined and compared with ten previously reported Caryophyllaceae chloroplast genomes. The chloroplast genome sequences of L. wilfordii and S. capitata contain 152,320 bp and 150,224 bp, respectively. The gene contents and orders among 12 Caryophyllaceae species are consistent, but several microstructural changes have occurred. Expansion of the inverted repeat (IR) regions at the large single copy (LSC)/IRb and small single copy (SSC)/IR boundaries led to partial or entire gene duplications. Additionally, rearrangements of the LSC region were caused by gene inversions and/or transpositions. The 18 kb inversions, which occurred three times in different lineages of tribe Sileneae, were thought to be facilitated by the intermolecular duplicated sequences. Sequence analyses of the L. wilfordii and S. capitata genomes revealed 39 and 43 repeats, respectively, including forward, palindromic, and reverse repeats. In addition, a total of 67 and 56 simple sequence repeats were discovered in the L. wilfordii and S. capitata chloroplast genomes, respectively. Finally, we constructed phylogenetic trees of the 12 Caryophyllaceae species and two Amaranthaceae species based on 73 protein-coding genes using both maximum parsimony and likelihood methods.

MtDNA profile of West Africa Guineans: towards a better understanding of the Senegambia region.

PubMed

Rosa, Alexandra; Brehm, António; Kivisild, Toomas; Metspalu, Ene; Villems, Richard

2004-07-01

The matrilineal genetic composition of 372 samples from the Republic of Guiné-Bissau (West African coast) was studied using RFLPs and partial sequencing of the mtDNA control and coding region. The majority of the mtDNA lineages of Guineans (94%) belong to West African specific sub-clusters of L0-L3 haplogroups. A new L3 sub-cluster (L3h) that is found in both eastern and western Africa is present at moderately low frequencies in Guinean populations. A non-random distribution of haplogroups U5 in the Fula group, the U6 among the "Brame" linguistic family and M1 in the Balanta-Djola group, suggests a correlation between the genetic and linguistic affiliation of Guinean populations. The presence of M1 in Balanta populations supports the earlier suggestion of their Sudanese origin. Haplogroups U5 and U6, on the other hand, were found to be restricted to populations that are thought to represent the descendants of a southern expansion of Berbers. Particular haplotypes, found almost exclusively in East-African populations, were found in some ethnic groups with an oral tradition claiming Sudanese origin.

Haplogroup relationships between domestic and wild sheep resolved using a mitogenome panel.

PubMed

Meadows, J R S; Hiendleder, S; Kijas, J W

2011-04-01

Five haplogroups have been identified in domestic sheep through global surveys of mitochondrial (mt) sequence variation, however these group classifications are often based on small fragments of the complete mtDNA sequence; partial control region or the cytochrome B gene. This study presents the complete mitogenome from representatives of each haplogroup identified in domestic sheep, plus a sample of their wild relatives. Comparison of the sequence successfully resolved the relationships between each haplogroup and provided insight into the relationship with wild sheep. The five haplogroups were characterised as branching independently, a radiation that shared a common ancestor 920,000 ± 190,000 years ago based on protein coding sequence. The utility of various mtDNA components to inform the true relationship between sheep was also examined with Bayesian, maximum likelihood and partitioned Bremmer support analyses. The control region was found to be the mtDNA component, which contributed the highest amount of support to the tree generated using the complete data set. This study provides the nucleus of a mtDNA mitogenome panel, which can be used to assess additional mitogenomes and serve as a reference set to evaluate small fragments of the mtDNA.

Haplogroup relationships between domestic and wild sheep resolved using a mitogenome panel

PubMed Central

Meadows, J R S; Hiendleder, S; Kijas, J W

2011-01-01

Five haplogroups have been identified in domestic sheep through global surveys of mitochondrial (mt) sequence variation, however these group classifications are often based on small fragments of the complete mtDNA sequence; partial control region or the cytochrome B gene. This study presents the complete mitogenome from representatives of each haplogroup identified in domestic sheep, plus a sample of their wild relatives. Comparison of the sequence successfully resolved the relationships between each haplogroup and provided insight into the relationship with wild sheep. The five haplogroups were characterised as branching independently, a radiation that shared a common ancestor 920 000±190 000 years ago based on protein coding sequence. The utility of various mtDNA components to inform the true relationship between sheep was also examined with Bayesian, maximum likelihood and partitioned Bremmer support analyses. The control region was found to be the mtDNA component, which contributed the highest amount of support to the tree generated using the complete data set. This study provides the nucleus of a mtDNA mitogenome panel, which can be used to assess additional mitogenomes and serve as a reference set to evaluate small fragments of the mtDNA. PMID:20940734

Direct Exploration of the Role of the Ventral Anterior Temporal Lobe in Semantic Memory: Cortical Stimulation and Local Field Potential Evidence From Subdural Grid Electrodes.

PubMed

Shimotake, Akihiro; Matsumoto, Riki; Ueno, Taiji; Kunieda, Takeharu; Saito, Satoru; Hoffman, Paul; Kikuchi, Takayuki; Fukuyama, Hidenao; Miyamoto, Susumu; Takahashi, Ryosuke; Ikeda, Akio; Lambon Ralph, Matthew A

2015-10-01

Semantic memory is a crucial higher cortical function that codes the meaning of objects and words, and when impaired after neurological damage, patients are left with significant disability. Investigations of semantic dementia have implicated the anterior temporal lobe (ATL) region, in general, as crucial for multimodal semantic memory. The potentially crucial role of the ventral ATL subregion has been emphasized by recent functional neuroimaging studies, but the necessity of this precise area has not been selectively tested. The implantation of subdural electrode grids over this subregion, for the presurgical assessment of patients with partial epilepsy or brain tumor, offers the dual yet rare opportunities to record cortical local field potentials while participants complete semantic tasks and to stimulate the functionally identified regions in the same participants to evaluate the necessity of these areas in semantic processing. Across 6 patients, and utilizing a variety of semantic assessments, we evaluated and confirmed that the anterior fusiform/inferior temporal gyrus is crucial in multimodal, receptive, and expressive, semantic processing. © The Author 2014. Published by Oxford University Press.

Explaining ecological clusters of maternal depression in South Western Sydney.

PubMed

Eastwood ED, John; Kemp, Lynn; Jalaludin, Bin

2014-01-24

The aim of the qualitative study reported here was to: 1) explain the observed clustering of postnatal depressive symptoms in South Western Sydney; and 2) identify group-level mechanisms that would add to our understanding of the social determinants of maternal depression. Critical realism provided the methodological underpinning for the study. The setting was four local government areas in South Western Sydney, Australia. Child and Family practitioners and mothers in naturally occurring mothers groups were interviewed. Using an open coding approach to maximise emergence of patterns and relationships we have identified seven theoretical concepts that might explain the observed spatial clustering of maternal depression. The theoretical concepts identified were: Community-level social networks; Social Capital and Social Cohesion; "Depressed community"; Access to services at the group level; Ethnic segregation and diversity; Supportive social policy; and Big business. We postulate that these regional structural, economic, social and cultural mechanisms partially explain the pattern of maternal depression observed in families and communities within South Western Sydney. We further observe that powerful global economic and political forces are having an impact on the local situation. The challenge for policy and practice is to support mothers and their families within this adverse regional and global-economic context.

Genetic and molecular characterization of the maize rp3 rust resistance locus.

PubMed Central

Webb, Craig A; Richter, Todd E; Collins, Nicholas C; Nicolas, Marie; Trick, Harold N; Pryor, Tony; Hulbert, Scot H

2002-01-01

In maize, the Rp3 gene confers resistance to common rust caused by Puccinia sorghi. Flanking marker analysis of rust-susceptible rp3 variants suggested that most of them arose via unequal crossing over, indicating that rp3 is a complex locus like rp1. The PIC13 probe identifies a nucleotide binding site-leucine-rich repeat (NBS-LRR) gene family that maps to the complex. Rp3 variants show losses of PIC13 family members relative to the resistant parents when probed with PIC13, indicating that the Rp3 gene is a member of this family. Gel blots and sequence analysis suggest that at least 9 family members are at the locus in most Rp3-carrying lines and that at least 5 of these are transcribed in the Rp3-A haplotype. The coding regions of 14 family members, isolated from three different Rp3-carrying haplotypes, had DNA sequence identities from 93 to 99%. Partial sequencing of clones of a BAC contig spanning the rp3 locus in the maize inbred line B73 identified five different PIC13 paralogues in a region of approximately 140 kb. PMID:12242248

Partially coherent X-ray wavefront propagation simulations including grazing-incidence focusing optics.

PubMed

Canestrari, Niccolo; Chubar, Oleg; Reininger, Ruben

2014-09-01

X-ray beamlines in modern synchrotron radiation sources make extensive use of grazing-incidence reflective optics, in particular Kirkpatrick-Baez elliptical mirror systems. These systems can focus the incoming X-rays down to nanometer-scale spot sizes while maintaining relatively large acceptance apertures and high flux in the focused radiation spots. In low-emittance storage rings and in free-electron lasers such systems are used with partially or even nearly fully coherent X-ray beams and often target diffraction-limited resolution. Therefore, their accurate simulation and modeling has to be performed within the framework of wave optics. Here the implementation and benchmarking of a wave-optics method for the simulation of grazing-incidence mirrors based on the local stationary-phase approximation or, in other words, the local propagation of the radiation electric field along geometrical rays, is described. The proposed method is CPU-efficient and fully compatible with the numerical methods of Fourier optics. It has been implemented in the Synchrotron Radiation Workshop (SRW) computer code and extensively tested against the geometrical ray-tracing code SHADOW. The test simulations have been performed for cases without and with diffraction at mirror apertures, including cases where the grazing-incidence mirrors can be hardly approximated by ideal lenses. Good agreement between the SRW and SHADOW simulation results is observed in the cases without diffraction. The differences between the simulation results obtained by the two codes in diffraction-dominated cases for illumination with fully or partially coherent radiation are analyzed and interpreted. The application of the new method for the simulation of wavefront propagation through a high-resolution X-ray microspectroscopy beamline at the National Synchrotron Light Source II (Brookhaven National Laboratory, USA) is demonstrated.

Hypothesis of Lithocoding: Origin of the Genetic Code as a "Double Jigsaw Puzzle" of Nucleobase-Containing Molecules and Amino Acids Assembled by Sequential Filling of Apatite Mineral Cellules.

PubMed

Skoblikow, Nikolai E; Zimin, Andrei A

2016-05-01

The hypothesis of direct coding, assuming the direct contact of pairs of coding molecules with amino acid side chains in hollow unit cells (cellules) of a regular crystal-structure mineral is proposed. The coding nucleobase-containing molecules in each cellule (named "lithocodon") partially shield each other; the remaining free space determines the stereochemical character of the filling side chain. Apatite-group minerals are considered as the most preferable for this type of coding (named "lithocoding"). A scheme of the cellule with certain stereometric parameters, providing for the isomeric selection of contacting molecules is proposed. We modelled the filling of cellules with molecules involved in direct coding, with the possibility of coding by their single combination for a group of stereochemically similar amino acids. The regular ordered arrangement of cellules enables the polymerization of amino acids and nucleobase-containing molecules in the same direction (named "lithotranslation") preventing the shift of coding. A table of the presumed "LithoCode" (possible and optimal lithocodon assignments for abiogenically synthesized α-amino acids involved in lithocoding and lithotranslation) is proposed. The magmatic nature of the mineral, abiogenic synthesis of organic molecules and polymerization events are considered within the framework of the proposed "volcanic scenario".

An efficient decoding for low density parity check codes

NASA Astrophysics Data System (ADS)

Zhao, Ling; Zhang, Xiaolin; Zhu, Manjie

2009-12-01

Low density parity check (LDPC) codes are a class of forward-error-correction codes. They are among the best-known codes capable of achieving low bit error rates (BER) approaching Shannon's capacity limit. Recently, LDPC codes have been adopted by the European Digital Video Broadcasting (DVB-S2) standard, and have also been proposed for the emerging IEEE 802.16 fixed and mobile broadband wireless-access standard. The consultative committee for space data system (CCSDS) has also recommended using LDPC codes in the deep space communications and near-earth communications. It is obvious that LDPC codes will be widely used in wired and wireless communication, magnetic recording, optical networking, DVB, and other fields in the near future. Efficient hardware implementation of LDPC codes is of great interest since LDPC codes are being considered for a wide range of applications. This paper presents an efficient partially parallel decoder architecture suited for quasi-cyclic (QC) LDPC codes using Belief propagation algorithm for decoding. Algorithmic transformation and architectural level optimization are incorporated to reduce the critical path. First, analyze the check matrix of LDPC code, to find out the relationship between the row weight and the column weight. And then, the sharing level of the check node updating units (CNU) and the variable node updating units (VNU) are determined according to the relationship. After that, rearrange the CNU and the VNU, and divide them into several smaller parts, with the help of some assistant logic circuit, these smaller parts can be grouped into CNU during the check node update processing and grouped into VNU during the variable node update processing. These smaller parts are called node update kernel units (NKU) and the assistant logic circuit are called node update auxiliary unit (NAU). With NAUs' help, the two steps of iteration operation are completed by NKUs, which brings in great hardware resource reduction. Meanwhile, efficient techniques have been developed to reduce the computation delay of the node processing units and to minimize hardware overhead for parallel processing. This method may be applied not only to regular LDPC codes, but also to the irregular ones. Based on the proposed architectures, a (7493, 6096) irregular QC-LDPC code decoder is described using verilog hardware design language and implemented on Altera field programmable gate array (FPGA) StratixII EP2S130. The implementation results show that over 20% of logic core size can be saved than conventional partially parallel decoder architectures without any performance degradation. If the decoding clock is 100MHz, the proposed decoder can achieve a maximum (source data) decoding throughput of 133 Mb/s at 18 iterations.

Comparative Mitogenomic Analysis Reveals Sexual Dimorphism in a Rare Montane Lacewing (Insecta: Neuroptera: Ithonidae)

PubMed Central

Wang, Yuyu; Liu, Xingyue; Winterton, Shaun L.; Yan, Yan; Chang, Wencheng; Yang, Ding

2013-01-01

Rapisma McLachlan, 1866 (Neuroptera: Ithonidae) is a rarely encountered genus of lacewings found inmontane tropical or subtropical forests in Oriental Asia. In Xizang Autonomous Region (Tibet) of China there are two sympatrically distributed species of Rapisma, i.e. Rapisma xizangense Yang, 1993 and Rapisma zayuanum Yang, 1993, in which R. xizangense is only known as male and has dull brownish body and wing coloration, while R. zayuanum is only known as female and has bright green body and wing coloration. In order to clarify the relationship between these two species, we determined the complete mitochondrial (mt) genomes of R. xizangense and R. zayuanum for the first time. The mt genomes are 15,961 and 15,984 bp in size, respectively, and comprised 37 genes (13 protein coding genes, 22 tRNA genes and 2 rRNA genes). A major noncoding (control) region was 1,167 bp in R. xizangense and 1,193 bp in R. zayuanum with structural organizations simpler than that reported in other Neuropterida species, notably lacking conserved blocks or long tandem repeats. Besides similar mitogenomic structure, the genetic distance between R. xizangense and R. zayuanum based on two rRNAs and 13 protein coding genes (PCGs) as well as the genetic distance between each of these two Tibetan Rapisma species and a Thai Rapisma species (R. cryptunum) based on partial rrnL show that R. xizangense and R. zayuanum are most likely conspecific. Thus, R. zayuanum syn. nov. is herein treated as a junior synonym of R. xizangense. The present finding represents a rare example of distinct sexual dimorphism in lacewings. This comparative mitogenomic analysis sheds new light on the identification of rare species with sexual dimorphism and the biology of Neuroptera. PMID:24391859

Building a Better Campus: An Update on Building Codes.

ERIC Educational Resources Information Center

Madden, Michael J.

2002-01-01

Discusses the implications for higher education institutions in terms of facility planning, design, construction, and renovation of the move from regionally-developed model-building codes to two international sets of codes. Also addresses the new performance-based design option within the codes. (EV)

Raman spectroscopy: in vivo quick response code of skin physiological status

NASA Astrophysics Data System (ADS)

Vyumvuhore, Raoul; Tfayli, Ali; Piot, Olivier; Le Guillou, Maud; Guichard, Nathalie; Manfait, Michel; Baillet-Guffroy, Arlette

2014-11-01

Dermatologists need to combine different clinically relevant characteristics for a better understanding of skin health. These characteristics are usually measured by different techniques, and some of them are highly time consuming. Therefore, a predicting model based on Raman spectroscopy and partial least square (PLS) regression was developed as a rapid multiparametric method. The Raman spectra collected from the five uppermost micrometers of 11 healthy volunteers were fitted to different skin characteristics measured by independent appropriate methods (transepidermal water loss, hydration, pH, relative amount of ceramides, fatty acids, and cholesterol). For each parameter, the obtained PLS model presented correlation coefficients higher than R2=0.9. This model enables us to obtain all the aforementioned parameters directly from the unique Raman signature. In addition to that, in-depth Raman analyses down to 20 μm showed different balances between partially bound water and unbound water with depth. In parallel, the increase of depth was followed by an unfolding process of the proteins. The combinations of all these information led to a multiparametric investigation, which better characterizes the skin status. Raman signal can thus be used as a quick response code (QR code). This could help dermatologic diagnosis of physiological variations and presents a possible extension to pathological characterization.

Raman spectroscopy: in vivo quick response code of skin physiological status.

PubMed

Vyumvuhore, Raoul; Tfayli, Ali; Piot, Olivier; Le Guillou, Maud; Guichard, Nathalie; Manfait, Michel; Baillet-Guffroy, Arlette

2014-01-01

Dermatologists need to combine different clinically relevant characteristics for a better understanding of skin health. These characteristics are usually measured by different techniques, and some of them are highly time consuming. Therefore, a predicting model based on Raman spectroscopy and partial least square (PLS) regression was developed as a rapid multiparametric method. The Raman spectra collected from the five uppermost micrometers of 11 healthy volunteers were fitted to different skin characteristics measured by independent appropriate methods (transepidermal water loss, hydration, pH, relative amount of ceramides, fatty acids, and cholesterol). For each parameter, the obtained PLS model presented correlation coefficients higher than R2=0.9. This model enables us to obtain all the aforementioned parameters directly from the unique Raman signature. In addition to that, in-depth Raman analyses down to 20 μm showed different balances between partially bound water and unbound water with depth. In parallel, the increase of depth was followed by an unfolding process of the proteins. The combinations of all these information led to a multiparametric investigation, which better characterizes the skin status. Raman signal can thus be used as a quick response code (QR code). This could help dermatologic diagnosis of physiological variations and presents a possible extension to pathological characterization.

A method of transition conflict resolving in hierarchical control

NASA Astrophysics Data System (ADS)

Łabiak, Grzegorz

2016-09-01

The paper concerns the problem of automatic solving of transition conflicts in hierarchical concurrent state machines (also known as UML state machine). Preparing by the designer a formal specification of a behaviour free from conflicts can be very complex. In this paper, it is proposed a method for solving conflicts through transition predicates modification. Partially specified predicates in the nondeterministic diagram are transformed into a symbolic Boolean space, whose points of the space code all possible valuations of transition predicates. Next, all valuations under partial specifications are logically multiplied by a function which represents all possible orthogonal predicate valuations. The result of this operation contains all possible collections of predicates, which under given partial specification make that the original diagram is conflict free and deterministic.

Extending compile-time reverse mode and exploiting partial separability in ADIFOR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bischof, C.H.; El-Khadiri, M.

1992-10-01

The numerical methods employed in the solution of many scientific computing problems require the computation of the gradient of a function f: R[sup n] [yields] R. ADIFOR is a source translator that, given a collection of subroutines to compute f, generates Fortran 77 code for computing the derivative of this function. Using the so-called torsion problem from the MINPACK-2 test collection as an example, this paper explores two issues in automatic differentiation: the efficient computation of derivatives for partial separable functions and the use of the compile-time reverse mode for the generation of derivatives. We show that orders of magnitudesmore » of improvement are possible when exploiting partial separability and maximizing use of the reverse mode.« less

An integrative approach to predicting the functional effects of small indels in non-coding regions of the human genome

PubMed Central

Ferlaino, Michael; Rogers, Mark F.; Shihab, Hashem A.; Mort, Matthew; Cooper, David N.; Gaunt, Tom R.; Campbell, Colin

2018-01-01

Background Small insertions and deletions (indels) have a significant influence in human disease and, in terms of frequency, they are second only to single nucleotide variants as pathogenic mutations. As the majority of mutations associated with complex traits are located outside the exome, it is crucial to investigate the potential pathogenic impact of indels in non-coding regions of the human genome. Results We present FATHMM-indel, an integrative approach to predict the functional effect, pathogenic or neutral, of indels in non-coding regions of the human genome. Our method exploits various genomic annotations in addition to sequence data. When validated on benchmark data, FATHMM-indel significantly outperforms CADD and GAVIN, state of the art models in assessing the pathogenic impact of non-coding variants. FATHMM-indel is available via a web server at indels.biocompute.org.uk. Conclusions FATHMM-indel can accurately predict the functional impact and prioritise small indels throughout the whole non-coding genome. PMID:28985712

An integrative approach to predicting the functional effects of small indels in non-coding regions of the human genome.

PubMed

Ferlaino, Michael; Rogers, Mark F; Shihab, Hashem A; Mort, Matthew; Cooper, David N; Gaunt, Tom R; Campbell, Colin

2017-10-06

Small insertions and deletions (indels) have a significant influence in human disease and, in terms of frequency, they are second only to single nucleotide variants as pathogenic mutations. As the majority of mutations associated with complex traits are located outside the exome, it is crucial to investigate the potential pathogenic impact of indels in non-coding regions of the human genome. We present FATHMM-indel, an integrative approach to predict the functional effect, pathogenic or neutral, of indels in non-coding regions of the human genome. Our method exploits various genomic annotations in addition to sequence data. When validated on benchmark data, FATHMM-indel significantly outperforms CADD and GAVIN, state of the art models in assessing the pathogenic impact of non-coding variants. FATHMM-indel is available via a web server at indels.biocompute.org.uk. FATHMM-indel can accurately predict the functional impact and prioritise small indels throughout the whole non-coding genome.

The nucleotide composition of microbial genomes indicates differential patterns of selection on core and accessory genomes.

PubMed

Bohlin, Jon; Eldholm, Vegard; Pettersson, John H O; Brynildsrud, Ola; Snipen, Lars

2017-02-10

The core genome consists of genes shared by the vast majority of a species and is therefore assumed to have been subjected to substantially stronger purifying selection than the more mobile elements of the genome, also known as the accessory genome. Here we examine intragenic base composition differences in core genomes and corresponding accessory genomes in 36 species, represented by the genomes of 731 bacterial strains, to assess the impact of selective forces on base composition in microbes. We also explore, in turn, how these results compare with findings for whole genome intragenic regions. We found that GC content in coding regions is significantly higher in core genomes than accessory genomes and whole genomes. Likewise, GC content variation within coding regions was significantly lower in core genomes than in accessory genomes and whole genomes. Relative entropy in coding regions, measured as the difference between observed and expected trinucleotide frequencies estimated from mononucleotide frequencies, was significantly higher in the core genomes than in accessory and whole genomes. Relative entropy was positively associated with coding region GC content within the accessory genomes, but not within the corresponding coding regions of core or whole genomes. The higher intragenic GC content and relative entropy, as well as the lower GC content variation, observed in the core genomes is most likely associated with selective constraints. It is unclear whether the positive association between GC content and relative entropy in the more mobile accessory genomes constitutes signatures of selection or selective neutral processes.

Establishing confidence in complex physics codes: Art or science?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trucano, T.

1997-12-31

The ALEGRA shock wave physics code, currently under development at Sandia National Laboratories and partially supported by the US Advanced Strategic Computing Initiative (ASCI), is generic to a certain class of physics codes: large, multi-application, intended to support a broad user community on the latest generation of massively parallel supercomputer, and in a continual state of formal development. To say that the author has ``confidence`` in the results of ALEGRA is to say something different than that he believes that ALEGRA is ``predictive.`` It is the purpose of this talk to illustrate the distinction between these two concepts. The authormore » elects to perform this task in a somewhat historical manner. He will summarize certain older approaches to code validation. He views these methods as aiming to establish the predictive behavior of the code. These methods are distinguished by their emphasis on local information. He will conclude that these approaches are more art than science.« less

High-resolution imaging gamma-ray spectroscopy with externally segmented germanium detectors

NASA Technical Reports Server (NTRS)

Callas, J. L.; Mahoney, W. A.; Varnell, L. S.; Wheaton, W. A.

1993-01-01

Externally segmented germanium detectors promise a breakthrough in gamma-ray imaging capabilities while retaining the superb energy resolution of germanium spectrometers. An angular resolution of 0.2 deg becomes practical by combining position-sensitive germanium detectors having a segment thickness of a few millimeters with a one-dimensional coded aperture located about a meter from the detectors. Correspondingly higher angular resolutions are possible with larger separations between the detectors and the coded aperture. Two-dimensional images can be obtained by rotating the instrument. Although the basic concept is similar to optical or X-ray coded-aperture imaging techniques, several complicating effects arise because of the penetrating nature of gamma rays. The complications include partial transmission through the coded aperture elements, Compton scattering in the germanium detectors, and high background count rates. Extensive electron-photon Monte Carlo modeling of a realistic detector/coded-aperture/collimator system has been performed. Results show that these complicating effects can be characterized and accounted for with no significant loss in instrument sensitivity.

Direct observation of mother-child communication in pediatric cancer: assessment of verbal and non-verbal behavior and emotion.

PubMed

Dunn, Madeleine J; Rodriguez, Erin M; Miller, Kimberly S; Gerhardt, Cynthia A; Vannatta, Kathryn; Saylor, Megan; Scheule, C Melanie; Compas, Bruce E

2011-06-01

To examine the acceptability and feasibility of coding observed verbal and nonverbal behavioral and emotional components of mother-child communication among families of children with cancer. Mother-child dyads (N=33, children ages 5-17 years) were asked to engage in a videotaped 15-min conversation about the child's cancer. Coding was done using the Iowa Family Interaction Rating Scale (IFIRS). Acceptability and feasibility of direct observation in this population were partially supported: 58% consented and 81% of those (47% of all eligible dyads) completed the task; trained raters achieved 78% agreement in ratings across codes. The construct validity of the IFIRS was demonstrated by expected associations within and between positive and negative behavioral/emotional code ratings and between mothers' and children's corresponding code ratings. Direct observation of mother-child communication about childhood cancer has the potential to be an acceptable and feasible method of assessing verbal and nonverbal behavior and emotion in this population.

Feature reconstruction of LFP signals based on PLSR in the neural information decoding study.

PubMed

Yonghui Dong; Zhigang Shang; Mengmeng Li; Xinyu Liu; Hong Wan

2017-07-01

To solve the problems of Signal-to-Noise Ratio (SNR) and multicollinearity when the Local Field Potential (LFP) signals is used for the decoding of animal motion intention, a feature reconstruction of LFP signals based on partial least squares regression (PLSR) in the neural information decoding study is proposed in this paper. Firstly, the feature information of LFP coding band is extracted based on wavelet transform. Then the PLSR model is constructed by the extracted LFP coding features. According to the multicollinearity characteristics among the coding features, several latent variables which contribute greatly to the steering behavior are obtained, and the new LFP coding features are reconstructed. Finally, the K-Nearest Neighbor (KNN) method is used to classify the reconstructed coding features to verify the decoding performance. The results show that the proposed method can achieve the highest accuracy compared to the other three methods and the decoding effect of the proposed method is robust.

Numerical simulations of sheared magnetic lines at the solar null line

NASA Astrophysics Data System (ADS)

Kuźma, B.; Murawski, K.; Solov'ev, A.

2015-05-01

Aims: We perform numerical simulations of sheared magnetic lines at the magnetic null line configuration of two magnetic arcades that are settled in a gravitationally stratified and magnetically confined solar corona. Methods: We developed a general analytical model of a 2.5D solar atmospheric structure. As a particular application of this model, we adopted it for the curved magnetic field lines with an inverted Y shape that compose the null line above two magnetic arcades, which are embedded in the solar atmosphere that is specified by the realistic temperature distribution. The physical system is described by 2.5D magnetohydrodynamic equations that are numerically solved by the FLASH code. Results: The magnetic field line shearing, implemented about 200 km below the transition region, results in Alfvén and magnetoacoustic waves that are able to penetrate solar coronal regions above the magnetic null line. As a result of the coupling of these waves, partial reflection from the transition region and scattering from inhomogeneous regions the Alfvén waves experience fast attenuation on time scales comparable to their wave periods, and the physical system relaxes in time. The attenuation time grows with the large amplitude and characteristic growing time of the shearing. Conclusions: By having chosen a different magnetic flux function, the analytical model we devised can be adopted to derive equilibrium conditions for a diversity of 2.5D magnetic structures in the solar atmosphere. Movie associated to Fig. 5 is available in electronic form at http://www.aanda.org

Reed-Solomon Codes and the Deep Hole Problem

NASA Astrophysics Data System (ADS)

Keti, Matt

In many types of modern communication, a message is transmitted over a noisy medium. When this is done, there is a chance that the message will be corrupted. An error-correcting code adds redundant information to the message which allows the receiver to detect and correct errors accrued during the transmission. We will study the famous Reed-Solomon code (found in QR codes, compact discs, deep space probes,ldots) and investigate the limits of its error-correcting capacity. It can be shown that understanding this is related to understanding the "deep hole" problem, which is a question of determining when a received message has, in a sense, incurred the worst possible corruption. We partially resolve this in its traditional context, when the code is based on the finite field F q or Fq*, as well as new contexts, when it is based on a subgroup of F q* or the image of a Dickson polynomial. This is a new and important problem that could give insight on the true error-correcting potential of the Reed-Solomon code.

76 FR 10341 - Notice of Intent To Grant Partially Exclusive Patent License; Dakota Technologies, Inc.

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-24

..., 53560 Hull St., Bldg. A33 Room 2305, San Diego, CA 92152-5001. FOR FURTHER INFORMATION CONTACT: Brian..., Code 72120, 53560 Hull St., Bldg. A33 Room 2305, San Diego, CA 92152-5001, telephone 619-553-5118, E...

Long Non-Coding RNAs Differentially Expressed between Normal versus Primary Breast Tumor Tissues Disclose Converse Changes to Breast Cancer-Related Protein-Coding Genes

PubMed Central

Reiche, Kristin; Kasack, Katharina; Schreiber, Stephan; Lüders, Torben; Due, Eldri U.; Naume, Bjørn; Riis, Margit; Kristensen, Vessela N.; Horn, Friedemann; Børresen-Dale, Anne-Lise; Hackermüller, Jörg; Baumbusch, Lars O.

2014-01-01

Breast cancer, the second leading cause of cancer death in women, is a highly heterogeneous disease, characterized by distinct genomic and transcriptomic profiles. Transcriptome analyses prevalently assessed protein-coding genes; however, the majority of the mammalian genome is expressed in numerous non-coding transcripts. Emerging evidence supports that many of these non-coding RNAs are specifically expressed during development, tumorigenesis, and metastasis. The focus of this study was to investigate the expression features and molecular characteristics of long non-coding RNAs (lncRNAs) in breast cancer. We investigated 26 breast tumor and 5 normal tissue samples utilizing a custom expression microarray enclosing probes for mRNAs as well as novel and previously identified lncRNAs. We identified more than 19,000 unique regions significantly differentially expressed between normal versus breast tumor tissue, half of these regions were non-coding without any evidence for functional open reading frames or sequence similarity to known proteins. The identified non-coding regions were primarily located in introns (53%) or in the intergenic space (33%), frequently orientated in antisense-direction of protein-coding genes (14%), and commonly distributed at promoter-, transcription factor binding-, or enhancer-sites. Analyzing the most diverse mRNA breast cancer subtypes Basal-like versus Luminal A and B resulted in 3,025 significantly differentially expressed unique loci, including 682 (23%) for non-coding transcripts. A notable number of differentially expressed protein-coding genes displayed non-synonymous expression changes compared to their nearest differentially expressed lncRNA, including an antisense lncRNA strongly anticorrelated to the mRNA coding for histone deacetylase 3 (HDAC3), which was investigated in more detail. Previously identified chromatin-associated lncRNAs (CARs) were predominantly downregulated in breast tumor samples, including CARs located in the protein-coding genes for CALD1, FTX, and HNRNPH1. In conclusion, a number of differentially expressed lncRNAs have been identified with relation to cancer-related protein-coding genes. PMID:25264628

Long non-coding RNAs differentially expressed between normal versus primary breast tumor tissues disclose converse changes to breast cancer-related protein-coding genes.

PubMed

Reiche, Kristin; Kasack, Katharina; Schreiber, Stephan; Lüders, Torben; Due, Eldri U; Naume, Bjørn; Riis, Margit; Kristensen, Vessela N; Horn, Friedemann; Børresen-Dale, Anne-Lise; Hackermüller, Jörg; Baumbusch, Lars O

2014-01-01

Breast cancer, the second leading cause of cancer death in women, is a highly heterogeneous disease, characterized by distinct genomic and transcriptomic profiles. Transcriptome analyses prevalently assessed protein-coding genes; however, the majority of the mammalian genome is expressed in numerous non-coding transcripts. Emerging evidence supports that many of these non-coding RNAs are specifically expressed during development, tumorigenesis, and metastasis. The focus of this study was to investigate the expression features and molecular characteristics of long non-coding RNAs (lncRNAs) in breast cancer. We investigated 26 breast tumor and 5 normal tissue samples utilizing a custom expression microarray enclosing probes for mRNAs as well as novel and previously identified lncRNAs. We identified more than 19,000 unique regions significantly differentially expressed between normal versus breast tumor tissue, half of these regions were non-coding without any evidence for functional open reading frames or sequence similarity to known proteins. The identified non-coding regions were primarily located in introns (53%) or in the intergenic space (33%), frequently orientated in antisense-direction of protein-coding genes (14%), and commonly distributed at promoter-, transcription factor binding-, or enhancer-sites. Analyzing the most diverse mRNA breast cancer subtypes Basal-like versus Luminal A and B resulted in 3,025 significantly differentially expressed unique loci, including 682 (23%) for non-coding transcripts. A notable number of differentially expressed protein-coding genes displayed non-synonymous expression changes compared to their nearest differentially expressed lncRNA, including an antisense lncRNA strongly anticorrelated to the mRNA coding for histone deacetylase 3 (HDAC3), which was investigated in more detail. Previously identified chromatin-associated lncRNAs (CARs) were predominantly downregulated in breast tumor samples, including CARs located in the protein-coding genes for CALD1, FTX, and HNRNPH1. In conclusion, a number of differentially expressed lncRNAs have been identified with relation to cancer-related protein-coding genes.

Comparison of Two Coronal Magnetic Field Models to Reconstruct a Sigmoidal Solar Active Region with Coronal Loops

NASA Astrophysics Data System (ADS)

Duan, Aiying; Jiang, Chaowei; Hu, Qiang; Zhang, Huai; Gary, G. Allen; Wu, S. T.; Cao, Jinbin

2017-06-01

Magnetic field extrapolation is an important tool to study the three-dimensional (3D) solar coronal magnetic field, which is difficult to directly measure. Various analytic models and numerical codes exist, but their results often drastically differ. Thus, a critical comparison of the modeled magnetic field lines with the observed coronal loops is strongly required to establish the credibility of the model. Here we compare two different non-potential extrapolation codes, a nonlinear force-free field code (CESE-MHD-NLFFF) and a non-force-free field (NFFF) code, in modeling a solar active region (AR) that has a sigmoidal configuration just before a major flare erupted from the region. A 2D coronal-loop tracing and fitting method is employed to study the 3D misalignment angles between the extrapolated magnetic field lines and the EUV loops as imaged by SDO/AIA. It is found that the CESE-MHD-NLFFF code with preprocessed magnetogram performs the best, outputting a field that matches the coronal loops in the AR core imaged in AIA 94 Å with a misalignment angle of ˜10°. This suggests that the CESE-MHD-NLFFF code, even without using the information of the coronal loops in constraining the magnetic field, performs as good as some coronal-loop forward-fitting models. For the loops as imaged by AIA 171 Å in the outskirts of the AR, all the codes including the potential field give comparable results of the mean misalignment angle (˜30°). Thus, further improvement of the codes is needed for a better reconstruction of the long loops enveloping the core region.

Comparison of Two Coronal Magnetic Field Models to Reconstruct a Sigmoidal Solar Active Region with Coronal Loops

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duan, Aiying; Zhang, Huai; Jiang, Chaowei

Magnetic field extrapolation is an important tool to study the three-dimensional (3D) solar coronal magnetic field, which is difficult to directly measure. Various analytic models and numerical codes exist, but their results often drastically differ. Thus, a critical comparison of the modeled magnetic field lines with the observed coronal loops is strongly required to establish the credibility of the model. Here we compare two different non-potential extrapolation codes, a nonlinear force-free field code (CESE–MHD–NLFFF) and a non-force-free field (NFFF) code, in modeling a solar active region (AR) that has a sigmoidal configuration just before a major flare erupted from themore » region. A 2D coronal-loop tracing and fitting method is employed to study the 3D misalignment angles between the extrapolated magnetic field lines and the EUV loops as imaged by SDO /AIA. It is found that the CESE–MHD–NLFFF code with preprocessed magnetogram performs the best, outputting a field that matches the coronal loops in the AR core imaged in AIA 94 Å with a misalignment angle of ∼10°. This suggests that the CESE–MHD–NLFFF code, even without using the information of the coronal loops in constraining the magnetic field, performs as good as some coronal-loop forward-fitting models. For the loops as imaged by AIA 171 Å in the outskirts of the AR, all the codes including the potential field give comparable results of the mean misalignment angle (∼30°). Thus, further improvement of the codes is needed for a better reconstruction of the long loops enveloping the core region.« less

Intact coding region of the serotonin transporter gene in obsessive-compulsive disorder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Altemus, M.; Murphy, D.L.; Greenberg, B.

1996-07-26

Epidemiologic studies indicate that obsessive-compulsive disorder is genetically transmitted in some families, although no genetic abnormalities have been identified in individuals with this disorder. The selective response of obsessive-compulsive disorder to treatment with agents which block serotonin reuptake suggests the gene coding for the serotonin transporter as a candidate gene. The primary structure of the serotonin-transporter coding region was sequenced in 22 patients with obsessive-compulsive disorder, using direct PCR sequencing of cDNA synthesized from platelet serotonin-transporter mRNA. No variations in amino acid sequence were found among the obsessive-compulsive disorder patients or healthy controls. These results do not support a rolemore » for alteration in the primary structure of the coding region of the serotonin-transporter gene in the pathogenesis of obsessive-compulsive disorder. 27 refs.« less

A hybrid LBG/lattice vector quantizer for high quality image coding

NASA Technical Reports Server (NTRS)

Ramamoorthy, V.; Sayood, K.; Arikan, E. (Editor)

1991-01-01

It is well known that a vector quantizer is an efficient coder offering a good trade-off between quantization distortion and bit rate. The performance of a vector quantizer asymptotically approaches the optimum bound with increasing dimensionality. A vector quantized image suffers from the following types of degradations: (1) edge regions in the coded image contain staircase effects, (2) quasi-constant or slowly varying regions suffer from contouring effects, and (3) textured regions lose details and suffer from granular noise. All three of these degradations are due to the finite size of the code book, the distortion measures used in the design, and due to the finite training procedure involved in the construction of the code book. In this paper, we present an adaptive technique which attempts to ameliorate the edge distortion and contouring effects.

The complete mitochondrial genome of Chrysopa pallens (Insecta, Neuroptera, Chrysopidae).

PubMed

He, Kun; Chen, Zhe; Yu, Dan-Na; Zhang, Jia-Yong

2012-10-01

The complete mitochondrial genome of Chrysopa pallens (Neuroptera, Chrysopidae) was sequenced. It consists of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA (rRNA) genes, and a control region (AT-rich region). The total length of C. pallens mitogenome is 16,723 bp with 79.5% AT content, and the length of control region is 1905 bp with 89.1% AT content. The non-coding regions of C. pallens include control region between 12S rRNA and trnI genes, and a 75-bp space region between trnI and trnQ genes.

A-to-I editing of coding and non-coding RNAs by ADARs

PubMed Central

Nishikura, Kazuko

2016-01-01

Adenosine deaminases acting on RNA (ADARs) convert adenosine to inosine in double-stranded RNA. This A-to-I editing occurs not only in protein-coding regions of mRNAs, but also frequently in non-coding regions that contain inverted Alu repeats. Editing of coding sequences can result in the expression of functionally altered proteins that are not encoded in the genome, whereas the significance of Alu editing remains largely unknown. Certain microRNA (miRNA) precursors are also edited, leading to reduced expression or altered function of mature miRNAs. Conversely, recent studies indicate that ADAR1 forms a complex with Dicer to promote miRNA processing, revealing a new function of ADAR1 in the regulation of RNA interference. PMID:26648264

Modeling of boron species in the Falcon 17 and ISP-34 integral tests

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lazaridis, M.; Capitao, J.A.; Drossinos, Y.

1996-09-01

The RAFT computer code for aerosol formation and transport was modified to include boron species in its chemical database. The modification was necessary to calculate fission product transport and deposition in the FAL-17 and ISP-34 Falcon tests, where boric acid was injected. The experimental results suggest that the transport of cesium is modified in the presence of boron. The results obtained with the modified RAFT code are presented; they show good agreement with experimental results for cesium and partial agreement for boron deposition in the Falcon silica tube. The new version of the RAFT code predicts the same behavior formore » iodine deposition as the previous version, where boron species were not included.« less

Status of thermalhydraulic modelling and assessment: Open issues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bestion, D.; Barre, F.

1997-07-01

This paper presents the status of the physical modelling in present codes used for Nuclear Reactor Thermalhydraulics (TRAC, RELAP 5, CATHARE, ATHLET,...) and attempts to list the unresolved or partially resolved issues. First, the capabilities and limitations of present codes are presented. They are mainly known from a synthesis of the assessment calculations performed for both separate effect tests and integral effect tests. It is also interesting to list all the assumptions and simplifications which were made in the establishment of the system of equations and of the constitutive relations. Many of the present limitations are associated to physical situationsmore » where these assumptions are not valid. Then, recommendations are proposed to extend the capabilities of these codes.« less

Learning of spatio-temporal codes in a coupled oscillator system.

PubMed

Orosz, Gábor; Ashwin, Peter; Townley, Stuart

2009-07-01

In this paper, we consider a learning strategy that allows one to transmit information between two coupled phase oscillator systems (called teaching and learning systems) via frequency adaptation. The dynamics of these systems can be modeled with reference to a number of partially synchronized cluster states and transitions between them. Forcing the teaching system by steady but spatially nonhomogeneous inputs produces cyclic sequences of transitions between the cluster states, that is, information about inputs is encoded via a "winnerless competition" process into spatio-temporal codes. The large variety of codes can be learned by the learning system that adapts its frequencies to those of the teaching system. We visualize the dynamics using "weighted order parameters (WOPs)" that are analogous to "local field potentials" in neural systems. Since spatio-temporal coding is a mechanism that appears in olfactory systems, the developed learning rules may help to extract information from these neural ensembles.

Cross-indexing of binary SIFT codes for large-scale image search.

PubMed

Liu, Zhen; Li, Houqiang; Zhang, Liyan; Zhou, Wengang; Tian, Qi

2014-05-01

In recent years, there has been growing interest in mapping visual features into compact binary codes for applications on large-scale image collections. Encoding high-dimensional data as compact binary codes reduces the memory cost for storage. Besides, it benefits the computational efficiency since the computation of similarity can be efficiently measured by Hamming distance. In this paper, we propose a novel flexible scale invariant feature transform (SIFT) binarization (FSB) algorithm for large-scale image search. The FSB algorithm explores the magnitude patterns of SIFT descriptor. It is unsupervised and the generated binary codes are demonstrated to be dispreserving. Besides, we propose a new searching strategy to find target features based on the cross-indexing in the binary SIFT space and original SIFT space. We evaluate our approach on two publicly released data sets. The experiments on large-scale partial duplicate image retrieval system demonstrate the effectiveness and efficiency of the proposed algorithm.

Surface micromachined counter-meshing gears discrimination device

DOEpatents

Polosky, Marc A.; Garcia, Ernest J.; Allen, James J.

2000-12-12

A surface micromachined Counter-Meshing Gears (CMG) discrimination device which functions as a mechanically coded lock. Each of two CMG has a first portion of its perimeter devoted to continuous driving teeth that mesh with respective pinion gears. Each EMG also has a second portion of its perimeter devoted to regularly spaced discrimination gear teeth that extend outwardly on at least one of three levels of the CMG. The discrimination gear teeth are designed so as to pass each other without interference only if the correct sequence of partial rotations of the CMG occurs in response to a coded series of rotations from the pinion gears. A 24 bit code is normally input to unlock the device. Once unlocked, the device provides a path for an energy or information signal to pass through the device. The device is designed to immediately lock up if any portion of the 24 bit code is incorrect.

Validation of multi-temperature nozzle flow code NOZNT

NASA Technical Reports Server (NTRS)

Park, Chul; Lee, Seung-Ho

1993-01-01

A computer code NOZNT (Nozzle in n-Temperatures), which calculates one-dimensional flows of partially dissociated and ionized air in an expanding nozzle, is tested against five existing sets of experimental data. The code accounts for: a) the differences among various temperatures, i.e., translational-rotational temperature, vibrational temperatures of individual molecular species, and electron-electronic temperature, b) radiative cooling, and c) the effects of impurities. The experimental data considered are: 1) the sodium line reversal and 2) the electron temperature and density data, both obtained in a shock tunnel, and 3) the spectroscopic emission data, 4) electron beam data on vibrational temperature, and 5) mass-spectrometric species concentration data, all obtained in arc-jet wind tunnels. It is shown that the impurities are most likely responsible for the observed phenomena in shock tunnels. For the arc-jet flows, impurities are inconsequential and the NOZNT code is validated by numerically reproducing the experimental data.

Ovine mitochondrial DNA sequence variation and its association with production and reproduction traits within an Afec-Assaf flock.

PubMed

Reicher, S; Seroussi, E; Weller, J I; Rosov, A; Gootwine, E

2012-07-01

Polymorphisms in mitochondrial DNA (mtDNA) protein- and tRNA-coding genes were shown to be associated with various diseases in humans as well as with production and reproduction traits in livestock. Alignment of full length mitochondria sequences from the 5 known ovine haplogroups: HA (n = 3), HB (n = 5), HC (n = 3), HD (n = 2), and HE (n = 2; GenBank accession nos. HE577847-50 and 11 published complete ovine mitochondria sequences) revealed sequence variation in 10 out of the 13 protein coding mtDNA sequences. Twenty-six of the 245 variable sites found in the protein coding sequences represent non-synonymous mutations. Sequence variation was observed also in 8 out of the 22 tRNA mtDNA sequences. On the basis of the mtDNA control region and cytochrome b partial sequences along with information on maternal lineages within an Afec-Assaf flock, 1,126 Afec-Assaf ewes were assigned to mitochondrial haplogroups HA, HB, and HC, with frequencies of 0.43, 0.43, and 0.14, respectively. Analysis of birth weight and growth rate records of lamb (n = 1286) and productivity from 4,993 lambing records revealed no association between mitochondrial haplogroup affiliation and female longevity, lambs perinatal survival rate, birth weight, and daily growth rate of lambs up to 150 d that averaged 1,664 d, 88.3%, 4.5 kg, and 320 g/d, respectively. However, significant (P < 0.0001) differences among the haplogroups were found for prolificacy of ewes, with prolificacies (mean ± SE) of 2.14 ± 0.04, 2.25 ± 0.04, and 2.30 ± 0.06 lamb born/ewe lambing for the HA, HB, and the HC haplogroups, respectively. Our results highlight the ovine mitogenome genetic variation in protein- and tRNA coding genes and suggest that sequence variation in ovine mtDNA is associated with variation in ewe prolificacy.

A Working Model for the System Alumina-Magnesia.

DTIC Science & Technology

1983-05-01

Several regions in the resulting diagram appear rather uncertain: the liquidus ’National bureau of StandaTds. JANAF Thermochemical Tables, by D. R. Stull ...Code 131) 1 Naval Ordnance Station, Indian Head (Technical Library) 29 Naval Postgraduate School. Monterey Code 012, Dean of Research (1) Code 06... Dean of Science and Engineering (1) Code 1424. Library - Technical Reports (2) Code 33. Weapons Engineering Program Office (1) Code 61. Chairman

A comparison of cosmological hydrodynamic codes

NASA Technical Reports Server (NTRS)

Kang, Hyesung; Ostriker, Jeremiah P.; Cen, Renyue; Ryu, Dongsu; Hernquist, Lars; Evrard, August E.; Bryan, Greg L.; Norman, Michael L.

1994-01-01

We present a detailed comparison of the simulation results of various hydrodynamic codes. Starting with identical initial conditions based on the cold dark matter scenario for the growth of structure, with parameters h = 0.5 Omega = Omega(sub b) = 1, and sigma(sub 8) = 1, we integrate from redshift z = 20 to z = O to determine the physical state within a representative volume of size L(exp 3) where L = 64 h(exp -1) Mpc. Five indenpendent codes are compared: three of them Eulerian mesh-based and two variants of the smooth particle hydrodynamics 'SPH' Lagrangian approach. The Eulerian codes were run at N(exp 3) = (32(exp 3), 64(exp 3), 128(exp 3), and 256(exp 3)) cells, the SPH codes at N(exp 3) = 32(exp 3) and 64(exp 3) particles. Results were then rebinned to a 16(exp 3) grid with the exception that the rebinned data should converge, by all techniques, to a common and correct result as N approaches infinity. We find that global averages of various physical quantities do, as expected, tend to converge in the rebinned model, but that uncertainites in even primitive quantities such as (T), (rho(exp 2))(exp 1/2) persists at the 3%-17% level achieve comparable and satisfactory accuracy for comparable computer time in their treatment of the high-density, high-temeprature regions as measured in the rebinned data; the variance among the five codes (at highest resolution) for the mean temperature (as weighted by rho(exp 2) is only 4.5%. Examined at high resolution we suspect that the density resolution is better in the SPH codes and the thermal accuracy in low-density regions better in the Eulerian codes. In the low-density, low-temperature regions the SPH codes have poor accuracy due to statiscal effects, and the Jameson code gives the temperatures which are too high, due to overuse of artificial viscosity in these high Mach number regions. Overall the comparison allows us to better estimate errors; it points to ways of improving this current generation ofhydrodynamic codes and of suiting their use to problems which exploit their best individual features.

Patients' experiences with partial dentures: a qualitative study.

PubMed

Smith, Patricia A; Entwistle, Vikki A; Nuttall, Nigel

2005-12-01

The aim of the study was to gain insight into people's experiences of being given and using partial dentures. In-depth semi-structured interviews were carried out with 23 people of varied age, social background and denture wearing experience in Tayside, Scotland. Participants were encouraged to discuss how they came to have partial dentures, their day-to-day denture use and their interactions with dentists. The interview data were systematically coded using key theme headings, and summary charts were constructed to facilitate analysis. The initial decision that a partial denture was needed was generally difficult to accept. People perceived the main benefits of partial dentures to be improved appearance and confidence, but experienced a variety of difficulties with their dentures and often coped with these by only wearing them on social occasions. Participants had not always told their dentists about the difficulties they experienced. Barriers to seeking help with denture problems included financial constraints, previous experience of rushed appointments or poor communication from dentists and a perceived lack of entitlement to help when partial dentures were issued free. Partial dentures can be difficult to cope with. People experience a range of difficulties in wearing them, not all of which have been discussed with dentists. Informative and supportive communication when partial dentures are first needed, and subsequently, can improve the quality of patients' experiences and may help promote effective use and appropriate help-seeking by partial denture wearers.

Primary structure of stanniocalcin in two basal Actinopterygii.

PubMed

Amemiya, Yutaka; Youson, John H

2004-01-15

The primary structure of stanniocalcin (STC), the principal product of the corpuscles of Stannius (CS) in ray-finned fishes, was deduced from STC cDNA clones for two species of holostean, the gar, Lepisosteus osseus and the bowfin, Amia calva. Overlapping partial cDNA clones were amplified by polymerase chain reaction (PCR) from single-strand cDNA of the CS. Excluding the poly(A) tail, the cDNAs of 1863 base pairs [bp] (gar) and 914 bp (bowfin) contained the 5' untranslated region followed by the coding region and the 3' untranslated region. Both the gar and bowfin STC cDNA encode a prehormone of 252 amino acids (aa) with a signal peptide of 32 aa and a mature protein of 220 aa. The deduced aa sequence of gar STC shows 87% identity with bowfin STC, 60-72% identity with most vertebrate STCs and 26% identity with mouse STC2. Phylogenetic analysis of the sequences support a view that the gar and bowfin form a monophyletic holostean clade. RT-PCR revealed in the gar and bowfin that, just as in mammals and rainbow trout, the expression of STC mRNA is widely spread in many tissues and organs. Since the gar and bowfin are representatives of the most ancient fishes known to possess CS, the corpuscular-derived STC molecule in fish has had a conserved evolution.

Fundamental period of Italian reinforced concrete buildings: comparison between numerical, experimental and Italian code simplified values

NASA Astrophysics Data System (ADS)

Ditommaso, Rocco; Carlo Ponzo, Felice; Auletta, Gianluca; Iacovino, Chiara; Nigro, Antonella

2015-04-01

Aim of this study is a comparison among the fundamental period of reinforced concrete buildings evaluated using the simplified approach proposed by the Italian Seismic code (NTC 2008), numerical models and real values retrieved from an experimental campaign performed on several buildings located in Basilicata region (Italy). With the intention of proposing simplified relationships to evaluate the fundamental period of reinforced concrete buildings, scientists and engineers performed several numerical and experimental campaigns, on different structures all around the world, to calibrate different kind of formulas. Most of formulas retrieved from both numerical and experimental analyses provides vibration periods smaller than those suggested by the Italian seismic code. However, it is well known that the fundamental period of a structure play a key role in the correct evaluation of the spectral acceleration for seismic static analyses. Generally, simplified approaches impose the use of safety factors greater than those related to in depth nonlinear analyses with the aim to cover possible unexpected uncertainties. Using the simplified formula proposed by the Italian seismic code the fundamental period is quite higher than fundamental periods experimentally evaluated on real structures, with the consequence that the spectral acceleration adopted in the seismic static analysis may be significantly different than real spectral acceleration. This approach could produces a decreasing in safety factors obtained using linear and nonlinear seismic static analyses. Finally, the authors suggest a possible update of the Italian seismic code formula for the simplified estimation of the fundamental period of vibration of existing RC buildings, taking into account both elastic and inelastic structural behaviour and the interaction between structural and non-structural elements. Acknowledgements This study was partially funded by the Italian Civil Protection Department within the project DPC-RELUIS 2014 - RS4 ''Seismic observatory of structures and health monitoring''. References R. Ditommaso, M. Vona, M. R. Gallipoli and M. Mucciarelli (2013). Evaluation and considerations about fundamental periods of damaged reinforced concrete buildings. Nat. Hazards Earth Syst. Sci., 13, 1903-1912, 2013. www.nat-hazards-earth-syst-sci.net/13/1903/2013. doi:10.5194/nhess-13-1903-2013

3DFEMWATER/3DLEWASTE: NUMERICAL CODES FOR DELINEATING WELLHEAD PROTECTION AREAS IN AGRICULTURAL REGIONS BASED ON THE ASSIMILATIVE CAPACITY CRITERION

EPA Science Inventory

Two related numerical codes, 3DFEMWATER and 3DLEWASTE, are presented sed to delineate wellhead protection areas in agricultural regions using the assimilative capacity criterion. DFEMWATER (Three-dimensional Finite Element Model of Water Flow Through Saturated-Unsaturated Media) ...

3D-PDR: Three-dimensional photodissociation region code

NASA Astrophysics Data System (ADS)

Bisbas, T. G.; Bell, T. A.; Viti, S.; Yates, J.; Barlow, M. J.

2018-03-01

3D-PDR is a three-dimensional photodissociation region code written in Fortran. It uses the Sundials package (written in C) to solve the set of ordinary differential equations and it is the successor of the one-dimensional PDR code UCL_PDR (ascl:1303.004). Using the HEALpix ray-tracing scheme (ascl:1107.018), 3D-PDR solves a three-dimensional escape probability routine and evaluates the attenuation of the far-ultraviolet radiation in the PDR and the propagation of FIR/submm emission lines out of the PDR. The code is parallelized (OpenMP) and can be applied to 1D and 3D problems.

Stable isotope ratios of carbon and nitrogen and mercury concentrations in 13 toothed whale species taken from the western Pacific Ocean off Japan.

PubMed

Endo, Tetsuya; Hisamichi, Yohsuke; Kimura, Osamu; Haraguchi, Koichi; Lavery, Shane; Dalebout, Merel L; Funahashi, Naoko; Baker, C Scott

2010-04-01

Stable isotope ratios of carbon (partial differential(13)C) and nitrogen (partial differential(15)N) and total mercury (T-Hg) concentrations were measured in red meat samples from 11 odontocete species (toothed whales, dolphins, and porpoises) sold in Japan (n = 96) and in muscle samples from stranded killer whales (n = 6) and melon-headed whales (n = 15), and the analytical data for these species were classified into three regions (northern, central, and southern Japan) depending on the locations in which they were caught or stranded. The partial differential(15)N in the samples from southern Japan tended to be lower than that in samples from the north, whereas both partial differential(13)C and T-Hg concentrations in samples from the south tended to higher than those in samples from northern Japan. Negative correlations were found between the partial differential(13)C and partial differential(15)N values and between the partial differential(15)N value and T-Hg concentrations in the combined samples all three regions (gamma= -0.238, n = 117, P < 0.01). The partial differential(13)C, partial differential(15)N, and T-Hg concentrations in the samples varied more by habitat than by species. Spatial variations in partial differential(13)C, partial differential(15)N, and T-Hg concentrations in the ocean may be the cause of these phenomena.

Obstacles to Using Prior Research and Evaluations.

ERIC Educational Resources Information Center

Orwin, Robert G.

1985-01-01

The manner in which results and methods are reported influences the ability of the synthesis of prior studies for planning new evaluations. Confidence ratings, coding conventions, and supplemental evidence can partially overcome the difficulties. Planners must acknowledge the influence of their own judgement in using prior research. (Author)

Modular 3-D Transport model

EPA Science Inventory

MT3D was first developed by Chunmiao Zheng in 1990 at S.S. Papadopulos & Associates, Inc. with partial support from the U.S. Environmental Protection Agency (USEPA). Starting in 1990, MT3D was released as a pubic domain code from the USEPA. Commercial versions with enhanced capab...

78 FR 72872 - Notice of Intent To Grant Partially Exclusive Patent License; ICAP Patent Brokerage, LLC

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-04

... 72120, 53560 Hull St, Bldg A33 Room 2531, San Diego, CA 92152-5001. FOR FURTHER INFORMATION CONTACT... Pacific, Code 72120, 53560 Hull St, Bldg A33 Room 2531, San Diego, CA 92152-5001, telephone 619-553-5118...

Experimental and Monte Carlo studies of fluence corrections for graphite calorimetry in low- and high-energy clinical proton beams.

PubMed

Lourenço, Ana; Thomas, Russell; Bouchard, Hugo; Kacperek, Andrzej; Vondracek, Vladimir; Royle, Gary; Palmans, Hugo

2016-07-01

The aim of this study was to determine fluence corrections necessary to convert absorbed dose to graphite, measured by graphite calorimetry, to absorbed dose to water. Fluence corrections were obtained from experiments and Monte Carlo simulations in low- and high-energy proton beams. Fluence corrections were calculated to account for the difference in fluence between water and graphite at equivalent depths. Measurements were performed with narrow proton beams. Plane-parallel-plate ionization chambers with a large collecting area compared to the beam diameter were used to intercept the whole beam. High- and low-energy proton beams were provided by a scanning and double scattering delivery system, respectively. A mathematical formalism was established to relate fluence corrections derived from Monte Carlo simulations, using the fluka code [A. Ferrari et al., "fluka: A multi-particle transport code," in CERN 2005-10, INFN/TC 05/11, SLAC-R-773 (2005) and T. T. Böhlen et al., "The fluka Code: Developments and challenges for high energy and medical applications," Nucl. Data Sheets 120, 211-214 (2014)], to partial fluence corrections measured experimentally. A good agreement was found between the partial fluence corrections derived by Monte Carlo simulations and those determined experimentally. For a high-energy beam of 180 MeV, the fluence corrections from Monte Carlo simulations were found to increase from 0.99 to 1.04 with depth. In the case of a low-energy beam of 60 MeV, the magnitude of fluence corrections was approximately 0.99 at all depths when calculated in the sensitive area of the chamber used in the experiments. Fluence correction calculations were also performed for a larger area and found to increase from 0.99 at the surface to 1.01 at greater depths. Fluence corrections obtained experimentally are partial fluence corrections because they account for differences in the primary and part of the secondary particle fluence. A correction factor, F(d), has been established to relate fluence corrections defined theoretically to partial fluence corrections derived experimentally. The findings presented here are also relevant to water and tissue-equivalent-plastic materials given their carbon content.

Reynolds-Averaged Navier-Stokes Simulations of Two Partial-Span Flap Wing Experiments

NASA Technical Reports Server (NTRS)

Takalluk, M. A.; Laflin, Kelly R.

1998-01-01

Structured Reynolds Averaged Navier-Stokes simulations of two partial-span flap wing experiments were performed. The high-lift aerodynamic and aeroacoustic wind-tunnel experiments were conducted at both the NASA Ames 7-by 10-Foot Wind Tunnel and at the NASA Langley Quiet Flow Facility. The purpose of these tests was to accurately document the acoustic and aerodynamic characteristics associated with the principle airframe noise sources, including flap side-edge noise. Specific measurements were taken that can be used to validate analytic and computational models of the noise sources and associated aerodynamic for configurations and conditions approximating flight for transport aircraft. The numerical results are used to both calibrate a widely used CFD code, CFL3D, and to obtain details of flap side-edge flow features not discernible from experimental observations. Both experimental set-ups were numerically modeled by using multiple block structured grids. Various turbulence models, grid block-interface interaction methods and grid topologies were implemented. Numerical results of both simulations are in excellent agreement with experimental measurements and flow visualization observations. The flow field in the flap-edge region was adequately resolved to discern some crucial information about the flow physics and to substantiate the merger of the two vortical structures. As a result of these investigations, airframe noise modelers have proposed various simplified models which use the results obtained from the steady-state computations as input.

Partial androgen insensitivity syndrome caused by a deep intronic mutation creating an alternative splice acceptor site of the AR gene.

PubMed

Ono, Hiroyuki; Saitsu, Hirotomo; Horikawa, Reiko; Nakashima, Shinichi; Ohkubo, Yumiko; Yanagi, Kumiko; Nakabayashi, Kazuhiko; Fukami, Maki; Fujisawa, Yasuko; Ogata, Tsutomu

2018-02-02

Although partial androgen insensitivity syndrome (PAIS) is caused by attenuated responsiveness to androgens, androgen receptor gene (AR) mutations on the coding regions and their splice sites have been identified only in <25% of patients with a diagnosis of PAIS. We performed extensive molecular studies including whole exome sequencing in a Japanese family with PAIS, identifying a deep intronic variant beyond the branch site at intron 6 of AR (NM_000044.4:c.2450-42 G > A). This variant created the splice acceptor motif that was accompanied by pyrimidine-rich sequence and two candidate branch sites. Consistent with this, reverse transcriptase (RT)-PCR experiments for cycloheximide-treated lymphoblastoid cell lines revealed a relatively large amount of aberrant mRNA produced by the newly created splice acceptor site and a relatively small amount of wildtype mRNA produced by the normal splice acceptor site. Furthermore, most of the aberrant mRNA was shown to undergo nonsense mediated decay (NMD) and, if a small amount of aberrant mRNA may have escaped NMD, such mRNA was predicted to generate a truncated AR protein missing some functional domains. These findings imply that the deep intronic mutation creating an alternative splice acceptor site resulted in the production of a relatively small amount of wildtype AR mRNA, leading to PAIS.

Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

PubMed Central

Ma, Zhengqiang

2013-01-01

Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966

Concurrent occurrence of human and equine West Nile virus infections in Central Anatolia, Turkey: the first evidence for circulation of lineage 1 viruses.

PubMed

Ozkul, Aykut; Ergunay, Koray; Koysuren, Aydan; Alkan, Feray; Arsava, Ethem M; Tezcan, Seda; Emekdas, Gurol; Hacioglu, Sabri; Turan, Mahur; Us, Durdal

2013-07-01

West Nile fever is an important zoonotic infection caused by West Nile virus (WNV), a member of the Flaviviridae. Previous serological data from Turkey suggest widespread WNV circulation. This report includes cases of human and equine WNV infections occurring concurrently, and manifesting as central nervous system infections, in two neighboring provinces of Central Anatolia, Turkey. A partial phylogenetic analysis of the causative virus is given for the first time. The cases were reported in February (horses) and March (human). Symptoms of the disease were similar in the two species, characterized by neurological manifestations suggesting meningoencephalitis. Real-time/nested PCRs and commercial immunoassays and a plaque reduction neutralization assay were employed for the detection of viral RNA and specific antibodies, respectively. WNV RNAs were detected in buffy coat (horses) and cerebrospinal fluid (human) samples. Partial nucleotide sequences of the E-gene coding region revealed that the strains are closely related to viruses of lineage 1, clade 1a. Accompanying equine serosurveillance demonstrated WNV-specific antibodies in 31.6% of the samples. This is the first report of acute WNV infections caused by lineage 1 strains from Turkey, in concordance with previous reports from some European and North African countries. Copyright © 2013 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Synaptic input correlations leading to membrane potential decorrelation of spontaneous activity in cortex.

PubMed

Graupner, Michael; Reyes, Alex D

2013-09-18

Correlations in the spiking activity of neurons have been found in many regions of the cortex under multiple experimental conditions and are postulated to have important consequences for neural population coding. While there is a large body of extracellular data reporting correlations of various strengths, the subthreshold events underlying the origin and magnitude of signal-independent correlations (called noise or spike count correlations) are unknown. Here we investigate, using intracellular recordings, how synaptic input correlations from shared presynaptic neurons translate into membrane potential and spike-output correlations. Using a pharmacologically activated thalamocortical slice preparation, we perform simultaneous recordings from pairs of layer IV neurons in the auditory cortex of mice and measure synaptic potentials/currents, membrane potentials, and spiking outputs. We calculate cross-correlations between excitatory and inhibitory inputs to investigate correlations emerging from the network. We furthermore evaluate membrane potential correlations near resting potential to study how excitation and inhibition combine and affect spike-output correlations. We demonstrate directly that excitation is correlated with inhibition thereby partially canceling each other and resulting in weak membrane potential and spiking correlations between neurons. Our data suggest that cortical networks are set up to partially cancel correlations emerging from the connections between neurons. This active decorrelation is achieved because excitation and inhibition closely track each other. Our results suggest that the numerous shared presynaptic inputs do not automatically lead to increased spiking correlations.

Partial complementation of the UV sensitivity of E. coli and yeast excision repair mutants by the cloned denV gene of bacteriophage T4.

PubMed

Chenevert, J M; Naumovski, L; Schultz, R A; Friedberg, E C

1986-04-01

The denV gene of bacteriophage T4 was reconstituted from two overlapping DNA fragments cloned in M13 vectors. The coding region of the intact gene was tailored into a series of plasmid vectors containing different promoters suitable for expression of the gene in E. coli and in yeast. Induction of the TAC promoter with IPTG resulted in overexpression of the gene, which was lethal to E. coli. Expression of the TACdenV gene in the absence of IPTG, or the use of the yeast GAL1 or ADH promoters resulted in partial complementation of the UV sensitivity of uvrA, uvrB, uvrC and recA mutants of E. coli and rad1, rad2, rad3, rad4 and rad10 mutants of S. cerevisiae. The extent of denV-mediated reactivation of excision-defective mutants was approximately equal to that of photoreactivation of such strains. Excision proficient E. coli cells transformed with a plasmid containing the denV gene were slightly more resistant to ultraviolet (UV) radiation than control cells without the denV gene. On the other hand, excision proficient yeast cells were slightly more sensitive to killing by UV radiation following transformation with a plasmid containing the denV gene. This effect was more pronounced in yeast mutants of the RAD52 epistasis group.

Polymorphism at the defensin gene in the Anopheles gambiae complex: testing different selection hypotheses

PubMed Central

Simard, Frédéric; Licht, Monica; Besansky, Nora J.; Lehmann, Tovi

2007-01-01

Genetic variation in defensin, a gene encoding a major effector molecule of insects immune response was analyzed within and between populations of three members of the Anopheles gambiae complex. The species selected included the two anthropophilic species, An. gambiae and An. arabiensis and the most zoophilic species of the complex, An. quadriannulatus. The first species was represented by four populations spanning its extreme genetic and geographical ranges, whereas each of the other two species was represented by a single population. We found (i) reduced overall polymorphism in the mature peptide region and in the total coding region, together with specific reductions in rare and moderately frequent mutations (sites) in the coding region compared with non coding regions, (ii) markedly reduced rate of nonsynonymous diversity compared with synonymous variation in the mature peptide and virtually identical mature peptide across the three species, and (iii) increased divergence between species in the mature peptide together with reduced differentiation between populations of An. gambiae in the same DNA region. These patterns suggest a strong purifying selection on the mature peptide and probably the whole coding region. Because An. quadriannulatus is not exposed to human pathogens, identical mature peptide and similar pattern of polymorphism across species implies that human pathogens played no role as selective agents on this peptide. PMID:17161659

A Combinatorial Geometry Target Description of the High Mobility Multipurpose Wheeled Vehicle (HMMWV)

DTIC Science & Technology

1985-10-01

NOTE3 1W. KFY OORDS (Continwo =n reverse aide If necesesar aid ldwttlfy by" block ntmber) •JW7 Regions, COM-EOM Region Ident• fication GIFT Material...technique of mobna.tcri• i Geometr- (Com-Geom). The Com-Gem data is used as input to the Geometric Inf• •cation for Targets ( GIFT ) computer code to... GIFT ) 2 3 computer code. This report documents the combinatorial geometry (Com-Geom) target description data which is the input data for the GIFT code

Residential Segregation and the Availability of Primary Care Physicians

PubMed Central

Gaskin, Darrell J; Dinwiddie, Gniesha Y; Chan, Kitty S; McCleary, Rachael R

2012-01-01

Objective To examine the association between residential segregation and geographic access to primary care physicians (PCPs) in metropolitan statistical areas (MSAs). Data Sources We combined zip code level data on primary care physicians from the 2006 American Medical Association master file with demographic, socioeconomic, and segregation measures from the 2000 U.S. Census. Our sample consisted of 15,465 zip codes located completely or partially in an MSA. Methods We defined PCP shortage areas as those zip codes with no PCP or a population to PCP ratio of >3,500. Using logistic regressions, we estimated the association between a zip code's odds of being a PCP shortage area and its minority composition and degree of segregation in its MSA. Principal Findings We found that odds of being a PCP shortage area were 67 percent higher for majority African American zip codes but 27 percent lower for majority Hispanic zip codes. The association varied with the degree of segregation. As the degree of segregation increased, the odds of being a PCP shortage area increased for majority African American zip codes; however, the converse was true for majority Hispanic and Asian zip codes. Conclusions Efforts to address PCP shortages should target African American communities especially in segregated MSAs. PMID:22524264

The ZPIC educational code suite

NASA Astrophysics Data System (ADS)

Calado, R.; Pardal, M.; Ninhos, P.; Helm, A.; Mori, W. B.; Decyk, V. K.; Vieira, J.; Silva, L. O.; Fonseca, R. A.

2017-10-01

Particle-in-Cell (PIC) codes are used in almost all areas of plasma physics, such as fusion energy research, plasma accelerators, space physics, ion propulsion, and plasma processing, and many other areas. In this work, we present the ZPIC educational code suite, a new initiative to foster training in plasma physics using computer simulations. Leveraging on our expertise and experience from the development and use of the OSIRIS PIC code, we have developed a suite of 1D/2D fully relativistic electromagnetic PIC codes, as well as 1D electrostatic. These codes are self-contained and require only a standard laptop/desktop computer with a C compiler to be run. The output files are written in a new file format called ZDF that can be easily read using the supplied routines in a number of languages, such as Python, and IDL. The code suite also includes a number of example problems that can be used to illustrate several textbook and advanced plasma mechanisms, including instructions for parameter space exploration. We also invite contributions to this repository of test problems that will be made freely available to the community provided the input files comply with the format defined by the ZPIC team. The code suite is freely available and hosted on GitHub at https://github.com/zambzamb/zpic. Work partially supported by PICKSC.

Balance and sustainability in multi-aged stands: a northern conifer case study

Treesearch

Robert S. Seymour; Laura S. Kenefic

1998-01-01

Foresters in the Northeast are both blessed and cursed by the inherent complexity of the region's forests. Thousands of years may pass between natural stand-replacing disturbances, though partial disturbances, such as blowdown, defoliating insects, and various forms of partial cutting, are common (Seymour 1995). Foresters in the region typically deal with...

Tree-based solvers for adaptive mesh refinement code FLASH - I: gravity and optical depths

NASA Astrophysics Data System (ADS)

Wünsch, R.; Walch, S.; Dinnbier, F.; Whitworth, A.

2018-04-01

We describe an OctTree algorithm for the MPI parallel, adaptive mesh refinement code FLASH, which can be used to calculate the gas self-gravity, and also the angle-averaged local optical depth, for treating ambient diffuse radiation. The algorithm communicates to the different processors only those parts of the tree that are needed to perform the tree-walk locally. The advantage of this approach is a relatively low memory requirement, important in particular for the optical depth calculation, which needs to process information from many different directions. This feature also enables a general tree-based radiation transport algorithm that will be described in a subsequent paper, and delivers excellent scaling up to at least 1500 cores. Boundary conditions for gravity can be either isolated or periodic, and they can be specified in each direction independently, using a newly developed generalization of the Ewald method. The gravity calculation can be accelerated with the adaptive block update technique by partially re-using the solution from the previous time-step. Comparison with the FLASH internal multigrid gravity solver shows that tree-based methods provide a competitive alternative, particularly for problems with isolated or mixed boundary conditions. We evaluate several multipole acceptance criteria (MACs) and identify a relatively simple approximate partial error MAC which provides high accuracy at low computational cost. The optical depth estimates are found to agree very well with those of the RADMC-3D radiation transport code, with the tree-solver being much faster. Our algorithm is available in the standard release of the FLASH code in version 4.0 and later.

Sensitivities of Greenland ice sheet volume inferred from an ice sheet adjoint model

NASA Astrophysics Data System (ADS)

Heimbach, P.; Bugnion, V.

2009-04-01

We present a new and original approach to understanding the sensitivity of the Greenland ice sheet to key model parameters and environmental conditions. At the heart of this approach is the use of an adjoint ice sheet model. Since its introduction by MacAyeal (1992), the adjoint method has become widespread to fit ice stream models to the increasing number and diversity of satellite observations, and to estimate uncertain model parameters such as basal conditions. However, no attempt has been made to extend this method to comprehensive ice sheet models. As a first step toward the use of adjoints of comprehensive three-dimensional ice sheet models we have generated an adjoint of the ice sheet model SICOPOLIS of Greve (1997). The adjoint was generated by means of the automatic differentiation (AD) tool TAF. The AD tool generates exact source code representing the tangent linear and adjoint model of the nonlinear parent model provided. Model sensitivities are given by the partial derivatives of a scalar-valued model diagnostic with respect to the controls, and can be efficiently calculated via the adjoint. By way of example, we determine the sensitivity of the total Greenland ice volume to various control variables, such as spatial fields of basal flow parameters, surface and basal forcings, and initial conditions. Reliability of the adjoint was tested through finite-difference perturbation calculations for various control variables and perturbation regions. Besides confirming qualitative aspects of ice sheet sensitivities, such as expected regional variations, we detect regions where model sensitivities are seemingly unexpected or counter-intuitive, albeit ``real'' in the sense of actual model behavior. An example is inferred regions where sensitivities of ice sheet volume to basal sliding coefficient are positive, i.e. where a local increase in basal sliding parameter increases the ice sheet volume. Similarly, positive ice temperature sensitivities in certain parts of the ice sheet are found (in most regions it is negativ, i.e. an increase in temperature decreases ice sheet volume), the detection of which seems highly unlikely if only conventional perturbation experiments had been used. An effort to generate an efficient adjoint with the newly developed open-source AD tool OpenAD is also under way. Available adjoint code generation tools now open up a variety of novel model applications, notably with regard to sensitivity and uncertainty analyses and ice sheet state estimation or data assimilation.

Analytical and numerical study of the transverse Kelvin-Helmholtz instability in tokamak edge plasmas

DOE PAGES

Myra, James R.; D'Ippolito, Daniel A.; Russell, David A.; ...

2016-04-11

Sheared flows perpendicular to the magnetic field can be driven by the Reynolds stress or ion pressure gradient effects and can potentially influence the stability and turbulent saturation level of edge plasma modes. On the other hand, such flows are subject to the transverse Kelvin- Helmholtz (KH) instability. Here, the linear theory of KH instabilities is first addressed with an analytic model in the asymptotic limit of long wavelengths compared with the flow scale length. The analytic model treats sheared ExB flows, ion diamagnetism (including gyro-viscous terms), density gradients and parallel currents in a slab geometry, enabling a unified summarymore » that encompasses and extends previous results. In particular, while ion diamagnetism, density gradients and parallel currents each individually reduce KH growth rates, the combined effect of density and ion pressure gradients is more complicated and partially counteracting. Secondly, the important role of realistic toroidal geometry is explored numerically using an invariant scaling analysis together with the 2DX eigenvalue code to examine KH modes in both closed and open field line regions. For a typical spherical torus magnetic geometry, it is found that KH modes are more unstable at and just outside the separatrix as a result of the distribution of magnetic shear. Lastly implications for reduced edge turbulence modeling codes are discussed.« less

East Asian mtDNA haplogroup determination in Koreans: haplogroup-level coding region SNP analysis and subhaplogroup-level control region sequence analysis.

PubMed

Lee, Hwan Young; Yoo, Ji-Eun; Park, Myung Jin; Chung, Ukhee; Kim, Chong-Youl; Shin, Kyoung-Jin

2006-11-01

The present study analyzed 21 coding region SNP markers and one deletion motif for the determination of East Asian mitochondrial DNA (mtDNA) haplogroups by designing three multiplex systems which apply single base extension methods. Using two multiplex systems, all 593 Korean mtDNAs were allocated into 15 haplogroups: M, D, D4, D5, G, M7, M8, M9, M10, M11, R, R9, B, A, and N9. As the D4 haplotypes occurred most frequently in Koreans, the third multiplex system was used to further define D4 subhaplogroups: D4a, D4b, D4e, D4g, D4h, and D4j. This method allowed the complementation of coding region information with control region mutation motifs and the resultant findings also suggest reliable control region mutation motifs for the assignment of East Asian mtDNA haplogroups. These three multiplex systems produce good results in degraded samples as they contain small PCR products (101-154 bp) for single base extension reactions. SNP scoring was performed in 101 old skeletal remains using these three systems to prove their utility in degraded samples. The sequence analysis of mtDNA control region with high incidence of haplogroup-specific mutations and the selective scoring of highly informative coding region SNPs using the three multiplex systems are useful tools for most applications involving East Asian mtDNA haplogroup determination and haplogroup-directed stringent quality control.

Functional interrogation of non-coding DNA through CRISPR genome editing

PubMed Central

Canver, Matthew C.; Bauer, Daniel E.; Orkin, Stuart H.

2017-01-01

Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. PMID:28288828

Acceleration of Semiempirical QM/MM Methods through Message Passage Interface (MPI), Hybrid MPI/Open Multiprocessing, and Self-Consistent Field Accelerator Implementations.

PubMed

Ojeda-May, Pedro; Nam, Kwangho

2017-08-08

The strategy and implementation of scalable and efficient semiempirical (SE) QM/MM methods in CHARMM are described. The serial version of the code was first profiled to identify routines that required parallelization. Afterward, the code was parallelized and accelerated with three approaches. The first approach was the parallelization of the entire QM/MM routines, including the Fock matrix diagonalization routines, using the CHARMM message passage interface (MPI) machinery. In the second approach, two different self-consistent field (SCF) energy convergence accelerators were implemented using density and Fock matrices as targets for their extrapolations in the SCF procedure. In the third approach, the entire QM/MM and MM energy routines were accelerated by implementing the hybrid MPI/open multiprocessing (OpenMP) model in which both the task- and loop-level parallelization strategies were adopted to balance loads between different OpenMP threads. The present implementation was tested on two solvated enzyme systems (including <100 QM atoms) and an S N 2 symmetric reaction in water. The MPI version exceeded existing SE QM methods in CHARMM, which include the SCC-DFTB and SQUANTUM methods, by at least 4-fold. The use of SCF convergence accelerators further accelerated the code by ∼12-35% depending on the size of the QM region and the number of CPU cores used. Although the MPI version displayed good scalability, the performance was diminished for large numbers of MPI processes due to the overhead associated with MPI communications between nodes. This issue was partially overcome by the hybrid MPI/OpenMP approach which displayed a better scalability for a larger number of CPU cores (up to 64 CPUs in the tested systems).

Combined actions of multiple hairpin loop structures and sites of rate-limiting endonucleolytic cleavage determine differential degradation rates of individual segments within polycistronic puf operon mRNA.

PubMed Central

Klug, G; Cohen, S N

1990-01-01

Differential expression of the genes within the puf operon of Rhodobacter capsulatus is accomplished in part by differences in the rate of degradation of different segments of the puf transcript. We report here that decay of puf mRNA sequences specifying the light-harvesting I (LHI) and reaction center (RC) photosynthetic membrane peptides is initiated endoribonucleolytically within a discrete 1.4-kilobase segment of the RC-coding region. Deletion of this segment increased the half-life of the RC-coding region from 8 to 20 min while not affecting decay of LHI-coding sequences upstream from an intercistronic hairpin loop structure shown previously to impede 3'-to-5' degradation. Prolongation of RC segment half-life was dependent on the presence of other hairpin structures 3' to the RC region. Inserting the endonuclease-sensitive sites into the LHI-coding segment markedly accelerated its degradation. Our results suggest that differential degradation of the RC- and LHI-coding segments of puf mRNA is accomplished at least in part by the combined actions of RC region-specific endonuclease(s), one or more exonucleases, and several strategically located exonuclease-impeding hairpins. Images PMID:2394682

Population kinetics on K alpha lines of partially ionized Cl atoms.

PubMed

Kawamura, Tohru; Nishimura, Hiroaki; Koike, Fumihiro; Ochi, Yoshihiro; Matsui, Ryoji; Miao, Wen Yong; Okihara, Shinichiro; Sakabe, Shuji; Uschmann, Ingo; Förster, Eckhart; Mima, Kunioki

2002-07-01

A population kinetics code was developed to analyze K alpha emission from partially ionized chlorine atoms in hydrocarbon plasmas. Atomic processes are solved under collisional-radiative equilibrium for two-temperature plasmas. It is shown that the fast electrons dominantly contribute to ionize the K-shell bound electrons (i.e., inner-shell ionization) and the cold electrons to the outer-shell bound ones. Ratios of K alpha lines of partially ionized atoms are presented as a function of cold-electron temperature. The model was validated by observation of the K alpha lines from a chlorinated plastic target irradiated with 1 TW Ti:sapphire laser pulses at 1.5 x 10(17) W/cm(2), inferring a plasma temperature of about 100 eV on the target surface.

Effect of partial heating at mid of vertical plate adjacent to porous medium

NASA Astrophysics Data System (ADS)

Mulla, Mohammed Fahimuddin; Pallan, Khalid. M.; Al-Rashed, A. A. A. A.

2018-05-01

Heat and mass transfer in porous medium due to heating of vertical plate at mid-section is analyzed for various physical parameters. The heat and mass transfer in porous medium is modeled with the help of momentum, energy and concentration equations in terms of non-dimensional partial differential equations. The partial differential equations are converted into simpler form of algebraic equations with the help of finite element method. A computer code is developed to assemble the matrix form of algebraic equations into global matrices and then to solve them in an iterative manner to obtain the temperature, concentration and streamline distribution inside the porous medium. It is found that the heat transfer behavior of porous medium heated at middle section is considerably different from other cases.

Extending compile-time reverse mode and exploiting partial separability in ADIFOR. ADIFOR Working Note No. 7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bischof, C.H.; El-Khadiri, M.

1992-10-01

The numerical methods employed in the solution of many scientific computing problems require the computation of the gradient of a function f: R{sup n} {yields} R. ADIFOR is a source translator that, given a collection of subroutines to compute f, generates Fortran 77 code for computing the derivative of this function. Using the so-called torsion problem from the MINPACK-2 test collection as an example, this paper explores two issues in automatic differentiation: the efficient computation of derivatives for partial separable functions and the use of the compile-time reverse mode for the generation of derivatives. We show that orders of magnitudesmore » of improvement are possible when exploiting partial separability and maximizing use of the reverse mode.« less

A Simulation Model of the Planetary Boundary Layer at Kennedy Space Center

NASA Technical Reports Server (NTRS)

Hwang, B.

1978-01-01

A simulation model which predicts the behavior of the Atmospheric Boundary Layer has been developed and coded. The model is partially evaluated by comparing it with laboratory measurements and the sounding measurements at Kennedy Space Center. The applicability of such an approach should prove quite widespread.

HIV1 V3 loop hypermutability is enhanced by the guanine usage bias in the part of env gene coding for it.

PubMed

Khrustalev, Vladislav Victorovich

2009-01-01

Guanine is the most mutable nucleotide in HIV genes because of frequently occurring G to A transitions, which are caused by cytosine deamination in viral DNA minus strands catalyzed by APOBEC enzymes. Distribution of guanine between three codon positions should influence the probability for G to A mutation to be nonsynonymous (to occur in first or second codon position). We discovered that nucleotide sequences of env genes coding for third variable regions (V3 loops) of gp120 from HIV1 and HIV2 have different kinds of guanine usage biases. In the HIV1 reference strain and 100 additionally analyzed HIV1 strains the guanine usage bias in V3 loop coding regions (2G>1G>3G) should lead to elevated nonsynonymous G to A transitions occurrence rates. In the HIV2 reference strain and 100 other HIV2 strains guanine usage bias in V3 loop coding regions (3G>2G>1G) should protect V3 loops from hypermutability. According to the HIV1 and HIV2 V3 alignment, insertion of the sequence enriched with 2G (21 codons in length) occurred during the evolution of HIV1 predecessor, while insertion of the different sequence enriched with 3G (19 codons in length) occurred during the evolution of HIV2 predecessor. The higher is the level of 3G in the V3 coding region, the lower should be the immune escaping mutation occurrence rates. This hypothesis was tested in this study by comparing the guanine usage in V3 loop coding regions from HIV1 fast and slow progressors. All calculations have been performed by our algorithms "VVK In length", "VVK Dinucleotides" and "VVK Consensus" (www.barkovsky.hotmail.ru).

The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

PubMed Central

Pietan, Lucas L.; Spradling, Theresa A.

2016-01-01

In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

The 1985 Army Experience Survey: Tabular Descriptions of First-Term Attritees. Volume 2

DTIC Science & Technology

1986-01-01

survey receipt control and sample management systems . Data were also keyed, edited, coded, and weighted. The coding schemes developed to classify... R136 REGION OF RESIDENCE WHEN YOU JOINED ARMY. .. ................. 272-273 049 El37 U TERMS OF ACTIVE ENLISTMENT .. ........ ................ 274...272 R136 -- REGION OF RESIDENCE WHEN YOU JOINED ARMY RECODED - WHAT STATE WERE YOU LIVING IN WHEN YOU JOINED THE ARMY! (RECODED TO REGION OF RSID) I

The 1985 Army Experience Survey: Tabular Descriptions of Enlisted Retirees. Volume 1

DTIC Science & Technology

1986-01-01

processed through survey receipt control and sample management systems . Data were also keyed, edited, coded, and weighted. The coding schemes...222-223 047A R135 AGE OF OLDEST CHILD .............-.-.-.-.-.-.-.-.-.-.-.-... . 224-225 048 R136 REGION OF RESIDENCE WHEN... R136 -- REGION OF RESIDENCE WHEN YOU JOINED ARMY 7 RECODED - WHAT STATE WERE YOU LIVING IN WHEN YOU JOItNED THE ARMY? (RECODED TO REGION OF RSID) I

RNAcode: Robust discrimination of coding and noncoding regions in comparative sequence data

PubMed Central

Washietl, Stefan; Findeiß, Sven; Müller, Stephan A.; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L.; Stadler, Peter F.; Goldman, Nick

2011-01-01

With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied “out of the box,” without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as “noncoding.” RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode. PMID:21357752

RNAcode: robust discrimination of coding and noncoding regions in comparative sequence data.

PubMed

Washietl, Stefan; Findeiss, Sven; Müller, Stephan A; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L; Stadler, Peter F; Goldman, Nick

2011-04-01

With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied "out of the box," without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as "noncoding." RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode.

Extension of the XGC code for global gyrokinetic simulations in stellarator geometry

NASA Astrophysics Data System (ADS)

Cole, Michael; Moritaka, Toseo; White, Roscoe; Hager, Robert; Ku, Seung-Hoe; Chang, Choong-Seock

2017-10-01

In this work, the total-f, gyrokinetic particle-in-cell code XGC is extended to treat stellarator geometries. Improvements to meshing tools and the code itself have enabled the first physics studies, including single particle tracing and flux surface mapping in the magnetic geometry of the heliotron LHD and quasi-isodynamic stellarator Wendelstein 7-X. These have provided the first successful test cases for our approach. XGC is uniquely placed to model the complex edge physics of stellarators. A roadmap to such a global confinement modeling capability will be presented. Single particle studies will include the physics of energetic particles' global stochastic motions and their effect on confinement. Good confinement of energetic particles is vital for a successful stellarator reactor design. These results can be compared in the core region with those of other codes, such as ORBIT3d. In subsequent work, neoclassical transport and turbulence can then be considered and compared to results from codes such as EUTERPE and GENE. After sufficient verification in the core region, XGC will move into the stellarator edge region including the material wall and neutral particle recycling.

30 CFR 250.1495 - How do I demonstrate financial solvency?

Code of Federal Regulations, 2011 CFR

2011-07-01

... 99503-5823, jeffrey,[email protected], (907) 334-5300. (2) For Gulf of Mexico and Atlantic OCS: Joshua Joyce, Regional FARM Program Coordinator, BOEMRE Gulf of Mexico OCS Region, 1201 Elmwood Park Boulevard... provision of the U.S. Bankruptcy Code (Title 11 of the United States Code), or BOEMRE notifies you that you...

30 CFR 250.1495 - How do I demonstrate financial solvency?

Code of Federal Regulations, 2012 CFR

2012-07-01

..., [email protected], (907) 334-5300. (2) For Gulf of Mexico and Atlantic OCS: Joshua Joyce, Regional FARM Program Coordinator, BOEM Gulf of Mexico OCS Region, 1201 Elmwood Park Boulevard New Orleans, LA.... Bankruptcy Code (Title 11 of the United States Code), or BSEE notifies you that you must redemonstrate...

30 CFR 250.1495 - How do I demonstrate financial solvency?

Code of Federal Regulations, 2013 CFR

2013-07-01

..., [email protected], (907) 334-5300. (2) For Gulf of Mexico and Atlantic OCS: Joshua Joyce, Regional FARM Program Coordinator, BOEM Gulf of Mexico OCS Region, 1201 Elmwood Park Boulevard New Orleans, LA.... Bankruptcy Code (Title 11 of the United States Code), or BSEE notifies you that you must redemonstrate...

30 CFR 250.1495 - How do I demonstrate financial solvency?

Code of Federal Regulations, 2014 CFR

2014-07-01

..., [email protected], (907) 334-5300. (2) For Gulf of Mexico and Atlantic OCS: Joshua Joyce, Regional FARM Program Coordinator, BOEM Gulf of Mexico OCS Region, 1201 Elmwood Park Boulevard New Orleans, LA.... Bankruptcy Code (Title 11 of the United States Code), or BSEE notifies you that you must redemonstrate...

Expressed gene sequence of the IFN-gamma-response chemokine CXCL9 of cattle, horses, and swine

USDA-ARS?s Scientific Manuscript database

This report describes the cloning and characterization of expressed gene sequences of bovine, equine, and swine CXCL9 from RNA obtained from peripheral blood mononuclear cell (PBMC) or other tissues. The bovine coding region was 378 nucleotides in length, while the equine and swine coding regions w...

Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

PubMed

Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

2016-03-01

Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

Microstructure and Hydrogen-Induced Failure Mechanisms in Fe and Ni Alloy Weldments

NASA Astrophysics Data System (ADS)

Fenske, J. A.; Robertson, I. M.; Ayer, Raghavan; Hukle, Martin; Lillig, Dan; Newbury, Brian

2012-09-01

The microstructure and fracture morphology of AISI 8630-IN625 and ASTM A182-F22-IN625 dissimilar metal weld interfaces were compared and contrasted as a function of postweld heat treatment (PWHT) duration. For both systems, the microstructure along the weld interface consisted of a coarse grain heat-affected zone in the Fe-base metal followed by discontinuous martensitic partially mixed zones and a continuous partially mixed zone on the Ni side of the fusion line. Within the partially mixed zone on the Ni side, there exists a 200-nm-wide transition zone within a 20- μm-wide planar solidification region followed by a cellular dendritic region with Nb-Mo-rich carbides decorating the dendrite boundaries. Although there were differences in the volume of the partially mixed zones, the major difference in the metal weld interfaces was the presence of M7C3 precipitates in the planar solidification region, which had formed in AISI 8630-IN625 but not in ASTM A182-F22-IN625. These precipitates make the weldment more susceptible to hydrogen embrittlement and provide a low energy fracture path between the discontinuous partially mixed zones.

Design optimization of continuous partially prestressed concrete beams

NASA Astrophysics Data System (ADS)

Al-Gahtani, A. S.; Al-Saadoun, S. S.; Abul-Feilat, E. A.

1995-04-01

An effective formulation for optimum design of two-span continuous partially prestressed concrete beams is described in this paper. Variable prestressing forces along the tendon profile, which may be jacked from one end or both ends with flexibility in the overlapping range and location, and the induced secondary effects are considered. The imposed constraints are on flexural stresses, ultimate flexural strength, cracking moment, ultimate shear strength, reinforcement limits cross-section dimensions, and cable profile geometries. These constraints are formulated in accordance with ACI (American Concrete Institute) code provisions. The capabilities of the program to solve several engineering problems are presented.

Lossy to lossless object-based coding of 3-D MRI data.

PubMed

Menegaz, Gloria; Thiran, Jean-Philippe

2002-01-01

We propose a fully three-dimensional (3-D) object-based coding system exploiting the diagnostic relevance of the different regions of the volumetric data for rate allocation. The data are first decorrelated via a 3-D discrete wavelet transform. The implementation via the lifting steps scheme allows to map integer-to-integer values, enabling lossless coding, and facilitates the definition of the object-based inverse transform. The coding process assigns disjoint segments of the bitstream to the different objects, which can be independently accessed and reconstructed at any up-to-lossless quality. Two fully 3-D coding strategies are considered: embedded zerotree coding (EZW-3D) and multidimensional layered zero coding (MLZC), both generalized for region of interest (ROI)-based processing. In order to avoid artifacts along region boundaries, some extra coefficients must be encoded for each object. This gives rise to an overheading of the bitstream with respect to the case where the volume is encoded as a whole. The amount of such extra information depends on both the filter length and the decomposition depth. The system is characterized on a set of head magnetic resonance images. Results show that MLZC and EZW-3D have competitive performances. In particular, the best MLZC mode outperforms the others state-of-the-art techniques on one of the datasets for which results are available in the literature.

MRI-negative refractory partial epilepsy: role for diffusion tensor imaging in high field MRI.

PubMed

Chen, Qin; Lui, Su; Li, Chun-Xiao; Jiang, Li-Jun; Ou-Yang, Luo; Tang, He-Han; Shang, Hui-Fang; Huang, Xiao-Qi; Gong, Qi-Yong; Zhou, Dong

2008-07-01

Our aim is to use the high field MR scanner (3T) to verify whether diffusion tensor imaging (DTI) could help in locating the epileptogenic zone in patients with MRI-negative refractory partial epilepsy. Fifteen patients with refractory partial epilepsy who had normal conventional MRI, and 40 healthy volunteers were recruited for the study. DTI was performed on a 3T MR scanner, individual maps of mean diffusivity (MD) and fractional anisotropy (FA) were calculated, and Voxel-Based Analysis (VBA) was performed for individual comparison between patients and controls. Voxel-based analysis revealed significant MD increase in variant regions in 13 patients. The electroclinical seizure localization was concurred to seven patients. No patient exhibited regions of significant decreased MD. Regions of significant reduced FA were observed in five patients, with two of these concurring with electroclinical seizure localization. Two patients had regions of significant increase in FA, which were distinct from electroclinical seizure localization. Our study's results revealed that DTI is a responsive neuroradiologic technique that provides information about the epileptogenic areas in patients with MRI-negative refractory partial epilepsy. This technique may also helpful in pre-surgical evaluation.

A computational and theoretical analysis of falling frequency VLF emissions

NASA Astrophysics Data System (ADS)

Nunn, David; Omura, Yoshiharu

2012-08-01

Recently much progress has been made in the simulation and theoretical understanding of rising frequency triggered emissions and rising chorus. Both PIC and Vlasov VHS codes produce risers in the region downstream from the equator toward which the VLF waves are traveling. The VHS code only produces fallers or downward hooks with difficulty due to the coherent nature of wave particle interaction across the equator. With the VHS code we now confine the interaction region to be the region upstream from the equator, where inhomogeneity factor S is positive. This suppresses correlated wave particle interaction effects across the equator and the tendency of the code to trigger risers, and permits the formation of a proper falling tone generation region. The VHS code now easily and reproducibly triggers falling tones. The evolution of resonant particle current JE in space and time shows a generation point at -5224 km and the wavefield undergoes amplification of some 25 dB in traversing the nonlinear generation region. The current component parallel to wave magnetic field (JB) is positive, whereas it is negative for risers. The resonant particle trap shows an enhanced distribution function or `hill', whereas risers have a `hole'. According to recent theory (Omura et al., 2008, 2009) sweeping frequency is due primarily to the advective term. The nonlinear frequency shift term is now negative (˜-12 Hz) and the sweep rate of -800 Hz/s is approximately nonlinear frequency shift divided by TN, the transition time, of the order of a trapping time.

Automatic code generation in SPARK: Applications of computer algebra and compiler-compilers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nataf, J.M.; Winkelmann, F.

We show how computer algebra and compiler-compilers are used for automatic code generation in the Simulation Problem Analysis and Research Kernel (SPARK), an object oriented environment for modeling complex physical systems that can be described by differential-algebraic equations. After a brief overview of SPARK, we describe the use of computer algebra in SPARK's symbolic interface, which generates solution code for equations that are entered in symbolic form. We also describe how the Lex/Yacc compiler-compiler is used to achieve important extensions to the SPARK simulation language, including parametrized macro objects and steady-state resetting of a dynamic simulation. The application of thesemore » methods to solving the partial differential equations for two-dimensional heat flow is illustrated.« less

Automatic code generation in SPARK: Applications of computer algebra and compiler-compilers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nataf, J.M.; Winkelmann, F.

We show how computer algebra and compiler-compilers are used for automatic code generation in the Simulation Problem Analysis and Research Kernel (SPARK), an object oriented environment for modeling complex physical systems that can be described by differential-algebraic equations. After a brief overview of SPARK, we describe the use of computer algebra in SPARK`s symbolic interface, which generates solution code for equations that are entered in symbolic form. We also describe how the Lex/Yacc compiler-compiler is used to achieve important extensions to the SPARK simulation language, including parametrized macro objects and steady-state resetting of a dynamic simulation. The application of thesemore » methods to solving the partial differential equations for two-dimensional heat flow is illustrated.« less

Drekar v.2.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seefeldt, Ben; Sondak, David; Hensinger, David M.

Drekar is an application code that solves partial differential equations for fluids that can be optionally coupled to electromagnetics. Drekar solves low-mach compressible and incompressible computational fluid dynamics (CFD), compressible and incompressible resistive magnetohydrodynamics (MHD), and multiple species plasmas interacting with electromagnetic fields. Drekar discretization technology includes continuous and discontinuous finite element formulations, stabilized finite element formulations, mixed integration finite element bases (nodal, edge, face, volume) and an initial arbitrary Lagrangian Eulerian (ALE) capability. Drekar contains the implementation of the discretized physics and leverages the open source Trilinos project for both parallel solver capabilities and general finite element discretization tools.more » The code will be released open source under a BSD license. The code is used for fundamental research for simulation of fluids and plasmas on high performance computing environments.« less

Partially Key Distribution with Public Key Cryptosystem Based on Error Control Codes

NASA Astrophysics Data System (ADS)

Tavallaei, Saeed Ebadi; Falahati, Abolfazl

Due to the low level of security in public key cryptosystems based on number theory, fundamental difficulties such as "key escrow" in Public Key Infrastructure (PKI) and a secure channel in ID-based cryptography, a new key distribution cryptosystem based on Error Control Codes (ECC) is proposed . This idea is done by some modification on McEliece cryptosystem. The security of ECC cryptosystem obtains from the NP-Completeness of block codes decoding. The capability of generating public keys with variable lengths which is suitable for different applications will be provided by using ECC. It seems that usage of these cryptosystems because of decreasing in the security of cryptosystems based on number theory and increasing the lengths of their keys would be unavoidable in future.

Performance of the ICAO standard core service modulation and coding techniques

NASA Technical Reports Server (NTRS)

Lodge, John; Moher, Michael

1988-01-01

Aviation binary phase shift keying (A-BPSK) is described and simulated performance results are given that demonstrate robust performance in the presence of hardlimiting amplifiers. The performance of coherently-detected A-BPSK with rate 1/2 convolutional coding are given. The performance loss due to the Rician fading was shown to be less than 1 dB over the simulated range. A partially coherent detection scheme that does not require carrier phase recovery was described. This scheme exhibits similiar performance to coherent detection, at high bit error rates, while it is superior at lower bit error rates.

Partial Diversity Generates Effector Immunity Specificity of the Bac41-Like Bacteriocins of Enterococcus faecalis Clinical Strains.

PubMed

Kurushima, Jun; Ike, Yasuyoshi; Tomita, Haruyoshi

2016-09-01

Bacteriocin 41 (Bac41) is the plasmid-encoded bacteriocin produced by the opportunistic pathogen Enterococcus faecalis Its genetic determinant consists of bacL1 (effector), bacL2 (regulator), bacA (effector), and bacI (immunity). The secreted effectors BacL1 and BacA coordinate to induce the lytic cell death of E. faecalis Meanwhile, the immunity factor BacI provides self-resistance to the Bac41 producer, E. faecalis, against the action of BacL1 and BacA. In this study, we demonstrated that more than half of the 327 clinical strains of E. faecalis screened had functional Bac41 genes. Analysis of the genetic structure of the Bac41 genes in the DNA sequences of the E. faecalis strains revealed that the Bac41-like genes consist of a relatively conserved region and a variable region located downstream from bacA Based on similarities in the variable region, the Bac41-like genes could be classified into type I, type IIa, and type IIb. Interestingly, the distinct Bac41 types had specific immunity factors for self-resistance, BacI1 or BacI2, and did not show cross-immunity to the other type of effector. We also demonstrated experimentally that the specificity of the immunity was determined by the combination of the C-terminal region of BacA and the presence of the unique BacI1 or BacI2 factor. These observations suggested that Bac41-like bacteriocin genes are extensively disseminated among E. faecalis strains in the clinical environment and can be grouped into at least three types. It was also indicated that the partial diversity results in specificity of self-resistance which may offer these strains a competitive advantage. Bacteriocins are antibacterial effectors produced by bacteria. In general, a bacteriocin-coding gene is accompanied by a cognate immunity gene that confers self-resistance on the bacteriocin-producing bacterium itself. We demonstrated that one of the bacteriocins, Bac41, is disseminated among E. faecalis clinical strains and the Bac41 subtypes with partial diversity. The Bac41-like bacteriocins were found to be classified into type I, type IIa, and type IIb by variation of the cognate immunity factors. The antibacterial activity of the respective effectors was specifically inhibited by the immunity factor from the same type of Bac41 but not the other types. This specificity of effector-immunity pairs suggests that bacteriocin genes might have evolved to change the immunity specificity to acquire an advantage in interbacterial competition. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

TCOF1 gene encodes a putative nucleolar phosphoprotein that exhibits mutations in Treacher Collins Syndrome throughout its coding region

PubMed Central

Wise, Carol A.; Chiang, Lydia C.; Paznekas, William A.; Sharma, Mridula; Musy, Maurice M.; Ashley, Jennifer A.; Lovett, Michael; Jabs, Ethylin W.

1997-01-01

Treacher Collins Syndrome (TCS) is the most common of the human mandibulofacial dysostosis disorders. Recently, a partial TCOF1 cDNA was identified and shown to contain mutations in TCS families. Here we present the entire exon/intron genomic structure and the complete coding sequence of TCOF1. TCOF1 encodes a low complexity protein of 1,411 amino acids, whose predicted protein structure reveals repeated motifs that mirror the organization of its exons. These motifs are shared with nucleolar trafficking proteins in other species and are predicted to be highly phosphorylated by casein kinase. Consistent with this, the full-length TCOF1 protein sequence also contains putative nuclear and nucleolar localization signals. Throughout the open reading frame, we detected an additional eight mutations in TCS families and several polymorphisms. We postulate that TCS results from defects in a nucleolar trafficking protein that is critically required during human craniofacial development. PMID:9096354

A novel recombinant Leishmania donovani p45, a partial coding region of methionine aminopeptidase, generates protective immunity by inducing a Th1 stimulatory response against experimental visceral leishmaniasis.

PubMed

Gupta, Reema; Kushawaha, Pramod K; Tripathi, Chandra Dev Pati; Sundar, Shyam; Dube, Anuradha

2012-05-01

The development of a vaccine against visceral leishmaniasis (VL) conferring long-lasting immunity remains a challenge. Identification and proteomic characterization of parasite proteins led to the detection of p45, a member of the methionine aminopeptidase family. To our knowledge the present study is the first known report that describes the molecular and immunological characterization of p45. Recombinant Leishmania donovani p45 (rLdp45) induced cellular responses in cured hamsters and generated Th1-type cytokines from peripheral blood mononuclear cells of cured/endemic VL patients. Immunization with rLdp45 exerted considerable prophylactic efficacy (∼85%) supported by an increase in mRNA expression of iNOS, IFN-γ, TNF-α and IL-12 and decrease in TGF-β and IL-4, indicating its potential as a vaccine candidate against VL. Copyright © 2012. Published by Elsevier Ltd.

Phylodynamic and Phylogeographic Patterns of the HIV Type 1 Subtype F1 Parenteral Epidemic in Romania

PubMed Central

Hué, Stéphane; Buckton, Andrew J.; Myers, Richard E.; Duiculescu, Dan; Ene, Luminita; Oprea, Cristiana; Tardei, Gratiela; Rugina, Sorin; Mardarescu, Mariana; Floch, Corinne; Notheis, Gundula; Zöhrer, Bettina; Cane, Patricia A.; Pillay, Deenan

2012-01-01

Abstract In the late 1980s an HIV-1 epidemic emerged in Romania that was dominated by subtype F1. The main route of infection is believed to be parenteral transmission in children. We sequenced partial pol coding regions of 70 subtype F1 samples from children and adolescents from the PENTA-EPPICC network of which 67 were from Romania. Phylogenetic reconstruction using the sequences and other publically available global subtype F sequences showed that 79% of Romanian F1 sequences formed a statistically robust monophyletic cluster. The monophyletic cluster was epidemiologically linked to parenteral transmission in children. Coalescent-based analysis dated the origins of the parenteral epidemic to 1983 [1981–1987; 95% HPD]. The analysis also shows that the epidemic's effective population size has remained fairly constant since the early 1990s suggesting limited onward spread of the virus within the population. Furthermore, phylogeographic analysis suggests that the root location of the parenteral epidemic was Bucharest. PMID:22251065

Holistic neural coding of Chinese character forms in bilateral ventral visual system.

PubMed

Mo, Ce; Yu, Mengxia; Seger, Carol; Mo, Lei

2015-02-01

How are Chinese characters recognized and represented in the brain of skilled readers? Functional MRI fast adaptation technique was used to address this question. We found that neural adaptation effects were limited to identical characters in bilateral ventral visual system while no activation reduction was observed for partially overlapping characters regardless of the spatial location of the shared sub-character components, suggesting highly selective neuronal tuning to whole characters. The consistent neural profile across the entire ventral visual cortex indicates that Chinese characters are represented as mutually distinctive wholes rather than combinations of sub-character components, which presents a salient contrast to the left-lateralized, simple-to-complex neural representations of alphabetic words. Our findings thus revealed the cultural modulation effect on both local neuronal activity patterns and functional anatomical regions associated with written symbol recognition. Moreover, the cross-language discrepancy in written symbol recognition mechanism might stem from the language-specific early-stage learning experience. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauss, H.R.

This paper describes the code FEMHD, an adaptive finite element MHD code, which is applied in a number of different manners to model MHD behavior and edge plasma phenomena on a diverted tokamak. The code uses an unstructured triangular mesh in 2D and wedge shaped mesh elements in 3D. The code has been adapted to look at neutral and charged particle dynamics in the plasma scrape off region, and into a full MHD-particle code.

Unfiltered Talk--A Challenge to Categories.

ERIC Educational Resources Information Center

McCormick, Kay

A study investigated how and why code switching and mixing occurs between English and Afrikaans in a region of South Africa. In District Six, non-standard Afrikaans seems to be a mixed code, and it is unclear whether non-standard English is a mixed code. Consequently, it is unclear when codes are being switched or mixed. The analysis looks at…

A second gene for acyl-(acyl-carrier-protein): glycerol-3-phosphate acyltransferase in squash, Cucurbita moschata cv. Shirogikuza(*), codes for an oleate-selective isozyme: molecular cloning and protein purification studies.

PubMed

Nishida, I; Sugiura, M; Enju, A; Nakamura, M

2000-12-01

A new isogene for acyl-(acyl-carrier-protein):glycerol-3-phosphate acyltransferase (GPAT; EC 2.3.1.15) in squash has been cloned and the gene product was identified as oleate-selective GPAT. Using PCR primers that could hybridise with exons for a previously cloned squash GPAT, we obtained two PCR products of different size: one coded for a previously cloned squash GPAT corresponding to non-selective isoforms AT2 and AT3, and the other for a new isozyme, probably the oleate-selective isoform AT1. Full-length amino acid sequences of respective isozymes were deduced from the nucleotide sequences of genomic genes and cDNAs, which were cloned by a series of PCR-based methods. Thus, we designated the new gene CmATS1;1 and the other one CmATS1;2. Genome blot analysis revealed that the squash genome contained the two isogenes at non-allelic loci. AT1-active fractions were partially purified, and three polypeptide bands were identified as being AT1 polypeptides, which exhibited relative molecular masses of 39.5-40.5 kDa, pI values of 6.75-7.15, and oleate selectivity over palmitate. Partial amino-terminal sequences obtained from two of these bands verified that the new isogene codes for AT1 polypeptides.

Functional interrogation of non-coding DNA through CRISPR genome editing.

PubMed

Canver, Matthew C; Bauer, Daniel E; Orkin, Stuart H

2017-05-15

Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

Codes of professional conduct for Australian Defence Force military physicians: evenomating the serpent?

PubMed

O'Connor, Mike

2010-09-01

The scandal of health professionals' involvement in recent human rights abuses in United States military detention centres has prompted concern that Australian military physicians should be well protected against similar pressures to participate in harsh interrogations. A framework of military health ethics has been proposed. Would a code of professional conduct be a partial solution? This article examines the utility of professional codes: can they transform unethical behaviour or are they only of value to those who already behave ethically? How should such codes be designed, what support mechanisms should be in place and how should complaints be managed? A key recommendation is that codes of professional conduct should be accompanied by publicly transparent procedures for the investigation of serious infractions and appropriate disciplinary action when proven. The training of military physicians should also aim to develop a sound understanding of both humanitarian and human rights law. At present, both civil and military education of physicians generally lacks any component of human rights law. The Australian Defence Force (ADF) seems well placed to add codes of professional conduct to its existing ethical framework because of strong support at the highest executive levels.

Performance of a Bounce-Averaged Global Model of Super-Thermal Electron Transport in the Earth's Magnetic Field

NASA Technical Reports Server (NTRS)

McGuire, Tim

1998-01-01

In this paper, we report the results of our recent research on the application of a multiprocessor Cray T916 supercomputer in modeling super-thermal electron transport in the earth's magnetic field. In general, this mathematical model requires numerical solution of a system of partial differential equations. The code we use for this model is moderately vectorized. By using Amdahl's Law for vector processors, it can be verified that the code is about 60% vectorized on a Cray computer. Speedup factors on the order of 2.5 were obtained compared to the unvectorized code. In the following sections, we discuss the methodology of improving the code. In addition to our goal of optimizing the code for solution on the Cray computer, we had the goal of scalability in mind. Scalability combines the concepts of portabilty with near-linear speedup. Specifically, a scalable program is one whose performance is portable across many different architectures with differing numbers of processors for many different problem sizes. Though we have access to a Cray at this time, the goal was to also have code which would run well on a variety of architectures.

Different evolutionary patterns of SNPs between domains and unassigned regions in human protein-coding sequences.

PubMed

Pang, Erli; Wu, Xiaomei; Lin, Kui

2016-06-01

Protein evolution plays an important role in the evolution of each genome. Because of their functional nature, in general, most of their parts or sites are differently constrained selectively, particularly by purifying selection. Most previous studies on protein evolution considered individual proteins in their entirety or compared protein-coding sequences with non-coding sequences. Less attention has been paid to the evolution of different parts within each protein of a given genome. To this end, based on PfamA annotation of all human proteins, each protein sequence can be split into two parts: domains or unassigned regions. Using this rationale, single nucleotide polymorphisms (SNPs) in protein-coding sequences from the 1000 Genomes Project were mapped according to two classifications: SNPs occurring within protein domains and those within unassigned regions. With these classifications, we found: the density of synonymous SNPs within domains is significantly greater than that of synonymous SNPs within unassigned regions; however, the density of non-synonymous SNPs shows the opposite pattern. We also found there are signatures of purifying selection on both the domain and unassigned regions. Furthermore, the selective strength on domains is significantly greater than that on unassigned regions. In addition, among all of the human protein sequences, there are 117 PfamA domains in which no SNPs are found. Our results highlight an important aspect of protein domains and may contribute to our understanding of protein evolution.

Statistical and linguistic features of DNA sequences

NASA Technical Reports Server (NTRS)

Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1995-01-01

We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

Adding kinetics and hydrodynamics to the CHEETAH thermochemical code

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fried, L.E., Howard, W.M., Souers, P.C.

1997-01-15

In FY96 we released CHEETAH 1.40, which made extensive improvements on the stability and user friendliness of the code. CHEETAH now has over 175 users in government, academia, and industry. Efforts have also been focused on adding new advanced features to CHEETAH 2.0, which is scheduled for release in FY97. We have added a new chemical kinetics capability to CHEETAH. In the past, CHEETAH assumed complete thermodynamic equilibrium and independence of time. The addition of a chemical kinetic framework will allow for modeling of time-dependent phenomena, such as partial combustion and detonation in composite explosives with large reaction zones. Wemore » have implemented a Wood-Kirkwood detonation framework in CHEETAH, which allows for the treatment of nonideal detonations and explosive failure. A second major effort in the project this year has been linking CHEETAH to hydrodynamic codes to yield an improved HE product equation of state. We have linked CHEETAH to 1- and 2-D hydrodynamic codes, and have compared the code to experimental data. 15 refs., 13 figs., 1 tab.« less

Coherent errors in quantum error correction

NASA Astrophysics Data System (ADS)

Greenbaum, Daniel; Dutton, Zachary

Analysis of quantum error correcting (QEC) codes is typically done using a stochastic, Pauli channel error model for describing the noise on physical qubits. However, it was recently found that coherent errors (systematic rotations) on physical data qubits result in both physical and logical error rates that differ significantly from those predicted by a Pauli model. We present analytic results for the logical error as a function of concatenation level and code distance for coherent errors under the repetition code. For data-only coherent errors, we find that the logical error is partially coherent and therefore non-Pauli. However, the coherent part of the error is negligible after two or more concatenation levels or at fewer than ɛ - (d - 1) error correction cycles. Here ɛ << 1 is the rotation angle error per cycle for a single physical qubit and d is the code distance. These results support the validity of modeling coherent errors using a Pauli channel under some minimum requirements for code distance and/or concatenation. We discuss extensions to imperfect syndrome extraction and implications for general QEC.

76 FR 27622 - Approval and Promulgation of State Implementation Plan Revisions; Infrastructure Requirements for...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-12

...), Region 8, Mail Code 8P-AR, 1595 Wynkoop Street, Denver, Colorado 80202-1129. Hand Delivery: Director, Air Program, Environmental Protection Agency (EPA), Region 8, Mail Code 8P-AR, 1595 Wynkoop Street, Denver..., Denver, Colorado 80202-1129. EPA requests that if at all possible, you contact the individual listed in...

A biological inspired fuzzy adaptive window median filter (FAWMF) for enhancing DNA signal processing.

PubMed

Ahmad, Muneer; Jung, Low Tan; Bhuiyan, Al-Amin

2017-10-01

Digital signal processing techniques commonly employ fixed length window filters to process the signal contents. DNA signals differ in characteristics from common digital signals since they carry nucleotides as contents. The nucleotides own genetic code context and fuzzy behaviors due to their special structure and order in DNA strand. Employing conventional fixed length window filters for DNA signal processing produce spectral leakage and hence results in signal noise. A biological context aware adaptive window filter is required to process the DNA signals. This paper introduces a biological inspired fuzzy adaptive window median filter (FAWMF) which computes the fuzzy membership strength of nucleotides in each slide of window and filters nucleotides based on median filtering with a combination of s-shaped and z-shaped filters. Since coding regions cause 3-base periodicity by an unbalanced nucleotides' distribution producing a relatively high bias for nucleotides' usage, such fundamental characteristic of nucleotides has been exploited in FAWMF to suppress the signal noise. Along with adaptive response of FAWMF, a strong correlation between median nucleotides and the Π shaped filter was observed which produced enhanced discrimination between coding and non-coding regions contrary to fixed length conventional window filters. The proposed FAWMF attains a significant enhancement in coding regions identification i.e. 40% to 125% as compared to other conventional window filters tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. This study proves that conventional fixed length window filters applied to DNA signals do not achieve significant results since the nucleotides carry genetic code context. The proposed FAWMF algorithm is adaptive and outperforms significantly to process DNA signal contents. The algorithm applied to variety of DNA datasets produced noteworthy discrimination between coding and non-coding regions contrary to fixed window length conventional filters. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of significantly mutated regions across cancer types highlights a rich landscape of functional molecular alterations

PubMed Central

Araya, Carlos L.; Cenik, Can; Reuter, Jason A.; Kiss, Gert; Pande, Vijay S.; Snyder, Michael P.; Greenleaf, William J.

2015-01-01

Cancer sequencing studies have primarily identified cancer-driver genes by the accumulation of protein-altering mutations. An improved method would be annotation-independent, sensitive to unknown distributions of functions within proteins, and inclusive of non-coding drivers. We employed density-based clustering methods in 21 tumor types to detect variably-sized significantly mutated regions (SMRs). SMRs reveal recurrent alterations across a spectrum of coding and non-coding elements, including transcription factor binding sites and untranslated regions mutated in up to ∼15% of specific tumor types. SMRs reveal spatial clustering of mutations at molecular domains and interfaces, often with associated changes in signaling. Mutation frequencies in SMRs demonstrate that distinct protein regions are differentially mutated among tumor types, as exemplified by a linker region of PIK3CA in which biophysical simulations suggest mutations affect regulatory interactions. The functional diversity of SMRs underscores both the varied mechanisms of oncogenic misregulation and the advantage of functionally-agnostic driver identification. PMID:26691984

Multi-scale approach to the modeling of fission gas discharge during hypothetical loss-of-flow accident in gen-IV sodium fast reactor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Behafarid, F.; Shaver, D. R.; Bolotnov, I. A.

The required technological and safety standards for future Gen IV Reactors can only be achieved if advanced simulation capabilities become available, which combine high performance computing with the necessary level of modeling detail and high accuracy of predictions. The purpose of this paper is to present new results of multi-scale three-dimensional (3D) simulations of the inter-related phenomena, which occur as a result of fuel element heat-up and cladding failure, including the injection of a jet of gaseous fission products into a partially blocked Sodium Fast Reactor (SFR) coolant channel, and gas/molten sodium transport along the coolant channels. The computational approachmore » to the analysis of the overall accident scenario is based on using two different inter-communicating computational multiphase fluid dynamics (CMFD) codes: a CFD code, PHASTA, and a RANS code, NPHASE-CMFD. Using the geometry and time history of cladding failure and the gas injection rate, direct numerical simulations (DNS), combined with the Level Set method, of two-phase turbulent flow have been performed by the PHASTA code. The model allows one to track the evolution of gas/liquid interfaces at a centimeter scale. The simulated phenomena include the formation and breakup of the jet of fission products injected into the liquid sodium coolant. The PHASTA outflow has been averaged over time to obtain mean phasic velocities and volumetric concentrations, as well as the liquid turbulent kinetic energy and turbulence dissipation rate, all of which have served as the input to the core-scale simulations using the NPHASE-CMFD code. A sliding window time averaging has been used to capture mean flow parameters for transient cases. The results presented in the paper include testing and validation of the proposed models, as well the predictions of fission-gas/liquid-sodium transport along a multi-rod fuel assembly of SFR during a partial loss-of-flow accident. (authors)« less

Recognizing short coding sequences of prokaryotic genome using a novel iteratively adaptive sparse partial least squares algorithm

PubMed Central

2013-01-01

Background Significant efforts have been made to address the problem of identifying short genes in prokaryotic genomes. However, most known methods are not effective in detecting short genes. Because of the limited information contained in short DNA sequences, it is very difficult to accurately distinguish between protein coding and non-coding sequences in prokaryotic genomes. We have developed a new Iteratively Adaptive Sparse Partial Least Squares (IASPLS) algorithm as the classifier to improve the accuracy of the identification process. Results For testing, we chose the short coding and non-coding sequences from seven prokaryotic organisms. We used seven feature sets (including GC content, Z-curve, etc.) of short genes. In comparison with GeneMarkS, Metagene, Orphelia, and Heuristic Approachs methods, our model achieved the best prediction performance in identification of short prokaryotic genes. Even when we focused on the very short length group ([60–100 nt)), our model provided sensitivity as high as 83.44% and specificity as high as 92.8%. These values are two or three times higher than three of the other methods while Metagene fails to recognize genes in this length range. The experiments also proved that the IASPLS can improve the identification accuracy in comparison with other widely used classifiers, i.e. Logistic, Random Forest (RF) and K nearest neighbors (KNN). The accuracy in using IASPLS was improved 5.90% or more in comparison with the other methods. In addition to the improvements in accuracy, IASPLS required ten times less computer time than using KNN or RF. Conclusions It is conclusive that our method is preferable for application as an automated method of short gene classification. Its linearity and easily optimized parameters make it practicable for predicting short genes of newly-sequenced or under-studied species. Reviewers This article was reviewed by Alexey Kondrashov, Rajeev Azad (nominated by Dr J.Peter Gogarten) and Yuriy Fofanov (nominated by Dr Janet Siefert). PMID:24067167

GUMAP: A GUPIXWIN-compatible code for extracting regional spectra from nuclear microbeam list mode files

NASA Astrophysics Data System (ADS)

Russell, John L.; Campbell, John L.; Boyd, Nicholas I.; Dias, Johnny F.

2018-02-01

The newly developed GUMAP software creates element maps from OMDAQ list mode files, displays these maps individually or collectively, and facilitates on-screen definitions of specified regions from which a PIXE spectrum can be built. These include a free-hand region defined by moving the cursor. The regional charge is entered automatically into the spectrum file in a new GUPIXWIN-compatible format, enabling a GUPIXWIN analysis of the spectrum. The code defaults to the OMDAQ dead time treatment but also facilitates two other methods for dead time correction in sample regions with count rates different from the average.

An experimental investigation of contamination-related reassurance seeking: Familiar versus unfamiliar others.

PubMed

Neal, Rachael L; Radomsky, Adam S

2015-12-01

Repeated reassurance seeking (RS) is a hallmark feature of obsessive-compulsive disorder (OCD). Research in related areas of psychopathology suggests that familiarity with a partner can influence symptom expression. We hypothesized that participants in the company of a familiar (vs. unfamiliar) partner would seek more reassurance following an ambiguous task involving contamination-related threat. Participants completed an ambiguous dishwashing task in the company of a familiar or unfamiliar other, and were subsequently given an opportunity to seek reassurance. Participants and their assigned partners completed a measure of RS wherein they reported the number of times the participant sought reassurance; actual reassurance seeking was coded based on a recording of the interaction. Results demonstrated that participants sought more reassurance from familiar (vs. unfamiliar) others F(3, 86) = 9.20, p < .001, partial η(2) = .24); this effect was robust when partner-reported (F(1, 88) = 27.04, p < .001, partial η(2) = .24), a trend when participant-reported (F(1, 88) = 2.72, p = .10, partial η(2) = .03), but not significant when using objectively-coded data (F(1, 88) = 0.14, p = .71, partial η(2) = .00). As this experiment was a preliminary attempt to examine RS in an interpersonal context, the study may not have captured compulsive or excessive RS. Overall, results suggest that RS may be perceived as more excessive by familiar (versus unfamiliar) others, which may contribute to the distress experienced by carers of individuals with OCD. Copyright © 2015 Elsevier Ltd. All rights reserved.

Decision to adopt medical technology: case study of breast cancer radiotherapy techniques.

PubMed

Gold, Heather Taffet; Pitrelli, Kimberly; Hayes, Mary Katherine; Murphy, Madhuvanti Mahadeo

2014-11-01

To understand decision making concerning adoption and nonadoption of accelerated partial breast radiotherapy (RT) prior to long-term randomized trial evidence. A total of 36 radiation oncologists and surgeons were recruited through purposive and snowball sampling strategies from September 2010 through January 2013. Semistructured phone interviews were conducted and audio-recorded and lasted 20-45 minutes. Qualitative analysis was conducted using a framework approach, iteratively exploring key concepts and emerging issues raised by subjects. Interviews were transcribed and imported into Atlas.ti v6. Transcripts were independently coded by 3 researchers shortly after each interview, followed by consensus development on each coded transcript. Barriers and facilitators of adoption, practice patterns, and informational/educational sources concerning accelerated partial breast RT were all assessed to determine major themes. Nearly half of physicians were surgeons (47%), and half were radiation oncologists (53%), with 61% overall in urban settings. Twenty-nine of the 36 physicians interviewed used brachytherapy-based partial breast RT. Five major factors were involved in physicians' decisions to adopt accelerated partial breast RT: facilitators encouraging adoption (e.g., enthusiastic colleagues and patient convenience), financial and prestige incentives, pressures to adopt (e.g., potential declines in referrals), judgment concerning acceptable level of scientific evidence, and barriers (e.g., not having appropriate machinery or referral mechanism in place). If technology was adopted, clinical guideline adherence varied. Technology adoption is based on financial and social pressures, along with often-limited scientific evidence and what seems "best" for patients. For technology adoption and diffusion to be rational and evidence-based, we must encourage appropriate financial payment models to curb use outside of research studies and promote development of additional treatment registries until sufficient evidence is gathered. © The Author(s) 2014.

LIF measurements and chemical kinetic analysis of methylidyne formation in high-pressure counter-flow partially premixed and non-premixed flames

NASA Astrophysics Data System (ADS)

Naik, S. V.; Laurendeau, N. M.

2004-11-01

We report quantitative, spatially resolved, linear laser-induced fluorescence (LIF) measurements of methylidyne concentration ([CH]) in laminar, methane air, counter-flow partially premixed and non-premixed flames using excitation near 431.5 nm in the A X (0,0) band. For partially premixed flames, fuel-side equivalence ratios (ϕB) of 1.45, 1.6 and 2.0 are studied at pressures of 1, 3, 6, 9 and 12 atm. For non-premixed flames, the fuel-side mixture consists of 25% CH4 and 75% N2; measurements are obtained at pressures of 1, 2, 3, 4, 5, 6, 9 and 12 atm. The quantitative CH measurements are compared with predictions from an opposed-flow flame code utilizing two GRI chemical kinetic mechanisms (versions 2.11 and 3.0). LIF measurements of [CH] are corrected for variations in the quenching rate coefficient by using major species concentrations and temperatures generated by the code along with suitable quenching cross sections for CH available from the literature. A pathway analysis provides relative contributions from important elementary reactions to the total amount of CH produced at various pressures. Key reactions controlling peak CH concentrations are also identified by using a sensitivity analysis. For the partially premixed flames, measured CH profiles are reproduced reasonably well by GRI 3.0, although some quantitative disagreement exists at all pressures. Two CH radical peaks are observed for ϕB=1.45 and ϕB=1.6 at pressures above 3 atm. Peak CH concentrations for the non-premixed flames are significantly underpredicted by GRI 3.0. The latter agrees with previously reported NO concentrations, which are also underpredicted in these same high-pressure counter-flow diffusion flames.

A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region.

PubMed

Kress, W John; Erickson, David L

2007-06-06

A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination.

Theory-based model for the pedestal, edge stability and ELMs in tokamaks

NASA Astrophysics Data System (ADS)

Pankin, A. Y.; Bateman, G.; Brennan, D. P.; Schnack, D. D.; Snyder, P. B.; Voitsekhovitch, I.; Kritz, A. H.; Janeschitz, G.; Kruger, S.; Onjun, T.; Pacher, G. W.; Pacher, H. D.

2006-04-01

An improved model for triggering edge localized mode (ELM) crashes is developed for use within integrated modelling simulations of the pedestal and ELM cycles at the edge of H-mode tokamak plasmas. The new model is developed by using the BALOO, DCON and ELITE ideal MHD stability codes to derive parametric expressions for the ELM triggering threshold. The whole toroidal mode number spectrum is studied with these codes. The DCON code applies to low mode numbers, while the BALOO code applies to only high mode numbers and the ELITE code applies to intermediate and high mode numbers. The variables used in the parametric stability expressions are the normalized pressure gradient and the parallel current density, which drive ballooning and peeling modes. Two equilibria motivated by DIII-D geometry with different plasma triangularities are studied. It is found that the stable region in the high triangularity discharge covers a much larger region of parameter space than the corresponding stability region in the low triangularity discharge. The new ELM trigger model is used together with a previously developed model for pedestal formation and ELM crashes in the ASTRA integrated modelling code to follow the time evolution of the temperature profiles during ELM cycles. The ELM frequencies obtained in the simulations of low and high triangularity discharges are observed to increase with increasing heating power. There is a transition from second stability to first ballooning mode stability as the heating power is increased in the high triangularity simulations. The results from the ideal MHD stability codes are compared with results from the resistive MHD stability code NIMROD.

A Statistical Analysis of IrisCode and Its Security Implications.

PubMed

Kong, Adams Wai-Kin

2015-03-01

IrisCode has been used to gather iris data for 430 million people. Because of the huge impact of IrisCode, it is vital that it is completely understood. This paper first studies the relationship between bit probabilities and a mean of iris images (The mean of iris images is defined as the average of independent iris images.) and then uses the Chi-square statistic, the correlation coefficient and a resampling algorithm to detect statistical dependence between bits. The results show that the statistical dependence forms a graph with a sparse and structural adjacency matrix. A comparison of this graph with a graph whose edges are defined by the inner product of the Gabor filters that produce IrisCodes shows that partial statistical dependence is induced by the filters and propagates through the graph. Using this statistical information, the security risk associated with two patented template protection schemes that have been deployed in commercial systems for producing application-specific IrisCodes is analyzed. To retain high identification speed, they use the same key to lock all IrisCodes in a database. The belief has been that if the key is not compromised, the IrisCodes are secure. This study shows that even without the key, application-specific IrisCodes can be unlocked and that the key can be obtained through the statistical dependence detected.

XGC developments for a more efficient XGC-GENE code coupling

NASA Astrophysics Data System (ADS)

Dominski, Julien; Hager, Robert; Ku, Seung-Hoe; Chang, Cs

2017-10-01

In the Exascale Computing Program, the High-Fidelity Whole Device Modeling project initially aims at delivering a tightly-coupled simulation of plasma neoclassical and turbulence dynamics from the core to the edge of the tokamak. To permit such simulations, the gyrokinetic codes GENE and XGC will be coupled together. Numerical efforts are made to improve the numerical schemes agreement in the coupling region. One of the difficulties of coupling those codes together is the incompatibility of their grids. GENE is a continuum grid-based code and XGC is a Particle-In-Cell code using unstructured triangular mesh. A field-aligned filter is thus implemented in XGC. Even if XGC originally had an approximately field-following mesh, this field-aligned filter permits to have a perturbation discretization closer to the one solved in the field-aligned code GENE. Additionally, new XGC gyro-averaging matrices are implemented on a velocity grid adapted to the plasma properties, thus ensuring same accuracy from the core to the edge regions.

Network perturbation by recurrent regulatory variants in cancer

PubMed Central

Cho, Ara; Lee, Insuk; Choi, Jung Kyoon

2017-01-01

Cancer driving genes have been identified as recurrently affected by variants that alter protein-coding sequences. However, a majority of cancer variants arise in noncoding regions, and some of them are thought to play a critical role through transcriptional perturbation. Here we identified putative transcriptional driver genes based on combinatorial variant recurrence in cis-regulatory regions. The identified genes showed high connectivity in the cancer type-specific transcription regulatory network, with high outdegree and many downstream genes, highlighting their causative role during tumorigenesis. In the protein interactome, the identified transcriptional drivers were not as highly connected as coding driver genes but appeared to form a network module centered on the coding drivers. The coding and regulatory variants associated via these interactions between the coding and transcriptional drivers showed exclusive and complementary occurrence patterns across tumor samples. Transcriptional cancer drivers may act through an extensive perturbation of the regulatory network and by altering protein network modules through interactions with coding driver genes. PMID:28333928

Structural analysis of the HLA-A/HLA-F subregion: Precise localization of two new multigene families closely associated with the HLA class I sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pichon, L.; Carn, G.; Bouric, P.

1996-03-01

Positional cloning strategies for the hemochromatosis gene have previously concentrated on a target area restricted to a maximum genomic expanse of 400 kb around the HLA-A and HLA-F loci. Recently, the candidate region has been extended to 2-3 Mb on the distal side of the MHC. In this study, 10 coding sequences [hemochromatosis candidate genes (HCG) I to X] were isolated by cDNA selection using YACs covering the HLA-A/HLA-F subregion. Two of these (HCG II and HCG IV) belong to multigene families, as well as other sequences already described in this region, i.e., P5, pMC 6.7, and HLA class I.more » Fingerprinting of the four YACSs overlapping the region was performed and allowed partial localization of the different multigene family sequences on each YAC without defining their exact positions. Fingerprinting on cosmids isolated from the ICRF chromosome 6-specific cosmid library allowed more precise localization of the redundant sequences in all of the multigene families and revealed their apparent organization in clusters. Further examination of these intertwined sequences demonstrated that this structural organization resulted from a succession of complex phenomena, including duplications and contractions. This study presents a precise description of the structural organization of the HLA-A/HLA-F region and a determination of the sequences involved in the megabase size polymorphism observed among the A3, A24, and A31 haplotypes. 29 refs., 2 figs., 2 tabs.« less

Complete nucleotide sequence of the gene for human heparin cofactor II and mapping to chromosomal band 22q11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herzog, R.; Lutz, S.; Blin, N.

1991-02-05

Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less

Large Deletions at the SHOX Locus in the Pseudoautosomal Region Are Associated with Skeletal Atavism in Shetland Ponies

PubMed Central

Rafati, Nima; Andersson, Lisa S.; Mikko, Sofia; Feng, Chungang; Raudsepp, Terje; Pettersson, Jessica; Janecka, Jan; Wattle, Ove; Ameur, Adam; Thyreen, Gunilla; Eberth, John; Huddleston, John; Malig, Maika; Bailey, Ernest; Eichler, Evan E.; Dalin, Göran; Chowdary, Bhanu; Andersson, Leif; Lindgren, Gabriella; Rubin, Carl-Johan

2016-01-01

Skeletal atavism in Shetland ponies is a heritable disorder characterized by abnormal growth of the ulna and fibula that extend the carpal and tarsal joints, respectively. This causes abnormal skeletal structure and impaired movements, and affected foals are usually killed. In order to identify the causal mutation we subjected six confirmed Swedish cases and a DNA pool consisting of 21 control individuals to whole genome resequencing. We screened for polymorphisms where the cases and the control pool were fixed for opposite alleles and observed this signature for only 25 SNPs, most of which were scattered on genome assembly unassigned scaffolds. Read depth analysis at these loci revealed homozygosity or compound heterozygosity for two partially overlapping large deletions in the pseudoautosomal region (PAR) of chromosome X/Y in cases but not in the control pool. One of these deletions removes the entire coding region of the SHOX gene and both deletions remove parts of the CRLF2 gene located downstream of SHOX. The horse reference assembly of the PAR is highly fragmented, and in order to characterize this region we sequenced bacterial artificial chromosome (BAC) clones by single-molecule real-time (SMRT) sequencing technology. This considerably improved the assembly and enabled size estimations of the two deletions to 160−180 kb and 60−80 kb, respectively. Complete association between the presence of these deletions and disease status was verified in eight other affected horses. The result of the present study is consistent with previous studies in humans showing crucial importance of SHOX for normal skeletal development. PMID:27207956

Tau mRNA 3'UTR-to-CDS ratio is increased in Alzheimer disease.

PubMed

García-Escudero, Vega; Gargini, Ricardo; Martín-Maestro, Patricia; García, Esther; García-Escudero, Ramón; Avila, Jesús

2017-08-10

Neurons frequently show an imbalance in expression of the 3' untranslated region (3'UTR) relative to the coding DNA sequence (CDS) region of mature messenger RNAs (mRNA). The ratio varies among different cells or parts of the brain. The Map2 protein levels per cell depend on the 3'UTR-to-CDS ratio rather than the total mRNA amount, which suggests powerful regulation of protein expression by 3'UTR sequences. Here we found that MAPT (the microtubule-associated protein tau gene) 3'UTR levels are particularly high with respect to other genes; indeed, the 3'UTR-to-CDS ratio of MAPT is balanced in healthy brain in mouse and human. The tau protein accumulates in Alzheimer diseased brain. We nonetheless observed that the levels of RNA encoding MAPT/tau were diminished in these patients' brains. To explain this apparently contradictory result, we studied MAPT mRNA stoichiometry in coding and non-coding regions, and found that the 3'UTR-to-CDS ratio was higher in the hippocampus of Alzheimer disease patients, with higher tau protein but lower total mRNA levels. Our data indicate that changes in the 3'UTR-to-CDS ratio have a regulatory role in the disease. Future research should thus consider not only mRNA levels, but also the ratios between coding and non-coding regions. Copyright © 2017 Elsevier B.V. All rights reserved.

The Comprehensive AOCMF Classification: Skull Base and Cranial Vault Fractures – Level 2 and 3 Tutorial

PubMed Central

Ieva, Antonio Di; Audigé, Laurent; Kellman, Robert M.; Shumrick, Kevin A.; Ringl, Helmut; Prein, Joachim; Matula, Christian

2014-01-01

The AOCMF Classification Group developed a hierarchical three-level craniomaxillofacial classification system with increasing level of complexity and details. The highest level 1 system distinguish four major anatomical units, including the mandible (code 91), midface (code 92), skull base (code 93), and cranial vault (code 94). This tutorial presents the level 2 and more detailed level 3 systems for the skull base and cranial vault units. The level 2 system describes fracture location outlining the topographic boundaries of the anatomic regions, considering in particular the endocranial and exocranial skull base surfaces. The endocranial skull base is divided into nine regions; a central skull base adjoining a left and right side are divided into the anterior, middle, and posterior skull base. The exocranial skull base surface and cranial vault are divided in regions defined by the names of the bones involved: frontal, parietal, temporal, sphenoid, and occipital bones. The level 3 system allows assessing fracture morphology described by the presence of fracture fragmentation, displacement, and bone loss. A documentation of associated intracranial diagnostic features is proposed. This tutorial is organized in a sequence of sections dealing with the description of the classification system with illustrations of the topographical skull base and cranial vault regions along with rules for fracture location and coding, a series of case examples with clinical imaging and a general discussion on the design of this classification. PMID:25489394

Non-coding cancer driver candidates identified with a sample- and position-specific model of the somatic mutation rate

PubMed Central

Juul, Malene; Bertl, Johanna; Guo, Qianyun; Nielsen, Morten Muhlig; Świtnicki, Michał; Hornshøj, Henrik; Madsen, Tobias; Hobolth, Asger; Pedersen, Jakob Skou

2017-01-01

Non-coding mutations may drive cancer development. Statistical detection of non-coding driver regions is challenged by a varying mutation rate and uncertainty of functional impact. Here, we develop a statistically founded non-coding driver-detection method, ncdDetect, which includes sample-specific mutational signatures, long-range mutation rate variation, and position-specific impact measures. Using ncdDetect, we screened non-coding regulatory regions of protein-coding genes across a pan-cancer set of whole-genomes (n = 505), which top-ranked known drivers and identified new candidates. For individual candidates, presence of non-coding mutations associates with altered expression or decreased patient survival across an independent pan-cancer sample set (n = 5454). This includes an antigen-presenting gene (CD1A), where 5’UTR mutations correlate significantly with decreased survival in melanoma. Additionally, mutations in a base-excision-repair gene (SMUG1) correlate with a C-to-T mutational-signature. Overall, we find that a rich model of mutational heterogeneity facilitates non-coding driver identification and integrative analysis points to candidates of potential clinical relevance. DOI: http://dx.doi.org/10.7554/eLife.21778.001 PMID:28362259

Analysis of whole genome sequences of 16 strains of rubella virus from the United States, 1961-2009.

PubMed

Abernathy, Emily; Chen, Min-hsin; Bera, Jayati; Shrivastava, Susmita; Kirkness, Ewen; Zheng, Qi; Bellini, William; Icenogle, Joseph

2013-01-25

Rubella virus is the causative agent of rubella, a mild rash illness, and a potent teratogenic agent when contracted by a pregnant woman. Global rubella control programs target the reduction and elimination of congenital rubella syndrome. Phylogenetic analysis of partial sequences of rubella viruses has contributed to virus surveillance efforts and played an important role in demonstrating that indigenous rubella viruses have been eliminated in the United States. Sixteen wild-type rubella viruses were chosen for whole genome sequencing. All 16 viruses were collected in the United States from 1961 to 2009 and are from 8 of the 13 known rubella genotypes. Phylogenetic analysis of 30 whole genome sequences produced a maximum likelihood tree giving high bootstrap values for all genotypes except provisional genotype 1a. Comparison of the 16 new complete sequences and 14 previously sequenced wild-type viruses found regions with clusters of variable amino acids. The 5' 250 nucleotides of the genome are more conserved than any other part of the genome. Genotype specific deletions in the untranslated region between the non-structural and structural open reading frames were observed for genotypes 2B and genotype 1G. No evidence was seen for recombination events among the 30 viruses. The analysis presented here is consistent with previous reports on the genetic characterization of rubella virus genomes. Conserved and variable regions were identified and additional evidence for genotype specific nucleotide deletions in the intergenic region was found. Phylogenetic analysis confirmed genotype groupings originally based on structural protein coding region sequences, which provides support for the WHO nomenclature for genetic characterization of wild-type rubella viruses.

Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

PubMed

Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

2015-04-01

Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

Attention enhances multi-voxel representation of novel objects in frontal, parietal and visual cortices.

PubMed

Woolgar, Alexandra; Williams, Mark A; Rich, Anina N

2015-04-01

Selective attention is fundamental for human activity, but the details of its neural implementation remain elusive. One influential theory, the adaptive coding hypothesis (Duncan, 2001, An adaptive coding model of neural function in prefrontal cortex, Nature Reviews Neuroscience 2:820-829), proposes that single neurons in certain frontal and parietal regions dynamically adjust their responses to selectively encode relevant information. This selective representation may in turn support selective processing in more specialized brain regions such as the visual cortices. Here, we use multi-voxel decoding of functional magnetic resonance images to demonstrate selective representation of attended--and not distractor--objects in frontal, parietal, and visual cortices. In addition, we highlight a critical role for task demands in determining which brain regions exhibit selective coding. Strikingly, representation of attended objects in frontoparietal cortex was highest under conditions of high perceptual demand, when stimuli were hard to perceive and coding in early visual cortex was weak. Coding in early visual cortex varied as a function of attention and perceptual demand, while coding in higher visual areas was sensitive to the allocation of attention but robust to changes in perceptual difficulty. Consistent with high-profile reports, peripherally presented objects could also be decoded from activity at the occipital pole, a region which corresponds to the fovea. Our results emphasize the flexibility of frontoparietal and visual systems. They support the hypothesis that attention enhances the multi-voxel representation of information in the brain, and suggest that the engagement of this attentional mechanism depends critically on current task demands. Copyright © 2015 Elsevier Inc. All rights reserved.

77 FR 44555 - Partial Approval and Disapproval of Air Quality Implementation Plans; Arizona; State Board...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-30

.... ARS 49-478(B) establishes the compositional requirements of the county Air Quality Hearing Boards... County Code 17.04.190 (``Composition'') generally mirrors the language or ARS 49-478 but also includes... membership requirement of ARS 49-478 to interests in persons subject to enforcement orders. However, this...

A Visual Analysis of the 1980 Houston Republican Presidential Primary Debate.

ERIC Educational Resources Information Center

Hellweg, Susan A.; Phillips, Steven L.

In partial replication of an analysis of the 1976 presidential campaign debates, two researchers analyzed the debate between Republican presidential candidates Ronald Reagan and George Bush (Houston, April 23, 1980) for its visual features, (amount and type of camera shots). The visual categories by which camera shots were coded included…

The effects of removing condition boundaries on FIA estimates

Treesearch

David Gartner; Gregory Reams

2002-01-01

When Forest Inverltory and Analysis (FIA) changed to the national standards for the inventory system, plots with lnultiplc condition codes were introduced to the Southern Station's FIA unit. FIA maps up to five different conditions on completely or partially forested 1124-acre subplots. This change has madc producing inventory estimates more complex because the...

ShiftNMFk 1.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexandrov, Boian S.; Vesselinov, Velimir V.; Stanev, Valentin

The ShiftNMFk1.2 code, or as we call it, GreenNMFk, represents a hybrid algorithm combining unsupervised adaptive machine learning and Green's function inverse method. GreenNMFk allows an efficient and high performance de-mixing and feature extraction of a multitude of nonnegative signals that change their shape propagating through the medium. The signals are mixed and recorded by a network of uncorrelated sensors. The code couples Non-negative Matrix Factorization (NMF) and inverse-analysis Green's functions method. GreenNMF synergistically performs decomposition of the recorded mixtures, finds the number of the unknown sources and uses the Green's function of the governing partial differential equation to identifymore » the unknown sources and their charecteristics. GreenNMF can be applied directly to any problem controlled by a known partial-differential parabolic equation where mixtures of an unknown number of sources are measured at multiple locations. Full GreenNMFk method is a subject LANL U.S. Patent application S133364.000 August, 2017. The ShiftNMFk 1.2 version here is a toy version of this method that can work with a limited number of unknown sources (4 or less).« less

Spatiotopic coding during dynamic head tilt

PubMed Central

Turi, Marco; Burr, David C.

2016-01-01

Humans maintain a stable representation of the visual world effortlessly, despite constant movements of the eyes, head, and body, across multiple planes. Whereas visual stability in the face of saccadic eye movements has been intensely researched, fewer studies have investigated retinal image transformations induced by head movements, especially in the frontal plane. Unlike head rotations in the horizontal and sagittal planes, tilting the head in the frontal plane is only partially counteracted by torsional eye movements and consequently induces a distortion of the retinal image to which we seem to be completely oblivious. One possible mechanism aiding perceptual stability is an active reconstruction of a spatiotopic map of the visual world, anchored in allocentric coordinates. To explore this possibility, we measured the positional motion aftereffect (PMAE; the apparent change in position after adaptation to motion) with head tilts of ∼42° between adaptation and test (to dissociate retinal from allocentric coordinates). The aftereffect was shown to have both a retinotopic and spatiotopic component. When tested with unpatterned Gaussian blobs rather than sinusoidal grating stimuli, the retinotopic component was greatly reduced, whereas the spatiotopic component remained. The results suggest that perceptual stability may be maintained at least partially through mechanisms involving spatiotopic coding. NEW & NOTEWORTHY Given that spatiotopic coding could play a key role in maintaining visual stability, we look for evidence of spatiotopic coding after retinal image transformations caused by head tilt. To this end, we measure the strength of the positional motion aftereffect (PMAE; previously shown to be largely spatiotopic after saccades) after large head tilts. We find that, as with eye movements, the spatial selectivity of the PMAE has a large spatiotopic component after head rotation. PMID:27903636

Tudor-staphylococcal nuclease regulates the expression and biological function of alkylglycerone phosphate synthase via nuclear factor-κB and microRNA-127 in human glioma U87MG cells.

PubMed

Zhang, Yongqiang; Jia, Jun; Li, Ying; Chen, Yan-Ge; Huang, Huan; Qiao, Yang; Zhu, Yu

2018-06-01

Glioma is one of the malignant tumor types detrimental to human health; therefore, it is important to find novel targets and therapeutics for this tumor. The downregulated expression of Tudor-staphylococcal nuclease (SN) and alkylglycerone phosphate synthase (AGPS) can decrease cancer malignancy, and the overexpression of them can the increase viability and migration potential of various tumor cell types; however, the role of AGPS in the proliferation and migration of glioma, and the association of Tudor-SN and AGPS in human glioma is not clear. In the present study, it was determined that AGPS silencing suppressed the proliferation and migration potential of glioma U87MG cells, and suppressed the expression of the circular RNAs circ-ubiquitin-associated protein 2, circ-zinc finger protein 292 and circ-homeodomain-interacting protein kinase 3, and the long non-coding RNAs H19 imprinted maternally expressed transcript (non-protein coding), colon cancer-associated transcript 1 (non-protein coding) and hepatocellular carcinoma upregulated long non-coding RNA. Furthermore, Tudor-SN silencing suppressed the expression of AGPS; however, nuclear factor (NF)-κB and microRNA (miR)-127 retrieval experiments partially reduced the expression of AGPS. Additionally, it was determined that Tudor-SN silencing suppressed the activity of the mechanistic target of rapamycin (mTOR) signaling pathway, and NF-κB and miR-127 retrieval experiments partially reduced the activity of mTOR. Therefore, it was considered that NF-κB and miR-127 may be the mediators of Tudor-SN-regulated AGPS via the mTOR signaling pathway. These results improve on our knowledge of the mechanisms underlying Tudor-SN and AGPS in human glioma.

PFLOTRAN Verification: Development of a Testing Suite to Ensure Software Quality

NASA Astrophysics Data System (ADS)

Hammond, G. E.; Frederick, J. M.

2016-12-01

In scientific computing, code verification ensures the reliability and numerical accuracy of a model simulation by comparing the simulation results to experimental data or known analytical solutions. The model is typically defined by a set of partial differential equations with initial and boundary conditions, and verification ensures whether the mathematical model is solved correctly by the software. Code verification is especially important if the software is used to model high-consequence systems which cannot be physically tested in a fully representative environment [Oberkampf and Trucano (2007)]. Justified confidence in a particular computational tool requires clarity in the exercised physics and transparency in its verification process with proper documentation. We present a quality assurance (QA) testing suite developed by Sandia National Laboratories that performs code verification for PFLOTRAN, an open source, massively-parallel subsurface simulator. PFLOTRAN solves systems of generally nonlinear partial differential equations describing multiphase, multicomponent and multiscale reactive flow and transport processes in porous media. PFLOTRAN's QA test suite compares the numerical solutions of benchmark problems in heat and mass transport against known, closed-form, analytical solutions, including documentation of the exercised physical process models implemented in each PFLOTRAN benchmark simulation. The QA test suite development strives to follow the recommendations given by Oberkampf and Trucano (2007), which describes four essential elements in high-quality verification benchmark construction: (1) conceptual description, (2) mathematical description, (3) accuracy assessment, and (4) additional documentation and user information. Several QA tests within the suite will be presented, including details of the benchmark problems and their closed-form analytical solutions, implementation of benchmark problems in PFLOTRAN simulations, and the criteria used to assess PFLOTRAN's performance in the code verification procedure. References Oberkampf, W. L., and T. G. Trucano (2007), Verification and Validation Benchmarks, SAND2007-0853, 67 pgs., Sandia National Laboratories, Albuquerque, NM.

Explaining ecological clusters of maternal depression in South Western Sydney

PubMed Central

2014-01-01

Background The aim of the qualitative study reported here was to: 1) explain the observed clustering of postnatal depressive symptoms in South Western Sydney; and 2) identify group-level mechanisms that would add to our understanding of the social determinants of maternal depression. Methods Critical realism provided the methodological underpinning for the study. The setting was four local government areas in South Western Sydney, Australia. Child and Family practitioners and mothers in naturally occurring mothers groups were interviewed. Results Using an open coding approach to maximise emergence of patterns and relationships we have identified seven theoretical concepts that might explain the observed spatial clustering of maternal depression. The theoretical concepts identified were: Community-level social networks; Social Capital and Social Cohesion; "Depressed community"; Access to services at the group level; Ethnic segregation and diversity; Supportive social policy; and Big business. Conclusions We postulate that these regional structural, economic, social and cultural mechanisms partially explain the pattern of maternal depression observed in families and communities within South Western Sydney. We further observe that powerful global economic and political forces are having an impact on the local situation. The challenge for policy and practice is to support mothers and their families within this adverse regional and global-economic context. PMID:24460690

De novo 14q24.2q24.3 microdeletion including IFT43 is associated with intellectual disability, skeletal anomalies, cardiac anomalies, and myopia.

PubMed

Stokman, Marijn F; Oud, Machteld M; van Binsbergen, Ellen; Slaats, Gisela G; Nicolaou, Nayia; Renkema, Kirsten Y; Nijman, Isaac J; Roepman, Ronald; Giles, Rachel H; Arts, Heleen H; Knoers, Nine V A M; van Haelst, Mieke M

2016-06-01

We report an 11-year-old girl with mild intellectual disability, skeletal anomalies, congenital heart defect, myopia, and facial dysmorphisms including an extra incisor, cup-shaped ears, and a preauricular skin tag. Array comparative genomic hybridization analysis identified a de novo 4.5-Mb microdeletion on chromosome 14q24.2q24.3. The deleted region and phenotype partially overlap with previously reported patients. Here, we provide an overview of the literature on 14q24 microdeletions and further delineate the associated phenotype. We performed exome sequencing to examine other causes for the phenotype and queried genes present in the 14q24.2q24.3 microdeletion that are associated with recessive disease for variants in the non-deleted allele. The deleted region contains 65 protein-coding genes, including the ciliary gene IFT43. Although Sanger and exome sequencing did not identify variants in the second IFT43 allele or in other IFT complex A-protein-encoding genes, immunocytochemistry showed increased accumulation of IFT-B proteins at the ciliary tip in patient-derived fibroblasts compared to control cells, demonstrating defective retrograde ciliary transport. This could suggest a ciliary defect in the pathogenesis of this disorder. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Computational Study of Poloidal Angular Momentum Transport in DIII-D

NASA Astrophysics Data System (ADS)

Pankin, Alexei; Kruger, Scott; Kritz, Arnold; Rafiq, Tariq; Weiland, Jan

2013-10-01

The new Multi-Mode Model, MMM8.1, includes the capability to predict the anomalous poloidal momentum diffusivity [T. Rafiq et al., Phys. Plasmas 20, 032506 (2013)]. It is important to consider the effect of this diffusivity on the poloidal rotation of tokamak plasmas since some experimental observations suggest that neoclassical effects are not always sufficient to explain the observed poloidal rotation [B.A. Grierson et al., Phys. Plasmas 19, 056107 (2012)]. One of the objectives of this research is to determine if the anomalous contribution to the poloidal rotation can be significant in the regions of internal transport barriers (ITBs). In this study, the MMM8.1 model is used to compute the poloidal momentum diffusivity for a range of plasma parameters that correspond to the parameters that occur in DIII-D discharges. The parameters that are considered include the temperature and density gradients, and magnetic shear. The role of anomalous poloidal transport in the possible poloidal spin up in the ITB regions is discussed. Progress in the implementation of poloidal transport equations in the ASTRA transport code is reported and initial predictive simulation results for the poloidal rotation profiles are presented. This research is partially support by the DOE Grants DE-SC0006629 and DE-FG02-92ER54141.

Genetic and antigenic analysis of foot-and-mouth disease virus serotype O responsible for outbreaks in India during 2013.

PubMed

Subramaniam, Saravanan; Mohapatra, Jajati K; Das, Biswajit; Sanyal, Aniket; Pattnaik, Bramhadev

2015-03-01

In recent times, majority of the foot-and-mouth disease (FMD) outbreaks in India are caused by serotype O Ind2001 lineage. The lineage has diverged into four sub-lineages (Ind2001a, b, c and d). We report here the genetic and antigenic analyses of nine Ind2001d isolates that caused outbreaks during April 2013-March 2014 in India. The length of the genomes of outbreak viruses varied between 8153 and 8181 nucleotides without any insertion or deletion in the coding region. Of the nine isolates analyzed antigenically against the currently used Indian vaccine strain INDR2/1975, eight showed good cross serological match (>0.3) indicating optimal antigenic coverage by the vaccine strain. An unprecedented deletion of 22 nucleotides between position 57 and 78 was observed in the 3' untranslated region of one of the isolates without compromising the virus viability, which imply that partial distortion in SL2 of 3'UTR may not have influence on virus viability at least under in-vitro conditions. Recently the Ind2001 lineage has been reported from several countries including Libya and spread of this lineage across a wide geographical area needs to be monitored carefully to avoid any future pandemic. Copyright © 2014 Elsevier B.V. All rights reserved.

Cloning and expression of colonization factor antigen I (CFA/I) epitopes of enterotoxigenic Escherichia coli (ETEC) in Salmonella flagellin.

PubMed

Luna, M G; Martins, M M; Newton, S M; Costa, S O; Almeida, D F; Ferreira, L C

1997-01-01

Oligonucleotides coding for linear epitopes of the fimbrial colonization factor antigen I (CFA/I) of enterotoxigenic Escherichia coli (ETEC) were cloned and expressed in a deleted form of the Salmonella muenchen flagellin fliC (H1-d) gene. Four synthetic oligonucleotide pairs coding for regions corresponding to amino acids 1 to 15 (region I), amino acids 11 to 25 (region II), amino acids 32 to 45 (region III) and amino acids 88 to 102 (region IV) were synthesized and cloned in the Salmonella flagellin-coding gene. All four hybrid flagellins were exported to the bacterial surface where they produced flagella, but only three constructs were fully motile. Sera recovered from mice immunized with intraperitoneal injections of purified flagella containing region II (FlaII) or region IV (FlaIV) showed high titres against dissociated solid-phase-bound CFA/I subunits. Hybrid flagellins containing region I (FlaI) or region III (FlaIII) elicited a weak immune response as measured in enzyme-linked immunosorbent assay (ELISA) with dissociated CFA/I subunits. None of the sera prepared with purified hybrid flagella were able to agglutinate or inhibit haemagglutination promoted by CFA/I-positive strains. Moreover, inhibition ELISA tests indicated that antisera directed against region I, II, III or IV cloned in flagellin were not able to recognize surface-exposed regions on the intact CFA/I fimbriae.

Partial Overhaul and Initial Parallel Optimization of KINETICS, a Coupled Dynamics and Chemistry Atmosphere Model

NASA Technical Reports Server (NTRS)

Nguyen, Howard; Willacy, Karen; Allen, Mark

2012-01-01

KINETICS is a coupled dynamics and chemistry atmosphere model that is data intensive and computationally demanding. The potential performance gain from using a supercomputer motivates the adaptation from a serial version to a parallelized one. Although the initial parallelization had been done, bottlenecks caused by an abundance of communication calls between processors led to an unfavorable drop in performance. Before starting on the parallel optimization process, a partial overhaul was required because a large emphasis was placed on streamlining the code for user convenience and revising the program to accommodate the new supercomputers at Caltech and JPL. After the first round of optimizations, the partial runtime was reduced by a factor of 23; however, performance gains are dependent on the size of the data, the number of processors requested, and the computer used.

Regional TEC model under quiet geomagnetic conditions and low-to-moderate solar activity based on CODE GIMs

NASA Astrophysics Data System (ADS)

Feng, Jiandi; Jiang, Weiping; Wang, Zhengtao; Zhao, Zhenzhen; Nie, Linjuan

2017-08-01

Global empirical total electron content (TEC) models based on TEC maps effectively describe the average behavior of the ionosphere. However, the accuracy of these global models for a certain region may not be ideal. Due to the number and distribution of the International GNSS Service (IGS) stations, the accuracy of TEC maps is geographically different. The modeling database derived from the global TEC maps with different accuracy is likely one of the main reasons that limits the accuracy of the new models. Moreover, many anomalies in the ionosphere are geographic or geomagnetic dependent, and as such the accuracy of global models can deteriorate if these anomalies are not fully incorporated into the modeling approach. For regional models built in small areas, these influences on modeling are immensely weakened. Thus, the regional TEC models may better reflect the temporal and spatial variations of TEC. In our previous work (Feng et al., 2016), a regional TEC model TECM-NEC is proposed for northeast China. However, this model is only directed against the typical region of Mid-latitude Summer Nighttime Anomaly (MSNA) occurrence, which is meaningless in other regions without MSNA. Following the technique of TECM-NEC model, this study proposes another regional empirical TEC model for other regions in mid-latitudes. Taking a small area BeiJing-TianJin-Tangshan (JJT) region (37.5°-42.5° N, 115°-120° E) in China as an example, a regional empirical TEC model (TECM-JJT) is proposed using the TEC grid data from January 1, 1999 to June 30, 2015 provided by the Center for Orbit Determination in Europe (CODE) under quiet geomagnetic conditions. The TECM-JJT model fits the input CODE TEC data with a bias of 0.11TECU and a root mean square error of 3.26TECU. Result shows that the regional model TECM-JJT is consistent with CODE TEC data and GPS-TEC data.

CRITICA: coding region identification tool invoking comparative analysis

NASA Technical Reports Server (NTRS)

Badger, J. H.; Olsen, G. J.; Woese, C. R. (Principal Investigator)

1999-01-01

Gene recognition is essential to understanding existing and future DNA sequence data. CRITICA (Coding Region Identification Tool Invoking Comparative Analysis) is a suite of programs for identifying likely protein-coding sequences in DNA by combining comparative analysis of DNA sequences with more common noncomparative methods. In the comparative component of the analysis, regions of DNA are aligned with related sequences from the DNA databases; if the translation of the aligned sequences has greater amino acid identity than expected for the observed percentage nucleotide identity, this is interpreted as evidence for coding. CRITICA also incorporates noncomparative information derived from the relative frequencies of hexanucleotides in coding frames versus other contexts (i.e., dicodon bias). The dicodon usage information is derived by iterative analysis of the data, such that CRITICA is not dependent on the existence or accuracy of coding sequence annotations in the databases. This independence makes the method particularly well suited for the analysis of novel genomes. CRITICA was tested by analyzing the available Salmonella typhimurium DNA sequences. Its predictions were compared with the DNA sequence annotations and with the predictions of GenMark. CRITICA proved to be more accurate than GenMark, and moreover, many of its predictions that would seem to be errors instead reflect problems in the sequence databases. The source code of CRITICA is freely available by anonymous FTP (rdp.life.uiuc.edu in/pub/critica) and on the World Wide Web (http:/(/)rdpwww.life.uiuc.edu).

Structure and expression of canary myc family genes.

PubMed Central

Collum, R G; Clayton, D F; Alt, F W

1991-01-01

We found that the canary N-myc gene is highly related to mammalian N-myc genes in both the protein-coding region and the long 3' untranslated region. Examined coding regions of the canary c-myc gene were also highly related to their mammalian counterparts, but in contrast to N-myc, the canary and mammalian c-myc genes were quite divergent in their 3' untranslated regions. We readily detected N-myc and c-myc expression in the adult canary brain and found N-myc expression both at sites of proliferating neuronal precursors and in mature neurons. Images PMID:1996121

DNA methylation of miRNA coding sequences putatively associated with childhood obesity.

PubMed

Mansego, M L; Garcia-Lacarte, M; Milagro, F I; Marti, A; Martinez, J A

2017-02-01

Epigenetic mechanisms may be involved in obesity onset and its consequences. The aim of the present study was to evaluate whether DNA methylation status in microRNA (miRNA) coding regions is associated with childhood obesity. DNA isolated from white blood cells of 24 children (identification sample: 12 obese and 12 non-obese) from the Grupo Navarro de Obesidad Infantil study was hybridized in a 450 K methylation microarray. Several CpGs whose DNA methylation levels were statistically different between obese and non-obese were validated by MassArray® in 95 children (validation sample) from the same study. Microarray analysis identified 16 differentially methylated CpGs between both groups (6 hypermethylated and 10 hypomethylated). DNA methylation levels in miR-1203, miR-412 and miR-216A coding regions significantly correlated with body mass index standard deviation score (BMI-SDS) and explained up to 40% of the variation of BMI-SDS. The network analysis identified 19 well-defined obesity-relevant biological pathways from the KEGG database. MassArray® validation identified three regions located in or near miR-1203, miR-412 and miR-216A coding regions differentially methylated between obese and non-obese children. The current work identified three CpG sites located in coding regions of three miRNAs (miR-1203, miR-412 and miR-216A) that were differentially methylated between obese and non-obese children, suggesting a role of miRNA epigenetic regulation in childhood obesity. © 2016 World Obesity Federation.

Protein unfolding as a switch from self-recognition to high-affinity client binding

PubMed Central

Groitl, Bastian; Horowitz, Scott; Makepeace, Karl A. T.; Petrotchenko, Evgeniy V.; Borchers, Christoph H.; Reichmann, Dana; Bardwell, James C. A.; Jakob, Ursula

2016-01-01

Stress-specific activation of the chaperone Hsp33 requires the unfolding of a central linker region. This activation mechanism suggests an intriguing functional relationship between the chaperone's own partial unfolding and its ability to bind other partially folded client proteins. However, identifying where Hsp33 binds its clients has remained a major gap in our understanding of Hsp33's working mechanism. By using site-specific Fluorine-19 nuclear magnetic resonance experiments guided by in vivo crosslinking studies, we now reveal that the partial unfolding of Hsp33's linker region facilitates client binding to an amphipathic docking surface on Hsp33. Furthermore, our results provide experimental evidence for the direct involvement of conditionally disordered regions in unfolded protein binding. The observed structural similarities between Hsp33's own metastable linker region and client proteins present a possible model for how Hsp33 uses protein unfolding as a switch from self-recognition to high-affinity client binding. PMID:26787517

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Vishal C.; Gopalakrishnan, Ganesh; Krishnamoorthy, Sriram

The systems resilience research community has developed methods to manually insert additional source-program level assertions to trap errors, and also devised tools to conduct fault injection studies for scalar program codes. In this work, we contribute the first vector oriented LLVM-level fault injector VULFI to help study the effects of faults in vector architectures that are of growing importance, especially for vectorizing loops. Using VULFI, we conduct a resiliency study of nine real-world vector benchmarks using Intel’s AVX and SSE extensions as the target vector instruction sets, and offer the first reported understanding of how faults affect vector instruction sets.more » We take this work further toward automating the insertion of resilience assertions during compilation. This is based on our observation that during intermediate (e.g., LLVM-level) code generation to handle full and partial vectorization, modern compilers exploit (and explicate in their code-documentation) critical invariants. These invariants are turned into error-checking code. We confirm the efficacy of these automatically inserted low-overhead error detectors for vectorized for-loops.« less

A novel encoding scheme for effective biometric discretization: Linearly Separable Subcode.

PubMed

Lim, Meng-Hui; Teoh, Andrew Beng Jin

2013-02-01

Separability in a code is crucial in guaranteeing a decent Hamming-distance separation among the codewords. In multibit biometric discretization where a code is used for quantization-intervals labeling, separability is necessary for preserving distance dissimilarity when feature components are mapped from a discrete space to a Hamming space. In this paper, we examine separability of Binary Reflected Gray Code (BRGC) encoding and reveal its inadequacy in tackling interclass variation during the discrete-to-binary mapping, leading to a tradeoff between classification performance and entropy of binary output. To overcome this drawback, we put forward two encoding schemes exhibiting full-ideal and near-ideal separability capabilities, known as Linearly Separable Subcode (LSSC) and Partially Linearly Separable Subcode (PLSSC), respectively. These encoding schemes convert the conventional entropy-performance tradeoff into an entropy-redundancy tradeoff in the increase of code length. Extensive experimental results vindicate the superiority of our schemes over the existing encoding schemes in discretization performance. This opens up possibilities of achieving much greater classification performance with high output entropy.

Effects of endogenous pyrogen and prostaglandin E2 on hypothalamic neurons in rat brain slices.

PubMed

Watanabe, T; Morimoto, A; Murakami, N

1987-06-01

We investigated the effects of endogenous pyrogen and prostaglandin E2 (PGE2) on the preoptic and anterior hypothalamic (POAH) neurons using brain slice preparations from the rat. Partially purified endogenous pyrogen did not change the activities of most of the neurons in the POAH region when applied locally through a micropipette attached to the recording electrode in proximity to the neurons. This indicates that partially purified endogenous pyrogen does not act directly on the neuronal activity in the POAH region. The partially purified endogenous pyrogen, applied into a culture chamber containing a brain slice, facilitated the activities in 24% of the total neurons tested, regardless of the thermal specificity of the neurons. Moreover, PGE2 added to the culture chamber facilitated 48% of the warm-responsive, 33% of the cold-responsive, and 29% of the thermally insensitive neurons. The direction of change in neuronal activity induced by partially purified endogenous pyrogen appears to be almost the same as that induced by PGE2 when these substances were applied by perfusion to the same neuron in the culture chamber. These results suggest that partially purified pyrogen applied to the perfusate of the culture chamber stimulates some constituents of brain tissue to synthesize and release prostaglandin, which in turn affects the neuronal activity of the POAH region.

Natural variation in non-coding regions underlying phenotypic diversity in budding yeast

PubMed Central

Salinas, Francisco; de Boer, Carl G.; Abarca, Valentina; García, Verónica; Cuevas, Mara; Araos, Sebastian; Larrondo, Luis F.; Martínez, Claudio; Cubillos, Francisco A.

2016-01-01

Linkage mapping studies in model organisms have typically focused their efforts in polymorphisms within coding regions, ignoring those within regulatory regions that may contribute to gene expression variation. In this context, differences in transcript abundance are frequently proposed as a source of phenotypic diversity between individuals, however, until now, little molecular evidence has been provided. Here, we examined Allele Specific Expression (ASE) in six F1 hybrids from Saccharomyces cerevisiae derived from crosses between representative strains of the four main lineages described in yeast. ASE varied between crosses with levels ranging between 28% and 60%. Part of the variation in expression levels could be explained by differences in transcription factors binding to polymorphic cis-regulations and to differences in trans-activation depending on the allelic form of the TF. Analysis on highly expressed alleles on each background suggested ASN1 as a candidate transcript underlying nitrogen consumption differences between two strains. Further promoter allele swap analysis under fermentation conditions confirmed that coding and non-coding regions explained aspartic and glutamic acid consumption differences, likely due to a polymorphism affecting Uga3 binding. Together, we provide a new catalogue of variants to bridge the gap between genotype and phenotype. PMID:26898953

Beating the Heat: Magmatism in the Low-Temperature Thermochronologic Record

NASA Astrophysics Data System (ADS)

Murray, K. E.; Reiners, P. W.; Braun, J.; Karlstrom, L.; Morriss, M. C.

2017-12-01

The low-temperature thermochronology community was quick to recognize upper-crustal complexities in the geotherm that reflect landscape evolution, but the complex effects of crustal magmatism on thermochronometers can be difficult to independently document and remain underexplored. Because magmatism is common in many regions central to our understanding of tectonics, this is a significant gap in our ability to robustly interpret rock cooling. Here, we use several different numerical approaches to examine how local and regional crustal magmatism affects cooling age patterns and present examples from the western US that demonstrate the importance—and utility—of considering these effects. We modified the finite-element code Pecube to calculate how thermochronometers document the emplacement of simple hot bodies at different crustal levels. Results demonstrate the potential for mid-crustal plutons, emplaced at 10-15 km depth, to reset cooling ages in the overlying rocks at partial-retention depths at the time of magmatism. Permo-Triassic sandstones from the Colorado Plateau's Canyonlands region have apatite cooling ages that exemplify the resulting ambiguity: Oligocene rock cooling can be attributed to either 1 km of erosion or relaxation of a geothermal gradient transiently doubled by mid-crustal magmatism. Despite these complexities, there are compelling reasons to target rocks with magmatic histories. Shallowly emplaced plutons can usefully reset cooling ages in country rocks with protracted near-surface histories, as we have demonstrated in the Colorado Plateau's Henry Mountains. Cooling age patterns are also useful for quantifying magmatic processes themselves. In an ongoing project, we use the pattern of thermochronometer resetting around individual dikes that fed the Columbia River flood basalts, which are exposed in the Wallowa Mountains, to identify long-lived feeder dikes and model their thermal aureoles to further constrain eruptive dynamics. The pattern of resetting around dikes compliments higher-temperature constraints on the longevity of magma flow from phase equilibria in partially melted wall rocks. In principal, this technique should also resolve along-strike variability in flow localization, providing novel constraints on eruptive flux in large igneous provinces.

An Open Source Framework for Coupled Hydro-Hydrogeo-Chemical Systems in Catchment Research

NASA Astrophysics Data System (ADS)

Delfs, J.; Sachse, A.; Gayler, S.; Grathwohl, P.; He, W.; Jang, E.; Kalbacher, T.; Klein, C.; Kolditz, O.; Maier, U.; Priesack, E.; Rink, K.; Selle, B.; Shao, H.; Singh, A. K.; Streck, T.; Sun, Y.; Wang, W.; Walther, M.

2013-12-01

This poster presents an open-source framework designed to assist water scientists in the study of catchment hydraulic functions with associated chemical processes, e.g. contaminant degradation, plant nutrient turnover. The model successfully calculates the feedbacks between surface water, subsurface water and air in standard benchmarks. In specific model applications to heterogeneous catchments, subsurface water is driven by density variations and runs through double porous media. Software codes of water science are tightly coupled by iteration, namely the Storm Water Management Model (SWMM) for urban runoff, Expert-N for simulating water fluxes and nutrient turnover in agricultural and forested soils, and OpenGeoSys (OGS) for groundwater. The coupled model calculates flow of hydrostatic shallow water over the land surface with finite volume and difference methods. The flow equations for water in the porous subsurface are discretized in space with finite elements. Chemical components are transferred through 1D, 2D or 3D watershed representations with advection-dispersion solvers or, as an alternative, random walk particle tracking. A transport solver can be in sequence with a chemical solver, e.g. PHREEQ-C, BRNS, additionally. Besides coupled partial differential equations, the concept of hydrological response units is employed in simulations at regional scale with scarce data availability. In this case, a conceptual hydrological model, specifically the Jena Adaptable Modeling System (JAMS), passes groundwater recharge through a software interface into OGS, which solves the partial differential equations of groundwater flow. Most components of the modeling framework are open source and can be modified for individual purposes. Applications range from temperate climate regions in Germany (Ammer catchment and Hessian Ried) to arid regions in the Middle East (Oman and Dead See). Some of the presented examples originate from intensively monitored research sites of the WESS research centre and the monitoring initiative TERENO. Other examples originate from the IWAS project on integrated water resources management. The model applications are primarily concerned with groundwater resources, which are endangered by overexploitation, intrusion of saltwater, and nitrate loads.

XMDS2: Fast, scalable simulation of coupled stochastic partial differential equations

NASA Astrophysics Data System (ADS)

Dennis, Graham R.; Hope, Joseph J.; Johnsson, Mattias T.

2013-01-01

XMDS2 is a cross-platform, GPL-licensed, open source package for numerically integrating initial value problems that range from a single ordinary differential equation up to systems of coupled stochastic partial differential equations. The equations are described in a high-level XML-based script, and the package generates low-level optionally parallelised C++ code for the efficient solution of those equations. It combines the advantages of high-level simulations, namely fast and low-error development, with the speed, portability and scalability of hand-written code. XMDS2 is a complete redesign of the XMDS package, and features support for a much wider problem space while also producing faster code. Program summaryProgram title: XMDS2 Catalogue identifier: AENK_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AENK_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: GNU General Public License, version 2 No. of lines in distributed program, including test data, etc.: 872490 No. of bytes in distributed program, including test data, etc.: 45522370 Distribution format: tar.gz Programming language: Python and C++. Computer: Any computer with a Unix-like system, a C++ compiler and Python. Operating system: Any Unix-like system; developed under Mac OS X and GNU/Linux. RAM: Problem dependent (roughly 50 bytes per grid point) Classification: 4.3, 6.5. External routines: The external libraries required are problem-dependent. Uses FFTW3 Fourier transforms (used only for FFT-based spectral methods), dSFMT random number generation (used only for stochastic problems), MPI message-passing interface (used only for distributed problems), HDF5, GNU Scientific Library (used only for Bessel-based spectral methods) and a BLAS implementation (used only for non-FFT-based spectral methods). Nature of problem: General coupled initial-value stochastic partial differential equations. Solution method: Spectral method with method-of-lines integration Running time: Determined by the size of the problem

Design of ACM system based on non-greedy punctured LDPC codes

NASA Astrophysics Data System (ADS)

Lu, Zijun; Jiang, Zihong; Zhou, Lin; He, Yucheng

2017-08-01

In this paper, an adaptive coded modulation (ACM) scheme based on rate-compatible LDPC (RC-LDPC) codes was designed. The RC-LDPC codes were constructed by a non-greedy puncturing method which showed good performance in high code rate region. Moreover, the incremental redundancy scheme of LDPC-based ACM system over AWGN channel was proposed. By this scheme, code rates vary from 2/3 to 5/6 and the complication of the ACM system is lowered. Simulations show that more and more obvious coding gain can be obtained by the proposed ACM system with higher throughput.

Partial melting of a Pb-Sn mushy layer due to heating from above, and implications for regional melting of Earth's directionally solidified inner core

NASA Astrophysics Data System (ADS)

Yu, James; Bergman, Michael I.; Huguet, Ludovic; Alboussiere, Thierry

2015-09-01

Superimposed on the radial solidification of Earth's inner core may be hemispherical and/or regional patches of melting at the inner-outer core boundary. Little work has been carried out on partial melting of a dendritic mushy layer due to heating from above. Here we study directional solidification, annealing, and partial melting from above of Pb-rich Sn alloy ingots. We find that partial melting from above results in convection in the mushy layer, with dense, melted Pb sinking and resolidifying at a lower height, yielding a different density profile than for those ingots that are just directionally solidified, irrespective of annealing. Partial melting from above causes a greater density deeper down and a corresponding steeper density decrease nearer the top. There is also a change in microstructure. These observations may be in accordance with inferences of east-west and perhaps smaller-scale variations in seismic properties near the top of the inner core.

Hypersonic CFD applications for the National Aero-Space Plane

NASA Technical Reports Server (NTRS)

Richardson, Pamela F.; Mcclinton, Charles R.; Bittner, Robert D.; Dilley, A. Douglas; Edwards, Kelvin W.

1989-01-01

Design and analysis of the NASP depends heavily upon developing the critical technology areas that cover the entire engineering design of the vehicle. These areas include materials, structures, propulsion systems, propellants, integration of airframe and propulsion systems, controls, subsystems, and aerodynamics areas. Currently, verification of many of the classical engineering tools relies heavily on computational fluid dynamics. Advances are being made in the development of CFD codes to accomplish nose-to-tail analyses for hypersonic aircraft. Additional details involving the partial development, analysis, verification, and application of the CFL3D code and the SPARK combustor code are discussed. A nonequilibrium version of CFL3D that is presently being developed and tested is also described. Examples are given of portion calculations for research hypersonic aircraft geometries and comparisons with experiment data show good agreement.

NASA-VOF3D: A three-dimensional computer program for incompressible flows with free surfaces

NASA Astrophysics Data System (ADS)

Torrey, M. D.; Mjolsness, R. C.; Stein, L. R.

1987-07-01

Presented is the NASA-VOF3D three-dimensional, transient, free-surface hydrodynamics program. This three-dimensional extension of NASA-VOF2D will, in principle, permit treatment in full three-dimensional generality of the wide variety of applications that could be treated by NASA-VOF2D only within the two-dimensional idealization. In particular, it, like NASA-VOF2D, is specifically designed to calculate confined flows in a low g environment. The code is presently restricted to cylindrical geometry. The code is based on the fractional volume-of-fluid method and allows multiple free surfaces with surface tension and wall adhesion. It also has a partial cell treatment that allows curved boundaries and internal obstacles. This report provides a brief discussion of the numerical method, a code listing, and some sample problems.

Numerical and analytical bounds on threshold error rates for hypergraph-product codes

NASA Astrophysics Data System (ADS)

Kovalev, Alexey A.; Prabhakar, Sanjay; Dumer, Ilya; Pryadko, Leonid P.

2018-06-01

We study analytically and numerically decoding properties of finite-rate hypergraph-product quantum low density parity-check codes obtained from random (3,4)-regular Gallager codes, with a simple model of independent X and Z errors. Several nontrivial lower and upper bounds for the decodable region are constructed analytically by analyzing the properties of the homological difference, equal minus the logarithm of the maximum-likelihood decoding probability for a given syndrome. Numerical results include an upper bound for the decodable region from specific heat calculations in associated Ising models and a minimum-weight decoding threshold of approximately 7 % .

The complete mitochondrial genome of a spiraling whitefly, Aleurodicus dispersus Russell (Hemiptera: Aleyrodidae).

PubMed

Ming-Xing, Lu; Zhi-Teng, Chen; Wei-Wei, Yu; Yu-Zhou, Du

2017-03-01

We report the complete mitochondrial genome (mitogenome) of a spiraling whitefly, Aleurodicus dispersus (Hemiptera: Aleyrodidae). The 16 170 bp long genome consists of 13 protein-coding genes, 20 transfer RNAs, 2 ribosomal RNAs, and a control region. The A. dispersus mitogenome also includes a cytb-like non-coding region and shows several variations relative to the typical insect mitogenome. A phylogenetic tree has been constructed using the 13 protein-coding genes of 12 related species from Hemiptera. Our results would contribute to further study of phylogeny in Aleyrodidae and Hemiptera.

Molecular mapping of 21 features associated with partial monosomy 21: Involvement of the APP-SODI region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chettouh, Z.; Maunoury, C.; Sinet, P.M.

1995-07-01

We compared the phenotypes, karyotypes, and molecular data for six cases of partial monosomy 21. Regions of chromosome 21, the deletion of which corresponds to particular features of monosomy 21, were thereby defined. Five such regions were identified for 21 features. Ten of the features could be assigned to the region flanked by genes APP and SOD1: six facial features, transverse palmar crease, arthrogryposis-like symptoms, hypertonia, and contribution to mental retardation. This region, covering the interface of bands 21q21-21q22.1, is 4.7-6.4 Mb long and contains the gene encoding the glutamate receptor subunit GluR5 (GRIK1). 82 refs., 5 figs., 1 tab.

Gene Expression and Polymorphism of Myostatin Gene and its Association with Growth Traits in Chicken.

PubMed

Dushyanth, K; Bhattacharya, T K; Shukla, R; Chatterjee, R N; Sitaramamma, T; Paswan, C; Guru Vishnu, P

2016-10-01

Myostatin is a member of TGF-β super family and is directly involved in regulation of body growth through limiting muscular growth. A study was carried out in three chicken lines to identify the polymorphism in the coding region of the myostatin gene through SSCP and DNA sequencing. A total of 12 haplotypes were observed in myostatin coding region of chicken. Significant associations between haplogroups with body weight at day 1, 14, 28, and 42 days, and carcass traits at 42 days were observed across the lines. It is concluded that the coding region of myostatin gene was polymorphic, with varied levels of expression among lines and had significant effects on growth traits. The expression of MSTN gene varied during embryonic and post hatch development stage.