Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

When Genomics Is Not Enough: Experimental Evidence for a Decrease in LINE-1 Activity During the Evolution of Australian Marsupials

PubMed Central

Gallus, Susanne; Lammers, Fritjof

2016-01-01

The autonomous transposable element LINE-1 is a highly abundant element that makes up between 15% and 20% of therian mammal genomes. Since their origin before the divergence of marsupials and placental mammals, LINE-1 elements have contributed actively to the genome landscape. A previous in silico screen of the Tasmanian devil genome revealed a lack of functional coding LINE-1 sequences. In this study we present the results of an in vitro analysis from a partial LINE-1 reverse transcriptase coding sequence in five marsupial species. Our experimental screen supports the in silico findings of the genome-wide degradation of LINE-1 sequences in the Tasmanian devil, and identifies a high frequency of degraded LINE-1 sequences in other Australian marsupials. The comparison between the experimentally obtained LINE-1 sequences and reference genome assemblies suggests that conclusions from in silico analyses of retrotransposition activity can be influenced by incomplete genome assemblies from short reads. PMID:27389686

Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

PubMed

Kanai, T H; Ueda, S; Nakamura, T

2000-01-31

Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

Analysis of CHRNA7 rare variants in autism spectrum disorder susceptibility.

PubMed

Bacchelli, Elena; Battaglia, Agatino; Cameli, Cinzia; Lomartire, Silvia; Tancredi, Raffaella; Thomson, Susanne; Sutcliffe, James S; Maestrini, Elena

2015-04-01

Chromosome 15q13.3 recurrent microdeletions are causally associated with a wide range of phenotypes, including autism spectrum disorder (ASD), seizures, intellectual disability, and other psychiatric conditions. Whether the reciprocal microduplication is pathogenic is less certain. CHRNA7, encoding for the alpha7 subunit of the neuronal nicotinic acetylcholine receptor, is considered the likely culprit gene in mediating neurological phenotypes in 15q13.3 deletion cases. To assess if CHRNA7 rare variants confer risk to ASD, we performed copy number variant analysis and Sanger sequencing of the CHRNA7 coding sequence in a sample of 135 ASD cases. Sequence variation in this gene remains largely unexplored, given the existence of a fusion gene, CHRFAM7A, which includes a nearly identical partial duplication of CHRNA7. Hence, attempts to sequence coding exons must distinguish between CHRNA7 and CHRFAM7A, making next-generation sequencing approaches unreliable for this purpose. A CHRNA7 microduplication was detected in a patient with autism and moderate cognitive impairment; while no rare damaging variants were identified in the coding region, we detected rare variants in the promoter region, previously described to functionally reduce transcription. This study represents the first sequence variant analysis of CHRNA7 in a sample of idiopathic autism. © 2015 Wiley Periodicals, Inc.

Comparative genomics approach to detecting split-coding regions in a low-coverage genome: lessons from the chimaera Callorhinchus milii (Holocephali, Chondrichthyes).

PubMed

Dessimoz, Christophe; Zoller, Stefan; Manousaki, Tereza; Qiu, Huan; Meyer, Axel; Kuraku, Shigehiro

2011-09-01

Recent development of deep sequencing technologies has facilitated de novo genome sequencing projects, now conducted even by individual laboratories. However, this will yield more and more genome sequences that are not well assembled, and will hinder thorough annotation when no closely related reference genome is available. One of the challenging issues is the identification of protein-coding sequences split into multiple unassembled genomic segments, which can confound orthology assignment and various laboratory experiments requiring the identification of individual genes. In this study, using the genome of a cartilaginous fish, Callorhinchus milii, as test case, we performed gene prediction using a model specifically trained for this genome. We implemented an algorithm, designated ESPRIT, to identify possible linkages between multiple protein-coding portions derived from a single genomic locus split into multiple unassembled genomic segments. We developed a validation framework based on an artificially fragmented human genome, improvements between early and recent mouse genome assemblies, comparison with experimentally validated sequences from GenBank, and phylogenetic analyses. Our strategy provided insights into practical solutions for efficient annotation of only partially sequenced (low-coverage) genomes. To our knowledge, our study is the first formulation of a method to link unassembled genomic segments based on proteomes of relatively distantly related species as references.

Comparative genomics approach to detecting split-coding regions in a low-coverage genome: lessons from the chimaera Callorhinchus milii (Holocephali, Chondrichthyes)

PubMed Central

Zoller, Stefan; Manousaki, Tereza; Qiu, Huan; Meyer, Axel; Kuraku, Shigehiro

2011-01-01

Recent development of deep sequencing technologies has facilitated de novo genome sequencing projects, now conducted even by individual laboratories. However, this will yield more and more genome sequences that are not well assembled, and will hinder thorough annotation when no closely related reference genome is available. One of the challenging issues is the identification of protein-coding sequences split into multiple unassembled genomic segments, which can confound orthology assignment and various laboratory experiments requiring the identification of individual genes. In this study, using the genome of a cartilaginous fish, Callorhinchus milii, as test case, we performed gene prediction using a model specifically trained for this genome. We implemented an algorithm, designated ESPRIT, to identify possible linkages between multiple protein-coding portions derived from a single genomic locus split into multiple unassembled genomic segments. We developed a validation framework based on an artificially fragmented human genome, improvements between early and recent mouse genome assemblies, comparison with experimentally validated sequences from GenBank, and phylogenetic analyses. Our strategy provided insights into practical solutions for efficient annotation of only partially sequenced (low-coverage) genomes. To our knowledge, our study is the first formulation of a method to link unassembled genomic segments based on proteomes of relatively distantly related species as references. PMID:21712341

Compact representations of partially coherent undulator radiation suitable for wave propagation

DOE PAGES

Lindberg, Ryan R.; Kim, Kwang -Je

2015-09-28

Undulator radiation is partially coherent in the transverse plane, with the degree of coherence depending on the ratio of the electron beam phase space area (emittance) to the characteristic radiation wavelength λ. Numerical codes used to predict x-ray beam line performance can typically only propagate coherent fields from the source to the image plane. We investigate methods for representing partially coherent undulator radiation using a suitably chosen set of coherent fields that can be used in standard wave propagation codes, and discuss such “coherent mode expansions” for arbitrary degrees of coherence. In the limit when the electron beam emittance alongmore » at least one direction is much larger than λ the coherent modes are orthogonal and therefore compact; when the emittance approaches λ in both planes we discuss an economical method of defining the relevant coherent fields that samples the electron beam phase space using low-discrepancy sequences.« less

Why barcode? High-throughput multiplex sequencing of mitochondrial genomes for molecular systematics.

PubMed

Timmermans, M J T N; Dodsworth, S; Culverwell, C L; Bocak, L; Ahrens, D; Littlewood, D T J; Pons, J; Vogler, A P

2010-11-01

Mitochondrial genome sequences are important markers for phylogenetics but taxon sampling remains sporadic because of the great effort and cost required to acquire full-length sequences. Here, we demonstrate a simple, cost-effective way to sequence the full complement of protein coding mitochondrial genes from pooled samples using the 454/Roche platform. Multiplexing was achieved without the need for expensive indexing tags ('barcodes'). The method was trialled with a set of long-range polymerase chain reaction (PCR) fragments from 30 species of Coleoptera (beetles) sequenced in a 1/16th sector of a sequencing plate. Long contigs were produced from the pooled sequences with sequencing depths ranging from ∼10 to 100× per contig. Species identity of individual contigs was established via three 'bait' sequences matching disparate parts of the mitochondrial genome obtained by conventional PCR and Sanger sequencing. This proved that assembly of contigs from the sequencing pool was correct. Our study produced sequences for 21 nearly complete and seven partial sets of protein coding mitochondrial genes. Combined with existing sequences for 25 taxa, an improved estimate of basal relationships in Coleoptera was obtained. The procedure could be employed routinely for mitochondrial genome sequencing at the species level, to provide improved species 'barcodes' that currently use the cox1 gene only.

Molecular cloning and evolutionary analysis of the calcium-modulated contractile protein, centrin, in green algae and land plants.

PubMed

Bhattacharya, D; Steinkötter, J; Melkonian, M

1993-12-01

Centrin (= caltractin) is a ubiquitous, cytoskeletal protein which is a member of the EF-hand superfamily of calcium-binding proteins. A centrin-coding cDNA was isolated and characterized from the prasinophyte green alga Scherffelia dubia. Centrin PCR amplification primers were used to isolate partial, homologous cDNA sequences from the green algae Tetraselmis striata and Spermatozopsis similis. Annealing analyses suggested that centrin is a single-copy-coding region in T. striata and S. similis and other green algae studied. Centrin-coding regions from S. dubia, S. similis and T. striata encode four colinear EF-hand domains which putatively bind calcium. Phylogenetic analyses, including homologous sequences from Chlamydomonas reinhardtii and the land plant Atriplex nummularia, demonstrate that the domains of centrins are congruent and arose from the two-fold duplication of an ancestral EF hand with Domains 1+3 and Domains 2+4 clustering. The domains of centrins are also congruent with those of calmodulins demonstrating that, like calmodulin, centrin is an ancient protein which arose within the ancestor of all eukaryotes via gene duplication. Phylogenetic relationships inferred from centrin-coding region comparisons mirror results of small subunit ribosomal RNA sequence analyses suggesting that centrin-coding regions are useful evolutionary markers within the green algae.

Delineating slowly and rapidly evolving fractions of the Drosophila genome.

PubMed

Keith, Jonathan M; Adams, Peter; Stephen, Stuart; Mattick, John S

2008-05-01

Evolutionary conservation is an important indicator of function and a major component of bioinformatic methods to identify non-protein-coding genes. We present a new Bayesian method for segmenting pairwise alignments of eukaryotic genomes while simultaneously classifying segments into slowly and rapidly evolving fractions. We also describe an information criterion similar to the Akaike Information Criterion (AIC) for determining the number of classes. Working with pairwise alignments enables detection of differences in conservation patterns among closely related species. We analyzed three whole-genome and three partial-genome pairwise alignments among eight Drosophila species. Three distinct classes of conservation level were detected. Sequences comprising the most slowly evolving component were consistent across a range of species pairs, and constituted approximately 62-66% of the D. melanogaster genome. Almost all (>90%) of the aligned protein-coding sequence is in this fraction, suggesting much of it (comprising the majority of the Drosophila genome, including approximately 56% of non-protein-coding sequences) is functional. The size and content of the most rapidly evolving component was species dependent, and varied from 1.6% to 4.8%. This fraction is also enriched for protein-coding sequence (while containing significant amounts of non-protein-coding sequence), suggesting it is under positive selection. We also classified segments according to conservation and GC content simultaneously. This analysis identified numerous sub-classes of those identified on the basis of conservation alone, but was nevertheless consistent with that classification. Software, data, and results available at www.maths.qut.edu.au/-keithj/. Genomic segments comprising the conservation classes available in BED format.

The mitochondrial genome of Polistes jokahamae and a phylogenetic analysis of the Vespoidea (Insecta: Hymenoptera).

PubMed

Song, Sheng-Nan; Chen, Peng-Yan; Wei, Shu-Jun; Chen, Xue-Xin

2016-07-01

The mitochondrial genome sequence of Polistes jokahamae (Radoszkowski, 1887) (Hymenoptera: Vespidae) (GenBank accession no. KR052468) was sequenced. The current length with partial A + T-rich region of this mitochondrial genome is 16,616 bp. All the typical mitochondrial genes were sequenced except for three tRNAs (trnI, trnQ, and trnY) located between the A + T-rich region and nad2. At least three rearrangement events occurred in the sequenced region compared with the pupative ancestral arrangement of insects, corresponding to the shuffling of trnK and trnD, translocation or remote inversion of tnnY and translocation of trnL1. All protein-coding genes start with ATN codons. Eleven, one, and another one protein-coding genes stop with termination codon TAA, TA, and T, respectively. Phylogenetic analysis using the Bayesian method based on all codon positions of the 13 protein-coding genes supports the monophyly of Vespidae and Formicidae. Within the Formicidae, the Myrmicinae and Formicinae form a sister lineage and then sister to the Dolichoderinae, while within the Vespidae, the Eumeninae is sister to the lineage of Vespinae + Polistinae.

Chromosomal localization and partial genomic structure of the human peroxisome proliferator activated receptor-gamma (hPPAR gamma) gene.

PubMed

Beamer, B A; Negri, C; Yen, C J; Gavrilova, O; Rumberger, J M; Durcan, M J; Yarnall, D P; Hawkins, A L; Griffin, C A; Burns, D K; Roth, J; Reitman, M; Shuldiner, A R

1997-04-28

We determined the chromosomal localization and partial genomic structure of the coding region of the human PPAR gamma gene (hPPAR gamma), a nuclear receptor important for adipocyte differentiation and function. Sequence analysis and long PCR of human genomic DNA with primers that span putative introns revealed that intron positions and sizes of hPPAR gamma are similar to those previously determined for the mouse PPAR gamma gene[13]. Fluorescent in situ hybridization localized hPPAR gamma to chromosome 3, band 3p25. Radiation hybrid mapping with two independent primer pairs was consistent with hPPAR gamma being within 1.5 Mb of marker D3S1263 on 3p25-p24.2. These sequences of the intron/exon junctions of the 6 coding exons shared by hPPAR gamma 1 and hPPAR gamma 2 will facilitate screening for possible mutations. Furthermore, D3S1263 is a suitable polymorphic marker for linkage analysis to evaluate PPAR gamma's potential contribution to genetic susceptibility to obesity, lipoatrophy, insulin resistance, and diabetes.

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals.

PubMed

Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M

2017-01-01

Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.

Ovine mitochondrial DNA sequence variation and its association with production and reproduction traits within an Afec-Assaf flock.

PubMed

Reicher, S; Seroussi, E; Weller, J I; Rosov, A; Gootwine, E

2012-07-01

Polymorphisms in mitochondrial DNA (mtDNA) protein- and tRNA-coding genes were shown to be associated with various diseases in humans as well as with production and reproduction traits in livestock. Alignment of full length mitochondria sequences from the 5 known ovine haplogroups: HA (n = 3), HB (n = 5), HC (n = 3), HD (n = 2), and HE (n = 2; GenBank accession nos. HE577847-50 and 11 published complete ovine mitochondria sequences) revealed sequence variation in 10 out of the 13 protein coding mtDNA sequences. Twenty-six of the 245 variable sites found in the protein coding sequences represent non-synonymous mutations. Sequence variation was observed also in 8 out of the 22 tRNA mtDNA sequences. On the basis of the mtDNA control region and cytochrome b partial sequences along with information on maternal lineages within an Afec-Assaf flock, 1,126 Afec-Assaf ewes were assigned to mitochondrial haplogroups HA, HB, and HC, with frequencies of 0.43, 0.43, and 0.14, respectively. Analysis of birth weight and growth rate records of lamb (n = 1286) and productivity from 4,993 lambing records revealed no association between mitochondrial haplogroup affiliation and female longevity, lambs perinatal survival rate, birth weight, and daily growth rate of lambs up to 150 d that averaged 1,664 d, 88.3%, 4.5 kg, and 320 g/d, respectively. However, significant (P < 0.0001) differences among the haplogroups were found for prolificacy of ewes, with prolificacies (mean ± SE) of 2.14 ± 0.04, 2.25 ± 0.04, and 2.30 ± 0.06 lamb born/ewe lambing for the HA, HB, and the HC haplogroups, respectively. Our results highlight the ovine mitogenome genetic variation in protein- and tRNA coding genes and suggest that sequence variation in ovine mtDNA is associated with variation in ewe prolificacy.

Optimization of a matched-filter receiver for frequency hopping code acquisition in jamming

NASA Astrophysics Data System (ADS)

Pawlowski, P. R.; Polydoros, A.

A matched-filter receiver for frequency hopping (FH) code acquisition is optimized when either partial-band tone jamming or partial-band Gaussian noise jamming is present. The receiver is matched to a segment of the FH code sequence, sums hard per-channel decisions to form a test, and uses multiple tests to verify acquisition. The length of the matched filter and the number of verification tests are fixed. Optimization is then choosing thresholds to maximize performance based upon the receiver's degree of knowledge about the jammer ('side-information'). Four levels of side-information are considered, ranging from none to complete. The latter level results in a constant-false-alarm-rate (CFAR) design. At each level, performance sensitivity to threshold choice is analyzed. Robust thresholds are chosen to maximize performance as the jammer varies its power distribution, resulting in simple design rules which aid threshold selection. Performance results, which show that optimum distributions for the jammer power over the total FH bandwidth exist, are presented.

The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

PubMed

Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

2018-05-17

Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

PubMed Central

Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

2006-01-01

Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

The nearly complete mitochondrial genome of a stonefly species, Styloperla sp. (Plecoptera: Styloperlidae).

PubMed

Chen, Zhi-Teng; Wu, Hai-Yan; Du, Yu-Zhou

2016-07-01

We report the nearly complete mitochondrial genome of a stonefly species, Styloperla sp. (Plecoptera: Styloperlidae), which is a circular molecule of 15,416 bp in length and consists of 13 protein-coding genes, 2 ribosomal RNAs, 20 transfer RNAs and a partial control region (645 bp). Using the 13 protein-coding genes of 8 stoneflies and 3 other related species, we constructed a phylogenetic tree to verify the accuracy of the new determined mitogenome sequences. Our results provide basic data for further study of phylogeny in Plecoptera.

Complete mitochondrial genome of the versicoloured emerald hummingbird Amazilia versicolor, a polymorphic species.

PubMed

Prosdocimi, Francisco; Souto, Helena Magarinos; Ruschi, Piero Angeli; Furtado, Carolina; Jennings, W Bryan

2016-09-01

The genome of the versicoloured emerald hummingbird (Amazilia versicolor) was partially sequenced in one-sixth of an Illumina HiSeq lane. The mitochondrial genome was assembled using MIRA and MITObim software, yielding a circular molecule of 16,861 bp in length and deposited in GenBank under the accession number KF624601. The mitogenome contained 13 protein-coding genes, 22 transfer tRNAs, 2 ribosomal RNAs and 1 non-coding control region. The molecule was assembled using 21,927 sequencing reads of 100 bp each, resulting in ∼130 × coverage of uniformly distributed reads along the genome. This is the forth mitochondrial genome described for this highly diverse family of birds and may benefit further phylogenetic, phylogeographic, population genetic and species delimitation studies of hummingbirds.

Partial genome sequence of Thioalkalivibrio thiocyanodenitrificans ARhD 1 T, a chemolithoautotrophic haloalkaliphilic sulfur-oxidizing bacterium capable of complete denitrification

DOE PAGES

Berben, Tom; Sorokin, Dimitry Y.; Ivanova, Natalia; ...

2015-10-26

Thioalkalivibrio thiocyanodenitrificans strain ARhD 1 T is a motile, Gram-negative bacterium isolated from soda lakes that belongs to the Gammaproteobacteria. It derives energy for growth and carbon fixation from the oxidation of sulfur compounds, most notably thiocyanate, and so is a chemolithoautotroph. It is capable of complete denitrification under anaerobic conditions. In addition, the draft genome sequence consists of 3,746,647 bp in 3 scaffolds, containing 3558 protein-coding and 121 RNA genes. T. thiocyanodenitrificans ARhD 1 T was sequenced as part of the DOE Joint Genome Institute Community Science Program.

Improved purification, crystallization and primary structure of pyruvate:ferredoxin oxidoreductase from Halobacterium halobium.

PubMed

Plaga, W; Lottspeich, F; Oesterhelt, D

1992-04-01

An improved purification procedure, including nickel chelate affinity chromatography, is reported which resulted in a crystallizable pyruvate:ferredoxin oxidoreductase preparation from Halobacterium halobium. Crystals of the enzyme were obtained using potassium citrate as the precipitant. The genes coding for pyruvate:ferredoxin oxidoreductase were cloned and their nucleotide sequences determined. The genes of both subunits were adjacent to one another on the halobacterial genome. The derived amino acid sequences were confirmed by partial primary structure analysis of the purified protein. The structural motif of thiamin-diphosphate-binding enzymes was unequivocally located in the deduced amino acid sequence of the small subunit.

Maximum-likelihood soft-decision decoding of block codes using the A* algorithm

NASA Technical Reports Server (NTRS)

Ekroot, L.; Dolinar, S.

1994-01-01

The A* algorithm finds the path in a finite depth binary tree that optimizes a function. Here, it is applied to maximum-likelihood soft-decision decoding of block codes where the function optimized over the codewords is the likelihood function of the received sequence given each codeword. The algorithm considers codewords one bit at a time, making use of the most reliable received symbols first and pursuing only the partially expanded codewords that might be maximally likely. A version of the A* algorithm for maximum-likelihood decoding of block codes has been implemented for block codes up to 64 bits in length. The efficiency of this algorithm makes simulations of codes up to length 64 feasible. This article details the implementation currently in use, compares the decoding complexity with that of exhaustive search and Viterbi decoding algorithms, and presents performance curves obtained with this implementation of the A* algorithm for several codes.

Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

PubMed Central

Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

2013-01-01

Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

Parallel evolution of chordate cis-regulatory code for development.

PubMed

Doglio, Laura; Goode, Debbie K; Pelleri, Maria C; Pauls, Stefan; Frabetti, Flavia; Shimeld, Sebastian M; Vavouri, Tanya; Elgar, Greg

2013-11-01

Urochordates are the closest relatives of vertebrates and at the larval stage, possess a characteristic bilateral chordate body plan. In vertebrates, the genes that orchestrate embryonic patterning are in part regulated by highly conserved non-coding elements (CNEs), yet these elements have not been identified in urochordate genomes. Consequently the evolution of the cis-regulatory code for urochordate development remains largely uncharacterised. Here, we use genome-wide comparisons between C. intestinalis and C. savignyi to identify putative urochordate cis-regulatory sequences. Ciona conserved non-coding elements (ciCNEs) are associated with largely the same key regulatory genes as vertebrate CNEs. Furthermore, some of the tested ciCNEs are able to activate reporter gene expression in both zebrafish and Ciona embryos, in a pattern that at least partially overlaps that of the gene they associate with, despite the absence of sequence identity. We also show that the ability of a ciCNE to up-regulate gene expression in vertebrate embryos can in some cases be localised to short sub-sequences, suggesting that functional cross-talk may be defined by small regions of ancestral regulatory logic, although functional sub-sequences may also be dispersed across the whole element. We conclude that the structure and organisation of cis-regulatory modules is very different between vertebrates and urochordates, reflecting their separate evolutionary histories. However, functional cross-talk still exists because the same repertoire of transcription factors has likely guided their parallel evolution, exploiting similar sets of binding sites but in different combinations.

Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

NASA Astrophysics Data System (ADS)

Sun, S. M.; Slightom, J. L.; Hall, T. C.

1981-01-01

A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

Analysis of the complete genome of the first Irkut virus isolate from China: comparison across the Lyssavirus genus.

PubMed

Liu, Ye; Li, Nan; Zhang, Shoufeng; Zhang, Fei; Lian, Hai; Wang, Ying; Zhang, Jinxia; Hu, Rongliang

2013-12-01

The genome of Irkut virus, isolate IRKV-THChina12, the first non-rabies lyssavirus from China (of bat origin), has been completely sequenced. In general, coding and non-coding regions of this viral genome are similar to those of other lyssaviruses. However, alignment of the deduced amino acid sequences of the structural proteins of IRKV-THChina12 with those of other lyssavirus representatives revealed significant variability between viral species. The nucleoprotein and matrix protein were found to be the most conserved, followed by the large protein, glycoprotein and phosphoprotein. Differences in the antigenic sites in glycoprotein may result in only partial protection of the available rabies biologics against Irkut virus, which is of particular concern for pre- and post-exposure rabies prophylaxis. Copyright © 2013 Elsevier Inc. All rights reserved.

In-depth characterization of breast cancer tumor-promoting cell transcriptome by RNA sequencing and microarrays

PubMed Central

Soldà, Giulia; Merlino, Giuseppe; Fina, Emanuela; Brini, Elena; Moles, Anna; Cappelletti, Vera; Daidone, Maria Grazia

2016-01-01

Numerous studies have reported the existence of tumor-promoting cells (TPC) with self-renewal potential and a relevant role in drug resistance. However, pathways and modifications involved in the maintenance of such tumor subpopulations are still only partially understood. Sequencing-based approaches offer the opportunity for a detailed study of TPC including their transcriptome modulation. Using microarrays and RNA sequencing approaches, we compared the transcriptional profiles of parental MCF7 breast cancer cells with MCF7-derived TPC (i.e. MCFS). Data were explored using different bioinformatic approaches, and major findings were experimentally validated. The different analytical pipelines (Lifescope and Cufflinks based) yielded similar although not identical results. RNA sequencing data partially overlapped microarray results and displayed a higher dynamic range, although overall the two approaches concordantly predicted pathway modifications. Several biological functions were altered in TPC, ranging from production of inflammatory cytokines (i.e., IL-8 and MCP-1) to proliferation and response to steroid hormones. More than 300 non-coding RNAs were defined as differentially expressed, and 2,471 potential splicing events were identified. A consensus signature of genes up-regulated in TPC was derived and was found to be significantly associated with insensitivity to fulvestrant in a public breast cancer patient dataset. Overall, we obtained a detailed portrait of the transcriptome of a breast cancer TPC line, highlighted the role of non-coding RNAs and differential splicing, and identified a gene signature with a potential as a context-specific biomarker in patients receiving endocrine treatment. PMID:26556871

FrameD: A flexible program for quality check and gene prediction in prokaryotic genomes and noisy matured eukaryotic sequences.

PubMed

Schiex, Thomas; Gouzy, Jérôme; Moisan, Annick; de Oliveira, Yannick

2003-07-01

We describe FrameD, a program that predicts coding regions in prokaryotic and matured eukaryotic sequences. Initially targeted at gene prediction in bacterial GC rich genomes, the gene model used in FrameD also allows to predict genes in the presence of frameshifts and partially undetermined sequences which makes it also very suitable for gene prediction and frameshift correction in unfinished sequences such as EST and EST cluster sequences. Like recent eukaryotic gene prediction programs, FrameD also includes the ability to take into account protein similarity information both in its prediction and its graphical output. Its performances are evaluated on different bacterial genomes. The web site (http://genopole.toulouse.inra.fr/bioinfo/FrameD/FD) allows direct prediction, sequence correction and translation and the ability to learn new models for new organisms.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene

PubMed Central

Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281

Preparation of highly multiplexed small RNA sequencing libraries.

PubMed

Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos

2017-08-01

MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.

24 CFR 200.926c - Model code provisions for use in partially accepted code jurisdictions.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Minimum Property Standards § 200.926c Model code provisions for use in partially accepted code... partially accepted, then the properties eligible for HUD benefits in that jurisdiction shall be constructed..., those portions of one of the model codes with which the property must comply. Schedule for Model Code...

24 CFR 200.926c - Model code provisions for use in partially accepted code jurisdictions.

Code of Federal Regulations, 2011 CFR

2011-04-01

... Minimum Property Standards § 200.926c Model code provisions for use in partially accepted code... partially accepted, then the properties eligible for HUD benefits in that jurisdiction shall be constructed..., those portions of one of the model codes with which the property must comply. Schedule for Model Code...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerr, J.M.; Fisher, L.W.; Termine, J.D.

The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less

Complete Genomic Sequence and Comparative Analysis of the Genome Segments of Sweet Potato Chlorotic Stunt Virus in China

PubMed Central

Qin, Yanhong; Wang, Li; Zhang, Zhenchen; Qiao, Qi; Zhang, Desheng; Tian, Yuting; Wang, Shuang; Wang, Yongjiang; Yan, Zhaoling

2014-01-01

Background Sweet potato chlorotic stunt virus (family Closteroviridae, genus Crinivirus) features a large bipartite, single-stranded, positive-sense RNA genome. To date, only three complete genomic sequences of SPCSV can be accessed through GenBank. SPCSV was first detected from China in 2011, only partial genomic sequences have been determined in the country. No report on the complete genomic sequence and genome structure of Chinese SPCSV isolates or the genetic relation between isolates from China and other countries is available. Methodology/Principal Findings The complete genomic sequences of five isolates from different areas in China were characterized. This study is the first to report the complete genome sequences of SPCSV from whitefly vectors. Genome structure analysis showed that isolates of WA and EA strains from China have the same coding protein as isolates Can181-9 and m2-47, respectively. Twenty cp genes and four RNA1 partial segments were sequenced and analyzed, and the nucleotide identities of complete genomic, cp, and RNA1 partial sequences were determined. Results indicated high conservation among strains and significant differences between WA and EA strains. Genetic analysis demonstrated that, except for isolates from Guangdong Province, SPCSVs from other areas belong to the WA strain. Genome organization analysis showed that the isolates in this study lack the p22 gene. Conclusions/Significance We presented the complete genome sequences of SPCSV in China. Comparison of nucleotide identities and genome structures between these isolates and previously reported isolates showed slight differences. The nucleotide identities of different SPCSV isolates showed high conservation among strains and significant differences between strains. All nine isolates in this study lacked p22 gene. WA strains were more extensively distributed than EA strains in China. These data provide important insights into the molecular variation and genomic structure of SPCSV in China as well as genetic relationships among isolates from China and other countries. PMID:25170926

GRIL-seq provides a method for identifying direct targets of bacterial small regulatory RNA by in vivo proximity ligation.

PubMed

Han, Kook; Tjaden, Brian; Lory, Stephen

2016-12-22

The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique, referred to as global small non-coding RNA target identification by ligation and sequencing (GRIL-seq), is based on preferential ligation of sRNAs to the ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimaeras. In addition to the RNA chaperone Hfq, the GRIL-seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrated that direct regulatory targets of this sRNA can readily be identified. Therefore, GRIL-seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but also for uncovering novel roles for sRNAs and their targets in complex regulatory networks.

The pig X and Y Chromosomes: structure, sequence, and evolution

PubMed Central

Skinner, Benjamin M.; Sargent, Carole A.; Churcher, Carol; Hunt, Toby; Herrero, Javier; Loveland, Jane E.; Dunn, Matt; Louzada, Sandra; Fu, Beiyuan; Chow, William; Gilbert, James; Austin-Guest, Siobhan; Beal, Kathryn; Carvalho-Silva, Denise; Cheng, William; Gordon, Daria; Grafham, Darren; Hardy, Matt; Harley, Jo; Hauser, Heidi; Howden, Philip; Howe, Kerstin; Lachani, Kim; Ellis, Peter J.I.; Kelly, Daniel; Kerry, Giselle; Kerwin, James; Ng, Bee Ling; Threadgold, Glen; Wileman, Thomas; Wood, Jonathan M.D.; Yang, Fengtang; Harrow, Jen; Affara, Nabeel A.; Tyler-Smith, Chris

2016-01-01

We have generated an improved assembly and gene annotation of the pig X Chromosome, and a first draft assembly of the pig Y Chromosome, by sequencing BAC and fosmid clones from Duroc animals and incorporating information from optical mapping and fiber-FISH. The X Chromosome carries 1033 annotated genes, 690 of which are protein coding. Gene order closely matches that found in primates (including humans) and carnivores (including cats and dogs), which is inferred to be ancestral. Nevertheless, several protein-coding genes present on the human X Chromosome were absent from the pig, and 38 pig-specific X-chromosomal genes were annotated, 22 of which were olfactory receptors. The pig Y-specific Chromosome sequence generated here comprises 30 megabases (Mb). A 15-Mb subset of this sequence was assembled, revealing two clusters of male-specific low copy number genes, separated by an ampliconic region including the HSFY gene family, which together make up most of the short arm. Both clusters contain palindromes with high sequence identity, presumably maintained by gene conversion. Many of the ancestral X-related genes previously reported in at least one mammalian Y Chromosome are represented either as active genes or partial sequences. This sequencing project has allowed us to identify genes—both single copy and amplified—on the pig Y Chromosome, to compare the pig X and Y Chromosomes for homologous sequences, and thereby to reveal mechanisms underlying pig X and Y Chromosome evolution. PMID:26560630

Learning of spatio-temporal codes in a coupled oscillator system.

PubMed

Orosz, Gábor; Ashwin, Peter; Townley, Stuart

2009-07-01

In this paper, we consider a learning strategy that allows one to transmit information between two coupled phase oscillator systems (called teaching and learning systems) via frequency adaptation. The dynamics of these systems can be modeled with reference to a number of partially synchronized cluster states and transitions between them. Forcing the teaching system by steady but spatially nonhomogeneous inputs produces cyclic sequences of transitions between the cluster states, that is, information about inputs is encoded via a "winnerless competition" process into spatio-temporal codes. The large variety of codes can be learned by the learning system that adapts its frequencies to those of the teaching system. We visualize the dynamics using "weighted order parameters (WOPs)" that are analogous to "local field potentials" in neural systems. Since spatio-temporal coding is a mechanism that appears in olfactory systems, the developed learning rules may help to extract information from these neural ensembles.

Surface micromachined counter-meshing gears discrimination device

DOEpatents

Polosky, Marc A.; Garcia, Ernest J.; Allen, James J.

2000-12-12

A surface micromachined Counter-Meshing Gears (CMG) discrimination device which functions as a mechanically coded lock. Each of two CMG has a first portion of its perimeter devoted to continuous driving teeth that mesh with respective pinion gears. Each EMG also has a second portion of its perimeter devoted to regularly spaced discrimination gear teeth that extend outwardly on at least one of three levels of the CMG. The discrimination gear teeth are designed so as to pass each other without interference only if the correct sequence of partial rotations of the CMG occurs in response to a coded series of rotations from the pinion gears. A 24 bit code is normally input to unlock the device. Once unlocked, the device provides a path for an energy or information signal to pass through the device. The device is designed to immediately lock up if any portion of the 24 bit code is incorrect.

Molecular detection of bovine Noroviruses in Argentinean dairy calves: Circulation of a tentative new genotype.

PubMed

Ferragut, Fátima; Vega, Celina G; Mauroy, Axel; Conceição-Neto, Nádia; Zeller, Mark; Heylen, Elisabeth; Uriarte, Enrique Louge; Bilbao, Gladys; Bok, Marina; Matthijnssens, Jelle; Thiry, Etienne; Badaracco, Alejandra; Parreño, Viviana

2016-06-01

Bovine noroviruses are enteric pathogens detected in fecal samples of both diarrheic and non-diarrheic calves from several countries worldwide. However, epidemiological information regarding bovine noroviruses is still lacking for many important cattle producing countries from South America. In this study, three bovine norovirus genogroup III sequences were determined by conventional RT-PCR and Sanger sequencing in feces from diarrheic dairy calves from Argentina (B4836, B4848, and B4881, all collected in 2012). Phylogenetic studies based on a partial coding region for the RNA-dependent RNA polymerase (RdRp, 503 nucleotides) of these three samples suggested that two of them (B4836 and B4881) belong to genotype 2 (GIII.2) while the third one (B4848) was more closely related to genotype 1 (GIII.1) strains. By deep sequencing, the capsid region from two of these strains could be determined. This confirmed the circulation of genotype 1 (B4848) together with the presence of another sequence (B4881) sharing its highest genetic relatedness with genotype 1, but sufficiently distant to constitute a new genotype. This latter strain was shown in silico to be a recombinant: phylogenetic divergence was detected between its RNA-dependent RNA polymerase coding sequence (genotype GIII.2) and its capsid protein coding sequence (genotype GIII.1 or a potential norovirus genotype). According to this data, this strain could be the second genotype GIII.2_GIII.1 bovine norovirus recombinant described in literature worldwide. Further analysis suggested that this strain could even be a potential norovirus GIII genotype, tentatively named GIII.4. The data provides important epidemiological and evolutionary information on bovine noroviruses circulating in South America. Copyright © 2016. Published by Elsevier B.V.

Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

PubMed

Hu, B; Li, J; Yu, W; Fang, J

1993-01-01

Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

Localization of the lysine epsilon-aminotransferase (lat) and delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase (pcbAB) genes from Streptomyces clavuligerus and production of lysine epsilon-aminotransferase activity in Escherichia coli.

PubMed Central

Tobin, M B; Kovacevic, S; Madduri, K; Hoskins, J A; Skatrud, P L; Vining, L C; Stuttard, C; Miller, J R

1991-01-01

Lysine epsilon-aminotransferase (LAT) in the beta-lactam-producing actinomycetes is considered to be the first step in the antibiotic biosynthetic pathway. Cloning of restriction fragments from Streptomyces clavuligerus, a beta-lactam producer, into Streptomyces lividans, a nonproducer that lacks LAT activity, led to the production of LAT in the host. DNA sequencing of restriction fragments containing the putative lat gene revealed a single open reading frame encoding a polypeptide with an approximately Mr 49,000. Expression of this coding sequence in Escherichia coli led to the production of LAT activity. Hence, LAT activity in S. clavuligerus is derived from a single polypeptide. A second open reading frame began immediately downstream from lat. Comparison of this partial sequence with the sequences of delta-(L-alpha-aminoadipyl)-L-cysteinyl-D valine (ACV) synthetases from Penicillium chrysogenum and Cephalosporium acremonium and with nonribosomal peptide synthetases (gramicidin S and tyrocidine synthetases) found similarities among the open reading frames. Since mapping of the putative N and C termini of S. clavuligerus pcbAB suggests that the coding region occupies approximately 12 kbp and codes for a polypeptide related in size to the fungal ACV synthetases, the molecular characterization of the beta-lactam biosynthetic cluster between pcbC and cefE (approximately 25 kbp) is nearly complete. Images PMID:1917855

Sparse orthogonal population representation of spatial context in the retrosplenial cortex.

PubMed

Mao, Dun; Kandler, Steffen; McNaughton, Bruce L; Bonin, Vincent

2017-08-15

Sparse orthogonal coding is a key feature of hippocampal neural activity, which is believed to increase episodic memory capacity and to assist in navigation. Some retrosplenial cortex (RSC) neurons convey distributed spatial and navigational signals, but place-field representations such as observed in the hippocampus have not been reported. Combining cellular Ca 2+ imaging in RSC of mice with a head-fixed locomotion assay, we identified a population of RSC neurons, located predominantly in superficial layers, whose ensemble activity closely resembles that of hippocampal CA1 place cells during the same task. Like CA1 place cells, these RSC neurons fire in sequences during movement, and show narrowly tuned firing fields that form a sparse, orthogonal code correlated with location. RSC 'place' cell activity is robust to environmental manipulations, showing partial remapping similar to that observed in CA1. This population code for spatial context may assist the RSC in its role in memory and/or navigation.Neurons in the retrosplenial cortex (RSC) encode spatial and navigational signals. Here the authors use calcium imaging to show that, similar to the hippocampus, RSC neurons also encode place cell-like activity in a sparse orthogonal representation, partially anchored to the allocentric cues on the linear track.

Comparative sequence analysis of acid sensitive/resistance proteins in Escherichia coli and Shigella flexneri

PubMed Central

Manikandan, Selvaraj; Balaji, Seetharaaman; Kumar, Anil; Kumar, Rita

2007-01-01

The molecular basis for the survival of bacteria under extreme conditions in which growth is inhibited is a question of great current interest. A preliminary study was carried out to determine residue pattern conservation among the antiporters of enteric bacteria, responsible for extreme acid sensitivity especially in Escherichia coli and Shigella flexneri. Here we found the molecular evidence that proved the relationship between E. coli and S. flexneri. Multiple sequence alignment of the gadC coded acid sensitive antiporter showed many conserved residue patterns at regular intervals at the N-terminal region. It was observed that as the alignment approaches towards the C-terminal, the number of conserved residues decreases, indicating that the N-terminal region of this protein has much active role when compared to the carboxyl terminal. The motif, FHLVFFLLLGG, is well conserved within the entire gadC coded protein at the amino terminal. The motif is also partially conserved among other antiporters (which are not coded by gadC) but involved in acid sensitive/resistance mechanism. Phylogenetic cluster analysis proves the relationship of Escherichia coli and Shigella flexneri. The gadC coded proteins are converged as a clade and diverged from other antiporters belongs to the amino acid-polyamine-organocation (APC) superfamily. PMID:21670792

Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens).

PubMed

Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei

2016-08-01

Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin.

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius)

PubMed Central

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-01-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus. Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research (FSHR and LHR) as well as reproduction-linked polymorphisms and breeding programs. PMID:27844002

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius).

PubMed

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-06-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus . Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research ( FSHR and LHR ) as well as reproduction-linked polymorphisms and breeding programs.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

Molecular homogeneity of heat-stable enterotoxins produced by bovine enterotoxigenic Escherichia coli.

PubMed Central

Saeed, A M; Magnuson, N S; Sriranganathan, N; Burger, D; Cosand, W

1984-01-01

Heat-stable enterotoxins (STs) from four strains of bovine enterotoxigenic Escherichia coli representing four serogroups were purified to homogeneity by utilizing previously published purification schemata. Biochemical characterization of the purified STs showed that they met the basic criteria for the heat-stable enterotoxins of E. coli. Amino acid analysis of the purified STs revealed that they were peptides of identical amino acid composition. This composition consisted of 18 residues of 10 different amino acids, 6 of which were cysteine. The amino acid composition of the four ST peptides was identical to that reported for the STs of human and porcine E. coli. In addition, complete sequence analysis of two of the ST peptides and partial sequencing of several others revealed strong homology to the sequences of STs from human and porcine E. coli and to the sequence predicted from the last 18 codons of the transposon Tn1681. There was also substantial homology to the sequence predicted from the ST-coding genetic element of human E. coli, which may indicate the existence of identical bioactive configuration among ST peptides of E. coli strains of various host origins. These data support the hypothesis that STs produced by human, bovine, and porcine E. coli are coded by a closely related genetic element which may have originated from a single, widely disseminated transposon. Images PMID:6376355

TCOF1 gene encodes a putative nucleolar phosphoprotein that exhibits mutations in Treacher Collins Syndrome throughout its coding region.

PubMed

Wise, C A; Chiang, L C; Paznekas, W A; Sharma, M; Musy, M M; Ashley, J A; Lovett, M; Jabs, E W

1997-04-01

Treacher Collins Syndrome (TCS) is the most common of the human mandibulofacial dysostosis disorders. Recently, a partial TCOF1 cDNA was identified and shown to contain mutations in TCS families. Here we present the entire exon/intron genomic structure and the complete coding sequence of TCOF1. TCOF1 encodes a low complexity protein of 1,411 amino acids, whose predicted protein structure reveals repeated motifs that mirror the organization of its exons. These motifs are shared with nucleolar trafficking proteins in other species and are predicted to be highly phosphorylated by casein kinase. Consistent with this, the full-length TCOF1 protein sequence also contains putative nuclear and nucleolar localization signals. Throughout the open reading frame, we detected an additional eight mutations in TCS families and several polymorphisms. We postulate that TCS results from defects in a nucleolar trafficking protein that is critically required during human craniofacial development.

Rotational dynamics of bases in the gene coding interferon alpha 17 (IFNA17).

PubMed

Krasnobaeva, L A; Yakushevich, L V

2015-02-01

In the present work, rotational oscillations of nitrogenous bases in the DNA with the sequence of the gene coding interferon alpha 17 (IFNA17), are investigated. As a mathematical model simulating oscillations of the bases, we use a system of two coupled nonlinear partial differential equations that takes into account effects of dissipation, action of external fields and dependence of the equation coefficients on the sequence of bases. We apply the methods of the theory of oscillations to solve the equations in the linear approach and to construct the dispersive curves determining the dependence of the frequency of the plane waves (ω) on the wave vector (q). In the nonlinear case, the solutions in the form of kink are considered, and the main characteristics of the kink: the rest energy (E0), the rest mass (m0), the size (d) and sound velocity (C0), are calculated. With the help of the energetic method, the kink velocity (υ), the path (S), and the lifetime (τ) are also obtained.

Preliminary consideration on the seismic actions recorded during the 2016 Central Italy seismic sequence

NASA Astrophysics Data System (ADS)

Carlo Ponzo, Felice; Ditommaso, Rocco; Nigro, Antonella; Nigro, Domenico S.; Iacovino, Chiara

2017-04-01

After the Mw 6.0 mainshock of August 24, 2016 at 03.36 a.m. (local time), with the epicenter located between the towns of Accumoli (province of Rieti), Amatrice (province of Rieti) and Arquata del Tronto (province of Ascoli Piceno), several activities were started in order to perform some preliminary evaluations on the characteristics of the recent seismic sequence in the areas affected by the earthquake. Ambient vibration acquisitions have been performed using two three-directional velocimetric synchronized stations, with a natural frequency equal to 0.5Hz and a digitizer resolution of equal to 24bit. The activities are continuing after the events of the seismic sequence of October 26 and October 30, 2016. In this paper, in order to compare recorded and code provision values in terms of peak (PGA, PGV and PGD), spectral and integral (Housner Intensity) seismic parameters, several preliminary analyses have been performed on accelerometric time-histories acquired by three near fault station of the RAN (Italian Accelerometric Network): Amatrice station (station code AMT), Norcia station (station code NRC) and Castelsantangelo sul Nera station (station code CNE). Several comparisons between the elastic response spectra derived from accelerometric recordings and the elastic demand spectra provided by the Italian seismic code (NTC 2008) have been performed. Preliminary results retrieved from these analyses highlight several apparent difference between experimental data and conventional code provision. Then, the ongoing seismic sequence appears compatible with the historical seismicity in terms of integral parameters, but not in terms of peak and spectral values. It seems appropriate to reconsider the necessity to revise the simplified design approach based on the conventional spectral values. Acknowledgements This study was partially funded by the Italian Department of Civil Protection within the project DPC-RELUIS 2016 - RS4 ''Seismic observatory of structures and health monitoring'' and by the "Centre of Integrated Geomorphology for the Mediterranean Area - CGIAM" within the Framework Agreement with the University of Basilicata "Study, Research and Experimentation in the Field of Analysis and Monitoring of Seismic Vulnerability of Strategic and Relevant Buildings for the purposes of Civil Protection and Development of Innovative Strategies of Seismic Reinforcement".

The central nervous system transcriptome of the weakly electric brown ghost knifefish (Apteronotus leptorhynchus): de novo assembly, annotation, and proteomics validation.

PubMed

Salisbury, Joseph P; Sîrbulescu, Ruxandra F; Moran, Benjamin M; Auclair, Jared R; Zupanc, Günther K H; Agar, Jeffrey N

2015-03-11

The brown ghost knifefish (Apteronotus leptorhynchus) is a weakly electric teleost fish of particular interest as a versatile model system for a variety of research areas in neuroscience and biology. The comprehensive information available on the neurophysiology and neuroanatomy of this organism has enabled significant advances in such areas as the study of the neural basis of behavior, the development of adult-born neurons in the central nervous system and their involvement in the regeneration of nervous tissue, as well as brain aging and senescence. Despite substantial scientific interest in this species, no genomic resources are currently available. Here, we report the de novo assembly and annotation of the A. leptorhynchus transcriptome. After evaluating several trimming and transcript reconstruction strategies, de novo assembly using Trinity uncovered 42,459 unique contigs containing at least a partial protein-coding sequence based on alignment to a reference set of known Actinopterygii sequences. As many as 11,847 of these contigs contained full or near-full length protein sequences, providing broad coverage of the proteome. A variety of non-coding RNA sequences were also identified and annotated, including conserved long intergenic non-coding RNA and other long non-coding RNA observed previously to be expressed in adult zebrafish (Danio rerio) brain, as well as a variety of miRNA, snRNA, and snoRNA. Shotgun proteomics confirmed translation of open reading frames from over 2,000 transcripts, including alternative splice variants. Assignment of tandem mass spectra was greatly improved by use of the assembly compared to databases of sequences from closely related organisms. The assembly and raw reads have been deposited at DDBJ/EMBL/GenBank under the accession number GBKR00000000. Tandem mass spectrometry data is available via ProteomeXchange with identifier PXD001285. Presented here is the first release of an annotated de novo transcriptome assembly from Apteronotus leptorhynchus, providing a broad overview of RNA expressed in central nervous system tissue. The assembly, which includes substantial coverage of a wide variety of both protein coding and non-coding transcripts, will allow the development of better tools to understand the mechanisms underlying unique characteristics of the knifefish model system, such as their tremendous regenerative capacity and negligible brain senescence.

Assignment of protein sequences to existing domain and family classification systems: Pfam and the PDB.

PubMed

Xu, Qifang; Dunbrack, Roland L

2012-11-01

Automating the assignment of existing domain and protein family classifications to new sets of sequences is an important task. Current methods often miss assignments because remote relationships fail to achieve statistical significance. Some assignments are not as long as the actual domain definitions because local alignment methods often cut alignments short. Long insertions in query sequences often erroneously result in two copies of the domain assigned to the query. Divergent repeat sequences in proteins are often missed. We have developed a multilevel procedure to produce nearly complete assignments of protein families of an existing classification system to a large set of sequences. We apply this to the task of assigning Pfam domains to sequences and structures in the Protein Data Bank (PDB). We found that HHsearch alignments frequently scored more remotely related Pfams in Pfam clans higher than closely related Pfams, thus, leading to erroneous assignment at the Pfam family level. A greedy algorithm allowing for partial overlaps was, thus, applied first to sequence/HMM alignments, then HMM-HMM alignments and then structure alignments, taking care to join partial alignments split by large insertions into single-domain assignments. Additional assignment of repeat Pfams with weaker E-values was allowed after stronger assignments of the repeat HMM. Our database of assignments, presented in a database called PDBfam, contains Pfams for 99.4% of chains >50 residues. The Pfam assignment data in PDBfam are available at http://dunbrack2.fccc.edu/ProtCid/PDBfam, which can be searched by PDB codes and Pfam identifiers. They will be updated regularly.

The Caenorhabditis elegans gene unc-89, required fpr muscle M-line assembly, encodes a giant modular protein composed of Ig and signal transduction domains

PubMed Central

1996-01-01

Mutations in the Caenorhabditis elegans gene unc-89 result in nematodes having disorganized muscle structure in which thick filaments are not organized into A-bands, and there are no M-lines. Beginning with a partial cDNA from the C. elegans sequencing project, we have cloned and sequenced the unc-89 gene. An unc-89 allele, st515, was found to contain an 84-bp deletion and a 10-bp duplication, resulting in an in- frame stop codon within predicted unc-89 coding sequence. Analysis of the complete coding sequence for unc-89 predicts a novel 6,632 amino acid polypeptide consisting of sequence motifs which have been implicated in protein-protein interactions. UNC-89 begins with 67 residues of unique sequences, SH3, dbl/CDC24, and PH domains, 7 immunoglobulins (Ig) domains, a putative KSP-containing multiphosphorylation domain, and ends with 46 Ig domains. A polyclonal antiserum raised to a portion of unc-89 encoded sequence reacts to a twitchin-sized polypeptide from wild type, but truncated polypeptides from st515 and from the amber allele e2338. By immunofluorescent microscopy, this antiserum localizes to the middle of A-bands, consistent with UNC-89 being a structural component of the M-line. Previous studies indicate that myofilament lattice assembly begins with positional cues laid down in the basement membrane and muscle cell membrane. We propose that the intracellular protein UNC-89 responds to these signals, localizes, and then participates in assembling an M-line. PMID:8603916

Ancient DNA sequence revealed by error-correcting codes.

PubMed

Brandão, Marcelo M; Spoladore, Larissa; Faria, Luzinete C B; Rocha, Andréa S L; Silva-Filho, Marcio C; Palazzo, Reginaldo

2015-07-10

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code.

Ancient DNA sequence revealed by error-correcting codes

PubMed Central

Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo

2015-01-01

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228

Evolutionary Dynamics of the Gametologous CTNNB1 Gene on the Z and W Chromosomes of Snakes.

PubMed

Laopichienpong, Nararat; Muangmai, Narongrit; Chanhome, Lawan; Suntrarachun, Sunutcha; Twilprawat, Panupon; Peyachoknagul, Surin; Srikulnath, Kornsorn

2017-03-01

Snakes exhibit genotypic sex determination with female heterogamety (ZZ males and ZW females), and the state of sex chromosome differentiation also varies among lineages. To investigate the evolutionary history of homologous genes located in the nonrecombining region of differentiated sex chromosomes in snakes, partial sequences of the gametologous CTNNB1 gene were analyzed for 12 species belonging to henophid (Cylindrophiidae, Xenopeltidae, and Pythonidae) and caenophid snakes (Viperidae, Elapidae, and Colubridae). Nonsynonymous/synonymous substitution ratios (Ka/Ks) in coding sequences were low (Ka/Ks < 1) between CTNNB1Z and CTNNB1W, suggesting that these 2 genes may have similar functional properties. However, frequencies of intron sequence substitutions and insertion–deletions were higher in CTNNB1Z than CTNNB1W, suggesting that Z-linked sequences evolved faster than W-linked sequences. Molecular phylogeny based on both intron and exon sequences showed the presence of 2 major clades: 1) Z-linked sequences of Caenophidia and 2) W-linked sequences of Caenophidia clustered with Z-linked sequences of Henophidia, which suggests that the sequence divergence between CTNNB1Z and CTNNB1W in Caenophidia may have occurred by the cessation of recombination after the split from Henophidia.

Analysis of cellulose synthase genes from domesticated apple identifies collinear genes WDR53 and CesA8A: partial co-expression, bicistronic mRNA, and alternative splicing of CESA8A

PubMed Central

Guerriero, Gea; Spadiut, Oliver; Kerschbamer, Christine; Giorno, Filomena; Baric, Sanja; Ezcurra, Inés

2016-01-01

Cellulose synthase (CesA) genes constitute a complex multigene family with six major phylogenetic clades in angiosperms. The recently sequenced genome of domestic apple, Malus×domestica, was mined for CesA genes, by blasting full-length cellulose synthase protein (CESA) sequences annotated in the apple genome against protein databases from the plant models Arabidopsis thaliana and Populus trichocarpa. Thirteen genes belonging to the six angiosperm CesA clades and coding for proteins with conserved residues typical of processive glycosyltransferases from family 2 were detected. Based on their phylogenetic relationship to Arabidopsis CESAs, as well as expression patterns, a nomenclature is proposed to facilitate further studies. Examination of their genomic organization revealed that MdCesA8-A is closely linked and co-oriented with WDR53, a gene coding for a WD40 repeat protein. The WDR53 and CesA8 genes display conserved collinearity in dicots and are partially co-expressed in the apple xylem. Interestingly, the presence of a bicistronic WDR53–CesA8A transcript was detected in phytoplasma-infected phloem tissues of apple. The bicistronic transcript contains a spliced intergenic sequence that is predicted to fold into hairpin structures typical of internal ribosome entry sites, suggesting its potential cap-independent translation. Surprisingly, the CesA8A cistron is alternatively spliced and lacks the zinc-binding domain. The possible roles of WDR53 and the alternatively spliced CESA8 variant during cellulose biosynthesis in M.×domestica are discussed. PMID:23048131

HYBRIDIZATION PROPERTIES OF DNA SEQUENCES DIRECTING THE SYNTHESIS OF MESSENGER RNA AND HETEROGENEOUS NUCLEAR RNA

PubMed Central

Greenberg, Jay R.; Perry, Robert P.

1971-01-01

The relationship of the DNA sequences from which polyribosomal messenger RNA (mRNA) and heterogeneous nuclear RNA (NRNA) of mouse L cells are transcribed was investigated by means of hybridization kinetics and thermal denaturation of the hybrids. Hybridization was performed in formamide solutions at DNA excess. Under these conditions most of the hybridizing mRNA and NRNA react at values of Dot (DNA concentration multiplied by time) expected for RNA transcribed from the nonrepeated or rarely repeated fraction of the genome. However, a fraction of both mRNA and NRNA hybridize at values of Dot about 10,000 times lower, and therefore must be transcribed from highly redundant DNA sequences. The fraction of NRNA hybridizing to highly repeated sequences is about 1.7 times greater than the corresponding fraction of mRNA. The hybrids formed by the rapidly reacting fractions of both NRNA and mRNA melt over a narrow temperature range with a midpoint about 11°C below that of native L cell DNA. This indicates that these hybrids consist of partially complementary sequences with approximately 11% mismatching of bases. Hybrids formed by the slowly reacting fraction of NRNA melt within 4°–6°C of native DNA, indicating very little, if any, mismatching of bases. Hybrids of the slowly reacting components of mRNA, formed under conditions of sufficiently low RNA input, have a high thermal stability, similar to that observed for hybrids of the slowly reacting NRNA component. However, when higher inputs of mRNA are used, hybrids are formed which have a strikingly lower thermal stability. This observation can be explained by assuming that there is sufficient similarity among the relatively rare DNA sequences coding for mRNA so that under hybridization conditions, in which these DNA sequences are not truly in excess, reversible hybrids exhibiting a considerable amount of mispairing are formed. The fact that a comparable phenomenon has not been observed for NRNA may mean that there is less similarity among the relatively rare DNA sequences coding for NRNA than there is among the rare sequences coding for mRNA. PMID:4999767

Two-terminal video coding.

PubMed

Yang, Yang; Stanković, Vladimir; Xiong, Zixiang; Zhao, Wei

2009-03-01

Following recent works on the rate region of the quadratic Gaussian two-terminal source coding problem and limit-approaching code designs, this paper examines multiterminal source coding of two correlated, i.e., stereo, video sequences to save the sum rate over independent coding of both sequences. Two multiterminal video coding schemes are proposed. In the first scheme, the left sequence of the stereo pair is coded by H.264/AVC and used at the joint decoder to facilitate Wyner-Ziv coding of the right video sequence. The first I-frame of the right sequence is successively coded by H.264/AVC Intracoding and Wyner-Ziv coding. An efficient stereo matching algorithm based on loopy belief propagation is then adopted at the decoder to produce pixel-level disparity maps between the corresponding frames of the two decoded video sequences on the fly. Based on the disparity maps, side information for both motion vectors and motion-compensated residual frames of the right sequence are generated at the decoder before Wyner-Ziv encoding. In the second scheme, source splitting is employed on top of classic and Wyner-Ziv coding for compression of both I-frames to allow flexible rate allocation between the two sequences. Experiments with both schemes on stereo video sequences using H.264/AVC, LDPC codes for Slepian-Wolf coding of the motion vectors, and scalar quantization in conjunction with LDPC codes for Wyner-Ziv coding of the residual coefficients give a slightly lower sum rate than separate H.264/AVC coding of both sequences at the same video quality.

Reconsideration of systematic relationships within the order Euplotida (Protista, Ciliophora) using new sequences of the gene coding for small-subunit rRNA and testing the use of combined data sets to construct phylogenies of the Diophrys-complex.

PubMed

Yi, Zhenzhen; Song, Weibo; Clamp, John C; Chen, Zigui; Gao, Shan; Zhang, Qianqian

2009-03-01

Comprehensive molecular analyses of phylogenetic relationships within euplotid ciliates are relatively rare, and the relationships among some families remain questionable. We performed phylogenetic analyses of the order Euplotida based on new sequences of the gene coding for small-subunit RNA (SSrRNA) from a variety of taxa across the entire order as well as sequences from some of these taxa of other genes (ITS1-5.8S-ITS2 region and histone H4) that have not been included in previous analyses. Phylogenetic trees based on SSrRNA gene sequences constructed with four different methods had a consistent branching pattern that included the following features: (1) the "typical" euplotids comprised a paraphyletic assemblage composed of two divergent clades (family Uronychiidae and families Euplotidae-Certesiidae-Aspidiscidae-Gastrocirrhidae), (2) in the family Uronychiidae, the genera Uronychia and Paradiophrys formed a clearly outlined, well-supported clade that seemed to be rather divergent from Diophrys and Diophryopsis, suggesting that the Diophrys-complex may have had a longer and more separate evolutionary history than previously supposed, (3) inclusion of 12 new SSrRNA sequences in analyses of Euplotidae revealed two new clades of species within the family and cast additional doubt on the present classification of genera within the family, and (4) the intraspecific divergence among five species of Aspidisca was far greater than those of closely related genera. The ITS1-5.8S-ITS2 coding regions and partial histone H4 genes of six morphospecies in the Diophrys-complex were sequenced along with their SSrRNA genes and used to compare phylogenies constructed from single data sets to those constructed from combined sets. Results indicated that combined analyses could be used to construct more reliable, less ambiguous phylogenies of complex groups like the order Euplotida, because they provide a greater amount and diversity of information.

Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

PubMed Central

Ma, Zhengqiang

2013-01-01

Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966

PepLine: a software pipeline for high-throughput direct mapping of tandem mass spectrometry data on genomic sequences.

PubMed

Ferro, Myriam; Tardif, Marianne; Reguer, Erwan; Cahuzac, Romain; Bruley, Christophe; Vermat, Thierry; Nugues, Estelle; Vigouroux, Marielle; Vandenbrouck, Yves; Garin, Jérôme; Viari, Alain

2008-05-01

PepLine is a fully automated software which maps MS/MS fragmentation spectra of trypsic peptides to genomic DNA sequences. The approach is based on Peptide Sequence Tags (PSTs) obtained from partial interpretation of QTOF MS/MS spectra (first module). PSTs are then mapped on the six-frame translations of genomic sequences (second module) giving hits. Hits are then clustered to detect potential coding regions (third module). Our work aimed at optimizing the algorithms of each component to allow the whole pipeline to proceed in a fully automated manner using raw nucleic acid sequences (i.e., genomes that have not been "reduced" to a database of ORFs or putative exons sequences). The whole pipeline was tested on controlled MS/MS spectra sets from standard proteins and from Arabidopsis thaliana envelope chloroplast samples. Our results demonstrate that PepLine competed with protein database searching softwares and was fast enough to potentially tackle large data sets and/or high size genomes. We also illustrate the potential of this approach for the detection of the intron/exon structure of genes.

Detection of hyper-conserved regions in hepatitis B virus X gene potentially useful for gene therapy.

PubMed

González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco

2018-05-21

To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.

Low Diversity in the Mitogenome of Sperm Whales Revealed by Next-Generation Sequencing

PubMed Central

Alexander, Alana; Steel, Debbie; Slikas, Beth; Hoekzema, Kendra; Carraher, Colm; Parks, Matthew; Cronn, Richard; Baker, C. Scott

2013-01-01

Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20 mitogenomes from 17 sperm whales representative of worldwide diversity using Next Generation Sequencing (NGS) technologies (Illumina GAIIx, Roche 454 GS Junior). Resequencing of three individuals with both NGS platforms and partial Sanger sequencing showed low discrepancy rates (454-Illumina: 0.0071%; Sanger-Illumina: 0.0034%; and Sanger-454: 0.0023%) confirming suitability of both NGS platforms for investigating low mitogenomic diversity. Using the 17 sperm whale mitogenomes in a phylogenetic reconstruction with 41 other species, including 11 new dolphin mitogenomes, we tested two hypotheses for the low CR diversity. First, the hypothesis that CR-specific constraints have reduced diversity solely in the CR was rejected as diversity was low throughout the mitogenome, not just in the CR (overall diversity π = 0.096%; protein-coding 3rd codon = 0.22%; CR = 0.35%), and CR phylogenetic signal was congruent with protein-coding regions. Second, the hypothesis that slow substitution rates reduced diversity throughout the sperm whale mitogenome was rejected as sperm whales had significantly higher rates of CR evolution and no evidence of slow coding region evolution relative to other cetaceans. The estimated time to most recent common ancestor for sperm whale mitogenomes was 72,800 to 137,400 years ago (95% highest probability density interval), consistent with previous hypotheses of a bottleneck or selective sweep as likely causes of low mitogenome diversity. PMID:23254394

Low diversity in the mitogenome of sperm whales revealed by next-generation sequencing.

PubMed

Alexander, Alana; Steel, Debbie; Slikas, Beth; Hoekzema, Kendra; Carraher, Colm; Parks, Matthew; Cronn, Richard; Baker, C Scott

2013-01-01

Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20 mitogenomes from 17 sperm whales representative of worldwide diversity using Next Generation Sequencing (NGS) technologies (Illumina GAIIx, Roche 454 GS Junior). Resequencing of three individuals with both NGS platforms and partial Sanger sequencing showed low discrepancy rates (454-Illumina: 0.0071%; Sanger-Illumina: 0.0034%; and Sanger-454: 0.0023%) confirming suitability of both NGS platforms for investigating low mitogenomic diversity. Using the 17 sperm whale mitogenomes in a phylogenetic reconstruction with 41 other species, including 11 new dolphin mitogenomes, we tested two hypotheses for the low CR diversity. First, the hypothesis that CR-specific constraints have reduced diversity solely in the CR was rejected as diversity was low throughout the mitogenome, not just in the CR (overall diversity π = 0.096%; protein-coding 3rd codon = 0.22%; CR = 0.35%), and CR phylogenetic signal was congruent with protein-coding regions. Second, the hypothesis that slow substitution rates reduced diversity throughout the sperm whale mitogenome was rejected as sperm whales had significantly higher rates of CR evolution and no evidence of slow coding region evolution relative to other cetaceans. The estimated time to most recent common ancestor for sperm whale mitogenomes was 72,800 to 137,400 years ago (95% highest probability density interval), consistent with previous hypotheses of a bottleneck or selective sweep as likely causes of low mitogenome diversity.

Application of MLST and Pilus Gene Sequence Comparisons to Investigate the Population Structures of Actinomyces naeslundii and Actinomyces oris

PubMed Central

Henssge, Uta; Do, Thuy; Gilbert, Steven C.; Cox, Steven; Clark, Douglas; Wickström, Claes; Ligtenberg, A. J. M.; Radford, David R.; Beighton, David

2011-01-01

Actinomyces naeslundii and Actinomyces oris are members of the oral biofilm. Their identification using 16S rRNA sequencing is problematic and better achieved by comparison of metG partial sequences. A. oris is more abundant and more frequently isolated than A. naeslundii. We used a multi-locus sequence typing approach to investigate the genotypic diversity of these species and assigned A. naeslundii (n = 37) and A. oris (n = 68) isolates to 32 and 68 sequence types (ST), respectively. Neighbor-joining and ClonalFrame dendrograms derived from the concatenated partial sequences of 7 house-keeping genes identified at least 4 significant subclusters within A. oris and 3 within A. naeslundii. The strain collection we had investigated was an under-representation of the total population since at least 3 STs composed of single strains may represent discrete clusters of strains not well represented in the collection. The integrity of these sub-clusters was supported by the sequence analysis of fimP and fimA, genes coding for the type 1 and 2 fimbriae, respectively. An A. naeslundii subcluster was identified with both fimA and fimP genes and these strains were able to bind to MUC7 and statherin while all other A. naeslundii strains possessed only fimA and did not bind to statherin. An A. oris subcluster harboured a fimA gene similar to that of Actinomyces odontolyticus but no detectable fimP failed to bind significantly to either MUC7 or statherin. These data are evidence of extensive genotypic and phenotypic diversity within the species A. oris and A. naeslundii but the status of the subclusters identified here will require genome comparisons before their phylogenic position can be unequivocally established. PMID:21738661

Application of MLST and pilus gene sequence comparisons to investigate the population structures of Actinomyces naeslundii and Actinomyces oris.

PubMed

Henssge, Uta; Do, Thuy; Gilbert, Steven C; Cox, Steven; Clark, Douglas; Wickström, Claes; Ligtenberg, A J M; Radford, David R; Beighton, David

2011-01-01

Actinomyces naeslundii and Actinomyces oris are members of the oral biofilm. Their identification using 16S rRNA sequencing is problematic and better achieved by comparison of metG partial sequences. A. oris is more abundant and more frequently isolated than A. naeslundii. We used a multi-locus sequence typing approach to investigate the genotypic diversity of these species and assigned A. naeslundii (n = 37) and A. oris (n = 68) isolates to 32 and 68 sequence types (ST), respectively. Neighbor-joining and ClonalFrame dendrograms derived from the concatenated partial sequences of 7 house-keeping genes identified at least 4 significant subclusters within A. oris and 3 within A. naeslundii. The strain collection we had investigated was an under-representation of the total population since at least 3 STs composed of single strains may represent discrete clusters of strains not well represented in the collection. The integrity of these sub-clusters was supported by the sequence analysis of fimP and fimA, genes coding for the type 1 and 2 fimbriae, respectively. An A. naeslundii subcluster was identified with both fimA and fimP genes and these strains were able to bind to MUC7 and statherin while all other A. naeslundii strains possessed only fimA and did not bind to statherin. An A. oris subcluster harboured a fimA gene similar to that of Actinomyces odontolyticus but no detectable fimP failed to bind significantly to either MUC7 or statherin. These data are evidence of extensive genotypic and phenotypic diversity within the species A. oris and A. naeslundii but the status of the subclusters identified here will require genome comparisons before their phylogenic position can be unequivocally established.

Assignment of protein sequences to existing domain and family classification systems: Pfam and the PDB

PubMed Central

Dunbrack, Roland L.

2012-01-01

Motivation: Automating the assignment of existing domain and protein family classifications to new sets of sequences is an important task. Current methods often miss assignments because remote relationships fail to achieve statistical significance. Some assignments are not as long as the actual domain definitions because local alignment methods often cut alignments short. Long insertions in query sequences often erroneously result in two copies of the domain assigned to the query. Divergent repeat sequences in proteins are often missed. Results: We have developed a multilevel procedure to produce nearly complete assignments of protein families of an existing classification system to a large set of sequences. We apply this to the task of assigning Pfam domains to sequences and structures in the Protein Data Bank (PDB). We found that HHsearch alignments frequently scored more remotely related Pfams in Pfam clans higher than closely related Pfams, thus, leading to erroneous assignment at the Pfam family level. A greedy algorithm allowing for partial overlaps was, thus, applied first to sequence/HMM alignments, then HMM–HMM alignments and then structure alignments, taking care to join partial alignments split by large insertions into single-domain assignments. Additional assignment of repeat Pfams with weaker E-values was allowed after stronger assignments of the repeat HMM. Our database of assignments, presented in a database called PDBfam, contains Pfams for 99.4% of chains >50 residues. Availability: The Pfam assignment data in PDBfam are available at http://dunbrack2.fccc.edu/ProtCid/PDBfam, which can be searched by PDB codes and Pfam identifiers. They will be updated regularly. Contact: Roland.Dunbracks@fccc.edu PMID:22942020

Multiple copies of a bile acid-inducible gene in Eubacterium sp. strain VPI 12708.

PubMed Central

Gopal-Srivastava, R; Mallonee, D H; White, W B; Hylemon, P B

1990-01-01

Eubacterium sp. strain VPI 12708 is an anaerobic intestinal bacterium which possesses inducible bile acid 7-dehydroxylation activity. Several new polypeptides are produced in this strain following induction with cholic acid. Genes coding for two copies of a bile acid-inducible 27,000-dalton polypeptide (baiA1 and baiA2) have been previously cloned and sequenced. We now report on a gene coding for a third copy of this 27,000-dalton polypeptide (baiA3). The baiA3 gene has been cloned in lambda DASH on an 11.2-kilobase DNA fragment from a partial Sau3A digest of the Eubacterium DNA. DNA sequence analysis of the baiA3 gene revealed 100% homology with the baiA1 gene within the coding region of the 27,000-dalton polypeptides. The baiA2 gene shares 81% sequence identity with the other two genes at the nucleotide level. The flanking nucleotide sequences associated with the baiA1 and baiA3 genes are identical for 930 bases in the 5' direction from the initiation codon and for at least 325 bases in the 3' direction from the stop codon, including the putative promoter regions for the genes. An additional open reading frame (occupying from 621 to 648 bases, depending on the correct start codon) was found in the identical 5' regions associated with the baiA1 and baiA3 clones. The 5' sequence 930 bases upstream from the baiA1 and baiA3 genes was totally divergent. The baiA2 gene, which is part of a large bile acid-inducible operon, showed no homology with the other two genes either in the 5' or 3' direction from the polypeptide coding region, except for a 15-base-pair presumed ribosome-binding site in the 5' region. These studies strongly suggest that a gene duplication (baiA1 and baiA3) has occurred and is stably maintained in this bacterium. Images PMID:2376563

Identification of largemouth bass virus in the introduced Northern Snakehead inhabiting the Chesapeake Bay watershed.

PubMed

Iwanowicz, L; Densmore, C; Hahn, C; McAllister, P; Odenkirk, J

2013-09-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Identification of largemouth bass virus in the introduced Northern snakehead inhabiting the Cheasapeake Bay watershed

USGS Publications Warehouse

Iwanowicz, Luke R.; Densmore, Christine L.; Hahn, Cassidy M.; McAllister, Phillip; Odenkirk, John

2013-01-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

[Cloning, sequencing and prokaryotic expression of cDNAs for the antifreeze protein family from the beetle Tenebrio molitor].

PubMed

Liu, Zhong-Yuan; Wang, Yun; Lü, Guo-Dong; Wang, Xian-Lei; Zhang, Fu-Chun; Ma, Ji

2006-12-01

The partial cDNA sequence coding for the antifreeze proteins in the Tenebrio molitor was obtained by RT-PCR. Sequence analysis revealed nine putative cDNAs with a high degree of homology to Tenebrio molitor antifreeze proteins. The recombinant pGEX-4T-1-tmafp-XJ430 was introduced into E. coli BL21 to induce a GST fusion protein by IPTG. SDS-PAGE of the fusion protein demonstrated that the antifreeze protein migrated at a size of 38 kDa. The immunization was performed by intra-muscular injection of pCDNA3-tmafp-XJ430, and then antiserum was detected by ELISA. The titer of the antibody was 1:2,000. Western blotting analysis showed the antiserum was specific against the antifreeze protein. This finding could lead to further investigation of the properties and function of antifreeze proteins.

Phylodynamic and Phylogeographic Patterns of the HIV Type 1 Subtype F1 Parenteral Epidemic in Romania

PubMed Central

Hué, Stéphane; Buckton, Andrew J.; Myers, Richard E.; Duiculescu, Dan; Ene, Luminita; Oprea, Cristiana; Tardei, Gratiela; Rugina, Sorin; Mardarescu, Mariana; Floch, Corinne; Notheis, Gundula; Zöhrer, Bettina; Cane, Patricia A.; Pillay, Deenan

2012-01-01

Abstract In the late 1980s an HIV-1 epidemic emerged in Romania that was dominated by subtype F1. The main route of infection is believed to be parenteral transmission in children. We sequenced partial pol coding regions of 70 subtype F1 samples from children and adolescents from the PENTA-EPPICC network of which 67 were from Romania. Phylogenetic reconstruction using the sequences and other publically available global subtype F sequences showed that 79% of Romanian F1 sequences formed a statistically robust monophyletic cluster. The monophyletic cluster was epidemiologically linked to parenteral transmission in children. Coalescent-based analysis dated the origins of the parenteral epidemic to 1983 [1981–1987; 95% HPD]. The analysis also shows that the epidemic's effective population size has remained fairly constant since the early 1990s suggesting limited onward spread of the virus within the population. Furthermore, phylogeographic analysis suggests that the root location of the parenteral epidemic was Bucharest. PMID:22251065

Transcriptome discovery in non-model wild fish species for the development of quantitative transcript abundance assays

USGS Publications Warehouse

Hahn, Cassidy M.; Iwanowicz, Luke R.; Cornman, Robert S.; Mazik, Patricia M.; Blazer, Vicki S.

2016-01-01

Environmental studies increasingly identify the presence of both contaminants of emerging concern (CECs) and legacy contaminants in aquatic environments; however, the biological effects of these compounds on resident fishes remain largely unknown. High throughput methodologies were employed to establish partial transcriptomes for three wild-caught, non-model fish species; smallmouth bass (Micropterus dolomieu), white sucker (Catostomus commersonii) and brown bullhead (Ameiurus nebulosus). Sequences from these transcriptome databases were utilized in the development of a custom nCounter CodeSet that allowed for direct multiplexed measurement of 50 transcript abundance endpoints in liver tissue. Sequence information was also utilized in the development of quantitative real-time PCR (qPCR) primers. Cross-species hybridization allowed the smallmouth bass nCounter CodeSet to be used for quantitative transcript abundance analysis of an additional non-model species, largemouth bass (Micropterus salmoides). We validated the nCounter analysis data system with qPCR for a subset of genes and confirmed concordant results. Changes in transcript abundance biomarkers between sexes and seasons were evaluated to provide baseline data on transcript modulation for each species of interest.

The cDNA-derived amino acid sequence of hemoglobin II from Lucina pectinata.

PubMed

Torres-Mercado, Elineth; Renta, Jessicca Y; Rodríguez, Yolanda; López-Garriga, Juan; Cadilla, Carmen L

2003-11-01

Hemoglobin II from the clam Lucina pectinata is an oxygen-reactive protein with a unique structural organization in the heme pocket involving residues Gln65 (E7), Tyr30 (B10), Phe44 (CD1), and Phe69 (E11). We employed the reverse transcriptase-polymerase chain reaction (RT-PCR) and methods to synthesize various cDNA(HbII). An initial 300-bp cDNA clone was amplified from total RNA by RT-PCR using degenerate oligonucleotides. Gene-specific primers derived from the HbII-partial cDNA sequence were used to obtain the 5' and 3' ends of the cDNA by RACE. The length of the HbII cDNA, estimated from overlapping clones, was approximately 2114 bases. Northern blot analysis revealed that the mRNA size of HbII agrees with the estimated size using cDNA data. The coding region of the full-length HbII cDNA codes for 151 amino acids. The calculated molecular weight of HbII, including the heme group and acetylated N-terminal residue, is 17,654.07 Da.

Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

PubMed Central

Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

2015-01-01

Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

PubMed

Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

1987-07-01

Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

Phylogenetic placement of the enigmatic parasite, Polypodium hydriforme, within the Phylum Cnidaria

PubMed Central

2008-01-01

Background Polypodium hydriforme is a parasite with an unusual life cycle and peculiar morphology, both of which have made its systematic position uncertain. Polypodium has traditionally been considered a cnidarian because it possesses nematocysts, the stinging structures characteristic of this phylum. However, recent molecular phylogenetic studies using 18S rDNA sequence data have challenged this interpretation, and have shown that Polypodium is a close relative to myxozoans and together they share a closer affinity to bilaterians than cnidarians. Due to the variable rates of 18S rDNA sequences, these results have been suggested to be an artifact of long-branch attraction (LBA). A recent study, using multiple protein coding markers, shows that the myxozoan Buddenbrockia, is nested within cnidarians. Polypodium was not included in this study. To further investigate the phylogenetic placement of Polypodium, we have performed phylogenetic analyses of metazoans with 18S and partial 28S rDNA sequences in a large dataset that includes Polypodium and a comprehensive sampling of cnidarian taxa. Results Analyses of a combined dataset of 18S and partial 28S sequences, and partial 28S alone, support the placement of Polypodium within Cnidaria. Removal of the long-branched myxozoans from the 18S dataset also results in Polypodium being nested within Cnidaria. These results suggest that previous reports showing that Polypodium and Myxozoa form a sister group to Bilateria were an artifact of long-branch attraction. Conclusion By including 28S rDNA sequences and a comprehensive sampling of cnidarian taxa, we demonstrate that previously conflicting hypotheses concerning the phylogenetic placement of Polypodium can be reconciled. Specifically, the data presented provide evidence that Polypodium is indeed a cnidarian and is either the sister taxon to Hydrozoa, or part of the hydrozoan clade, Leptothecata. The former hypothesis is consistent with the traditional view that Polypodium should be placed in its own cnidarian class, Polypodiozoa. PMID:18471296

Phylogenetic placement of the enigmatic parasite, Polypodium hydriforme, within the Phylum Cnidaria.

PubMed

Evans, Nathaniel M; Lindner, Alberto; Raikova, Ekaterina V; Collins, Allen G; Cartwright, Paulyn

2008-05-09

Polypodium hydriforme is a parasite with an unusual life cycle and peculiar morphology, both of which have made its systematic position uncertain. Polypodium has traditionally been considered a cnidarian because it possesses nematocysts, the stinging structures characteristic of this phylum. However, recent molecular phylogenetic studies using 18S rDNA sequence data have challenged this interpretation, and have shown that Polypodium is a close relative to myxozoans and together they share a closer affinity to bilaterians than cnidarians. Due to the variable rates of 18S rDNA sequences, these results have been suggested to be an artifact of long-branch attraction (LBA). A recent study, using multiple protein coding markers, shows that the myxozoan Buddenbrockia, is nested within cnidarians. Polypodium was not included in this study. To further investigate the phylogenetic placement of Polypodium, we have performed phylogenetic analyses of metazoans with 18S and partial 28S rDNA sequences in a large dataset that includes Polypodium and a comprehensive sampling of cnidarian taxa. Analyses of a combined dataset of 18S and partial 28S sequences, and partial 28S alone, support the placement of Polypodium within Cnidaria. Removal of the long-branched myxozoans from the 18S dataset also results in Polypodium being nested within Cnidaria. These results suggest that previous reports showing that Polypodium and Myxozoa form a sister group to Bilateria were an artifact of long-branch attraction. By including 28S rDNA sequences and a comprehensive sampling of cnidarian taxa, we demonstrate that previously conflicting hypotheses concerning the phylogenetic placement of Polypodium can be reconciled. Specifically, the data presented provide evidence that Polypodium is indeed a cnidarian and is either the sister taxon to Hydrozoa, or part of the hydrozoan clade, Leptothecata. The former hypothesis is consistent with the traditional view that Polypodium should be placed in its own cnidarian class, Polypodiozoa.

Avian sarcoma virus 17 carries the jun oncogene.

PubMed Central

Maki, Y; Bos, T J; Davis, C; Starbuck, M; Vogt, P K

1987-01-01

Biologically active molecular clones of avian sarcoma virus 17 (ASV 17) contain a replication-defective proviral genome of 3.5 kilobases (kb). The genome retains partial gag and env sequences, which flank a cell-derived putative oncogene of 0.93 kb, termed jun. The jun gene lacks preserved coding domains of tyrosine-specific protein kinases. It also shows no significant nucleic acid homology with other known oncogenes. The probable transformation-specific protein in ASV 17-transformed cells is a 55-kDa gag-jun fusion product. Images PMID:3033666

Dual coding with STDP in a spiking recurrent neural network model of the hippocampus.

PubMed

Bush, Daniel; Philippides, Andrew; Husbands, Phil; O'Shea, Michael

2010-07-01

The firing rate of single neurons in the mammalian hippocampus has been demonstrated to encode for a range of spatial and non-spatial stimuli. It has also been demonstrated that phase of firing, with respect to the theta oscillation that dominates the hippocampal EEG during stereotype learning behaviour, correlates with an animal's spatial location. These findings have led to the hypothesis that the hippocampus operates using a dual (rate and temporal) coding system. To investigate the phenomenon of dual coding in the hippocampus, we examine a spiking recurrent network model with theta coded neural dynamics and an STDP rule that mediates rate-coded Hebbian learning when pre- and post-synaptic firing is stochastic. We demonstrate that this plasticity rule can generate both symmetric and asymmetric connections between neurons that fire at concurrent or successive theta phase, respectively, and subsequently produce both pattern completion and sequence prediction from partial cues. This unifies previously disparate auto- and hetero-associative network models of hippocampal function and provides them with a firmer basis in modern neurobiology. Furthermore, the encoding and reactivation of activity in mutually exciting Hebbian cell assemblies demonstrated here is believed to represent a fundamental mechanism of cognitive processing in the brain.

Analysis of the mitochondrial genome of cheetahs (Acinonyx jubatus) with neurodegenerative disease.

PubMed

Burger, Pamela A; Steinborn, Ralf; Walzer, Christian; Petit, Thierry; Mueller, Mathias; Schwarzenberger, Franz

2004-08-18

The complete mitochondrial genome of Acinonyx jubatus was sequenced and mitochondrial DNA (mtDNA) regions were screened for polymorphisms as candidates for the cause of a neurodegenerative demyelinating disease affecting captive cheetahs. The mtDNA reference sequences were established on the basis of the complete sequences of two diseased and two nondiseased animals as well as partial sequences of 26 further individuals. The A. jubatus mitochondrial genome is 17,047-bp long and shows a high sequence similarity (91%) to the domestic cat. Based on single nucleotide polymorphisms (SNPs) in the control region (CR) and pedigree information, the 18 myelopathic and 12 non-myelopathic cheetahs included in this study were classified into haplotypes I, II and III. In view of the phenotypic comparability of the neurodegenerative disease observed in cheetahs and human mtDNA-associated diseases, specific coding regions including the tRNAs leucine UUR, lysine, serine UCN, and partial complex I and V sequences were screened. We identified a heteroplasmic and a homoplasmic SNP at codon 507 in the subunit 5 (MTND5) of complex I. The heteroplasmic haplotype I-specific valine to methionine substitution represents a nonconservative amino acid change and was found in 11 myelopathic and eight non-myelopathic cheetahs with levels ranging from 29% to 79%. The homoplasmic conservative amino acid substitution valine to alanine was identified in two myelopathic animals of haplotype II. In addition, a synonymous SNP in the codon 76 of the MTND4L gene was found in the single haplotype III animal. The amino acid exchanges in the MTND5 gene were not associated with the occurrence of neurodegenerative disease in captive cheetahs.

Xenopus laevis ribosomal protein genes: isolation of recombinant cDNA clones and study of the genomic organization.

PubMed Central

Bozzoni, I; Beccari, E; Luo, Z X; Amaldi, F

1981-01-01

Poly-A+ mRNA from Xenopus laevis oocytes, partially enriched for r-protein coding capacity has been used as starting material for preparing a cDNA bank in plasmid pBR322. The clones containing sequences specific for r-proteins have been selected by translation of the complementary mRNAs. Clones for six different r-proteins have been identified and utilized as probes for studying their genomic organization. Two gene copies per haploid genome were found for r-proteins L1, L14, S19, and four-five for protein S1, S8 and L32. Moreover a population polymorphism has been observed for the genomic regions containing sequences for r-protein S1, S8 and L14. Images PMID:6112733

Improving performance of DS-CDMA systems using chaotic complex Bernoulli spreading codes

NASA Astrophysics Data System (ADS)

Farzan Sabahi, Mohammad; Dehghanfard, Ali

2014-12-01

The most important goal of spreading spectrum communication system is to protect communication signals against interference and exploitation of information by unintended listeners. In fact, low probability of detection and low probability of intercept are two important parameters to increase the performance of the system. In Direct Sequence Code Division Multiple Access (DS-CDMA) systems, these properties are achieved by multiplying the data information in spreading sequences. Chaotic sequences, with their particular properties, have numerous applications in constructing spreading codes. Using one-dimensional Bernoulli chaotic sequence as spreading code is proposed in literature previously. The main feature of this sequence is its negative auto-correlation at lag of 1, which with proper design, leads to increase in efficiency of the communication system based on these codes. On the other hand, employing the complex chaotic sequences as spreading sequence also has been discussed in several papers. In this paper, use of two-dimensional Bernoulli chaotic sequences is proposed as spreading codes. The performance of a multi-user synchronous and asynchronous DS-CDMA system will be evaluated by applying these sequences under Additive White Gaussian Noise (AWGN) and fading channel. Simulation results indicate improvement of the performance in comparison with conventional spreading codes like Gold codes as well as similar complex chaotic spreading sequences. Similar to one-dimensional Bernoulli chaotic sequences, the proposed sequences also have negative auto-correlation. Besides, construction of complex sequences with lower average cross-correlation is possible with the proposed method.

A new polymorphic and multicopy MHC gene family related to nonmammalian class I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leelayuwat, C.; Degli-Esposti, M.A.; Abraham, L.J.

1994-12-31

The authors have used genomic analysis to characterize a region of the central major histocompatibility complex (MHC) spanning {approximately} 300 kilobases (kb) between TNF and HLA-B. This region has been suggested to carry genetic factors relevant to the development of autoimmune diseases such as myasthenia gravis (MG) and insulin dependent diabetes mellitus (IDDM). Genomic sequence was analyzed for coding potential, using two neural network programs, GRAIL and GeneParser. A genomic probe, JAB, containing putative coding sequences (PERB11) located 60 kb centromeric of HLA-B, was used for northern analysis of human tissues. Multiple transcripts were detected. Southern analysis of genomic DNAmore » and overlapping YAC clones, covering the region from BAT1 to HLA-F, indicated that there are at least five copies of PERB11, four of which are located within this region of the MHC. The partial cDNA sequence of PERB11 was obtained from poly-A RNA derived from skeletal muscle. The putative amino acid sequence of PERB11 shares {approximately} 30% identity to MHC class I molecules from various species, including reptiles, chickens, and frogs, as well as to other MHC class I-like molecules, such as the IgG FcR of the mouse and rat and the human Zn-{alpha}2-glycoprotein. From direct comparison of amino acid sequences, it is concluded that PERB11 is a distinct molecule more closely related to nonmammalian than known mammalian MHC class I molecules. Genomic sequence analysis of PERB11 from five MHC ancestral haplotypes (AH) indicated that the gene is polymorphic at both DNA and protein level. The results suggest that the authors have identified a novel polymorphic gene family with multiple copies within the MHC. 48 refs., 10 figs., 2 tabs.« less

The glucose transporter 1 -GLUT1- from the white shrimp Litopenaeus vannamei is up-regulated during hypoxia.

PubMed

Martínez-Quintana, José A; Peregrino-Uriarte, Alma B; Gollas-Galván, Teresa; Gómez-Jiménez, Silvia; Yepiz-Plascencia, Gloria

2014-12-01

During hypoxia the shrimp Litopenaeus vannamei accelerates anaerobic glycolysis to obtain energy; therefore, a correct supply of glucose to the cells is needed. Facilitated glucose transport across the cells is mediated by a group of membrane embedded integral proteins called GLUT; being GLUT1 the most ubiquitous form. In this work, we report the first cDNA nucleotide and deduced amino acid sequences of a glucose transporter 1 from L. vannamei. A 1619 bp sequence was obtained by RT-PCR and RACE approaches. The 5´ UTR is 161 bp and the poly A tail is exactly after the stop codon in the mRNA. The ORF is 1485 bp and codes for 485 amino acids. The deduced protein sequence has high identity to GLUT1 proteins from several species and contains all the main features of glucose transporter proteins, including twelve transmembrane domains, the conserved motives and amino acids involved in transport activity, ligands binding and membrane anchor. Therefore, we decided to name this sequence, glucose transporter 1 of L. vannamei (LvGLUT1). A partial gene sequence of 8.87 Kbp was also obtained; it contains the complete coding sequence divided in 10 exons. LvGlut1 expression was detected in hemocytes, hepatopancreas, intestine gills, muscle and pleopods. The higher relative expression was found in gills and the lower in hemocytes. This indicates that LvGlut1 is ubiquitously expressed but its levels are tissue-specific and upon short-term hypoxia, the GLUT1 transcripts increase 3.7-fold in hepatopancreas and gills. To our knowledge, this is the first evidence of expression of GLUT1 in crustaceans.

Frequency of the first feature in action sequences influences feature binding.

PubMed

Mattson, Paul S; Fournier, Lisa R; Behmer, Lawrence P

2012-10-01

We investigated whether binding among perception and action feature codes is a preliminary step toward creating a more durable memory trace of an action event. If so, increasing the frequency of a particular event (e.g., a stimulus requiring a movement with the left or right hand in an up or down direction) should increase the strength and speed of feature binding for this event. The results from two experiments, using a partial-repetition paradigm, confirmed that feature binding increased in strength and/or occurred earlier for a high-frequency (e.g., left hand moving up) than for a low-frequency (e.g., right hand moving down) event. Moreover, increasing the frequency of the first-specified feature in the action sequence alone (e.g., "left" hand) increased the strength and/or speed of action feature binding (e.g., between the "left" hand and movement in an "up" or "down" direction). The latter finding suggests an update to the theory of event coding, as not all features in the action sequence equally determine binding strength. We conclude that action planning involves serial binding of features in the order of action feature execution (i.e., associations among features are not bidirectional but are directional), which can lead to a more durable memory trace. This is consistent with physiological evidence suggesting that serial order is preserved in an action plan executed from memory and that the first feature in the action sequence may be critical in preserving this serial order.

Molecular cloning and characterization of a novel RING zinc-finger protein gene up-regulated under in vitro salt stress in cassava.

PubMed

dos Reis, Sávio Pinho; Tavares, Liliane de Souza Conceição; Costa, Carinne de Nazaré Monteiro; Brígida, Aílton Borges Santa; de Souza, Cláudia Regina Batista

2012-06-01

Cassava (Manihot esculenta Crantz) is one of the world's most important food crops. It is cultivated mainly in developing countries of tropics, since its root is a major source of calories for low-income people due to its high productivity and resistance to many abiotic and biotic factors. A previous study has identified a partial cDNA sequence coding for a putative RING zinc finger in cassava storage root. The RING zinc finger protein is a specialized type of zinc finger protein found in many organisms. Here, we isolated the full-length cDNA sequence coding for M. esculenta RZF (MeRZF) protein by a combination of 5' and 3' RACE assays. BLAST analysis showed that its deduced amino acid sequence has a high level of similarity to plant proteins of RZF family. MeRZF protein contains a signature sequence motif for a RING zinc finger at its C-terminal region. In addition, this protein showed a histidine residue at the fifth coordination site, likely belonging to the RING-H2 subgroup, as confirmed by our phylogenetic analysis. There is also a transmembrane domain in its N-terminal region. Finally, semi-quantitative RT-PCR assays showed that MeRZF expression is increased in detached leaves treated with sodium chloride. Here, we report the first evidence of a RING zinc finger gene of cassava showing potential role in response to salt stress.

Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)

NASA Technical Reports Server (NTRS)

Shibata, K.; Abe, S.; Davies, E.

2001-01-01

Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.

The effects of sex-biased gene expression and X-linkage on rates of sequence evolution in Drosophila.

PubMed

Campos, José Luis; Johnston, Keira; Charlesworth, Brian

2017-12-08

A faster rate of adaptive evolution of X-linked genes compared with autosomal genes (the faster-X effect) can be caused by the fixation of recessive or partially recessive advantageous mutations. This effect should be largest for advantageous mutations that affect only male fitness, and least for mutations that affect only female fitness. We tested these predictions in Drosophila melanogaster by using coding and functionally significant non-coding sequences of genes with different levels of sex-biased expression. Consistent with theory, nonsynonymous substitutions in most male-biased and unbiased genes show faster adaptive evolution on the X. However, genes with very low recombination rates do not show such an effect, possibly as a consequence of Hill-Robertson interference. Contrary to expectation, there was a substantial faster-X effect for female-biased genes. After correcting for recombination rate differences, however, female-biased genes did not show a faster X-effect. Similar analyses of non-coding UTRs and long introns showed a faster-X effect for all groups of genes, other than introns of female-biased genes. Given the strong evidence that deleterious mutations are mostly recessive or partially recessive, we would expect a slower rate of evolution of X-linked genes for slightly deleterious mutations that become fixed by genetic drift. Surprisingly, we found little evidence for this after correcting for recombination rate, implying that weakly deleterious mutations are mostly close to being semidominant. This is consistent with evidence from polymorphism data, which we use to test how models of selection that assume semidominance with no sex-specific fitness effects may bias estimates of purifying selection. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

[Transposition errors during learning to reproduce a sequence by the right- and the left-hand movements: simulation of positional and movement coding].

PubMed

Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N

2012-01-01

Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.

Informational structure of genetic sequences and nature of gene splicing

NASA Astrophysics Data System (ADS)

Trifonov, E. N.

1991-10-01

Only about 1/20 of DNA of higher organisms codes for proteins, by means of classical triplet code. The rest of DNA sequences is largely silent, with unclear functions, if any. The triplet code is not the only code (message) carried by the sequences. There are three levels of molecular communication, where the same sequence ``talks'' to various bimolecules, while having, respectively, three different appearances: DNA, RNA and protein. Since the molecular structures and, hence, sequence specific preferences of these are substantially different, the original DNA sequence has to carry simultaneously three types of sequence patterns (codes, messages), thus, being a composite structure in which one had the same letter (nucleotide) is frequently involved in several overlapping codes of different nature. This multiplicity and overlapping of the codes is a unique feature of the Gnomic, language of genetic sequences. The coexisting codes have to be degenerate in various degrees to allow an optimal and concerted performance of all the encoded functions. There is an obvious conflict between the best possible performance of a given function and necessity to compromise the quality of a given sequence pattern in favor of other patterns. It appears that the major role of various changes in the sequences on their ``ontogenetic'' way from DNA to RNA to protein, like RNA editing and splicing, or protein post-translational modifications is to resolve such conflicts. New data are presented strongly indicating that the gene splicing is such a device to resolve the conflict between the code of DNA folding in chromatin and the triplet code for protein synthesis.

Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

PubMed

Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

2004-01-01

The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

PubMed Central

de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

2000-01-01

Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

Developmental assessment of the Fort St. Vrain version of the Composite HTGR Analysis Program (CHAP-2)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stroh, K.R.

1980-01-01

The Composite HTGR Analysis Program (CHAP) consists of a model-independent systems analysis mainframe named LASAN and model-dependent linked code modules, each representing a component, subsystem, or phenomenon of an HTGR plant. The Fort St. Vrain (FSV) version (CHAP-2) includes 21 coded modules that model the neutron kinetics and thermal response of the core; the thermal-hydraulics of the reactor primary coolant system, secondary steam supply system, and balance-of-plant; the actions of the control system and plant protection system; the response of the reactor building; and the relative hazard resulting from fuel particle failure. FSV steady-state and transient plant data are beingmore » used to partially verify the component modeling and dynamic smulation techniques used to predict plant response to postulated accident sequences.« less

Genetic Code Analysis Toolkit: A novel tool to explore the coding properties of the genetic code and DNA sequences

NASA Astrophysics Data System (ADS)

Kraljić, K.; Strüngmann, L.; Fimmel, E.; Gumbel, M.

2018-01-01

The genetic code is degenerated and it is assumed that redundancy provides error detection and correction mechanisms in the translation process. However, the biological meaning of the code's structure is still under current research. This paper presents a Genetic Code Analysis Toolkit (GCAT) which provides workflows and algorithms for the analysis of the structure of nucleotide sequences. In particular, sets or sequences of codons can be transformed and tested for circularity, comma-freeness, dichotomic partitions and others. GCAT comes with a fertile editor custom-built to work with the genetic code and a batch mode for multi-sequence processing. With the ability to read FASTA files or load sequences from GenBank, the tool can be used for the mathematical and statistical analysis of existing sequence data. GCAT is Java-based and provides a plug-in concept for extensibility. Availability: Open source Homepage:http://www.gcat.bio/

Holding a manual response sequence in memory can disrupt vocal responses that share semantic features with the manual response.

PubMed

Fournier, Lisa Renee; Wiediger, Matthew D; McMeans, Ryan; Mattson, Paul S; Kirkwood, Joy; Herzog, Theibot

2010-07-01

Holding an action plan in memory for later execution can delay execution of another action if the actions share a similar (compatible) feature. This compatibility interference (CI) occurs for actions that share the same response modality (e.g., manual response). We investigated whether CI can generalize to actions that utilize different response modalities (manual and vocal). In three experiments, participants planned and withheld a sequence of key-presses with the left- or right-hand based on the visual identity of the first stimulus, and then immediately executed a speeded, vocal response ('left' or 'right') to a second visual stimulus. The vocal response was based on discriminating stimulus color (Experiment 1), reading a written word (Experiment 2), or reporting the antonym of a written word (Experiment 3). Results showed that CI occurred when the manual response hand (e.g., left) was compatible with the identity of the vocal response (e.g., 'left') in Experiment 1 and 3, but not in Experiment 2. This suggests that partial overlap of semantic codes is sufficient to obtain CI unless the intervening action can be accessed automatically (Experiment 2). These findings are consistent with the code occupation hypothesis and the general framework of the theory of event coding (Behav Brain Sci 24:849-878, 2001a; Behav Brain Sci 24:910-937, 2001b).

SEQassembly: A Practical Tools Program for Coding Sequences Splicing

NASA Astrophysics Data System (ADS)

Lee, Hongbin; Yang, Hang; Fu, Lei; Qin, Long; Li, Huili; He, Feng; Wang, Bo; Wu, Xiaoming

CDS (Coding Sequences) is a portion of mRNA sequences, which are composed by a number of exon sequence segments. The construction of CDS sequence is important for profound genetic analysis such as genotyping. A program in MATLAB environment is presented, which can process batch of samples sequences into code segments under the guide of reference exon models, and splice these code segments of same sample source into CDS according to the exon order in queue file. This program is useful in transcriptional polymorphism detection and gene function study.

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Statistical properties of DNA sequences

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

1995-01-01

We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

Cellulases and coding sequences

DOEpatents

Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

2001-02-20

The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.

Cellulases and coding sequences

DOEpatents

Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

2001-01-01

The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.

A high-throughput venom-gland transcriptome for the Eastern Diamondback Rattlesnake (Crotalus adamanteus) and evidence for pervasive positive selection across toxin classes.

PubMed

Rokyta, Darin R; Wray, Kenneth P; Lemmon, Alan R; Lemmon, Emily Moriarty; Caudle, S Brian

2011-04-01

Despite causing considerable human mortality and morbidity, animal toxins represent a valuable source of pharmacologically active macromolecules, a unique system for studying molecular adaptation, and a powerful framework for examining structure-function relationships in proteins. Snake venoms are particularly useful in the latter regard as they consist primarily of a moderate number of proteins and peptides that have been found to belong to just a handful of protein families. As these proteins and peptides are produced in dedicated glands, transcriptome sequencing has proven to be an effective approach to identifying the expressed toxin genes. We generated a venom-gland transcriptome for the Eastern Diamondback Rattlesnake (Crotalus adamanteus) using Roche 454 sequencing technology. In the current work, we focus on transcripts encoding toxins. We identified 40 unique toxin transcripts, 30 of which have full-length coding sequences, and 10 have only partial coding sequences. These toxins account for 24% of the total sequencing reads. We found toxins from 11 previously described families of snake-venom toxins and have discovered two putative, previously undescribed toxin classes. The most diverse and highly expressed toxin classes in the C. adamanteus venom-gland transcriptome are the serine proteinases, metalloproteinases, and C-type lectins. The serine proteinases are the most abundant class, accounting for 35% of the toxin sequencing reads. Metalloproteinases are the most diverse; 11 different forms have been identified. Using our sequences and those available in public databases, we detected positive selection in seven of the eight toxin families for which sufficient sequences were available for the analysis. We find that the vast majority of the genes that contribute directly to this vertebrate trait show evidence for a role for positive selection in their evolutionary history. Copyright © 2011 Elsevier Ltd. All rights reserved.

Complete Taiwanese Macaque (Macaca cyclopis) Mitochondrial Genome: Reference-Assisted de novo Assembly with Multiple k-mer Strategy.

PubMed

Huang, Yu-Feng; Midha, Mohit; Chen, Tzu-Han; Wang, Yu-Tai; Smith, David Glenn; Pei, Kurtis Jai-Chyi; Chiu, Kuo Ping

2015-01-01

The Taiwanese (Formosan) macaque (Macaca cyclopis) is the only nonhuman primate endemic to Taiwan. This primate species is valuable for evolutionary studies and as subjects in medical research. However, only partial fragments of the mitochondrial genome (mitogenome) of this primate species have been sequenced, not mentioning its nuclear genome. We employed next-generation sequencing to generate 2 x 90 bp paired-end reads, followed by reference-assisted de novo assembly with multiple k-mer strategy to characterize the M. cyclopis mitogenome. We compared the assembled mitogenome with that of other macaque species for phylogenetic analysis. Our results show that, the M. cyclopis mitogenome consists of 16,563 nucleotides encoding for 13 protein-coding genes, 2 ribosomal RNAs and 22 transfer RNAs. Phylogenetic analysis indicates that M. cyclopis is most closely related to M. mulatta lasiota (Chinese rhesus macaque), supporting the notion of Asia-continental origin of M. cyclopis proposed in previous studies based on partial mitochondrial sequences. Our work presents a novel approach for assembling a mitogenome that utilizes the capabilities of de novo genome assembly with assistance of a reference genome. The availability of the complete Taiwanese macaque mitogenome will facilitate the study of primate evolution and the characterization of genetic variations for the potential usage of this species as a non-human primate model for medical research.

Comparison of partial and full nitrification processes applied for treating high-strength nitrogen wastewaters: microbial ecology through nitrous oxide production.

PubMed

Ahn, Joon Ho; Kwan, Tiffany; Chandran, Kartik

2011-04-01

The goal of this study was to compare the microbial ecology, gene expression, biokinetics, and N2O emissions from a lab-scale bioreactor operated sequentially in full-nitrification and partial-nitrification modes. Based on sequencing of 16S rRNA and ammonia monooxygenase subunit A (amoA) genes, ammonia oxidizing bacteria (AOB) populations during full- and partial-nitrification modes were distinct from one another. The concentrations of AOB (XAOB) and their respiration rates during full- and partial-nitrification modes were statistically similar, whereas the concentrations of nitrite oxidizing bacteria (XNOB) and their respiration rates declined significantly after the switch from full- to partial-nitrification. The transition from full-nitrification to partial nitrification resulted in a protracted transient spike of nitrous oxide (N2O) and nitric oxide (NO) emissions, which later stabilized. The trends in N2O and NO emissions correlated well with trends in the expression of nirK and norB genes that code for the production of these gases in AOB. Both the transient and stabilized N2O and NO emissions during partial nitrification were statistically higher than those during steady-state full-nitrification. Based on these results, partial nitrification strategies for biological nitrogen removal, although attractive for their reduced operating costs and energy demand, may need to be optimized against the higher carbon foot-print attributed to their N2O emissions.

Some partial-unit-memory convolutional codes

NASA Technical Reports Server (NTRS)

Abdel-Ghaffar, K.; Mceliece, R. J.; Solomon, G.

1991-01-01

The results of a study on a class of error correcting codes called partial unit memory (PUM) codes are presented. This class of codes, though not entirely new, has until now remained relatively unexplored. The possibility of using the well developed theory of block codes to construct a large family of promising PUM codes is shown. The performance of several specific PUM codes are compared with that of the Voyager standard (2, 1, 6) convolutional code. It was found that these codes can outperform the Voyager code with little or no increase in decoder complexity. This suggests that there may very well be PUM codes that can be used for deep space telemetry that offer both increased performance and decreased implementational complexity over current coding systems.

Transcriptome discovery in non-model wild fish species for the development of quantitative transcript abundance assays.

PubMed

Hahn, Cassidy M; Iwanowicz, Luke R; Cornman, Robert S; Mazik, Patricia M; Blazer, Vicki S

2016-12-01

Environmental studies increasingly identify the presence of both contaminants of emerging concern (CECs) and legacy contaminants in aquatic environments; however, the biological effects of these compounds on resident fishes remain largely unknown. High throughput methodologies were employed to establish partial transcriptomes for three wild-caught, non-model fish species; smallmouth bass (Micropterus dolomieu), white sucker (Catostomus commersonii) and brown bullhead (Ameiurus nebulosus). Sequences from these transcriptome databases were utilized in the development of a custom nCounter CodeSet that allowed for direct multiplexed measurement of 50 transcript abundance endpoints in liver tissue. Sequence information was also utilized in the development of quantitative real-time PCR (qPCR) primers. Cross-species hybridization allowed the smallmouth bass nCounter CodeSet to be used for quantitative transcript abundance analysis of an additional non-model species, largemouth bass (Micropterus salmoides). We validated the nCounter analysis data system with qPCR for a subset of genes and confirmed concordant results. Changes in transcript abundance biomarkers between sexes and seasons were evaluated to provide baseline data on transcript modulation for each species of interest. Published by Elsevier Inc.

Widespread signatures of local mRNA folding structure selection in four Dengue virus serotypes

PubMed Central

2015-01-01

Background It is known that mRNA folding can affect and regulate various gene expression steps both in living organisms and in viruses. Previous studies have recognized functional RNA structures in the genome of the Dengue virus. However, these studies usually focused either on the viral untranslated regions or on very specific and limited regions at the beginning of the coding sequences, in a limited number of strains, and without considering evolutionary selection. Results Here we performed the first large scale comprehensive genomics analysis of selection for local mRNA folding strength in the Dengue virus coding sequences, based on a total of 1,670 genomes and 4 serotypes. Our analysis identified clusters of positions along the coding regions that may undergo a conserved evolutionary selection for strong or weak local folding maintained across different viral variants. Specifically, 53-66 clusters for strong folding and 49-73 clusters for weak folding (depending on serotype) aggregated of positions with a significant conservation of folding energy signals (related to partially overlapping local genomic regions) were recognized. In addition, up to 7% of these positions were found to be conserved in more than 90% of the viral genomes. Although some of the identified positions undergo frequent synonymous / non-synonymous substitutions, the selection for folding strength therein is preserved, and thus cannot be trivially explained based on sequence conservation alone. Conclusions The fact that many of the positions with significant folding related signals are conserved among different Dengue variants suggests that a better understanding of the mRNA structures in the corresponding regions may promote the development of prospective anti- Dengue vaccination strategies. The comparative genomics approach described here can be employed in the future for detecting functional regions in other pathogens with very high mutations rates. PMID:26449467

The complete chloroplast genome sequences of Lychnis wilfordii and Silene capitata and comparative analyses with other Caryophyllaceae genomes.

PubMed

Kang, Jong-Soo; Lee, Byoung Yoon; Kwak, Myounghai

2017-01-01

The complete chloroplast genomes of Lychnis wilfordii and Silene capitata were determined and compared with ten previously reported Caryophyllaceae chloroplast genomes. The chloroplast genome sequences of L. wilfordii and S. capitata contain 152,320 bp and 150,224 bp, respectively. The gene contents and orders among 12 Caryophyllaceae species are consistent, but several microstructural changes have occurred. Expansion of the inverted repeat (IR) regions at the large single copy (LSC)/IRb and small single copy (SSC)/IR boundaries led to partial or entire gene duplications. Additionally, rearrangements of the LSC region were caused by gene inversions and/or transpositions. The 18 kb inversions, which occurred three times in different lineages of tribe Sileneae, were thought to be facilitated by the intermolecular duplicated sequences. Sequence analyses of the L. wilfordii and S. capitata genomes revealed 39 and 43 repeats, respectively, including forward, palindromic, and reverse repeats. In addition, a total of 67 and 56 simple sequence repeats were discovered in the L. wilfordii and S. capitata chloroplast genomes, respectively. Finally, we constructed phylogenetic trees of the 12 Caryophyllaceae species and two Amaranthaceae species based on 73 protein-coding genes using both maximum parsimony and likelihood methods.

The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

1994-12-31

Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

Genomic clones for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kott, M.; Venta, P.J.; Larsen, J.

1987-05-01

A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Rational design of micro-RNA-like bifunctional siRNAs targeting HIV and the HIV coreceptor CCR5.

PubMed

Ehsani, Ali; Saetrom, Pål; Zhang, Jane; Alluin, Jessica; Li, Haitang; Snøve, Ola; Aagaard, Lars; Rossi, John J

2010-04-01

Small-interfering RNAs (siRNAs) and micro-RNAs (miRNAs) are distinguished by their modes of action. SiRNAs serve as guides for sequence-specific cleavage of complementary mRNAs and the targets can be in coding or noncoding regions of the target transcripts. MiRNAs inhibit translation via partially complementary base-pairing to 3' untranslated regions (UTRs) and are generally ineffective when targeting coding regions of a transcript. In this study, we deliberately designed siRNAs that simultaneously direct cleavage and translational suppression of HIV RNAs, or cleavage of the mRNA encoding the HIV coreceptor CCR5 and suppression of translation of HIV. These bifunctional siRNAs trigger inhibition of HIV infection and replication in cell culture. The design principles have wide applications throughout the genome, as about 90% of genes harbor sites that make the design of bifunctional siRNAs possible.

The complete mitochondrial genome of Chinese green hydra, Hydra sinensis (Hydroida: Hydridae).

PubMed

Pan, Hong-Chun; Qian, Xiao-Cheng; Li, Ping; Li, Xiao-Fei; Wang, An-Tai

2014-02-01

The complete mitochondrial genome of Chinese green hydra, Hydra sinensis (Hydroida: Hydridae) is a linear molecule of 16,189 bp in length, containing 13 protein-coding genes, small and large subunit ribosomal RNAs, methionine and tryptophan transfer RNAs, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mitochondrial DNA. The A + T content of the overall base composition of H-strand is 77.2% (T: 41.7%; C: 10.9%; A: 35.5%; and G: 11.9%). COI and ND1 genes begin with GTG as start codon, while other 11 protein-coding genes start with a typical ATG initiation codon. COII, ATP8, ATP6, COIII, ND5, ND6, ND3, ND1, ND4 and COI genes are terminated with TAA as stop codon, ND4L ends with TAG, ND2 ends with TA and Cyt b ends with T.

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

DNA barcode goes two-dimensions: DNA QR code web server.

PubMed

Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

2012-01-01

The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

Lichenase and coding sequences

DOEpatents

Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

2000-08-15

The present invention provides a fungal lichenase, i.e., an endo-1,3-1,4-.beta.-D-glucanohydrolase, its coding sequence, recombinant DNA molecules comprising the lichenase coding sequences, recombinant host cells and methods for producing same. The present lichenase is from Orpinomyces PC-2.

Transfer Function Bounds for Partial-unit-memory Convolutional Codes Based on Reduced State Diagram

NASA Technical Reports Server (NTRS)

Lee, P. J.

1984-01-01

The performance of a coding system consisting of a convolutional encoder and a Viterbi decoder is analytically found by the well-known transfer function bounding technique. For the partial-unit-memory byte-oriented convolutional encoder with m sub 0 binary memory cells and (k sub 0 m sub 0) inputs, a state diagram of 2(K) (sub 0) was for the transfer function bound. A reduced state diagram of (2 (m sub 0) +1) is used for easy evaluation of transfer function bounds for partial-unit-memory codes.

FRAGS: estimation of coding sequence substitution rates from fragmentary data

PubMed Central

Swart, Estienne C; Hide, Winston A; Seoighe, Cathal

2004-01-01

Background Rates of substitution in protein-coding sequences can provide important insights into evolutionary processes that are of biomedical and theoretical interest. Increased availability of coding sequence data has enabled researchers to estimate more accurately the coding sequence divergence of pairs of organisms. However the use of different data sources, alignment protocols and methods to estimate substitution rates leads to widely varying estimates of key parameters that define the coding sequence divergence of orthologous genes. Although complete genome sequence data are not available for all organisms, fragmentary sequence data can provide accurate estimates of substitution rates provided that an appropriate and consistent methodology is used and that differences in the estimates obtainable from different data sources are taken into account. Results We have developed FRAGS, an application framework that uses existing, freely available software components to construct in-frame alignments and estimate coding substitution rates from fragmentary sequence data. Coding sequence substitution estimates for human and chimpanzee sequences, generated by FRAGS, reveal that methodological differences can give rise to significantly different estimates of important substitution parameters. The estimated substitution rates were also used to infer upper-bounds on the amount of sequencing error in the datasets that we have analysed. Conclusion We have developed a system that performs robust estimation of substitution rates for orthologous sequences from a pair of organisms. Our system can be used when fragmentary genomic or transcript data is available from one of the organisms and the other is a completely sequenced genome within the Ensembl database. As well as estimating substitution statistics our system enables the user to manage and query alignment and substitution data. PMID:15005802

Visual pattern image sequence coding

NASA Technical Reports Server (NTRS)

Silsbee, Peter; Bovik, Alan C.; Chen, Dapang

1990-01-01

The visual pattern image coding (VPIC) configurable digital image-coding process is capable of coding with visual fidelity comparable to the best available techniques, at compressions which (at 30-40:1) exceed all other technologies. These capabilities are associated with unprecedented coding efficiencies; coding and decoding operations are entirely linear with respect to image size and entail a complexity that is 1-2 orders of magnitude faster than any previous high-compression technique. The visual pattern image sequence coding to which attention is presently given exploits all the advantages of the static VPIC in the reduction of information from an additional, temporal dimension, to achieve unprecedented image sequence coding performance.

Code Calibration Applied to the TCA High-Lift Model in the 14 x 22 Wind Tunnel (Simulation With and Without Model Post-Mount)

NASA Technical Reports Server (NTRS)

Lessard, Wendy B.

1999-01-01

The objective of this study is to calibrate a Navier-Stokes code for the TCA (30/10) baseline configuration (partial span leading edge flaps were deflected at 30 degs. and all the trailing edge flaps were deflected at 10 degs). The computational results for several angles of attack are compared with experimental force, moments, and surface pressures. The code used in this study is CFL3D; mesh sequencing and multi-grid were used to full advantage to accelerate convergence. A multi-grid approach was used similar to that used for the Reference H configuration allowing point-to-point matching across all the trailingedge block interfaces. From past experiences with the Reference H (ie, good force, moment, and pressure comparisons were obtained), it was assumed that the mounting system would produce small effects; hence, it was not initially modeled. However, comparisons of lower surface pressures indicated the post mount significantly influenced the lower surface pressures, so the post geometry was inserted into the existing grid using Chimera (overset grids).

Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

USGS Publications Warehouse

Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

2011-01-01

Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

[Influence of "prehistory" of sequential movements of the right and the left hand on reproduction: coding of positions, movements and sequence structure].

PubMed

Bobrova, E V; Liakhovetskiĭ, V A; Borshchevskaia, E R

2011-01-01

The dependence of errors during reproduction of a sequence of hand movements without visual feedback on the previous right- and left-hand performance ("prehistory") and on positions in space of sequence elements (random or ordered by the explicit rule) was analyzed. It was shown that the preceding information about the ordered positions of the sequence elements was used during right-hand movements, whereas left-hand movements were performed with involvement of the information about the random sequence. The data testify to a central mechanism of the analysis of spatial structure of sequence elements. This mechanism activates movement coding specific for the left hemisphere (vector coding) in case of an ordered sequence structure and positional coding specific for the right hemisphere in case of a random sequence structure.

Discrete Cosine Transform Image Coding With Sliding Block Codes

NASA Astrophysics Data System (ADS)

Divakaran, Ajay; Pearlman, William A.

1989-11-01

A transform trellis coding scheme for images is presented. A two dimensional discrete cosine transform is applied to the image followed by a search on a trellis structured code. This code is a sliding block code that utilizes a constrained size reproduction alphabet. The image is divided into blocks by the transform coding. The non-stationarity of the image is counteracted by grouping these blocks in clusters through a clustering algorithm, and then encoding the clusters separately. Mandela ordered sequences are formed from each cluster i.e identically indexed coefficients from each block are grouped together to form one dimensional sequences. A separate search ensues on each of these Mandela ordered sequences. Padding sequences are used to improve the trellis search fidelity. The padding sequences absorb the error caused by the building up of the trellis to full size. The simulations were carried out on a 256x256 image ('LENA'). The results are comparable to any existing scheme. The visual quality of the image is enhanced considerably by the padding and clustering.

DNA Barcode Goes Two-Dimensions: DNA QR Code Web Server

PubMed Central

Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

2012-01-01

The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, “DNA barcode” actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications. PMID:22574113

Detection and partial molecular characterization of atypical plum pox virus isolates from naturally infected sour cherry.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna

2013-06-01

Atypical isolates of plum pox virus (PPV) were discovered in naturally infected sour cherry in urban ornamental plantings in Moscow, Russia. The isolates were detected by polyclonal double antibody sandwich ELISA and RT-PCR using universal primers specific for the 3'-non-coding and coat protein (CP) regions of the genome but failed to be recognized by triple antibody sandwich ELISA with the universal monoclonal antibody 5B and by RT-PCR using primers specific to for PPV strains D, M, C and W. Sequence analysis of the CP genes of nine isolates revealed 99.2-100 % within-group identity and 62-85 % identity to conventional PPV strains. Phylogenetic analysis showed that the atypical isolates represent a group that is distinct from the known PPV strains. Alignment of the N-terminal amino acid sequences of CP demonstrated their close similarity to those of a new tentative PPV strain, CR.

CRITICA: coding region identification tool invoking comparative analysis

NASA Technical Reports Server (NTRS)

Badger, J. H.; Olsen, G. J.; Woese, C. R. (Principal Investigator)

1999-01-01

Gene recognition is essential to understanding existing and future DNA sequence data. CRITICA (Coding Region Identification Tool Invoking Comparative Analysis) is a suite of programs for identifying likely protein-coding sequences in DNA by combining comparative analysis of DNA sequences with more common noncomparative methods. In the comparative component of the analysis, regions of DNA are aligned with related sequences from the DNA databases; if the translation of the aligned sequences has greater amino acid identity than expected for the observed percentage nucleotide identity, this is interpreted as evidence for coding. CRITICA also incorporates noncomparative information derived from the relative frequencies of hexanucleotides in coding frames versus other contexts (i.e., dicodon bias). The dicodon usage information is derived by iterative analysis of the data, such that CRITICA is not dependent on the existence or accuracy of coding sequence annotations in the databases. This independence makes the method particularly well suited for the analysis of novel genomes. CRITICA was tested by analyzing the available Salmonella typhimurium DNA sequences. Its predictions were compared with the DNA sequence annotations and with the predictions of GenMark. CRITICA proved to be more accurate than GenMark, and moreover, many of its predictions that would seem to be errors instead reflect problems in the sequence databases. The source code of CRITICA is freely available by anonymous FTP (rdp.life.uiuc.edu in/pub/critica) and on the World Wide Web (http:/(/)rdpwww.life.uiuc.edu).

Frequency Hopping, Multiple Frequency-Shift Keying, Coding, and Optimal Partial-Band Jamming.

DTIC Science & Technology

1982-08-01

receivers appropriate for these two strategies. Each receiver is noncoherent (a coherent receiver is generally impractical) and implements hard...Advances in Coding and Modulation for Noncoherent Channels Affected by Fading, Partial Band, and Multiple- . Access Interference, in A. J. Viterbi...Modulation for Noncoherent Channels Affected by Fading, Partial Band, and Multiple-Access interference, in A. J. Viterbi, ed., Advances in Coumunication

Flexible manipulation of terahertz wave reflection using polarization insensitive coding metasurfaces.

PubMed

Jiu-Sheng, Li; Ze-Jiang, Zhao; Jian-Quan, Yao

2017-11-27

In order to extend to 3-bit encoding, we propose notched-wheel structures as polarization insensitive coding metasurfaces to control terahertz wave reflection and suppress backward scattering. By using a coding sequence of "00110011…" along x-axis direction and 16 × 16 random coding sequence, we investigate the polarization insensitive properties of the coding metasurfaces. By designing the coding sequences of the basic coding elements, the terahertz wave reflection can be flexibly manipulated. Additionally, radar cross section (RCS) reduction in the backward direction is less than -10dB in a wide band. The present approach can offer application for novel terahertz manipulation devices.

Cloning, overexpression and interaction of recombinant Fur from the cyanobacterium Anabaena PCC 7119 with isiB and its own promoter.

PubMed

Bes, M T; Hernández, J A; Peleato, M L; Fillat, M F

2001-01-15

A gene coding for a Fur (ferric uptake regulation) protein from the cyanobacterium Anabaena PCC 7119 has been cloned and overexpressed in Escherichia coli. DNA sequence analysis confirmed the presence of a 151-amino-acid open reading frame that showed homology with the Fur proteins reported for the unicellular cyanobacteria Synechococcus 7942 and Synechocystis PCC 6803. Two putative Fur-binding sites were detected in the promoter regions of the fur gene from Anabaena. Partially purified recombinant Fur binds to the flavodoxin promoter as well as its own promoter. This suggests that the Fur gene is autoregulated in Anabaena.

Molecular basis of the polydispersity of mucins: implications for the generation of saccharide diversity.

PubMed

Bhavanandan, V P; Gupta, D; Woitach, J; Guo, X; Jiang, W

1999-06-01

Secreted epithelial mucins are large macromolecules which exhibit extreme polydispersity, the molecular basis of which is not fully understood. We have obtained partial sequences of two genes (BSM1 and BSM2) coding for two distinct molecules. This is the first time that such closely-related genes have been identified for any mucin from an animal. We propose that a combination of multiple homologous genes, alternative splicing, differential glycosylation, and additional post-translational processing all contribute to the extreme polydispersity of mucins. The multiple domain structure and non-identical tandem repeats are also very important for the generation of the saccharide diversities of mucins.

Identification of a Novel Renal Coccidian (Apicomplexa: Eimeriidae) from the Great-Horned Owl ( Bubo virginianus ), USA.

PubMed

Jankovsky, Jennie M; Brand, Mabre; Gerhold, Richard W

2017-04-01

We diagnosed renal coccidiosis in two of five Great-horned Owls ( Bubo virginianus ) examined in eastern Tennessee, US, 2007-13. Histopathologic examination of the kidneys revealed multifocal mild-to-moderate dilation and epithelial hyperplasia of collecting ducts. Renal collecting duct epithelial cells contained intracytoplasmic microgametocytes, macrogametocytes, and sporulating and sporulated oocysts. Renal coccidiosis in affected birds did not result in significant inflammation. Sequence analysis of the amplified partial 18S short subunit ribosomal RNA coding region from examination of formalin fixed tissue by using PCR disclosed a 93% identity to Eimeria reichenowi in GenBank, suggesting a novel Eimeria sp.

Noncoding sequence classification based on wavelet transform analysis: part I

NASA Astrophysics Data System (ADS)

Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

2017-09-01

DNA sequences in human genome can be divided into the coding and noncoding ones. Coding sequences are those that are read during the transcription. The identification of coding sequences has been widely reported in literature due to its much-studied periodicity. Noncoding sequences represent the majority of the human genome. They play an important role in gene regulation and differentiation among the cells. However, noncoding sequences do not exhibit periodicities that correlate to their functions. The ENCODE (Encyclopedia of DNA elements) and Epigenomic Roadmap Project projects have cataloged the human noncoding sequences into specific functions. We study characteristics of noncoding sequences with wavelet analysis of genomic signals.

Converting Panax ginseng DNA and chemical fingerprints into two-dimensional barcode.

PubMed

Cai, Yong; Li, Peng; Li, Xi-Wen; Zhao, Jing; Chen, Hai; Yang, Qing; Hu, Hao

2017-07-01

In this study, we investigated how to convert the Panax ginseng DNA sequence code and chemical fingerprints into a two-dimensional code. In order to improve the compression efficiency, GATC2Bytes and digital merger compression algorithms are proposed. HPLC chemical fingerprint data of 10 groups of P. ginseng from Northeast China and the internal transcribed spacer 2 (ITS2) sequence code as the DNA sequence code were ready for conversion. In order to convert such data into a two-dimensional code, the following six steps were performed: First, the chemical fingerprint characteristic data sets were obtained through the inflection filtering algorithm. Second, precompression processing of such data sets is undertaken. Third, precompression processing was undertaken with the P. ginseng DNA (ITS2) sequence codes. Fourth, the precompressed chemical fingerprint data and the DNA (ITS2) sequence code were combined in accordance with the set data format. Such combined data can be compressed by Zlib, an open source data compression algorithm. Finally, the compressed data generated a two-dimensional code called a quick response code (QR code). Through the abovementioned converting process, it can be found that the number of bytes needed for storing P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can be greatly reduced. After GTCA2Bytes algorithm processing, the ITS2 compression rate reaches 75% and the chemical fingerprint compression rate exceeds 99.65% via filtration and digital merger compression algorithm processing. Therefore, the overall compression ratio even exceeds 99.36%. The capacity of the formed QR code is around 0.5k, which can easily and successfully be read and identified by any smartphone. P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can form a QR code after data processing, and therefore the QR code can be a perfect carrier of the authenticity and quality of P. ginseng information. This study provides a theoretical basis for the development of a quality traceability system of traditional Chinese medicine based on a two-dimensional code.

The convergence of the order sequence and the solution function sequence on fractional partial differential equation

NASA Astrophysics Data System (ADS)

Rusyaman, E.; Parmikanti, K.; Chaerani, D.; Asefan; Irianingsih, I.

2018-03-01

One of the application of fractional ordinary differential equation is related to the viscoelasticity, i.e., a correlation between the viscosity of fluids and the elasticity of solids. If the solution function develops into function with two or more variables, then its differential equation must be changed into fractional partial differential equation. As the preliminary study for two variables viscoelasticity problem, this paper discusses about convergence analysis of function sequence which is the solution of the homogenous fractional partial differential equation. The method used to solve the problem is Homotopy Analysis Method. The results show that if given two real number sequences (αn) and (βn) which converge to α and β respectively, then the solution function sequences of fractional partial differential equation with order (αn, βn) will also converge to the solution function of fractional partial differential equation with order (α, β).

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome

PubMed Central

Camargo, Anamaria A.; Samaia, Helena P. B.; Dias-Neto, Emmanuel; Simão, Daniel F.; Migotto, Italo A.; Briones, Marcelo R. S.; Costa, Fernando F.; Aparecida Nagai, Maria; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; Sonati, Maria de Fátima; Tajara, Eloiza H.; Valentini, Sandro R.; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Arnaldi, Liliane A. T.; de Assis, Angela M.; Bengtson, Mário Henrique; Bergamo, Nadia Aparecida; Bombonato, Vanessa; de Camargo, Maria E. R.; Canevari, Renata A.; Carraro, Dirce M.; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Corrêa, Rosana F. R.; Costa, Maria Cristina R.; Curcio, Cyntia; Hokama, Paula O. M.; Ferreira, Ari J. S.; Furuzawa, Gilberto K.; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Krieger, José E.; Leite, Luciana C. C.; Majumder, Paromita; Marins, Mozart; Marques, Everaldo R.; Melo, Analy S. A.; Melo, Monica; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana G.; Prevedel, Aline C.; Rahal, Paula; Rainho, Claudia A.; Reis, Eduardo M. R.; Ribeiro, Marcelo L.; da Rós, Nancy; de Sá, Renata G.; Sales, Magaly M.; Sant'anna, Simone Cristina; dos Santos, Mariana L.; da Silva, Aline M.; da Silva, Neusa P.; Silva, Wilson A.; da Silveira, Rosana A.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Soares, Fernando; Moreira, Eloisa S.; Nunes, Diana N.; Correa, Ricardo G.; Zalcberg, Heloisa; Carvalho, Alex F.; Reis, Luis F. L.; Brentani, Ricardo R.; Simpson, Andrew J. G.; de Souza, Sandro J.

2001-01-01

Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription–PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning. PMID:11593022

The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome.

PubMed

Camargo, A A; Samaia, H P; Dias-Neto, E; Simão, D F; Migotto, I A; Briones, M R; Costa, F F; Nagai, M A; Verjovski-Almeida, S; Zago, M A; Andrade, L E; Carrer, H; El-Dorry, H F; Espreafico, E M; Habr-Gama, A; Giannella-Neto, D; Goldman, G H; Gruber, A; Hackel, C; Kimura, E T; Maciel, R M; Marie, S K; Martins, E A; Nobrega, M P; Paco-Larson, M L; Pardini, M I; Pereira, G G; Pesquero, J B; Rodrigues, V; Rogatto, S R; da Silva, I D; Sogayar, M C; Sonati, M F; Tajara, E H; Valentini, S R; Alberto, F L; Amaral, M E; Aneas, I; Arnaldi, L A; de Assis, A M; Bengtson, M H; Bergamo, N A; Bombonato, V; de Camargo, M E; Canevari, R A; Carraro, D M; Cerutti, J M; Correa, M L; Correa, R F; Costa, M C; Curcio, C; Hokama, P O; Ferreira, A J; Furuzawa, G K; Gushiken, T; Ho, P L; Kimura, E; Krieger, J E; Leite, L C; Majumder, P; Marins, M; Marques, E R; Melo, A S; Melo, M B; Mestriner, C A; Miracca, E C; Miranda, D C; Nascimento, A L; Nobrega, F G; Ojopi, E P; Pandolfi, J R; Pessoa, L G; Prevedel, A C; Rahal, P; Rainho, C A; Reis, E M; Ribeiro, M L; da Ros, N; de Sa, R G; Sales, M M; Sant'anna, S C; dos Santos, M L; da Silva, A M; da Silva, N P; Silva, W A; da Silveira, R A; Sousa, J F; Stecconi, D; Tsukumo, F; Valente, V; Soares, F; Moreira, E S; Nunes, D N; Correa, R G; Zalcberg, H; Carvalho, A F; Reis, L F; Brentani, R R; Simpson, A J; de Souza, S J; Melo, M

2001-10-09

Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription-PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning.

ScaffoldSeq: Software for characterization of directed evolution populations.

PubMed

Woldring, Daniel R; Holec, Patrick V; Hackel, Benjamin J

2016-07-01

ScaffoldSeq is software designed for the numerous applications-including directed evolution analysis-in which a user generates a population of DNA sequences encoding for partially diverse proteins with related functions and would like to characterize the single site and pairwise amino acid frequencies across the population. A common scenario for enzyme maturation, antibody screening, and alternative scaffold engineering involves naïve and evolved populations that contain diversified regions, varying in both sequence and length, within a conserved framework. Analyzing the diversified regions of such populations is facilitated by high-throughput sequencing platforms; however, length variability within these regions (e.g., antibody CDRs) encumbers the alignment process. To overcome this challenge, the ScaffoldSeq algorithm takes advantage of conserved framework sequences to quickly identify diverse regions. Beyond this, unintended biases in sequence frequency are generated throughout the experimental workflow required to evolve and isolate clones of interest prior to DNA sequencing. ScaffoldSeq software uniquely handles this issue by providing tools to quantify and remove background sequences, cluster similar protein families, and dampen the impact of dominant clones. The software produces graphical and tabular summaries for each region of interest, allowing users to evaluate diversity in a site-specific manner as well as identify epistatic pairwise interactions. The code and detailed information are freely available at http://research.cems.umn.edu/hackel. Proteins 2016; 84:869-874. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Novel Xylose Dehydrogenase in the Halophilic Archaeon Haloarcula marismortui†

PubMed Central

Johnsen, Ulrike; Schönheit, Peter

2004-01-01

During growth of the halophilic archaeon Haloarcula marismortui on d-xylose, a specific d-xylose dehydrogenase was induced. The enzyme was purified to homogeneity. It constitutes a homotetramer of about 175 kDa and catalyzed the oxidation of xylose with both NADP+ and NAD+ as cosubstrates with 10-fold higher affinity for NADP+. In addition to d-xylose, d-ribose was oxidized at similar kinetic constants, whereas d-glucose was used with about 70-fold lower catalytic efficiency (kcat/Km). With the N-terminal amino acid sequence of the subunit, an open reading frame (ORF)—coding for a 39.9-kDA protein—was identified in the partially sequenced genome of H. marismortui. The function of the ORF as the gene designated xdh and coding for xylose dehydrogenase was proven by its functional overexpression in Escherichia coli. The recombinant enzyme was reactivated from inclusion bodies following solubilization in urea and refolding in the presence of salts, reduced and oxidized glutathione, and substrates. Xylose dehydrogenase showed the highest sequence similarity to glucose-fructose oxidoreductase from Zymomonas mobilis and other putative bacterial and archaeal oxidoreductases. Activities of xylose isomerase and xylulose kinase, the initial reactions of xylose catabolism of most bacteria, could not be detected in xylose-grown cells of H. marismortui, and the genes that encode them, xylA and xylB, were not found in the genome of H. marismortui. Thus, we propose that this first characterized archaeal xylose dehydrogenase catalyzes the initial step in xylose degradation by H. marismortui. PMID:15342590

Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

PubMed Central

Liu, X; Gorovsky, M A

1996-01-01

A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

Identification of a glycine-rich protein from the tick Rhipicephalus haemaphysaloides and evaluation of its vaccine potential against tick feeding.

PubMed

Zhou, Jinlin; Gong, Haiyan; Zhou, Yongzhi; Xuan, Xuenan; Fujisaki, Kozo

2006-12-01

A cDNA coding a glycine-rich protein was identified from the Rhipicephalus haemaphysaloides tick. The cDNA named here as RH50 was 1,823 bp, including a single open reading frame (ORF) of 1,518 nucleotides. The ORF encodes a polypeptide of 506 amino acid residues with a size of 50 kDa, as calculated by a computer. The predicted amino acid sequence of RH50 showed a low homology to sequences of some known extracellular matrix-like proteins. The native protein was identified in both the fed tick salivary gland lysates and extracts of cement material using the serum against the recombinant protein. Reverse transcription polymerase chain reaction results showed that RH50 mRNA was only transcribed in partially fed tick salivary glands, not in unfed tick salivary glands or partially fed tick midgut, fat body, or ovary. The differential expression of RH50 protein in fed tick salivary glands was confirmed by immunofluorescence. The low attachment rate both in the adult and nymphal tick, and the high mortality of immature ticks (nymph) feeding on recombinant RH50-immunized rabbits were found. These results show that the RH50 protein could be a useful candidate for anti-tick vaccine development.

Is a Genome a Codeword of an Error-Correcting Code?

PubMed Central

Kleinschmidt, João H.; Silva-Filho, Márcio C.; Bim, Edson; Herai, Roberto H.; Yamagishi, Michel E. B.; Palazzo, Reginaldo

2012-01-01

Since a genome is a discrete sequence, the elements of which belong to a set of four letters, the question as to whether or not there is an error-correcting code underlying DNA sequences is unavoidable. The most common approach to answering this question is to propose a methodology to verify the existence of such a code. However, none of the methodologies proposed so far, although quite clever, has achieved that goal. In a recent work, we showed that DNA sequences can be identified as codewords in a class of cyclic error-correcting codes known as Hamming codes. In this paper, we show that a complete intron-exon gene, and even a plasmid genome, can be identified as a Hamming code codeword as well. Although this does not constitute a definitive proof that there is an error-correcting code underlying DNA sequences, it is the first evidence in this direction. PMID:22649495

Striking similarities in amino acid sequence among nonstructural proteins encoded by RNA viruses that have dissimilar genomic organization.

PubMed Central

Haseloff, J; Goelet, P; Zimmern, D; Ahlquist, P; Dasgupta, R; Kaesberg, P

1984-01-01

The plant viruses alfalfa mosaic virus (AMV) and brome mosaic virus (BMV) each divide their genetic information among three RNAs while tobacco mosaic virus (TMV) contains a single genomic RNA. Amino acid sequence comparisons suggest that the single proteins encoded by AMV RNA 1 and BMV RNA 1 and by AMV RNA 2 and BMV RNA 2 are related to the NH2-terminal two-thirds and the COOH-terminal one-third, respectively, of the largest protein encoded by TMV. Separating these two domains in the TMV RNA sequence is an amber termination codon, whose partial suppression allows translation of the downstream domain. Many of the residues that the TMV read-through domain and the segmented plant viruses have in common are also conserved in a read-through domain found in the nonstructural polyprotein of the animal alphaviruses Sindbis and Middelburg. We suggest that, despite substantial differences in gene organization and expression, all of these viruses use related proteins for common functions in RNA replication. Reassortment of functional modules of coding and regulatory sequence from preexisting viral or cellular sources, perhaps via RNA recombination, may be an important mechanism in RNA virus evolution. PMID:6611550

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

Haplogroup relationships between domestic and wild sheep resolved using a mitogenome panel.

PubMed

Meadows, J R S; Hiendleder, S; Kijas, J W

2011-04-01

Five haplogroups have been identified in domestic sheep through global surveys of mitochondrial (mt) sequence variation, however these group classifications are often based on small fragments of the complete mtDNA sequence; partial control region or the cytochrome B gene. This study presents the complete mitogenome from representatives of each haplogroup identified in domestic sheep, plus a sample of their wild relatives. Comparison of the sequence successfully resolved the relationships between each haplogroup and provided insight into the relationship with wild sheep. The five haplogroups were characterised as branching independently, a radiation that shared a common ancestor 920,000 ± 190,000 years ago based on protein coding sequence. The utility of various mtDNA components to inform the true relationship between sheep was also examined with Bayesian, maximum likelihood and partitioned Bremmer support analyses. The control region was found to be the mtDNA component, which contributed the highest amount of support to the tree generated using the complete data set. This study provides the nucleus of a mtDNA mitogenome panel, which can be used to assess additional mitogenomes and serve as a reference set to evaluate small fragments of the mtDNA.

Haplogroup relationships between domestic and wild sheep resolved using a mitogenome panel

PubMed Central

Meadows, J R S; Hiendleder, S; Kijas, J W

2011-01-01

Five haplogroups have been identified in domestic sheep through global surveys of mitochondrial (mt) sequence variation, however these group classifications are often based on small fragments of the complete mtDNA sequence; partial control region or the cytochrome B gene. This study presents the complete mitogenome from representatives of each haplogroup identified in domestic sheep, plus a sample of their wild relatives. Comparison of the sequence successfully resolved the relationships between each haplogroup and provided insight into the relationship with wild sheep. The five haplogroups were characterised as branching independently, a radiation that shared a common ancestor 920 000±190 000 years ago based on protein coding sequence. The utility of various mtDNA components to inform the true relationship between sheep was also examined with Bayesian, maximum likelihood and partitioned Bremmer support analyses. The control region was found to be the mtDNA component, which contributed the highest amount of support to the tree generated using the complete data set. This study provides the nucleus of a mtDNA mitogenome panel, which can be used to assess additional mitogenomes and serve as a reference set to evaluate small fragments of the mtDNA. PMID:20940734

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lagrimini, L.M.

Since this manuscript was submitted we have conducted a more thorough physiological analysis of water relations in wild-type and peroxidase overproducing plants. These experiments include pressure bomb, plasmolysis, and membrane integrity analysis. We are also in the process of analyzing other phenotypes in peroxidase overproducer plants such as excessive browning of tissue, the rapid death of tissue in culture, and poor germination of seed. Transformed plants of Nicotiana tabacum and Nicotiana sylvestris were obtained which have peroxidase activity 3--7 fold lower than wild-type plants. This was done by introducing a chimeric gene composed of the CaMV 35S promoter and themore » 5' half of the tobacco anionic peroxidase cDNA in the antisense RNA configuration. A manuscript which describes this work is being written, and will be submitted for publication in January 1990. The anionic peroxidase gene has been cloned by hybridization to the cloned cDNA. The entire gene is contained on an 8.7kb fragment within a lambda phage clone. Several smaller DNA fragments have been subcloned, and some have been sequenced. One exon within the coding sequence has been sequenced, along with the partial sequence of two introns. Further sequencing is being carried-out to identify the promoter, which will be later joined to a reporter gene. 6 figs.« less

Pattern recognition of electronic bit-sequences using a semiconductor mode-locked laser and spatial light modulators

NASA Astrophysics Data System (ADS)

Bhooplapur, Sharad; Akbulut, Mehmetkan; Quinlan, Franklyn; Delfyett, Peter J.

2010-04-01

A novel scheme for recognition of electronic bit-sequences is demonstrated. Two electronic bit-sequences that are to be compared are each mapped to a unique code from a set of Walsh-Hadamard codes. The codes are then encoded in parallel on the spectral phase of the frequency comb lines from a frequency-stabilized mode-locked semiconductor laser. Phase encoding is achieved by using two independent spatial light modulators based on liquid crystal arrays. Encoded pulses are compared using interferometric pulse detection and differential balanced photodetection. Orthogonal codes eight bits long are compared, and matched codes are successfully distinguished from mismatched codes with very low error rates, of around 10-18. This technique has potential for high-speed, high accuracy recognition of bit-sequences, with applications in keyword searches and internet protocol packet routing.

Two Perspectives on the Origin of the Standard Genetic Code

NASA Astrophysics Data System (ADS)

Sengupta, Supratim; Aggarwal, Neha; Bandhu, Ashutosh Vishwa

2014-12-01

The origin of a genetic code made it possible to create ordered sequences of amino acids. In this article we provide two perspectives on code origin by carrying out simulations of code-sequence coevolution in finite populations with the aim of examining how the standard genetic code may have evolved from more primitive code(s) encoding a small number of amino acids. We determine the efficacy of the physico-chemical hypothesis of code origin in the absence and presence of horizontal gene transfer (HGT) by allowing a diverse collection of code-sequence sets to compete with each other. We find that in the absence of horizontal gene transfer, natural selection between competing codes distinguished by differences in the degree of physico-chemical optimization is unable to explain the structure of the standard genetic code. However, for certain probabilities of the horizontal transfer events, a universal code emerges having a structure that is consistent with the standard genetic code.

Interuser Interference Analysis for Direct-Sequence Spread-Spectrum Systems Part I: Partial-Period Cross-Correlation

NASA Technical Reports Server (NTRS)

Ni, Jianjun (David)

2012-01-01

This presentation discusses an analysis approach to evaluate the interuser interference for Direct-Sequence Spread-Spectrum (DSSS) Systems for Space Network (SN) Users. Part I of this analysis shows that the correlation property of pseudo noise (PN) sequences is the critical factor which determines the interuser interference performance of the DSSS system. For non-standard DSSS systems in which PN sequence s period is much larger than one data symbol duration, it is the partial-period cross-correlation that determines the system performance. This study reveals through an example that a well-designed PN sequence set (e.g. Gold Sequence, in which the cross-correlation for a whole-period is well controlled) may have non-controlled partial-period cross-correlation which could cause severe interuser interference for a DSSS system. Since the analytical derivation of performance metric (bit error rate or signal-to-noise ratio) based on partial-period cross-correlation is prohibitive, the performance degradation due to partial-period cross-correlation will be evaluated using simulation in Part II of this analysis in the future.

An algebraic hypothesis about the primeval genetic code architecture.

PubMed

Sánchez, Robersy; Grau, Ricardo

2009-09-01

A plausible architecture of an ancient genetic code is derived from an extended base triplet vector space over the Galois field of the extended base alphabet {D,A,C,G,U}, where symbol D represents one or more hypothetical bases with unspecific pairings. We hypothesized that the high degeneration of a primeval genetic code with five bases and the gradual origin and improvement of a primeval DNA repair system could make possible the transition from ancient to modern genetic codes. Our results suggest that the Watson-Crick base pairing G identical with C and A=U and the non-specific base pairing of the hypothetical ancestral base D used to define the sum and product operations are enough features to determine the coding constraints of the primeval and the modern genetic code, as well as, the transition from the former to the latter. Geometrical and algebraic properties of this vector space reveal that the present codon assignment of the standard genetic code could be induced from a primeval codon assignment. Besides, the Fourier spectrum of the extended DNA genome sequences derived from the multiple sequence alignment suggests that the called period-3 property of the present coding DNA sequences could also exist in the ancient coding DNA sequences. The phylogenetic analyses achieved with metrics defined in the N-dimensional vector space (B(3))(N) of DNA sequences and with the new evolutionary model presented here also suggest that an ancient DNA coding sequence with five or more bases does not contradict the expected evolutionary history.

Homoeologous cloning of omega-secalin gene family in a wheat 1BL/1RS translocation.

PubMed

Chai, Jian Fang; Liu, Xu; Jia, Ji Zeng

2005-08-01

Wheat 1BL/1RS translocations are widely planted in China as well as in most of the wheat producing area in the world for their good qualities of disease resistance and high yield. 1BL/1RS translocations are however poor in bread making, partially caused by a family of small monomeric proteins, omega-secalins, which are encoded by genes on 1RS. Based on published sequence of a rye omega-secalin gene we designed a pair of primers to cover the whole mature protein coding sequence. A major band could be amplified from 1BL/1RS translocations but not from euploid wheat. Using this primer set we conducted PCR amplification by using high fidelity Pfu polymerase on the genomic DNAs and cDNAs purified from a 1BL/1RS translocation Lankao 906. Sequencing analysis indicated that this gene family contains several members of 1150 bp, 1076 bp, 1075 bp, 1052 bp and 1004 bp genes, including two pseudogenes and three active genes. The gene transcripts were differentially expressed in developing seeds.

A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

PubMed Central

Clos, J; Buttgereit, D; Grummt, I

1986-01-01

A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

A novel flavivirus detected in two Aedes spp. collected near the demilitarized zone of the Republic of Korea.

PubMed

Korkusol, Achareeya; Takhampunya, Ratree; Hang, Jun; Jarman, Richard G; Tippayachai, Bousaraporn; Kim, Heung-Chul; Chong, Sung-Tae; Davidson, Silas A; Klein, Terry A

2017-05-01

Flaviviruses comprise a large and diverse group of positive-stranded RNA viruses, including tick-, mosquito- and unknown-vector-borne flaviviruses. A novel flavivirus was detected in pools of Aedes vexans nipponii (n=1) and Aedes esoensis (n=3) collected in 2012 and 2013 near the demilitarized zone (DMZ), Republic of Korea (ROK). Phylogenetic analyses of the NS5, E gene and complete polyprotein coding sequence (CDS) showed that the novel virus fell within the Aedes-borne flaviviruses (ABFVs), with nucleotide identity ranging from 57.8-75.1 %, 46.1-74.2 % and 51.1-76.2 %, respectively. While the novel ABFV was distant from other flaviviruses within the group, it formed a clade with Ilomantsi virus (ILOV). Sequence alignments of the partial NS5 gene, full-length E gene and polyprotein CDS between the novel virus and ILOV showed approximately 76.2 % nucleotide identity and 90 % amino acid identity, respectively. The ABFV identified in Aedes mosquitoes from the ROK is a novel ABFV based on the sequence analyses and is designated as Panmunjeom flavivirus (PANFV).

Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

NASA Astrophysics Data System (ADS)

Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

2017-07-01

DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

A Novel Partial Sequence Alignment Tool for Finding Large Deletions

PubMed Central

Aruk, Taner; Ustek, Duran; Kursun, Olcay

2012-01-01

Finding large deletions in genome sequences has become increasingly more useful in bioinformatics, such as in clinical research and diagnosis. Although there are a number of publically available next generation sequencing mapping and sequence alignment programs, these software packages do not correctly align fragments containing deletions larger than one kb. We present a fast alignment software package, BinaryPartialAlign, that can be used by wet lab scientists to find long structural variations in their experiments. For BinaryPartialAlign, we make use of the Smith-Waterman (SW) algorithm with a binary-search-based approach for alignment with large gaps that we called partial alignment. BinaryPartialAlign implementation is compared with other straight-forward applications of SW. Simulation results on mtDNA fragments demonstrate the effectiveness (runtime and accuracy) of the proposed method. PMID:22566777

Circular codes revisited: a statistical approach.

PubMed

Gonzalez, D L; Giannerini, S; Rosa, R

2011-04-21

In 1996 Arquès and Michel [1996. A complementary circular code in the protein coding genes. J. Theor. Biol. 182, 45-58] discovered the existence of a common circular code in eukaryote and prokaryote genomes. Since then, circular code theory has provoked great interest and underwent a rapid development. In this paper we discuss some theoretical issues related to the synchronization properties of coding sequences and circular codes with particular emphasis on the problem of retrieval and maintenance of the reading frame. Motivated by the theoretical discussion, we adopt a rigorous statistical approach in order to try to answer different questions. First, we investigate the covering capability of the whole class of 216 self-complementary, C(3) maximal codes with respect to a large set of coding sequences. The results indicate that, on average, the code proposed by Arquès and Michel has the best covering capability but, still, there exists a great variability among sequences. Second, we focus on such code and explore the role played by the proportion of the bases by means of a hierarchy of permutation tests. The results show the existence of a sort of optimization mechanism such that coding sequences are tailored as to maximize or minimize the coverage of circular codes on specific reading frames. Such optimization clearly relates the function of circular codes with reading frame synchronization. Copyright © 2011 Elsevier Ltd. All rights reserved.

Automated conserved non-coding sequence (CNS) discovery reveals differences in gene content and promoter evolution among grasses

PubMed Central

Turco, Gina; Schnable, James C.; Pedersen, Brent; Freeling, Michael

2013-01-01

Conserved non-coding sequences (CNS) are islands of non-coding sequence that, like protein coding exons, show less divergence in sequence between related species than functionless DNA. Several CNSs have been demonstrated experimentally to function as cis-regulatory regions. However, the specific functions of most CNSs remain unknown. Previous searches for CNS in plants have either anchored on exons and only identified nearby sequences or required years of painstaking manual annotation. Here we present an open source tool that can accurately identify CNSs between any two related species with sequenced genomes, including both those immediately adjacent to exons and distal sequences separated by >12 kb of non-coding sequence. We have used this tool to characterize new motifs, associate CNSs with additional functions, and identify previously undetected genes encoding RNA and protein in the genomes of five grass species. We provide a list of 15,363 orthologous CNSs conserved across all grasses tested. We were also able to identify regulatory sequences present in the common ancestor of grasses that have been lost in one or more extant grass lineages. Lists of orthologous gene pairs and associated CNSs are provided for reference inbred lines of arabidopsis, Japonica rice, foxtail millet, sorghum, brachypodium, and maize. PMID:23874343

Molecular identification and partial sequence analysis of an aryl hydrocarbon receptor from beluga (Delphinapterus leucas)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jensen, B.A.; Hahn, M.E.

1995-12-31

The aryl hydrocarbon receptor (AhR) mediates the effects of many common and potentially toxic organic hydrocarbons, including some polychlorinated biphenyls and dioxins. Since small cetaceans often inhabit industrially polluted coastal waters, comparison of the molecular structure and function of this protein in cetaeans with other marine and mammalian species is important for evaluating the sensitivity of cetaceans to these pollutants. An AhR protein has been identified in beluga liver by photoaffinity labeling. In the present study, the authors sought to clone and sequence an AhR cDNA from beluga as a prelude to studying its structure and function, using reverse-transcription polymerasemore » chain reaction (RT-PCR) and degenerate primers, a 515 base pair fragment was amplified, cloned and sequenced, revealing homology to the PAS domain (ligand binding and dimerization region) of AhRs from terrestrial mammals. This portion of the putative beluga AhR has 82% amino acid and 81% nucleotide sequence identity to the mouse AhR, and 63% amino acid and 64% nucleotide sequence identity to an AhR from the marine fish Fundulus heteroclitus. A beluga cDNA library was synthesized and is currently being screened with the PCR-generated fragment to obtain the complete coding sequence. This is the first molecular evidence of AhR presence in cetaceans.« less

Characterization of Apricot pseudo-chlorotic leaf spot virus, A Novel Trichovirus Isolated from Stone Fruit Trees.

PubMed

Liberti, D; Marais, A; Svanella-Dumas, L; Dulucq, M J; Alioto, D; Ragozzino, A; Rodoni, B; Candresse, T

2005-04-01

ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.

Effective Identification of Similar Patients Through Sequential Matching over ICD Code Embedding.

PubMed

Nguyen, Dang; Luo, Wei; Venkatesh, Svetha; Phung, Dinh

2018-04-11

Evidence-based medicine often involves the identification of patients with similar conditions, which are often captured in ICD (International Classification of Diseases (World Health Organization 2013)) code sequences. With no satisfying prior solutions for matching ICD-10 code sequences, this paper presents a method which effectively captures the clinical similarity among routine patients who have multiple comorbidities and complex care needs. Our method leverages the recent progress in representation learning of individual ICD-10 codes, and it explicitly uses the sequential order of codes for matching. Empirical evaluation on a state-wide cancer data collection shows that our proposed method achieves significantly higher matching performance compared with state-of-the-art methods ignoring the sequential order. Our method better identifies similar patients in a number of clinical outcomes including readmission and mortality outlook. Although this paper focuses on ICD-10 diagnosis code sequences, our method can be adapted to work with other codified sequence data.

Clique-Based Neural Associative Memories with Local Coding and Precoding.

PubMed

Mofrad, Asieh Abolpour; Parker, Matthew G; Ferdosi, Zahra; Tadayon, Mohammad H

2016-08-01

Techniques from coding theory are able to improve the efficiency of neuroinspired and neural associative memories by forcing some construction and constraints on the network. In this letter, the approach is to embed coding techniques into neural associative memory in order to increase their performance in the presence of partial erasures. The motivation comes from recent work by Gripon, Berrou, and coauthors, which revisited Willshaw networks and presented a neural network with interacting neurons that partitioned into clusters. The model introduced stores patterns as small-size cliques that can be retrieved in spite of partial error. We focus on improving the success of retrieval by applying two techniques: doing a local coding in each cluster and then applying a precoding step. We use a slightly different decoding scheme, which is appropriate for partial erasures and converges faster. Although the ideas of local coding and precoding are not new, the way we apply them is different. Simulations show an increase in the pattern retrieval capacity for both techniques. Moreover, we use self-dual additive codes over field [Formula: see text], which have very interesting properties and a simple-graph representation.

Representation of DNA sequences with virtual potentials and their processing by (SEQREP) Kohonen self-organizing maps.

PubMed

Aires-de-Sousa, João; Aires-de-Sousa, Luisa

2003-01-01

We propose representing individual positions in DNA sequences by virtual potentials generated by other bases of the same sequence. This is a compact representation of the neighbourhood of a base. The distribution of the virtual potentials over the whole sequence can be used as a representation of the entire sequence (SEQREP code). It is a flexible code, with a length independent of the sequence size, does not require previous alignment, and is convenient for processing by neural networks or statistical techniques. To evaluate its biological significance, the SEQREP code was used for training Kohonen self-organizing maps (SOMs) in two applications: (a) detection of Alu sequences, and (b) classification of sequences encoding for HIV-1 envelope glycoprotein (env) into subtypes A-G. It was demonstrated that SOMs clustered sequences belonging to different classes into distinct regions. For independent test sets, very high rates of correct predictions were obtained (97% in the first application, 91% in the second). Possible areas of application of SEQREP codes include functional genomics, phylogenetic analysis, detection of repetitions, database retrieval, and automatic alignment. Software for representing sequences by SEQREP code, and for training Kohonen SOMs is made freely available from http://www.dq.fct.unl.pt/qoa/jas/seqrep. Supplementary material is available at http://www.dq.fct.unl.pt/qoa/jas/seqrep/bioinf2002

CombAlign: a code for generating a one-to-many sequence alignment from a set of pairwise structure-based sequence alignments.

PubMed

Zhou, Carol L Ecale

2015-01-01

In order to better define regions of similarity among related protein structures, it is useful to identify the residue-residue correspondences among proteins. Few codes exist for constructing a one-to-many multiple sequence alignment derived from a set of structure or sequence alignments, and a need was evident for creating such a tool for combining pairwise structure alignments that would allow for insertion of gaps in the reference structure. This report describes a new Python code, CombAlign, which takes as input a set of pairwise sequence alignments (which may be structure based) and generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA). The use and utility of CombAlign was demonstrated by generating gapped MSSAs using sets of pairwise structure-based sequence alignments between structure models of the matrix protein (VP40) and pre-small/secreted glycoprotein (sGP) of Reston Ebolavirus and the corresponding proteins of several other filoviruses. The gapped MSSAs revealed structure-based residue-residue correspondences, which enabled identification of structurally similar versus differing regions in the Reston proteins compared to each of the other corresponding proteins. CombAlign is a new Python code that generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA) given a set of pairwise sequence alignments (which may be structure based). CombAlign has utility in assisting the user in distinguishing structurally conserved versus divergent regions on a reference protein structure relative to other closely related proteins. CombAlign was developed in Python 2.6, and the source code is available for download from the GitHub code repository.

Complete Coding Genome Sequence for Mogiana Tick Virus, a Jingmenvirus Isolated from Ticks in Brazil

DTIC Science & Technology

2017-05-04

and capable of infecting a wide range of animal hosts (1–5). Here, we report the complete coding genome sequence (i.e., only missing portions of...segmented nature of the genome was not under- stood. Therefore, only the two genome segments with detectable sequence homolo- gies to flaviviruses were...originally reported (2). We revisited the data set of Maruyama et al. (2) and assembled the complete coding sequences for all four genome segments. We

Computing partial traces and reduced density matrices

NASA Astrophysics Data System (ADS)

Maziero, Jonas

Taking partial traces (PTrs) for computing reduced density matrices, or related functions, is a ubiquitous procedure in the quantum mechanics of composite systems. In this paper, we present a thorough description of this function and analyze the number of elementary operations (ops) needed, under some possible alternative implementations, to compute it on a classical computer. As we note, it is worthwhile doing some analytical developments in order to avoid making null multiplications and sums, what can considerably reduce the ops. For instance, for a bipartite system ℋa⊗ℋb with dimensions da=dimℋa and db=dimℋb and for da,db≫1, while a direct use of PTr definition applied to ℋb requires 𝒪(da6db6) ops, its optimized implementation entails 𝒪(da2db) ops. In the sequence, we regard the computation of PTrs for general multipartite systems and describe Fortran code provided to implement it numerically. We also consider the calculation of reduced density matrices via Bloch’s parametrization with generalized Gell Mann’s matrices.

Quantized phase coding and connected region labeling for absolute phase retrieval.

PubMed

Chen, Xiangcheng; Wang, Yuwei; Wang, Yajun; Ma, Mengchao; Zeng, Chunnian

2016-12-12

This paper proposes an absolute phase retrieval method for complex object measurement based on quantized phase-coding and connected region labeling. A specific code sequence is embedded into quantized phase of three coded fringes. Connected regions of different codes are labeled and assigned with 3-digit-codes combining the current period and its neighbors. Wrapped phase, more than 36 periods, can be restored with reference to the code sequence. Experimental results verify the capability of the proposed method to measure multiple isolated objects.

Functional interrogation of non-coding DNA through CRISPR genome editing

PubMed Central

Canver, Matthew C.; Bauer, Daniel E.; Orkin, Stuart H.

2017-01-01

Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. PMID:28288828

Memorization of Sequences of Movements of the Right or the Left Hand by Right- and Left-Handers: Vector Coding.

PubMed

Bobrova, E V; Bogacheva, I N; Lyakhovetskii, V A; Fabinskaja, A A; Fomina, E V

2017-01-01

In order to test the hypothesis of hemisphere specialization for different types of information coding (the right hemisphere, for positional coding; the left one, for vector coding), we analyzed the errors of right and left-handers during a task involving the memorization of sequences of movements by the left or the right hand, which activates vector coding by changing the order of movements in memorized sequences. The task was first performed by the right or the left hand, then by the opposite hand. It was found that both'right- and left-handers use the information about the previous movements of the dominant hand, but not of the non-dom" inant one. After changing the hand, right-handers use the information about previous movements of the second hand, while left-handers do not. We compared our results with the data of previous experiments, in which positional coding was activated, and concluded that both right- and left-handers use vector coding for memorizing the sequences of their dominant hands and positional coding for memorizing the sequences of non-dominant hand. No similar patterns of errors were found between right- and left-handers after changing the hand, which suggests that in right- and left-handersthe skills are transferred in different ways depending on the type of coding.

Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

PubMed

Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

2017-01-23

Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental inheritance from the tetraploid progenitor. The obtained molecular, cytogenetic and phylogenetic data demonstrate complex evolutionary dynamics of rDNA loci in allohexaploid species of Atropa belladonna. The high level of sequence unification revealed in 45S and 5S rDNA loci of this ancient hybrid species have been seemingly achieved by different molecular mechanisms.

CSTminer: a web tool for the identification of coding and noncoding conserved sequence tags through cross-species genome comparison

PubMed Central

Castrignanò, Tiziana; Canali, Alessandro; Grillo, Giorgio; Liuni, Sabino; Mignone, Flavio; Pesole, Graziano

2004-01-01

The identification and characterization of genome tracts that are highly conserved across species during evolution may contribute significantly to the functional annotation of whole-genome sequences. Indeed, such sequences are likely to correspond to known or unknown coding exons or regulatory motifs. Here, we present a web server implementing a previously developed algorithm that, by comparing user-submitted genome sequences, is able to identify statistically significant conserved blocks and assess their coding or noncoding nature through the measure of a coding potential score. The web tool, available at http://www.caspur.it/CSTminer/, is dynamically interconnected with the Ensembl genome resources and produces a graphical output showing a map of detected conserved sequences and annotated gene features. PMID:15215464

Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements.

PubMed

Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan

2015-07-21

Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress.

Computation of three-dimensional nozzle-exhaust flow fields with the GIM code

NASA Technical Reports Server (NTRS)

Spradley, L. W.; Anderson, P. G.

1978-01-01

A methodology is introduced for constructing numerical analogs of the partial differential equations of continuum mechanics. A general formulation is provided which permits classical finite element and many of the finite difference methods to be derived directly. The approach, termed the General Interpolants Method (GIM), can combined the best features of finite element and finite difference methods. A quasi-variational procedure is used to formulate the element equations, to introduce boundary conditions into the method and to provide a natural assembly sequence. A derivation is given in terms of general interpolation functions from this procedure. Example computations for transonic and supersonic flows in two and three dimensions are given to illustrate the utility of GIM. A three-dimensional nozzle-exhaust flow field is solved including interaction with the freestream and a coupled treatment of the shear layer. Potential applications of the GIM code to a variety of computational fluid dynamics problems is then discussed in terms of existing capability or by extension of the methodology.

Primer development to obtain complete coding sequence of HA and NA genes of influenza A/H3N2 virus.

PubMed

Agustiningsih, Agustiningsih; Trimarsanto, Hidayat; Setiawaty, Vivi; Artika, I Made; Muljono, David Handojo

2016-08-30

Influenza is an acute respiratory illness and has become a serious public health problem worldwide. The need to study the HA and NA genes in influenza A virus is essential since these genes frequently undergo mutations. This study describes the development of primer sets for RT-PCR to obtain complete coding sequence of Hemagglutinin (HA) and Neuraminidase (NA) genes of influenza A/H3N2 virus from Indonesia. The primers were developed based on influenza A/H3N2 sequence worldwide from Global Initiative on Sharing All Influenza Data (GISAID) and further tested using Indonesian influenza A/H3N2 archived samples of influenza-like illness (ILI) surveillance from 2008 to 2009. An optimum RT-PCR condition was acquired for all HA and NA fragments designed to cover complete coding sequence of HA and NA genes. A total of 71 samples were successfully sequenced for complete coding sequence both of HA and NA genes out of 145 samples of influenza A/H3N2 tested. The developed primer sets were suitable for obtaining complete coding sequences of HA and NA genes of Indonesian samples from 2008 to 2009.

Expression of the Caulobacter heat shock gene dnaK is developmentally controlled during growth at normal temperatures.

PubMed Central

Gomes, S L; Gober, J W; Shapiro, L

1990-01-01

Caulobacter crescentus has a single dnaK gene that is highly homologous to the hsp70 family of heat shock genes. Analysis of the cloned and sequenced dnaK gene has shown that the deduced amino acid sequence could encode a protein of 67.6 kilodaltons that is 68% identical to the DnaK protein of Escherichia coli and 49% identical to the Drosophila and human hsp70 protein family. A partial open reading frame 165 base pairs 3' to the end of dnaK encodes a peptide of 190 amino acids that is 59% identical to DnaJ of E. coli. Northern blot analysis revealed a single 4.0-kilobase mRNA homologous to the cloned fragment. Since the dnaK coding region is 1.89 kilobases, dnaK and dnaJ may be transcribed as a polycistronic message. S1 mapping and primer extension experiments showed that transcription initiated at two sites 5' to the dnaK coding sequence. A single start site of transcription was identified during heat shock at 42 degrees C, and the predicted promoter sequence conformed to the consensus heat shock promoters of E. coli. At normal growth temperature (30 degrees C), a different start site was identified 3' to the heat shock start site that conformed to the E. coli sigma 70 promoter consensus sequence. S1 protection assays and analysis of expression of the dnaK gene fused to the lux transcription reporter gene showed that expression of dnaK is temporally controlled under normal physiological conditions and that transcription occurs just before the initiation of DNA replication. Thus, in both human cells (I. K. L. Milarski and R. I. Morimoto, Proc. Natl. Acad. Sci. USA 83:9517-9521, 1986) and in a simple bacterium, the transcription of a hsp70 gene is temporally controlled as a function of the cell cycle under normal growth conditions. Images PMID:2345134

Umchs5, a gene coding for a class IV chitin synthase in Ustilago maydis.

PubMed

Xoconostle-Cázares, B; Specht, C A; Robbins, P W; Liu, Y; León, C; Ruiz-Herrera, J

1997-12-01

A fragment corresponding to a conserved region of a fifth gene coding for chitin synthase in the plant pathogenic fungus Ustilago maydis was amplified by means of the polymerase chain reaction (PCR). The amplified fragment was utilized as a probe for the identification of the whole gene in a genomic library of the fungus. The predicted gene product of Umchs5 has highest similarity with class IV chitin synthases encoded by the CHS3 genes from Saccharomyces cerevisiae and Candida albicans, chs-4 from Neurospora crassa, and chsE from Aspergillus nidulans. Umchs5 null mutants were constructed by substitution of most of the coding sequence with the hygromycin B resistance cassette. Mutants displayed significant reduction in growth rate, chitin content, and chitin synthase activity, specially in the mycelial form. Virulence to corn plantules was also reduced in the mutants. PCR was also used to obtain a fragment of a sixth chitin synthase, Umchs6. It is suggested that multigenic control of chitin synthesis in U. maydis operates as a protection mechanism for fungal viability in which the loss of one activity is partially compensated by the remaining enzymes. Copyright 1997 Academic Press.

A low-frequency inactivating AKT2 variant enriched in the Finnish population is associated with fasting insulin levels and type 2 diabetes risk

PubMed Central

Grarup, Niels; Rivas, Manuel A; Mahajan, Anubha; Locke, Adam E; Cingolani, Pablo; Pers, Tune H; Viñuela, Ana; Brown, Andrew A; Wu, Ying; Flannick, Jason; Fuchsberger, Christian; Gamazon, Eric R; Gaulton, Kyle J; Im, Hae Kyung; Teslovich, Tanya M; Blackwell, Thomas W; Bork-Jensen, Jette; Burtt, Noël P; Chen, Yuhui; Green, Todd; Hartl, Christopher; Kang, Hyun Min; Kumar, Ashish; Ladenvall, Claes; Ma, Clement; Moutsianas, Loukas; Pearson, Richard D; Perry, John R B; Rayner, N William; Robertson, Neil R; Scott, Laura J; van de Bunt, Martijn; Eriksson, Johan G; Jula, Antti; Koskinen, Seppo; Lehtimäki, Terho; Palotie, Aarno; Raitakari, Olli T; Jacobs, Suzanne BR; Wessel, Jennifer; Chu, Audrey Y; Scott, Robert A; Goodarzi, Mark O; Blancher, Christine; Buck, Gemma; Buck, David; Chines, Peter S; Gabriel, Stacey; Gjesing, Anette P; Groves, Christopher J; Hollensted, Mette; Huyghe, Jeroen R; Jackson, Anne U; Jun, Goo; Justesen, Johanne Marie; Mangino, Massimo; Murphy, Jacquelyn; Neville, Matt; Onofrio, Robert; Small, Kerrin S; Stringham, Heather M; Trakalo, Joseph; Banks, Eric; Carey, Jason; Carneiro, Mauricio O; DePristo, Mark; Farjoun, Yossi; Fennell, Timothy; Goldstein, Jacqueline I; Grant, George; de Angelis, Martin Hrabé; Maguire, Jared; Neale, Benjamin M; Poplin, Ryan; Purcell, Shaun; Schwarzmayr, Thomas; Shakir, Khalid; Smith, Joshua D; Strom, Tim M; Wieland, Thomas; Lindstrom, Jaana; Brandslund, Ivan; Christensen, Cramer; Surdulescu, Gabriela L; Lakka, Timo A; Doney, Alex S F; Nilsson, Peter; Wareham, Nicholas J; Langenberg, Claudia; Varga, Tibor V; Franks, Paul W; Rolandsson, Olov; Rosengren, Anders H; Farook, Vidya S; Thameem, Farook; Puppala, Sobha; Kumar, Satish; Lehman, Donna M; Jenkinson, Christopher P; Curran, Joanne E; Hale, Daniel Esten; Fowler, Sharon P; Arya, Rector; DeFronzo, Ralph A; Abboud, Hanna E; Syvänen, Ann-Christine; Hicks, Pamela J; Palmer, Nicholette D; Ng, Maggie C Y; Bowden, Donald W; Freedman, Barry I; Esko, Tõnu; Mägi, Reedik; Milani, Lili; Mihailov, Evelin; Metspalu, Andres; Narisu, Narisu; Kinnunen, Leena; Bonnycastle, Lori L; Swift, Amy; Pasko, Dorota; Wood, Andrew R; Fadista, João; Pollin, Toni I; Barzilai, Nir; Atzmon, Gil; Glaser, Benjamin; Thorand, Barbara; Strauch, Konstantin; Peters, Annette; Roden, Michael; Müller-Nurasyid, Martina; Liang, Liming; Kriebel, Jennifer; Illig, Thomas; Grallert, Harald; Gieger, Christian; Meisinger, Christa; Lannfelt, Lars; Musani, Solomon K; Griswold, Michael; Taylor, Herman A; Wilson, Gregory; Correa, Adolfo; Oksa, Heikki; Scott, William R; Afzal, Uzma; Tan, Sian-Tsung; Loh, Marie; Chambers, John C; Sehmi, Jobanpreet; Kooner, Jaspal Singh; Lehne, Benjamin; Cho, Yoon Shin; Lee, Jong-Young; Han, Bok-Ghee; Käräjämäki, Annemari; Qi, Qibin; Qi, Lu; Huang, Jinyan; Hu, Frank B; Melander, Olle; Orho-Melander, Marju; Below, Jennifer E; Aguilar, David; Wong, Tien Yin; Liu, Jianjun; Khor, Chiea-Chuen; Chia, Kee Seng; Lim, Wei Yen; Cheng, Ching-Yu; Chan, Edmund; Tai, E Shyong; Aung, Tin; Linneberg, Allan; Isomaa, Bo; Meitinger, Thomas; Tuomi, Tiinamaija; Hakaste, Liisa; Kravic, Jasmina; Jørgensen, Marit E; Lauritzen, Torsten; Deloukas, Panos; Stirrups, Kathleen E; Owen, Katharine R; Farmer, Andrew J; Frayling, Timothy M; O'Rahilly, Stephen P; Walker, Mark; Levy, Jonathan C; Hodgkiss, Dylan; Hattersley, Andrew T; Kuulasmaa, Teemu; Stančáková, Alena; Barroso, Inês; Bharadwaj, Dwaipayan; Chan, Juliana; Chandak, Giriraj R; Daly, Mark J; Donnelly, Peter J; Ebrahim, Shah B; Elliott, Paul; Fingerlin, Tasha; Froguel, Philippe; Hu, Cheng; Jia, Weiping; Ma, Ronald C W; McVean, Gilean; Park, Taesung; Prabhakaran, Dorairaj; Sandhu, Manjinder; Scott, James; Sladek, Rob; Tandon, Nikhil; Teo, Yik Ying; Zeggini, Eleftheria; Watanabe, Richard M; Koistinen, Heikki A; Kesaniemi, Y Antero; Uusitupa, Matti; Spector, Timothy D; Salomaa, Veikko; Rauramaa, Rainer; Palmer, Colin N A; Prokopenko, Inga; Morris, Andrew D; Bergman, Richard N; Collins, Francis S; Lind, Lars; Ingelsson, Erik; Tuomilehto, Jaakko; Karpe, Fredrik; Groop, Leif; Jørgensen, Torben; Hansen, Torben; Pedersen, Oluf; Kuusisto, Johanna; Abecasis, Gonçalo; Bell, Graeme I; Blangero, John; Cox, Nancy J; Duggirala, Ravindranath; Seielstad, Mark; Wilson, James G; Dupuis, Josee; Ripatti, Samuli; Hanis, Craig L; Florez, Jose C; Mohlke, Karen L; Meigs, James B; Laakso, Markku; Morris, Andrew P; Boehnke, Michael; Altshuler, David; McCarthy, Mark I; Gloyn, Anna L; Lindgren, Cecilia M

2017-01-01

To identify novel coding association signals and facilitate characterization of mechanisms influencing glycemic traits and type 2 diabetes risk, we analyzed 109,215 variants derived from exome array genotyping together with an additional 390,225 variants from exome sequence in up to 39,339 normoglycemic individuals from five ancestry groups. We identified a novel association between the coding variant (p.Pro50Thr) in AKT2 and fasting insulin, a gene in which rare fully penetrant mutations are causal for monogenic glycemic disorders. The low-frequency allele is associated with a 12% increase in fasting plasma insulin (FI) levels. This variant is present at 1.1% frequency in Finns but virtually absent in individuals from other ancestries. Carriers of the FI-increasing allele had increased 2-hour insulin values, decreased insulin sensitivity, and increased risk of type 2 diabetes (odds ratio=1.05). In cellular studies, the AKT2-Thr50 protein exhibited a partial loss of function. We extend the allelic spectrum for coding variants in AKT2 associated with disorders of glucose homeostasis and demonstrate bidirectional effects of variants within the pleckstrin homology domain of AKT2. PMID:28341696

GATA: A graphic alignment tool for comparative sequenceanalysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nix, David A.; Eisen, Michael B.

2005-01-01

Several problems exist with current methods used to align DNA sequences for comparative sequence analysis. Most dynamic programming algorithms assume that conserved sequence elements are collinear. This assumption appears valid when comparing orthologous protein coding sequences. Functional constraints on proteins provide strong selective pressure against sequence inversions, and minimize sequence duplications and feature shuffling. For non-coding sequences this collinearity assumption is often invalid. For example, enhancers contain clusters of transcription factor binding sites that change in number, orientation, and spacing during evolution yet the enhancer retains its activity. Dotplot analysis is often used to estimate non-coding sequence relatedness. Yet dotmore » plots do not actually align sequences and thus cannot account well for base insertions or deletions. Moreover, they lack an adequate statistical framework for comparing sequence relatedness and are limited to pairwise comparisons. Lastly, dot plots and dynamic programming text outputs fail to provide an intuitive means for visualizing DNA alignments.« less

Phylogenetic Network for European mtDNA

PubMed Central

Finnilä, Saara; Lehtonen, Mervi S.; Majamaa, Kari

2001-01-01

The sequence in the first hypervariable segment (HVS-I) of the control region has been used as a source of evolutionary information in most phylogenetic analyses of mtDNA. Population genetic inference would benefit from a better understanding of the variation in the mtDNA coding region, but, thus far, complete mtDNA sequences have been rare. We determined the nucleotide sequence in the coding region of mtDNA from 121 Finns, by conformation-sensitive gel electrophoresis and subsequent sequencing and by direct sequencing of the D loop. Furthermore, 71 sequences from our previous reports were included, so that the samples represented all the mtDNA haplogroups present in the Finnish population. We found a total of 297 variable sites in the coding region, which allowed the compilation of unambiguous phylogenetic networks. The D loop harbored 104 variable sites, and, in most cases, these could be localized within the coding-region networks, without discrepancies. Interestingly, many homoplasies were detected in the coding region. Nucleotide variation in the rRNA and tRNA genes was 6%, and that in the third nucleotide positions of structural genes amounted to 22% of that in the HVS-I. The complete networks enabled the relationships between the mtDNA haplogroups to be analyzed. Phylogenetic networks based on the entire coding-region sequence in mtDNA provide a rich source for further population genetic studies, and complete sequences make it easier to differentiate between disease-causing mutations and rare polymorphisms. PMID:11349229

RY-Coding and Non-Homogeneous Models Can Ameliorate the Maximum-Likelihood Inferences From Nucleotide Sequence Data with Parallel Compositional Heterogeneity.

PubMed

Ishikawa, Sohta A; Inagaki, Yuji; Hashimoto, Tetsuo

2012-01-01

In phylogenetic analyses of nucleotide sequences, 'homogeneous' substitution models, which assume the stationarity of base composition across a tree, are widely used, albeit individual sequences may bear distinctive base frequencies. In the worst-case scenario, a homogeneous model-based analysis can yield an artifactual union of two distantly related sequences that achieved similar base frequencies in parallel. Such potential difficulty can be countered by two approaches, 'RY-coding' and 'non-homogeneous' models. The former approach converts four bases into purine and pyrimidine to normalize base frequencies across a tree, while the heterogeneity in base frequency is explicitly incorporated in the latter approach. The two approaches have been applied to real-world sequence data; however, their basic properties have not been fully examined by pioneering simulation studies. Here, we assessed the performances of the maximum-likelihood analyses incorporating RY-coding and a non-homogeneous model (RY-coding and non-homogeneous analyses) on simulated data with parallel convergence to similar base composition. Both RY-coding and non-homogeneous analyses showed superior performances compared with homogeneous model-based analyses. Curiously, the performance of RY-coding analysis appeared to be significantly affected by a setting of the substitution process for sequence simulation relative to that of non-homogeneous analysis. The performance of a non-homogeneous analysis was also validated by analyzing a real-world sequence data set with significant base heterogeneity.

Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

PubMed

Suyama, Mikita; Lathe, Warren C; Bork, Peer

2005-10-10

We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

The 1-aminocyclopropane-1-carboxylate synthase of Cucurbita. Purification, properties, expression in Escherichia coli, and primary structure determination by DNA sequence analysis.

PubMed

Sato, T; Oeller, P W; Theologis, A

1991-02-25

The key regulatory enzyme in the biosynthetic pathway of the plant hormone ethylene is 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (EC 4.4.1.14). We have partially purified ACC synthase 6,000-fold from Cucurbita fruit tissue treated with indoleacetic acid + benzyladenine + aminooxyacetic acid + LiCl. The enzyme has a specific activity of 35,000 nmol/h/mg protein, a pH optimum of 9.5, an isoelectric point of 5.0, a Km of 17 microM with respect to S-adenosylmethionine, and is a dimer of two identical subunits of approximately 46,000 Da each. The subunit exists in vivo as a 55,000-Da species similar in size to the primary in vitro translation product. DNA sequence analysis of the cDNA clone pACC1 revealed that the coding region of the ACC synthase mRNA spans 493 amino acids corresponding to a 55,779-Da polypeptide; and expression of the coding sequence (pACC1) in Escherichia coli as a COOH terminus hybrid of beta-galactosidase or as a nonhybrid polypeptide catalyzed the conversion of S-adenosylmethionine to ACC (Sato, T., and Theologis, A. (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 6621-6625). Immunoblotting experiments herein show that the molecular mass of the beta-galactosidase hybrid polypeptide is 170,000 Da, and the size of the largest nonhybrid polypeptide is 53,000 Da. The data suggest that the enzyme is post-translationally processed during protein purification.

Strategic and Tactical Decision-Making Under Uncertainty

DTIC Science & Technology

2006-01-03

message passing algorithms. In recent work we applied this method to the problem of joint decoding of a low-density parity-check ( LDPC ) code and a partial...Joint Decoding of LDPC Codes and Partial-Response Channels." IEEE Transactions on Communications. Vol. 54, No. 7, 1149-1153, 2006. P. Pakzad and V...Michael I. Jordan PAGES U U U SAPR 20 19b. TELEPHONE NUMBER (Include area code ) 510/642-3806 Standard Form 298 (Rev. 8/98) Prescribed by ANSI Std. Z39.18

Brain cDNA clone for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McTiernan, C.; Adkins, S.; Chatonnet, A.

1987-10-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

Functional interrogation of non-coding DNA through CRISPR genome editing.

PubMed

Canver, Matthew C; Bauer, Daniel E; Orkin, Stuart H

2017-05-15

Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

RECOVIR Software for Identifying Viruses

NASA Technical Reports Server (NTRS)

Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

2013-01-01

Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

[Identifying and sequence analysis of HLA-B*2736].

PubMed

Li, Zhen; Zou, Hong-Yan; Shao, Chao-Peng; Tang, Si; Wang, Da-Ming; Cheng, Liang-Hong

2007-11-01

An unknown HLA-B allele which was similar to HLA-B*270401 was detected by FLOW-SSOPCR-SSP and heterozygous sequence-based typing (SBT) in Chinese Han individual. Its anomalous patterns suggested the possible presence of new allele. Amplifying exon 2-5(include intron 2-4) of the HLA-B*27 allele separately by using allele-specific primers and sequencing in both directions. Identifying the difference between the novel B*27 allele and B*270401. The sequence of novel B*27 from exon 2 to partial exon 5 is 1 815 bp. There are 10 nt changes from B*270401 in exon 3-4, at nt634where A-->C(codon130 AGC-->CGC, 130 S-->R); nt670 where A-->T (codon142 ACC-->TCC, 142 T-->S); nt683 where G-->T (codon146 TGG-->TTG, 146 W-->L); nt698 where A-->T (codon151 GAG-->GTG, 151 E-->V); nt774 where G-->C (codon176 GAG-->GAC, 176 E-->D); nt776 where C-->A (codon177 ACG-->AAG, 177 T-->K); nt781 where C-->G (codon179 CAG-->GAG, 179Q-->E); nt789 where G-->T (codon181 GCG-->GCT) resulting no coding change; nt1438 where C-->T (codon206 GGC-->GGT) resulting no coding change; nt1449 where G-->C (codon210 GGG-->GCG, 210G-->A). In IMGT/HLA database, only three alleles (B*270502/2706/2732) have sequences of introns. The same sequence in intron 2 showed homology between the novel HLA-B*27 allele and B*2706, but their homology could not be supported in intron 3-4. Comparing the sequence of the novel B*27 allele in intron 3 and 4 with B*27 group, it showed there are three mutations at nt106 C-->G, nt179 G-->A, nt536 G-->A and one deletion at nt168 in intron 3 and one mutations at nt82 T-->C in intron 4, but the sequence of the novel B*27 allele in intron 3 and 4 was all the same to B*070201. The sequence was submitted to Gen-Bank and the accession number was DQ915176. The allele has been confirmed as an extension of B*2736 by the WHO Nomenclature committee in November 2006.

A Code Division Multiple Access Communication System for the Low Frequency Band.

DTIC Science & Technology

1983-04-01

frequency channels spread-spectrum communication / complex sequences, orthogonal codes impulsive noise 20. ABSTRACT (Continue an reverse side It...their transmissions with signature sequences. Our LF/CDMA scheme is different in that each user’s signature sequence set consists of M orthogonal ...signature sequences. Our LF/CDMA scheme is different in that each user’s signature sequence set consists of M orthogonal sequences and thus log 2 M

A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region.

PubMed

Kress, W John; Erickson, David L

2007-06-06

A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination.

Detonation Velocity Calculations of Explosives with Slowly-Burning Constituents

NASA Astrophysics Data System (ADS)

Howard, W. Michael; Souers, P. Clark; Fried, Laurence E.

1997-07-01

The thermochemical code Equilbrium CHEETAH has been modified to allow partial reaction of constituents and partial flow of heat. Solid or liquid reactants are described by Einstein oscillators, whose temperatures can be changed to allow heat transfer. Hydroxy-terminated-poly-budadiene, mixed with RDX or HMX, does not react, as shown by the effect on the calculated detonation velocity. Aluminum and ammonium perchlorate in composites also do not react. Only partial heat flow also takes place in the unreacted materials. These results show that the usual assumption of total burn in a thermochemical code is probably incorrect, at least in the sonic reaction zone that drives the detonation velocity. A kinetic code would be the logical extension of this work.

Partial androgen insensitivity syndrome caused by a deep intronic mutation creating an alternative splice acceptor site of the AR gene.

PubMed

Ono, Hiroyuki; Saitsu, Hirotomo; Horikawa, Reiko; Nakashima, Shinichi; Ohkubo, Yumiko; Yanagi, Kumiko; Nakabayashi, Kazuhiko; Fukami, Maki; Fujisawa, Yasuko; Ogata, Tsutomu

2018-02-02

Although partial androgen insensitivity syndrome (PAIS) is caused by attenuated responsiveness to androgens, androgen receptor gene (AR) mutations on the coding regions and their splice sites have been identified only in <25% of patients with a diagnosis of PAIS. We performed extensive molecular studies including whole exome sequencing in a Japanese family with PAIS, identifying a deep intronic variant beyond the branch site at intron 6 of AR (NM_000044.4:c.2450-42 G > A). This variant created the splice acceptor motif that was accompanied by pyrimidine-rich sequence and two candidate branch sites. Consistent with this, reverse transcriptase (RT)-PCR experiments for cycloheximide-treated lymphoblastoid cell lines revealed a relatively large amount of aberrant mRNA produced by the newly created splice acceptor site and a relatively small amount of wildtype mRNA produced by the normal splice acceptor site. Furthermore, most of the aberrant mRNA was shown to undergo nonsense mediated decay (NMD) and, if a small amount of aberrant mRNA may have escaped NMD, such mRNA was predicted to generate a truncated AR protein missing some functional domains. These findings imply that the deep intronic mutation creating an alternative splice acceptor site resulted in the production of a relatively small amount of wildtype AR mRNA, leading to PAIS.

Streamlined Genome Sequence Compression using Distributed Source Coding

PubMed Central

Wang, Shuang; Jiang, Xiaoqian; Chen, Feng; Cui, Lijuan; Cheng, Samuel

2014-01-01

We aim at developing a streamlined genome sequence compression algorithm to support alternative miniaturized sequencing devices, which have limited communication, storage, and computation power. Existing techniques that require heavy client (encoder side) cannot be applied. To tackle this challenge, we carefully examined distributed source coding theory and developed a customized reference-based genome compression protocol to meet the low-complexity need at the client side. Based on the variation between source and reference, our protocol will pick adaptively either syndrome coding or hash coding to compress subsequences of changing code length. Our experimental results showed promising performance of the proposed method when compared with the state-of-the-art algorithm (GRS). PMID:25520552

Ground-state coding in partially connected neural networks

NASA Technical Reports Server (NTRS)

Baram, Yoram

1989-01-01

Patterns over (-1,0,1) define, by their outer products, partially connected neural networks, consisting of internally strongly connected, externally weakly connected subnetworks. The connectivity patterns may have highly organized structures, such as lattices and fractal trees or nests. Subpatterns over (-1,1) define the subcodes stored in the subnetwork, that agree in their common bits. It is first shown that the code words are locally stable stares of the network, provided that each of the subcodes consists of mutually orthogonal words or of, at most, two words. Then it is shown that if each of the subcodes consists of two orthogonal words, the code words are the unique ground states (absolute minima) of the Hamiltonian associated with the network. The regions of attraction associated with the code words are shown to grow with the number of subnetworks sharing each of the neurons. Depending on the particular network architecture, the code sizes of partially connected networks can be vastly greater than those of fully connected ones and their error correction capabilities can be significantly greater than those of the disconnected subnetworks. The codes associated with lattice-structured and hierarchical networks are discussed in some detail.

Superior ab initio identification, annotation and characterisation of TEs and segmental duplications from genome assemblies.

PubMed

Zeng, Lu; Kortschak, R Daniel; Raison, Joy M; Bertozzi, Terry; Adelson, David L

2018-01-01

Transposable Elements (TEs) are mobile DNA sequences that make up significant fractions of amniote genomes. However, they are difficult to detect and annotate ab initio because of their variable features, lengths and clade-specific variants. We have addressed this problem by refining and developing a Comprehensive ab initio Repeat Pipeline (CARP) to identify and cluster TEs and other repetitive sequences in genome assemblies. The pipeline begins with a pairwise alignment using krishna, a custom aligner. Single linkage clustering is then carried out to produce families of repetitive elements. Consensus sequences are then filtered for protein coding genes and then annotated using Repbase and a custom library of retrovirus and reverse transcriptase sequences. This process yields three types of family: fully annotated, partially annotated and unannotated. Fully annotated families reflect recently diverged/young known TEs present in Repbase. The remaining two types of families contain a mixture of novel TEs and segmental duplications. These can be resolved by aligning these consensus sequences back to the genome to assess copy number vs. length distribution. Our pipeline has three significant advantages compared to other methods for ab initio repeat identification: 1) we generate not only consensus sequences, but keep the genomic intervals for the original aligned sequences, allowing straightforward analysis of evolutionary dynamics, 2) consensus sequences represent low-divergence, recently/currently active TE families, 3) segmental duplications are annotated as a useful by-product. We have compared our ab initio repeat annotations for 7 genome assemblies to other methods and demonstrate that CARP compares favourably with RepeatModeler, the most widely used repeat annotation package.

Superior ab initio identification, annotation and characterisation of TEs and segmental duplications from genome assemblies

PubMed Central

Zeng, Lu; Kortschak, R. Daniel; Raison, Joy M.

2018-01-01

Transposable Elements (TEs) are mobile DNA sequences that make up significant fractions of amniote genomes. However, they are difficult to detect and annotate ab initio because of their variable features, lengths and clade-specific variants. We have addressed this problem by refining and developing a Comprehensive ab initio Repeat Pipeline (CARP) to identify and cluster TEs and other repetitive sequences in genome assemblies. The pipeline begins with a pairwise alignment using krishna, a custom aligner. Single linkage clustering is then carried out to produce families of repetitive elements. Consensus sequences are then filtered for protein coding genes and then annotated using Repbase and a custom library of retrovirus and reverse transcriptase sequences. This process yields three types of family: fully annotated, partially annotated and unannotated. Fully annotated families reflect recently diverged/young known TEs present in Repbase. The remaining two types of families contain a mixture of novel TEs and segmental duplications. These can be resolved by aligning these consensus sequences back to the genome to assess copy number vs. length distribution. Our pipeline has three significant advantages compared to other methods for ab initio repeat identification: 1) we generate not only consensus sequences, but keep the genomic intervals for the original aligned sequences, allowing straightforward analysis of evolutionary dynamics, 2) consensus sequences represent low-divergence, recently/currently active TE families, 3) segmental duplications are annotated as a useful by-product. We have compared our ab initio repeat annotations for 7 genome assemblies to other methods and demonstrate that CARP compares favourably with RepeatModeler, the most widely used repeat annotation package. PMID:29538441

TCOF1 gene encodes a putative nucleolar phosphoprotein that exhibits mutations in Treacher Collins Syndrome throughout its coding region

PubMed Central

Wise, Carol A.; Chiang, Lydia C.; Paznekas, William A.; Sharma, Mridula; Musy, Maurice M.; Ashley, Jennifer A.; Lovett, Michael; Jabs, Ethylin W.

1997-01-01

Treacher Collins Syndrome (TCS) is the most common of the human mandibulofacial dysostosis disorders. Recently, a partial TCOF1 cDNA was identified and shown to contain mutations in TCS families. Here we present the entire exon/intron genomic structure and the complete coding sequence of TCOF1. TCOF1 encodes a low complexity protein of 1,411 amino acids, whose predicted protein structure reveals repeated motifs that mirror the organization of its exons. These motifs are shared with nucleolar trafficking proteins in other species and are predicted to be highly phosphorylated by casein kinase. Consistent with this, the full-length TCOF1 protein sequence also contains putative nuclear and nucleolar localization signals. Throughout the open reading frame, we detected an additional eight mutations in TCS families and several polymorphisms. We postulate that TCS results from defects in a nucleolar trafficking protein that is critically required during human craniofacial development. PMID:9096354

Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing.

PubMed

Kanda, Kojun; Pflug, James M; Sproul, John S; Dasenko, Mark A; Maddison, David R

2015-01-01

In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles being more successfully sequenced.

Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing

PubMed Central

Dasenko, Mark A.

2015-01-01

In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles being more successfully sequenced. PMID:26716693

The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

PubMed Central

Pietan, Lucas L.; Spradling, Theresa A.

2016-01-01

In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

Issues and opportunities: beam simulations for heavy ion fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Friedman, A

1999-07-15

UCRL- JC- 134975 PREPRINT code offering 3- D, axisymmetric, and ''transverse slice'' (steady flow) geometries, with a hierarchy of models for the ''lattice'' of focusing, bending, and accelerating elements. Interactive and script- driven code steering is afforded through an interpreter interface. The code runs with good parallel scaling on the T3E. Detailed simulations of machine segments and of complete small experiments, as well as simplified full- system runs, have been carried out, partially benchmarking the code. A magnetoinductive model, with module impedance and multi- beam effects, is under study. experiments, including an injector scalable to multi- beam arrays, a high-more » current beam transport and acceleration experiment, and a scaled final- focusing experiment. These ''phase I'' projects are laying the groundwork for the next major step in HIF development, the Integrated Research Experiment (IRE). Simulations aimed directly at the IRE must enable us to: design a facility with maximum power on target at minimal cost; set requirements for hardware tolerances, beam steering, etc.; and evaluate proposed chamber propagation modes. Finally, simulations must enable us to study all issues which arise in the context of a fusion driver, and must facilitate the assessment of driver options. In all of this, maximum advantage must be taken of emerging terascale computer architectures, requiring an aggressive code development effort. An organizing principle should be pursuit of the goal of integrated and detailed source- to- target simulation. methods for analysis of the beam dynamics in the various machine concepts, using moment- based methods for purposes of design, waveform synthesis, steering algorithm synthesis, etc. Three classes of discrete- particle models should be coupled: (1) electrostatic/ magnetoinductive PIC simulations should track the beams from the source through the final- focusing optics, passing details of the time- dependent distribution function to (2) electromagnetic or magnetoinductive PIC or hybrid PIG/ fluid simulations in the fusion chamber (which would finally pass their particle trajectory information to the radiation- hydrodynamics codes used for target design); in parallel, (3) detailed PIC, delta- f, core/ test- particle, and perhaps continuum Vlasov codes should be used to study individual sections of the driver and chamber very carefully; consistency may be assured by linking data from the PIC sequence, and knowledge gained may feed back into that sequence.« less

Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.

PubMed

2004-12-09

We present here a draft genome sequence of the red jungle fowl, Gallus gallus. Because the chicken is a modern descendant of the dinosaurs and the first non-mammalian amniote to have its genome sequenced, the draft sequence of its genome--composed of approximately one billion base pairs of sequence and an estimated 20,000-23,000 genes--provides a new perspective on vertebrate genome evolution, while also improving the annotation of mammalian genomes. For example, the evolutionary distance between chicken and human provides high specificity in detecting functional elements, both non-coding and coding. Notably, many conserved non-coding sequences are far from genes and cannot be assigned to defined functional classes. In coding regions the evolutionary dynamics of protein domains and orthologous groups illustrate processes that distinguish the lineages leading to birds and mammals. The distinctive properties of avian microchromosomes, together with the inferred patterns of conserved synteny, provide additional insights into vertebrate chromosome architecture.

Golay sequences coded coherent optical OFDM for long-haul transmission

NASA Astrophysics Data System (ADS)

Qin, Cui; Ma, Xiangrong; Hua, Tao; Zhao, Jing; Yu, Huilong; Zhang, Jian

2017-09-01

We propose to use binary Golay sequences in coherent optical orthogonal frequency division multiplexing (CO-OFDM) to improve the long-haul transmission performance. The Golay sequences are generated by binary Reed-Muller codes, which have low peak-to-average power ratio and certain error correction capability. A low-complexity decoding algorithm for the Golay sequences is then proposed to recover the signal. Under same spectral efficiency, the QPSK modulated OFDM with binary Golay sequences coding with and without discrete Fourier transform (DFT) spreading (DFTS-QPSK-GOFDM and QPSK-GOFDM) are compared with the normal BPSK modulated OFDM with and without DFT spreading (DFTS-BPSK-OFDM and BPSK-OFDM) after long-haul transmission. At a 7% forward error correction code threshold (Q2 factor of 8.5 dB), it is shown that DFTS-QPSK-GOFDM outperforms DFTS-BPSK-OFDM by extending the transmission distance by 29% and 18%, in non-dispersion managed and dispersion managed links, respectively.

Genome sequence of the olive tree, Olea europaea.

PubMed

Cruz, Fernando; Julca, Irene; Gómez-Garrido, Jèssica; Loska, Damian; Marcet-Houben, Marina; Cano, Emilio; Galán, Beatriz; Frias, Leonor; Ribeca, Paolo; Derdak, Sophia; Gut, Marta; Sánchez-Fernández, Manuel; García, Jose Luis; Gut, Ivo G; Vargas, Pablo; Alioto, Tyler S; Gabaldón, Toni

2016-06-27

The Mediterranean olive tree (Olea europaea subsp. europaea) was one of the first trees to be domesticated and is currently of major agricultural importance in the Mediterranean region as the source of olive oil. The molecular bases underlying the phenotypic differences among domesticated cultivars, or between domesticated olive trees and their wild relatives, remain poorly understood. Both wild and cultivated olive trees have 46 chromosomes (2n). A total of 543 Gb of raw DNA sequence from whole genome shotgun sequencing, and a fosmid library containing 155,000 clones from a 1,000+ year-old olive tree (cv. Farga) were generated by Illumina sequencing using different combinations of mate-pair and pair-end libraries. Assembly gave a final genome with a scaffold N50 of 443 kb, and a total length of 1.31 Gb, which represents 95 % of the estimated genome length (1.38 Gb). In addition, the associated fungus Aureobasidium pullulans was partially sequenced. Genome annotation, assisted by RNA sequencing from leaf, root, and fruit tissues at various stages, resulted in 56,349 unique protein coding genes, suggesting recent genomic expansion. Genome completeness, as estimated using the CEGMA pipeline, reached 98.79 %. The assembled draft genome of O. europaea will provide a valuable resource for the study of the evolution and domestication processes of this important tree, and allow determination of the genetic bases of key phenotypic traits. Moreover, it will enhance breeding programs and the formation of new varieties.

BASiNET-BiologicAl Sequences NETwork: a case study on coding and non-coding RNAs identification.

PubMed

Ito, Eric Augusto; Katahira, Isaque; Vicente, Fábio Fernandes da Rocha; Pereira, Luiz Filipe Protasio; Lopes, Fabrício Martins

2018-06-05

With the emergence of Next Generation Sequencing (NGS) technologies, a large volume of sequence data in particular de novo sequencing was rapidly produced at relatively low costs. In this context, computational tools are increasingly important to assist in the identification of relevant information to understand the functioning of organisms. This work introduces BASiNET, an alignment-free tool for classifying biological sequences based on the feature extraction from complex network measurements. The method initially transform the sequences and represents them as complex networks. Then it extracts topological measures and constructs a feature vector that is used to classify the sequences. The method was evaluated in the classification of coding and non-coding RNAs of 13 species and compared to the CNCI, PLEK and CPC2 methods. BASiNET outperformed all compared methods in all adopted organisms and datasets. BASiNET have classified sequences in all organisms with high accuracy and low standard deviation, showing that the method is robust and non-biased by the organism. The proposed methodology is implemented in open source in R language and freely available for download at https://cran.r-project.org/package=BASiNET.

The Number, Organization, and Size of Polymorphic Membrane Protein Coding Sequences as well as the Most Conserved Pmp Protein Differ within and across Chlamydia Species.

PubMed

Van Lent, Sarah; Creasy, Heather Huot; Myers, Garry S A; Vanrompay, Daisy

2016-01-01

Variation is a central trait of the polymorphic membrane protein (Pmp) family. The number of pmp coding sequences differs between Chlamydia species, but it is unknown whether the number of pmp coding sequences is constant within a Chlamydia species. The level of conservation of the Pmp proteins has previously only been determined for Chlamydia trachomatis. As different Pmp proteins might be indispensible for the pathogenesis of different Chlamydia species, this study investigated the conservation of Pmp proteins both within and across C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci. The pmp coding sequences were annotated in 16 C. trachomatis, 6 C. pneumoniae, 2 C. abortus, and 16 C. psittaci genomes. The number and organization of polymorphic membrane coding sequences differed within and across the analyzed Chlamydia species. The length of coding sequences of pmpA,pmpB, and pmpH was conserved among all analyzed genomes, while the length of pmpE/F and pmpG, and remarkably also of the subtype pmpD, differed among the analyzed genomes. PmpD, PmpA, PmpH, and PmpA were the most conserved Pmp in C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci, respectively. PmpB was the most conserved Pmp across the 4 analyzed Chlamydia species. © 2016 S. Karger AG, Basel.

Transcription of a protein-coding gene on B chromosomes of the Siberian roe deer (Capreolus pygargus)

PubMed Central

2013-01-01

Background Most eukaryotic species represent stable karyotypes with a particular diploid number. B chromosomes are additional to standard karyotypes and may vary in size, number and morphology even between cells of the same individual. For many years it was generally believed that B chromosomes found in some plant, animal and fungi species lacked active genes. Recently, molecular cytogenetic studies showed the presence of additional copies of protein-coding genes on B chromosomes. However, the transcriptional activity of these genes remained elusive. We studied karyotypes of the Siberian roe deer (Capreolus pygargus) that possess up to 14 B chromosomes to investigate the presence and expression of genes on supernumerary chromosomes. Results Here, we describe a 2 Mbp region homologous to cattle chromosome 3 and containing TNNI3K (partial), FPGT, LRRIQ3 and a large gene-sparse segment on B chromosomes of the Siberian roe deer. The presence of the copy of the autosomal region was demonstrated by B-specific cDNA analysis, PCR assisted mapping, cattle bacterial artificial chromosome (BAC) clone localization and quantitative polymerase chain reaction (qPCR). By comparative analysis of B-specific and non-B chromosomal sequences we discovered some B chromosome-specific mutations in protein-coding genes, which further enabled the detection of a FPGT-TNNI3K transcript expressed from duplicated genes located on B chromosomes in roe deer fibroblasts. Conclusions Discovery of a large autosomal segment in all B chromosomes of the Siberian roe deer further corroborates the view of an autosomal origin for these elements. Detection of a B-derived transcript in fibroblasts implies that the protein coding sequences located on Bs are not fully inactivated. The origin, evolution and effect on host of B chromosomal genes seem to be similar to autosomal segmental duplications, which reinforces the view that supernumerary chromosomal elements might play an important role in genome evolution. PMID:23915065

A Two-Locus Global DNA Barcode for Land Plants: The Coding rbcL Gene Complements the Non-Coding trnH-psbA Spacer Region

PubMed Central

Kress, W. John; Erickson, David L.

2007-01-01

Background A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Methodology/Principal Findings Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. Conclusions/Significance A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination. PMID:17551588

A common class of transcripts with 5'-intron depletion, distinct early coding sequence features, and N1-methyladenosine modification.

PubMed

Cenik, Can; Chua, Hon Nian; Singh, Guramrit; Akef, Abdalla; Snyder, Michael P; Palazzo, Alexander F; Moore, Melissa J; Roth, Frederick P

2017-03-01

Introns are found in 5' untranslated regions (5'UTRs) for 35% of all human transcripts. These 5'UTR introns are not randomly distributed: Genes that encode secreted, membrane-bound and mitochondrial proteins are less likely to have them. Curiously, transcripts lacking 5'UTR introns tend to harbor specific RNA sequence elements in their early coding regions. To model and understand the connection between coding-region sequence and 5'UTR intron status, we developed a classifier that can predict 5'UTR intron status with >80% accuracy using only sequence features in the early coding region. Thus, the classifier identifies transcripts with 5 ' proximal- i ntron- m inus-like-coding regions ("5IM" transcripts). Unexpectedly, we found that the early coding sequence features defining 5IM transcripts are widespread, appearing in 21% of all human RefSeq transcripts. The 5IM class of transcripts is enriched for non-AUG start codons, more extensive secondary structure both preceding the start codon and near the 5' cap, greater dependence on eIF4E for translation, and association with ER-proximal ribosomes. 5IM transcripts are bound by the exon junction complex (EJC) at noncanonical 5' proximal positions. Finally, N 1 -methyladenosines are specifically enriched in the early coding regions of 5IM transcripts. Taken together, our analyses point to the existence of a distinct 5IM class comprising ∼20% of human transcripts. This class is defined by depletion of 5' proximal introns, presence of specific RNA sequence features associated with low translation efficiency, N 1 -methyladenosines in the early coding region, and enrichment for noncanonical binding by the EJC. © 2017 Cenik et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

A DS-UWB Cognitive Radio System Based on Bridge Function Smart Codes

NASA Astrophysics Data System (ADS)

Xu, Yafei; Hong, Sheng; Zhao, Guodong; Zhang, Fengyuan; di, Jinshan; Zhang, Qishan

This paper proposes a direct-sequence UWB Gaussian pulse of cognitive radio systems based on bridge function smart sequence matrix and the Gaussian pulse. As the system uses the spreading sequence code, that is the bridge function smart code sequence, the zero correlation zones (ZCZs) which the bridge function sequences' auto-correlation functions had, could reduce multipath fading of the pulse interference. The Modulated channel signal was sent into the IEEE 802.15.3a UWB channel. We analysis the ZCZs's inhibition to the interference multipath interference (MPI), as one of the main system sources interferences. The simulation in SIMULINK/MATLAB is described in detail. The result shows the system has better performance by comparison with that employing Walsh sequence square matrix, and it was verified by the formula in principle.

Proglucagons in vertebrates: Expression and processing of multiple genes in a bony fish.

PubMed

Busby, Ellen R; Mommsen, Thomas P

2016-09-01

In contrast to mammals, where a single proglucagon (PG) gene encodes three peptides: glucagon, glucagon-like peptide 1 and glucagon-like peptide 2 (GLP-1; GLP-2), many non-mammalian vertebrates carry multiple PG genes. Here, we investigate proglucagon mRNA sequences, their tissue expression and processing in a diploid bony fish. Copper rockfish (Sebastes caurinus) express two independent genes coding for distinct proglucagon sequences (PG I, PG II), with PG II lacking the GLP-2 sequence. These genes are differentially transcribed in the endocrine pancreas, the brain, and the gastrointestinal tract. Alternative splicing identified in rockfish is only one part of this complex regulation of the PG transcripts: the system has the potential to produce two glucagons, four GLP-1s and a single GLP-2, or any combination of these peptides. Mass spectrometric analysis of partially purified PG-derived peptides in endocrine pancreas confirms translation of both PG transcripts and differential processing of the resulting peptides. The complex differential regulation of the two PG genes and their continued presence in this extant teleostean fish strongly suggests unique and, as yet largely unidentified, roles for the peptide products encoded in each gene. Copyright © 2016 Elsevier Inc. All rights reserved.

CID-miRNA: A web server for prediction of novel miRNA precursors in human genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tyagi, Sonika; Vaz, Candida; Gupta, Vipin

2008-08-08

microRNAs (miRNA) are a class of non-protein coding functional RNAs that are thought to regulate expression of target genes by direct interaction with mRNAs. miRNAs have been identified through both experimental and computational methods in a variety of eukaryotic organisms. Though these approaches have been partially successful, there is a need to develop more tools for detection of these RNAs as they are also thought to be present in abundance in many genomes. In this report we describe a tool and a web server, named CID-miRNA, for identification of miRNA precursors in a given DNA sequence, utilising secondary structure-based filteringmore » systems and an algorithm based on stochastic context free grammar trained on human miRNAs. CID-miRNA analyses a given sequence using a web interface, for presence of putative miRNA precursors and the generated output lists all the potential regions that can form miRNA-like structures. It can also scan large genomic sequences for the presence of potential miRNA precursors in its stand-alone form. The web server can be accessed at (http://mirna.jnu.ac.in/cidmirna/)« less

Genetic and molecular characterization of the maize rp3 rust resistance locus.

PubMed Central

Webb, Craig A; Richter, Todd E; Collins, Nicholas C; Nicolas, Marie; Trick, Harold N; Pryor, Tony; Hulbert, Scot H

2002-01-01

In maize, the Rp3 gene confers resistance to common rust caused by Puccinia sorghi. Flanking marker analysis of rust-susceptible rp3 variants suggested that most of them arose via unequal crossing over, indicating that rp3 is a complex locus like rp1. The PIC13 probe identifies a nucleotide binding site-leucine-rich repeat (NBS-LRR) gene family that maps to the complex. Rp3 variants show losses of PIC13 family members relative to the resistant parents when probed with PIC13, indicating that the Rp3 gene is a member of this family. Gel blots and sequence analysis suggest that at least 9 family members are at the locus in most Rp3-carrying lines and that at least 5 of these are transcribed in the Rp3-A haplotype. The coding regions of 14 family members, isolated from three different Rp3-carrying haplotypes, had DNA sequence identities from 93 to 99%. Partial sequencing of clones of a BAC contig spanning the rp3 locus in the maize inbred line B73 identified five different PIC13 paralogues in a region of approximately 140 kb. PMID:12242248

SieveSifter: a web-based tool for visualizing the sieve analyses of HIV-1 vaccine efficacy trials.

PubMed

Fiore-Gartland, Andrew; Kullman, Nicholas; deCamp, Allan C; Clenaghan, Graham; Yang, Wayne; Magaret, Craig A; Edlefsen, Paul T; Gilbert, Peter B

2017-08-01

Analysis of HIV-1 virions from participants infected in a randomized controlled preventive HIV-1 vaccine efficacy trial can help elucidate mechanisms of partial protection. By comparing the genetic sequence of viruses from vaccine and placebo recipients to the sequence of the vaccine itself, a technique called 'sieve analysis', one can identify functional specificities of vaccine-induced immune responses. We have created an interactive web-based visualization and data access tool for exploring the results of sieve analyses performed on four major preventive HIV-1 vaccine efficacy trials: (i) the HIV Vaccine Trial Network (HVTN) 502/Step trial, (ii) the RV144/Thai trial, (iii) the HVTN 503/Phambili trial and (iv) the HVTN 505 trial. The tool acts simultaneously as a platform for rapid reinterpretation of sieve effects and as a portal for organizing and sharing the viral sequence data. Access to these valuable datasets also enables the development of novel methodology for future sieve analyses. Visualization: http://sieve.fredhutch.org/viz . Source code: https://github.com/nkullman/SIEVE . Data API: http://sieve.fredhutch.org/data . agartlan@fredhutch.org. © The Author(s) 2017. Published by Oxford University Press.

Expanding the proteome: disordered and alternatively-folded proteins

PubMed Central

Dyson, H. Jane

2011-01-01

Proteins provide much of the scaffolding for life, as well as undertaking a variety of essential catalytic reactions. These characteristic functions have led us to presuppose that proteins are in general functional only when well-structured and correctly folded. As we begin to explore the repertoire of possible protein sequences inherent in the human and other genomes, two stark facts that belie this supposition become clear: firstly, the number of apparent open reading frames in the human genome is significantly smaller than appears to be necessary to code for all of the diverse proteins in higher organisms, and secondly that a significant proportion of the protein sequences that would be coded by the genome would not be expected to form stable three-dimensional structures. Clearly the genome must include coding for a multitude of alternative forms of proteins, some of which may be partly or fully disordered or incompletely structured in their functional states. At the same time as this likelihood was recognized, experimental studies also began to uncover examples of important protein molecules and domains that were incompletely structured or completely disordered in solution, yet remained perfectly functional. In the ensuing years, we have seen an explosion of experimental and genome-annotation studies that have mapped the extent of the intrinsic disorder phenomenon and explored the possible biological rationales for its widespread occurrence. Answers to the question “why would a particular domain need to be unstructured?” are as varied as the systems where such domains are found. This review provides a survey of recent new directions in this field, and includes an evaluation of the role not only of intrinsically disordered proteins but of partially structured and highly dynamic members of the disorder-order continuum. PMID:21729349

The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes.

PubMed Central

Fletcher, Simon P; Ali, Iraj K; Kaminski, Ann; Digard, Paul; Jackson, Richard J

2002-01-01

Classical swine fever virus (CSFV) is a member of the pestivirus family, which shares many features in common with hepatitis C virus (HCV). It is shown here that CSFV has an exceptionally efficient cis-acting internal ribosome entry segment (IRES), which, like that of HCV, is strongly influenced by the sequences immediately downstream of the initiation codon, and is optimal with viral coding sequences in this position. Constructs that retained 17 or more codons of viral coding sequence exhibited full IRES activity, but with only 12 codons, activity was approximately 66% of maximum in vitro (though close to maximum in transfected BHK cells), whereas with just 3 codons or fewer, the activity was only approximately 15% of maximum. The minimal coding region elements required for high activity were exchanged between HCV and CSFV. Although maximum activity was observed in each case with the homologous combination of coding region and 5' UTR, the heterologous combinations were sufficiently active to rule out a highly specific functional interplay between the 5' UTR and coding sequences. On the other hand, inversion of the coding sequences resulted in low IRES activity, particularly with the HCV coding sequences. RNA structure probing showed that the efficiency of internal initiation of these chimeric constructs correlated most closely with the degree of single-strandedness of the region around and immediately downstream of the initiation codon. The low activity IRESs could not be rescued by addition of supplementary eIF4A (the initiation factor with ATP-dependent RNA helicase activity). The extreme sensitivity to secondary structure around the initiation codon is likely to be due to the fact that the eIF4F complex (which has eIF4A as one of its subunits) is not required for and does not participate in initiation on these IRESs. PMID:12515388

Transition to chaos in an open unforced 2D flow

NASA Technical Reports Server (NTRS)

Pulliam, Thomas H.; Vastano, John A.

1993-01-01

The present numerical study of unsteady, low Reynolds number flow past a 2D airfoil attempts to ascertain the bifurcation sequence leading from simple periodic to complex aperiodic flow with rising Reynolds number, as well as to characterize the degree of chaos present in the aperiodic flow and assess the role of numerics in the modification and control of the observed bifurcation scenario. The ARC2D Navier-Stokes code is used in an unsteady time-accurate mode for most of these computations. The system undergoes a period-doubling bifurcation to chaos as the Reynolds number is increased from 800 to 1600; its chaotic attractors are characterized by estimates of the fractal dimension and partial Liapunov exponent spectra.

Draft genome sequence of Micrococcus luteus strain O'Kane implicates metabolic versatility and the potential to degrade polyhydroxybutyrates.

PubMed

Hanafy, Radwa A; Couger, M B; Baker, Kristina; Murphy, Chelsea; O'Kane, Shannon D; Budd, Connie; French, Donald P; Hoff, Wouter D; Youssef, Noha

2016-09-01

Micrococcus luteus is a predominant member of skin microbiome. We here report on the genomic analysis of Micrococcus luteus strain O'Kane that was isolated from an elevator. The partial genome assembly of Micrococcus luteus strain O'Kane is 2.5 Mb with 2256 protein-coding genes and 62 RNA genes. Genomic analysis revealed metabolic versatility with genes involved in the metabolism and transport of glucose, galactose, fructose, mannose, alanine, aspartate, asparagine, glutamate, glutamine, glycine, serine, cysteine, methionine, arginine, proline, histidine, phenylalanine, and fatty acids. Genomic comparison to other M. luteus representatives identified the potential to degrade polyhydroxybutyrates, as well as several antibiotic resistance genes absent from other genomes.

Optimizing multiple sequence alignments using a genetic algorithm based on three objectives: structural information, non-gaps percentage and totally conserved columns.

PubMed

Ortuño, Francisco M; Valenzuela, Olga; Rojas, Fernando; Pomares, Hector; Florido, Javier P; Urquiza, Jose M; Rojas, Ignacio

2013-09-01

Multiple sequence alignments (MSAs) are widely used approaches in bioinformatics to carry out other tasks such as structure predictions, biological function analyses or phylogenetic modeling. However, current tools usually provide partially optimal alignments, as each one is focused on specific biological features. Thus, the same set of sequences can produce different alignments, above all when sequences are less similar. Consequently, researchers and biologists do not agree about which is the most suitable way to evaluate MSAs. Recent evaluations tend to use more complex scores including further biological features. Among them, 3D structures are increasingly being used to evaluate alignments. Because structures are more conserved in proteins than sequences, scores with structural information are better suited to evaluate more distant relationships between sequences. The proposed multiobjective algorithm, based on the non-dominated sorting genetic algorithm, aims to jointly optimize three objectives: STRIKE score, non-gaps percentage and totally conserved columns. It was significantly assessed on the BAliBASE benchmark according to the Kruskal-Wallis test (P < 0.01). This algorithm also outperforms other aligners, such as ClustalW, Multiple Sequence Alignment Genetic Algorithm (MSA-GA), PRRP, DIALIGN, Hidden Markov Model Training (HMMT), Pattern-Induced Multi-sequence Alignment (PIMA), MULTIALIGN, Sequence Alignment Genetic Algorithm (SAGA), PILEUP, Rubber Band Technique Genetic Algorithm (RBT-GA) and Vertical Decomposition Genetic Algorithm (VDGA), according to the Wilcoxon signed-rank test (P < 0.05), whereas it shows results not significantly different to 3D-COFFEE (P > 0.05) with the advantage of being able to use less structures. Structural information is included within the objective function to evaluate more accurately the obtained alignments. The source code is available at http://www.ugr.es/~fortuno/MOSAStrE/MO-SAStrE.zip.

Detecting the borders between coding and non-coding DNA regions in prokaryotes based on recursive segmentation and nucleotide doublets statistics

PubMed Central

2012-01-01

Background Detecting the borders between coding and non-coding regions is an essential step in the genome annotation. And information entropy measures are useful for describing the signals in genome sequence. However, the accuracies of previous methods of finding borders based on entropy segmentation method still need to be improved. Methods In this study, we first applied a new recursive entropic segmentation method on DNA sequences to get preliminary significant cuts. A 22-symbol alphabet is used to capture the differential composition of nucleotide doublets and stop codon patterns along three phases in both DNA strands. This process requires no prior training datasets. Results Comparing with the previous segmentation methods, the experimental results on three bacteria genomes, Rickettsia prowazekii, Borrelia burgdorferi and E.coli, show that our approach improves the accuracy for finding the borders between coding and non-coding regions in DNA sequences. Conclusions This paper presents a new segmentation method in prokaryotes based on Jensen-Rényi divergence with a 22-symbol alphabet. For three bacteria genomes, comparing to A12_JR method, our method raised the accuracy of finding the borders between protein coding and non-coding regions in DNA sequences. PMID:23282225

Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

PubMed

Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

2016-01-01

The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

Nonspatial Sequence Coding in CA1 Neurons

PubMed Central

Allen, Timothy A.; Salz, Daniel M.; McKenzie, Sam

2016-01-01

The hippocampus is critical to the memory for sequences of events, a defining feature of episodic memory. However, the fundamental neuronal mechanisms underlying this capacity remain elusive. While considerable research indicates hippocampal neurons can represent sequences of locations, direct evidence of coding for the memory of sequential relationships among nonspatial events remains lacking. To address this important issue, we recorded neural activity in CA1 as rats performed a hippocampus-dependent sequence-memory task. Briefly, the task involves the presentation of repeated sequences of odors at a single port and requires rats to identify each item as “in sequence” or “out of sequence”. We report that, while the animals' location and behavior remained constant, hippocampal activity differed depending on the temporal context of items—in this case, whether they were presented in or out of sequence. Some neurons showed this effect across items or sequence positions (general sequence cells), while others exhibited selectivity for specific conjunctions of item and sequence position information (conjunctive sequence cells) or for specific probe types (probe-specific sequence cells). We also found that the temporal context of individual trials could be accurately decoded from the activity of neuronal ensembles, that sequence coding at the single-cell and ensemble level was linked to sequence memory performance, and that slow-gamma oscillations (20–40 Hz) were more strongly modulated by temporal context and performance than theta oscillations (4–12 Hz). These findings provide compelling evidence that sequence coding extends beyond the domain of spatial trajectories and is thus a fundamental function of the hippocampus. SIGNIFICANCE STATEMENT The ability to remember the order of life events depends on the hippocampus, but the underlying neural mechanisms remain poorly understood. Here we addressed this issue by recording neural activity in hippocampal region CA1 while rats performed a nonspatial sequence memory task. We found that hippocampal neurons code for the temporal context of items (whether odors were presented in the correct or incorrect sequential position) and that this activity is linked with memory performance. The discovery of this novel form of temporal coding in hippocampal neurons advances our fundamental understanding of the neurobiology of episodic memory and will serve as a foundation for our cross-species, multitechnique approach aimed at elucidating the neural mechanisms underlying memory impairments in aging and dementia. PMID:26843637

Structural analysis of the HLA-A/HLA-F subregion: Precise localization of two new multigene families closely associated with the HLA class I sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pichon, L.; Carn, G.; Bouric, P.

1996-03-01

Positional cloning strategies for the hemochromatosis gene have previously concentrated on a target area restricted to a maximum genomic expanse of 400 kb around the HLA-A and HLA-F loci. Recently, the candidate region has been extended to 2-3 Mb on the distal side of the MHC. In this study, 10 coding sequences [hemochromatosis candidate genes (HCG) I to X] were isolated by cDNA selection using YACs covering the HLA-A/HLA-F subregion. Two of these (HCG II and HCG IV) belong to multigene families, as well as other sequences already described in this region, i.e., P5, pMC 6.7, and HLA class I.more » Fingerprinting of the four YACSs overlapping the region was performed and allowed partial localization of the different multigene family sequences on each YAC without defining their exact positions. Fingerprinting on cosmids isolated from the ICRF chromosome 6-specific cosmid library allowed more precise localization of the redundant sequences in all of the multigene families and revealed their apparent organization in clusters. Further examination of these intertwined sequences demonstrated that this structural organization resulted from a succession of complex phenomena, including duplications and contractions. This study presents a precise description of the structural organization of the HLA-A/HLA-F region and a determination of the sequences involved in the megabase size polymorphism observed among the A3, A24, and A31 haplotypes. 29 refs., 2 figs., 2 tabs.« less

Repeats of base oligomers as the primordial coding sequences of the primeval earth and their vestiges in modern genes.

PubMed

Ohno, S

1984-01-01

Three outstanding properties uniquely qualify repeats of base oligomers as the primordial coding sequences of all polypeptide chains. First, when compared with randomly generated base sequences in general, they are more likely to have long open reading frames. Second, periodical polypeptide chains specified by such repeats are more likely to assume either alpha-helical or beta-sheet secondary structures than are polypeptide chains of random sequence. Third, provided that the number of bases in the oligomeric unit is not a multiple of 3, these internally repetitious coding sequences are impervious to randomly sustained base substitutions, deletions, and insertions. This is because the recurring periodicity of their polypeptide chains is given by three consecutive copies of the oligomeric unit translated in three different reading frames. Accordingly, when one reading frame is open, the other two are automatically open as well, all three being capable of coding for polypeptide chains of identical periodicity. Under this circumstance, a frame shift due to the deletion or insertion of a number of bases that is not a multiple of 3 fails to alter the down-stream amino acid sequence, and even a base change causing premature chain-termination can silence only one of the three potential coding units. Newly arisen coding sequences in modern organisms are oligomeric repeats, and most of the older genes retain various vestiges of their original internal repetitions. Some of the genes (e.g., oncogenes) have even inherited the property of being impervious to randomly sustained base changes.

Identification of three genotypes of sugarcane yellow leaf virus causing yellow leaf disease from India and their molecular characterization.

PubMed

Viswanathan, R; Balamuralikrishnan, M; Karuppaiah, R

2008-12-01

Sugarcane yellow leaf virus (SCYLV) that causes yellow leaf disease (YLD) in sugarcane (recently reported in India) belongs to Polerovirus. Detailed studies were conducted to characterize the virus based on partial open reading frames (ORFs) 1 and 2 and complete ORFs 3 and 4 sequences in their genome. Reverse-transcriptase polymerase chain reaction (RT-PCR) was performed on 48 sugarcane leaf samples to detect the virus using a specific set of primers. Of the 48 samples, 36 samples (field samples with and without foliar symptoms) including 10 meristem culture derived plants were found to be positive to SCYLV infection. Additionally, an aphid colony collected from symptomatic sugarcane in the field was also found to be SCYLV positive. The amplicons from 22 samples were cloned, sequenced and acronymed as SCYLV-CB isolates. The nucleotide (nt) and amino acid (aa) sequence comparison showed a significant variation between SCYLV-CB and the database sequences at nt (3.7-5.1%) and aa (3.2-5.3%) sequence level in the CP coding region. However, the database sequences comprising isolates of three reported genotypes, viz., BRA, PER and REU, were observed with least nt and aa sequence dissimilarities (0.0-1.6%). The phylogenetic analyses of the overlapping ORFs (ORF 3 and ORF 4) of SCYLV encoding CP and MP determined in this study and additional sequences of 26 other isolates including an Indian isolate (SCYLV-IND) available from GenBank were distributed in four phylogenetic clusters. The SCYLV-CB isolates from this study lineated in two clusters (C1 and C2) and all the other isolates from the worldwide locations into another two clusters (C3 and C4). The sequence variation of the isolates in this study with the database isolates, even in the least variable region of the SCYLV genome, showed that the population existing in India is significantly different from rest of the world. Further, comparison of partial sequences encoding for ORFs 1 and 2 revealed that YLD in sugarcane in India is caused by at least three genotypes, viz., CUB, IND and BRA-PER, of which a majority of the samples were found infected with Cuban genotype (CUB) and lesser by IND and BRA-PER genotypes. The genotype IND was identified as a new genotype from this study, and this was found to have significant variation with the reported genotypes.

Analysis and recognition of 5′ UTR intron splice sites in human pre-mRNA

PubMed Central

Eden, E.; Brunak, S.

2004-01-01

Prediction of splice sites in non-coding regions of genes is one of the most challenging aspects of gene structure recognition. We perform a rigorous analysis of such splice sites embedded in human 5′ untranslated regions (UTRs), and investigate correlations between this class of splice sites and other features found in the adjacent exons and introns. By restricting the training of neural network algorithms to ‘pure’ UTRs (not extending partially into protein coding regions), we for the first time investigate the predictive power of the splicing signal proper, in contrast to conventional splice site prediction, which typically relies on the change in sequence at the transition from protein coding to non-coding. By doing so, the algorithms were able to pick up subtler splicing signals that were otherwise masked by ‘coding’ noise, thus enhancing significantly the prediction of 5′ UTR splice sites. For example, the non-coding splice site predicting networks pick up compositional and positional bias in the 3′ ends of non-coding exons and 5′ non-coding intron ends, where cytosine and guanine are over-represented. This compositional bias at the true UTR donor sites is also visible in the synaptic weights of the neural networks trained to identify UTR donor sites. Conventional splice site prediction methods perform poorly in UTRs because the reading frame pattern is absent. The NetUTR method presented here performs 2–3-fold better compared with NetGene2 and GenScan in 5′ UTRs. We also tested the 5′ UTR trained method on protein coding regions, and discovered, surprisingly, that it works quite well (although it cannot compete with NetGene2). This indicates that the local splicing pattern in UTRs and coding regions is largely the same. The NetUTR method is made publicly available at www.cbs.dtu.dk/services/NetUTR. PMID:14960723

24 CFR 200.926c - Model code provisions for use in partially accepted code jurisdictions.

Code of Federal Regulations, 2014 CFR

2014-04-01

... jurisdictions. If a lender or other interested party is notified that a State or local building code has been... in accordance with the applicable State or local building code, plus those additional requirements... 24 Housing and Urban Development 2 2014-04-01 2014-04-01 false Model code provisions for use in...

24 CFR 200.926c - Model code provisions for use in partially accepted code jurisdictions.

Code of Federal Regulations, 2013 CFR

2013-04-01

... jurisdictions. If a lender or other interested party is notified that a State or local building code has been... in accordance with the applicable State or local building code, plus those additional requirements... 24 Housing and Urban Development 2 2013-04-01 2013-04-01 false Model code provisions for use in...

24 CFR 200.926c - Model code provisions for use in partially accepted code jurisdictions.

Code of Federal Regulations, 2012 CFR

2012-04-01

... jurisdictions. If a lender or other interested party is notified that a State or local building code has been... in accordance with the applicable State or local building code, plus those additional requirements... 24 Housing and Urban Development 2 2012-04-01 2012-04-01 false Model code provisions for use in...

Diagnostic screening identifies a wide range of mutations involving the SHOX gene, including a common 47.5 kb deletion 160 kb downstream with a variable phenotypic effect.

PubMed

Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon

2013-06-01

Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.

Genetic and molecular characterization of a gene encoding a wide specificity purine permease of Aspergillus nidulans reveals a novel family of transporters conserved in prokaryotes and eukaryotes.

PubMed

Diallinas, G; Gorfinkiel, L; Arst, H N; Cecchetto, G; Scazzocchio, C

1995-04-14

In Aspergillus nidulans, loss-of-function mutations in the uapA and azgA genes, encoding the major uric acid-xanthine and hypoxanthine-adenine-guanine permeases, respectively, result in impaired utilization of these purines as sole nitrogen sources. The residual growth of the mutant strains is due to the activity of a broad specificity purine permease. We have identified uapC, the gene coding for this third permease through the isolation of both gain-of-function and loss-of-function mutations. Uptake studies with wild-type and mutant strains confirmed the genetic analysis and showed that the UapC protein contributes 30% and 8-10% to uric acid and hypoxanthine transport rates, respectively. The uapC gene was cloned, its expression studied, its sequence and transcript map established, and the sequence of its putative product analyzed. uapC message accumulation is: (i) weakly induced by 2-thiouric acid; (ii) repressed by ammonium; (iii) dependent on functional uaY and areA regulatory gene products (mediating uric acid induction and nitrogen metabolite repression, respectively); (iv) increased by uapC gain-of-function mutations which specifically, but partially, suppress a leucine to valine mutation in the zinc finger of the protein coded by the areA gene. The putative uapC gene product is a highly hydrophobic protein of 580 amino acids (M(r) = 61,251) including 12-14 putative transmembrane segments. The UapC protein is highly similar (58% identity) to the UapA permease and significantly similar (23-34% identity) to a number of bacterial transporters. Comparisons of the sequences and hydropathy profiles of members of this novel family of transporters yield insights into their structure, functionally important residues, and possible evolutionary relationships.

The Pekin duck programmed death-ligand 1: cDNA cloning, genomic structure, molecular characterization and mRNA expression analysis.

PubMed

Yao, Q; Fischer, K P; Tyrrell, D L; Gutfreund, K S

2015-04-01

Programmed death ligand-1 (PD-L1) plays an important role in the attenuation of adaptive immune responses in higher vertebrates. Here, we describe the identification of the Pekin duck PD-L1 orthologue (duPD-L1) and its gene structure. The duPD-L1 cDNA encodes a 311-amino acid protein that has an amino acid identity of 78% and 42% with chicken and human PD-L1, respectively. Mapping of the duPD-L1 cDNA with duck genomic sequences revealed an exonic structure of its coding sequence similar to those of other vertebrates but lacked a noncoding exon 1. Homology modelling of the duPD-L1 extracellular domain was compatible with the tandem IgV-like and IgC-like IgSF domain structure of human PD-L1 (PDB ID: 3BIS). Residues known to be important for receptor binding of human PD-L1 were mostly conserved in duPD-L1 within the N-terminus and the G sheet, and partially conserved within the F sheet but not within sheets C and C'. DuPD-L1 mRNA was constitutively expressed in all tissues examined with highest expression levels in lung and spleen and very low levels of expression in muscle, kidney and brain. Mitogen stimulation of duck peripheral blood mononuclear cells transiently increased duPD-L1 mRNA expression. Our observations demonstrate evolutionary conservation of the exonic structure of its coding sequence, the extracellular domain structure and residues implicated in receptor binding, but the role of the longer cytoplasmic tail in avian PD-L1 proteins remains to be determined. © 2014 John Wiley & Sons Ltd.

Detection of a new bat gammaherpesvirus in the Philippines.

PubMed

Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

2009-08-01

A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

Comparison of simple sequence repeats in 19 Archaea.

PubMed

Trivedi, S

2006-12-05

All organisms that have been studied until now have been found to have differential distribution of simple sequence repeats (SSRs), with more SSRs in intergenic than in coding sequences. SSR distribution was investigated in Archaea genomes where complete chromosome sequences of 19 Archaea were analyzed with the program SPUTNIK to find di- to penta-nucleotide repeats. The number of repeats was determined for the complete chromosome sequences and for the coding and non-coding sequences. Different from what has been found for other groups of organisms, there is an abundance of SSRs in coding regions of the genome of some Archaea. Dinucleotide repeats were rare and CG repeats were found in only two Archaea. In general, trinucleotide repeats are the most abundant SSR motifs; however, pentanucleotide repeats are abundant in some Archaea. Some of the tetranucleotide and pentanucleotide repeat motifs are organism specific. In general, repeats are short and CG-rich repeats are present in Archaea having a CG-rich genome. Among the 19 Archaea, SSR density was not correlated with genome size or with optimum growth temperature. Pentanucleotide density had an inverse correlation with the CG content of the genome.

Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

PubMed

Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

2016-03-01

Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

High-speed optical phase-shifting apparatus

DOEpatents

Zortman, William A.

2016-11-08

An optical phase shifter includes an optical waveguide, a plurality of partial phase shifting elements arranged sequentially, and control circuitry electrically coupled to the partial phase shifting elements. The control circuitry is adapted to provide an activating signal to each of the N partial phase shifting elements such that the signal is delayed by a clock cycle between adjacent partial phase shifting elements in the sequence. The transit time for a guided optical pulse train between the input edges of consecutive partial phase shifting elements in the sequence is arranged to be equal to a clock cycle, thereby enabling pipelined processing of the optical pulses.

Coherent direct sequence optical code multiple access encoding-decoding efficiency versus wavelength detuning.

PubMed

Pastor, D; Amaya, W; García-Olcina, R; Sales, S

2007-07-01

We present a simple theoretical model of and the experimental verification for vanishing of the autocorrelation peak due to wavelength detuning on the coding-decoding process of coherent direct sequence optical code multiple access systems based on a superstructured fiber Bragg grating. Moreover, the detuning vanishing effect has been explored to take advantage of this effect and to provide an additional degree of multiplexing and/or optical code tuning.

FOURTH SEMINAR TO THE MEMORY OF D.N. KLYSHKO: Algebraic solution of the synthesis problem for coded sequences

NASA Astrophysics Data System (ADS)

Leukhin, Anatolii N.

2005-08-01

The algebraic solution of a 'complex' problem of synthesis of phase-coded (PC) sequences with the zero level of side lobes of the cyclic autocorrelation function (ACF) is proposed. It is shown that the solution of the synthesis problem is connected with the existence of difference sets for a given code dimension. The problem of estimating the number of possible code combinations for a given code dimension is solved. It is pointed out that the problem of synthesis of PC sequences is related to the fundamental problems of discrete mathematics and, first of all, to a number of combinatorial problems, which can be solved, as the number factorisation problem, by algebraic methods by using the theory of Galois fields and groups.

Police accident report forms: safety device coding and enacted laws.

PubMed

Brock, K; Lapidus, G

2008-12-01

Safety device coding on state police accident report (PAR) forms was compared with provisions in state traffic safety laws. PAR forms were obtained from all 50 states and the District of Columbia (states/DC). For seat belts, 22 states/DC had a primary seat belt enforcement law vs 50 with a PAR code. For car seats, all 51 states/DC had a law and a PAR code. For booster seats, 39 states/DC had a law vs nine with a PAR code. For motorcycle helmets, 21 states/DC had an all-age rider helmet law and another 26 a partial-age law vs 50 with a PAR code. For bicycle helmets, 21 states/DC had a partial-age rider helmet law vs 48 with a PAR code. Therefore gaps in the ability of states to fully record accident data reflective of existing state traffic safety laws are revealed. Revising the PAR forms in all states to include complete variables for safety devices should be an important priority, independent of the laws.

Evaluating the protein coding potential of exonized transposable element sequences

PubMed Central

Piriyapongsa, Jittima; Rutledge, Mark T; Patel, Sanil; Borodovsky, Mark; Jordan, I King

2007-01-01

Background Transposable element (TE) sequences, once thought to be merely selfish or parasitic members of the genomic community, have been shown to contribute a wide variety of functional sequences to their host genomes. Analysis of complete genome sequences have turned up numerous cases where TE sequences have been incorporated as exons into mRNAs, and it is widely assumed that such 'exonized' TEs encode protein sequences. However, the extent to which TE-derived sequences actually encode proteins is unknown and a matter of some controversy. We have tried to address this outstanding issue from two perspectives: i-by evaluating ascertainment biases related to the search methods used to uncover TE-derived protein coding sequences (CDS) and ii-through a probabilistic codon-frequency based analysis of the protein coding potential of TE-derived exons. Results We compared the ability of three classes of sequence similarity search methods to detect TE-derived sequences among data sets of experimentally characterized proteins: 1-a profile-based hidden Markov model (HMM) approach, 2-BLAST methods and 3-RepeatMasker. Profile based methods are more sensitive and more selective than the other methods evaluated. However, the application of profile-based search methods to the detection of TE-derived sequences among well-curated experimentally characterized protein data sets did not turn up many more cases than had been previously detected and nowhere near as many cases as recent genome-wide searches have. We observed that the different search methods used were complementary in the sense that they yielded largely non-overlapping sets of hits and differed in their ability to recover known cases of TE-derived CDS. The probabilistic analysis of TE-derived exon sequences indicates that these sequences have low protein coding potential on average. In particular, non-autonomous TEs that do not encode protein sequences, such as Alu elements, are frequently exonized but unlikely to encode protein sequences. Conclusion The exaptation of the numerous TE sequences found in exons as bona fide protein coding sequences may prove to be far less common than has been suggested by the analysis of complete genomes. We hypothesize that many exonized TE sequences actually function as post-transcriptional regulators of gene expression, rather than coding sequences, which may act through a variety of double stranded RNA related regulatory pathways. Indeed, their relatively high copy numbers and similarity to sequences dispersed throughout the genome suggests that exonized TE sequences could serve as master regulators with a wide scope of regulatory influence. Reviewers: This article was reviewed by Itai Yanai, Kateryna D. Makova, Melissa Wilson (nominated by Kateryna D. Makova) and Cedric Feschotte (nominated by John M. Logsdon Jr.). PMID:18036258

RAMICS: trainable, high-speed and biologically relevant alignment of high-throughput sequencing reads to coding DNA

PubMed Central

Wright, Imogen A.; Travers, Simon A.

2014-01-01

The challenge presented by high-throughput sequencing necessitates the development of novel tools for accurate alignment of reads to reference sequences. Current approaches focus on using heuristics to map reads quickly to large genomes, rather than generating highly accurate alignments in coding regions. Such approaches are, thus, unsuited for applications such as amplicon-based analysis and the realignment phase of exome sequencing and RNA-seq, where accurate and biologically relevant alignment of coding regions is critical. To facilitate such analyses, we have developed a novel tool, RAMICS, that is tailored to mapping large numbers of sequence reads to short lengths (<10 000 bp) of coding DNA. RAMICS utilizes profile hidden Markov models to discover the open reading frame of each sequence and aligns to the reference sequence in a biologically relevant manner, distinguishing between genuine codon-sized indels and frameshift mutations. This approach facilitates the generation of highly accurate alignments, accounting for the error biases of the sequencing machine used to generate reads, particularly at homopolymer regions. Performance improvements are gained through the use of graphics processing units, which increase the speed of mapping through parallelization. RAMICS substantially outperforms all other mapping approaches tested in terms of alignment quality while maintaining highly competitive speed performance. PMID:24861618

A Low-Frequency Inactivating AKT2 Variant Enriched in the Finnish Population Is Associated With Fasting Insulin Levels and Type 2 Diabetes Risk.

PubMed

Manning, Alisa; Highland, Heather M; Gasser, Jessica; Sim, Xueling; Tukiainen, Taru; Fontanillas, Pierre; Grarup, Niels; Rivas, Manuel A; Mahajan, Anubha; Locke, Adam E; Cingolani, Pablo; Pers, Tune H; Viñuela, Ana; Brown, Andrew A; Wu, Ying; Flannick, Jason; Fuchsberger, Christian; Gamazon, Eric R; Gaulton, Kyle J; Im, Hae Kyung; Teslovich, Tanya M; Blackwell, Thomas W; Bork-Jensen, Jette; Burtt, Noël P; Chen, Yuhui; Green, Todd; Hartl, Christopher; Kang, Hyun Min; Kumar, Ashish; Ladenvall, Claes; Ma, Clement; Moutsianas, Loukas; Pearson, Richard D; Perry, John R B; Rayner, N William; Robertson, Neil R; Scott, Laura J; van de Bunt, Martijn; Eriksson, Johan G; Jula, Antti; Koskinen, Seppo; Lehtimäki, Terho; Palotie, Aarno; Raitakari, Olli T; Jacobs, Suzanne B R; Wessel, Jennifer; Chu, Audrey Y; Scott, Robert A; Goodarzi, Mark O; Blancher, Christine; Buck, Gemma; Buck, David; Chines, Peter S; Gabriel, Stacey; Gjesing, Anette P; Groves, Christopher J; Hollensted, Mette; Huyghe, Jeroen R; Jackson, Anne U; Jun, Goo; Justesen, Johanne Marie; Mangino, Massimo; Murphy, Jacquelyn; Neville, Matt; Onofrio, Robert; Small, Kerrin S; Stringham, Heather M; Trakalo, Joseph; Banks, Eric; Carey, Jason; Carneiro, Mauricio O; DePristo, Mark; Farjoun, Yossi; Fennell, Timothy; Goldstein, Jacqueline I; Grant, George; Hrabé de Angelis, Martin; Maguire, Jared; Neale, Benjamin M; Poplin, Ryan; Purcell, Shaun; Schwarzmayr, Thomas; Shakir, Khalid; Smith, Joshua D; Strom, Tim M; Wieland, Thomas; Lindstrom, Jaana; Brandslund, Ivan; Christensen, Cramer; Surdulescu, Gabriela L; Lakka, Timo A; Doney, Alex S F; Nilsson, Peter; Wareham, Nicholas J; Langenberg, Claudia; Varga, Tibor V; Franks, Paul W; Rolandsson, Olov; Rosengren, Anders H; Farook, Vidya S; Thameem, Farook; Puppala, Sobha; Kumar, Satish; Lehman, Donna M; Jenkinson, Christopher P; Curran, Joanne E; Hale, Daniel Esten; Fowler, Sharon P; Arya, Rector; DeFronzo, Ralph A; Abboud, Hanna E; Syvänen, Ann-Christine; Hicks, Pamela J; Palmer, Nicholette D; Ng, Maggie C Y; Bowden, Donald W; Freedman, Barry I; Esko, Tõnu; Mägi, Reedik; Milani, Lili; Mihailov, Evelin; Metspalu, Andres; Narisu, Narisu; Kinnunen, Leena; Bonnycastle, Lori L; Swift, Amy; Pasko, Dorota; Wood, Andrew R; Fadista, João; Pollin, Toni I; Barzilai, Nir; Atzmon, Gil; Glaser, Benjamin; Thorand, Barbara; Strauch, Konstantin; Peters, Annette; Roden, Michael; Müller-Nurasyid, Martina; Liang, Liming; Kriebel, Jennifer; Illig, Thomas; Grallert, Harald; Gieger, Christian; Meisinger, Christa; Lannfelt, Lars; Musani, Solomon K; Griswold, Michael; Taylor, Herman A; Wilson, Gregory; Correa, Adolfo; Oksa, Heikki; Scott, William R; Afzal, Uzma; Tan, Sian-Tsung; Loh, Marie; Chambers, John C; Sehmi, Jobanpreet; Kooner, Jaspal Singh; Lehne, Benjamin; Cho, Yoon Shin; Lee, Jong-Young; Han, Bok-Ghee; Käräjämäki, Annemari; Qi, Qibin; Qi, Lu; Huang, Jinyan; Hu, Frank B; Melander, Olle; Orho-Melander, Marju; Below, Jennifer E; Aguilar, David; Wong, Tien Yin; Liu, Jianjun; Khor, Chiea-Chuen; Chia, Kee Seng; Lim, Wei Yen; Cheng, Ching-Yu; Chan, Edmund; Tai, E Shyong; Aung, Tin; Linneberg, Allan; Isomaa, Bo; Meitinger, Thomas; Tuomi, Tiinamaija; Hakaste, Liisa; Kravic, Jasmina; Jørgensen, Marit E; Lauritzen, Torsten; Deloukas, Panos; Stirrups, Kathleen E; Owen, Katharine R; Farmer, Andrew J; Frayling, Timothy M; O'Rahilly, Stephen P; Walker, Mark; Levy, Jonathan C; Hodgkiss, Dylan; Hattersley, Andrew T; Kuulasmaa, Teemu; Stančáková, Alena; Barroso, Inês; Bharadwaj, Dwaipayan; Chan, Juliana; Chandak, Giriraj R; Daly, Mark J; Donnelly, Peter J; Ebrahim, Shah B; Elliott, Paul; Fingerlin, Tasha; Froguel, Philippe; Hu, Cheng; Jia, Weiping; Ma, Ronald C W; McVean, Gilean; Park, Taesung; Prabhakaran, Dorairaj; Sandhu, Manjinder; Scott, James; Sladek, Rob; Tandon, Nikhil; Teo, Yik Ying; Zeggini, Eleftheria; Watanabe, Richard M; Koistinen, Heikki A; Kesaniemi, Y Antero; Uusitupa, Matti; Spector, Timothy D; Salomaa, Veikko; Rauramaa, Rainer; Palmer, Colin N A; Prokopenko, Inga; Morris, Andrew D; Bergman, Richard N; Collins, Francis S; Lind, Lars; Ingelsson, Erik; Tuomilehto, Jaakko; Karpe, Fredrik; Groop, Leif; Jørgensen, Torben; Hansen, Torben; Pedersen, Oluf; Kuusisto, Johanna; Abecasis, Gonçalo; Bell, Graeme I; Blangero, John; Cox, Nancy J; Duggirala, Ravindranath; Seielstad, Mark; Wilson, James G; Dupuis, Josee; Ripatti, Samuli; Hanis, Craig L; Florez, Jose C; Mohlke, Karen L; Meigs, James B; Laakso, Markku; Morris, Andrew P; Boehnke, Michael; Altshuler, David; McCarthy, Mark I; Gloyn, Anna L; Lindgren, Cecilia M

2017-07-01

To identify novel coding association signals and facilitate characterization of mechanisms influencing glycemic traits and type 2 diabetes risk, we analyzed 109,215 variants derived from exome array genotyping together with an additional 390,225 variants from exome sequence in up to 39,339 normoglycemic individuals from five ancestry groups. We identified a novel association between the coding variant (p.Pro50Thr) in AKT2 and fasting plasma insulin (FI), a gene in which rare fully penetrant mutations are causal for monogenic glycemic disorders. The low-frequency allele is associated with a 12% increase in FI levels. This variant is present at 1.1% frequency in Finns but virtually absent in individuals from other ancestries. Carriers of the FI-increasing allele had increased 2-h insulin values, decreased insulin sensitivity, and increased risk of type 2 diabetes (odds ratio 1.05). In cellular studies, the AKT2-Thr50 protein exhibited a partial loss of function. We extend the allelic spectrum for coding variants in AKT2 associated with disorders of glucose homeostasis and demonstrate bidirectional effects of variants within the pleckstrin homology domain of AKT2 . © 2017 by the American Diabetes Association.

Genomic Sequence around Butterfly Wing Development Genes: Annotation and Comparative Analysis

PubMed Central

Conceição, Inês C.; Long, Anthony D.; Gruber, Jonathan D.; Beldade, Patrícia

2011-01-01

Background Analysis of genomic sequence allows characterization of genome content and organization, and access beyond gene-coding regions for identification of functional elements. BAC libraries, where relatively large genomic regions are made readily available, are especially useful for species without a fully sequenced genome and can increase genomic coverage of phylogenetic and biological diversity. For example, no butterfly genome is yet available despite the unique genetic and biological properties of this group, such as diversified wing color patterns. The evolution and development of these patterns is being studied in a few target species, including Bicyclus anynana, where a whole-genome BAC library allows targeted access to large genomic regions. Methodology/Principal Findings We characterize ∼1.3 Mb of genomic sequence around 11 selected genes expressed in B. anynana developing wings. Extensive manual curation of in silico predictions, also making use of a large dataset of expressed genes for this species, identified repetitive elements and protein coding sequence, and highlighted an expansion of Alcohol dehydrogenase genes. Comparative analysis with orthologous regions of the lepidopteran reference genome allowed assessment of conservation of fine-scale synteny (with detection of new inversions and translocations) and of DNA sequence (with detection of high levels of conservation of non-coding regions around some, but not all, developmental genes). Conclusions The general properties and organization of the available B. anynana genomic sequence are similar to the lepidopteran reference, despite the more than 140 MY divergence. Our results lay the groundwork for further studies of new interesting findings in relation to both coding and non-coding sequence: 1) the Alcohol dehydrogenase expansion with higher similarity between the five tandemly-repeated B. anynana paralogs than with the corresponding B. mori orthologs, and 2) the high conservation of non-coding sequence around the genes wingless and Ecdysone receptor, both involved in multiple developmental processes including wing pattern formation. PMID:21909358

Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6) causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto.

PubMed

Sasado, Takao; Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi

2017-01-01

Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.

Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6) causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto

PubMed Central

Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi

2017-01-01

Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3’UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3’UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3’UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo. PMID:28253363

Speech processing using conditional observable maximum likelihood continuity mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hogden, John; Nix, David

A computer implemented method enables the recognition of speech and speech characteristics. Parameters are initialized of first probability density functions that map between the symbols in the vocabulary of one or more sequences of speech codes that represent speech sounds and a continuity map. Parameters are also initialized of second probability density functions that map between the elements in the vocabulary of one or more desired sequences of speech transcription symbols and the continuity map. The parameters of the probability density functions are then trained to maximize the probabilities of the desired sequences of speech-transcription symbols. A new sequence ofmore » speech codes is then input to the continuity map having the trained first and second probability function parameters. A smooth path is identified on the continuity map that has the maximum probability for the new sequence of speech codes. The probability of each speech transcription symbol for each input speech code can then be output.« less

SequenceL: Automated Parallel Algorithms Derived from CSP-NT Computational Laws

NASA Technical Reports Server (NTRS)

Cooke, Daniel; Rushton, Nelson

2013-01-01

With the introduction of new parallel architectures like the cell and multicore chips from IBM, Intel, AMD, and ARM, as well as the petascale processing available for highend computing, a larger number of programmers will need to write parallel codes. Adding the parallel control structure to the sequence, selection, and iterative control constructs increases the complexity of code development, which often results in increased development costs and decreased reliability. SequenceL is a high-level programming language that is, a programming language that is closer to a human s way of thinking than to a machine s. Historically, high-level languages have resulted in decreased development costs and increased reliability, at the expense of performance. In recent applications at JSC and in industry, SequenceL has demonstrated the usual advantages of high-level programming in terms of low cost and high reliability. SequenceL programs, however, have run at speeds typically comparable with, and in many cases faster than, their counterparts written in C and C++ when run on single-core processors. Moreover, SequenceL is able to generate parallel executables automatically for multicore hardware, gaining parallel speedups without any extra effort from the programmer beyond what is required to write the sequen tial/singlecore code. A SequenceL-to-C++ translator has been developed that automatically renders readable multithreaded C++ from a combination of a SequenceL program and sample data input. The SequenceL language is based on two fundamental computational laws, Consume-Simplify- Produce (CSP) and Normalize-Trans - pose (NT), which enable it to automate the creation of parallel algorithms from high-level code that has no annotations of parallelism whatsoever. In our anecdotal experience, SequenceL development has been in every case less costly than development of the same algorithm in sequential (that is, single-core, single process) C or C++, and an order of magnitude less costly than development of comparable parallel code. Moreover, SequenceL not only automatically parallelizes the code, but since it is based on CSP-NT, it is provably race free, thus eliminating the largest quality challenge the parallelized software developer faces.

ANN modeling of DNA sequences: new strategies using DNA shape code.

PubMed

Parbhane, R V; Tambe, S S; Kulkarni, B D

2000-09-01

Two new encoding strategies, namely, wedge and twist codes, which are based on the DNA helical parameters, are introduced to represent DNA sequences in artificial neural network (ANN)-based modeling of biological systems. The performance of the new coding strategies has been evaluated by conducting three case studies involving mapping (modeling) and classification applications of ANNs. The proposed coding schemes have been compared rigorously and shown to outperform the existing coding strategies especially in situations wherein limited data are available for building the ANN models.

The primitive code and repeats of base oligomers as the primordial protein-encoding sequence.

PubMed Central

Ohno, S; Epplen, J T

1983-01-01

Even if the prebiotic self-replication of nucleic acids and the subsequent emergence of primitive, enzyme-independent tRNAs are accepted as plausible, the origin of life by spontaneous generation still appears improbable. This is because the just-emerged primitive translational machinery had to cope with base sequences that were not preselected for their coding potentials. Particularly if the primitive mitochondria-like code with four chain-terminating base triplets preceded the universal code, the translation of long, randomly generated, base sequences at this critical stage would have merely resulted in the production of short oligopeptides instead of long polypeptide chains. We present the base sequence of a mouse transcript containing tetranucleotide repeats conserved during evolution. Even if translated in accordance with the primitive mitochondria-like code, this transcript in its three reading frames can yield 245-, 246-, and 251-residue-long tetrapeptidic periodical polypeptides that are already acquiring longer periodicities. We contend that the first set of base sequences translated at the beginning of life were such oligonucleotide repeats. By quickly acquiring longer periodicities, their products must have soon gained characteristic secondary structures--alpha-helical or beta-sheet or both. PMID:6574491

Distribution of hepatitis B virus subgenotype F2a in São Paulo, Brazil.

PubMed

Alvarado-Mora, Mónica V; Botelho-Lima, Livia S; Santana, Rubia A; Sitnik, Roberta; Ferreira, Paulo Abrão; do Amaral Mello, Francisco; Mangueira, Cristovão P; Carrilho, Flair J; Rebello Pinho, João R

2013-10-21

HBV genotype F is primarily found in indigenous populations from South America and is classified in four subgenotypes (F1 to F4). Subgenotype F2a is the most common in Brazil among genotype F cases. The aim of this study was to characterize HBV genotype F2a circulating in 16 patients from São Paulo, Brazil. Samples were collected between 2006 and 2012 and sent to Hospital Israelita Albert Einstein. A fragment of 1306 bp partially comprising HBsAg and DNA polymerase coding regions was amplified and sequenced. Viral sequences were genotyped by phylogenetic analysis using reference sequences from GenBank (n=198), including 80 classified as subgenotype F2a. Bayesian Markov chain Monte Carlo simulation implemented in BEAST v.1.5.4 was applied to obtain the best possible estimates using the model of nucleotide substitutions GTR+G+I. It were identified three groups of sequences of subgenotype F2a: 1) 10 sequences from São Paulo state; 2) 3 sequences from Rio de Janeiro and one from São Paulo states; 3) 8 sequences from the West Amazon Basin. These results showing for the first time the distribution of F2a subgenotype in Brazil. The spreading and the dynamic of subgenotype F2a in Brazil requires the study of a higher number of samples from different regions as it is unfold in almost all Brazilian populations studied so far. We cannot infer with certainty the origin of these different groups due to the lack of available sequences. Nevertheless, our data suggest that the common origin of these groups probably occurred a long time ago.

Characterizing partial AZFc deletions of the Y chromosome with amplicon-specific sequence markers

PubMed Central

Navarro-Costa, Paulo; Pereira, Luísa; Alves, Cíntia; Gusmão, Leonor; Proença, Carmen; Marques-Vidal, Pedro; Rocha, Tiago; Correia, Sónia C; Jorge, Sónia; Neves, António; Soares, Ana P; Nunes, Joaquim; Calhaz-Jorge, Carlos; Amorim, António; Plancha, Carlos E; Gonçalves, João

2007-01-01

Background The AZFc region of the human Y chromosome is a highly recombinogenic locus containing multi-copy male fertility genes located in repeated DNA blocks (amplicons). These AZFc gene families exhibit slight sequence variations between copies which are considered to have functional relevance. Yet, partial AZFc deletions yield phenotypes ranging from normospermia to azoospermia, thwarting definite conclusions on their real impact on fertility. Results The amplicon content of partial AZFc deletion products was characterized with novel amplicon-specific sequence markers. Data indicate that partial AZFc deletions are a male infertility risk [odds ratio: 5.6 (95% CI: 1.6–30.1)] and although high diversity of partial deletion products and sequence conversion profiles were recorded, the AZFc marker profiles detected in fertile men were also observed in infertile men. Additionally, the assessment of rearrangement recurrence by Y-lineage analysis indicated that while partial AZFc deletions occurred in highly diverse samples, haplotype diversity was minimal in fertile men sharing identical marker profiles. Conclusion Although partial AZFc deletion products are highly heterogeneous in terms of amplicon content, this plasticity is not sufficient to account for the observed phenotypical variance. The lack of causative association between the deletion of specific gene copies and infertility suggests that AZFc gene content might be part of a multifactorial network, with Y-lineage evolution emerging as a possible phenotype modulator. PMID:17903263

A symmetry model for genetic coding via a wallpaper group composed of the traditional four bases and an imaginary base E: towards category theory-like systematization of molecular/genetic biology.

PubMed

Sawamura, Jitsuki; Morishita, Shigeru; Ishigooka, Jun

2014-05-07

Previously, we suggested prototypal models that describe some clinical states based on group postulates. Here, we demonstrate a group/category theory-like model for molecular/genetic biology as an alternative application of our previous model. Specifically, we focus on deoxyribonucleic acid (DNA) base sequences. We construct a wallpaper pattern based on a five-letter cruciform motif with letters C, A, T, G, and E. Whereas the first four letters represent the standard DNA bases, the fifth is introduced for ease in formulating group operations that reproduce insertions and deletions of DNA base sequences. A basic group Z5 = {r, u, d, l, n} of operations is defined for the wallpaper pattern, with which a sequence of points can be generated corresponding to changes of a base in a DNA sequence by following the orbit of a point of the pattern under operations in group Z5. Other manipulations of DNA sequence can be treated using a vector-like notation 'Dj' corresponding to a DNA sequence but based on the five-letter base set; also, 'Dj's are expressed graphically. Insertions and deletions of a series of letters 'E' are admitted to assist in describing DNA recombination. Likewise, a vector-like notation Rj can be constructed for sequences of ribonucleic acid (RNA). The wallpaper group B = {Z5×∞, ●} (an ∞-fold Cartesian product of Z5) acts on Dj (or Rj) yielding changes to Dj (or Rj) denoted by 'Dj◦B(j→k) = Dk' (or 'Rj◦B(j→k) = Rk'). Based on the operations of this group, two types of groups-a modulo 5 linear group and a rotational group over the Gaussian plane, acting on the five bases-are linked as parts of the wallpaper group for broader applications. As a result, changes, insertions/deletions and DNA (RNA) recombination (partial/total conversion) are described. As an exploratory study, a notation for the canonical "central dogma" via a category theory-like way is presented for future developments. Despite the large incompleteness of our methodology, there is fertile ground to consider a symmetry model for genetic coding based on our specific wallpaper group. A more integrated formulation containing "central dogma" for future molecular/genetic biology remains to be explored.

Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements

PubMed Central

Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan

2015-01-01

Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress. DOI: http://dx.doi.org/10.7554/eLife.09343.001 PMID:26196146

Substitution rate and natural selection in parvovirus B19

PubMed Central

Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.

2016-01-01

The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080

Genomics dataset of unidentified disclosed isolates.

PubMed

Rekadwad, Bhagwan N

2016-09-01

Analysis of DNA sequences is necessary for higher hierarchical classification of the organisms. It gives clues about the characteristics of organisms and their taxonomic position. This dataset is chosen to find complexities in the unidentified DNA in the disclosed patents. A total of 17 unidentified DNA sequences were thoroughly analyzed. The quick response codes were generated. AT/GC content of the DNA sequences analysis was carried out. The QR is helpful for quick identification of isolates. AT/GC content is helpful for studying their stability at different temperatures. Additionally, a dataset on cleavage code and enzyme code studied under the restriction digestion study, which helpful for performing studies using short DNA sequences was reported. The dataset disclosed here is the new revelatory data for exploration of unique DNA sequences for evaluation, identification, comparison and analysis.

CDSbank: taxonomy-aware extraction, selection, renaming and formatting of protein-coding DNA or amino acid sequences.

PubMed

Hazes, Bart

2014-02-28

Protein-coding DNA sequences and their corresponding amino acid sequences are routinely used to study relationships between sequence, structure, function, and evolution. The rapidly growing size of sequence databases increases the power of such comparative analyses but it makes it more challenging to prepare high quality sequence data sets with control over redundancy, quality, completeness, formatting, and labeling. Software tools for some individual steps in this process exist but manual intervention remains a common and time consuming necessity. CDSbank is a database that stores both the protein-coding DNA sequence (CDS) and amino acid sequence for each protein annotated in Genbank. CDSbank also stores Genbank feature annotation, a flag to indicate incomplete 5' and 3' ends, full taxonomic data, and a heuristic to rank the scientific interest of each species. This rich information allows fully automated data set preparation with a level of sophistication that aims to meet or exceed manual processing. Defaults ensure ease of use for typical scenarios while allowing great flexibility when needed. Access is via a free web server at http://hazeslab.med.ualberta.ca/CDSbank/. CDSbank presents a user-friendly web server to download, filter, format, and name large sequence data sets. Common usage scenarios can be accessed via pre-programmed default choices, while optional sections give full control over the processing pipeline. Particular strengths are: extract protein-coding DNA sequences just as easily as amino acid sequences, full access to taxonomy for labeling and filtering, awareness of incomplete sequences, and the ability to take one protein sequence and extract all synonymous CDS or identical protein sequences in other species. Finally, CDSbank can also create labeled property files to, for instance, annotate or re-label phylogenetic trees.

Genetic Diversity of Crimean Congo Hemorrhagic Fever Virus Strains from Iran

PubMed Central

Chinikar, Sadegh; Bouzari, Saeid; Shokrgozar, Mohammad Ali; Mostafavi, Ehsan; Jalali, Tahmineh; Khakifirouz, Sahar; Nowotny, Norbert; Fooks, Anthony R.; Shah-Hosseini, Nariman

2016-01-01

Background: Crimean Congo hemorrhagic fever virus (CCHFV) is a member of the Bunyaviridae family and Nairovirus genus. It has a negative-sense, single stranded RNA genome approximately 19.2 kb, containing the Small, Medium, and Large segments. CCHFVs are relatively divergent in their genome sequence and grouped in seven distinct clades based on S-segment sequence analysis and six clades based on M-segment sequences. Our aim was to obtain new insights into the molecular epidemiology of CCHFV in Iran. Methods: We analyzed partial and complete nucleotide sequences of the S and M segments derived from 50 Iranian patients. The extracted RNA was amplified using one-step RT-PCR and then sequenced. The sequences were analyzed using Mega5 software. Results: Phylogenetic analysis of partial S segment sequences demonstrated that clade IV-(Asia 1), clade IV-(Asia 2) and clade V-(Europe) accounted for 80 %, 4 % and 14 % of the circulating genomic variants of CCHFV in Iran respectively. However, one of the Iranian strains (Iran-Kerman/22) was associated with none of other sequences and formed a new clade (VII). The phylogenetic analysis of complete S-segment nucleotide sequences from selected Iranian CCHFV strains complemented with representative strains from GenBank revealed similar topology as partial sequences with eight major clusters. A partial M segment phylogeny positioned the Iranian strains in either association with clade III (Asia-Africa) or clade V (Europe). Conclusion: The phylogenetic analysis revealed subtle links between distant geographic locations, which we propose might originate either from international livestock trade or from long-distance carriage of CCHFV by infected ticks via bird migration. PMID:27308271

Variability and transmission by Aphis glycines of North American and Asian Soybean mosaic virus isolates.

PubMed

Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L

2003-10-01

The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.

Coding For Compression Of Low-Entropy Data

NASA Technical Reports Server (NTRS)

Yeh, Pen-Shu

1994-01-01

Improved method of encoding digital data provides for efficient lossless compression of partially or even mostly redundant data from low-information-content source. Method of coding implemented in relatively simple, high-speed arithmetic and logic circuits. Also increases coding efficiency beyond that of established Huffman coding method in that average number of bits per code symbol can be less than 1, which is the lower bound for Huffman code.

Closed Genome Sequence of Chryseobacterium piperi Strain CTMT/ATCC BAA-1782, a Gram-Negative Bacterium with Clostridial Neurotoxin-Like Coding Sequences

PubMed Central

Wentz, Travis G.; Muruvanda, Tim; Thirunavukkarasu, Nagarajan; Hoffmann, Maria; Allard, Marc W.; Hodge, David R.; Pillai, Segaran P.; Hammack, Thomas S.; Brown, Eric W.

2017-01-01

ABSTRACT Clostridial neurotoxins, including botulinum and tetanus neurotoxins, are among the deadliest known bacterial toxins. Until recently, the horizontal mobility of this toxin gene family appeared to be limited to the genus Clostridium. We report here the closed genome sequence of Chryseobacterium piperi, a Gram-negative bacterium containing coding sequences with homology to clostridial neurotoxin family proteins. PMID:29192076

Improving the genome annotation of the acarbose producer Actinoplanes sp. SE50/110 by sequencing enriched 5'-ends of primary transcripts.

PubMed

Schwientek, Patrick; Neshat, Armin; Kalinowski, Jörn; Klein, Andreas; Rückert, Christian; Schneiker-Bekel, Susanne; Wendler, Sergej; Stoye, Jens; Pühler, Alfred

2014-11-20

Actinoplanes sp. SE50/110 is the producer of the alpha-glucosidase inhibitor acarbose, which is an economically relevant and potent drug in the treatment of type-2 diabetes mellitus. In this study, we present the detection of transcription start sites on this genome by sequencing enriched 5'-ends of primary transcripts. Altogether, 1427 putative transcription start sites were initially identified. With help of the annotated genome sequence, 661 transcription start sites were found to belong to the leader region of protein-coding genes with the surprising result that roughly 20% of these genes rank among the class of leaderless transcripts. Next, conserved promoter motifs were identified for protein-coding genes with and without leader sequences. The mapped transcription start sites were finally used to improve the annotation of the Actinoplanes sp. SE50/110 genome sequence. Concerning protein-coding genes, 41 translation start sites were corrected and 9 novel protein-coding genes could be identified. In addition to this, 122 previously undetermined non-coding RNA (ncRNA) genes of Actinoplanes sp. SE50/110 were defined. Focusing on antisense transcription start sites located within coding genes or their leader sequences, it was discovered that 96 of those ncRNA genes belong to the class of antisense RNA (asRNA) genes. The remaining 26 ncRNA genes were found outside of known protein-coding genes. Four chosen examples of prominent ncRNA genes, namely the transfer messenger RNA gene ssrA, the ribonuclease P class A RNA gene rnpB, the cobalamin riboswitch RNA gene cobRS, and the selenocysteine-specific tRNA gene selC, are presented in more detail. This study demonstrates that sequencing of enriched 5'-ends of primary transcripts and the identification of transcription start sites are valuable tools for advanced genome annotation of Actinoplanes sp. SE50/110 and most probably also for other bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

Molecular confirmation of Hepatozoon canis in Mauritius.

PubMed

Daskalaki, Aikaterini Alexandra; Ionică, Angela Monica; Jeetah, Keshav; Gherman, Călin Mircea; Mihalca, Andrei Daniel

2018-01-01

In this study, Hepatozoon species was molecularly identified and characterized for the first time on the Indian Ocean island of Mauritius. Partial sequences of the 18S rRNA gene of the Hepatozoon isolates were analysed from three naturally infected dogs. The sequences of H. canis were similar to the 18S rRNA partial sequences (JX112783, AB365071 99%) from dog blood samples from West Indies and Nigeria. Our sequences were deposited in the GenBank database. Copyright © 2017 Elsevier B.V. All rights reserved.

Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov., isolated from flowers in French Guiana.

PubMed

Amoikon, Tiemele Laurent Simon; Grondin, Cécile; Djéni, Théodore N'Dédé; Jacques, Noémie; Casaregola, Serge

2018-05-21

Analysis of yeasts isolated from various biotopes in French Guiana led to the identification of two strains isolated from flowers and designated CLIB 1634 T and CLIB 1707 T . Comparison of the D1/D2 domain of the large subunit (LSU D1/D2) rRNA gene sequences of CLIB 1634 T and CLIB 1707 T to those in the GenBank database revealed that these strains belong to the Starmerella clade. Strain CLIB 1634 T was shown to diverge from the closely related Starmerella apicola type strain CBS 2868 T with a sequence divergence of 1.34 and 1.30 %, in the LSU D1/D2 rRNA gene and internal transcribed spacer (ITS) sequences respectively. Strain CLIB 1634 T and Candida apicola CBS 2868 T diverged by 3.81 and 14.96 % at the level of the protein-coding gene partial sequences EF-1α and RPB2, respectively. CLIB 1707 T was found to have sequence divergence of 3.88 and 9.16 % in the LSU D1/D2 rRNA gene and ITS, respectively, from that of the most closely related species Starmerella ratchasimensis type strain CBS 10611 T . The species Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov. are proposed to accommodate strains CLIB 1634 T (=CBS 15247 T ) and CLIB 1707 T (=CBS 15257 T ), respectively.

Homology of aspartyl- and lysyl-tRNA synthetases.

PubMed Central

Gampel, A; Tzagoloff, A

1989-01-01

The yeast nuclear gene MSD1 coding for mitochondrial aspartyl-tRNA synthetase has been cloned and sequenced. The identity of the gene is confirmed by the following evidence. (i) The primary structure of the protein derived from the gene sequence is similar to that of the yeast cytoplasmic aspartyl-tRNA synthetase. (ii) In situ disruption of MSD1 in a respiratory-competent haploid strain of yeast induces a pleiotropic phenotype consistent with a lesion in mitochondrial protein synthesis. (iii) Mitochondria from a mutant with a disrupted chromosomal copy of MSD1 are unable to acylate mitochondrial aspartyl-tRNA. The primary structures of the cytoplasmic and mitochondrial aspartyl-tRNA synthetases are similar to the yeast cytoplasmic lysyl-tRNA synthetase, suggesting that the two types of synthetases may have a common evolutionary origin. Searches of the current protein banks also have revealed a high degree of sequence similarity of the lysyl-tRNA synthetase to the product of the Escherichia coli herC gene and to the partial sequence of a protein encoded by an unidentified reading frame located adjacent to the E. coli frdA gene. Based on the sequence similarities and the map positions of the herC and frdA loci, we propose herC to be the structural gene of the constitutively expressed lysyl-tRNA synthetase of E. coli and the unidentified reading frame to be the structural gene of the heat-inducible lysyl-tRNA synthetase. Images PMID:2668951

Characterization of a novel ADAM protease expressed by Pneumocystis carinii.

PubMed

Kennedy, Cassie C; Kottom, Theodore J; Limper, Andrew H

2009-08-01

Pneumocystis species are opportunistic fungal pathogens that cause severe pneumonia in immunocompromised hosts. Recent evidence has suggested that unidentified proteases are involved in Pneumocystis life cycle regulation. Proteolytically active ADAM (named for "a disintegrin and metalloprotease") family molecules have been identified in some fungal organisms, such as Aspergillus fumigatus and Schizosaccharomyces pombe, and some have been shown to participate in life cycle regulation. Accordingly, we sought to characterize ADAM-like molecules in the fungal opportunistic pathogen, Pneumocystis carinii (PcADAM). After an in silico search of the P. carinii genomic sequencing project identified a 329-bp partial sequence with homology to known ADAM proteins, the full-length PcADAM sequence was obtained by PCR extension cloning, yielding a final coding sequence of 1,650 bp. Sequence analysis detected the presence of a typical ADAM catalytic active site (HEXXHXXGXXHD). Expression of PcADAM over the Pneumocystis life cycle was analyzed by Northern blot. Southern and contour-clamped homogenous electronic field blot analysis demonstrated its presence in the P. carinii genome. Expression of PcADAM was observed to be increased in Pneumocystis cysts compared to trophic forms. The full-length gene was subsequently cloned and heterologously expressed in Saccharomyces cerevisiae. Purified PcADAMp protein was proteolytically active in casein zymography, requiring divalent zinc. Furthermore, native PcADAMp extracted directly from freshly isolated Pneumocystis organisms also exhibited protease activity. This is the first report of protease activity attributable to a specific, characterized protein in the clinically important opportunistic fungal pathogen Pneumocystis.

Motion Detection in Ultrasound Image-Sequences Using Tensor Voting

NASA Astrophysics Data System (ADS)

Inba, Masafumi; Yanagida, Hirotaka; Tamura, Yasutaka

2008-05-01

Motion detection in ultrasound image sequences using tensor voting is described. We have been developing an ultrasound imaging system adopting a combination of coded excitation and synthetic aperture focusing techniques. In our method, frame rate of the system at distance of 150 mm reaches 5000 frame/s. Sparse array and short duration coded ultrasound signals are used for high-speed data acquisition. However, many artifacts appear in the reconstructed image sequences because of the incompleteness of the transmitted code. To reduce the artifacts, we have examined the application of tensor voting to the imaging method which adopts both coded excitation and synthetic aperture techniques. In this study, the basis of applying tensor voting and the motion detection method to ultrasound images is derived. It was confirmed that velocity detection and feature enhancement are possible using tensor voting in the time and space of simulated ultrasound three-dimensional image sequences.

Drosophila Nnf1 paralogs are partially redundant for somatic and germ line kinetochore function.

PubMed

Blattner, Ariane C; Aguilar-Rodríguez, José; Kränzlin, Marcella; Wagner, Andreas; Lehner, Christian F

2017-02-01

Kinetochores allow attachment of chromosomes to spindle microtubules. Moreover, they host proteins that permit correction of erroneous attachments and prevent premature anaphase onset before bi-orientation of all chromosomes in metaphase has been achieved. Kinetochores are assembled from subcomplexes. Kinetochore proteins as well as the underlying centromere proteins and the centromeric DNA sequences evolve rapidly despite their fundamental importance for faithful chromosome segregation during mitotic and meiotic divisions. During evolution of Drosophila melanogaster, several centromere proteins were lost and a recent gene duplication has resulted in two Nnf1 paralogs, Nnf1a and Nnf1b, which code for alternative forms of a Mis12 kinetochore complex component. The rapid evolutionary divergence of centromere/kinetochore constituents in animals and plants has been proposed to be driven by an intragenome conflict resulting from centromere drive during female meiosis. Thus, a female meiosis-specific paralog might be expected to evolve rapidly under positive selection. While our characterization of the D. melanogaster Nnf1 paralogs hints at some partial functional specialization of Nnf1b for meiosis, we have failed to detect evidence for positive selection in our analysis of Nnf1 sequence evolution in the Drosophilid lineage. Neither paralog is essential, even though we find some clear differences in subcellular localization and expression during development. Loss of both paralogs results in developmental lethality. We therefore conclude that the two paralogs are still in early stages of differentiation.

Differential gene expression in the siphonophore Nanomia bijuga (Cnidaria) assessed with multiple next-generation sequencing workflows.

PubMed

Siebert, Stefan; Robinson, Mark D; Tintori, Sophia C; Goetz, Freya; Helm, Rebecca R; Smith, Stephen A; Shaner, Nathan; Haddock, Steven H D; Dunn, Casey W

2011-01-01

We investigated differential gene expression between functionally specialized feeding polyps and swimming medusae in the siphonophore Nanomia bijuga (Cnidaria) with a hybrid long-read/short-read sequencing strategy. We assembled a set of partial gene reference sequences from long-read data (Roche 454), and generated short-read sequences from replicated tissue samples that were mapped to the references to quantify expression. We collected and compared expression data with three short-read expression workflows that differ in sample preparation, sequencing technology, and mapping tools. These workflows were Illumina mRNA-Seq, which generates sequence reads from random locations along each transcript, and two tag-based approaches, SOLiD SAGE and Helicos DGE, which generate reads from particular tag sites. Differences in expression results across workflows were mostly due to the differential impact of missing data in the partial reference sequences. When all 454-derived gene reference sequences were considered, Illumina mRNA-Seq detected more than twice as many differentially expressed (DE) reference sequences as the tag-based workflows. This discrepancy was largely due to missing tag sites in the partial reference that led to false negatives in the tag-based workflows. When only the subset of reference sequences that unambiguously have tag sites was considered, we found broad congruence across workflows, and they all identified a similar set of DE sequences. Our results are promising in several regards for gene expression studies in non-model organisms. First, we demonstrate that a hybrid long-read/short-read sequencing strategy is an effective way to collect gene expression data when an annotated genome sequence is not available. Second, our replicated sampling indicates that expression profiles are highly consistent across field-collected animals in this case. Third, the impacts of partial reference sequences on the ability to detect DE can be mitigated through workflow choice and deeper reference sequencing.

Differential Gene Expression in the Siphonophore Nanomia bijuga (Cnidaria) Assessed with Multiple Next-Generation Sequencing Workflows

PubMed Central

Siebert, Stefan; Robinson, Mark D.; Tintori, Sophia C.; Goetz, Freya; Helm, Rebecca R.; Smith, Stephen A.; Shaner, Nathan; Haddock, Steven H. D.; Dunn, Casey W.

2011-01-01

We investigated differential gene expression between functionally specialized feeding polyps and swimming medusae in the siphonophore Nanomia bijuga (Cnidaria) with a hybrid long-read/short-read sequencing strategy. We assembled a set of partial gene reference sequences from long-read data (Roche 454), and generated short-read sequences from replicated tissue samples that were mapped to the references to quantify expression. We collected and compared expression data with three short-read expression workflows that differ in sample preparation, sequencing technology, and mapping tools. These workflows were Illumina mRNA-Seq, which generates sequence reads from random locations along each transcript, and two tag-based approaches, SOLiD SAGE and Helicos DGE, which generate reads from particular tag sites. Differences in expression results across workflows were mostly due to the differential impact of missing data in the partial reference sequences. When all 454-derived gene reference sequences were considered, Illumina mRNA-Seq detected more than twice as many differentially expressed (DE) reference sequences as the tag-based workflows. This discrepancy was largely due to missing tag sites in the partial reference that led to false negatives in the tag-based workflows. When only the subset of reference sequences that unambiguously have tag sites was considered, we found broad congruence across workflows, and they all identified a similar set of DE sequences. Our results are promising in several regards for gene expression studies in non-model organisms. First, we demonstrate that a hybrid long-read/short-read sequencing strategy is an effective way to collect gene expression data when an annotated genome sequence is not available. Second, our replicated sampling indicates that expression profiles are highly consistent across field-collected animals in this case. Third, the impacts of partial reference sequences on the ability to detect DE can be mitigated through workflow choice and deeper reference sequencing. PMID:21829563

Genomic organization of the neurofibromatosis 1 gene (NF1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Y.; O`Connell, P.; Huntsman Breidenbach, H.

Neurofibromatosis 1 maps to chromosome band 17q11.2, and the NF1 locus has been partially characterized. Even though the full-length NF1 cDNA has been sequenced, the complete genomic structure of the NF1 gene has not been elucidated. The 5{prime} end of NF1 is embedded in a CpG island containing a NotI restriction site, and the remainder of the gene lies in the adjacent 350-kb NotI fragment. In our efforts to develop a comprehensive screen for NF1 mutations, we have isolated genomic DNA clones that together harbor the entire NF1 cDNA sequence. We have identified all intron-exon boundaries of the coding regionmore » and established that it is composed of 59 exons. Furthermore, we have defined the 3{prime}-untranslated region (3{prime}-UTR) of the NF1 gene; it spans approximately 3.5 kb of genomic DNA sequence and is continuous with the stop codon. Oligonucleotide primer pairs synthesized from exon-flanking DNA sequences were used in the polymerase chain reaction with cloned, chromosome 17-specific genomic DNA as template to amplify NF1 exons 1 through 27b and the exon containing the 3{prime}-UTR separately. This information should be useful for implementing a comprehensive NF1 mutation screen using genomic DNA as template. 41 refs., 3 figs., 2 tabs.« less

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

NASA Technical Reports Server (NTRS)

Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.

1995-01-01

We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis.

PubMed

Buldyrev, S V; Goldberger, A L; Havlin, S; Mantegna, R N; Matsa, M E; Peng, C K; Simons, M; Stanley, H E

1995-05-01

An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

NASA Technical Reports Server (NTRS)

Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.

1995-01-01

An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

Slow Feature Analysis on Retinal Waves Leads to V1 Complex Cells

PubMed Central

Dähne, Sven; Wilbert, Niko; Wiskott, Laurenz

2014-01-01

The developing visual system of many mammalian species is partially structured and organized even before the onset of vision. Spontaneous neural activity, which spreads in waves across the retina, has been suggested to play a major role in these prenatal structuring processes. Recently, it has been shown that when employing an efficient coding strategy, such as sparse coding, these retinal activity patterns lead to basis functions that resemble optimal stimuli of simple cells in primary visual cortex (V1). Here we present the results of applying a coding strategy that optimizes for temporal slowness, namely Slow Feature Analysis (SFA), to a biologically plausible model of retinal waves. Previously, SFA has been successfully applied to model parts of the visual system, most notably in reproducing a rich set of complex-cell features by training SFA with quasi-natural image sequences. In the present work, we obtain SFA units that share a number of properties with cortical complex-cells by training on simulated retinal waves. The emergence of two distinct properties of the SFA units (phase invariance and orientation tuning) is thoroughly investigated via control experiments and mathematical analysis of the input-output functions found by SFA. The results support the idea that retinal waves share relevant temporal and spatial properties with natural visual input. Hence, retinal waves seem suitable training stimuli to learn invariances and thereby shape the developing early visual system such that it is best prepared for coding input from the natural world. PMID:24810948

The mitochondrial genome of the quiet-calling katydids, Xizicus fascipes (Orthoptera: Tettigoniidae: Meconematinae).

PubMed

Yang, Ming Ru; Zhou, Zhi Jun; Chang, Yan Lin; Zhao, Le Hong

2012-08-01

To help determine whether the typical arthropod arrangement was a synapomorphy for the whole Tettigoniidae, we sequenced the mitochondrial genome (mitogenome) of the quiet-calling katydids, Xizicus fascipes (Orthoptera: Tettigoniidae: Meconematinae). The 16,166-bp nucleotide sequences of X. fascipes mitogenome contains the typical gene content, gene order, base composition, and codon usage found in arthropod mitogenomes. As a whole, the X. fascipes mitogenome contains a lower A+T content (70.2%) found in the complete orthopteran mitogenomes determined to date. All protein-coding genes started with a typical ATN codon. Ten of the 13 protein-coding genes have a complete termination codon, but the remaining three genes (COIII, ND5 and ND4) terminate with incomplete T. All tRNAs have the typical clover-leaf structure of mitogenome tRNA, except for tRNA(Ser(AGN)), in which lengthened anticodon stem (9 bp) with a bulged nuleotide in the middle, an unusual T-stem (6 bp in constrast to the normal 5 bp), a mini DHU arm (2 bp) and no connector nucleotides. In the A+T-rich region, two (TA)n conserved blocks that were previously described in Ensifera and two 150-bp tandem repeats plus a partial copy of the composed at 61 bp of the beginning were present. Phylogenetic analysis found: i) the monophyly of Conocephalinae was interrupted by Elimaea cheni from Phaneropterinae; and ii) Meconematinae was the most basal group among these five subfamilies.

Complete genome analysis of porcine kobuviruses from the feces of pigs in Japan.

PubMed

Akagami, Masataka; Ito, Mika; Niira, Kazutaka; Kuroda, Moegi; Masuda, Tsuneyuki; Haga, Kei; Tsuchiaka, Shinobu; Naoi, Yuki; Kishimoto, Mai; Sano, Kaori; Omatsu, Tsutomu; Aoki, Hiroshi; Katayama, Yukie; Oba, Mami; Oka, Tomoichiro; Ichimaru, Toru; Yamasato, Hiroshi; Ouchi, Yoshinao; Shirai, Junsuke; Katayama, Kazuhiko; Mizutani, Tetsuya; Nagai, Makoto

2017-08-01

Porcine kobuviruses (PoKoVs) are ubiquitously distributed in pig populations worldwide and are thought to be enteric viruses in swine. Although PoKoVs have been detected in pigs in Japan, no complete genome data for Japanese PoKoVs are available. In the present study, 24 nearly complete or complete sequences of the PoKoV genome obtained from 10 diarrheic feces and 14 non-diarrheic feces of Japanese pigs were analyzed using a metagenomics approach. Japanese PoKoVs shared 85.2-100% identity with the complete coding nucleotide (nt) sequences and the closest relationship of 85.1-98.3% with PoKoVs from other countries. Twenty of 24 Japanese PoKoVs carried a deletion of 90 nt in the 2B coding region. Phylogenetic tree analyses revealed that PoKoVs were not grouped according to their geographical region of origin and the phylogenetic trees of the L, P1, P2, and P3 genetic regions showed topologies different from each other. Similarity plot analysis using strains from a single farm revealed partially different similarity patterns among strains from identical farm origins, suggesting that recombination events had occurred. These results indicate that various PoKoV strains are prevalent and not restricted geographically on pig farms worldwide and the coexistence of multiple strains leads to recombination events of PoKoVs and contributes to the genetic diversity and evolution of PoKoVs.

Cryptic tRNAs in chaetognath mitochondrial genomes.

PubMed

Barthélémy, Roxane-Marie; Seligmann, Hervé

2016-06-01

The chaetognaths constitute a small and enigmatic phylum of little marine invertebrates. Both nuclear and mitochondrial genomes have numerous originalities, some phylum-specific. Until recently, their mitogenomes seemed containing only one tRNA gene (trnMet), but a recent study found in two chaetognath mitogenomes two and four tRNA genes. Moreover, apparently two conspecific mitogenomes have different tRNA gene numbers (one and two). Reanalyses by tRNAscan-SE and ARWEN softwares of the five available complete chaetognath mitogenomes suggest numerous additional tRNA genes from different types. Their total number never reaches the 22 found in most other invertebrates using that genetic code. Predicted error compensation between codon-anticodon mismatch and tRNA misacylation suggests translational activity by tRNAs predicted solely according to secondary structure for tRNAs predicted by tRNAscan-SE, not ARWEN. Numbers of predicted stop-suppressor (antitermination) tRNAs coevolve with predicted overlapping, frameshifted protein coding genes including stop codons. Sequence alignments in secondary structure prediction with non-chaetognath tRNAs suggest that the most likely functional tRNAs are in intergenic regions, as regular mt-tRNAs. Due to usually short intergenic regions, generally tRNA sequences partially overlap with flanking genes. Some tRNA pairs seem templated by sense-antisense strands. Moreover, 16S rRNA genes, but not 12S rRNAs, appear as tRNA nurseries, as previously suggested for multifunctional ribosomal-like protogenomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sequence data and association statistics from 12,940 type 2 diabetes cases and controls.

PubMed

Flannick, Jason; Fuchsberger, Christian; Mahajan, Anubha; Teslovich, Tanya M; Agarwala, Vineeta; Gaulton, Kyle J; Caulkins, Lizz; Koesterer, Ryan; Ma, Clement; Moutsianas, Loukas; McCarthy, Davis J; Rivas, Manuel A; Perry, John R B; Sim, Xueling; Blackwell, Thomas W; Robertson, Neil R; Rayner, N William; Cingolani, Pablo; Locke, Adam E; Tajes, Juan Fernandez; Highland, Heather M; Dupuis, Josee; Chines, Peter S; Lindgren, Cecilia M; Hartl, Christopher; Jackson, Anne U; Chen, Han; Huyghe, Jeroen R; van de Bunt, Martijn; Pearson, Richard D; Kumar, Ashish; Müller-Nurasyid, Martina; Grarup, Niels; Stringham, Heather M; Gamazon, Eric R; Lee, Jaehoon; Chen, Yuhui; Scott, Robert A; Below, Jennifer E; Chen, Peng; Huang, Jinyan; Go, Min Jin; Stitzel, Michael L; Pasko, Dorota; Parker, Stephen C J; Varga, Tibor V; Green, Todd; Beer, Nicola L; Day-Williams, Aaron G; Ferreira, Teresa; Fingerlin, Tasha; Horikoshi, Momoko; Hu, Cheng; Huh, Iksoo; Ikram, Mohammad Kamran; Kim, Bong-Jo; Kim, Yongkang; Kim, Young Jin; Kwon, Min-Seok; Lee, Juyoung; Lee, Selyeong; Lin, Keng-Han; Maxwell, Taylor J; Nagai, Yoshihiko; Wang, Xu; Welch, Ryan P; Yoon, Joon; Zhang, Weihua; Barzilai, Nir; Voight, Benjamin F; Han, Bok-Ghee; Jenkinson, Christopher P; Kuulasmaa, Teemu; Kuusisto, Johanna; Manning, Alisa; Ng, Maggie C Y; Palmer, Nicholette D; Balkau, Beverley; Stančáková, Alena; Abboud, Hanna E; Boeing, Heiner; Giedraitis, Vilmantas; Prabhakaran, Dorairaj; Gottesman, Omri; Scott, James; Carey, Jason; Kwan, Phoenix; Grant, George; Smith, Joshua D; Neale, Benjamin M; Purcell, Shaun; Butterworth, Adam S; Howson, Joanna M M; Lee, Heung Man; Lu, Yingchang; Kwak, Soo-Heon; Zhao, Wei; Danesh, John; Lam, Vincent K L; Park, Kyong Soo; Saleheen, Danish; So, Wing Yee; Tam, Claudia H T; Afzal, Uzma; Aguilar, David; Arya, Rector; Aung, Tin; Chan, Edmund; Navarro, Carmen; Cheng, Ching-Yu; Palli, Domenico; Correa, Adolfo; Curran, Joanne E; Rybin, Dennis; Farook, Vidya S; Fowler, Sharon P; Freedman, Barry I; Griswold, Michael; Hale, Daniel Esten; Hicks, Pamela J; Khor, Chiea-Chuen; Kumar, Satish; Lehne, Benjamin; Thuillier, Dorothée; Lim, Wei Yen; Liu, Jianjun; Loh, Marie; Musani, Solomon K; Puppala, Sobha; Scott, William R; Yengo, Loïc; Tan, Sian-Tsung; Taylor, Herman A; Thameem, Farook; Wilson, Gregory; Wong, Tien Yin; Njølstad, Pål Rasmus; Levy, Jonathan C; Mangino, Massimo; Bonnycastle, Lori L; Schwarzmayr, Thomas; Fadista, João; Surdulescu, Gabriela L; Herder, Christian; Groves, Christopher J; Wieland, Thomas; Bork-Jensen, Jette; Brandslund, Ivan; Christensen, Cramer; Koistinen, Heikki A; Doney, Alex S F; Kinnunen, Leena; Esko, Tõnu; Farmer, Andrew J; Hakaste, Liisa; Hodgkiss, Dylan; Kravic, Jasmina; Lyssenko, Valeri; Hollensted, Mette; Jørgensen, Marit E; Jørgensen, Torben; Ladenvall, Claes; Justesen, Johanne Marie; Käräjämäki, Annemari; Kriebel, Jennifer; Rathmann, Wolfgang; Lannfelt, Lars; Lauritzen, Torsten; Narisu, Narisu; Linneberg, Allan; Melander, Olle; Milani, Lili; Neville, Matt; Orho-Melander, Marju; Qi, Lu; Qi, Qibin; Roden, Michael; Rolandsson, Olov; Swift, Amy; Rosengren, Anders H; Stirrups, Kathleen; Wood, Andrew R; Mihailov, Evelin; Blancher, Christine; Carneiro, Mauricio O; Maguire, Jared; Poplin, Ryan; Shakir, Khalid; Fennell, Timothy; DePristo, Mark; de Angelis, Martin Hrabé; Deloukas, Panos; Gjesing, Anette P; Jun, Goo; Nilsson, Peter; Murphy, Jacquelyn; Onofrio, Robert; Thorand, Barbara; Hansen, Torben; Meisinger, Christa; Hu, Frank B; Isomaa, Bo; Karpe, Fredrik; Liang, Liming; Peters, Annette; Huth, Cornelia; O'Rahilly, Stephen P; Palmer, Colin N A; Pedersen, Oluf; Rauramaa, Rainer; Tuomilehto, Jaakko; Salomaa, Veikko; Watanabe, Richard M; Syvänen, Ann-Christine; Bergman, Richard N; Bharadwaj, Dwaipayan; Bottinger, Erwin P; Cho, Yoon Shin; Chandak, Giriraj R; Chan, Juliana Cn; Chia, Kee Seng; Daly, Mark J; Ebrahim, Shah B; Langenberg, Claudia; Elliott, Paul; Jablonski, Kathleen A; Lehman, Donna M; Jia, Weiping; Ma, Ronald C W; Pollin, Toni I; Sandhu, Manjinder; Tandon, Nikhil; Froguel, Philippe; Barroso, Inês; Teo, Yik Ying; Zeggini, Eleftheria; Loos, Ruth J F; Small, Kerrin S; Ried, Janina S; DeFronzo, Ralph A; Grallert, Harald; Glaser, Benjamin; Metspalu, Andres; Wareham, Nicholas J; Walker, Mark; Banks, Eric; Gieger, Christian; Ingelsson, Erik; Im, Hae Kyung; Illig, Thomas; Franks, Paul W; Buck, Gemma; Trakalo, Joseph; Buck, David; Prokopenko, Inga; Mägi, Reedik; Lind, Lars; Farjoun, Yossi; Owen, Katharine R; Gloyn, Anna L; Strauch, Konstantin; Tuomi, Tiinamaija; Kooner, Jaspal Singh; Lee, Jong-Young; Park, Taesung; Donnelly, Peter; Morris, Andrew D; Hattersley, Andrew T; Bowden, Donald W; Collins, Francis S; Atzmon, Gil; Chambers, John C; Spector, Timothy D; Laakso, Markku; Strom, Tim M; Bell, Graeme I; Blangero, John; Duggirala, Ravindranath; Tai, E Shyong; McVean, Gilean; Hanis, Craig L; Wilson, James G; Seielstad, Mark; Frayling, Timothy M; Meigs, James B; Cox, Nancy J; Sladek, Rob; Lander, Eric S; Gabriel, Stacey; Mohlke, Karen L; Meitinger, Thomas; Groop, Leif; Abecasis, Goncalo; Scott, Laura J; Morris, Andrew P; Kang, Hyun Min; Altshuler, David; Burtt, Noël P; Florez, Jose C; Boehnke, Michael; McCarthy, Mark I

2017-12-19

To investigate the genetic basis of type 2 diabetes (T2D) to high resolution, the GoT2D and T2D-GENES consortia catalogued variation from whole-genome sequencing of 2,657 European individuals and exome sequencing of 12,940 individuals of multiple ancestries. Over 27M SNPs, indels, and structural variants were identified, including 99% of low-frequency (minor allele frequency [MAF] 0.1-5%) non-coding variants in the whole-genome sequenced individuals and 99.7% of low-frequency coding variants in the whole-exome sequenced individuals. Each variant was tested for association with T2D in the sequenced individuals, and, to increase power, most were tested in larger numbers of individuals (>80% of low-frequency coding variants in ~82 K Europeans via the exome chip, and ~90% of low-frequency non-coding variants in ~44 K Europeans via genotype imputation). The variants, genotypes, and association statistics from these analyses provide the largest reference to date of human genetic information relevant to T2D, for use in activities such as T2D-focused genotype imputation, functional characterization of variants or genes, and other novel analyses to detect associations between sequence variation and T2D.

Sequence data and association statistics from 12,940 type 2 diabetes cases and controls

PubMed Central

Jason, Flannick; Fuchsberger, Christian; Mahajan, Anubha; Teslovich, Tanya M.; Agarwala, Vineeta; Gaulton, Kyle J.; Caulkins, Lizz; Koesterer, Ryan; Ma, Clement; Moutsianas, Loukas; McCarthy, Davis J.; Rivas, Manuel A.; Perry, John R. B.; Sim, Xueling; Blackwell, Thomas W.; Robertson, Neil R.; Rayner, N William; Cingolani, Pablo; Locke, Adam E.; Tajes, Juan Fernandez; Highland, Heather M.; Dupuis, Josee; Chines, Peter S.; Lindgren, Cecilia M.; Hartl, Christopher; Jackson, Anne U.; Chen, Han; Huyghe, Jeroen R.; van de Bunt, Martijn; Pearson, Richard D.; Kumar, Ashish; Müller-Nurasyid, Martina; Grarup, Niels; Stringham, Heather M.; Gamazon, Eric R.; Lee, Jaehoon; Chen, Yuhui; Scott, Robert A.; Below, Jennifer E.; Chen, Peng; Huang, Jinyan; Go, Min Jin; Stitzel, Michael L.; Pasko, Dorota; Parker, Stephen C. J.; Varga, Tibor V.; Green, Todd; Beer, Nicola L.; Day-Williams, Aaron G.; Ferreira, Teresa; Fingerlin, Tasha; Horikoshi, Momoko; Hu, Cheng; Huh, Iksoo; Ikram, Mohammad Kamran; Kim, Bong-Jo; Kim, Yongkang; Kim, Young Jin; Kwon, Min-Seok; Lee, Juyoung; Lee, Selyeong; Lin, Keng-Han; Maxwell, Taylor J.; Nagai, Yoshihiko; Wang, Xu; Welch, Ryan P.; Yoon, Joon; Zhang, Weihua; Barzilai, Nir; Voight, Benjamin F.; Han, Bok-Ghee; Jenkinson, Christopher P.; Kuulasmaa, Teemu; Kuusisto, Johanna; Manning, Alisa; Ng, Maggie C. Y.; Palmer, Nicholette D.; Balkau, Beverley; Stančáková, Alena; Abboud, Hanna E.; Boeing, Heiner; Giedraitis, Vilmantas; Prabhakaran, Dorairaj; Gottesman, Omri; Scott, James; Carey, Jason; Kwan, Phoenix; Grant, George; Smith, Joshua D.; Neale, Benjamin M.; Purcell, Shaun; Butterworth, Adam S.; Howson, Joanna M. M.; Lee, Heung Man; Lu, Yingchang; Kwak, Soo-Heon; Zhao, Wei; Danesh, John; Lam, Vincent K. L.; Park, Kyong Soo; Saleheen, Danish; So, Wing Yee; Tam, Claudia H. T.; Afzal, Uzma; Aguilar, David; Arya, Rector; Aung, Tin; Chan, Edmund; Navarro, Carmen; Cheng, Ching-Yu; Palli, Domenico; Correa, Adolfo; Curran, Joanne E.; Rybin, Dennis; Farook, Vidya S.; Fowler, Sharon P.; Freedman, Barry I.; Griswold, Michael; Hale, Daniel Esten; Hicks, Pamela J.; Khor, Chiea-Chuen; Kumar, Satish; Lehne, Benjamin; Thuillier, Dorothée; Lim, Wei Yen; Liu, Jianjun; Loh, Marie; Musani, Solomon K.; Puppala, Sobha; Scott, William R.; Yengo, Loïc; Tan, Sian-Tsung; Taylor, Herman A.; Thameem, Farook; Wilson, Gregory; Wong, Tien Yin; Njølstad, Pål Rasmus; Levy, Jonathan C.; Mangino, Massimo; Bonnycastle, Lori L.; Schwarzmayr, Thomas; Fadista, João; Surdulescu, Gabriela L.; Herder, Christian; Groves, Christopher J.; Wieland, Thomas; Bork-Jensen, Jette; Brandslund, Ivan; Christensen, Cramer; Koistinen, Heikki A.; Doney, Alex S. F.; Kinnunen, Leena; Esko, Tõnu; Farmer, Andrew J.; Hakaste, Liisa; Hodgkiss, Dylan; Kravic, Jasmina; Lyssenko, Valeri; Hollensted, Mette; Jørgensen, Marit E.; Jørgensen, Torben; Ladenvall, Claes; Justesen, Johanne Marie; Käräjämäki, Annemari; Kriebel, Jennifer; Rathmann, Wolfgang; Lannfelt, Lars; Lauritzen, Torsten; Narisu, Narisu; Linneberg, Allan; Melander, Olle; Milani, Lili; Neville, Matt; Orho-Melander, Marju; Qi, Lu; Qi, Qibin; Roden, Michael; Rolandsson, Olov; Swift, Amy; Rosengren, Anders H.; Stirrups, Kathleen; Wood, Andrew R.; Mihailov, Evelin; Blancher, Christine; Carneiro, Mauricio O.; Maguire, Jared; Poplin, Ryan; Shakir, Khalid; Fennell, Timothy; DePristo, Mark; de Angelis, Martin Hrabé; Deloukas, Panos; Gjesing, Anette P.; Jun, Goo; Nilsson, Peter; Murphy, Jacquelyn; Onofrio, Robert; Thorand, Barbara; Hansen, Torben; Meisinger, Christa; Hu, Frank B.; Isomaa, Bo; Karpe, Fredrik; Liang, Liming; Peters, Annette; Huth, Cornelia; O'Rahilly, Stephen P; Palmer, Colin N. A.; Pedersen, Oluf; Rauramaa, Rainer; Tuomilehto, Jaakko; Salomaa, Veikko; Watanabe, Richard M.; Syvänen, Ann-Christine; Bergman, Richard N.; Bharadwaj, Dwaipayan; Bottinger, Erwin P.; Cho, Yoon Shin; Chandak, Giriraj R.; Chan, Juliana CN; Chia, Kee Seng; Daly, Mark J.; Ebrahim, Shah B.; Langenberg, Claudia; Elliott, Paul; Jablonski, Kathleen A.; Lehman, Donna M.; Jia, Weiping; Ma, Ronald C. W.; Pollin, Toni I.; Sandhu, Manjinder; Tandon, Nikhil; Froguel, Philippe; Barroso, Inês; Teo, Yik Ying; Zeggini, Eleftheria; Loos, Ruth J. F.; Small, Kerrin S.; Ried, Janina S.; DeFronzo, Ralph A.; Grallert, Harald; Glaser, Benjamin; Metspalu, Andres; Wareham, Nicholas J.; Walker, Mark; Banks, Eric; Gieger, Christian; Ingelsson, Erik; Im, Hae Kyung; Illig, Thomas; Franks, Paul W.; Buck, Gemma; Trakalo, Joseph; Buck, David; Prokopenko, Inga; Mägi, Reedik; Lind, Lars; Farjoun, Yossi; Owen, Katharine R.; Gloyn, Anna L.; Strauch, Konstantin; Tuomi, Tiinamaija; Kooner, Jaspal Singh; Lee, Jong-Young; Park, Taesung; Donnelly, Peter; Morris, Andrew D.; Hattersley, Andrew T.; Bowden, Donald W.; Collins, Francis S.; Atzmon, Gil; Chambers, John C.; Spector, Timothy D.; Laakso, Markku; Strom, Tim M.; Bell, Graeme I.; Blangero, John; Duggirala, Ravindranath; Tai, E. Shyong; McVean, Gilean; Hanis, Craig L.; Wilson, James G.; Seielstad, Mark; Frayling, Timothy M.; Meigs, James B.; Cox, Nancy J.; Sladek, Rob; Lander, Eric S.; Gabriel, Stacey; Mohlke, Karen L.; Meitinger, Thomas; Groop, Leif; Abecasis, Goncalo; Scott, Laura J.; Morris, Andrew P.; Kang, Hyun Min; Altshuler, David; Burtt, Noël P.; Florez, Jose C.; Boehnke, Michael; McCarthy, Mark I.

2017-01-01

To investigate the genetic basis of type 2 diabetes (T2D) to high resolution, the GoT2D and T2D-GENES consortia catalogued variation from whole-genome sequencing of 2,657 European individuals and exome sequencing of 12,940 individuals of multiple ancestries. Over 27M SNPs, indels, and structural variants were identified, including 99% of low-frequency (minor allele frequency [MAF] 0.1–5%) non-coding variants in the whole-genome sequenced individuals and 99.7% of low-frequency coding variants in the whole-exome sequenced individuals. Each variant was tested for association with T2D in the sequenced individuals, and, to increase power, most were tested in larger numbers of individuals (>80% of low-frequency coding variants in ~82 K Europeans via the exome chip, and ~90% of low-frequency non-coding variants in ~44 K Europeans via genotype imputation). The variants, genotypes, and association statistics from these analyses provide the largest reference to date of human genetic information relevant to T2D, for use in activities such as T2D-focused genotype imputation, functional characterization of variants or genes, and other novel analyses to detect associations between sequence variation and T2D. PMID:29257133

Not All Order Memory Is Equal: Test Demands Reveal Dissociations in Memory for Sequence Information

ERIC Educational Resources Information Center

Jonker, Tanya R.; MacLeod, Colin M.

2017-01-01

Remembering the order of a sequence of events is a fundamental feature of episodic memory. Indeed, a number of formal models represent temporal context as part of the memory system, and memory for order has been researched extensively. Yet, the nature of the code(s) underlying sequence memory is still relatively unknown. Across 4 experiments that…

Complete mitochondrial genome sequence of the heart failure model of cardiomyopathic Syrian hamster (Mesocricetus auratus).

PubMed

Hu, Bo; Liu, Dong-Xing; Zhang, Yu-Qing; Song, Jian-Tao; Ji, Xian-Fei; Hou, Zhi-Qiang; Zhang, Zhen-Hai

2016-05-01

In this study we sequenced the complete mitochondrial genome sequencing of a heart failure model of cardiomyopathic Syrian hamster (Mesocricetus auratus) for the first time. The total length of the mitogenome was 16,267 bp. It harbored 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and 1 non-coding control region.

Code-Switching to Know a TL Equivalent of an L1 Word: Request-Provision-Acknowledgement (RPA) Sequence

ERIC Educational Resources Information Center

Lucero, Edgar

2011-01-01

This article focuses on the learner's use of Code-switching to learn the TL (Target Language) equivalent of an L1 word. The interactional pattern that this situation creates defines the Request-Provision-Acknowledgement (RPA) sequence. The article explains each of the turns of the sequence under the combination of the Ethnomethodological…

Quantitative analysis of the anti-noise performance of an m-sequence in an electromagnetic method

NASA Astrophysics Data System (ADS)

Yuan, Zhe; Zhang, Yiming; Zheng, Qijia

2018-02-01

An electromagnetic method with a transmitted waveform coded by an m-sequence achieved better anti-noise performance compared to the conventional manner with a square-wave. The anti-noise performance of the m-sequence varied with multiple coding parameters; hence, a quantitative analysis of the anti-noise performance for m-sequences with different coding parameters was required to optimize them. This paper proposes the concept of an identification system, with the identified Earth impulse response obtained by measuring the system output with the input of the voltage response. A quantitative analysis of the anti-noise performance of the m-sequence was achieved by analyzing the amplitude-frequency response of the corresponding identification system. The effects of the coding parameters on the anti-noise performance are summarized by numerical simulation, and their optimization is further discussed in our conclusions; the validity of the conclusions is further verified by field experiment. The quantitative analysis method proposed in this paper provides a new insight into the anti-noise mechanism of the m-sequence, and could be used to evaluate the anti-noise performance of artificial sources in other time-domain exploration methods, such as the seismic method.

RAMICS: trainable, high-speed and biologically relevant alignment of high-throughput sequencing reads to coding DNA.

PubMed

Wright, Imogen A; Travers, Simon A

2014-07-01

The challenge presented by high-throughput sequencing necessitates the development of novel tools for accurate alignment of reads to reference sequences. Current approaches focus on using heuristics to map reads quickly to large genomes, rather than generating highly accurate alignments in coding regions. Such approaches are, thus, unsuited for applications such as amplicon-based analysis and the realignment phase of exome sequencing and RNA-seq, where accurate and biologically relevant alignment of coding regions is critical. To facilitate such analyses, we have developed a novel tool, RAMICS, that is tailored to mapping large numbers of sequence reads to short lengths (<10 000 bp) of coding DNA. RAMICS utilizes profile hidden Markov models to discover the open reading frame of each sequence and aligns to the reference sequence in a biologically relevant manner, distinguishing between genuine codon-sized indels and frameshift mutations. This approach facilitates the generation of highly accurate alignments, accounting for the error biases of the sequencing machine used to generate reads, particularly at homopolymer regions. Performance improvements are gained through the use of graphics processing units, which increase the speed of mapping through parallelization. RAMICS substantially outperforms all other mapping approaches tested in terms of alignment quality while maintaining highly competitive speed performance. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genomics dataset on unclassified published organism (patent US 7547531).

PubMed

Khan Shawan, Mohammad Mahfuz Ali; Hasan, Md Ashraful; Hossain, Md Mozammel; Hasan, Md Mahmudul; Parvin, Afroza; Akter, Salina; Uddin, Kazi Rasel; Banik, Subrata; Morshed, Mahbubul; Rahman, Md Nazibur; Rahman, S M Badier

2016-12-01

Nucleotide (DNA) sequence analysis provides important clues regarding the characteristics and taxonomic position of an organism. With the intention that, DNA sequence analysis is very crucial to learn about hierarchical classification of that particular organism. This dataset (patent US 7547531) is chosen to simplify all the complex raw data buried in undisclosed DNA sequences which help to open doors for new collaborations. In this data, a total of 48 unidentified DNA sequences from patent US 7547531 were selected and their complete sequences were retrieved from NCBI BioSample database. Quick response (QR) code of those DNA sequences was constructed by DNA BarID tool. QR code is useful for the identification and comparison of isolates with other organisms. AT/GC content of the DNA sequences was determined using ENDMEMO GC Content Calculator, which indicates their stability at different temperature. The highest GC content was observed in GP445188 (62.5%) which was followed by GP445198 (61.8%) and GP445189 (59.44%), while lowest was in GP445178 (24.39%). In addition, New England BioLabs (NEB) database was used to identify cleavage code indicating the 5, 3 and blunt end and enzyme code indicating the methylation site of the DNA sequences was also shown. These data will be helpful for the construction of the organisms' hierarchical classification, determination of their phylogenetic and taxonomic position and revelation of their molecular characteristics.

Fast gravity, gravity partials, normalized gravity, gravity gradient torque and magnetic field: Derivation, code and data

NASA Technical Reports Server (NTRS)

Gottlieb, Robert G.

1993-01-01

Derivation of first and second partials of the gravitational potential is given in both normalized and unnormalized form. Two different recursion formulas are considered. Derivation of a general gravity gradient torque algorithm which uses the second partial of the gravitational potential is given. Derivation of the geomagnetic field vector is given in a form that closely mimics the gravitational algorithm. Ada code for all algorithms that precomputes all possible data is given. Test cases comparing the new algorithms with previous data are given, as well as speed comparisons showing the relative efficiencies of the new algorithms.

Evaluation of partial 16S ribosomal DNA sequencing for identification of nocardia species by using the MicroSeq 500 system with an expanded database.

PubMed

Cloud, Joann L; Conville, Patricia S; Croft, Ann; Harmsen, Dag; Witebsky, Frank G; Carroll, Karen C

2004-02-01

Identification of clinically significant nocardiae to the species level is important in patient diagnosis and treatment. A study was performed to evaluate Nocardia species identification obtained by partial 16S ribosomal DNA (rDNA) sequencing by the MicroSeq 500 system with an expanded database. The expanded portion of the database was developed from partial 5' 16S rDNA sequences derived from 28 reference strains (from the American Type Culture Collection and the Japanese Collection of Microorganisms). The expanded MicroSeq 500 system was compared to (i). conventional identification obtained from a combination of growth characteristics with biochemical and drug susceptibility tests; (ii). molecular techniques involving restriction enzyme analysis (REA) of portions of the 16S rRNA and 65-kDa heat shock protein genes; and (iii). when necessary, sequencing of a 999-bp fragment of the 16S rRNA gene. An unknown isolate was identified as a particular species if the sequence obtained by partial 16S rDNA sequencing by the expanded MicroSeq 500 system was 99.0% similar to that of the reference strain. Ninety-four nocardiae representing 10 separate species were isolated from patient specimens and examined by using the three different methods. Sequencing of partial 16S rDNA by the expanded MicroSeq 500 system resulted in only 72% agreement with conventional methods for species identification and 90% agreement with the alternative molecular methods. Molecular methods for identification of Nocardia species provide more accurate and rapid results than the conventional methods using biochemical and susceptibility testing. With an expanded database, the MicroSeq 500 system for partial 16S rDNA was able to correctly identify the human pathogens N. brasiliensis, N. cyriacigeorgica, N. farcinica, N. nova, N. otitidiscaviarum, and N. veterana.

RNAcode: Robust discrimination of coding and noncoding regions in comparative sequence data

PubMed Central

Washietl, Stefan; Findeiß, Sven; Müller, Stephan A.; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L.; Stadler, Peter F.; Goldman, Nick

2011-01-01

With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied “out of the box,” without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as “noncoding.” RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode. PMID:21357752

RNAcode: robust discrimination of coding and noncoding regions in comparative sequence data.

PubMed

Washietl, Stefan; Findeiss, Sven; Müller, Stephan A; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L; Stadler, Peter F; Goldman, Nick

2011-04-01

With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied "out of the box," without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as "noncoding." RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode.

High compression image and image sequence coding

NASA Technical Reports Server (NTRS)

Kunt, Murat

1989-01-01

The digital representation of an image requires a very large number of bits. This number is even larger for an image sequence. The goal of image coding is to reduce this number, as much as possible, and reconstruct a faithful duplicate of the original picture or image sequence. Early efforts in image coding, solely guided by information theory, led to a plethora of methods. The compression ratio reached a plateau around 10:1 a couple of years ago. Recent progress in the study of the brain mechanism of vision and scene analysis has opened new vistas in picture coding. Directional sensitivity of the neurones in the visual pathway combined with the separate processing of contours and textures has led to a new class of coding methods capable of achieving compression ratios as high as 100:1 for images and around 300:1 for image sequences. Recent progress on some of the main avenues of object-based methods is presented. These second generation techniques make use of contour-texture modeling, new results in neurophysiology and psychophysics and scene analysis.

MCTP system model based on linear programming optimization of apertures obtained from sequencing patient image data maps.

PubMed

Ureba, A; Salguero, F J; Barbeiro, A R; Jimenez-Ortega, E; Baeza, J A; Miras, H; Linares, R; Perucha, M; Leal, A

2014-08-01

The authors present a hybrid direct multileaf collimator (MLC) aperture optimization model exclusively based on sequencing of patient imaging data to be implemented on a Monte Carlo treatment planning system (MC-TPS) to allow the explicit radiation transport simulation of advanced radiotherapy treatments with optimal results in efficient times for clinical practice. The planning system (called CARMEN) is a full MC-TPS, controlled through aMATLAB interface, which is based on the sequencing of a novel map, called "biophysical" map, which is generated from enhanced image data of patients to achieve a set of segments actually deliverable. In order to reduce the required computation time, the conventional fluence map has been replaced by the biophysical map which is sequenced to provide direct apertures that will later be weighted by means of an optimization algorithm based on linear programming. A ray-casting algorithm throughout the patient CT assembles information about the found structures, the mass thickness crossed, as well as PET values. Data are recorded to generate a biophysical map for each gantry angle. These maps are the input files for a home-made sequencer developed to take into account the interactions of photons and electrons with the MLC. For each linac (Axesse of Elekta and Primus of Siemens) and energy beam studied (6, 9, 12, 15 MeV and 6 MV), phase space files were simulated with the EGSnrc/BEAMnrc code. The dose calculation in patient was carried out with the BEAMDOSE code. This code is a modified version of EGSnrc/DOSXYZnrc able to calculate the beamlet dose in order to combine them with different weights during the optimization process. Three complex radiotherapy treatments were selected to check the reliability of CARMEN in situations where the MC calculation can offer an added value: A head-and-neck case (Case I) with three targets delineated on PET/CT images and a demanding dose-escalation; a partial breast irradiation case (Case II) solved with photon and electron modulated beams (IMRT + MERT); and a prostatic bed case (Case III) with a pronounced concave-shaped PTV by using volumetric modulated arc therapy. In the three cases, the required target prescription doses and constraints on organs at risk were fulfilled in a short enough time to allow routine clinical implementation. The quality assurance protocol followed to check CARMEN system showed a high agreement with the experimental measurements. A Monte Carlo treatment planning model exclusively based on maps performed from patient imaging data has been presented. The sequencing of these maps allows obtaining deliverable apertures which are weighted for modulation under a linear programming formulation. The model is able to solve complex radiotherapy treatments with high accuracy in an efficient computation time.

Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus (Digenea): Species Differentiation Based On mtDNA (Barcode) and Partial LSU–rDNA Sequences

USGS Publications Warehouse

Bergmame, Laura; Huffman, Jane; Cole, Rebecca; Dayanandan, Selvadurai; Tkach, Vasyl; McLaughlin, J. Daniel

2011-01-01

Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota.

Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus (Digenea): Species Differentiation Based on mtDNA (Barcode) and Partial LSUrDNA Sequences

USGS Publications Warehouse

Bergmame, L.; Huffman, J.; Cole, R.; Dayanandan, S.; Tkach, V.; McLaughlin, J.D.

2011-01-01

Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota. ?? 2011 American Society of Parasitologists.

Investigations carried out under the Director's Discretionary Fund

NASA Technical Reports Server (NTRS)

Chahine, M. T.

1985-01-01

This annual report comprises a set of summaries, describing task objectives, progress and results or accomplishments, future outlook, and financial status for each director's discretionary fund (DDF) task that was active during fiscal year 1984. Publications and conference presentations related to the work are listed. The individual reports are categorized as interim or final according to whether the task efforts are ongoing or completed. A partial list of new tasks to be initiated with fiscal year 1985 funds and a glossary of abbreviations and acronyms, used by the task authors in their summaries are included. The table of contents lists the DDF reports in sequence by their task number, which is derived from the 13-digit code assigned to account for the fund awarded to the task project.

Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

PubMed

Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

2007-03-01

In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae).

PubMed

Liu, Ze-Xuan; Zhang, Yan; Liu, Yu-Ting; Chang, Qiao-Cheng; Su, Xin; Fu, Xue; Yue, Dong-Mei; Gao, Yuan; Wang, Chun-Ren

2016-04-01

Echinostoma hortense (Digenea: Echinostomatidae) is one of the intestinal flukes with medical importance in humans. However, the mitochondrial (mt) genome of this fluke has not been known yet. The present study has determined the complete mt genome sequences of E. hortense and assessed the phylogenetic relationships with other digenean species for which the complete mt genome sequences are available in GenBank using concatenated amino acid sequences inferred from 12 protein-coding genes. The mt genome of E. hortense contained 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding region. The length of the mt genome of E. hortense was 14,994 bp, which was somewhat smaller than those of other trematode species. Phylogenetic analyses based on concatenated nucleotide sequence datasets for all 12 protein-coding genes using maximum parsimony (MP) method showed that E. hortense and Hypoderaeum conoideum gathered together, and they were closer to each other than to Fasciolidae and other echinostomatid trematodes. The availability of the complete mt genome sequences of E. hortense provides important genetic markers for diagnostics, population genetics, and evolutionary studies of digeneans.

Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae)

PubMed Central

Liu, Ze-Xuan; Zhang, Yan; Liu, Yu-Ting; Chang, Qiao-Cheng; Su, Xin; Fu, Xue; Yue, Dong-Mei; Gao, Yuan; Wang, Chun-Ren

2016-01-01

Echinostoma hortense (Digenea: Echinostomatidae) is one of the intestinal flukes with medical importance in humans. However, the mitochondrial (mt) genome of this fluke has not been known yet. The present study has determined the complete mt genome sequences of E. hortense and assessed the phylogenetic relationships with other digenean species for which the complete mt genome sequences are available in GenBank using concatenated amino acid sequences inferred from 12 protein-coding genes. The mt genome of E. hortense contained 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding region. The length of the mt genome of E. hortense was 14,994 bp, which was somewhat smaller than those of other trematode species. Phylogenetic analyses based on concatenated nucleotide sequence datasets for all 12 protein-coding genes using maximum parsimony (MP) method showed that E. hortense and Hypoderaeum conoideum gathered together, and they were closer to each other than to Fasciolidae and other echinostomatid trematodes. The availability of the complete mt genome sequences of E. hortense provides important genetic markers for diagnostics, population genetics, and evolutionary studies of digeneans. PMID:27180575

Analysis of whole genome sequences of 16 strains of rubella virus from the United States, 1961-2009.

PubMed

Abernathy, Emily; Chen, Min-hsin; Bera, Jayati; Shrivastava, Susmita; Kirkness, Ewen; Zheng, Qi; Bellini, William; Icenogle, Joseph

2013-01-25

Rubella virus is the causative agent of rubella, a mild rash illness, and a potent teratogenic agent when contracted by a pregnant woman. Global rubella control programs target the reduction and elimination of congenital rubella syndrome. Phylogenetic analysis of partial sequences of rubella viruses has contributed to virus surveillance efforts and played an important role in demonstrating that indigenous rubella viruses have been eliminated in the United States. Sixteen wild-type rubella viruses were chosen for whole genome sequencing. All 16 viruses were collected in the United States from 1961 to 2009 and are from 8 of the 13 known rubella genotypes. Phylogenetic analysis of 30 whole genome sequences produced a maximum likelihood tree giving high bootstrap values for all genotypes except provisional genotype 1a. Comparison of the 16 new complete sequences and 14 previously sequenced wild-type viruses found regions with clusters of variable amino acids. The 5' 250 nucleotides of the genome are more conserved than any other part of the genome. Genotype specific deletions in the untranslated region between the non-structural and structural open reading frames were observed for genotypes 2B and genotype 1G. No evidence was seen for recombination events among the 30 viruses. The analysis presented here is consistent with previous reports on the genetic characterization of rubella virus genomes. Conserved and variable regions were identified and additional evidence for genotype specific nucleotide deletions in the intergenic region was found. Phylogenetic analysis confirmed genotype groupings originally based on structural protein coding region sequences, which provides support for the WHO nomenclature for genetic characterization of wild-type rubella viruses.

An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

PubMed

Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

2004-01-21

We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

SHARAKU: an algorithm for aligning and clustering read mapping profiles of deep sequencing in non-coding RNA processing.

PubMed

Tsuchiya, Mariko; Amano, Kojiro; Abe, Masaya; Seki, Misato; Hase, Sumitaka; Sato, Kengo; Sakakibara, Yasubumi

2016-06-15

Deep sequencing of the transcripts of regulatory non-coding RNA generates footprints of post-transcriptional processes. After obtaining sequence reads, the short reads are mapped to a reference genome, and specific mapping patterns can be detected called read mapping profiles, which are distinct from random non-functional degradation patterns. These patterns reflect the maturation processes that lead to the production of shorter RNA sequences. Recent next-generation sequencing studies have revealed not only the typical maturation process of miRNAs but also the various processing mechanisms of small RNAs derived from tRNAs and snoRNAs. We developed an algorithm termed SHARAKU to align two read mapping profiles of next-generation sequencing outputs for non-coding RNAs. In contrast with previous work, SHARAKU incorporates the primary and secondary sequence structures into an alignment of read mapping profiles to allow for the detection of common processing patterns. Using a benchmark simulated dataset, SHARAKU exhibited superior performance to previous methods for correctly clustering the read mapping profiles with respect to 5'-end processing and 3'-end processing from degradation patterns and in detecting similar processing patterns in deriving the shorter RNAs. Further, using experimental data of small RNA sequencing for the common marmoset brain, SHARAKU succeeded in identifying the significant clusters of read mapping profiles for similar processing patterns of small derived RNA families expressed in the brain. The source code of our program SHARAKU is available at http://www.dna.bio.keio.ac.jp/sharaku/, and the simulated dataset used in this work is available at the same link. Accession code: The sequence data from the whole RNA transcripts in the hippocampus of the left brain used in this work is available from the DNA DataBank of Japan (DDBJ) Sequence Read Archive (DRA) under the accession number DRA004502. yasu@bio.keio.ac.jp Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

Genomic Sequence and Characterization of the Virulent Bacteriophage φCTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin▿

PubMed Central

Mayer, Melinda J.; Payne, John; Gasson, Michael J.; Narbad, Arjan

2010-01-01

The growth of Clostridium tyrobutyricum in developing cheese leads to spoilage and cheese blowing. Bacteriophages or their specific lytic enzymes may provide a biological control method for eliminating such undesirable organisms without affecting other microflora. We isolated the virulent bacteriophage φCTP1 belonging to the Siphoviridae and have shown that it is effective in causing lysis of sensitive strains. The double-stranded DNA genome of φCTP1 is 59,199 bp, and sequence analysis indicated that it has 86 open reading frames. orf29 was identified as the gene coding for the phage endolysin responsible for cell wall degradation prior to virion release. We cloned and expressed the ctp1l gene in E. coli and demonstrated that the partially purified protein induced lysis of C. tyrobutyricum cells and reduced viable counts both in buffer and in milk. The endolysin was inactive against a range of clostridial species but did show lysis of Clostridium sporogenes, another potential spoilage organism. Removal of the C-terminal portion of the endolysin completely abolished lytic activity. PMID:20581196

A Cluster of Cuticle Protein Genes of Drosophila Melanogaster at 65a: Sequence, Structure and Evolution

PubMed Central

Charles, J. P.; Chihara, C.; Nejad, S.; Riddiford, L. M.

1997-01-01

A 36-kb genomic DNA segment of the Drosophila melanogaster genome containing 12 clustered cuticle genes has been mapped and partially sequenced. The cluster maps at 65A 5-6 on the left arm of the third chromosome, in agreement with the previously determined location of a putative cluster encompassing the genes for the third instar larval cuticle proteins LCP5, LCP6 and LCP8. This cluster is the largest cuticle gene cluster discovered to date and shows a number of surprising features that explain in part the genetic complexity of the LCP5, LCP6 and LCP8 loci. The genes encoding LCP5 and LCP8 are multiple copy genes and the presence of extensive similarity in their coding regions gives the first evidence for gene conversion in cuticle genes. In addition, five genes in the cluster are intronless. Four of these five have arisen by retroposition. The other genes in the cluster have a single intron located at an unusual location for insect cuticle genes. PMID:9383064

Severe Phenotype of Keratitis-Ichthyosis-Deafness Syndrome With Presumed Ocular Surface Squamous Neoplasia.

PubMed

Serrano-Ahumada, Ana Silvia; Cortes-González, Vianney; González-Huerta, Luz María; Cuevas, Sergio; Aguilar-Lozano, Luis; Villanueva-Mendoza, Cristina

2018-02-01

The aim of this study was to describe a case of severe keratitis-ichthyosis-deafness (KID) syndrome with ocular surface squamous neoplasia. The affected patient underwent complete ocular and systemic examinations. The molecular studies included polymerase chain reaction amplification and automated DNA sequencing of the complete gap junction beta-2 (GJB2) gene coding sequence. A 30-year-old man presented with generalized erythro-hyperkeratosis and deafness and complaints of decreased visual acuity, tearing, and photophobia. Ophthalmic examination showed corneal erosion, vascularization, and a gray gelatinous lesion partially covering the right cornea, suggestive of squamous neoplasia. The clinical features were characteristic of KID syndrome. This diagnosis was confirmed with a DNA analysis showing the pathogenic variant p.D50N in the GJB2 gene. Presumed squamous neoplasia was treated with topical interferon α2b. KID syndrome is a very rare disease that has been reported with an incremental incidence of squamous cell carcinoma of the mucous membranes and skin (12%-15%). Here, we presented a case of severe systemic KID syndrome with ocular surface squamous neoplasia.

Diversity in copy number and structure of a silkworm morphogenetic gene as a result of domestication.

PubMed

Sakudoh, Takashi; Nakashima, Takeharu; Kuroki, Yoko; Fujiyama, Asao; Kohara, Yuji; Honda, Naoko; Fujimoto, Hirofumi; Shimada, Toru; Nakagaki, Masao; Banno, Yutaka; Tsuchida, Kozo

2011-03-01

The carotenoid-binding protein (CBP) of the domesticated silkworm, Bombyx mori, a major determinant of cocoon color, is likely to have been substantially influenced by domestication of this species. We analyzed the structure of the CBP gene in multiple strains of B. mori, in multiple individuals of the wild silkworm, B. mandarina (the putative wild ancestor of B. mori), and in a number of other lepidopterans. We found the CBP gene copy number in genomic DNA to vary widely among B. mori strains, ranging from 1 to 20. The copies of CBP are of several types, based on the presence of a retrotransposon or partial deletion of the coding sequence. In contrast to B. mori, B. mandarina was found to possess a single copy of CBP without the retrotransposon insertion, regardless of habitat. Several other lepidopterans were found to contain sequences homologous to CBP, revealing that this gene is evolutionarily conserved in the lepidopteran lineage. Thus, domestication can generate significant diversity of gene copy number and structure over a relatively short evolutionary time. © 2011 by the Genetics Society of America

Diversity in Copy Number and Structure of a Silkworm Morphogenetic Gene as a Result of Domestication

PubMed Central

Sakudoh, Takashi; Nakashima, Takeharu; Kuroki, Yoko; Fujiyama, Asao; Kohara, Yuji; Honda, Naoko; Fujimoto, Hirofumi; Shimada, Toru; Nakagaki, Masao; Banno, Yutaka; Tsuchida, Kozo

2011-01-01

The carotenoid-binding protein (CBP) of the domesticated silkworm, Bombyx mori, a major determinant of cocoon color, is likely to have been substantially influenced by domestication of this species. We analyzed the structure of the CBP gene in multiple strains of B. mori, in multiple individuals of the wild silkworm, B. mandarina (the putative wild ancestor of B. mori), and in a number of other lepidopterans. We found the CBP gene copy number in genomic DNA to vary widely among B. mori strains, ranging from 1 to 20. The copies of CBP are of several types, based on the presence of a retrotransposon or partial deletion of the coding sequence. In contrast to B. mori, B. mandarina was found to possess a single copy of CBP without the retrotransposon insertion, regardless of habitat. Several other lepidopterans were found to contain sequences homologous to CBP, revealing that this gene is evolutionarily conserved in the lepidopteran lineage. Thus, domestication can generate significant diversity of gene copy number and structure over a relatively short evolutionary time. PMID:21242537

GRIL-Seq, a method for identifying direct targets of bacterial small regulatory RNA by in vivo proximity ligation

PubMed Central

Han, Kook; Tjaden, Brian; Lory, Stephen

2017-01-01

The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base-pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique (referred to as GRIL-Seq) is based on preferential ligation of sRNAs to ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimeras. In addition to the RNA chaperone Hfq, the GRIL-Seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrate that direct regulatory targets of this sRNA can be readily identified. Therefore, GRIL-Seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but can also result in uncovering novel roles for sRNAs and their targets in complex regulatory networks. PMID:28005055

Identification and Characterization of a Cis-Encoded Antisense RNA Associated with the Replication Process of Salmonella enterica Serovar Typhi

PubMed Central

Dadzie, Isaac; Xu, Shungao; Ni, Bin; Zhang, Xiaolei; Zhang, Haifang; Sheng, Xiumei; Xu, Huaxi; Huang, Xinxiang

2013-01-01

Antisense RNAs that originate from the complementary strand of protein coding genes are involved in the regulation of gene expression in all domains of life. In bacteria, some of these antisense RNAs are transcriptional noise whiles others play a vital role to adapt the cell to changing environmental conditions. By deep sequencing analysis of transcriptome of Salmonella enterica serovar Typhi, a partial RNA sequence encoded in-cis to the dnaA gene was revealed. Northern blot and RACE analysis confirmed the transcription of this antisense RNA which was expressed mostly in the stationary phase of the bacterial growth and also under iron limitation and osmotic stress. Pulse expression analysis showed that overexpression of the antisense RNA resulted in a significant increase in the mRNA levels of dnaA, which will ultimately enhance their translation. Our findings have revealed that antisense RNA of dnaA is indeed transcribed not merely as a by-product of the cell's transcription machinery but plays a vital role as far as stability of dnaA mRNA is concerned. PMID:23637809

Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005

PubMed Central

Klein, Joern; Hussain, Manzoor; Ahmad, Munir; Normann, Preben; Afzal, Muhammad; Alexandersen, Soren

2007-01-01

Background According to the World Reference Laboratory for FMD, a new subtype of FMDV serotype A was detected in Iran in 2005. This subtype was designated A/IRN/2005, and rapidly spread throughout Iran and moved westwards into Saudi Arabia and Turkey where it was initially detected from August 2005 and subsequently caused major disease problems in the spring of 2006. The same subtype reached Jordan in 2007. As part of an ongoing project we have also detected this subtype in Pakistan with the first positive samples detected in April 2006. To characterise this subtype in detail, we have sequenced and analysed the complete coding sequence of three subtype A/IRN/2005 isolates collected in Pakistan in 2006, the complete coding sequence of one subtype A/IRN/2005 isolate collected during the first outbreak in Turkey in 2005 and, in addition, the partial 1D coding sequence derived from 4 epithelium samples and 34 swab-samples from Asian buffaloes or cattle subsequently found to be infected with the A/IRN/2005 subtype. Results The phylogenies of the genome regions encoding for the structural proteins, displayed, with the exception of 1A, distinct, serotype-specific clustering and an evolutionary relationship of the A/IRN/2005 sublineage with the A22 sublineage. Potential recombination events have been detected in parts of the genome region coding for the non-structural proteins of FMDV. In addition, amino acid substitutions have been detected in the deduced VP1 protein sequence, potentially related to clinical or subclinical outcome of FMD. Indications of differential susceptibility for developing a subclinical course of disease between Asian buffaloes and cattle have been detected. Furthermore, hitherto unknown insertions of 2 amino acids before the second start codon, as well as sublineage specific amino acids have been detected in the genome region encoding for the leader proteinase of A/IRN/2005 sublineage. Conclusion Our findings indicate that the A/IRN/2005 sublineage has undergone two different paths of evolution for the structural and non-structural genome regions. The structural genome regions have had their evolutionary starting point in the A22 sublineage. It can be assumed that, due to the quasispecies structure of FMDV populations and the error-prone replication process, advantageous mutations in a changed environment have been fixed and lead to the occurrence of the new A/IRN/2005 sublineage. Together with this mechanism, recombination within the non-structural genome regions, potentially modifying the virulence of the virus, may be involved in the success of this new sublineage. The possible origin of this recombinant virus may be a co-infection with Asia1 and a serotype A precursor of the A/IRN/2005 sublineage potentially within Asian Buffaloes, as these appears to relatively easy become infected, but usually without developing clinical disease and consequently showing not a strong acute inflammatory immune response against a second FMDV infection. PMID:18001482

Efficient analysis of mouse genome sequences reveal many nonsense variants

PubMed Central

Steeland, Sophie; Timmermans, Steven; Van Ryckeghem, Sara; Hulpiau, Paco; Saeys, Yvan; Van Montagu, Marc; Vandenbroucke, Roosmarijn E.; Libert, Claude

2016-01-01

Genetic polymorphisms in coding genes play an important role when using mouse inbred strains as research models. They have been shown to influence research results, explain phenotypical differences between inbred strains, and increase the amount of interesting gene variants present in the many available inbred lines. SPRET/Ei is an inbred strain derived from Mus spretus that has ∼1% sequence difference with the C57BL/6J reference genome. We obtained a listing of all SNPs and insertions/deletions (indels) present in SPRET/Ei from the Mouse Genomes Project (Wellcome Trust Sanger Institute) and processed these data to obtain an overview of all transcripts having nonsynonymous coding sequence variants. We identified 8,883 unique variants affecting 10,096 different transcripts from 6,328 protein-coding genes, which is about 28% of all coding genes. Because only a subset of these variants results in drastic changes in proteins, we focused on variations that are nonsense mutations that ultimately resulted in a gain of a stop codon. These genes were identified by in silico changing the C57BL/6J coding sequences to the SPRET/Ei sequences, converting them to amino acid (AA) sequences, and comparing the AA sequences. All variants and transcripts affected were also stored in a database, which can be browsed using a SPRET/Ei M. spretus variants web tool (www.spretus.org), including a manual. We validated the tool by demonstrating the loss of function of three proteins predicted to be severely truncated, namely Fas, IRAK2, and IFNγR1. PMID:27147605

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

VaDiR: an integrated approach to Variant Detection in RNA.

PubMed

Neums, Lisa; Suenaga, Seiji; Beyerlein, Peter; Anders, Sara; Koestler, Devin; Mariani, Andrea; Chien, Jeremy

2018-02-01

Advances in next-generation DNA sequencing technologies are now enabling detailed characterization of sequence variations in cancer genomes. With whole-genome sequencing, variations in coding and non-coding sequences can be discovered. But the cost associated with it is currently limiting its general use in research. Whole-exome sequencing is used to characterize sequence variations in coding regions, but the cost associated with capture reagents and biases in capture rate limit its full use in research. Additional limitations include uncertainty in assigning the functional significance of the mutations when these mutations are observed in the non-coding region or in genes that are not expressed in cancer tissue. We investigated the feasibility of uncovering mutations from expressed genes using RNA sequencing datasets with a method called Variant Detection in RNA(VaDiR) that integrates 3 variant callers, namely: SNPiR, RVBoost, and MuTect2. The combination of all 3 methods, which we called Tier 1 variants, produced the highest precision with true positive mutations from RNA-seq that could be validated at the DNA level. We also found that the integration of Tier 1 variants with those called by MuTect2 and SNPiR produced the highest recall with acceptable precision. Finally, we observed a higher rate of mutation discovery in genes that are expressed at higher levels. Our method, VaDiR, provides a possibility of uncovering mutations from RNA sequencing datasets that could be useful in further functional analysis. In addition, our approach allows orthogonal validation of DNA-based mutation discovery by providing complementary sequence variation analysis from paired RNA/DNA sequencing datasets.

Draft Genome Sequence of Cellulolytic and Xylanolytic Paenibacillus sp. A59, Isolated from Decaying Forest Soil from Patagonia, Argentina

PubMed Central

Ghio, Silvina; Martinez Cáceres, Alfredo I.; Talia, Paola; Grasso, Daniel H.

2015-01-01

Paenibacillus sp. A59 was isolated from decaying forest soil in Argentina and characterized as a xylanolytic strain. We report the draft genome sequence of this isolate, with an estimated genome size of 7 Mb which harbor 6,424 coding sequences. Genes coding for hydrolytic enzymes involved in lignocellulose deconstruction were predicted. PMID:26494679

Partial Picture Effects on Children's Memory for Sentences Containing Implicit Information.

ERIC Educational Resources Information Center

Miller, Gloria E.; Pressley, Michael

1987-01-01

Two experiments were conducted examining the effects of partial picture adjuncts on young children's coding of information implied in sentences. Developmental differences were found in whether (l) partial pictures facilitated inferencing and (2) pictures containing information not explicitly stated in sentences promoted cue recall of the…

Expression of the histone chaperone SET/TAF-Iβ during the strobilation process of Mesocestoides corti (Platyhelminthes, Cestoda).

PubMed

Costa, Caroline B; Monteiro, Karina M; Teichmann, Aline; da Silva, Edileuza D; Lorenzatto, Karina R; Cancela, Martín; Paes, Jéssica A; Benitz, André de N D; Castillo, Estela; Margis, Rogério; Zaha, Arnaldo; Ferreira, Henrique B

2015-08-01

The histone chaperone SET/TAF-Iβ is implicated in processes of chromatin remodelling and gene expression regulation. It has been associated with the control of developmental processes, but little is known about its function in helminth parasites. In Mesocestoides corti, a partial cDNA sequence related to SET/TAF-Iβ was isolated in a screening for genes differentially expressed in larvae (tetrathyridia) and adult worms. Here, the full-length coding sequence of the M. corti SET/TAF-Iβ gene was analysed and the encoded protein (McSET/TAF) was compared with orthologous sequences, showing that McSET/TAF can be regarded as a SET/TAF-Iβ family member, with a typical nucleosome-assembly protein (NAP) domain and an acidic tail. The expression patterns of the McSET/TAF gene and protein were investigated during the strobilation process by RT-qPCR, using a set of five reference genes, and by immunoblot and immunofluorescence, using monospecific polyclonal antibodies. A gradual increase in McSET/TAF transcripts and McSET/TAF protein was observed upon development induction by trypsin, demonstrating McSET/TAF differential expression during strobilation. These results provided the first evidence for the involvement of a protein from the NAP family of epigenetic effectors in the regulation of cestode development.

Gene Identification Algorithms Using Exploratory Statistical Analysis of Periodicity

NASA Astrophysics Data System (ADS)

Mukherjee, Shashi Bajaj; Sen, Pradip Kumar

2010-10-01

Studying periodic pattern is expected as a standard line of attack for recognizing DNA sequence in identification of gene and similar problems. But peculiarly very little significant work is done in this direction. This paper studies statistical properties of DNA sequences of complete genome using a new technique. A DNA sequence is converted to a numeric sequence using various types of mappings and standard Fourier technique is applied to study the periodicity. Distinct statistical behaviour of periodicity parameters is found in coding and non-coding sequences, which can be used to distinguish between these parts. Here DNA sequences of Drosophila melanogaster were analyzed with significant accuracy.

24 CFR 200.926 - Minimum property standards for one and two family dwellings.

Code of Federal Regulations, 2012 CFR

2012-04-01

... property is to be located. (c) Standard for evaluating local or state building codes. The Secretary shall compare a local building code submitted under paragraph (d) of this section or a State code to the list of... each area and subarea on the list. (2) A State or local building code will be partially accepted if it...

24 CFR 200.926 - Minimum property standards for one and two family dwellings.

Code of Federal Regulations, 2014 CFR

2014-04-01

... property is to be located. (c) Standard for evaluating local or state building codes. The Secretary shall compare a local building code submitted under paragraph (d) of this section or a State code to the list of... each area and subarea on the list. (2) A State or local building code will be partially accepted if it...

24 CFR 200.926 - Minimum property standards for one and two family dwellings.

Code of Federal Regulations, 2013 CFR

2013-04-01

... property is to be located. (c) Standard for evaluating local or state building codes. The Secretary shall compare a local building code submitted under paragraph (d) of this section or a State code to the list of... each area and subarea on the list. (2) A State or local building code will be partially accepted if it...

Genetic code, hamming distance and stochastic matrices.

PubMed

He, Matthew X; Petoukhov, Sergei V; Ricci, Paolo E

2004-09-01

In this paper we use the Gray code representation of the genetic code C=00, U=10, G=11 and A=01 (C pairs with G, A pairs with U) to generate a sequence of genetic code-based matrices. In connection with these code-based matrices, we use the Hamming distance to generate a sequence of numerical matrices. We then further investigate the properties of the numerical matrices and show that they are doubly stochastic and symmetric. We determine the frequency distributions of the Hamming distances, building blocks of the matrices, decomposition and iterations of matrices. We present an explicit decomposition formula for the genetic code-based matrix in terms of permutation matrices, which provides a hypercube representation of the genetic code. It is also observed that there is a Hamiltonian cycle in a genetic code-based hypercube.

Mitochondrial genomes of the jungle crow Corvus macrorhynchos (Passeriformes: Corvidae) from shed feathers and a phylogenetic analysis of genus Corvus using mitochondrial protein-coding genes.

PubMed

Krzeminska, Urszula; Wilson, Robyn; Rahman, Sadequr; Song, Beng Kah; Seneviratne, Sampath; Gan, Han Ming; Austin, Christopher M

2016-07-01

The complete mitochondrial genomes of two jungle crows (Corvus macrorhynchos) were sequenced. DNA was extracted from tissue samples obtained from shed feathers collected in the field in Sri Lanka and sequenced using the Illumina MiSeq Personal Sequencer. Jungle crow mitogenomes have a structural organization typical of the genus Corvus and are 16,927 bp and 17,066 bp in length, both comprising 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal subunit genes, and a non-coding control region. In addition, we complement already available house crow (Corvus spelendens) mitogenome resources by sequencing an individual from Singapore. A phylogenetic tree constructed from Corvidae family mitogenome sequences available on GenBank is presented. We confirm the monophyly of the genus Corvus and propose to use complete mitogenome resources for further intra- and interspecies genetic studies.

Evolution of the alternative AQP2 gene: Acquisition of a novel protein-coding sequence in dolphins.

PubMed

Kishida, Takushi; Suzuki, Miwa; Takayama, Asuka

2018-01-01

Taxon-specific de novo protein-coding sequences are thought to be important for taxon-specific environmental adaptation. A recent study revealed that bottlenose dolphins acquired a novel isoform of aquaporin 2 generated by alternative splicing (alternative AQP2), which helps dolphins to live in hyperosmotic seawater. The AQP2 gene consists of four exons, but the alternative AQP2 gene lacks the fourth exon and instead has a longer third exon that includes the original third exon and a part of the original third intron. Here, we show that the latter half of the third exon of the alternative AQP2 arose from a non-protein-coding sequence. Intact ORF of this de novo sequence is shared not by all cetaceans, but only by delphinoids. However, this sequence is conservative in all modern cetaceans, implying that this de novo sequence potentially plays important roles for marine adaptation in cetaceans. Copyright © 2017 Elsevier Inc. All rights reserved.

An improved algorithm for evaluating trellis phase codes

NASA Technical Reports Server (NTRS)

Mulligan, M. G.; Wilson, S. G.

1982-01-01

A method is described for evaluating the minimum distance parameters of trellis phase codes, including CPFSK, partial response FM, and more importantly, coded CPM (continuous phase modulation) schemes. The algorithm provides dramatically faster execution times and lesser memory requirements than previous algorithms. Results of sample calculations and timing comparisons are included.

An improved algorithm for evaluating trellis phase codes

NASA Technical Reports Server (NTRS)

Mulligan, M. G.; Wilson, S. G.

1984-01-01

A method is described for evaluating the minimum distance parameters of trellis phase codes, including CPFSK, partial response FM, and more importantly, coded CPM (continuous phase modulation) schemes. The algorithm provides dramatically faster execution times and lesser memory requirements than previous algorithms. Results of sample calculations and timing comparisons are included.

Complete genome sequencing of the luminescent bacterium, Vibrio qinghaiensis sp. Q67 using PacBio technology

NASA Astrophysics Data System (ADS)

Gong, Liang; Wu, Yu; Jian, Qijie; Yin, Chunxiao; Li, Taotao; Gupta, Vijai Kumar; Duan, Xuewu; Jiang, Yueming

2018-01-01

Vibrio qinghaiensis sp.-Q67 (Vqin-Q67) is a freshwater luminescent bacterium that continuously emits blue-green light (485 nm). The bacterium has been widely used for detecting toxic contaminants. Here, we report the complete genome sequence of Vqin-Q67, obtained using third-generation PacBio sequencing technology. Continuous long reads were attained from three PacBio sequencing runs and reads >500 bp with a quality value of >0.75 were merged together into a single dataset. This resultant highly-contiguous de novo assembly has no genome gaps, and comprises two chromosomes with substantial genetic information, including protein-coding genes, non-coding RNA, transposon and gene islands. Our dataset can be useful as a comparative genome for evolution and speciation studies, as well as for the analysis of protein-coding gene families, the pathogenicity of different Vibrio species in fish, the evolution of non-coding RNA and transposon, and the regulation of gene expression in relation to the bioluminescence of Vqin-Q67.

Heterozygous Mutations Causing Partial Prohormone Convertase 1 Deficiency Contribute to Human Obesity

PubMed Central

Creemers, John W.M.; Choquet, Hélène; Stijnen, Pieter; Vatin, Vincent; Pigeyre, Marie; Beckers, Sigri; Meulemans, Sandra; Than, Manuel E.; Yengo, Loïc; Tauber, Maithé; Balkau, Beverley; Elliott, Paul; Jarvelin, Marjo-Riitta; Van Hul, Wim; Van Gaal, Luc; Horber, Fritz; Pattou, François; Froguel, Philippe; Meyre, David

2012-01-01

Null mutations in the PCSK1 gene, encoding the proprotein convertase 1/3 (PC1/3), cause recessive monogenic early onset obesity. Frequent coding variants that modestly impair PC1/3 function mildly increase the risk for common obesity. The aim of this study was to determine the contribution of rare functional PCSK1 mutations to obesity. PCSK1 exons were sequenced in 845 nonconsanguineous extremely obese Europeans. Eight novel nonsynonymous PCSK1 mutations were identified, all heterozygous. Seven mutations had a deleterious effect on either the maturation or the enzymatic activity of PC1/3 in cell lines. Of interest, five of these novel mutations, one of the previously described frequent variants (N221D), and the mutation found in an obese mouse model (N222D), affect residues at or near the structural calcium binding site Ca-1. The prevalence of the newly identified mutations was assessed in 6,233 obese and 6,274 lean European adults and children, which showed that carriers of any of these mutations causing partial PCSK1 deficiency had an 8.7-fold higher risk to be obese than wild-type carriers. These results provide the first evidence of an increased risk of obesity in heterozygous carriers of mutations in the PCSK1 gene. Furthermore, mutations causing partial PCSK1 deficiency are present in 0.83% of extreme obesity phenotypes. PMID:22210313

Heterozygous mutations causing partial prohormone convertase 1 deficiency contribute to human obesity.

PubMed

Creemers, John W M; Choquet, Hélène; Stijnen, Pieter; Vatin, Vincent; Pigeyre, Marie; Beckers, Sigri; Meulemans, Sandra; Than, Manuel E; Yengo, Loïc; Tauber, Maithé; Balkau, Beverley; Elliott, Paul; Jarvelin, Marjo-Riitta; Van Hul, Wim; Van Gaal, Luc; Horber, Fritz; Pattou, François; Froguel, Philippe; Meyre, David

2012-02-01

Null mutations in the PCSK1 gene, encoding the proprotein convertase 1/3 (PC1/3), cause recessive monogenic early onset obesity. Frequent coding variants that modestly impair PC1/3 function mildly increase the risk for common obesity. The aim of this study was to determine the contribution of rare functional PCSK1 mutations to obesity. PCSK1 exons were sequenced in 845 nonconsanguineous extremely obese Europeans. Eight novel nonsynonymous PCSK1 mutations were identified, all heterozygous. Seven mutations had a deleterious effect on either the maturation or the enzymatic activity of PC1/3 in cell lines. Of interest, five of these novel mutations, one of the previously described frequent variants (N221D), and the mutation found in an obese mouse model (N222D), affect residues at or near the structural calcium binding site Ca-1. The prevalence of the newly identified mutations was assessed in 6,233 obese and 6,274 lean European adults and children, which showed that carriers of any of these mutations causing partial PCSK1 deficiency had an 8.7-fold higher risk to be obese than wild-type carriers. These results provide the first evidence of an increased risk of obesity in heterozygous carriers of mutations in the PCSK1 gene. Furthermore, mutations causing partial PCSK1 deficiency are present in 0.83% of extreme obesity phenotypes.

Weight distributions for turbo codes using random and nonrandom permutations

NASA Technical Reports Server (NTRS)

Dolinar, S.; Divsalar, D.

1995-01-01

This article takes a preliminary look at the weight distributions achievable for turbo codes using random, nonrandom, and semirandom permutations. Due to the recursiveness of the encoders, it is important to distinguish between self-terminating and non-self-terminating input sequences. The non-self-terminating sequences have little effect on decoder performance, because they accumulate high encoded weight until they are artificially terminated at the end of the block. From probabilistic arguments based on selecting the permutations randomly, it is concluded that the self-terminating weight-2 data sequences are the most important consideration in the design of constituent codes; higher-weight self-terminating sequences have successively decreasing importance. Also, increasing the number of codes and, correspondingly, the number of permutations makes it more and more likely that the bad input sequences will be broken up by one or more of the permuters. It is possible to design nonrandom permutations that ensure that the minimum distance due to weight-2 input sequences grows roughly as the square root of (2N), where N is the block length. However, these nonrandom permutations amplify the bad effects of higher-weight inputs, and as a result they are inferior in performance to randomly selected permutations. But there are 'semirandom' permutations that perform nearly as well as the designed nonrandom permutations with respect to weight-2 input sequences and are not as susceptible to being foiled by higher-weight inputs.

Analysis of 16S-23S intergenic spacer regions of the rRNA operons in Edwardsiella ictaluri and Edwardsiella tarda isolates from fish.

PubMed

Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H

2005-01-01

To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.

Next-generation sequencing of the Trichinella murrelli mitochondrial genome allows comprehensive comparison of its divergence from the principal agent of human trichinellosis, Trichinella spiralis.

PubMed

Webb, Kristen M; Rosenthal, Benjamin M

2011-01-01

The mitochondrial genome's non-recombinant mode of inheritance and relatively rapid rate of evolution has promoted its use as a marker for studying the biogeographic history and evolutionary interrelationships among many metazoan species. A modest portion of the mitochondrial genome has been defined for 12 species and genotypes of parasites in the genus Trichinella, but its adequacy in representing the mitochondrial genome as a whole remains unclear, as the complete coding sequence has been characterized only for Trichinella spiralis. Here, we sought to comprehensively describe the extent and nature of divergence between the mitochondrial genomes of T. spiralis (which poses the most appreciable zoonotic risk owing to its capacity to establish persistent infections in domestic pigs) and Trichinella murrelli (which is the most prevalent species in North American wildlife hosts, but which poses relatively little risk to the safety of pork). Next generation sequencing methodologies and scaffold and de novo assembly strategies were employed. The entire protein-coding region was sequenced (13,917 bp), along with a portion of the highly repetitive non-coding region (1524 bp) of the mitochondrial genome of T. murrelli with a combined average read depth of 250 reads. The accuracy of base calling, estimated from coding region sequence was found to exceed 99.3%. Genome content and gene order was not found to be significantly different from that of T. spiralis. An overall inter-species sequence divergence of 9.5% was estimated. Significant variation was identified when the amount of variation between species at each gene is compared to the average amount of variation between species across the coding region. Next generation sequencing is a highly effective means to obtain previously unknown mitochondrial genome sequence. Particular to parasites, the extremely deep coverage achieved through this method allows for the detection of sequence heterogeneity between the multiple individuals that necessarily comprise such templates. Copyright © 2010 Elsevier B.V. All rights reserved.

Cloning and sequence determination of the gene coding for the pyruvate phosphate dikinase of Entamoeba histolytica.

PubMed

Saavedra-Lira, E; Pérez-Montfort, R

1994-05-16

We isolated three overlapping clones from a DNA genomic library of Entamoeba histolytica strain HM1:IMSS, whose translated nucleotide (nt) sequence shows similarities of 51, 48 and 47% with the amino acid (aa) sequences reported for the pyruvate phosphate dikinases from Bacteroides symbiosus, maize and Flaveria trinervia, respectively. The reading frame determined codes for a protein of 886 aa.

Draft Genome Sequence of Cellulolytic and Xylanolytic Paenibacillus sp. A59, Isolated from Decaying Forest Soil from Patagonia, Argentina.

PubMed

Ghio, Silvina; Martinez Cáceres, Alfredo I; Talia, Paola; Grasso, Daniel H; Campos, Eleonora

2015-10-22

Paenibacillus sp. A59 was isolated from decaying forest soil in Argentina and characterized as a xylanolytic strain. We report the draft genome sequence of this isolate, with an estimated genome size of 7 Mb which harbor 6,424 coding sequences. Genes coding for hydrolytic enzymes involved in lignocellulose deconstruction were predicted. Copyright © 2015 Ghio et al.

Comparisons between Arabidopsis thaliana and Drosophila melanogaster in relation to Coding and Noncoding Sequence Length and Gene Expression

PubMed Central

Caldwell, Rachel; Lin, Yan-Xia; Zhang, Ren

2015-01-01

There is a continuing interest in the analysis of gene architecture and gene expression to determine the relationship that may exist. Advances in high-quality sequencing technologies and large-scale resource datasets have increased the understanding of relationships and cross-referencing of expression data to the large genome data. Although a negative correlation between expression level and gene (especially transcript) length has been generally accepted, there have been some conflicting results arising from the literature concerning the impacts of different regions of genes, and the underlying reason is not well understood. The research aims to apply quantile regression techniques for statistical analysis of coding and noncoding sequence length and gene expression data in the plant, Arabidopsis thaliana, and fruit fly, Drosophila melanogaster, to determine if a relationship exists and if there is any variation or similarities between these species. The quantile regression analysis found that the coding sequence length and gene expression correlations varied, and similarities emerged for the noncoding sequence length (5′ and 3′ UTRs) between animal and plant species. In conclusion, the information described in this study provides the basis for further exploration into gene regulation with regard to coding and noncoding sequence length. PMID:26114098

The mitochondrial genomes of the acoelomorph worms Paratomella rubra, Isodiametra pulchra and Archaphanostoma ylvae.

PubMed

Robertson, Helen E; Lapraz, François; Egger, Bernhard; Telford, Maximilian J; Schiffer, Philipp H

2017-05-12

Acoels are small, ubiquitous - but understudied - marine worms with a very simple body plan. Their internal phylogeny is still not fully resolved, and the position of their proposed phylum Xenacoelomorpha remains debated. Here we describe mitochondrial genome sequences from the acoels Paratomella rubra and Isodiametra pulchra, and the complete mitochondrial genome of the acoel Archaphanostoma ylvae. The P. rubra and A. ylvae sequences are typical for metazoans in size and gene content. The larger I. pulchra  mitochondrial genome contains both ribosomal genes, 21 tRNAs, but only 11 protein-coding genes. We find evidence suggesting a duplicated sequence in the I. pulchra mitochondrial genome. The P. rubra, I. pulchra and A. ylvae mitochondria have a unique genome organisation in comparison to other metazoan mitochondrial genomes. We found a large degree of protein-coding gene and tRNA overlap with little non-coding sequence in the compact P. rubra genome. Conversely, the A. ylvae and I. pulchra genomes have many long non-coding sequences between genes, likely driving genome size expansion in the latter. Phylogenetic trees inferred from mitochondrial genes retrieve Xenacoelomorpha as an early branching taxon in the deuterostomes. Sequence divergence analysis between P. rubra sampled in England and Spain indicates cryptic diversity.

Metal resistance sequences and transgenic plants

DOEpatents

Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

1999-10-12

The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

Complete mitochondrial genome of the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae).

PubMed

Kim, Min Jee; Im, Hyun Hwak; Lee, Kwang Youll; Han, Yeon Soo; Kim, Iksoo

2014-06-01

Abstract The complete nucleotide sequences of the mitochondrial genome from the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae), was determined. The 20,319-bp long circular genome is the longest among completely sequenced Coleoptera. As is typical in animals, the P. brevitarsis genome consisted of two ribosomal RNAs, 22 transfer RNAs, 13 protein-coding genes and one A + T-rich region. Although the size of the coding genes was typical, the non-coding A + T-rich region was 5654 bp, which is the longest in insects. The extraordinary length of this region was composed of 28,117-bp tandem repeats and 782-bp tandem repeats. These repeat sequences were encompassed by three non-repeat sequences constituting 1804 bp.

Partial Gene Sequencing of CYP1A, Vitellogenin, and Metallothionein in Mosquitofish Gambusia yucatana and Gambusia sexradiata.

PubMed

Vázquez-Euán, Roberto; Escalante-Herrera, Karla S; Rodríguez-Fuentes, Gabriela

2017-01-01

Ground characteristics in the Yucatan Peninsula make recovery and treatment of wastewater very expensive. This situation has contributed to an increase of pollutants in the aquifer. Unfortunately, studies related to the effects of those pollutants in native organisms are scarce. The aim of this work was to obtain partial sequences of widely known genes used as biomarkers of pollutant effect in Gambusia yucatana and Gambusia sexradiata. The studied genes were: cytochrome P450 1A (CYP1A); vitellogenin (VTG); metallothionein (MT), and two housekeeping genes, 18S and β-actin. From reported sequences of Gambusia affinis, primers were designed and amplification was done in the local Gambusia species exposed for 48 h to gasoline (100 µL/L, stirred for 24 h pre-exposure). Preliminary results revealed partial sequences of all genes with an approximate average length of 200 bp. BLAST analysis of found sequences indicated a minimum of 97% identity with reported sequences for G. affinis or Gambusia holbrooki showing great similarity.

EDGE 2017 R&D 100 Entry with Appendix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chain, Patrick Sam Guy; Davenport, Karen Walston; Li, Po-E

Diabetes, infertility, cancer, and Alzheimer’s disease—the key to one day preventing or even curing such afflictions and diseases (both infectious and genetically driven) may be locked in our own genetic code and the code of microorganisms that inhabit our bodies. The study of this code, known as genomics, has recently become much more promising as a result of two things: (1) vast improvements in high-throughput, nextgeneration sequencing (NSG), and (2) an exponential decrease in the cost of such sequencing. For example, it originally cost approximately $3 billion to sequence the human genome; today, this genome could be resequenced for lessmore » than $1,000.« less

Nebo: An efficient, parallel, and portable domain-specific language for numerically solving partial differential equations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Earl, Christopher; Might, Matthew; Bagusetty, Abhishek

This study presents Nebo, a declarative domain-specific language embedded in C++ for discretizing partial differential equations for transport phenomena on multiple architectures. Application programmers use Nebo to write code that appears sequential but can be run in parallel, without editing the code. Currently Nebo supports single-thread execution, multi-thread execution, and many-core (GPU-based) execution. With single-thread execution, Nebo performs on par with code written by domain experts. With multi-thread execution, Nebo can linearly scale (with roughly 90% efficiency) up to 12 cores, compared to its single-thread execution. Moreover, Nebo’s many-core execution can be over 140x faster than its single-thread execution.

Nebo: An efficient, parallel, and portable domain-specific language for numerically solving partial differential equations

DOE PAGES

Earl, Christopher; Might, Matthew; Bagusetty, Abhishek; ...

2016-01-26

This study presents Nebo, a declarative domain-specific language embedded in C++ for discretizing partial differential equations for transport phenomena on multiple architectures. Application programmers use Nebo to write code that appears sequential but can be run in parallel, without editing the code. Currently Nebo supports single-thread execution, multi-thread execution, and many-core (GPU-based) execution. With single-thread execution, Nebo performs on par with code written by domain experts. With multi-thread execution, Nebo can linearly scale (with roughly 90% efficiency) up to 12 cores, compared to its single-thread execution. Moreover, Nebo’s many-core execution can be over 140x faster than its single-thread execution.

Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

PubMed

Zhao, Ya-E; Wu, Li-Ping

2012-09-01

To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

Robust analysis of semiparametric renewal process models

PubMed Central

Lin, Feng-Chang; Truong, Young K.; Fine, Jason P.

2013-01-01

Summary A rate model is proposed for a modulated renewal process comprising a single long sequence, where the covariate process may not capture the dependencies in the sequence as in standard intensity models. We consider partial likelihood-based inferences under a semiparametric multiplicative rate model, which has been widely studied in the context of independent and identical data. Under an intensity model, gap times in a single long sequence may be used naively in the partial likelihood with variance estimation utilizing the observed information matrix. Under a rate model, the gap times cannot be treated as independent and studying the partial likelihood is much more challenging. We employ a mixing condition in the application of limit theory for stationary sequences to obtain consistency and asymptotic normality. The estimator's variance is quite complicated owing to the unknown gap times dependence structure. We adapt block bootstrapping and cluster variance estimators to the partial likelihood. Simulation studies and an analysis of a semiparametric extension of a popular model for neural spike train data demonstrate the practical utility of the rate approach in comparison with the intensity approach. PMID:24550568

Scaling features of noncoding DNA

NASA Technical Reports Server (NTRS)

Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.

1999-01-01

We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

[Learning and Repetive Reproduction of Memorized Sequences by the Right and the Left Hand].

PubMed

Bobrova, E V; Lyakhovetskii, V A; Bogacheva, I N

2015-01-01

An important stage of learning a new skill is repetitive reproduction of one and the same sequence of movements, which plays a significant role in forming of the movement stereotypes. Two groups of right-handers repeatedly memorized (6-10 repetitions) the sequences of their hand transitions by experimenter in 6 positions, firstly by the right hand (RH), and then--by the left hand (LH) or vice versa. Random sequences previously unknown to the volunteers were reproduced in the 11 series. Modified sequences were tested in the 2nd and 3rd series, where the same elements' positions were presented in different order. The processes of repetitive sequence reproduction were similar for RH and LH. However, the learning of the modified sequences differed: Information about elements' position disregarding the reproduction order was used only when LH initiated task performing. This information was not used when LH followed RH and when RH performed the task. Consequently, the type of information coding activated by LH helped learn the positions of sequence elements, while the type of information coding activated by RH prevented learning. It is supposedly connected with the predominant role of right hemisphere in the processes of positional coding and motor learning.

Multiple Access Interference Reduction Using Received Response Code Sequence for DS-CDMA UWB System

NASA Astrophysics Data System (ADS)

Toh, Keat Beng; Tachikawa, Shin'ichi

This paper proposes a combination of novel Received Response (RR) sequence at the transmitter and a Matched Filter-RAKE (MF-RAKE) combining scheme receiver system for the Direct Sequence-Code Division Multiple Access Ultra Wideband (DS-CDMA UWB) multipath channel model. This paper also demonstrates the effectiveness of the RR sequence in Multiple Access Interference (MAI) reduction for the DS-CDMA UWB system. It suggests that by using conventional binary code sequence such as the M sequence or the Gold sequence, there is a possibility of generating extra MAI in the UWB system. Therefore, it is quite difficult to collect the energy efficiently although the RAKE reception method is applied at the receiver. The main purpose of the proposed system is to overcome the performance degradation for UWB transmission due to the occurrence of MAI during multiple accessing in the DS-CDMA UWB system. The proposed system improves the system performance by improving the RAKE reception performance using the RR sequence which can reduce the MAI effect significantly. Simulation results verify that significant improvement can be obtained by the proposed system in the UWB multipath channel models.

Viewing multiple sequence alignments with the JavaScript Sequence Alignment Viewer (JSAV)

PubMed Central

Martin, Andrew C. R.

2014-01-01

The JavaScript Sequence Alignment Viewer (JSAV) is designed as a simple-to-use JavaScript component for displaying sequence alignments on web pages. The display of sequences is highly configurable with options to allow alternative coloring schemes, sorting of sequences and ’dotifying’ repeated amino acids. An option is also available to submit selected sequences to another web site, or to other JavaScript code. JSAV is implemented purely in JavaScript making use of the JQuery and JQuery-UI libraries. It does not use any HTML5-specific options to help with browser compatibility. The code is documented using JSDOC and is available from http://www.bioinf.org.uk/software/jsav/. PMID:25653836

Viewing multiple sequence alignments with the JavaScript Sequence Alignment Viewer (JSAV).

PubMed

Martin, Andrew C R

2014-01-01

The JavaScript Sequence Alignment Viewer (JSAV) is designed as a simple-to-use JavaScript component for displaying sequence alignments on web pages. The display of sequences is highly configurable with options to allow alternative coloring schemes, sorting of sequences and 'dotifying' repeated amino acids. An option is also available to submit selected sequences to another web site, or to other JavaScript code. JSAV is implemented purely in JavaScript making use of the JQuery and JQuery-UI libraries. It does not use any HTML5-specific options to help with browser compatibility. The code is documented using JSDOC and is available from http://www.bioinf.org.uk/software/jsav/.

First description of Grapevine leafroll-associated virus 5 in Argentina and partial genome sequence.

PubMed

Gómez Talquenca, Sebastián; Muñoz, Claudio; Grau, Oscar; Gracia, Olga

2009-02-01

An accession of Vitis vinifera cv. Red Globe from Argentina, was found to be infected with Grapevine leafroll-associated virus-5 by ELISA. It was partially sequenced, and three ORFs, corresponding to HSP70h, HSP90h, and CP, were found. This isolate shares a high aminoacid identity with the previously reported sequence of the virus, and identities between 80% and 90% with previously reported GLRaV-9 and GLRaV-4 isolates. The analysis of the sequence supports the clustering together with GLRaV-4 and GLRV-9 inside the Ampelovirus genus.

RNAcentral: an international database of ncRNA sequences

DOE PAGES

Williams, Kelly Porter

2014-10-28

The field of non-coding RNA biology has been hampered by the lack of availability of a comprehensive, up-to-date collection of accessioned RNA sequences. Here we present the first release of RNAcentral, a database that collates and integrates information from an international consortium of established RNA sequence databases. The initial release contains over 8.1 million sequences, including representatives of all major functional classes. A web portal (http://rnacentral.org) provides free access to data, search functionality, cross-references, source code and an integrated genome browser for selected species.

The complete validated mitochondrial genome of the silver gemfish Rexea solandri (Cuvier, 1832) (Perciformes, Gempylidae).

PubMed

Bustamante, Carlos; Ovenden, Jennifer R

2016-01-01

The silver gemfish Rexea solandri is an important economic resource but Vulnerable to overfishing in Australian waters. The complete mitochondrial genome sequence is described from 1.6 million reads obtained via next generation sequencing. The total length of the mitogenome is 16,350 bp comprising 2 rRNA, 13 protein-coding genes, 22 tRNA and 2 non-coding regions. The mitogenome sequence was validated against sequences of PCR fragments and BLAST queries of Genbank. Gene order was equivalent to that found in marine fishes.

High rate concatenated coding systems using bandwidth efficient trellis inner codes

NASA Technical Reports Server (NTRS)

Deng, Robert H.; Costello, Daniel J., Jr.

1989-01-01

High-rate concatenated coding systems with bandwidth-efficient trellis inner codes and Reed-Solomon (RS) outer codes are investigated for application in high-speed satellite communication systems. Two concatenated coding schemes are proposed. In one the inner code is decoded with soft-decision Viterbi decoding, and the outer RS code performs error-correction-only decoding (decoding without side information). In the other, the inner code is decoded with a modified Viterbi algorithm, which produces reliability information along with the decoded output. In this algorithm, path metrics are used to estimate the entire information sequence, whereas branch metrics are used to provide reliability information on the decoded sequence. This information is used to erase unreliable bits in the decoded output. An errors-and-erasures RS decoder is then used for the outer code. The two schemes have been proposed for high-speed data communication on NASA satellite channels. The rates considered are at least double those used in current NASA systems, and the results indicate that high system reliability can still be achieved.

Mutant swarms of a totivirus-like entities are present in the red macroalga Chondrus crispus and have been partially transferred to the nuclear genome.

PubMed

Rousvoal, Sylvie; Bouyer, Betty; López-Cristoffanini, Camilo; Boyen, Catherine; Collén, Jonas

2016-08-01

Chondrus crispus Stackhouse (Gigartinales) is a red seaweed found on North Atlantic rocky shores. Electrophoresis of RNA extracts showed a prominent band with a size of around 6,000 bp. Sequencing of the band revealed several sequences with similarity to totiviruses, double-stranded RNA viruses that normally infect fungi. This virus-like entity was named C. crispus virus (CcV). It should probably be regarded as an extreme viral quasispecies or a mutant swarm since low identity (<65%) was found between sequences. Totiviruses typically code for two genes: one capsid gene (gag) and one RNA-dependent RNA polymerase gene (pol) with a pseudoknot structure between the genes. Both the genes and the intergenic structures were found in the CcV sequences. A nonidentical gag gene was also found in the nuclear genome of C. crispus, with associated expressed sequence tags (EST) and upstream regulatory features. The gene was presumably horizontally transferred from the virus to the alga. Similar dsRNA bands were seen in extracts from different life cycle stages of C. crispus and from all geographic locations tested. In addition, similar bands were also observed in RNA extractions from other red algae; however, the significance of this apparently widespread phenomenon is unknown. Neither phenotype caused by the infection nor any virus particles or capsid proteins were identified; thus, the presence of viral particles has not been validated. These findings increase the known host range of totiviruses to include marine red algae. © 2016 Phycological Society of America.

Intact coding region of the serotonin transporter gene in obsessive-compulsive disorder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Altemus, M.; Murphy, D.L.; Greenberg, B.

1996-07-26

Epidemiologic studies indicate that obsessive-compulsive disorder is genetically transmitted in some families, although no genetic abnormalities have been identified in individuals with this disorder. The selective response of obsessive-compulsive disorder to treatment with agents which block serotonin reuptake suggests the gene coding for the serotonin transporter as a candidate gene. The primary structure of the serotonin-transporter coding region was sequenced in 22 patients with obsessive-compulsive disorder, using direct PCR sequencing of cDNA synthesized from platelet serotonin-transporter mRNA. No variations in amino acid sequence were found among the obsessive-compulsive disorder patients or healthy controls. These results do not support a rolemore » for alteration in the primary structure of the coding region of the serotonin-transporter gene in the pathogenesis of obsessive-compulsive disorder. 27 refs.« less

Novel coding, translation, and gene expression of a replicating covalently closed circular RNA of 220 nt.

PubMed

AbouHaidar, Mounir Georges; Venkataraman, Srividhya; Golshani, Ashkan; Liu, Bolin; Ahmad, Tauqeer

2014-10-07

The highly structured (64% GC) covalently closed circular (CCC) RNA (220 nt) of the virusoid associated with rice yellow mottle virus codes for a 16-kDa highly basic protein using novel modalities for coding, translation, and gene expression. This CCC RNA is the smallest among all known viroids and virusoids and the only one that codes proteins. Its sequence possesses an internal ribosome entry site and is directly translated through two (or three) completely overlapping ORFs (shifting to a new reading frame at the end of each round). The initiation and termination codons overlap UGAUGA (underline highlights the initiation codon AUG within the combined initiation-termination sequence). Termination codons can be ignored to obtain larger read-through proteins. This circular RNA with no noncoding sequences is a unique natural supercompact "nanogenome."

A PRESTO-SENSE sequence with alternating partial-Fourier encoding for rapid susceptibility-weighted 3D MRI time series.

PubMed

Klarhöfer, Markus; Dilharreguy, Bixente; van Gelderen, Peter; Moonen, Chrit T W

2003-10-01

A 3D sequence for dynamic susceptibility imaging is proposed which combines echo-shifting principles (such as PRESTO), sensitivity encoding (SENSE), and partial-Fourier acquisition. The method uses a moderate SENSE factor of 2 and takes advantage of an alternating partial k-space acquisition in the "slow" phase encode direction allowing an iterative reconstruction using high-resolution phase estimates. Offering an isotropic spatial resolution of 4 x 4 x 4 mm(3), the novel sequence covers the whole brain including parts of the cerebellum in 0.5 sec. Its temporal signal stability is comparable to that of a full-Fourier, full-FOV EPI sequence having the same dynamic scan time but much less brain coverage. Initial functional MRI experiments showed consistent activation in the motor cortex with an average signal change slightly less than that of EPI. Copyright 2003 Wiley-Liss, Inc.

Gene and genon concept: coding versus regulation

PubMed Central

2007-01-01

We analyse here the definition of the gene in order to distinguish, on the basis of modern insight in molecular biology, what the gene is coding for, namely a specific polypeptide, and how its expression is realized and controlled. Before the coding role of the DNA was discovered, a gene was identified with a specific phenotypic trait, from Mendel through Morgan up to Benzer. Subsequently, however, molecular biologists ventured to define a gene at the level of the DNA sequence in terms of coding. As is becoming ever more evident, the relations between information stored at DNA level and functional products are very intricate, and the regulatory aspects are as important and essential as the information coding for products. This approach led, thus, to a conceptual hybrid that confused coding, regulation and functional aspects. In this essay, we develop a definition of the gene that once again starts from the functional aspect. A cellular function can be represented by a polypeptide or an RNA. In the case of the polypeptide, its biochemical identity is determined by the mRNA prior to translation, and that is where we locate the gene. The steps from specific, but possibly separated sequence fragments at DNA level to that final mRNA then can be analysed in terms of regulation. For that purpose, we coin the new term “genon”. In that manner, we can clearly separate product and regulative information while keeping the fundamental relation between coding and function without the need to introduce a conceptual hybrid. In mRNA, the program regulating the expression of a gene is superimposed onto and added to the coding sequence in cis - we call it the genon. The complementary external control of a given mRNA by trans-acting factors is incorporated in its transgenon. A consequence of this definition is that, in eukaryotes, the gene is, in most cases, not yet present at DNA level. Rather, it is assembled by RNA processing, including differential splicing, from various pieces, as steered by the genon. It emerges finally as an uninterrupted nucleic acid sequence at mRNA level just prior to translation, in faithful correspondence with the amino acid sequence to be produced as a polypeptide. After translation, the genon has fulfilled its role and expires. The distinction between the protein coding information as materialised in the final polypeptide and the processing information represented by the genon allows us to set up a new information theoretic scheme. The standard sequence information determined by the genetic code expresses the relation between coding sequence and product. Backward analysis asks from which coding region in the DNA a given polypeptide originates. The (more interesting) forward analysis asks in how many polypeptides of how many different types a given DNA segment is expressed. This concerns the control of the expression process for which we have introduced the genon concept. Thus, the information theoretic analysis can capture the complementary aspects of coding and regulation, of gene and genon. PMID:18087760

The Use and Effectiveness of Triple Multiplex System for Coding Region Single Nucleotide Polymorphism in Mitochondrial DNA Typing of Archaeologically Obtained Human Skeletons from Premodern Joseon Tombs of Korea

PubMed Central

Oh, Chang Seok; Lee, Soong Deok; Kim, Yi-Suk; Shin, Dong Hoon

2015-01-01

Previous study showed that East Asian mtDNA haplogroups, especially those of Koreans, could be successfully assigned by the coupled use of analyses on coding region SNP markers and control region mutation motifs. In this study, we tried to see if the same triple multiplex analysis for coding regions SNPs could be also applicable to ancient samples from East Asia as the complementation for sequence analysis of mtDNA control region. By the study on Joseon skeleton samples, we know that mtDNA haplogroup determined by coding region SNP markers successfully falls within the same haplogroup that sequence analysis on control region can assign. Considering that ancient samples in previous studies make no small number of errors in control region mtDNA sequencing, coding region SNP analysis can be used as good complimentary to the conventional haplogroup determination, especially of archaeological human bone samples buried underground over long periods. PMID:26345190

Flexible and polarization-controllable diffusion metasurface with optical transparency

NASA Astrophysics Data System (ADS)

Zhuang, Yaqiang; Wang, Guangming; Liang, Jiangang; Cai, Tong; Guo, Wenlong; Zhang, Qingfeng

2017-11-01

In this paper, a novel coding metasurface is proposed to realize polarization-controllable diffusion scattering. The anisotropic Jerusalem-cross unit cell is employed as the basic coding element due to its polarization-dependent phase response. The isotropic random coding sequence is firstly designed to obtain diffusion scattering, and the anisotropic random coding sequence is subsequently realized by adding different periodic coding sequences to the original isotropic one along different directions. For demonstration, we designed and fabricated a flexible polarization-controllable diffusion metasurface (PCDM) with both chessboard diffusion and hedge diffusion under different polarizations. The specular scattering reduction performance of the anisotropic metasurface is better than the isotropic one because the scattered energies are redirected away from the specular reflection direction. For potential applications, the flexible PCDM wrapped around a cylinder structure is investigated and tested for polarization-controllable diffusion scattering. The numerical and experimental results coincide well, indicating anisotropic low scatterings with comparable performances. This paper provides an alternative approach for designing high-performance, flexible, low-scattering platforms.

Imported dengue virus serotype 1 from Madeira to Finland 2012.

PubMed

Huhtamo, E; Korhonen, Em; Vapalahti, O

2013-02-21

Imported dengue cases originating from the Madeiran outbreak are increasingly reported. In 2012 five Finnish travellers returning from Madeira were diagnosed with dengue fever. Viral sequence data was obtained from two patients. The partial C-preM sequences (399 and 396 bp respectively) were found similar to that of an autochthonous case from Madeira. The partial E-gene sequence (933 bp) which was identical among the two patients grouped phylogenetically with South American strains of dengue virus serotype 1.

Unprecedented genomic diversity of AhR1 and AhR2 genes in Atlantic salmon (Salmo salar L.).

PubMed

Hansson, Maria C; Wittzell, Håkan; Persson, Kerstin; von Schantz, Torbjörn

2004-06-24

Aryl hydrocarbon receptor (AhR) genes encode proteins involved in mediating the toxic responses induced by several environmental pollutants. Here, we describe the identification of the first two AhR1 (alpha and beta) genes and two additional AhR2 (alpha and beta) genes in the tetraploid species Atlantic salmon (Salmo salar L.) from a cosmid library screening. Cosmid clones containing genomic salmon AhR sequences were isolated using a cDNA clone containing the coding region of the Atlantic salmon AhR2gamma as a probe. Screening revealed 14 positive clones, from which four were chosen for further analyses. One of the cosmids contained genomic AhR sequences that were highly similar to the rainbow trout (Oncorhynchus mykiss) AhR2alpha and beta genes. SMART RACE amplified two complete, highly similar but not identical AhR type 2 sequences from salmon cDNA, which from phylogenetic analyses were determined as the rainbow trout AhR2alpha and beta orthologs. The salmon AhR2alpha and beta encode proteins of 1071 and 1058 residues, respectively, and encompass characteristic AhR sequence elements like a basic-helix-loop-helix (bHLH) and two PER-ARNT-SIM (PAS) domains. Both genes are transcribed in liver, spleen and muscle tissues of adult salmon. A second cosmid contained partial sequences, which were identical to the previously characterized AhR2gamma gene. The last two cosmids contained partial genomic AhR sequences, which were more similar to other AhR type 1 fish genes than the four characterized salmon AhR2 genes. However, attempts to amplify the corresponding complete cDNA sequences of the inserts proved very difficult, suggesting that these genes are non-functional or very weakly transcribed in the examined tissues. Phylogenetic analyses of the conserved regions did, however, clearly indicate that these two AhRs belong to the AhR type 1 clade and have been assigned as the Atlantic salmon AhR1alpha and AhR1beta genes. Taken together, these findings demonstrate that multiple AhR genes are present in Atlantic salmon genome, which likely is a consequence of previous genome duplications in the evolutionary past of salmonids. Plausible explanations for the high incidence of AhR genes in fish and more specifically in salmonids, like rapid divergences in specialized functions, are discussed.

A generalized architecture of quantum secure direct communication for N disjointed users with authentication

NASA Astrophysics Data System (ADS)

Farouk, Ahmed; Zakaria, Magdy; Megahed, Adel; Omara, Fatma A.

2015-11-01

In this paper, we generalize a secured direct communication process between N users with partial and full cooperation of quantum server. So, N - 1 disjointed users u1, u2, …, uN-1 can transmit a secret message of classical bits to a remote user uN by utilizing the property of dense coding and Pauli unitary transformations. The authentication process between the quantum server and the users are validated by EPR entangled pair and CNOT gate. Afterwards, the remained EPR will generate shared GHZ states which are used for directly transmitting the secret message. The partial cooperation process indicates that N - 1 users can transmit a secret message directly to a remote user uN through a quantum channel. Furthermore, N - 1 users and a remote user uN can communicate without an established quantum channel among them by a full cooperation process. The security analysis of authentication and communication processes against many types of attacks proved that the attacker cannot gain any information during intercepting either authentication or communication processes. Hence, the security of transmitted message among N users is ensured as the attacker introduces an error probability irrespective of the sequence of measurement.

A generalized architecture of quantum secure direct communication for N disjointed users with authentication.

PubMed

Farouk, Ahmed; Zakaria, Magdy; Megahed, Adel; Omara, Fatma A

2015-11-18

In this paper, we generalize a secured direct communication process between N users with partial and full cooperation of quantum server. So, N - 1 disjointed users u1, u2, …, uN-1 can transmit a secret message of classical bits to a remote user uN by utilizing the property of dense coding and Pauli unitary transformations. The authentication process between the quantum server and the users are validated by EPR entangled pair and CNOT gate. Afterwards, the remained EPR will generate shared GHZ states which are used for directly transmitting the secret message. The partial cooperation process indicates that N - 1 users can transmit a secret message directly to a remote user uN through a quantum channel. Furthermore, N - 1 users and a remote user uN can communicate without an established quantum channel among them by a full cooperation process. The security analysis of authentication and communication processes against many types of attacks proved that the attacker cannot gain any information during intercepting either authentication or communication processes. Hence, the security of transmitted message among N users is ensured as the attacker introduces an error probability irrespective of the sequence of measurement.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ion, A.; Telvi, L.; Galacteros, F.

We describe a pedigree presenting X-linked severe mental retardation associated with multiple congenital abnormalities and 46,XY gonadal dysgenesis, leading in one family member to female gender assignment. Female carriers are unaffected. The dysmorphic features are similar to those described in the {alpha}-thalassemia and mental retardation (ATR-X) syndrome, although there is no clinical evidence of {alpha}-thalassemia in this family. In addition, the family had other clinical features not previously observed in the ATR-X syndrome, including partial optic-nerve atrophy and partial ocular albinism. Mutations in a putative DNA helicase, termed XH2, have been reported to give rise to the ATR-X syndrome. Wemore » screened the YCH2 gene for mutations in affected members of the family and identified a 4-bp deletion at an intron/exon boundary that removes an invariant 3{prime} splice-acceptor site. The mutation cosegregates with the syndrome. The genomic deletion causes missplicing of the pre-mRNA, which results in the loss of 8 bp of coding sequence, thereby generating a frameshift and a downstream premature stop codon. Our finding increases the range of clinical features associated with mutations in the XH2 gene. 17 refs., 4 figs., 2 tabs.« less

Genome of turbot rhabdovirus exhibits unusual non-coding regions and an additional ORF that could be expressed in fish cell.

PubMed

Zhu, Ruo-Lin; Lei, Xiao-Ying; Ke, Fei; Yuan, Xiu-Ping; Zhang, Qi-Ya

2011-02-01

Genomic sequence of Scophthalmus maximus rhabdovirus (SMRV) isolated from diseased turbot has been characterized. The complete genome of SMRV comprises 11,492 nucleotides and encodes five typical rhabdovirus genes N, P, M, G and L. In addition, two open reading frames (ORF) are predicted overlapping with P gene, one upstream of P and smaller than P (temporarily called Ps), and another in P gene which may encodes a protein similar to the vesicular stomatitis virus C protein. The C ORF is contained within the P ORF. The five typical proteins share the highest sequence identities (48.9%) with the corresponding proteins of rhabdoviruses in genus Vesiculovirus. Phylogenetic analysis of partial L protein sequence indicates that SMRV is close to genus Vesiculovirus. The first 13 nucleotides at the ends of the SMRV genome are absolutely inverse complementarity. The gene junctions between the five genes show conserved polyadenylation signal (CATGA(7)) and intergenic dinucleotide (CT) followed by putative transcription initiation sequence A(A/G)(C/G)A(A/G/T), which are different from known rhabdoviruses. The entire Ps ORF was cloned and expressed, and used to generate polyclonal antibody in mice. One obvious band could be detected in SMRV-infected carp leucocyte cells (CLCs) by anti-Ps/C serum via Western blot, and the subcellular localization of Ps-GFP fusion protein exhibited cytoplasm distribution as multiple punctuate or doughnut shaped foci of uneven size. Copyright © 2010 Elsevier B.V. All rights reserved.

Comparative Genomics Reveals Chd1 as a Determinant of Nucleosome Spacing in Vivo.

PubMed

Hughes, Amanda L; Rando, Oliver J

2015-07-14

Packaging of genomic DNA into nucleosomes is nearly universally conserved in eukaryotes, and many features of the nucleosome landscape are quite conserved. Nonetheless, quantitative aspects of nucleosome packaging differ between species because, for example, the average length of linker DNA between nucleosomes can differ significantly even between closely related species. We recently showed that the difference in nucleosome spacing between two Hemiascomycete species-Saccharomyces cerevisiae and Kluyveromyces lactis-is established by trans-acting factors rather than being encoded in cis in the DNA sequence. Here, we generated several S. cerevisiae strains in which endogenous copies of candidate nucleosome spacing factors are deleted and replaced with the orthologous factors from K. lactis. We find no change in nucleosome spacing in such strains in which H1 or Isw1 complexes are swapped. In contrast, the K. lactis gene encoding the ATP-dependent remodeler Chd1 was found to direct longer internucleosomal spacing in S. cerevisiae, establishing that this remodeler is partially responsible for the relatively long internucleosomal spacing observed in K. lactis. By analyzing several chimeric proteins, we find that sequence differences that contribute to the spacing activity of this remodeler are dispersed throughout the coding sequence, but that the strongest spacing effect is linked to the understudied N-terminal end of Chd1. Taken together, our data find a role for sequence evolution of a chromatin remodeler in establishing quantitative aspects of the chromatin landscape in a species-specific manner. Copyright © 2015 Hughes and Rando.

Adler hantavirus, a new genetic variant of Tula virus identified in Major's pine voles (Microtus majori) sampled in southern European Russia.

PubMed

Tkachenko, Evgeniy A; Witkowski, Peter T; Radosa, Lukas; Dzagurova, Tamara K; Okulova, Nataliya M; Yunicheva, Yulia V; Vasilenko, Ludmila; Morozov, Vyacheslav G; Malkin, Gennadiy A; Krüger, Detlev H; Klempa, Boris

2015-01-01

Although at least 30 novel hantaviruses have been recently discovered in novel hosts such as shrews, moles and even bats, hantaviruses (family Bunyaviridae, genus Hantavirus) are primarily known as rodent-borne human pathogens. Here we report on identification of a novel hantavirus variant associated with a rodent host, Major's pine vole (Microtus majori). Altogether 36 hantavirus PCR-positive Major's pine voles were identified in the Krasnodar region of southern European Russia within the years 2008-2011. Initial partial L-segment sequence analysis revealed novel hantavirus sequences. Moreover, we found a single common vole (Microtusarvalis) infected with Tula virus (TULV). Complete S- and M-segment coding sequences were determined from 11 Major's pine voles originating from 8 trapping sites and subjected to phylogenetic analyses. The data obtained show that Major's pine vole is a newly recognized hantavirus reservoir host. The newfound virus, provisionally called Adler hantavirus (ADLV), is closely related to TULV. Based on amino acid differences to TULV (5.6-8.2% for nucleocapsid protein, 9.4-9.5% for glycoprotein precursor) we propose to consider ADLV as a genotype of TULV. Occurrence of ADLV and TULV in the same region suggests that ADLV is not only a geographical variant of TULV but a host-specific genotype. High intra-cluster nucleotide sequence variability (up to 18%) and geographic clustering indicate long-term presence of the virus in this region. Copyright © 2014. Published by Elsevier B.V.

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

Genome-wide comparisons of phylogenetic similarities between partial genomic regions and the full-length genome in Hepatitis E virus genotyping.

PubMed

Wang, Shuai; Wei, Wei; Luo, Xuenong; Cai, Xuepeng

2014-01-01

Besides the complete genome, different partial genomic sequences of Hepatitis E virus (HEV) have been used in genotyping studies, making it difficult to compare the results based on them. No commonly agreed partial region for HEV genotyping has been determined. In this study, we used a statistical method to evaluate the phylogenetic performance of each partial genomic sequence from a genome wide, by comparisons of evolutionary distances between genomic regions and the full-length genomes of 101 HEV isolates to identify short genomic regions that can reproduce HEV genotype assignments based on full-length genomes. Several genomic regions, especially one genomic region at the 3'-terminal of the papain-like cysteine protease domain, were detected to have relatively high phylogenetic correlations with the full-length genome. Phylogenetic analyses confirmed the identical performances between these regions and the full-length genome in genotyping, in which the HEV isolates involved could be divided into reasonable genotypes. This analysis may be of value in developing a partial sequence-based consensus classification of HEV species.

Coding visual features extracted from video sequences.

PubMed

Baroffio, Luca; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

2014-05-01

Visual features are successfully exploited in several applications (e.g., visual search, object recognition and tracking, etc.) due to their ability to efficiently represent image content. Several visual analysis tasks require features to be transmitted over a bandwidth-limited network, thus calling for coding techniques to reduce the required bit budget, while attaining a target level of efficiency. In this paper, we propose, for the first time, a coding architecture designed for local features (e.g., SIFT, SURF) extracted from video sequences. To achieve high coding efficiency, we exploit both spatial and temporal redundancy by means of intraframe and interframe coding modes. In addition, we propose a coding mode decision based on rate-distortion optimization. The proposed coding scheme can be conveniently adopted to implement the analyze-then-compress (ATC) paradigm in the context of visual sensor networks. That is, sets of visual features are extracted from video frames, encoded at remote nodes, and finally transmitted to a central controller that performs visual analysis. This is in contrast to the traditional compress-then-analyze (CTA) paradigm, in which video sequences acquired at a node are compressed and then sent to a central unit for further processing. In this paper, we compare these coding paradigms using metrics that are routinely adopted to evaluate the suitability of visual features in the context of content-based retrieval, object recognition, and tracking. Experimental results demonstrate that, thanks to the significant coding gains achieved by the proposed coding scheme, ATC outperforms CTA with respect to all evaluation metrics.

Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

PubMed

Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

2010-02-01

Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer

PubMed Central

Wojcik, Sylwia E.; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S.; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z.; Rai, Kanti R.; Kipps, Thomas J.; Keating, Michael J.

2010-01-01

Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas. PMID:19926640

Molecular characterization of rotavirus isolated from alpaca (Vicugna pacos) crias with diarrhea in the Andean Region of Cusco, Peru.

PubMed

Garmendia, Antonio E; Lopez, Wellington; Ortega, Nastassja; Chamorro, Marycris J

2015-10-22

Alpacas (Vicugna pacos), a species of South American camelids (SAC), suffer high morbidity and mortality from infectious diseases. Diarrhea is one of the leading causes of alpaca cria mortality in Peru and elsewhere. In order to develop appropriate control and/or treatment, it is necessary to identify infectious pathogens that cause diarrhea in crias. Rotavirus was isolated in cell culture from feces collected from crias with acute diarrhea that tested positive to rotaviral antigen by rapid immunochromatographic methods in an earlier study. The isolates were identified as rotaviruses by RT-PCR run with specific primers for human rotavirus VP7 coding sequences using total RNA extracted from cells displaying cytopathic effects as template. These alpaca isolates were further identified as group A rotaviruses by means of a VP6-specific PCR and were designated as ALRVA-K'ayra/Perú/3368-10 and ALRVA-K'ayra/Perú/3386-10. Molecular G and P typing, placed the former as G3/P11 and the latter as G3/P?. Sequence analysis of two genome segments (coding for VP4 and VP7) from the alpaca isolates revealed partial homologies to swine and human rotaviruses, respectively. These results demonstrate that rotaviruses are associated with a proportion of cases of diarrhea in crias, although prevalence and impact remain to be determined. The isolation of rotaviruses from alpaca crias with diarrhea will contribute positively to further understand the pathogen and its role in the diarrhea complex. Copyright © 2015 Elsevier B.V. All rights reserved.

A symmetry model for genetic coding via a wallpaper group composed of the traditional four bases and an imaginary base E: Towards category theory-like systematization of molecular/genetic biology

PubMed Central

2014-01-01

Background Previously, we suggested prototypal models that describe some clinical states based on group postulates. Here, we demonstrate a group/category theory-like model for molecular/genetic biology as an alternative application of our previous model. Specifically, we focus on deoxyribonucleic acid (DNA) base sequences. Results We construct a wallpaper pattern based on a five-letter cruciform motif with letters C, A, T, G, and E. Whereas the first four letters represent the standard DNA bases, the fifth is introduced for ease in formulating group operations that reproduce insertions and deletions of DNA base sequences. A basic group Z5 = {r, u, d, l, n} of operations is defined for the wallpaper pattern, with which a sequence of points can be generated corresponding to changes of a base in a DNA sequence by following the orbit of a point of the pattern under operations in group Z5. Other manipulations of DNA sequence can be treated using a vector-like notation ‘Dj’ corresponding to a DNA sequence but based on the five-letter base set; also, ‘Dj’s are expressed graphically. Insertions and deletions of a series of letters ‘E’ are admitted to assist in describing DNA recombination. Likewise, a vector-like notation Rj can be constructed for sequences of ribonucleic acid (RNA). The wallpaper group B = {Z5×∞, ●} (an ∞-fold Cartesian product of Z5) acts on Dj (or Rj) yielding changes to Dj (or Rj) denoted by ‘Dj◦B(j→k) = Dk’ (or ‘Rj◦B(j→k) = Rk’). Based on the operations of this group, two types of groups—a modulo 5 linear group and a rotational group over the Gaussian plane, acting on the five bases—are linked as parts of the wallpaper group for broader applications. As a result, changes, insertions/deletions and DNA (RNA) recombination (partial/total conversion) are described. As an exploratory study, a notation for the canonical “central dogma” via a category theory-like way is presented for future developments. Conclusions Despite the large incompleteness of our methodology, there is fertile ground to consider a symmetry model for genetic coding based on our specific wallpaper group. A more integrated formulation containing “central dogma” for future molecular/genetic biology remains to be explored. PMID:24885369

COMPUTER SIMULATION STUDY OF AMYLOID FIBRIL FORMATION BY PALINDROMIC SEQUENCES IN PRION PEPTIDES

PubMed Central

Wagoner, Victoria; Cheon, Mookyung; Chang, Iksoo; Hall, Carol

2011-01-01

We simulate the aggregation of large systems containing palindromic peptides from the Syrian hamster prion protein SHaPrP 113–120 (AGAAAAGA) and the mouse prion protein MoPrP 111–120 (VAGAAAAGAV) and eight sequence variations: GAAAAAAG, (AG)4, A8, GAAAGAAA, A10, V10, GAVAAAAVAG, and VAVAAAAVAV The first two peptides are thought to act as the Velcro that holds the parent prion proteins together in amyloid structures and can form fibrils themselves. Kinetic events along the fibrillization pathway influence the types of structures that occur and variations in the sequence affect aggregation kinetics and fibrillar structure. Discontinuous molecular dynamics simulations using the PRIME20 force field are performed on systems containing 48 peptides starting from a random coil configuration. Depending on the sequence, fibrillar structures form spontaneously over a range of temperatures, below which amorphous aggregates form and above which no aggregation occurs. AGAAAAGA forms well organized fibrillar structures whereas VAGAAAAGAV forms less well organized structures that are partially fibrillar and partially amorphous. The degree of order in the fibrillar structure stems in part from the types of kinetic events leading up to its formation, with AGAAAAGA forming less amorphous structures early in the simulation than VAGAAAAGAV. The ability to form fibrils increases as the chain length and the length of the stretch of hydrophobic residues increase. However as the hydrophobicity of the sequence increases, the ability to form well-ordered structures decreases. Thus, longer hydrophobic sequences form slightly disordered aggregates that are partially fibrillar and partially amorphous. Subtle changes in sequence result in slightly different fibril structures. PMID:21557317

Blastocystis phylogeny among various isolates from humans to insects.

PubMed

Yoshikawa, Hisao; Koyama, Yukiko; Tsuchiya, Erika; Takami, Kazutoshi

2016-12-01

Blastocystis is a common unicellular eukaryotic parasite found not only in humans, but also in various kinds of animal species worldwide. Since Blastocystis isolates are morphologically indistinguishable, many molecular biological approaches have been applied to classify these isolates. The complete or partial sequences of the small subunit rRNA gene (SSU rDNA) are mainly used for comparisons and phylogenetic analyses among Blastocystis isolates. However, various lengths of the partial SSU rDNA sequence have been used for phylogenetic inference among genetically different isolates. Based on the complete SSU rDNA sequences, consensus terminology of nine subtypes (STs) of Blastocystis sp. that were supported by phylogenetically monophyletic nine clades was proposed in 2007. Thereafter, eight additional kinds of STs comprising non-human mammalian Blastocystis isolates have been reported based on the phylogeny of SSU rDNA sequences, while STs 11 and 12 were only proposed on the base of partial sequences. Although many sequence data from mammalian and avian Blastocystis are registered in GenBank, only limited data on SSU rDNA are available for poikilotherm-derived Blastocystis isolates. Therefore, the phylogenetic positions of the reptilian/amphibian Blastocystis clades are unstable. The phylogenetic inference of various STs comprising mammalian and/or avian Blastocystis isolates was verified herein based on comparisons between partial and complete SSU rDNA sequences, and the phylogenetic positions of reptilian and amphibian Blastocystis isolates were also investigated using 14 new Blastocystis isolates from reptiles with all known isolates from other reptilians, amphibians, and insects registered in GenBank. Copyright © 2016. Published by Elsevier Ireland Ltd.

A new user-assisted segmentation and tracking technique for an object-based video editing system

NASA Astrophysics Data System (ADS)

Yu, Hong Y.; Hong, Sung-Hoon; Lee, Mike M.; Choi, Jae-Gark

2004-03-01

This paper presents a semi-automatic segmentation method which can be used to generate video object plane (VOP) for object based coding scheme and multimedia authoring environment. Semi-automatic segmentation can be considered as a user-assisted segmentation technique. A user can initially mark objects of interest around the object boundaries and then the user-guided and selected objects are continuously separated from the unselected areas through time evolution in the image sequences. The proposed segmentation method consists of two processing steps: partially manual intra-frame segmentation and fully automatic inter-frame segmentation. The intra-frame segmentation incorporates user-assistance to define the meaningful complete visual object of interest to be segmentation and decides precise object boundary. The inter-frame segmentation involves boundary and region tracking to obtain temporal coherence of moving object based on the object boundary information of previous frame. The proposed method shows stable efficient results that could be suitable for many digital video applications such as multimedia contents authoring, content based coding and indexing. Based on these results, we have developed objects based video editing system with several convenient editing functions.

Probability of coding of a DNA sequence: an algorithm to predict translated reading frames from their thermodynamic characteristics.

PubMed Central

Tramontano, A; Macchiato, M F

1986-01-01

An algorithm to determine the probability that a reading frame codifies for a protein is presented. It is based on the results of our previous studies on the thermodynamic characteristics of a translated reading frame. We also develop a prediction procedure to distinguish between coding and non-coding reading frames. The procedure is based on the characteristics of the putative product of the DNA sequence and not on periodicity characteristics of the sequence, so the prediction is not biased by the presence of overlapping translated reading frames or by the presence of translated reading frames on the complementary DNA strand. PMID:3753761

The Use of Coding Methods to Estimate the Social Behavior Directed toward Peers and Adults of Preschoolers with ASD in TEACCH, LEAP, and Eclectic ''BAU'' Classrooms

ERIC Educational Resources Information Center

Sam, Ann; Reszka, Stephanie; Odom, Samuel; Hume, Kara; Boyd, Brian

2015-01-01

Momentary time sampling, partial-interval recording, and event coding are observational coding methods commonly used to examine the social and challenging behaviors of children at risk for or with developmental delays or disabilities. Yet there is limited research comparing the accuracy of and relationship between these three coding methods. By…

Finite-SNR analysis for partial relaying cooperation with channel coding and opportunistic relay selection

NASA Astrophysics Data System (ADS)

Vu, Thang X.; Duhamel, Pierre; Chatzinotas, Symeon; Ottersten, Bjorn

2017-12-01

This work studies the performance of a cooperative network which consists of two channel-coded sources, multiple relays, and one destination. To achieve high spectral efficiency, we assume that a single time slot is dedicated to relaying. Conventional network-coded-based cooperation (NCC) selects the best relay which uses network coding to serve the two sources simultaneously. The bit error rate (BER) performance of NCC with channel coding, however, is still unknown. In this paper, we firstly study the BER of NCC via a closed-form expression and analytically show that NCC only achieves diversity of order two regardless of the number of available relays and the channel code. Secondly, we propose a novel partial relaying-based cooperation (PARC) scheme to improve the system diversity in the finite signal-to-noise ratio (SNR) regime. In particular, closed-form expressions for the system BER and diversity order of PARC are derived as a function of the operating SNR value and the minimum distance of the channel code. We analytically show that the proposed PARC achieves full (instantaneous) diversity order in the finite SNR regime, given that an appropriate channel code is used. Finally, numerical results verify our analysis and demonstrate a large SNR gain of PARC over NCC in the SNR region of interest.

A COMPARISON OF EXPERIMENTS AND THREE-DIMENSIONAL ANALYSIS TECHNIQUES. PART I. UNPOISONED UNIFORM SLAB CORE WITH A PARTIALLY INSERTED HAFNIUM ROD

DOE Office of Scientific and Technical Information (OSTI.GOV)

Renzi, N.E.; Roseberry, R.J.

>The experimental measurements and nuclear analysis of a uniformly loaded, unpoisoned slab core with a partially insented hafnium rod are described. Comparisons of experimental data with calculated results of the UFO code and flux synthesis techniques are given. It was concluded that one of the flux synthesis techniques and the UFO code are able to predict flux distributions to within approximately 5% of experiment for most cases. An error of approximately 10% was found in the synthesis technique for a channel near the partially inserted rod. The various calculations were able to predict neutron pulsed shutdowns to only approximately 30%.more » (auth)« less

mPUMA: a computational approach to microbiota analysis by de novo assembly of operational taxonomic units based on protein-coding barcode sequences.

PubMed

Links, Matthew G; Chaban, Bonnie; Hemmingsen, Sean M; Muirhead, Kevin; Hill, Janet E

2013-08-15

Formation of operational taxonomic units (OTU) is a common approach to data aggregation in microbial ecology studies based on amplification and sequencing of individual gene targets. The de novo assembly of OTU sequences has been recently demonstrated as an alternative to widely used clustering methods, providing robust information from experimental data alone, without any reliance on an external reference database. Here we introduce mPUMA (microbial Profiling Using Metagenomic Assembly, http://mpuma.sourceforge.net), a software package for identification and analysis of protein-coding barcode sequence data. It was developed originally for Cpn60 universal target sequences (also known as GroEL or Hsp60). Using an unattended process that is independent of external reference sequences, mPUMA forms OTUs by DNA sequence assembly and is capable of tracking OTU abundance. mPUMA processes microbial profiles both in terms of the direct DNA sequence as well as in the translated amino acid sequence for protein coding barcodes. By forming OTUs and calculating abundance through an assembly approach, mPUMA is capable of generating inputs for several popular microbiota analysis tools. Using SFF data from sequencing of a synthetic community of Cpn60 sequences derived from the human vaginal microbiome, we demonstrate that mPUMA can faithfully reconstruct all expected OTU sequences and produce compositional profiles consistent with actual community structure. mPUMA enables analysis of microbial communities while empowering the discovery of novel organisms through OTU assembly.

Evaluation of full S1 gene sequencing of classical and variant infectious bronchitis viruses extracted from allantoic fluid and FTA cards.

PubMed

Manswr, Basim; Ball, Christopher; Forrester, Anne; Chantrey, Julian; Ganapathy, Kannan

2018-08-01

Sequence variability in the S1 gene determines the genotype of infectious bronchitis virus (IBV) strains. A single RT-PCR assay was developed to amplify and sequence the full S1 gene for six classical and variant IBVs (M41, D274, 793B, IS/885/00, IS/1494/06 and Q1) enriched in allantoic fluid (AF) or the same AF inoculated onto Flinders Technology Association (FTA) cards. Representative strains from each genotype were grown in specific-pathogen-free eggs and RNA was extracted from AF. Full S1 gene amplification was achieved using primer A and primer 22.51. Products were sequenced using primers A, 1050+, 1380+ and SX3+ to obtain short sequences covering the full gene. Following serial dilutions of AF, detection limits of the partial assay were higher than those of the full S1 gene. Partial S1 sequences exhibited higher-than-average nucleotide similarity percentages (79%; 352 bp) compared to full S1 sequences (77%; 1756 bp), suggesting that full S1 analysis allows greater strain differentiation. For IBV detection from AF-inoculated FTA cards, four serotypes were incubated for up to 21 days at three temperatures, 4°C, room temperature (approximately 24°C) and 40°C. RNA was extracted and tested with partial and full S1 protocols. Through partial sequencing, all IBVs were successfully detected at all sampling points and storage temperatures. In contrast, using full S1 sequencing it was not possible to amplify the gene beyond 14 days or when stored at 40°C. Data presented show that for full S1 sequencing, a substantial amount of RNA is needed. Field samples collected onto FTA cards are unlikely to yield such quantity or quality. AF: allantoic fluid; CD50: ciliostatic dose 50; FTA: Flinders Technology Association; IB: infectious bronchitis; IBV: infectious bronchitis virus.

Recurrence time statistics: versatile tools for genomic DNA sequence analysis.

PubMed

Cao, Yinhe; Tung, Wen-Wen; Gao, J B

2004-01-01

With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

A candidate gene for choanal atresia in alpaca.

PubMed

Reed, Kent M; Bauer, Miranda M; Mendoza, Kristelle M; Armién, Aníbal G

2010-03-01

Choanal atresia (CA) is a common nasal craniofacial malformation in New World domestic camelids (alpaca and llama). CA results from abnormal development of the nasal passages and is especially debilitating to newborn crias. CA in camelids shares many of the clinical manifestations of a similar condition in humans (CHARGE syndrome). Herein we report on the regulatory gene CHD7 of alpaca, whose homologue in humans is most frequently associated with CHARGE. Sequence of the CHD7 coding region was obtained from a non-affected cria. The complete coding region was 9003 bp, corresponding to a translated amino acid sequence of 3000 aa. Additional genomic sequences corresponding to a significant portion of the CHD7 gene were identified and assembled from the 2x alpaca whole genome sequence, providing confirmatory sequence for much of the CHD7 coding region. The alpaca CHD7 mRNA sequence was 97.9% similar to the human sequence, with the greatest sequence difference being an insertion in exon 38 that results in a polyalanine repeat (A12). Polymorphism in this repeat was tested for association with CA in alpaca by cloning and sequencing the repeat from both affected and non-affected individuals. Variation in length of the poly-A repeat was not associated with CA. Complete sequencing of the CHD7 gene will be necessary to determine whether other mutations in CHD7 are the cause of CA in camelids.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ureba, A.; Salguero, F. J.; Barbeiro, A. R.

Purpose: The authors present a hybrid direct multileaf collimator (MLC) aperture optimization model exclusively based on sequencing of patient imaging data to be implemented on a Monte Carlo treatment planning system (MC-TPS) to allow the explicit radiation transport simulation of advanced radiotherapy treatments with optimal results in efficient times for clinical practice. Methods: The planning system (called CARMEN) is a full MC-TPS, controlled through aMATLAB interface, which is based on the sequencing of a novel map, called “biophysical” map, which is generated from enhanced image data of patients to achieve a set of segments actually deliverable. In order to reducemore » the required computation time, the conventional fluence map has been replaced by the biophysical map which is sequenced to provide direct apertures that will later be weighted by means of an optimization algorithm based on linear programming. A ray-casting algorithm throughout the patient CT assembles information about the found structures, the mass thickness crossed, as well as PET values. Data are recorded to generate a biophysical map for each gantry angle. These maps are the input files for a home-made sequencer developed to take into account the interactions of photons and electrons with the MLC. For each linac (Axesse of Elekta and Primus of Siemens) and energy beam studied (6, 9, 12, 15 MeV and 6 MV), phase space files were simulated with the EGSnrc/BEAMnrc code. The dose calculation in patient was carried out with the BEAMDOSE code. This code is a modified version of EGSnrc/DOSXYZnrc able to calculate the beamlet dose in order to combine them with different weights during the optimization process. Results: Three complex radiotherapy treatments were selected to check the reliability of CARMEN in situations where the MC calculation can offer an added value: A head-and-neck case (Case I) with three targets delineated on PET/CT images and a demanding dose-escalation; a partial breast irradiation case (Case II) solved with photon and electron modulated beams (IMRT + MERT); and a prostatic bed case (Case III) with a pronounced concave-shaped PTV by using volumetric modulated arc therapy. In the three cases, the required target prescription doses and constraints on organs at risk were fulfilled in a short enough time to allow routine clinical implementation. The quality assurance protocol followed to check CARMEN system showed a high agreement with the experimental measurements. Conclusions: A Monte Carlo treatment planning model exclusively based on maps performed from patient imaging data has been presented. The sequencing of these maps allows obtaining deliverable apertures which are weighted for modulation under a linear programming formulation. The model is able to solve complex radiotherapy treatments with high accuracy in an efficient computation time.« less

Different evolutionary patterns of SNPs between domains and unassigned regions in human protein-coding sequences.

PubMed

Pang, Erli; Wu, Xiaomei; Lin, Kui

2016-06-01

Protein evolution plays an important role in the evolution of each genome. Because of their functional nature, in general, most of their parts or sites are differently constrained selectively, particularly by purifying selection. Most previous studies on protein evolution considered individual proteins in their entirety or compared protein-coding sequences with non-coding sequences. Less attention has been paid to the evolution of different parts within each protein of a given genome. To this end, based on PfamA annotation of all human proteins, each protein sequence can be split into two parts: domains or unassigned regions. Using this rationale, single nucleotide polymorphisms (SNPs) in protein-coding sequences from the 1000 Genomes Project were mapped according to two classifications: SNPs occurring within protein domains and those within unassigned regions. With these classifications, we found: the density of synonymous SNPs within domains is significantly greater than that of synonymous SNPs within unassigned regions; however, the density of non-synonymous SNPs shows the opposite pattern. We also found there are signatures of purifying selection on both the domain and unassigned regions. Furthermore, the selective strength on domains is significantly greater than that on unassigned regions. In addition, among all of the human protein sequences, there are 117 PfamA domains in which no SNPs are found. Our results highlight an important aspect of protein domains and may contribute to our understanding of protein evolution.

Translational resistivity/conductivity of coding sequences during exponential growth of Escherichia coli.

PubMed

Takai, Kazuyuki

2017-01-21

Codon adaptation index (CAI) has been widely used for prediction of expression of recombinant genes in Escherichia coli and other organisms. However, CAI has no mechanistic basis that rationalizes its application to estimation of translational efficiency. Here, I propose a model based on which we could consider how codon usage is related to the level of expression during exponential growth of bacteria. In this model, translation of a gene is considered as an analog of electric current, and an analog of electric resistance corresponding to each gene is considered. "Translational resistance" is dependent on the steady-state concentration and the sequence of the mRNA species, and "translational resistivity" is dependent only on the mRNA sequence. The latter is the sum of two parts: one is the resistivity for the elongation reaction (coding sequence resistivity), and the other comes from all of the other steps of the decoding reaction. This electric circuit model clearly shows that some conditions should be met for codon composition of a coding sequence to correlate well with its expression level. On the other hand, I calculated relative frequency of each of the 61 sense codon triplets translated during exponential growth of E. coli from a proteomic dataset covering over 2600 proteins. A tentative method for estimating relative coding sequence resistivity based on the data is presented. Copyright © 2016. Published by Elsevier Ltd.

Origins of Genes: "Big Bang" or Continuous Creation?

NASA Astrophysics Data System (ADS)

Kesse, Paul K.; Gibbs, Adrian

1992-10-01

Many protein families are common to all cellular organisms, indicating that many genes have ancient origins. Genetic variation is mostly attributed to processes such as mutation, duplication, and rearrangement of ancient modules. Thus it is widely assumed that much of present-day genetic diversity can be traced by common ancestry to a molecular "big bang." A rarely considered alternative is that proteins may arise continuously de novo. One mechanism of generating different coding sequences is by "overprinting," in which an existing nucleotide sequence is translated de novo in a different reading frame or from noncoding open reading frames. The clearest evidence for overprinting is provided when the original gene function is retained, as in overlapping genes. Analysis of their phylogenies indicates which are the original genes and which are their informationally novel partners. We report here the phylogenetic relationships of overlapping coding sequences from steroid-related receptor genes and from tymovirus, luteovirus, and lentivirus genomes. For each pair of overlapping coding sequences, one is confined to a single lineage, whereas the other is more widespread. This suggests that the phylogenetically restricted coding sequence arose only in the progenitor of that lineage by translating an out-of-frame sequence to yield the new polypeptide. The production of novel exons by alternative splicing in thyroid receptor and lentivirus genes suggests that introns can be a valuable evolutionary source for overprinting. New genes and their products may drive major evolutionary changes.

Protein structure and the sequential structure of mRNA: alpha-helix and beta-sheet signals at the nucleotide level.

PubMed

Brunak, S; Engelbrecht, J

1996-06-01

A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed. We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting protein. The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain. A complete search for GenBank nucleotide sequences coding for structural entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment. By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets. These signals do not originate from the clustering of rare codons, but from the similarity of codons coding for very abundant amino acid residues at the N- and C-termini of helices and sheets. No correlation between the positioning of rare codons and the location of structural units was found. The mRNA signals were also compared with conserved nucleotide features of 16S-like ribosomal RNA sequences and related to mechanisms for maintaining the correct reading frame by the ribosome.

Evolution and Diversity of the Human Hepatitis D Virus Genome

PubMed Central

Huang, Chi-Ruei; Lo, Szecheng J.

2010-01-01

Human hepatitis delta virus (HDV) is the smallest RNA virus in genome. HDV genome is divided into a viroid-like sequence and a protein-coding sequence which could have originated from different resources and the HDV genome was eventually constituted through RNA recombination. The genome subsequently diversified through accumulation of mutations selected by interactions between the mutated RNA and proteins with host factors to successfully form the infectious virions. Therefore, we propose that the conservation of HDV nucleotide sequence is highly related with its functionality. Genome analysis of known HDV isolates shows that the C-terminal coding sequences of large delta antigen (LDAg) are the highest diversity than other regions of protein-coding sequences but they still retain biological functionality to interact with the heavy chain of clathrin can be selected and maintained. Since viruses interact with many host factors, including escaping the host immune response, how to design a program to predict RNA genome evolution is a great challenging work. PMID:20204073

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Random digital encryption secure communication system

NASA Technical Reports Server (NTRS)

Doland, G. D. (Inventor)

1982-01-01

The design of a secure communication system is described. A product code, formed from two pseudorandom sequences of digital bits, is used to encipher or scramble data prior to transmission. The two pseudorandom sequences are periodically changed at intervals before they have had time to repeat. One of the two sequences is transmitted continuously with the scrambled data for synchronization. In the receiver portion of the system, the incoming signal is compared with one of two locally generated pseudorandom sequences until correspondence between the sequences is obtained. At this time, the two locally generated sequences are formed into a product code which deciphers the data from the incoming signal. Provision is made to ensure synchronization of the transmitting and receiving portions of the system.

Expressed gene sequence of the IFN-gamma-response chemokine CXCL9 of cattle, horses, and swine

USDA-ARS?s Scientific Manuscript database

This report describes the cloning and characterization of expressed gene sequences of bovine, equine, and swine CXCL9 from RNA obtained from peripheral blood mononuclear cell (PBMC) or other tissues. The bovine coding region was 378 nucleotides in length, while the equine and swine coding regions w...

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

PubMed

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-12-31

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

PubMed Central

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-01-01

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215

Some New Sets of Sequences of Fuzzy Numbers with Respect to the Partial Metric

PubMed Central

Ozluk, Muharrem

2015-01-01

In this paper, we essentially deal with Köthe-Toeplitz duals of fuzzy level sets defined using a partial metric. Since the utilization of Zadeh's extension principle is quite difficult in practice, we prefer the idea of level sets in order to construct some classical notions. In this paper, we present the sets of bounded, convergent, and null series and the set of sequences of bounded variation of fuzzy level sets, based on the partial metric. We examine the relationships between these sets and their classical forms and give some properties including definitions, propositions, and various kinds of partial metric spaces of fuzzy level sets. Furthermore, we study some of their properties like completeness and duality. Finally, we obtain the Köthe-Toeplitz duals of fuzzy level sets with respect to the partial metric based on a partial ordering. PMID:25695102

ISSYS: An integrated synergistic Synthesis System

NASA Technical Reports Server (NTRS)

Dovi, A. R.

1980-01-01

Integrated Synergistic Synthesis System (ISSYS), an integrated system of computer codes in which the sequence of program execution and data flow is controlled by the user, is discussed. The commands available to exert such control, the ISSYS major function and rules, and the computer codes currently available in the system are described. Computational sequences frequently used in the aircraft structural analysis and synthesis are defined. External computer codes utilized by the ISSYS system are documented. A bibliography on the programs is included.

Operations analysis (study 2.1). Program listing for the LOVES computer code

NASA Technical Reports Server (NTRS)

Wray, S. T., Jr.

1974-01-01

A listing of the LOVES computer program is presented. The program is coded partially in SIMSCRIPT and FORTRAN. This version of LOVES is compatible with both the CDC 7600 and the UNIVAC 1108 computers. The code has been compiled, loaded, and executed successfully on the EXEC 8 system for the UNIVAC 1108.

Annotation of a hybrid partial genome of the coffee rust (Hemileia vastatrix) contributes to the gene repertoire catalog of the Pucciniales

PubMed Central

Cristancho, Marco A.; Botero-Rozo, David Octavio; Giraldo, William; Tabima, Javier; Riaño-Pachón, Diego Mauricio; Escobar, Carolina; Rozo, Yomara; Rivera, Luis F.; Durán, Andrés; Restrepo, Silvia; Eilam, Tamar; Anikster, Yehoshua; Gaitán, Alvaro L.

2014-01-01

Coffee leaf rust caused by the fungus Hemileia vastatrix is the most damaging disease to coffee worldwide. The pathogen has recently appeared in multiple outbreaks in coffee producing countries resulting in significant yield losses and increases in costs related to its control. New races/isolates are constantly emerging as evidenced by the presence of the fungus in plants that were previously resistant. Genomic studies are opening new avenues for the study of the evolution of pathogens, the detailed description of plant-pathogen interactions and the development of molecular techniques for the identification of individual isolates. For this purpose we sequenced 8 different H. vastatrix isolates using NGS technologies and gathered partial genome assemblies due to the large repetitive content in the coffee rust hybrid genome; 74.4% of the assembled contigs harbor repetitive sequences. A hybrid assembly of 333 Mb was built based on the 8 isolates; this assembly was used for subsequent analyses. Analysis of the conserved gene space showed that the hybrid H. vastatrix genome, though highly fragmented, had a satisfactory level of completion with 91.94% of core protein-coding orthologous genes present. RNA-Seq from urediniospores was used to guide the de novo annotation of the H. vastatrix gene complement. In total, 14,445 genes organized in 3921 families were uncovered; a considerable proportion of the predicted proteins (73.8%) were homologous to other Pucciniales species genomes. Several gene families related to the fungal lifestyle were identified, particularly 483 predicted secreted proteins that represent candidate effector genes and will provide interesting hints to decipher virulence in the coffee rust fungus. The genome sequence of Hva will serve as a template to understand the molecular mechanisms used by this fungus to attack the coffee plant, to study the diversity of this species and for the development of molecular markers to distinguish races/isolates. PMID:25400655

Characterization and Expression of the Lucina pectinata Oxygen and Sulfide Binding Hemoglobin Genes

PubMed Central

López-Garriga, Juan; Cadilla, Carmen L.

2016-01-01

The clam Lucina pectinata lives in sulfide-rich muds and houses intracellular symbiotic bacteria that need to be supplied with hydrogen sulfide and oxygen. This clam possesses three hemoglobins: hemoglobin I (HbI), a sulfide-reactive protein, and hemoglobin II (HbII) and III (HbIII), which are oxygen-reactive. We characterized the complete gene sequence and promoter regions for the oxygen reactive hemoglobins and the partial structure and promoters of the HbI gene from Lucina pectinata. We show that HbI has two mRNA variants, where the 5’end had either a sequence of 96 bp (long variant) or 37 bp (short variant). The gene structure of the oxygen reactive Hbs is defined by having 4-exons/3-introns with conservation of intron location at B12.2 and G7.0 and the presence of pre-coding introns, while the partial gene structure of HbI has the same intron conservation but appears to have a 5-exon/ 4-intron structure. A search for putative transcription factor binding sites (TFBSs) was done with the promoters for HbII, HbIII, HbI short and HbI long. The HbII, HbIII and HbI long promoters showed similar predicted TFBSs. We also characterized MITE-like elements in the HbI and HbII gene promoters and intronic regions that are similar to sequences found in other mollusk genomes. The gene expression levels of the clam Hbs, from sulfide-rich and sulfide-poor environments showed a significant decrease of expression in the symbiont-containing tissue for those clams in a sulfide-poor environment, suggesting that the sulfide concentration may be involved in the regulation of these proteins. Gene expression evaluation of the two HbI mRNA variants indicated that the longer variant is expressed at higher levels than the shorter variant in both environments. PMID:26824233

Connection anonymity analysis in coded-WDM PONs

NASA Astrophysics Data System (ADS)

Sue, Chuan-Ching

2008-04-01

A coded wavelength division multiplexing passive optical network (WDM PON) is presented for fiber to the home (FTTH) systems to protect against eavesdropping. The proposed scheme applies spectral amplitude coding (SAC) with a unipolar maximal-length sequence (M-sequence) code matrix to generate a specific signature address (coding) and to retrieve its matching address codeword (decoding) by exploiting the cyclic properties inherent in array waveguide grating (AWG) routers. In addition to ensuring the confidentiality of user data, the proposed coded-WDM scheme is also a suitable candidate for the physical layer with connection anonymity. Under the assumption that the eavesdropper applies a photo-detection strategy, it is shown that the coded WDM PON outperforms the conventional TDM PON and WDM PON schemes in terms of a higher degree of connection anonymity. Additionally, the proposed scheme allows the system operator to partition the optical network units (ONUs) into appropriate groups so as to achieve a better degree of anonymity.

Novel coding, translation, and gene expression of a replicating covalently closed circular RNA of 220 nt

PubMed Central

AbouHaidar, Mounir Georges; Venkataraman, Srividhya; Golshani, Ashkan; Liu, Bolin; Ahmad, Tauqeer

2014-01-01

The highly structured (64% GC) covalently closed circular (CCC) RNA (220 nt) of the virusoid associated with rice yellow mottle virus codes for a 16-kDa highly basic protein using novel modalities for coding, translation, and gene expression. This CCC RNA is the smallest among all known viroids and virusoids and the only one that codes proteins. Its sequence possesses an internal ribosome entry site and is directly translated through two (or three) completely overlapping ORFs (shifting to a new reading frame at the end of each round). The initiation and termination codons overlap UGAUGA (underline highlights the initiation codon AUG within the combined initiation-termination sequence). Termination codons can be ignored to obtain larger read-through proteins. This circular RNA with no noncoding sequences is a unique natural supercompact “nanogenome.” PMID:25253891

Trellises and Trellis-Based Decoding Algorithms for Linear Block Codes. Part 3; The Map and Related Decoding Algirithms

NASA Technical Reports Server (NTRS)

Lin, Shu; Fossorier, Marc

1998-01-01

In a coded communication system with equiprobable signaling, MLD minimizes the word error probability and delivers the most likely codeword associated with the corresponding received sequence. This decoding has two drawbacks. First, minimization of the word error probability is not equivalent to minimization of the bit error probability. Therefore, MLD becomes suboptimum with respect to the bit error probability. Second, MLD delivers a hard-decision estimate of the received sequence, so that information is lost between the input and output of the ML decoder. This information is important in coded schemes where the decoded sequence is further processed, such as concatenated coding schemes, multi-stage and iterative decoding schemes. In this chapter, we first present a decoding algorithm which both minimizes bit error probability, and provides the corresponding soft information at the output of the decoder. This algorithm is referred to as the MAP (maximum aposteriori probability) decoding algorithm.

Automatic vehicle location system

NASA Technical Reports Server (NTRS)

Hansen, G. R., Jr. (Inventor)

1973-01-01

An automatic vehicle detection system is disclosed, in which each vehicle whose location is to be detected carries active means which interact with passive elements at each location to be identified. The passive elements comprise a plurality of passive loops arranged in a sequence along the travel direction. Each of the loops is tuned to a chosen frequency so that the sequence of the frequencies defines the location code. As the vehicle traverses the sequence of the loops as it passes over each loop, signals only at the frequency of the loop being passed over are coupled from a vehicle transmitter to a vehicle receiver. The frequencies of the received signals in the receiver produce outputs which together represent a code of the traversed location. The code location is defined by a painted pattern which reflects light to a vehicle carried detector whose output is used to derive the code defined by the pattern.

Digital data for quick response (QR) codes of alkalophilic Bacillus pumilus to identify and to compare bacilli isolated from Lonar Crator Lake, India.

PubMed

Rekadwad, Bhagwan N; Khobragade, Chandrahasya N

2016-06-01

Microbiologists are routinely engaged isolation, identification and comparison of isolated bacteria for their novelty. 16S rRNA sequences of Bacillus pumilus were retrieved from NCBI repository and generated QR codes for sequences (FASTA format and full Gene Bank information). 16SrRNA were used to generate quick response (QR) codes of Bacillus pumilus isolated from Lonar Crator Lake (19° 58' N; 76° 31' E), India. Bacillus pumilus 16S rRNA gene sequences were used to generate CGR, FCGR and PCA. These can be used for visual comparison and evaluation respectively. The hyperlinked QR codes, CGR, FCGR and PCA of all the isolates are made available to the users on a portal https://sites.google.com/site/bhagwanrekadwad/. This generated digital data helps to evaluate and compare any Bacillus pumilus strain, minimizes laboratory efforts and avoid misinterpretation of the species.

Sequence differences in the diagnostic region of the cysteine protease 8 gene of Tritrichomonas foetus parasites of cats and cattle.

PubMed

Sun, Zichen; Stack, Colin; Šlapeta, Jan

2012-05-25

In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.

EUGENE'HOM: A generic similarity-based gene finder using multiple homologous sequences.

PubMed

Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas

2003-07-01

EUGENE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGENE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGENE'HOM to handle sequences from a variety of organisms. The current target of EUGENE'HOM is plant sequences. The EUGENE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl.

Synthetic oligonucleotide probes deduced from amino acid sequence data. Theoretical and practical considerations.

PubMed

Lathe, R

1985-05-05

Synthetic probes deduced from amino acid sequence data are widely used to detect cognate coding sequences in libraries of cloned DNA segments. The redundancy of the genetic code dictates that a choice must be made between (1) a mixture of probes reflecting all codon combinations, and (2) a single longer "optimal" probe. The second strategy is examined in detail. The frequency of sequences matching a given probe by chance alone can be determined and also the frequency of sequences closely resembling the probe and contributing to the hybridization background. Gene banks cannot be treated as random associations of the four nucleotides, and probe sequences deduced from amino acid sequence data occur more often than predicted by chance alone. Probe lengths must be increased to confer the necessary specificity. Examination of hybrids formed between unique homologous probes and their cognate targets reveals that short stretches of perfect homology occurring by chance make a significant contribution to the hybridization background. Statistical methods for improving homology are examined, taking human coding sequences as an example, and considerations of codon utilization and dinucleotide frequencies yield an overall homology of greater than 82%. Recommendations for probe design and hybridization are presented, and the choice between using multiple probes reflecting all codon possibilities and a unique optimal probe is discussed.

Tenebrio molitor antifreeze protein gene identification and regulation.

PubMed

Qin, Wensheng; Walker, Virginia K

2006-02-15

The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

What Information is Stored in DNA: Does it Contain Digital Error Correcting Codes?

NASA Astrophysics Data System (ADS)

Liebovitch, Larry

1998-03-01

The longest term correlations in living systems are the information stored in DNA which reflects the evolutionary history of an organism. The 4 bases (A,T,G,C) encode sequences of amino acids as well as locations of binding sites for proteins that regulate DNA. The fidelity of this important information is maintained by ANALOG error check mechanisms. When a single strand of DNA is replicated the complementary base is inserted in the new strand. Sometimes the wrong base is inserted that sticks out disrupting the phosphate backbone. The new base is not yet methylated, so repair enzymes, that slide along the DNA, can tear out the wrong base and replace it with the right one. The bases in DNA form a sequence of 4 different symbols and so the information is encoded in a DIGITAL form. All the digital codes in our society (ISBN book numbers, UPC product codes, bank account numbers, airline ticket numbers) use error checking code, where some digits are functions of other digits to maintain the fidelity of transmitted informaiton. Does DNA also utitlize a DIGITAL error chekcing code to maintain the fidelity of its information and increase the accuracy of replication? That is, are some bases in DNA functions of other bases upstream or downstream? This raises the interesting mathematical problem: How does one determine whether some symbols in a sequence of symbols are a function of other symbols. It also bears on the issue of determining algorithmic complexity: What is the function that generates the shortest algorithm for reproducing the symbol sequence. The error checking codes most used in our technology are linear block codes. We developed an efficient method to test for the presence of such codes in DNA. We coded the 4 bases as (0,1,2,3) and used Gaussian elimination, modified for modulus 4, to test if some bases are linear combinations of other bases. We used this method to analyze the base sequence in the genes from the lac operon and cytochrome C. We did not find evidence for such error correcting codes in these genes. However, we analyzed only a small amount of DNA and if digitial error correcting schemes are present in DNA, they may be more subtle than such simple linear block codes. The basic issue we raise here, is how information is stored in DNA and an appreciation that digital symbol sequences, such as DNA, admit of interesting schemes to store and protect the fidelity of their information content. Liebovitch, Tao, Todorov, Levine. 1996. Biophys. J. 71:1539-1544. Supported by NIH grant EY6234.

Evolutionary Dynamics of Microsatellite Distribution in Plants: Insight from the Comparison of Sequenced Brassica, Arabidopsis and Other Angiosperm Species

PubMed Central

Shi, Jiaqin; Huang, Shunmou; Fu, Donghui; Yu, Jinyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

2013-01-01

Despite their ubiquity and functional importance, microsatellites have been largely ignored in comparative genomics, mostly due to the lack of genomic information. In the current study, microsatellite distribution was characterized and compared in the whole genomes and both the coding and non-coding DNA sequences of the sequenced Brassica, Arabidopsis and other angiosperm species to investigate their evolutionary dynamics in plants. The variation in the microsatellite frequencies of these angiosperm species was much smaller than those for their microsatellite numbers and genome sizes, suggesting that microsatellite frequency may be relatively stable in plants. The microsatellite frequencies of these angiosperm species were significantly negatively correlated with both their genome sizes and transposable elements contents. The pattern of microsatellite distribution may differ according to the different genomic regions (such as coding and non-coding sequences). The observed differences in many important microsatellite characteristics (especially the distribution with respect to motif length, type and repeat number) of these angiosperm species were generally accordant with their phylogenetic distance, which suggested that the evolutionary dynamics of microsatellite distribution may be generally consistent with plant divergence/evolution. Importantly, by comparing these microsatellite characteristics (especially the distribution with respect to motif type) the angiosperm species (aside from a few species) all clustered into two obviously different groups that were largely represented by monocots and dicots, suggesting a complex and generally dichotomous evolutionary pattern of microsatellite distribution in angiosperms. Polyploidy may lead to a slight increase in microsatellite frequency in the coding sequences and a significant decrease in microsatellite frequency in the whole genome/non-coding sequences, but have little effect on the microsatellite distribution with respect to motif length, type and repeat number. Interestingly, several microsatellite characteristics seemed to be constant in plant evolution, which can be well explained by the general biological rules. PMID:23555856

Epidemiology of foot-and-mouth disease in Landhi Dairy Colony, Pakistan, the world largest Buffalo colony

PubMed Central

Klein, Joern; Hussain, Manzoor; Ahmad, Munir; Afzal, Muhammad; Alexandersen, Soren

2008-01-01

Background Foot-and-mouth disease (FMD) is endemic in Pakistan and causes huge economic losses. This work focus on the Landhi Dairy Colony (LDC), located in the suburbs of Karachi. LDC is the largest Buffalo colony in the world, with more than 300,000 animals (around 95% buffaloes and 5% cattle, as well as an unknown number of sheep and goats). Each month from April 2006 to April 2007 we collected mouth-swabs from apparently healthy buffaloes and cattle, applying a convenient sampling based on a two-stage random sampling scheme, in conjunction with participatory information from each selected farm. Furthermore, we also collected epithelium samples from animals with clinical disease, as well as mouth-swabs samples from those farms. In addition, we analysed a total of 180 serum samples randomly collecting 30 samples each month at the local slaughterhouse, from October 2006 to March 2007. Samples have been screened for FMDV by real-time RT-PCR and the partial or full 1D coding region of selected isolates has been sequenced. Serum samples have been analysed by applying serotype-specific antibody ELISA and non-structural proteins (NSP) antibody ELISA. Results FMDV infection prevalence at aggregate level shows an endemic occurrence of FMDV in the colony, with peaks in August 2006, December 2006 and February 2007 to March 2007. A significant association of prevalence peaks to the rainy seasons, which includes the coldest time of the year and the muslimic Eid-festival, has been demonstrated. Participatory information indicated that 88% of all questioned farmers vaccinate their animals. Analysis of the serum samples showed high levels of antibodies for serotypes O, A, Asia 1 and C. The median endpoint-titre for all tested serotypes, except serotype C, in VNT titration is at a serum dilution of equal or above 1/100. All 180 serum samples collected have been tested for antibodies against the non-structural proteins and all but four have been found positive. Out of the 106 swab-samples from apparently healthy and affected animals positive in real-time RT-PCR, we sequenced the partial or full 1D coding region from 58 samples. In addition we sequenced the full 1D coding region of 17 epithelium samples from animals with clinical signs of FMD. From all sequenced samples, swabs and epithelium, 19 belong to the regional PanAsia II lineage of serotype O and 56 to the A/Iran/2005 lineage of serotype A. Conclusion For an effective and realisable FMD control program in LDC, we suggest to introduce a twice annually mass vaccination of all buffaloes and cattle in the colony. These mass vaccinations should optimally take place shortly before the beginning of the two rainy periods, e.g. in June and September. Those vaccinations should, in our opinion, be in addition to the already individually performed vaccinations of single animals, as the latter usually targets only newly introduced animals. This suggested combination of mass vaccination of all large ruminants with the already performed individually vaccination should provide a continuous high level of herd immunity in the entire colony. Vaccines used for this purpose should contain the matching vaccine strains, i.e. as our results indicate antigens for A/Iran/2005 and the regional type of serotype O (PanAsia II), but also antigens of the, in this world region endemic, Asia 1 lineage should be included. In the long term it will be important to control the vaccine use, so that subclinical FMD will be avoided. PMID:18445264

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mebarki, F.; Forest, M.G.; Josso, N.

The androgen insensivity syndrome (AIS) is a recessive X-linked disorder resulting from a deficient function of the androgen receptor (AR). The human AR gene has 3 functional domains: N-terminal encoded by exon 1, DNA-binding domain encoded by exons 2 and 3, and androgen-binding domain encoded by exons 4 to 8. In order to characterize the molecular defects of the AR gene in AIS, the entire coding regions and the intronic bording sequences of the AR gene were amplified by PCR before automatic direct sequencing in 45 patients. Twenty seven different point mutations were found in 32 unrelated AIS patients: 18more » with a complete form (CAIS), 14 with a partial form (PAIS); 18 of these mutations are novel mutations, not published to date. Only 3 mutations were repeatedly found: R804H in 3 families; M780I in 3 families and R774C in 2 families. For 26 patients out of the 32 found to have a mutation, maternal DNA was collected and sequenced: 6 de novo mutations were detected (i.e. 23% of the cases). Finally, no mutation was detected in 13 patients (29%): 7 with CAIS and 6 familial severe PAIS. The latter all presented with perineal hypospadias, micropenis, 4 out of 6 being raised as girl. Diagnosis of AIS in these 13 families in whom no mutation was detected is supported by the following criteria: clinical data, familial history (2 or 3 index cases in the same family), familial segregation of the polymorphic CAG repeat of the AR gene. Mutations in intronic regions or the promoter of the AR gene could not explain all cases of AIS without mutations in the AR coding regions, because AR binding (performed in 9 out of 13) was normal in 6, suggesting the synthesis of an AR protein. This situation led us to speculate that another X-linked factor associated with the AR could be implicated in some cases of AIS.« less

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE PAGES

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; ...

2015-05-12

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less

NullSeq: A Tool for Generating Random Coding Sequences with Desired Amino Acid and GC Contents.

PubMed

Liu, Sophia S; Hockenberry, Adam J; Lancichinetti, Andrea; Jewett, Michael C; Amaral, Luís A N

2016-11-01

The existence of over- and under-represented sequence motifs in genomes provides evidence of selective evolutionary pressures on biological mechanisms such as transcription, translation, ligand-substrate binding, and host immunity. In order to accurately identify motifs and other genome-scale patterns of interest, it is essential to be able to generate accurate null models that are appropriate for the sequences under study. While many tools have been developed to create random nucleotide sequences, protein coding sequences are subject to a unique set of constraints that complicates the process of generating appropriate null models. There are currently no tools available that allow users to create random coding sequences with specified amino acid composition and GC content for the purpose of hypothesis testing. Using the principle of maximum entropy, we developed a method that generates unbiased random sequences with pre-specified amino acid and GC content, which we have developed into a python package. Our method is the simplest way to obtain maximally unbiased random sequences that are subject to GC usage and primary amino acid sequence constraints. Furthermore, this approach can easily be expanded to create unbiased random sequences that incorporate more complicated constraints such as individual nucleotide usage or even di-nucleotide frequencies. The ability to generate correctly specified null models will allow researchers to accurately identify sequence motifs which will lead to a better understanding of biological processes as well as more effective engineering of biological systems.

RNAcentral: A comprehensive database of non-coding RNA sequences

DOE PAGES

Williams, Kelly Porter; Lau, Britney Yan

2016-10-28

RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

RNAcentral: A comprehensive database of non-coding RNA sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, Kelly Porter; Lau, Britney Yan

RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

A specific indel marker for the Philippines Schistosoma japonicum revealed by analysis of mitochondrial genome sequences.

PubMed

Li, Juan; Chen, Fen; Sugiyama, Hiromu; Blair, David; Lin, Rui-Qing; Zhu, Xing-Quan

2015-07-01

In the present study, near-complete mitochondrial (mt) genome sequences for Schistosoma japonicum from different regions in the Philippines and Japan were amplified and sequenced. Comparisons among S. japonicum from the Philippines, Japan, and China revealed a geographically based length difference in mt genomes, but the mt genomic organization and gene arrangement were the same. Sequence differences among samples from the Philippines and all samples from the three endemic areas were 0.57-2.12 and 0.76-3.85 %, respectively. The most variable part of the mt genome was the non-coding region. In the coding portion of the genome, protein-coding genes varied more than rRNA genes and tRNAs. The near-complete mt genome sequences for Philippine specimens were identical in length (14,091 bp) which was 4 bp longer than those of S. japonicum samples from Japan and China. This indel provides a unique genetic marker for S. japonicum samples from the Philippines. Phylogenetic analyses based on the concatenated amino acids of 12 protein-coding genes showed that samples of S. japonicum clustered according to their geographical origins. The identified mitochondrial indel marker will be useful for tracing the source of S. japonicum infection in humans and animals in Southeast Asia.

Integrative structural annotation of de novo RNA-Seq provides an accurate reference gene set of the enormous genome of the onion (Allium cepa L.)

PubMed Central

Kim, Seungill; Kim, Myung-Shin; Kim, Yong-Min; Yeom, Seon-In; Cheong, Kyeongchae; Kim, Ki-Tae; Jeon, Jongbum; Kim, Sunggil; Kim, Do-Sun; Sohn, Seong-Han; Lee, Yong-Hwan; Choi, Doil

2015-01-01

The onion (Allium cepa L.) is one of the most widely cultivated and consumed vegetable crops in the world. Although a considerable amount of onion transcriptome data has been deposited into public databases, the sequences of the protein-coding genes are not accurate enough to be used, owing to non-coding sequences intermixed with the coding sequences. We generated a high-quality, annotated onion transcriptome from de novo sequence assembly and intensive structural annotation using the integrated structural gene annotation pipeline (ISGAP), which identified 54,165 protein-coding genes among 165,179 assembled transcripts totalling 203.0 Mb by eliminating the intron sequences. ISGAP performed reliable annotation, recognizing accurate gene structures based on reference proteins, and ab initio gene models of the assembled transcripts. Integrative functional annotation and gene-based SNP analysis revealed a whole biological repertoire of genes and transcriptomic variation in the onion. The method developed in this study provides a powerful tool for the construction of reference gene sets for organisms based solely on de novo transcriptome data. Furthermore, the reference genes and their variation described here for the onion represent essential tools for molecular breeding and gene cloning in Allium spp. PMID:25362073

Code-modulated visual evoked potentials using fast stimulus presentation and spatiotemporal beamformer decoding.

PubMed

Wittevrongel, Benjamin; Van Wolputte, Elia; Van Hulle, Marc M

2017-11-08

When encoding visual targets using various lagged versions of a pseudorandom binary sequence of luminance changes, the EEG signal recorded over the viewer's occipital pole exhibits so-called code-modulated visual evoked potentials (cVEPs), the phase lags of which can be tied to these targets. The cVEP paradigm has enjoyed interest in the brain-computer interfacing (BCI) community for the reported high information transfer rates (ITR, in bits/min). In this study, we introduce a novel decoding algorithm based on spatiotemporal beamforming, and show that this algorithm is able to accurately identify the gazed target. Especially for a small number of repetitions of the coding sequence, our beamforming approach significantly outperforms an optimised support vector machine (SVM)-based classifier, which is considered state-of-the-art in cVEP-based BCI. In addition to the traditional 60 Hz stimulus presentation rate for the coding sequence, we also explore the 120 Hz rate, and show that the latter enables faster communication, with a maximal median ITR of 172.87 bits/min. Finally, we also report on a transition effect in the EEG signal following the onset of the stimulus sequence, and recommend to exclude the first 150 ms of the trials from decoding when relying on a single presentation of the stimulus sequence.

Exome sequencing and arrayCGH detection of gene sequence and copy number variation between ILS and ISS mouse strains.

PubMed

Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M

2014-06-01

It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to contribute to the alcohol-related phenotypic differences associated with these strains.

Identification of Putative Nuclear Receptors and Steroidogenic Enzymes in Murray-Darling Rainbowfish (Melanotaenia fluviatilis) Using RNA-Seq and De Novo Transcriptome Assembly.

PubMed

Bain, Peter A; Papanicolaou, Alexie; Kumar, Anupama

2015-01-01

Murray-Darling rainbowfish (Melanotaenia fluviatilis [Castelnau, 1878]; Atheriniformes: Melanotaeniidae) is a small-bodied teleost currently under development in Australasia as a test species for aquatic toxicological studies. To date, efforts towards the development of molecular biomarkers of contaminant exposure have been hindered by the lack of available sequence data. To address this, we sequenced messenger RNA from brain, liver and gonads of mature male and female fish and generated a high-quality draft transcriptome using a de novo assembly approach. 149,742 clusters of putative transcripts were obtained, encompassing 43,841 non-redundant protein-coding regions. Deduced amino acid sequences were annotated by functional inference based on similarity with sequences from manually curated protein sequence databases. The draft assembly contained protein-coding regions homologous to 95.7% of the complete cohort of predicted proteins from the taxonomically related species, Oryzias latipes (Japanese medaka). The mean length of rainbowfish protein-coding sequences relative to their medaka homologues was 92.1%, indicating that despite the limited number of tissues sampled a large proportion of the total expected number of protein-coding genes was captured in the study. Because of our interest in the effects of environmental contaminants on endocrine pathways, we manually curated subsets of coding regions for putative nuclear receptors and steroidogenic enzymes in the rainbowfish transcriptome, revealing 61 candidate nuclear receptors encompassing all known subfamilies, and 41 putative steroidogenic enzymes representing all major steroidogenic enzymes occurring in teleosts. The transcriptome presented here will be a valuable resource for researchers interested in biomarker development, protein structure and function, and contaminant-response genomics in Murray-Darling rainbowfish.

Applications of statistical physics and information theory to the analysis of DNA sequences

NASA Astrophysics Data System (ADS)

Grosse, Ivo

2000-10-01

DNA carries the genetic information of most living organisms, and the of genome projects is to uncover that genetic information. One basic task in the analysis of DNA sequences is the recognition of protein coding genes. Powerful computer programs for gene recognition have been developed, but most of them are based on statistical patterns that vary from species to species. In this thesis I address the question if there exist universal statistical patterns that are different in coding and noncoding DNA of all living species, regardless of their phylogenetic origin. In search for such species-independent patterns I study the mutual information function of genomic DNA sequences, and find that it shows persistent period-three oscillations. To understand the biological origin of the observed period-three oscillations, I compare the mutual information function of genomic DNA sequences to the mutual information function of stochastic model sequences. I find that the pseudo-exon model is able to reproduce the mutual information function of genomic DNA sequences. Moreover, I find that a generalization of the pseudo-exon model can connect the existence and the functional form of long-range correlations to the presence and the length distributions of coding and noncoding regions. Based on these theoretical studies I am able to find an information-theoretical quantity, the average mutual information (AMI), whose probability distributions are significantly different in coding and noncoding DNA, while they are almost identical in all studied species. These findings show that there exist universal statistical patterns that are different in coding and noncoding DNA of all studied species, and they suggest that the AMI may be used to identify genes in different living species, irrespective of their taxonomic origin.

Shared prefetching to reduce execution skew in multi-threaded systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eichenberger, Alexandre E; Gunnels, John A

Mechanisms are provided for optimizing code to perform prefetching of data into a shared memory of a computing device that is shared by a plurality of threads that execute on the computing device. A memory stream of a portion of code that is shared by the plurality of threads is identified. A set of prefetch instructions is distributed across the plurality of threads. Prefetch instructions are inserted into the instruction sequences of the plurality of threads such that each instruction sequence has a separate sub-portion of the set of prefetch instructions, thereby generating optimized code. Executable code is generated basedmore » on the optimized code and stored in a storage device. The executable code, when executed, performs the prefetches associated with the distributed set of prefetch instructions in a shared manner across the plurality of threads.« less

The evolution of transcriptional regulation in eukaryotes

NASA Technical Reports Server (NTRS)

Wray, Gregory A.; Hahn, Matthew W.; Abouheif, Ehab; Balhoff, James P.; Pizer, Margaret; Rockman, Matthew V.; Romano, Laura A.

2003-01-01

Gene expression is central to the genotype-phenotype relationship in all organisms, and it is an important component of the genetic basis for evolutionary change in diverse aspects of phenotype. However, the evolution of transcriptional regulation remains understudied and poorly understood. Here we review the evolutionary dynamics of promoter, or cis-regulatory, sequences and the evolutionary mechanisms that shape them. Existing evidence indicates that populations harbor extensive genetic variation in promoter sequences, that a substantial fraction of this variation has consequences for both biochemical and organismal phenotype, and that some of this functional variation is sorted by selection. As with protein-coding sequences, rates and patterns of promoter sequence evolution differ considerably among loci and among clades for reasons that are not well understood. Studying the evolution of transcriptional regulation poses empirical and conceptual challenges beyond those typically encountered in analyses of coding sequence evolution: promoter organization is much less regular than that of coding sequences, and sequences required for the transcription of each locus reside at multiple other loci in the genome. Because of the strong context-dependence of transcriptional regulation, sequence inspection alone provides limited information about promoter function. Understanding the functional consequences of sequence differences among promoters generally requires biochemical and in vivo functional assays. Despite these challenges, important insights have already been gained into the evolution of transcriptional regulation, and the pace of discovery is accelerating.

Bellerophon: A program to detect chimeric sequences in multiple sequence alignments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2003-12-23

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.

Convolutional encoding of self-dual codes

NASA Technical Reports Server (NTRS)

Solomon, G.

1994-01-01

There exist almost complete convolutional encodings of self-dual codes, i.e., block codes of rate 1/2 with weights w, w = 0 mod 4. The codes are of length 8m with the convolutional portion of length 8m-2 and the nonsystematic information of length 4m-1. The last two bits are parity checks on the two (4m-1) length parity sequences. The final information bit complements one of the extended parity sequences of length 4m. Solomon and van Tilborg have developed algorithms to generate these for the Quadratic Residue (QR) Codes of lengths 48 and beyond. For these codes and reasonable constraint lengths, there are sequential decodings for both hard and soft decisions. There are also possible Viterbi-type decodings that may be simple, as in a convolutional encoding/decoding of the extended Golay Code. In addition, the previously found constraint length K = 9 for the QR (48, 24;12) Code is lowered here to K = 8.

16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

PubMed

Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

2013-12-01

Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

Gene and translation initiation site prediction in metagenomic sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hyatt, Philip Douglas; LoCascio, Philip F; Hauser, Loren John

2012-01-01

Gene prediction in metagenomic sequences remains a difficult problem. Current sequencing technologies do not achieve sufficient coverage to assemble the individual genomes in a typical sample; consequently, sequencing runs produce a large number of short sequences whose exact origin is unknown. Since these sequences are usually smaller than the average length of a gene, algorithms must make predictions based on very little data. We present MetaProdigal, a metagenomic version of the gene prediction program Prodigal, that can identify genes in short, anonymous coding sequences with a high degree of accuracy. The novel value of the method consists of enhanced translationmore » initiation site identification, ability to identify sequences that use alternate genetic codes and confidence values for each gene call. We compare the results of MetaProdigal with other methods and conclude with a discussion of future improvements.« less

Genetic Characterization of a Panel of Diverse HIV-1 Isolates at Seven International Sites

PubMed Central

Chen, Yue; Sanchez, Ana M.; Sabino, Ester; Hunt, Gillian; Ledwaba, Johanna; Hackett, John; Swanson, Priscilla; Hewlett, Indira; Ragupathy, Viswanath; Vikram Vemula, Sai; Zeng, Peibin; Tee, Kok-Keng; Chow, Wei Zhen; Ji, Hezhao; Sandstrom, Paul; Denny, Thomas N.; Busch, Michael P.; Gao, Feng

2016-01-01

HIV-1 subtypes and drug resistance are routinely tested by many international surveillance groups. However, results from different sites often vary. A systematic comparison of results from multiple sites is needed to determine whether a standardized protocol is required for consistent and accurate data analysis. A panel of well-characterized HIV-1 isolates (N = 50) from the External Quality Assurance Program Oversight Laboratory (EQAPOL) was assembled for evaluation at seven international sites. This virus panel included seven subtypes, six circulating recombinant forms (CRFs), nine unique recombinant forms (URFs) and three group O viruses. Seven viruses contained 10 major drug resistance mutations (DRMs). HIV-1 isolates were prepared at a concentration of 107 copies/ml and compiled into blinded panels. Subtypes and DRMs were determined with partial or full pol gene sequences by conventional Sanger sequencing and/or Next Generation Sequencing (NGS). Subtype and DRM results were reported and decoded for comparison with full-length genome sequences generated by EQAPOL. The partial pol gene was amplified by RT-PCR and sequenced for 89.4%-100% of group M viruses at six sites. Subtyping results of majority of the viruses (83%-97.9%) were correctly determined for the partial pol sequences. All 10 major DRMs in seven isolates were detected at these six sites. The complete pol gene sequence was also obtained by NGS at one site. However, this method missed six group M viruses and sequences contained host chromosome fragments. Three group O viruses were only characterized with additional group O-specific RT-PCR primers employed by one site. These results indicate that PCR protocols and subtyping tools should be standardized to efficiently amplify diverse viruses and more consistently assign virus genotypes, which is critical for accurate global subtype and drug resistance surveillance. Targeted NGS analysis of partial pol sequences can serve as an alternative approach, especially for detection of low-abundance DRMs. PMID:27314585

Genetic Characterization of a Panel of Diverse HIV-1 Isolates at Seven International Sites.

PubMed

Hora, Bhavna; Keating, Sheila M; Chen, Yue; Sanchez, Ana M; Sabino, Ester; Hunt, Gillian; Ledwaba, Johanna; Hackett, John; Swanson, Priscilla; Hewlett, Indira; Ragupathy, Viswanath; Vikram Vemula, Sai; Zeng, Peibin; Tee, Kok-Keng; Chow, Wei Zhen; Ji, Hezhao; Sandstrom, Paul; Denny, Thomas N; Busch, Michael P; Gao, Feng

2016-01-01

HIV-1 subtypes and drug resistance are routinely tested by many international surveillance groups. However, results from different sites often vary. A systematic comparison of results from multiple sites is needed to determine whether a standardized protocol is required for consistent and accurate data analysis. A panel of well-characterized HIV-1 isolates (N = 50) from the External Quality Assurance Program Oversight Laboratory (EQAPOL) was assembled for evaluation at seven international sites. This virus panel included seven subtypes, six circulating recombinant forms (CRFs), nine unique recombinant forms (URFs) and three group O viruses. Seven viruses contained 10 major drug resistance mutations (DRMs). HIV-1 isolates were prepared at a concentration of 107 copies/ml and compiled into blinded panels. Subtypes and DRMs were determined with partial or full pol gene sequences by conventional Sanger sequencing and/or Next Generation Sequencing (NGS). Subtype and DRM results were reported and decoded for comparison with full-length genome sequences generated by EQAPOL. The partial pol gene was amplified by RT-PCR and sequenced for 89.4%-100% of group M viruses at six sites. Subtyping results of majority of the viruses (83%-97.9%) were correctly determined for the partial pol sequences. All 10 major DRMs in seven isolates were detected at these six sites. The complete pol gene sequence was also obtained by NGS at one site. However, this method missed six group M viruses and sequences contained host chromosome fragments. Three group O viruses were only characterized with additional group O-specific RT-PCR primers employed by one site. These results indicate that PCR protocols and subtyping tools should be standardized to efficiently amplify diverse viruses and more consistently assign virus genotypes, which is critical for accurate global subtype and drug resistance surveillance. Targeted NGS analysis of partial pol sequences can serve as an alternative approach, especially for detection of low-abundance DRMs.

78 FR 22529 - Notice of Intent To Grant Partially Exclusive Patent License; Max-Viz, Inc.

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-16

... Technology Applications, Space and Naval Warfare Systems Center Pacific, Code 72120, 53560 Hull St, Bldg A33... Technology Applications, Space and Naval Warfare Systems Center Pacific, Code 72120, 53560 Hull St, Bldg A33...

Discrete Ramanujan transform for distinguishing the protein coding regions from other regions.

PubMed

Hua, Wei; Wang, Jiasong; Zhao, Jian

2014-01-01

Based on the study of Ramanujan sum and Ramanujan coefficient, this paper suggests the concepts of discrete Ramanujan transform and spectrum. Using Voss numerical representation, one maps a symbolic DNA strand as a numerical DNA sequence, and deduces the discrete Ramanujan spectrum of the numerical DNA sequence. It is well known that of discrete Fourier power spectrum of protein coding sequence has an important feature of 3-base periodicity, which is widely used for DNA sequence analysis by the technique of discrete Fourier transform. It is performed by testing the signal-to-noise ratio at frequency N/3 as a criterion for the analysis, where N is the length of the sequence. The results presented in this paper show that the property of 3-base periodicity can be only identified as a prominent spike of the discrete Ramanujan spectrum at period 3 for the protein coding regions. The signal-to-noise ratio for discrete Ramanujan spectrum is defined for numerical measurement. Therefore, the discrete Ramanujan spectrum and the signal-to-noise ratio of a DNA sequence can be used for distinguishing the protein coding regions from the noncoding regions. All the exon and intron sequences in whole chromosomes 1, 2, 3 and 4 of Caenorhabditis elegans have been tested and the histograms and tables from the computational results illustrate the reliability of our method. In addition, we have analyzed theoretically and gotten the conclusion that the algorithm for calculating discrete Ramanujan spectrum owns the lower computational complexity and higher computational accuracy. The computational experiments show that the technique by using discrete Ramanujan spectrum for classifying different DNA sequences is a fast and effective method. Copyright © 2014 Elsevier Ltd. All rights reserved.

The Evolution of Bony Vertebrate Enhancers at Odds with Their Coding Sequence Landscape.

PubMed

Yousaf, Aisha; Sohail Raza, Muhammad; Ali Abbasi, Amir

2015-08-06

Enhancers lie at the heart of transcriptional and developmental gene regulation. Therefore, changes in enhancer sequences usually disrupt the target gene expression and result in disease phenotypes. Despite the well-established role of enhancers in development and disease, evolutionary sequence studies are lacking. The current study attempts to unravel the puzzle of bony vertebrates' conserved noncoding elements (CNE) enhancer evolution. Bayesian phylogenetics of enhancer sequences spotlights promising interordinal relationships among placental mammals, proposing a closer relationship between humans and laurasiatherians while placing rodents at the basal position. Clock-based estimates of enhancer evolution provided a dynamic picture of interspecific rate changes across the bony vertebrate lineage. Moreover, coelacanth in the study augmented our appreciation of the vertebrate cis-regulatory evolution during water-land transition. Intriguingly, we observed a pronounced upsurge in enhancer evolution in land-dwelling vertebrates. These novel findings triggered us to further investigate the evolutionary trend of coding as well as CNE nonenhancer repertoires, to highlight the relative evolutionary dynamics of diverse genomic landscapes. Surprisingly, the evolutionary rates of enhancer sequences were clearly at odds with those of the coding and the CNE nonenhancer sequences during vertebrate adaptation to land, with land vertebrates exhibiting significantly reduced rates of coding sequence evolution in comparison to their fast evolving regulatory landscape. The observed variation in tetrapod cis-regulatory elements caused the fine-tuning of associated gene regulatory networks. Therefore, the increased evolutionary rate of tetrapods' enhancer sequences might be responsible for the variation in developmental regulatory circuits during the process of vertebrate adaptation to land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

PHYLOGENETIC ANALYSIS OF THE GENOME OF AN ENTERITIS-ASSOCIATED BOTTLENOSE DOLPHIN MASTADENOVIRUS SUPPORTS A CLADE INFECTING THE CETARTIODACTYLA.

PubMed

Standorf, Kali; Cortés-Hinojosa, Galaxia; Venn-Watson, Stephanie; Rivera, Rebecca; Archer, Linda L; Wellehan, James F X

2018-01-01

:  Adenoviruses are nonenveloped, double-stranded DNA viruses, known to infect members of all tetrapod classes, with a similarity between phylogenies of hosts and viruses observed. We characterized bottlenose dolphin adenovirus 2 (BdAdV-2) found in a bottlenose dolphin ( Tursiops truncatus) with enteritis. Virions were seen by negative staining electron microscopy of feces. Initial sequences obtained using conserved PCR primers were expanded using primer walking techniques, and the complete coding sequence was obtained. Phylogenetic analyses were consistent with coevolution of this virus and its bottlenose dolphin host, placing BdAdV-2 into a monophyletic group with other mastadenoviruses of Cetartiodactyla. When considering the low guanine/cytosine (G/C) content of BdAdV-2 with the phylogenetic data, this virus may represent a host-jumping event from another member of Cetartiodactyla. Analysis of partial polymerase indicated that bottlenose dolphin adenovirus 1, previously identified in Spain, and BdAdV-2 are sister taxa with harbor porpoise adenovirus 1, forming a cetacean clade. Bottlenose dolphin adenovirus 2 includes a highly divergent fiber gene. Two genes homologous to the dUTPase superfamily are also present which could play a role in enabling viral replication in nondividing cells. We used sequence data to develop a probe hybridization quantitative PCR assay specific to BdAdV-2 with a limit of detection of 10 copies.

Phylogenetic relationships among superfamilies of Neritimorpha (Mollusca: Gastropoda).

PubMed

Uribe, Juan E; Colgan, Don; Castro, Lyda R; Kano, Yasunori; Zardoya, Rafael

2016-11-01

Despite the extraordinary morphological and ecological diversity of Neritimorpha, few studies have focused on the phylogenetic relationships of this lineage of gastropods, which includes four extant superfamilies: Neritopsoidea, Hydrocenoidea, Helicinoidea, and Neritoidea. Here, the nucleotide sequences of the complete mitochondrial genomes of Georissa bangueyensis (Hydrocenoidea), Neritina usnea (Neritoidea), and Pleuropoma jana (Helicinoidea) and the nearly complete mt genomes of Titiscania sp. (Neritopsoidea) and Theodoxus fluviatilis (Neritoidea) were determined. Phylogenetic reconstructions using probabilistic methods were based on mitochondrial (13 protein coding genes and two ribosomal rRNA genes), nuclear (partial 28S rRNA, 18S rRNA, actin, and histone H3 genes) and combined sequence data sets. All phylogenetic analyses except one converged on a single, highly supported tree in which Neritopsoidea was recovered as the sister group of a clade including Helicinoidea as the sister group of Hydrocenoidea and Neritoidea. This topology agrees with the fossil record and supports at least three independent invasions of land by neritimorph snails. The mitochondrial genomes of Titiscania sp., G. bangueyensis, N. usnea, and T. fluviatilis share the same gene organization previously described for Nerita mt genomes whereas that of P. jana has undergone major rearrangements. We sequenced about half of the mitochondrial genome of another species of Helicinoidea, Viana regina, and confirmed that this species shares the highly derived gene order of P. jana. Copyright © 2016 Elsevier Inc. All rights reserved.

Usutu virus, Austria and Hungary, 2010–2016

PubMed Central

Bakonyi, Tamás; Erdélyi, Károly; Brunthaler, René; Dán, Ádám; Weissenböck, Herbert; Nowotny, Norbert

2017-01-01

Usutu virus (USUV, Flaviviridae) was first reported in Europe in Austria in 2001, where it caused wild bird (mainly blackbird) mortality until 2005. Since 2006 no further USUV cases were diagnosed in the country. However, the virus emerged in other European countries (Hungary, Italy, Switzerland, Spain, Germany and the Czech Republic) between 2005 and 2011. In 2016, widespread USUV-associated wild bird mortality was observed in Germany, France, Belgium and the Netherlands. In this study, we report the results of passive monitoring for USUV in Austria and Hungary between 2010 and 2016. In Hungary, USUV caused sporadic cases of wild bird mortality between 2010 and 2015 (altogether 18 diagnosed cases), whereas in summer and autumn 2016 the number of cases considerably increased to 12 (ten blackbirds, one Eurasian jay and one starling). In Austria, USUV was identified in two blackbirds in 2016. Phylogenetic analyses of coding-complete genomes and partial regions of the NS5 protein gene revealed that USUVs from Hungary between 2010 and 2015 are closely related to the virus that emerged in Austria in 2001 and in Hungary in 2005, while one Hungarian sequence from 2015 and all sequences from Hungary and Austria from 2016 clustered together with USUV sequences reported from Italy between 2009 and 2010. The results of the study indicate continuous USUV circulation in the region and exchange of USUV strains between Italy, Austria and Hungary. PMID:29018253

Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus.

PubMed

Su, Jingliang; Li, Shuang; Hu, Xudong; Yu, Xiuling; Wang, Yongyue; Liu, Peipei; Lu, Xishan; Zhang, Guozhong; Hu, Xueying; Liu, Di; Li, Xiaoxia; Su, Wenliang; Lu, Hao; Mok, Ngai Shing; Wang, Peiyi; Wang, Ming; Tian, Kegong; Gao, George F

2011-03-24

Since April 2010, a severe outbreak of duck viral infection, with egg drop, feed uptake decline and ovary-oviduct disease, has spread around the major duck-producing regions in China. A new virus, named BYD virus, was isolated in different areas, and a similar disease was reproduced in healthy egg-producing ducks, infecting with the isolated virus. The virus was re-isolated from the affected ducks and replicated well in primary duck embryo fibroblasts and Vero cells, causing the cytopathic effect. The virus was identified as an enveloped positive-stranded RNA virus with a size of approximately 55 nm in diameter. Genomic sequencing of the isolated virus revealed that it is closely related to Tembusu virus (a mosquito-borne Ntaya group flavivirus), with 87-91% nucleotide identity of the partial E (envelope) proteins to that of Tembusu virus and 72% of the entire genome coding sequence with Bagaza virus, the most closely related flavivirus with an entirely sequenced genome. Collectively our systematic studies fulfill Koch's postulates, and therefore, the causative agent of the duck egg drop syndrome occurring in China is a new flavivirus. Flavivirus is an emerging and re-emerging zoonotic pathogen and BYD virus that causes severe egg-drop, could be disastrous for the duck industry. More importantly its public health concerns should also be evaluated, and its epidemiology should be closely watched due to the zoonotic nature of flaviviruses.

Isolation and characterization of an isoproturon mineralizing Sphingomonas sp. strain SH from a French agricultural soil.

PubMed

Hussain, Sabir; Devers-Lamrani, Marion; El Azhari, Najoi; Martin-Laurent, Fabrice

2011-06-01

The phenylurea herbicide isoproturon, 3-(4-isopropylphenyl)-1,1-dimethylurea (IPU), was found to be rapidly mineralized in an agricultural soil in France that had been periodically exposed to IPU. Enrichment cultures from samples of this soil isolated a bacterial strain able to mineralize IPU. 16S rRNA sequence analysis showed that this strain belonged to the phylogeny of the genus Sphingomonas (96% similarity with Sphingomonas sp. JEM-14, AB219361) and was designated Sphingomonas sp. strain SH. From this strain, a partial sequence of a 1,2-dioxygenase (catA) gene coding for an enzyme degrading catechol putatively formed during IPU mineralization was amplified. Phylogenetic analysis revealed that the catA sequence was related to Sphingomonas spp. and showed a lack of congruence between the catA and 16S rRNA based phylogenies, implying horizontal gene transfer of the catA gene cluster between soil microbiota. The IPU degrading ability of strain SH was strongly influenced by pH with maximum degradation taking place at pH 7.5. SH was only able to mineralize IPU and its known metabolites including 4-isopropylaniline and it could not degrade other structurally related phenylurea herbicides such as diuron, linuron, monolinuron and chlorotoluron or their aniline derivatives. These observations suggest that the catabolic abilities of the strain SH are highly specific to the metabolism of IPU.

Analysis of sequences from field samples reveals the presence of the recently described pepper vein yellows virus (genus Polerovirus) in six additional countries.

PubMed

Knierim, Dennis; Tsai, Wen-Shi; Kenyon, Lawrence

2013-06-01

Polerovirus infection was detected by reverse transcription polymerase chain reaction (RT-PCR) in 29 pepper plants (Capsicum spp.) and one black nightshade plant (Solanum nigrum) sample collected from fields in India, Indonesia, Mali, Philippines, Thailand and Taiwan. At least two representative samples for each country were selected to generate a general polerovirus RT-PCR product of 1.4 kb length for sequencing. Sequence analysis of the partial genome sequences revealed the presence of pepper vein yellows virus (PeVYV) in all 13 samples. A 1990 Australian herbarium sample of pepper described by serological means as infected with capsicum yellows virus (CYV) was identified by sequence analysis of a partial CP sequence as probably infected with a potato leaf roll virus (PLRV) isolate.

Software for optimization of SNP and PCR-RFLP genotyping to discriminate many genomes with the fewest assays

PubMed Central

Gardner, Shea N; Wagner, Mark C

2005-01-01

Background Microbial forensics is important in tracking the source of a pathogen, whether the disease is a naturally occurring outbreak or part of a criminal investigation. Results A method and SPR Opt (SNP and PCR-RFLP Optimization) software to perform a comprehensive, whole-genome analysis to forensically discriminate multiple sequences is presented. Tools for the optimization of forensic typing using Single Nucleotide Polymorphism (SNP) and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP) analyses across multiple isolate sequences of a species are described. The PCR-RFLP analysis includes prediction and selection of optimal primers and restriction enzymes to enable maximum isolate discrimination based on sequence information. SPR Opt calculates all SNP or PCR-RFLP variations present in the sequences, groups them into haplotypes according to their co-segregation across those sequences, and performs combinatoric analyses to determine which sets of haplotypes provide maximal discrimination among all the input sequences. Those set combinations requiring that membership in the fewest haplotypes be queried (i.e. the fewest assays be performed) are found. These analyses highlight variable regions based on existing sequence data. These markers may be heterogeneous among unsequenced isolates as well, and thus may be useful for characterizing the relationships among unsequenced as well as sequenced isolates. The predictions are multi-locus. Analyses of mumps and SARS viruses are summarized. Phylogenetic trees created based on SNPs, PCR-RFLPs, and full genomes are compared for SARS virus, illustrating that purported phylogenies based only on SNP or PCR-RFLP variations do not match those based on multiple sequence alignment of the full genomes. Conclusion This is the first software to optimize the selection of forensic markers to maximize information gained from the fewest assays, accepting whole or partial genome sequence data as input. As more sequence data becomes available for multiple strains and isolates of a species, automated, computational approaches such as those described here will be essential to make sense of large amounts of information, and to guide and optimize efforts in the laboratory. The software and source code for SPR Opt is publicly available and free for non-profit use at . PMID:15904493

Specific and Modular Binding Code for Cytosine Recognition in Pumilio/FBF (PUF) RNA-binding Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, Shuyun; Wang, Yang; Cassidy-Amstutz, Caleb

2011-10-28

Pumilio/fem-3 mRNA-binding factor (PUF) proteins possess a recognition code for bases A, U, and G, allowing designed RNA sequence specificity of their modular Pumilio (PUM) repeats. However, recognition side chains in a PUM repeat for cytosine are unknown. Here we report identification of a cytosine-recognition code by screening random amino acid combinations at conserved RNA recognition positions using a yeast three-hybrid system. This C-recognition code is specific and modular as specificity can be transferred to different positions in the RNA recognition sequence. A crystal structure of a modified PUF domain reveals specific contacts between an arginine side chain and themore » cytosine base. We applied the C-recognition code to design PUF domains that recognize targets with multiple cytosines and to generate engineered splicing factors that modulate alternative splicing. Finally, we identified a divergent yeast PUF protein, Nop9p, that may recognize natural target RNAs with cytosine. This work deepens our understanding of natural PUF protein target recognition and expands the ability to engineer PUF domains to recognize any RNA sequence.« less

Dexter - A one-dimensional code for calculating thermionic performance of long converters.

NASA Technical Reports Server (NTRS)

Sawyer, C. D.

1971-01-01

This paper describes a versatile code for computing the coupled thermionic electric-thermal performance of long thermionic converters in which the temperature and voltage variations cannot be neglected. The code is capable of accounting for a variety of external electrical connection schemes, coolant flow paths and converter failures by partial shorting. Example problem solutions are given.

Novel numerical and graphical representation of DNA sequences and proteins.

PubMed

Randić, M; Novic, M; Vikić-Topić, D; Plavsić, D

2006-12-01

We have introduced novel numerical and graphical representations of DNA, which offer a simple and unique characterization of DNA sequences. The numerical representation of a DNA sequence is given as a sequence of real numbers derived from a unique graphical representation of the standard genetic code. There is no loss of information on the primary structure of a DNA sequence associated with this numerical representation. The novel representations are illustrated with the coding sequences of the first exon of beta-globin gene of half a dozen species in addition to human. The method can be extended to proteins as is exemplified by humanin, a 24-aa peptide that has recently been identified as a specific inhibitor of neuronal cell death induced by familial Alzheimer's disease mutant genes.

A global assembly of cotton ESTs

PubMed Central

Udall, Joshua A.; Swanson, Jordan M.; Haller, Karl; Rapp, Ryan A.; Sparks, Michael E.; Hatfield, Jamie; Yu, Yeisoo; Wu, Yingru; Dowd, Caitriona; Arpat, Aladdin B.; Sickler, Brad A.; Wilkins, Thea A.; Guo, Jin Ying; Chen, Xiao Ya; Scheffler, Jodi; Taliercio, Earl; Turley, Ricky; McFadden, Helen; Payton, Paxton; Klueva, Natalya; Allen, Randell; Zhang, Deshui; Haigler, Candace; Wilkerson, Curtis; Suo, Jinfeng; Schulze, Stefan R.; Pierce, Margaret L.; Essenberg, Margaret; Kim, HyeRan; Llewellyn, Danny J.; Dennis, Elizabeth S.; Kudrna, David; Wing, Rod; Paterson, Andrew H.; Soderlund, Cari; Wendel, Jonathan F.

2006-01-01

Approximately 185,000 Gossypium EST sequences comprising >94,800,000 nucleotides were amassed from 30 cDNA libraries constructed from a variety of tissues and organs under a range of conditions, including drought stress and pathogen challenges. These libraries were derived from allopolyploid cotton (Gossypium hirsutum; AT and DT genomes) as well as its two diploid progenitors, Gossypium arboreum (A genome) and Gossypium raimondii (D genome). ESTs were assembled using the Program for Assembling and Viewing ESTs (PAVE), resulting in 22,030 contigs and 29,077 singletons (51,107 unigenes). Further comparisons among the singletons and contigs led to recognition of 33,665 exemplar sequences that represent a nonredundant set of putative Gossypium genes containing partial or full-length coding regions and usually one or two UTRs. The assembly, along with their UniProt BLASTX hits, GO annotation, and Pfam analysis results, are freely accessible as a public resource for cotton genomics. Because ESTs from diploid and allotetraploid Gossypium were combined in a single assembly, we were in many cases able to bioinformatically distinguish duplicated genes in allotetraploid cotton and assign them to either the A or D genome. The assembly and associated information provide a framework for future investigation of cotton functional and evolutionary genomics. PMID:16478941

Sense-antisense (complementary) peptide interactions and the proteomic code; potential opportunities in biology and pharmaceutical science.

PubMed

Miller, Andrew D

2015-02-01

A sense peptide can be defined as a peptide whose sequence is coded by the nucleotide sequence (read 5' → 3') of the sense (positive) strand of DNA. Conversely, an antisense (complementary) peptide is coded by the corresponding nucleotide sequence (read 5' → 3') of the antisense (negative) strand of DNA. Research has been accumulating steadily to suggest that sense peptides are capable of specific interactions with their corresponding antisense peptides. Unfortunately, although more and more examples of specific sense-antisense peptide interactions are emerging, the very idea of such interactions does not conform to standard biology dogma and so there remains a sizeable challenge to lift this concept from being perceived as a peripheral phenomenon if not worse, into becoming part of the scientific mainstream. Specific interactions have now been exploited for the inhibition of number of widely different protein-protein and protein-receptor interactions in vitro and in vivo. Further, antisense peptides have also been used to induce the production of antibodies targeted to specific receptors or else the production of anti-idiotypic antibodies targeted against auto-antibodies. Such illustrations of utility would seem to suggest that observed sense-antisense peptide interactions are not just the consequence of a sequence of coincidental 'lucky-hits'. Indeed, at the very least, one might conclude that sense-antisense peptide interactions represent a potentially new and different source of leads for drug discovery. But could there be more to come from studies in this area? Studies on the potential mechanism of sense-antisense peptide interactions suggest that interactions may be driven by amino acid residue interactions specified from the genetic code. If so, such specified amino acid residue interactions could form the basis for an even wider amino acid residue interaction code (proteomic code) that links gene sequences to actual protein structure and function, even entire genomes to entire proteomes. The possibility that such a proteomic code should exist is discussed. So too the potential implications for biology and pharmaceutical science are also discussed were such a code to exist.

Multiple symbol partially coherent detection of MPSK

NASA Technical Reports Server (NTRS)

Simon, M. K.; Divsalar, D.

1992-01-01

It is shown that by using the known (or estimated) value of carrier tracking loop signal to noise ratio (SNR) in the decision metric, it is possible to improve the error probability performance of a partially coherent multiple phase-shift-keying (MPSK) system relative to that corresponding to the commonly used ideal coherent decision rule. Using a maximum-likeihood approach, an optimum decision metric is derived and shown to take the form of a weighted sum of the ideal coherent decision metric (i.e., correlation) and the noncoherent decision metric which is optimum for differential detection of MPSK. The performance of a receiver based on this optimum decision rule is derived and shown to provide continued improvement with increasing length of observation interval (data symbol sequence length). Unfortunately, increasing the observation length does not eliminate the error floor associated with the finite loop SNR. Nevertheless, in the limit of infinite observation length, the average error probability performance approaches the algebraic sum of the error floor and the performance of ideal coherent detection, i.e., at any error probability above the error floor, there is no degradation due to the partial coherence. It is shown that this limiting behavior is virtually achievable with practical size observation lengths. Furthermore, the performance is quite insensitive to mismatch between the estimate of loop SNR (e.g., obtained from measurement) fed to the decision metric and its true value. These results may be of use in low-cost Earth-orbiting or deep-space missions employing coded modulations.

Instructions for the use of the CIVM-Jet 4C finite-strain computer code to calculate the transient structural responses of partial and/or complete arbitrarily-curved rings subjected to fragment impact

NASA Technical Reports Server (NTRS)

Rodal, J. J. A.; French, S. E.; Witmer, E. A.; Stagliano, T. R.

1979-01-01

The CIVM-JET 4C computer program for the 'finite strain' analysis of 2 d transient structural responses of complete or partial rings and beams subjected to fragment impact stored on tape as a series of individual files. Which subroutines are found in these files are described in detail. All references to the CIVM-JET 4C program are made assuming that the user has a copy of NASA CR-134907 (ASRL TR 154-9) which serves as a user's guide to (1) the CIVM-JET 4B computer code and (2) the CIVM-JET 4C computer code 'with the use of the modified input instructions' attached hereto.

Partial Least Squares with Structured Output for Modelling the Metabolomics Data Obtained from Complex Experimental Designs: A Study into the Y-Block Coding.

PubMed

Xu, Yun; Muhamadali, Howbeer; Sayqal, Ali; Dixon, Neil; Goodacre, Royston

2016-10-28

Partial least squares (PLS) is one of the most commonly used supervised modelling approaches for analysing multivariate metabolomics data. PLS is typically employed as either a regression model (PLS-R) or a classification model (PLS-DA). However, in metabolomics studies it is common to investigate multiple, potentially interacting, factors simultaneously following a specific experimental design. Such data often cannot be considered as a "pure" regression or a classification problem. Nevertheless, these data have often still been treated as a regression or classification problem and this could lead to ambiguous results. In this study, we investigated the feasibility of designing a hybrid target matrix Y that better reflects the experimental design than simple regression or binary class membership coding commonly used in PLS modelling. The new design of Y coding was based on the same principle used by structural modelling in machine learning techniques. Two real metabolomics datasets were used as examples to illustrate how the new Y coding can improve the interpretability of the PLS model compared to classic regression/classification coding.

Origins of genes: "big bang" or continuous creation?

PubMed Central

Keese, P K; Gibbs, A

1992-01-01

Many protein families are common to all cellular organisms, indicating that many genes have ancient origins. Genetic variation is mostly attributed to processes such as mutation, duplication, and rearrangement of ancient modules. Thus it is widely assumed that much of present-day genetic diversity can be traced by common ancestry to a molecular "big bang." A rarely considered alternative is that proteins may arise continuously de novo. One mechanism of generating different coding sequences is by "overprinting," in which an existing nucleotide sequence is translated de novo in a different reading frame or from noncoding open reading frames. The clearest evidence for overprinting is provided when the original gene function is retained, as in overlapping genes. Analysis of their phylogenies indicates which are the original genes and which are their informationally novel partners. We report here the phylogenetic relationships of overlapping coding sequences from steroid-related receptor genes and from tymovirus, luteovirus, and lentivirus genomes. For each pair of overlapping coding sequences, one is confined to a single lineage, whereas the other is more widespread. This suggests that the phylogenetically restricted coding sequence arose only in the progenitor of that lineage by translating an out-of-frame sequence to yield the new polypeptide. The production of novel exons by alternative splicing in thyroid receptor and lentivirus genes suggests that introns can be a valuable evolutionary source for overprinting. New genes and their products may drive major evolutionary changes. PMID:1329098

Abstract feature codes: The building blocks of the implicit learning system.

PubMed

Eberhardt, Katharina; Esser, Sarah; Haider, Hilde

2017-07-01

According to the Theory of Event Coding (TEC; Hommel, Müsseler, Aschersleben, & Prinz, 2001), action and perception are represented in a shared format in the cognitive system by means of feature codes. In implicit sequence learning research, it is still common to make a conceptual difference between independent motor and perceptual sequences. This supposedly independent learning takes place in encapsulated modules (Keele, Ivry, Mayr, Hazeltine, & Heuer 2003) that process information along single dimensions. These dimensions have remained underspecified so far. It is especially not clear whether stimulus and response characteristics are processed in separate modules. Here, we suggest that feature dimensions as they are described in the TEC should be viewed as the basic content of modules of implicit learning. This means that the modules process all stimulus and response information related to certain feature dimensions of the perceptual environment. In 3 experiments, we investigated by means of a serial reaction time task the nature of the basic units of implicit learning. As a test case, we used stimulus location sequence learning. The results show that a stimulus location sequence and a response location sequence cannot be learned without interference (Experiment 2) unless one of the sequences can be coded via an alternative, nonspatial dimension (Experiment 3). These results support the notion that spatial location is one module of the implicit learning system and, consequently, that there are no separate processing units for stimulus versus response locations. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Adaptive decoding of convolutional codes

NASA Astrophysics Data System (ADS)

Hueske, K.; Geldmacher, J.; Götze, J.

2007-06-01

Convolutional codes, which are frequently used as error correction codes in digital transmission systems, are generally decoded using the Viterbi Decoder. On the one hand the Viterbi Decoder is an optimum maximum likelihood decoder, i.e. the most probable transmitted code sequence is obtained. On the other hand the mathematical complexity of the algorithm only depends on the used code, not on the number of transmission errors. To reduce the complexity of the decoding process for good transmission conditions, an alternative syndrome based decoder is presented. The reduction of complexity is realized by two different approaches, the syndrome zero sequence deactivation and the path metric equalization. The two approaches enable an easy adaptation of the decoding complexity for different transmission conditions, which results in a trade-off between decoding complexity and error correction performance.

Optimization of algorithm of coding of genetic information of Chlamydia

NASA Astrophysics Data System (ADS)

Feodorova, Valentina A.; Ulyanov, Sergey S.; Zaytsev, Sergey S.; Saltykov, Yury V.; Ulianova, Onega V.

2018-04-01

New method of coding of genetic information using coherent optical fields is developed. Universal technique of transformation of nucleotide sequences of bacterial gene into laser speckle pattern is suggested. Reference speckle patterns of the nucleotide sequences of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci serovar I as well are generated. Algorithm of coding of gene information into speckle pattern is optimized. Fully developed speckles with Gaussian statistics for gene-based speckles have been used as criterion of optimization.

Simulated Assessment of Interference Effects in Direct Sequence Spread Spectrum (DSSS) QPSK Receiver

DTIC Science & Technology

2014-03-27

bit error rate BPSK binary phase shift keying CDMA code division multiple access CSI comb spectrum interference CW continuous wave DPSK differential... CDMA ) and GPS systems which is a Gold code. This code is generated by a modulo-2 operation between two different preferred m-sequences. The preferred m...10 SNR Sim (dB) S N R O ut ( dB ) SNR RF SNR DS Figure 3.26: Comparison of input S NRS im and S NROut of the band-pass RF filter (S NRRF) and

Hiding message into DNA sequence through DNA coding and chaotic maps.

PubMed

Liu, Guoyan; Liu, Hongjun; Kadir, Abdurahman

2014-09-01

The paper proposes an improved reversible substitution method to hide data into deoxyribonucleic acid (DNA) sequence, and four measures have been taken to enhance the robustness and enlarge the hiding capacity, such as encode the secret message by DNA coding, encrypt it by pseudo-random sequence, generate the relative hiding locations by piecewise linear chaotic map, and embed the encoded and encrypted message into a randomly selected DNA sequence using the complementary rule. The key space and the hiding capacity are analyzed. Experimental results indicate that the proposed method has a better performance compared with the competing methods with respect to robustness and capacity.

Physics behind the mechanical nucleosome positioning code

NASA Astrophysics Data System (ADS)

Zuiddam, Martijn; Everaers, Ralf; Schiessel, Helmut

2017-11-01

The positions along DNA molecules of nucleosomes, the most abundant DNA-protein complexes in cells, are influenced by the sequence-dependent DNA mechanics and geometry. This leads to the "nucleosome positioning code", a preference of nucleosomes for certain sequence motives. Here we introduce a simplified model of the nucleosome where a coarse-grained DNA molecule is frozen into an idealized superhelical shape. We calculate the exact sequence preferences of our nucleosome model and find it to reproduce qualitatively all the main features known to influence nucleosome positions. Moreover, using well-controlled approximations to this model allows us to come to a detailed understanding of the physics behind the sequence preferences of nucleosomes.

EUGÈNE'HOM: a generic similarity-based gene finder using multiple homologous sequences

PubMed Central

Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas

2003-01-01

EUGÈNE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGÈNE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGÈNE'HOM to handle sequences from a variety of organisms. The current target of EUGÈNE'HOM is plant sequences. The EUGÈNE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl. PMID:12824408

An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

PubMed

Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

2011-01-01

cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

PubMed Central

Gustafson, G; Armour, S L

1986-01-01

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

Diversity in VP3, NSP3, and NSP4 of rotavirus B detected from Japanese cattle.

PubMed

Hayashi-Miyamoto, Michiko; Murakami, Toshiaki; Minami-Fukuda, Fujiko; Tsuchiaka, Shinobu; Kishimoto, Mai; Sano, Kaori; Naoi, Yuki; Asano, Keigo; Ichimaru, Toru; Haga, Kei; Omatsu, Tsutomu; Katayama, Yukie; Oba, Mami; Aoki, Hiroshi; Shirai, Junsuke; Ishida, Motohiko; Katayama, Kazuhiko; Mizutani, Tetsuya; Nagai, Makoto

2017-04-01

Bovine rotavirus B (RVB) is an etiological agent of diarrhea mostly in adult cattle. Currently, a few sequences of viral protein (VP)1, 2, 4, 6, and 7 and nonstructural protein (NSP)1, 2, and 5 of bovine RVB are available in the DDBJ/EMBL/GenBank databases, and none have been reported for VP3, NSP3, and NSP4. In order to fill this gap in the genetic characterization of bovine RVB strains, we used a metagenomics approach and sequenced and analyzed the complete coding sequences (CDS) of VP3, NSP3, and NSP4 genes, as well as the partial or complete CDS of other genes of RVBs detected from Japanese cattle. VP3, NSP3, and NSP4 of bovine RVBs shared low nucleotide sequence identities (63.3-64.9% for VP3, 65.9-68.2% for NSP3, and 52.6-56.2% for NSP4) with those of murine, human, and porcine RVBs, suggesting that bovine RVBs belong to a novel genotype. Furthermore, significantly low amino acid sequence identities were observed for NSP4 (36.1-39.3%) between bovine RVBs and the RVBs of other species. In contrast, hydrophobic plot analysis of NSP4 revealed profiles similar to those of RVBs of other species and rotavirus A (RVA) strains. Phylogenetic analyses of all gene segments revealed that bovine RVB strains formed a cluster that branched distantly from other RVBs. These results suggest that bovine RVBs have evolved independently from other RVBs but in a similar manner to other rotaviruses. These findings provide insights into the evolution and diversity of RVB strains. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of the novel antifungal protein PgAFP and the encoding gene of Penicillium chrysogenum.

PubMed

Rodríguez-Martín, Andrea; Acosta, Raquel; Liddell, Susan; Núñez, Félix; Benito, M José; Asensio, Miguel A

2010-04-01

The strain RP42C from Penicillium chrysogenum produces a small protein PgAFP that inhibits the growth of some toxigenic molds. The molecular mass of the protein determined by electrospray ionization mass spectrometry (ESI-MS) was 6 494Da. PgAFP showed a cationic character with an estimated pI value of 9.22. Upon chemical and enzymatic treatments of PgAFP, no evidence for N- or O-glycosylations was obtained. Five partial sequences of PgAFP were obtained by Edman degradation and by ESI-MS/MS after trypsin and chymotrypsin digestions. Using degenerate primers from these peptide sequences, a segment of 70bp was amplified by PCR from pgafp gene. 5'- and 3'-ends of pgafp were obtained by RACE-PCR with gene-specific primers designed from the 70bp segment. The complete pgafp sequence of 404bp was obtained using primers designed from 5'- and 3'-ends. Comparison of genomic and cDNA sequences revealed a 279bp coding region interrupted by two introns of 63 and 62bp. The precursor of the antifungal protein consists of 92 amino acids and appears to be processed to the mature 58 amino acids PgAFP. The deduced amino acid sequence of the mature protein shares 79% identity to the antifungal protein Anafp from Aspergillus niger. PgAFP is a new protein that belongs to the group of small, cysteine-rich, and basic proteins with antifungal activity produced by ascomycetes. Given that P. chrysogenum is regarded as safe mold commonly found in foods, PgAFP may be useful to prevent growth of toxigenic molds in food and agricultural products. Copyright (c) 2009 Elsevier Inc. All rights reserved.

Comprehensive Insights in the Mycobacterium avium subsp. paratuberculosis Genome Using New WGS Data of Sheep Strain JIII-386 from Germany

PubMed Central

Möbius, Petra; Hölzer, Martin; Felder, Marius; Nordsiek, Gabriele; Groth, Marco; Köhler, Heike; Reichwald, Kathrin; Platzer, Matthias; Marz, Manja

2015-01-01

Mycobacterium avium (M. a.) subsp. paratuberculosis (MAP)—the etiologic agent of Johne’s disease—affects cattle, sheep, and other ruminants worldwide. To decipher phenotypic differences among sheep and cattle strains (belonging to MAP-S [Type-I/III], respectively, MAP-C [Type-II]), comparative genome analysis needs data from diverse isolates originating from different geographic regions of the world. This study presents the so far best assembled genome of a MAP-S-strain: Sheep isolate JIII-386 from Germany. One newly sequenced cattle isolate (JII-1961, Germany), four published MAP strains of MAP-C and MAP-S from the United States and Australia, and M. a. subsp. hominissuis (MAH) strain 104 were used for assembly improvement and comparisons. All genomes were annotated by BacProt and results compared with NCBI (National Center for Biotechnology Information) annotation. Corresponding protein-coding sequences (CDSs) were detected, but also CDSs that were exclusively determined by either NCBI or BacProt. A new Shine–Dalgarno sequence motif (5′-AGCTGG-3′) was extracted. Novel CDSs including PE-PGRS family protein genes and about 80 noncoding RNAs exhibiting high sequence conservation are presented. Previously found genetic differences between MAP-types are partially revised. Four of ten assumed MAP-S-specific large sequence polymorphism regions (LSPSs) are still present in MAP-C strains; new LSPSs were identified. Independently of the regional origin of the strains, the number of individual CDSs and single nucleotide variants confirms the strong similarity of MAP-C strains and shows higher diversity among MAP-S strains. This study gives ambiguous results regarding the hypothesis that MAP-S is the evolutionary intermediate between MAH and MAP-C, but it clearly shows a higher similarity of MAP to MAH than to Mycobacterium intracellulare. PMID:26384038

Colour cyclic code for Brillouin distributed sensors

NASA Astrophysics Data System (ADS)

Le Floch, Sébastien; Sauser, Florian; Llera, Miguel; Rochat, Etienne

2015-09-01

For the first time, a colour cyclic coding (CCC) is theoretically and experimentally demonstrated for Brillouin optical time-domain analysis (BOTDA) distributed sensors. Compared to traditional intensity-modulated cyclic codes, the code presents an additional gain of √2 while keeping the same number of sequences as for a colour coding. A comparison with a standard BOTDA sensor is realized and validates the theoretical coding gain.

A New Zamilon-like Virophage Partial Genome Assembled from a Bioreactor Metagenome

PubMed Central

Bekliz, Meriem; Verneau, Jonathan; Benamar, Samia; Raoult, Didier; La Scola, Bernard; Colson, Philippe

2015-01-01

Virophages replicate within viral factories inside the Acanthamoeba cytoplasm, and decrease the infectivity and replication of their associated giant viruses. Culture isolation and metagenome analyses have suggested that they are common in our environment. By screening metagenomic databases in search of amoebal viruses, we detected virophage-related sequences among sequences generated from the same non-aerated bioreactor metagenome as recently screened by another team for virophage capsid-encoding genes. We describe here the assembled partial genome of a virophage closely related to Zamilon, which infects Acanthamoeba with mimiviruses of lineages B and C but not A. Searches for sequences related to amoebal giant viruses, other Megavirales representatives and virophages were conducted using BLAST against this bioreactor metagenome (PRJNA73603). Comparative genomic and phylogenetic analyses were performed using sequences from previously identified virophages. A total of 72 metagenome contigs generated from the bioreactor were identified as best matching with sequences from Megavirales representatives, mostly Pithovirus sibericum, pandoraviruses and amoebal mimiviruses from three lineages A–C, as well as from virophages. In addition, a partial genome from a Zamilon-like virophage, we named Zamilon 2, was assembled. This genome has a size of 6716 base pairs, corresponding to 39% of the Zamilon genome, and comprises partial or full-length homologs for 15 Zamilon predicted open reading frames (ORFs). Mean nucleotide and amino acid identities for these 15 Zamilon 2 ORFs with their Zamilon counterparts were 89% (range, 81–96%) and 91% (range, 78–99%), respectively. Notably, these ORFs included two encoding a capsid protein and a packaging ATPase. Comparative genomics and phylogenetic analyses indicated that the partial genome was that of a new Zamilon-like virophage. Further studies are needed to gain better knowledge of the tropism and prevalence of virophages in our biosphere and in humans. PMID:26640459

New encoded single-indicator sequences based on physico-chemical parameters for efficient exon identification.

PubMed

Meher, J K; Meher, P K; Dash, G N; Raval, M K

2012-01-01

The first step in gene identification problem based on genomic signal processing is to convert character strings into numerical sequences. These numerical sequences are then analysed spectrally or using digital filtering techniques for the period-3 peaks, which are present in exons (coding areas) and absent in introns (non-coding areas). In this paper, we have shown that single-indicator sequences can be generated by encoding schemes based on physico-chemical properties. Two new methods are proposed for generating single-indicator sequences based on hydration energy and dipole moments. The proposed methods produce high peak at exon locations and effectively suppress false exons (intron regions having greater peak than exon regions) resulting in high discriminating factor, sensitivity and specificity.

TANDEM: matching proteins with tandem mass spectra.

PubMed

Craig, Robertson; Beavis, Ronald C

2004-06-12

Tandem mass spectra obtained from fragmenting peptide ions contain some peptide sequence specific information, but often there is not enough information to sequence the original peptide completely. Several proprietary software applications have been developed to attempt to match the spectra with a list of protein sequences that may contain the sequence of the peptide. The application TANDEM was written to provide the proteomics research community with a set of components that can be used to test new methods and algorithms for performing this type of sequence-to-data matching. The source code and binaries for this software are available at http://www.proteome.ca/opensource.html, for Windows, Linux and Macintosh OSX. The source code is made available under the Artistic License, from the authors.

N-terminal Proteomics Assisted Profiling of the Unexplored Translation Initiation Landscape in Arabidopsis thaliana *

PubMed Central

Ndah, Elvis; Jonckheere, Veronique

2017-01-01

Proteogenomics is an emerging research field yet lacking a uniform method of analysis. Proteogenomic studies in which N-terminal proteomics and ribosome profiling are combined, suggest that a high number of protein start sites are currently missing in genome annotations. We constructed a proteogenomic pipeline specific for the analysis of N-terminal proteomics data, with the aim of discovering novel translational start sites outside annotated protein coding regions. In summary, unidentified MS/MS spectra were matched to a specific N-terminal peptide library encompassing protein N termini encoded in the Arabidopsis thaliana genome. After a stringent false discovery rate filtering, 117 protein N termini compliant with N-terminal methionine excision specificity and indicative of translation initiation were found. These include N-terminal protein extensions and translation from transposable elements and pseudogenes. Gene prediction provided supporting protein-coding models for approximately half of the protein N termini. Besides the prediction of functional domains (partially) contained within the newly predicted ORFs, further supporting evidence of translation was found in the recently released Araport11 genome re-annotation of Arabidopsis and computational translations of sequences stored in public repositories. Most interestingly, complementary evidence by ribosome profiling was found for 23 protein N termini. Finally, by analyzing protein N-terminal peptides, an in silico analysis demonstrates the applicability of our N-terminal proteogenomics strategy in revealing protein-coding potential in species with well- and poorly-annotated genomes. PMID:28432195

N-terminal Proteomics Assisted Profiling of the Unexplored Translation Initiation Landscape in Arabidopsis thaliana.

PubMed

Willems, Patrick; Ndah, Elvis; Jonckheere, Veronique; Stael, Simon; Sticker, Adriaan; Martens, Lennart; Van Breusegem, Frank; Gevaert, Kris; Van Damme, Petra

2017-06-01

Proteogenomics is an emerging research field yet lacking a uniform method of analysis. Proteogenomic studies in which N-terminal proteomics and ribosome profiling are combined, suggest that a high number of protein start sites are currently missing in genome annotations. We constructed a proteogenomic pipeline specific for the analysis of N-terminal proteomics data, with the aim of discovering novel translational start sites outside annotated protein coding regions. In summary, unidentified MS/MS spectra were matched to a specific N-terminal peptide library encompassing protein N termini encoded in the Arabidopsis thaliana genome. After a stringent false discovery rate filtering, 117 protein N termini compliant with N-terminal methionine excision specificity and indicative of translation initiation were found. These include N-terminal protein extensions and translation from transposable elements and pseudogenes. Gene prediction provided supporting protein-coding models for approximately half of the protein N termini. Besides the prediction of functional domains (partially) contained within the newly predicted ORFs, further supporting evidence of translation was found in the recently released Araport11 genome re-annotation of Arabidopsis and computational translations of sequences stored in public repositories. Most interestingly, complementary evidence by ribosome profiling was found for 23 protein N termini. Finally, by analyzing protein N-terminal peptides, an in silico analysis demonstrates the applicability of our N-terminal proteogenomics strategy in revealing protein-coding potential in species with well- and poorly-annotated genomes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Evidence for Coincident Fusion Products Using Silicon Surface-barrier Detectors

NASA Astrophysics Data System (ADS)

Jones, Steven; Scott, Mark; Keeney, Frank

2002-10-01

We report experimental results showing coincident proton and triton production from the reaction: d + d --> t (1.01 MeV) + p (3.02 MeV). Partially-deuterided thin titanium foils were positioned between two silicon surface-barrier detectors which were mounted in a small cylindrical vacuum chamber which also served as a Faraday cage. We performed Monte Carlo studies using the SRIM code to determine the expected energies of arriving particles after they exit the host foil. The dual-coincidence requirement reduces background to very low levels so that low yields from very thin TiD foils can be readily detected. In one sequence of experiments, we observed 74 foreground coincidences in the regions of interest compared with 24 background counts; the statistical significance is approximately ten standard deviations. A striking advance is that the repeatability from the dual-coincidence experiments is currently greater than 70%.

Molecular epidemiology of eastern equine encephalitis Virus, New York

USGS Publications Warehouse

Young, David S.; Kramer, Laura D.; Maffei, Joseph G.; Dusek, Robert J.; Backenson, P. Bryon; Mores, Christopher N.; Bernard, Kristen A.; Ebel, Gregory D.

2008-01-01

Perpetuation, overwintering, and extinction of eastern equine encephalitis virus (EEEV) in northern foci are poorly understood. We therefore sought to describe the molecular epidemiology of EEEV in New York State during current and past epizootics. To determine whether EEEV overwinters, is periodically reintroduced, or both, we sequenced the E2 and partial NSP3 coding regions of 42 EEEV isolates from New York State and the Eastern Seaboard of the United States. Our phylogenetic analyses indicated that derived subclades tended to contain southern strains that had been isolated before genetically similar northern strains, suggesting southern to northern migration of EEEV along the Eastern Seaboard. Strong clustering among strains isolated during epizootics in New York from 2003–2005, as well as from 1974–1975, demonstrates that EEEV has overwintered in this focus. This study provides molecular evidence for the introduction of southern EEEV strains to New York, followed by local amplification, perpetuation, and overwintering.

Applications of the RELAP5 code to the station blackout transients at the Browns Ferry Unit One Plant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schultz, R.R.; Wagoner, S.R.

1983-01-01

As a part of the charter of the Severe Accident Sequence Analysis (SASA) Program, station blackout transients have been analyzed using a RELAP5 model of the Browns Ferry Unit 1 Plant. The task was conducted as a partial fulfillment of the needs of the US Nuclear Regulatory Commission in examining the Unresolved Safety Issue A-44: Station Blackout (1) the station blackout transients were examined (a) to define the equipment needed to maintain a well cooled core, (b) to determine when core uncovery would occur given equipment failure, and (c) to characterize the behavior of the vessel thermal-hydraulics during the stationmore » blackout transients (in part as the plant operator would see it). These items are discussed in the paper. Conclusions and observations specific to the station blackout are presented.« less

Draft Genome Sequence of the Deinococcus-Thermus Bacterium Meiothermus ruber Strain A

DOE PAGES

Thiel, Vera; Tomsho, Lynn P.; Burhans, Richard; ...

2015-03-26

The draft genome sequence of the Deinococcus-Thermus group bacterium Meiothermus ruber strain A, isolated from a cyanobacterial enrichment culture obtained from Octopus Spring (Yellowstone National Park, WY), comprises 2,968,099 bp in 170 contigs. It is predicted to contain 2,895 protein-coding genes, 44 tRNA-coding genes, and 2 rRNA operons.