Sample records for partial exon skipping

  1. Reengineering a transmembrane protein to treat muscular dystrophy using exon skipping.

    PubMed

    Gao, Quan Q; Wyatt, Eugene; Goldstein, Jeff A; LoPresti, Peter; Castillo, Lisa M; Gazda, Alec; Petrossian, Natalie; Earley, Judy U; Hadhazy, Michele; Barefield, David Y; Demonbreun, Alexis R; Bönnemann, Carsten; Wolf, Matthew; McNally, Elizabeth M

    2015-11-02

    Exon skipping uses antisense oligonucleotides as a treatment for genetic diseases. The antisense oligonucleotides used for exon skipping are designed to bypass premature stop codons in the target RNA and restore reading frame disruption. Exon skipping is currently being tested in humans with dystrophin gene mutations who have Duchenne muscular dystrophy. For Duchenne muscular dystrophy, the rationale for exon skipping derived from observations in patients with naturally occurring dystrophin gene mutations that generated internally deleted but partially functional dystrophin proteins. We have now expanded the potential for exon skipping by testing whether an internal, in-frame truncation of a transmembrane protein γ-sarcoglycan is functional. We generated an internally truncated γ-sarcoglycan protein that we have termed Mini-Gamma by deleting a large portion of the extracellular domain. Mini-Gamma provided functional and pathological benefits to correct the loss of γ-sarcoglycan in a Drosophila model, in heterologous cell expression studies, and in transgenic mice lacking γ-sarcoglycan. We generated a cellular model of human muscle disease and showed that multiple exon skipping could be induced in RNA that encodes a mutant human γ-sarcoglycan. Since Mini-Gamma represents removal of 4 of the 7 coding exons in γ-sarcoglycan, this approach provides a viable strategy to treat the majority of patients with γ-sarcoglycan gene mutations.

  2. Reengineering a transmembrane protein to treat muscular dystrophy using exon skipping

    PubMed Central

    Gao, Quan Q.; Wyatt, Eugene; Goldstein, Jeff A.; LoPresti, Peter; Castillo, Lisa M.; Gazda, Alec; Petrossian, Natalie; Earley, Judy U.; Hadhazy, Michele; Barefield, David Y.; Demonbreun, Alexis R.; Bönnemann, Carsten; Wolf, Matthew; McNally, Elizabeth M.

    2015-01-01

    Exon skipping uses antisense oligonucleotides as a treatment for genetic diseases. The antisense oligonucleotides used for exon skipping are designed to bypass premature stop codons in the target RNA and restore reading frame disruption. Exon skipping is currently being tested in humans with dystrophin gene mutations who have Duchenne muscular dystrophy. For Duchenne muscular dystrophy, the rationale for exon skipping derived from observations in patients with naturally occurring dystrophin gene mutations that generated internally deleted but partially functional dystrophin proteins. We have now expanded the potential for exon skipping by testing whether an internal, in-frame truncation of a transmembrane protein γ-sarcoglycan is functional. We generated an internally truncated γ-sarcoglycan protein that we have termed Mini-Gamma by deleting a large portion of the extracellular domain. Mini-Gamma provided functional and pathological benefits to correct the loss of γ-sarcoglycan in a Drosophila model, in heterologous cell expression studies, and in transgenic mice lacking γ-sarcoglycan. We generated a cellular model of human muscle disease and showed that multiple exon skipping could be induced in RNA that encodes a mutant human γ-sarcoglycan. Since Mini-Gamma represents removal of 4 of the 7 coding exons in γ-sarcoglycan, this approach provides a viable strategy to treat the majority of patients with γ-sarcoglycan gene mutations. PMID:26457733

  3. Identification of Small Molecule and Genetic Modulators of AON-Induced Dystrophin Exon Skipping by High-Throughput Screening

    PubMed Central

    O'Leary, Debra A.; Sharif, Orzala; Anderson, Paul; Tu, Buu; Welch, Genevieve; Zhou, Yingyao; Caldwell, Jeremy S.; Engels, Ingo H.; Brinker, Achim

    2009-01-01

    One therapeutic approach to Duchenne Muscular Dystrophy (DMD) recently entering clinical trials aims to convert DMD phenotypes to that of a milder disease variant, Becker Muscular Dystrophy (BMD), by employing antisense oligonucleotides (AONs) targeting splice sites, to induce exon skipping and restore partial dystrophin function. In order to search for small molecule and genetic modulators of AON-dependent and independent exon skipping, we screened ∼10,000 known small molecule drugs, >17,000 cDNA clones, and >2,000 kinase- targeted siRNAs against a 5.6 kb luciferase minigene construct, encompassing exon 71 to exon 73 of human dystrophin. As a result, we identified several enhancers of exon skipping, acting on both the reporter construct as well as endogenous dystrophin in mdx cells. Multiple mechanisms of action were identified, including histone deacetylase inhibition, tubulin modulation and pre-mRNA processing. Among others, the nucleolar protein NOL8 and staufen RNA binding protein homolog 2 (Stau2) were found to induce endogenous exon skipping in mdx cells in an AON-dependent fashion. An unexpected but recurrent theme observed in our screening efforts was the apparent link between the inhibition of cell cycle progression and the induction of exon skipping. PMID:20020055

  4. Identification of small molecule and genetic modulators of AON-induced dystrophin exon skipping by high-throughput screening.

    PubMed

    O'Leary, Debra A; Sharif, Orzala; Anderson, Paul; Tu, Buu; Welch, Genevieve; Zhou, Yingyao; Caldwell, Jeremy S; Engels, Ingo H; Brinker, Achim

    2009-12-17

    One therapeutic approach to Duchenne Muscular Dystrophy (DMD) recently entering clinical trials aims to convert DMD phenotypes to that of a milder disease variant, Becker Muscular Dystrophy (BMD), by employing antisense oligonucleotides (AONs) targeting splice sites, to induce exon skipping and restore partial dystrophin function. In order to search for small molecule and genetic modulators of AON-dependent and independent exon skipping, we screened approximately 10,000 known small molecule drugs, >17,000 cDNA clones, and >2,000 kinase- targeted siRNAs against a 5.6 kb luciferase minigene construct, encompassing exon 71 to exon 73 of human dystrophin. As a result, we identified several enhancers of exon skipping, acting on both the reporter construct as well as endogenous dystrophin in mdx cells. Multiple mechanisms of action were identified, including histone deacetylase inhibition, tubulin modulation and pre-mRNA processing. Among others, the nucleolar protein NOL8 and staufen RNA binding protein homolog 2 (Stau2) were found to induce endogenous exon skipping in mdx cells in an AON-dependent fashion. An unexpected but recurrent theme observed in our screening efforts was the apparent link between the inhibition of cell cycle progression and the induction of exon skipping.

  5. Identification of a novel exonic mutation at -13 from 5' splice site causing exon skipping in a girl with mitochondrial acetoacetyl-coenzyme A thiolase deficiency.

    PubMed Central

    Fukao, T; Yamaguchi, S; Wakazono, A; Orii, T; Hoganson, G; Hashimoto, T

    1994-01-01

    We identified a novel exonic mutation which causes exon skipping in the mitochondrial acetoacetyl-CoA thiolase (T2) gene from a girl with T2 deficiency (GK07). GK07 is a compound heterozygote; the maternal allele has a novel G to T transversion at position 1136 causing Gly379 to Val substitution (G379V) of the T2 precursor. In case of in vivo expression analysis, cells transfected with this mutant cDNA showed no evidence of restored T2 activity. The paternal allele was associated with exon 8 skipping at the cDNA level. At the gene level, a C to T transition causing Gln272 to termination codon (Q272STOP) was identified within exon 8, 13 bp from the 5' splice site of intron 8 in the paternal allele. The mRNA with Q272STOP could not be detected in GK07 fibroblasts, presumably because pre-mRNA with Q272STOP was unstable because of the premature termination. In vivo splicing experiments revealed that the exonic mutation caused partial skipping of exon 8. This substitution was thought to alter the secondary structure of T2 pre-mRNA around exon 8 and thus impede normal splicing. The role of exon sequences in the splicing mechanism is indicated by the exon skipping which occurred with an exonic mutation. Images PMID:7907600

  6. Development of Exon Skipping Therapies for Duchenne Muscular Dystrophy: A Critical Review and a Perspective on the Outstanding Issues

    PubMed Central

    Aartsma-Rus, Annemieke; Straub, Volker; Hemmings, Robert; Haas, Manuel; Schlosser-Weber, Gabriele; Stoyanova-Beninska, Violeta; Mercuri, Eugenio; Muntoni, Francesco; Sepodes, Bruno; Vroom, Elizabeth

    2017-01-01

    Duchenne muscular dystrophy (DMD) is a rare, severe, progressive muscle-wasting disease leading to disability and premature death. Patients lack the muscle membrane-stabilizing protein dystrophin. Antisense oligonucleotide (AON)-mediated exon skipping is a therapeutic approach that aims to induce production of partially functional dystrophins. Recently, an AON targeting exon 51 became the first of its class to be approved by the United States regulators [Food and Drug Administration (FDA)] for the treatment of DMD. A unique aspect of the exon-skipping approach for DMD is that, depending on the size and location of the mutation, different exons need to be skipped. This challenge raises a number of questions regarding the development and regulatory approval of those individual compounds. In this study, we present a perspective on those questions, following a European stakeholder meeting involving academics, regulators, and representatives from industry and patient organizations, and in the light of the most recent scientific and regulatory experience. PMID:28796573

  7. Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials.

    PubMed

    Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S; Verschuuren, Jan J; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E; Muntoni, Francesco

    2011-12-01

    Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy.

  8. Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials

    PubMed Central

    Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S.; Verschuuren, Jan J.; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E.

    2011-01-01

    Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy. PMID:22102647

  9. MET exon 14 skipping defines a unique molecular class of non-small cell lung cancer.

    PubMed

    Zheng, Difan; Wang, Rui; Ye, Ting; Yu, Su; Hu, Haichuan; Shen, Xuxia; Li, Yuan; Ji, Hongbin; Sun, Yihua; Chen, Haiquan

    2016-07-05

    Recurrent MET exon 14 splicing has been revealed in lung cancers and is a promising therapeutic target. Because we have limited knowledge about the natural history of MET mutant tumors, the current study was aiming to determine the clinical and pathological characteristics in non-small cell lung cancers (NSCLC). Twenty-three patients (1.3%) were positive for MET exon 14 skipping. Patients with MET exon 14 skipping displayed unique characteristics: female, non-smokers, earlier pathology stage and older age. MET exon 14 skipping indicated an early event as other drivers in lung cancer, while MET copy number gain was more likely a late event in lung cancer. Overall survival (OS) of patients harboring MET exon 14 skipping was longer than patients with KRAS mutation. Almost four-fifths of the lung tumors with MET exon 14 skipping had EGFR and/or HER2 gene copy number gains. EGFR inhibitor showed moderate antitumor activity in treatment of a patient harboring MET exon 14 skipping. From October 2007 to June 2013, we screened 1770 patients with NSCLC and correlated MET status with clinical pathologic characteristics and mutations in EGFR, KRAS, BRAF, HER2, and ALK. Quantitative Real-Time PCR was used to detect MET gene copy number gain. Immunohistochemistry (IHC) was also performed to screen MET exon 14 skipping. Clinicopathological characteristics and survival information were analyzed. MET exon 14 skipping was detected in 1.3% (23/1770) of the Chinese patients with NSCLC. MET exon 14 skipping defined a new molecular subset of NSCLC with identifiable clinical characteristics. The therapeutic EGFR inhibitors might be an alternative treatment for patients with MET mutant NSCLC.

  10. Assessment of the feasibility of exon 45–55 multiexon skipping for duchenne muscular dystrophy

    PubMed Central

    van Vliet, Laura; de Winter, Christa L; van Deutekom, Judith CT; van Ommen, Gert-Jan B; Aartsma-Rus, Annemieke

    2008-01-01

    Background The specific skipping of an exon, induced by antisense oligonucleotides (AON) during splicing, has shown to be a promising therapeutic approach for Duchenne muscular dystrophy (DMD) patients. As different mutations require skipping of different exons, this approach is mutation dependent. The skipping of an entire stretch of exons (e.g. exons 45 to 55) has recently been suggested as an approach applicable to larger groups of patients. However, this multiexon skipping approach is technically challenging. The levels of intended multiexon skips are typically low and highly variable, and may be dependent on the order of intron removal. We hypothesized that the splicing order might favor the induction of multiexon 45–55 skipping. Methods We here tested the feasibility of inducing multiexon 45–55 in control and patient muscle cell cultures using various AON cocktails. Results In all experiments, the exon 45–55 skip frequencies were minimal and comparable to those observed in untreated cells. Conclusion We conclude that current state of the art does not sufficiently support clinical development of multiexon skipping for DMD. PMID:19046429

  11. Efficient exon skipping of SGCG mutations mediated by phosphorodiamidate morpholino oligomers.

    PubMed

    Wyatt, Eugene J; Demonbreun, Alexis R; Kim, Ellis Y; Puckelwartz, Megan J; Vo, Andy H; Dellefave-Castillo, Lisa M; Gao, Quan Q; Vainzof, Mariz; Pavanello, Rita C M; Zatz, Mayana; McNally, Elizabeth M

    2018-05-03

    Exon skipping uses chemically modified antisense oligonucleotides to modulate RNA splicing. Therapeutically, exon skipping can bypass mutations and restore reading frame disruption by generating internally truncated, functional proteins to rescue the loss of native gene expression. Limb-girdle muscular dystrophy type 2C is caused by autosomal recessive mutations in the SGCG gene, which encodes the dystrophin-associated protein γ-sarcoglycan. The most common SGCG mutations disrupt the transcript reading frame abrogating γ-sarcoglycan protein expression. In order to treat most SGCG gene mutations, it is necessary to skip 4 exons in order to restore the SGCG transcript reading frame, creating an internally truncated protein referred to as Mini-Gamma. Using direct reprogramming of human cells with MyoD, myogenic cells were tested with 2 antisense oligonucleotide chemistries, 2'-O-methyl phosphorothioate oligonucleotides and vivo-phosphorodiamidate morpholino oligomers, to induce exon skipping. Treatment with vivo-phosphorodiamidate morpholino oligomers demonstrated efficient skipping of the targeted exons and corrected the mutant reading frame, resulting in the expression of a functional Mini-Gamma protein. Antisense-induced exon skipping of SGCG occurred in normal cells and those with multiple distinct SGCG mutations, including the most common 521ΔT mutation. These findings demonstrate a multiexon-skipping strategy applicable to the majority of limb-girdle muscular dystrophy 2C patients.

  12. Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.

    PubMed

    Echigoya, Yusuke; Lim, Kenji Rowel Q; Trieu, Nhu; Bao, Bo; Miskew Nichols, Bailey; Vila, Maria Candida; Novak, James S; Hara, Yuko; Lee, Joshua; Touznik, Aleksander; Mamchaoui, Kamel; Aoki, Yoshitsugu; Takeda, Shin'ichi; Nagaraju, Kanneboyina; Mouly, Vincent; Maruyama, Rika; Duddy, William; Yokota, Toshifumi

    2017-11-01

    Duchenne muscular dystrophy (DMD), the most common lethal genetic disorder, is caused by mutations in the dystrophin (DMD) gene. Exon skipping is a therapeutic approach that uses antisense oligonucleotides (AOs) to modulate splicing and restore the reading frame, leading to truncated, yet functional protein expression. In 2016, the US Food and Drug Administration (FDA) conditionally approved the first phosphorodiamidate morpholino oligomer (morpholino)-based AO drug, eteplirsen, developed for DMD exon 51 skipping. Eteplirsen remains controversial with insufficient evidence of its therapeutic effect in patients. We recently developed an in silico tool to design antisense morpholino sequences for exon skipping. Here, we designed morpholino AOs targeting DMD exon 51 using the in silico tool and quantitatively evaluated the effects in immortalized DMD muscle cells in vitro. To our surprise, most of the newly designed morpholinos induced exon 51 skipping more efficiently compared with the eteplirsen sequence. The efficacy of exon 51 skipping and rescue of dystrophin protein expression were increased by up to more than 12-fold and 7-fold, respectively, compared with the eteplirsen sequence. Significant in vivo efficacy of the most effective morpholino, determined in vitro, was confirmed in mice carrying the human DMD gene. These findings underscore the importance of AO sequence optimization for exon skipping. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  13. Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications

    PubMed Central

    Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B.

    2007-01-01

    Antisense-mediated modulation of splicing is one of the few fields where antisense oligonucleotides (AONs) have been able to live up to their expectations. In this approach, AONs are implemented to restore cryptic splicing, to change levels of alternatively spliced genes, or, in case of Duchenne muscular dystrophy (DMD), to skip an exon in order to restore a disrupted reading frame. The latter allows the generation of internally deleted, but largely functional, dystrophin proteins and would convert a severe DMD into a milder Becker muscular dystrophy phenotype. In fact, exon skipping is currently one of the most promising therapeutic tools for DMD, and a successful first-in-man trial has recently been completed. In this review the applicability of exon skipping for DMD and other diseases is described. For DMD AONs have been designed for numerous exons, which has given us insight into their mode of action, splicing in general, and splicing of the DMD gene in particular. In addition, retrospective analysis resulted in guidelines for AON design for DMD and most likely other genes as well. This knowledge allows us to optimize therapeutic exon skipping, but also opens up a range of other applications for the exon skipping approach. PMID:17684229

  14. Systemic Delivery of Morpholinos to Skip Multiple Exons in a Dog Model of Duchenne Muscular Dystrophy.

    PubMed

    Maruyama, Rika; Echigoya, Yusuke; Caluseriu, Oana; Aoki, Yoshitsugu; Takeda, Shin'ichi; Yokota, Toshifumi

    2017-01-01

    Exon-skipping therapy is an emerging approach that uses synthetic DNA-like molecules called antisense oligonucleotides (AONs) to splice out frame-disrupting parts of mRNA, restore the reading frame, and produce truncated yet functional proteins. Multiple exon skipping utilizing a cocktail of AONs can theoretically treat 80-90% of patients with Duchenne muscular dystrophy (DMD). The success of multiple exon skipping by the systemic delivery of a cocktail of AONs called phosphorodiamidate morpholino oligomers (PMOs) in a DMD dog model has made a significant impact on the development of therapeutics for DMD, leading to clinical trials of PMO-based drugs. Here, we describe the systemic delivery of a cocktail of PMOs to skip multiple exons in dystrophic dogs and the evaluation of the efficacies and toxicity in vivo.

  15. Antisense Oligonucleotide-mediated Exon Skipping as a Systemic Therapeutic Approach for Recessive Dystrophic Epidermolysis Bullosa.

    PubMed

    Bremer, Jeroen; Bornert, Olivier; Nyström, Alexander; Gostynski, Antoni; Jonkman, Marcel F; Aartsma-Rus, Annemieke; van den Akker, Peter C; Pasmooij, Anna Mg

    2016-10-18

    The "generalized severe" form of recessive dystrophic epidermolysis bullosa (RDEB-gen sev) is caused by bi-allelic null mutations in COL7A1, encoding type VII collagen. The absence of type VII collagen leads to blistering of the skin and mucous membranes upon the slightest trauma. Because most patients carry exonic point mutations or small insertions/deletions, most exons of COL7A1 are in-frame, and low levels of type VII collagen already drastically improve the disease phenotype, this gene seems a perfect candidate for antisense oligonucleotide (AON)-mediated exon skipping. In this study, we examined the feasibility of AON-mediated exon skipping in vitro in primary cultured keratinocytes and fibroblasts, and systemically in vivo using a human skin-graft mouse model. We show that treatment with AONs designed against exon 105 leads to in-frame exon 105 skipping at the RNA level and restores type VII collagen protein production in vitro. Moreover, we demonstrate that systemic delivery in vivo induces de novo expression of type VII collagen in skin grafts generated from patient cells. Our data demonstrate strong proof-of-concept for AON-mediated exon skipping as a systemic therapeutic strategy for RDEB.

  16. Unusual splice site mutations disrupt FANCA exon 8 definition.

    PubMed

    Mattioli, Chiara; Pianigiani, Giulia; De Rocco, Daniela; Bianco, Anna Monica Rosaria; Cappelli, Enrico; Savoia, Anna; Pagani, Franco

    2014-07-01

    The pathological role of mutations that affect not conserved splicing regulatory sequences can be difficult to determine. In a patient with Fanconi anemia, we identified two unpredictable splicing mutations that act on either sides of FANCA exon 8. In patients-derived cells and in minigene splicing assay, we showed that both an apparently benign intronic c.710-5T>C transition and the nonsense c.790C>T substitution induce almost complete exon 8 skipping. Site-directed mutagenesis experiments indicated that the c.710-5T>C transition affects a polypyrimidine tract where most of the thymidines cannot be compensated by cytidines. The c.790C>T mutation located in position -3 relative to the donor site induce exon 8 skipping in an NMD-independent manner and complementation experiments with modified U1 snRNAs showed that U1 snRNP is only partially involved in the splicing defect. Our results highlight the importance of performing splicing functional assay for correct identification of disease-causing mechanism of genomic variants and provide mechanistic insights on how these two FANCA mutations affect exon 8 definition. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Basal exon skipping and nonsense-associated altered splicing allows bypassing complete CEP290 loss-of-function in individuals with unusually mild retinal disease.

    PubMed

    Barny, Iris; Perrault, Isabelle; Michel, Christel; Soussan, Mickael; Goudin, Nicolas; Rio, Marlène; Thomas, Sophie; Attié-Bitach, Tania; Hamel, Christian; Dollfus, Hélène; Kaplan, Josseline; Rozet, Jean-Michel; Gerard, Xavier

    2018-05-16

    CEP290 mutations cause a spectrum of ciliopathies from Leber congenital amaurosis type 10 (LCA10) to embryo-lethal Meckel syndrome (MKS). Using panel-based molecular diagnosis testing for inherited retinal diseases, we identified two individuals with some preserved vision despite biallelism for presumably truncating CEP290 mutations. The first one carried a homozygous 1 base-pair deletion in exon 17, introducing a premature termination codon (PTC) in exon 18 (c.1666del; p.Ile556Phefs*17). mRNA analysis revealed a basal exon skipping (BES) of exon 18, providing mutant cells with the ability to escape protein truncation, while disrupting the reading frame in controls. The second individual harbored compound heterozygous nonsense mutations in exon 8 (c.508A>T, p.Lys170*) and exon 32 (c.4090G>T, p.Glu1364*), respectively. Some CEP290 lacking exon 8 were detected in mutant fibroblasts but not in controls whereas some skipping of exon 32 occurred in both lines, but with higher amplitude in the mutant. Considering that the deletion of either exon maintains the reading frame in either line, skipping in mutant cells likely involves nonsense-associated altered splicing (NAS) alone (exon 8), or with BES (exon 32). Skipping of PTC-containing exons in mutant cells allowed production of CEP290 isoforms with preserved ability to assemble into a high molecular weight complex and to interact efficiently with proteins important for cilia formation and intraflagellar trafficking. In contrast, studying LCA10 and MKS fibroblasts we show moderate to severe cilia alterations, providing support for a correlation between disease severity and the ability of cells to express shortened, yet functional, CEP290 isoforms.

  18. In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

    PubMed Central

    Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

    2015-01-01

    The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

  19. A compatible exon-exon junction database for the identification of exon skipping events using tandem mass spectrum data.

    PubMed

    Mo, Fan; Hong, Xu; Gao, Feng; Du, Lin; Wang, Jun; Omenn, Gilbert S; Lin, Biaoyang

    2008-12-16

    Alternative splicing is an important gene regulation mechanism. It is estimated that about 74% of multi-exon human genes have alternative splicing. High throughput tandem (MS/MS) mass spectrometry provides valuable information for rapidly identifying potentially novel alternatively-spliced protein products from experimental datasets. However, the ability to identify alternative splicing events through tandem mass spectrometry depends on the database against which the spectra are searched. We wrote scripts in perl, Bioperl, mysql and Ensembl API and built a theoretical exon-exon junction protein database to account for all possible combinations of exons for a gene while keeping the frame of translation (i.e., keeping only in-phase exon-exon combinations) from the Ensembl Core Database. Using our liver cancer MS/MS dataset, we identified a total of 488 non-redundant peptides that represent putative exon skipping events. Our exon-exon junction database provides the scientific community with an efficient means to identify novel alternatively spliced (exon skipping) protein isoforms using mass spectrometry data. This database will be useful in annotating genome structures using rapidly accumulating proteomics data.

  20. Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy

    PubMed Central

    Nguyen, Quynh

    2017-01-01

    Duchenne muscular dystrophy (DMD) is a lethal genetic disorder that most commonly results from mutations disrupting the reading frame of the dystrophin (DMD) gene. Among the therapeutic approaches employed, exon skipping using antisense oligonucleotides (AOs) is one of the most promising strategies. This strategy aims to restore the reading frame, thus producing a truncated, yet functioning dystrophin protein. In 2016, the Food and Drug Administration (FDA) conditionally approved the first AO-based drug, eteplirsen (Exondys 51), developed for DMD exon 51 skipping. An accurate and reproducible method to quantify exon skipping efficacy is essential for evaluating the therapeutic potential of different AOs sequences. However, previous in vitro screening studies have been hampered by the limited proliferative capacity and insufficient amounts of dystrophin expressed by primary muscle cell lines that have been the main system used to evaluate AOs sequences. In this paper, we illustrate the challenges associated with primary muscle cell lines and describe a novel approach that utilizes immortalized cell lines to quantitatively evaluate the exon skipping efficacy in in vitro studies. PMID:29035327

  1. Cwf16p Associating with the Nineteen Complex Ensures Ordered Exon Joining in Constitutive Pre-mRNA Splicing in Fission Yeast

    PubMed Central

    Sasaki-Haraguchi, Noriko; Ikuyama, Takeshi; Yoshii, Shogo; Takeuchi-Andoh, Tomoko; Frendewey, David; Tani, Tokio

    2015-01-01

    Exons are ligated in an ordered manner without the skipping of exons in the constitutive splicing of pre-mRNAs with multiple introns. To identify factors ensuring ordered exon joining in constitutive pre-mRNA splicing, we previously screened for exon skipping mutants in Schizosaccharomyces pombe using a reporter plasmid, and characterized three exon skipping mutants named ods1 (ordered splicing 1), ods2, and ods3, the responsible genes of which encode Prp2/U2AF59, U2AF23, and SF1, respectively. They form an SF1-U2AF59-U2AF23 complex involved in recognition of the branch and 3′ splice sites in pre-mRNA. In the present study, we identified a fourth ods mutant, ods4, which was isolated in an exon-skipping screen. The ods4 + gene encodes Cwf16p, which interacts with the NineTeen Complex (NTC), a complex thought to be involved in the first catalytic step of the splicing reaction. We isolated two multi-copy suppressors for the ods4-1 mutation, Srp2p, an SR protein essential for pre-mRNA splicing, and Tif213p, a translation initiation factor, in S. pombe. The overexpression of Srp2p suppressed the exon-skipping phenotype of all ods mutants, whereas Tif213p suppressed only ods4-1, which has a mutation in the translational start codon of the cwf16 gene. We also showed that the decrease in the transcriptional elongation rate induced by drug treatment suppressed exon skipping in ods4-1. We propose that Cwf16p/NTC participates in the early recognition of the branch and 3′ splice sites and cooperates with the SF1-U2AF59-U2AF23 complex to maintain ordered exon joining. PMID:26302002

  2. Intron self-complementarity enforces exon inclusion in a yeast pre-mRNA

    PubMed Central

    Howe, Kenneth James; Ares, Manuel

    1997-01-01

    Skipping of internal exons during removal of introns from pre-mRNA must be avoided for proper expression of most eukaryotic genes. Despite significant understanding of the mechanics of intron removal, mechanisms that ensure inclusion of internal exons in multi-intron pre-mRNAs remain mysterious. Using a natural two-intron yeast gene, we have identified distinct RNA–RNA complementarities within each intron that prevent exon skipping and ensure inclusion of internal exons. We show that these complementarities are positioned to act as intron identity elements, bringing together only the appropriate 5′ splice sites and branchpoints. Destroying either intron self-complementarity allows exon skipping to occur, and restoring the complementarity using compensatory mutations rescues exon inclusion, indicating that the elements act through formation of RNA secondary structure. Introducing new pairing potential between regions near the 5′ splice site of intron 1 and the branchpoint of intron 2 dramatically enhances exon skipping. Similar elements identified in single intron yeast genes contribute to splicing efficiency. Our results illustrate how intron secondary structure serves to coordinate splice site pairing and enforce exon inclusion. We suggest that similar elements in vertebrate genes could assist in the splicing of very large introns and in the evolution of alternative splicing. PMID:9356473

  3. Histone hyperacetylation and exon skipping: a calcium-mediated dynamic regulation in cardiomyocytes

    PubMed Central

    Sharma, Alok; Nguyen, Hieu; Cai, Lu; Lou, Hua

    2015-01-01

    In contrast to cell type-specific pre-mRNA alternative splicing, mechanisms controlling activity-dependent alternative splicing is under-studied and not well understood. In a recent study, we conducted a comprehensive analysis of calcium-mediated mechanism that regulates alternative exon skipping in mouse cardiomyocytes. Our results reveal a strong link between histone hyperacetylation and skipping of cassette exons, and provide support to the kinetic coupling model of the epigenetic regulation of alternative splicing at the chromatin level. PMID:26325491

  4. HnRNP C, YB-1 and hnRNP L coordinately enhance skipping of human MUSK exon 10 to generate a Wnt-insensitive MuSK isoform

    PubMed Central

    Nasrin, Farhana; Rahman, Mohammad Alinoor; Masuda, Akio; Ohe, Kenji; Takeda, Jun-ichi; Ohno, Kinji

    2014-01-01

    Muscle specific receptor tyrosine kinase (MuSK) is an essential postsynaptic transmembrane molecule that mediates clustering of acetylcholine receptors (AChR). MUSK exon 10 is alternatively skipped in human, but not in mouse. Skipping of this exon disrupts a cysteine-rich region (Fz-CRD), which is essential for Wnt-mediated AChR clustering. To investigate the underlying mechanisms of alternative splicing, we exploited block-scanning mutagenesis with human minigene and identified a 20-nucleotide block that contained exonic splicing silencers. Using RNA-affinity purification, mass spectrometry, and Western blotting, we identified that hnRNP C, YB-1 and hnRNP L are bound to MUSK exon 10. siRNA-mediated knockdown and cDNA overexpression confirmed the additive, as well as the independent, splicing suppressing effects of hnRNP C, YB-1 and hnRNP L. Antibody-mediated in vitro protein depletion and scanning mutagenesis additionally revealed that binding of hnRNP C to RNA subsequently promotes binding of YB-1 and hnRNP L to the immediate downstream sites and enhances exon skipping. Simultaneous tethering of two splicing trans-factors to the target confirmed the cooperative effect of YB-1 and hnRNP L on hnRNP C-mediated exon skipping. Search for a similar motif in the human genome revealed nine alternative exons that were individually or coordinately regulated by hnRNP C and YB-1. PMID:25354590

  5. Oxidative Stress Triggers Body-Wide Skipping of Multiple Exons of the Spinal Muscular Atrophy Gene

    PubMed Central

    Seo, Joonbae; Singh, Natalia N.; Ottesen, Eric W.; Sivanesan, Senthilkumar; Shishimorova, Maria; Singh, Ravindra N.

    2016-01-01

    Humans carry two nearly identical copies of Survival Motor Neuron gene: SMN1 and SMN2. Loss of SMN1 leads to spinal muscular atrophy (SMA), the most frequent genetic cause of infant mortality. While SMN2 cannot compensate for the loss of SMN1 due to predominant skipping of exon 7, correction of SMN2 exon 7 splicing holds the promise of a cure for SMA. Previously, we used cell-based models coupled with a multi-exon-skipping detection assay (MESDA) to demonstrate the vulnerability of SMN2 exons to aberrant splicing under the conditions of oxidative stress (OS). Here we employ a transgenic mouse model and MESDA to examine the OS-induced splicing regulation of SMN2 exons. We induced OS using paraquat that is known to trigger production of reactive oxygen species and cause mitochondrial dysfunction. We show an overwhelming co-skipping of SMN2 exon 5 and exon 7 under OS in all tissues except testis. We also show that OS increases skipping of SMN2 exon 3 in all tissues except testis. We uncover several new SMN2 splice isoforms expressed at elevated levels under the conditions of OS. We analyze cis-elements and transacting factors to demonstrate the diversity of mechanisms for splicing misregulation under OS. Our results of proteome analysis reveal downregulation of hnRNP H as one of the potential consequences of OS in brain. Our findings suggest SMN2 as a sensor of OS with implications to SMA and other diseases impacted by low levels of SMN protein. PMID:27111068

  6. Analysis of the functional consequences of targeted exon deletion in COL7A1 reveals prospects for dystrophic epidermolysis bullosa therapy

    PubMed Central

    Bornert, Olivier; Kühl, Tobias; Bremer, Jeroen; van den Akker, Peter C; Pasmooij, Anna MG; Nyström, Alexander

    2016-01-01

    Genetically evoked deficiency of collagen VII causes dystrophic epidermolysis bullosa (DEB)—a debilitating disease characterized by chronic skin fragility and progressive fibrosis. Removal of exons carrying frame-disrupting mutations can reinstate protein expression in genetic diseases. The therapeutic potential of this approach is critically dependent on gene, protein, and disease intrinsic factors. Naturally occurring exon skipping in COL7A1, translating collagen VII, suggests that skipping of exons containing disease-causing mutations may be feasible for the treatment of DEB. However, despite a primarily in-frame arrangement of exons in the COL7A1 gene, no general conclusion of the aptitude of exon skipping for DEB can be drawn, since regulation of collagen VII functionality is complex involving folding, intra- and intermolecular interactions. To directly address this, we deleted two conceptually important exons located at both ends of COL7A1, exon 13, containing recurrent mutations, and exon 105, predicted to impact folding. The resulting recombinantly expressed proteins showed conserved functionality in biochemical and in vitro assays. Injected into DEB mice, the proteins promoted skin stability. By demonstrating functionality of internally deleted collagen VII variants, our study provides support of targeted exon deletion or skipping as a potential therapy to treat a large number of individuals with DEB. PMID:27157667

  7. Genetic variation affecting exon skipping contributes to brain structural atrophy in Alzheimer's disease.

    PubMed

    Lee, Younghee; Han, Seonggyun; Kim, Dongwook; Kim, Dokyoon; Horgousluoglu, Emrin; Risacher, Shannon L; Saykin, Andrew J; Nho, Kwangsik

    2018-01-01

    Genetic variation in cis-regulatory elements related to splicing machinery and splicing regulatory elements (SREs) results in exon skipping and undesired protein products. We developed a splicing decision model to identify actionable loci among common SNPs for gene regulation. The splicing decision model identified SNPs affecting exon skipping by analyzing sequence-driven alternative splicing (AS) models and by scanning the genome for the regions with putative SRE motifs. We used non-Hispanic Caucasians with neuroimaging, and fluid biomarkers for Alzheimer's disease (AD) and identified 17,088 common exonic SNPs affecting exon skipping. GWAS identified one SNP (rs1140317) in HLA-DQB1 as significantly associated with entorhinal cortical thickness, AD neuroimaging biomarker, after controlling for multiple testing. Further analysis revealed that rs1140317 was significantly associated with brain amyloid-f deposition (PET and CSF). HLA-DQB1 is an essential immune gene and may regulate AS, thereby contributing to AD pathology. SRE may hold potential as novel therapeutic targets for AD.

  8. Therapeutic NOTCH3 cysteine correction in CADASIL using exon skipping: in vitro proof of concept.

    PubMed

    Rutten, Julie W; Dauwerse, Hans G; Peters, Dorien J M; Goldfarb, Andrew; Venselaar, Hanka; Haffner, Christof; van Ommen, Gert-Jan B; Aartsma-Rus, Annemieke M; Lesnik Oberstein, Saskia A J

    2016-04-01

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, or CADASIL, is a hereditary cerebral small vessel disease caused by characteristic cysteine altering missense mutations in the NOTCH3 gene. NOTCH3 mutations in CADASIL result in an uneven number of cysteine residues in one of the 34 epidermal growth factor like-repeat (EGFr) domains of the NOTCH3 protein. The consequence of an unpaired cysteine residue in an EGFr domain is an increased multimerization tendency of mutant NOTCH3, leading to toxic accumulation of the protein in the (cerebro)vasculature, and ultimately reduced cerebral blood flow, recurrent stroke and vascular dementia. There is no therapy to delay or alleviate symptoms in CADASIL. We hypothesized that exclusion of the mutant EGFr domain from NOTCH3 would abolish the detrimental effect of the unpaired cysteine and thus prevent toxic NOTCH3 accumulation and the negative cascade of events leading to CADASIL. To accomplish this NOTCH3 cysteine correction by EGFr domain exclusion, we used pre-mRNA antisense-mediated skipping of specific NOTCH3 exons. Selection of these exons was achieved using in silico studies and based on the criterion that skipping of a particular exon or exon pair would modulate the protein in such a way that the mutant EGFr domain is eliminated, without otherwise corrupting NOTCH3 structure and function. Remarkably, we found that this strategy closely mimics evolutionary events, where the elimination and fusion of NOTCH EGFr domains led to the generation of four functional NOTCH homologues. We modelled a selection of exon skip strategies using cDNA constructs and show that the skip proteins retain normal protein processing, can bind ligand and be activated by ligand. We then determined the technical feasibility of targeted NOTCH3 exon skipping, by designing antisense oligonucleotides targeting exons 2-3, 4-5 and 6, which together harbour the majority of distinct CADASIL-causing mutations. Transfection of these antisense oligonucleotides into CADASIL patient-derived cerebral vascular smooth muscle cells resulted in successful exon skipping, without abrogating NOTCH3 signalling. Combined, these data provide proof of concept for this novel application of exon skipping, and are a first step towards the development of a rational therapeutic approach applicable to up to 94% of CADASIL-causing mutations. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. In vivo effects on intron retention and exon skipping by the U2AF large subunit and SF1/BBP in the nematode Caenorhabditis elegans

    PubMed Central

    Ma, Long; Tan, Zhiping; Teng, Yanling; Hoersch, Sebastian; Horvitz, H. Robert

    2011-01-01

    The in vivo analysis of the roles of splicing factors in regulating alternative splicing in animals remains a challenge. Using a microarray-based screen, we identified a Caenorhabditis elegans gene, tos-1, that exhibited three of the four major types of alternative splicing: intron retention, exon skipping, and, in the presence of U2AF large subunit mutations, the use of alternative 3′ splice sites. Mutations in the splicing factors U2AF large subunit and SF1/BBP altered the splicing of tos-1. 3′ splice sites of the retained intron or before the skipped exon regulate the splicing pattern of tos-1. Our study provides in vivo evidence that intron retention and exon skipping can be regulated largely by the identities of 3′ splice sites. PMID:22033331

  10. Context Dependent Effects of Chimeric Peptide Morpholino Conjugates Contribute to Dystrophin Exon-skipping Efficiency.

    PubMed

    Yin, Haifang; Boisguerin, Prisca; Moulton, Hong M; Betts, Corinne; Seow, Yiqi; Boutilier, Jordan; Wang, Qingsong; Walsh, Anthony; Lebleu, Bernard; Wood, Matthew Ja

    2013-09-24

    We have recently reported that cell-penetrating peptides (CPPs) and novel chimeric peptides containing CPP (referred as B peptide) and muscle-targeting peptide (referred as MSP) motifs significantly improve the systemic exon-skipping activity of morpholino phosphorodiamidate oligomers (PMOs) in dystrophin-deficient mdx mice. In the present study, the general mechanistic significance of the chimeric peptide configuration on the activity and tissue uptake of peptide conjugated PMOs in vivo was investigated. Four additional chimeric peptide-PMO conjugates including newly identified peptide 9 (B-9-PMO and 9-B-PMO) and control peptide 3 (B-3-PMO and 3-B-PMO) were tested in mdx mice. Immunohistochemical staining, RT-PCR and western blot results indicated that B-9-PMO induced significantly higher level of exon skipping and dystrophin restoration than its counterpart (9-B-PMO), further corroborating the notion that the activity of chimeric peptide-PMO conjugates is dependent on relative position of the tissue-targeting peptide motif within the chimeric peptide with respect to PMOs. Subsequent mechanistic studies showed that enhanced cellular uptake of B-MSP-PMO into muscle cells leads to increased exon-skipping activity in comparison with MSP-B-PMO. Surprisingly, further evidence showed that the uptake of chimeric peptide-PMO conjugates of both orientations (B-MSP-PMO and MSP-B-PMO) was ATP- and temperature-dependent and also partially mediated by heparan sulfate proteoglycans (HSPG), indicating that endocytosis is likely the main uptake pathway for both chimeric peptide-PMO conjugates. Collectively, our data demonstrate that peptide orientation in chimeric peptides is an important parameter that determines cellular uptake and activity when conjugated directly to oligonucleotides. These observations provide insight into the design of improved cell targeting compounds for future therapeutics studies.Molecular Therapy-Nucleic Acids (2013) 2, e124; doi:10.1038/mtna.2013.51; published online 24 September 2013.

  11. Hereditary vitamin D resistant rickets: identification of a novel splice site mutation in the vitamin D receptor gene and successful treatment with oral calcium therapy.

    PubMed

    Ma, Nina S; Malloy, Peter J; Pitukcheewanont, Pisit; Dreimane, Daina; Geffner, Mitchell E; Feldman, David

    2009-10-01

    To study the vitamin D receptor (VDR) gene in a young girl with severe rickets and clinical features of hereditary vitamin D resistant rickets, including hypocalcemia, hypophosphatemia, partial alopecia, and elevated serum levels of 1,25-dihydroxyvitamin D. We amplified and sequenced DNA samples from blood from the patient, her mother, and the patient's two siblings. We also amplified and sequenced the VDR cDNA from RNA isolated from the patient's blood. DNA sequence analyses of the VDR gene showed that the patient was homozygous for a novel guanine to thymine substitution in the 5'-splice site in the exon 8-intron J junction. Analysis of the VDR cDNA using reverse transcriptase-polymerase chain reaction showed that exons 7 and 9 were fused, and that exon 8 was skipped. The mother was heterozygous for the mutation and the two siblings were unaffected. A novel splice site mutation was identified in the VDR gene that caused exon 8 to be skipped. The mutation deleted amino acids 303-341 in the VDR ligand-binding domain, which is expected to render the VDR non-functional. Nevertheless, successful outpatient treatment was achieved with frequent high doses of oral calcium.

  12. Modulating Calcium Signals to Boost AON Exon Skipping for DMD

    DTIC Science & Technology

    2016-10-01

    RNA Seq analysis to identify mechanisms of activity and specificity in order to guide discovery of second-generation skipping drugs or combinations...with greater activity. 15. SUBJECT TERMS Exon skipping, Dantrolene, Calcium, Duchenne, Dytrophy, Dystrophin, anti-sense-oligonucleatide, DMD, RNA ...for a subset of very rare mutations. Finally, we hypothesize that by combining chemical genomics with RNA Seq analysis we can begin to identify

  13. Ameliorating pathogenesis by removing an exon containing a missense mutation: a potential exon-skipping therapy for laminopathies.

    PubMed

    Scharner, J; Figeac, N; Ellis, J A; Zammit, P S

    2015-06-01

    Exon skipping, as a therapy to restore a reading frame or switch protein isoforms, is under clinical trial. We hypothesised that removing an in-frame exon containing a mutation could also improve pathogenic phenotypes. Our model is laminopathies: incurable tissue-specific degenerative diseases associated with LMNA mutations. LMNA encodes A-type lamins, that together with B-type lamins, form the nuclear lamina. Lamins contain an alpha-helical central rod domain composed of multiple heptad repeats. Eliminating LMNA exon 3 or 5 removes six heptad repeats, so shortens, but should not otherwise significantly alter, the alpha-helix. Human Lamin A or Lamin C with a deletion corresponding to amino acids encoded by exon 5 (Lamin A/C-Δ5) localised normally in murine lmna-null cells, rescuing both nuclear shape and endogenous Lamin B1/emerin distribution. However, Lamin A carrying pathogenic mutations in exon 3 or 5, or Lamin A/C-Δ3, did not. Furthermore, Lamin A/C-Δ5 was not deleterious to wild-type cells, unlike the other Lamin A mutants including Lamin A/C-Δ3. Thus Lamin A/C-Δ5 function as effectively as wild-type Lamin A/C and better than mutant versions. Antisense oligonucleotides skipped LMNA exon 5 in human cells, demonstrating the possibility of treating certain laminopathies with this approach. This proof-of-concept is the first to report the therapeutic potential of exon skipping for diseases arising from missense mutations.

  14. Longitudinal effect of eteplirsen versus historical control on ambulation in Duchenne muscular dystrophy

    PubMed Central

    Goemans, Nathalie; Lowes, Linda P.; Alfano, Lindsay N.; Berry, Katherine; Shao, James; Kaye, Edward M.; Mercuri, Eugenio; Hamid, Hoda Abdel; Byrne, Barry J.; Connolly, Anne M.; Dracker, Robert A.; Matthew Frank, L.; Heydemann, Peter T.; O'Brien, Kevin C.; Sparks, Susan E.; Specht, Linda A.; Rodino‐Klapac, Louise; Sahenk, Zarife; Al‐Zaidy, Samiah; Cripe, Linda H.; Lewis, Sarah; M, Pane; E, Mazzone; S, Messina; GL, Vita; Bertini, D Amico A; Casimiro, Berardinelli A; Y, Torrente; F, Magri; GP, Comi; G, Baranello; T, Mongini; A, Pini; R, Battini; E, Pegoraro; C, Bruno; L, Politano; S, Previtali

    2016-01-01

    Objective To continue evaluation of the long‐term efficacy and safety of eteplirsen, a phosphorodiamidate morpholino oligomer designed to skip DMD exon 51 in patients with Duchenne muscular dystrophy (DMD). Three‐year progression of eteplirsen‐treated patients was compared to matched historical controls (HC). Methods Ambulatory DMD patients who were ≥7 years old and amenable to exon 51 skipping were randomized to eteplirsen (30/50mg/kg) or placebo for 24 weeks. Thereafter, all received eteplirsen on an open‐label basis. The primary functional assessment in this study was the 6‐Minute Walk Test (6MWT). Respiratory muscle function was assessed by pulmonary function testing (PFT). Longitudinal natural history data were used for comparative analysis of 6MWT performance at baseline and months 12, 24, and 36. Patients were matched to the eteplirsen group based on age, corticosteroid use, and genotype. Results At 36 months, eteplirsen‐treated patients (n = 12) demonstrated a statistically significant advantage of 151m (p < 0.01) on 6MWT and experienced a lower incidence of loss of ambulation in comparison to matched HC (n = 13) amenable to exon 51 skipping. PFT results remained relatively stable in eteplirsen‐treated patients. Eteplirsen was well tolerated. Analysis of HC confirmed the previously observed change in disease trajectory at age 7 years, and more severe progression was observed in patients with mutations amenable to exon skipping than in those not amenable. The subset of patients amenable to exon 51 skipping showed a more severe disease course than those amenable to any exon skipping. Interpretation Over 3 years of follow‐up, eteplirsen‐treated patients showed a slower rate of decline in ambulation assessed by 6MWT compared to untreated matched HC. Ann Neurol 2016;79:257–271 PMID:26573217

  15. Antisense oligonucleotide-induced alternative splicing of the APOB mRNA generates a novel isoform of APOB.

    PubMed

    Khoo, Bernard; Roca, Xavier; Chew, Shern L; Krainer, Adrian R

    2007-01-17

    Apolipoprotein B (APOB) is an integral part of the LDL, VLDL, IDL, Lp(a) and chylomicron lipoprotein particles. The APOB pre-mRNA consists of 29 constitutively-spliced exons. APOB exists as two natural isoforms: the full-length APOB100 isoform, assembled into LDL, VLDL, IDL and Lp(a) and secreted by the liver in humans; and the C-terminally truncated APOB48, assembled into chylomicrons and secreted by the intestine in humans. Down-regulation of APOB100 is a potential therapy to lower circulating LDL and cholesterol levels. We investigated the ability of 2'O-methyl RNA antisense oligonucleotides (ASOs) to induce the skipping of exon 27 in endogenous APOB mRNA in HepG2 cells. These ASOs are directed towards the 5' and 3' splice-sites of exon 27, the branch-point sequence (BPS) of intron 26-27 and several predicted exonic splicing enhancers within exon 27. ASOs targeting either the 5' or 3' splice-site, in combination with the BPS, are the most effective. The splicing of other alternatively spliced genes are not influenced by these ASOs, suggesting that the effects seen are not due to non-specific changes in alternative splicing. The skip 27 mRNA is translated into a truncated isoform, APOB87SKIP27. The induction of APOB87SKIP27 expression in vivo should lead to decreased LDL and cholesterol levels, by analogy to patients with hypobetalipoproteinemia. As intestinal APOB mRNA editing and APOB48 expression rely on sequences within exon 26, exon 27 skipping should not affect APOB48 expression unlike other methods of down-regulating APOB100 expression which also down-regulate APOB48.

  16. A Duchenne Muscular Dystrophy Gene Hot Spot Mutation in Dystrophin-Deficient Cavalier King Charles Spaniels Is Amenable to Exon 51 Skipping

    PubMed Central

    Walmsley, Gemma L.; Arechavala-Gomeza, Virginia; Fernandez-Fuente, Marta; Burke, Margaret M.; Nagel, Nicole; Holder, Angela; Stanley, Rachael; Chandler, Kate; Marks, Stanley L.; Muntoni, Francesco; Shelton, G. Diane; Piercy, Richard J.

    2010-01-01

    Background Duchenne muscular dystrophy (DMD), which afflicts 1 in 3500 boys, is one of the most common genetic disorders of children. This fatal degenerative condition is caused by an absence or deficiency of dystrophin in striated muscle. Most affected patients have inherited or spontaneous deletions in the dystrophin gene that disrupt the reading frame resulting in unstable truncated products. For these patients, restoration of the reading frame via antisense oligonucleotide-mediated exon skipping is a promising therapeutic approach. The major DMD deletion “hot spot” is found between exons 45 and 53, and skipping exon 51 in particular is predicted to ameliorate the dystrophic phenotype in the greatest number of patients. Currently the mdx mouse is the most widely used animal model of DMD, although its mild phenotype limits its suitability in clinical trials. The Golden Retriever muscular dystrophy (GRMD) model has a severe phenotype, but due to its large size, is expensive to use. Both these models have mutations in regions of the dystrophin gene distant from the commonly mutated DMD “hot spot”. Methodology/Principal Findings Here we describe the severe phenotype, histopathological findings, and molecular analysis of Cavalier King Charles Spaniels with dystrophin-deficient muscular dystrophy (CKCS-MD). The dogs harbour a missense mutation in the 5′ donor splice site of exon 50 that results in deletion of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein. Antisense oligonucleotide-mediated skipping of exon 51 in cultured myoblasts from an affected dog restored the reading frame and protein expression. Conclusions/Significance Given the small size of the breed, the amiable temperament and the nature of the mutation, we propose that CKCS-MD is a valuable new model for clinical trials of antisense oligonucleotide-induced exon skipping and other therapeutic approaches for DMD. PMID:20072625

  17. Muscle function recovery in golden retriever muscular dystrophy after AAV1-U7 exon skipping.

    PubMed

    Vulin, Adeline; Barthélémy, Inès; Goyenvalle, Aurélie; Thibaud, Jean-Laurent; Beley, Cyriaque; Griffith, Graziella; Benchaouir, Rachid; le Hir, Maëva; Unterfinger, Yves; Lorain, Stéphanie; Dreyfus, Patrick; Voit, Thomas; Carlier, Pierre; Blot, Stéphane; Garcia, Luis

    2012-11-01

    Duchenne muscular dystrophy (DMD) is an X-linked recessive disorder resulting from lesions of the gene encoding dystrophin. These usually consist of large genomic deletions, the extents of which are not correlated with the severity of the phenotype. Out-of-frame deletions give rise to dystrophin deficiency and severe DMD phenotypes, while internal deletions that produce in-frame mRNAs encoding truncated proteins can lead to a milder myopathy known as Becker muscular dystrophy (BMD). Widespread restoration of dystrophin expression via adeno-associated virus (AAV)-mediated exon skipping has been successfully demonstrated in the mdx mouse model and in cardiac muscle after percutaneous transendocardial delivery in the golden retriever muscular dystrophy dog (GRMD) model. Here, a set of optimized U7snRNAs carrying antisense sequences designed to rescue dystrophin were delivered into GRMD skeletal muscles by AAV1 gene transfer using intramuscular injection or forelimb perfusion. We show sustained correction of the dystrophic phenotype in extended muscle areas and partial recovery of muscle strength. Muscle architecture was improved and fibers displayed the hallmarks of mature and functional units. A 5-year follow-up ruled out immune rejection drawbacks but showed a progressive decline in the number of corrected muscle fibers, likely due to the persistence of a mild dystrophic process such as occurs in BMD phenotypes. Although AAV-mediated exon skipping was shown safe and efficient to rescue a truncated dystrophin, it appears that recurrent treatments would be required to maintain therapeutic benefit ahead of the progression of the disease.

  18. A role for exon sequences in alternative splicing of the human fibronectin gene.

    PubMed Central

    Mardon, H J; Sebastio, G; Baralle, F E

    1987-01-01

    Exon EDIIIA of the fibronectin (Fn) gene is alternatively spliced via pathways which either skip or include the whole exon in the messenger RNA (mRNA). We have investigated the role of EDIIIA exon sequences in the human Fn gene in determining alternative splicing of this exon during transient expression of alpha globin/Fn minigene hybrids in HeLa cells. We demonstrate that a DNA sequence of 81bp within the central region of exon EDIIIA is required for alternative splicing during processing of the primary transcript to generate both EDIIIA+ and EDIIIA- mRNA's. Furthermore, alternative splicing of EDIIIA only occurs when this sequence is present in the correct orientation since when it is in antisense orientation splicing always occurs via exon-skipping generating EDIIIA- mRNA. Images PMID:3671064

  19. Exon skipping and gene transfer restore dystrophin expression in human induced pluripotent stem cells-cardiomyocytes harboring DMD mutations.

    PubMed

    Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns; Denning, Chris

    2013-10-15

    With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47-50 or 48-50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart.

  20. Exon Skipping and Gene Transfer Restore Dystrophin Expression in Human Induced Pluripotent Stem Cells-Cardiomyocytes Harboring DMD Mutations

    PubMed Central

    Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H.; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns

    2013-01-01

    With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47–50 or 48–50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart. PMID:23829870

  1. A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes.

    PubMed

    Liu, H X; Cartegni, L; Zhang, M Q; Krainer, A R

    2001-01-01

    Point mutations can generate defective and sometimes harmful proteins. The nonsense-mediated mRNA decay (NMD) pathway minimizes the potential damage caused by nonsense mutations. In-frame nonsense codons located at a minimum distance upstream of the last exon-exon junction are recognized as premature termination codons (PTCs), targeting the mRNA for degradation. Some nonsense mutations cause skipping of one or more exons, presumably during pre-mRNA splicing in the nucleus; this phenomenon is termed nonsense-mediated altered splicing (NAS), and its underlying mechanism is unclear. By analyzing NAS in BRCA1, we show here that inappropriate exon skipping can be reproduced in vitro, and results from disruption of a splicing enhancer in the coding sequence. Enhancers can be disrupted by single nonsense, missense and translationally silent point mutations, without recognition of an open reading frame as such. These results argue against a nuclear reading-frame scanning mechanism for NAS. Coding-region single-nucleotide polymorphisms (cSNPs) within exonic splicing enhancers or silencers may affect the patterns or efficiency of mRNA splicing, which may in turn cause phenotypic variability and variable penetrance of mutations elsewhere in a gene.

  2. Translational and regulatory challenges for exon skipping therapies.

    PubMed

    Aartsma-Rus, Annemieke; Ferlini, Alessandra; Goemans, Nathalie; Pasmooij, Anna M G; Wells, Dominic J; Bushby, Katerine; Vroom, Elizabeth; Balabanov, Pavel

    2014-10-01

    Several translational challenges are currently impeding the therapeutic development of antisense-mediated exon skipping approaches for rare diseases. Some of these are inherent to developing therapies for rare diseases, such as small patient numbers and limited information on natural history and interpretation of appropriate clinical outcome measures. Others are inherent to the antisense oligonucleotide (AON)-mediated exon skipping approach, which employs small modified DNA or RNA molecules to manipulate the splicing process. This is a new approach and only limited information is available on long-term safety and toxicity for most AON chemistries. Furthermore, AONs often act in a mutation-specific manner, in which case multiple AONs have to be developed for a single disease. A workshop focusing on preclinical development, trial design, outcome measures, and different forms of marketing authorization was organized by the regulatory models and biochemical outcome measures working groups of Cooperation of Science and Technology Action: "Networking towards clinical application of antisense-mediated exon skipping for rare diseases." The workshop included participants from patient organizations, academia, and members of staff from the European Medicine Agency and Medicine Evaluation Board (the Netherlands). This statement article contains the key outcomes of this meeting.

  3. Fluorescent Protein-Based Quantification of Alternative Splicing of a Target Cassette Exon in Mammalian Cells.

    PubMed

    Gurskaya, N G; Staroverov, D B; Lukyanov, K A

    2016-01-01

    Alternative splicing is an important mechanism of regulation of gene expression and expansion of proteome complexity. Recently we developed a new fluorescence reporter for quantitative analysis of alternative splicing of a target cassette exon in live cells (Gurskaya et al., 2012). It consists of a specially designed minigene encoding red and green fluorescent proteins (Katushka and TagGFP2) and a fragment of the target gene between them. Skipping or inclusion of the alternative exon induces a frameshift; ie, alternative exon length must not be a multiple of 3. Finally, red and green fluorescence intensities of cells expressing this reporter are used to estimate the percentage of alternative (exon-skipped) and normal (exon-retained) transcripts. Here, we provide a detailed description of design and application of the fluorescence reporter of a target alternative exon splicing in mammalian cell lines. © 2016 Elsevier Inc. All rights reserved.

  4. Dynamic ASXL1 Exon Skipping and Alternative Circular Splicing in Single Human Cells

    PubMed Central

    Natarajan, Sivaraman; Carter, Robert; Brown, Patrick O.

    2016-01-01

    Circular RNAs comprise a poorly understood new class of noncoding RNA. In this study, we used a combination of targeted deletion, high-resolution splicing detection, and single-cell sequencing to deeply probe ASXL1 circular splicing. We found that efficient circular splicing required the canonical transcriptional start site and inverted AluSx elements. Sequencing-based interrogation of isoforms after ASXL1 overexpression identified promiscuous linear splicing between all exons, with the two most abundant non-canonical linear products skipping the exons that produced the circular isoforms. Single-cell sequencing revealed a strong preference for either the linear or circular ASXL1 isoforms in each cell, and found the predominant exon skipping product is frequently co-expressed with its reciprocal circular isoform. Finally, absolute quantification of ASXL1 isoforms confirmed our findings and suggests that standard methods overestimate circRNA abundance. Taken together, these data reveal a dynamic new view of circRNA genesis, providing additional framework for studying their roles in cellular biology. PMID:27736885

  5. Intron-mediated alternative splicing of Arabidopsis P5CS1 and its association with natural variation in proline and climate adaptation

    PubMed Central

    Kesari, Ravi; Lasky, Jesse R.; Villamor, Joji Grace; Des Marais, David L.; Chen, Ying-Jiun C.; Liu, Tzu-Wen; Juenger, Thomas E.; Verslues, Paul E.

    2012-01-01

    Drought-induced proline accumulation is widely observed in plants but its regulation and adaptive value are not as well understood. Proline accumulation of the Arabidopsis accession Shakdara (Sha) was threefold less than that of Landsberg erecta (Ler) and quantitative trait loci mapping identified a reduced function allele of the proline synthesis enzyme Δ1-pyrroline-5-carboxylate synthetase1 (P5CS1) as a basis for the lower proline of Sha. Sha P5CS1 had additional TA repeats in intron 2 and a G-to-T transversion in intron 3 that were sufficient to promote alternative splicing and production of a nonfunctional transcript lacking exon 3 (exon 3-skip P5CS1). In Sha, and additional accessions with the same intron polymorphisms, the nonfunctional exon 3-skip P5CS1 splice variant constituted as much as half of the total P5CS1 transcript. In a larger panel of Arabidopsis accessions, low water potential-induced proline accumulation varied by 10-fold and variable production of exon 3-skip P5CS1 among accessions was an important, but not the sole, factor underlying variation in proline accumulation. Population genetic analyses suggest that P5CS1 may have evolved under positive selection, and more extensive correlation of exon 3-skip P5CS1 production than proline abundance with climate conditions of natural accessions also suggest a role of P5CS1 in local adaptation to the environment. These data identify a unique source of alternative splicing in plants, demonstrate a role of exon 3-skip P5CS1 in natural variation of proline metabolism, and suggest an association of P5CS1 and its alternative splicing with environmental adaptation. PMID:22615385

  6. Clinical characterisation of Becker muscular dystrophy patients predicts favourable outcome in exon-skipping therapy.

    PubMed

    van den Bergen, J C; Schade van Westrum, S M; Dekker, L; van der Kooi, A J; de Visser, M; Wokke, B H A; Straathof, C S; Hulsker, M A; Aartsma-Rus, A; Verschuuren, J J; Ginjaar, H B

    2014-01-01

    Duchenne and Becker muscular dystrophy (DMD/BMD) are both caused by mutations in the DMD gene. Out-of-frame mutations in DMD lead to absence of the dystrophin protein, while in-frame BMD mutations cause production of internally deleted dystrophin. Clinically, patients with DMD loose ambulance around the age of 12, need ventilatory support at their late teens and die in their third or fourth decade due to pulmonary or cardiac failure. BMD has a more variable disease course. The disease course of patients with BMD with specific mutations could be very informative to predict the outcome of the exon-skipping therapy, aiming to restore the reading-frame in patients with DMD. Patients with BMD with a mutation equalling a DMD mutation after successful exon skipping were selected from the Dutch Dystrophinopathy Database. Information about disease course was gathered through a standardised questionnaire. Cardiac data were collected from medical correspondence and a previous study on cardiac function in BMD. Forty-eight patients were included, representing 11 different mutations. Median age of patients was 43 years (range 6-67). Nine patients were wheelchair users (26-56 years). Dilated cardiomyopathy was present in 7/36 patients. Only one patient used ventilatory support. Three patients had died at the age of 45, 50 and 76 years, respectively. This study provides mutation specific data on the course of disease in patients with BMD. It shows that the disease course of patients with BMD, with a mutation equalling a 'skipped' DMD mutation is relatively mild. This finding strongly supports the potential benefit of exon skipping in patients with DMD.

  7. Analysis of aberrant pre-messenger RNA splicing resulting from mutations in ATP8B1 and efficient in vitro rescue by adapted U1 small nuclear RNA.

    PubMed

    van der Woerd, Wendy L; Mulder, Johanna; Pagani, Franco; Beuers, Ulrich; Houwen, Roderick H J; van de Graaf, Stan F J

    2015-04-01

    ATP8B1 deficiency is a severe autosomal recessive liver disease resulting from mutations in the ATP8B1 gene characterized by a continuous phenotypical spectrum from intermittent (benign recurrent intrahepatic cholestasis; BRIC) to progressive familial intrahepatic cholestasis (PFIC). Current therapeutic options are insufficient, and elucidating the molecular consequences of mutations could lead to personalized mutation-specific therapies. We investigated the effect on pre-messenger RNA splicing of 14 ATP8B1 mutations at exon-intron boundaries using an in vitro minigene system. Eleven mutations, mostly associated with a PFIC phenotype, resulted in aberrant splicing and a complete absence of correctly spliced product. In contrast, three mutations led to partially correct splicing and were associated with a BRIC phenotype. These findings indicate an inverse correlation between the level of correctly spliced product and disease severity. Expression of modified U1 small nuclear RNAs (snRNA) complementary to the splice donor sites strongly improved or completely rescued splicing for several ATP8B1 mutations located at donor, as well as acceptor, splice sites. In one case, we also evaluated exon-specific U1 snRNAs that, by targeting nonconserved intronic sequences, might reduce possible off-target events. Although very effective in correcting exon skipping, they also induced retention of the short downstream intron. We systematically characterized the molecular consequences of 14 ATP8B1 mutations at exon-intron boundaries associated with ATP8B1 deficiency and found that the majority resulted in total exon skipping. The amount of correctly spliced product inversely correlated with disease severity. Compensatory modified U1 snRNAs, complementary to mutated donor splice sites, were able to improve exon definition very efficiently and could be a novel therapeutic strategy in ATP8B1 deficiency as well as other genetic diseases. © 2014 by the American Association for the Study of Liver Diseases.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Asai, Hirohide; Hirano, Makito; Kiriyama, Takao

    Intranuclear events due to mutations in the Parkin gene remain elusive in autosomal recessive juvenile parkinsonism (ARJP). We identified a mutant PARKIN protein in fibroblast cultures from a pair of siblings with ARJP who were homozygous for the exon 4-deleted Parkin gene. Disease was mild in one patient and debilitating in the other. The detected mutant, encoded by a transcript lacking exon 3 as well as exon 4, is an in-frame deletion that removes 121 aa, resulting in a 344-aa protein (PaDel3,4). Cell culture and transfection studies revealed negative correlations between expression levels of PaDel3,4 and those of cell cyclemore » proteins, including cyclin E, CDK2, ppRb, and E2F-1, and demonstrated that GFP-PaDel3,4 entered nucleus and ubiquitinated cyclin E as a part of SCF{sup hSel-10} ligase complex in the patient cells. In addition, nuclear localization signal-tagged PaDel3,4 expressed in the transfected patient cells most effectively ubiquitinated cyclin E and reduced DNA damage, protecting cells from oxidative stress. Antisense-oligonucleotide treatment promoted skipping of exon 3 and thus generated PaDel3,4, increasing cell survival. Collectively, we propose that naturally- and experimentally-induced exon skipping at least partly restores the mutant Parkin gene deficit, providing a molecular basis for the development of therapeutic exon skipping.« less

  9. Exon 11 skipping of SCN10A coding for voltage-gated sodium channels in dorsal root ganglia

    PubMed Central

    Schirmeyer, Jana; Szafranski, Karol; Leipold, Enrico; Mawrin, Christian; Platzer, Matthias; Heinemann, Stefan H

    2014-01-01

    The voltage-gated sodium channel NaV1.8 (encoded by SCN10A) is predominantly expressed in dorsal root ganglia (DRG) and plays a critical role in pain perception. We analyzed SCN10A transcripts isolated from human DRGs using deep sequencing and found a novel splice variant lacking exon 11, which codes for 98 amino acids of the domain I/II linker. Quantitative PCR analysis revealed an abundance of this variant of up to 5–10% in human, while no such variants were detected in mouse or rat. Since no obvious functional differences between channels with and without the exon-11 sequence were detected, it is suggested that SCN10A exon 11 skipping in humans is a tolerated event. PMID:24763188

  10. Morpholino oligomer-mediated exon skipping averts the onset of dystrophic pathology in the mdx mouse.

    PubMed

    Fletcher, Sue; Honeyman, Kaite; Fall, Abbie M; Harding, Penny L; Johnsen, Russell D; Steinhaus, Joshua P; Moulton, Hong M; Iversen, Patrick L; Wilton, Stephen D

    2007-09-01

    Duchenne and Becker muscular dystrophies are allelic disorders arising from mutations in the dystrophin gene. Duchenne muscular dystrophy is characterized by an absence of functional protein, whereas Becker muscular dystrophy, commonly caused by in-frame deletions, shows synthesis of partially functional protein. Anti-sense oligonucleotides can induce specific exon removal during processing of the dystrophin primary transcript, while maintaining or restoring the reading frame, and thereby overcome protein-truncating mutations. The mdx mouse has a non-sense mutation in exon 23 of the dystrophin gene that precludes functional dystrophin production, and this model has been used in the development of treatment strategies for dystrophinopathies. A phosphorodiamidate morpholino oligomer (PMO) has previously been shown to exclude exon 23 from the dystrophin gene transcript and induce dystrophin expression in the mdxmouse, in vivo and in vitro. In this report, a cell-penetrating peptide (CPP)-conjugated oligomer targeted to the mouse dystrophin exon 23 donor splice site was administered to mdxmice by intraperitoneal injection. We demonstrate dystrophin expression and near-normal muscle architecture in all muscles examined, except for cardiac muscle. The CPP greatly enhanced uptake of the PMO, resulting in widespread dystrophin expression.

  11. G to A substitution in 5{prime} donor splice site of introns 18 and 48 of COL1A1 gene of type I collagen results in different splicing alternatives in osteogenesis imperfecta type I cell strains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Willing, M.; Deschenes, S.

    We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exonmore » 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.« less

  12. Antisense oligonucleotide–mediated MDM4 exon 6 skipping impairs tumor growth

    PubMed Central

    Dewaele, Michael; Tabaglio, Tommaso; Willekens, Karen; Bezzi, Marco; Teo, Shun Xie; Low, Diana H.P.; Koh, Cheryl M.; Rambow, Florian; Fiers, Mark; Rogiers, Aljosja; Radaelli, Enrico; Al-Haddawi, Muthafar; Tan, Soo Yong; Hermans, Els; Amant, Frederic; Yan, Hualong; Lakshmanan, Manikandan; Koumar, Ratnacaram Chandrahas; Lim, Soon Thye; Derheimer, Frederick A.; Campbell, Robert M.; Bonday, Zahid; Tergaonkar, Vinay; Shackleton, Mark; Blattner, Christine; Marine, Jean-Christophe; Guccione, Ernesto

    2015-01-01

    MDM4 is a promising target for cancer therapy, as it is undetectable in most normal adult tissues but often upregulated in cancer cells to dampen p53 tumor-suppressor function. The mechanisms that underlie MDM4 upregulation in cancer cells are largely unknown. Here, we have shown that this key oncogenic event mainly depends on a specific alternative splicing switch. We determined that while a nonsense-mediated, decay-targeted isoform of MDM4 (MDM4-S) is produced in normal adult tissues as a result of exon 6 skipping, enhanced exon 6 inclusion leads to expression of full-length MDM4 in a large number of human cancers. Although this alternative splicing event is likely regulated by multiple splicing factors, we identified the SRSF3 oncoprotein as a key enhancer of exon 6 inclusion. In multiple human melanoma cell lines and in melanoma patient–derived xenograft (PDX) mouse models, antisense oligonucleotide–mediated (ASO-mediated) skipping of exon 6 decreased MDM4 abundance, inhibited melanoma growth, and enhanced sensitivity to MAPK-targeting therapeutics. Additionally, ASO-based MDM4 targeting reduced diffuse large B cell lymphoma PDX growth. As full-length MDM4 is enhanced in multiple human tumors, our data indicate that this strategy is applicable to a wide range of tumor types. We conclude that enhanced MDM4 exon 6 inclusion is a common oncogenic event and has potential as a clinically compatible therapeutic target. PMID:26595814

  13. Rare Autosomal Recessive Cardiac Valvular Form of Ehlers-Danlos Syndrome Results from Mutations in the COL1A2 Gene That Activate the Nonsense-Mediated RNA Decay Pathway

    PubMed Central

    Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A.; Shinkai, Hiroshi; Hoyme, H. Eugene; Pyeritz, Reed E.; Byers, Peter H.

    2004-01-01

    Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of proα2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement. PMID:15077201

  14. Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway.

    PubMed

    Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A; Shinkai, Hiroshi; Hoyme, H Eugene; Pyeritz, Reed E; Byers, Peter H

    2004-05-01

    Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of pro alpha 2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement.

  15. Splicing regulation and dysregulation of cholinergic genes expressed at the neuromuscular junction.

    PubMed

    Ohno, Kinji; Rahman, Mohammad Alinoor; Nazim, Mohammad; Nasrin, Farhana; Lin, Yingni; Takeda, Jun-Ichi; Masuda, Akio

    2017-08-01

    We humans have evolved by acquiring diversity of alternative RNA metabolisms including alternative means of splicing and transcribing non-coding genes, and not by acquiring new coding genes. Tissue-specific and developmental stage-specific alternative RNA splicing is achieved by tightly regulated spatiotemporal regulation of expressions and activations of RNA-binding proteins that recognize their cognate splicing cis-elements on nascent RNA transcripts. Genes expressed at the neuromuscular junction are also alternatively spliced. In addition, germline mutations provoke aberrant splicing by compromising binding of RNA-binding proteins, and cause congenital myasthenic syndromes (CMS). We present physiological splicing mechanisms of genes for agrin (AGRN), acetylcholinesterase (ACHE), MuSK (MUSK), acetylcholine receptor (AChR) α1 subunit (CHRNA1), and collagen Q (COLQ) in human, and their aberration in diseases. Splicing isoforms of AChE T , AChE H , and AChE R are generated by hnRNP H/F. Skipping of MUSK exon 10 makes a Wnt-insensitive MuSK isoform, which is unique to human. Skipping of exon 10 is achieved by coordinated binding of hnRNP C, YB-1, and hnRNP L to exon 10. Exon P3A of CHRNA1 is alternatively included to generate a non-functional AChR α1 subunit in human. Molecular dissection of splicing mutations in patients with CMS reveals that exon P3A is alternatively skipped by hnRNP H, polypyrimidine tract-binding protein 1, and hnRNP L. Similarly, analysis of an exonic mutation in COLQ exon 16 in a CMS patient discloses that constitutive splicing of exon 16 requires binding of serine arginine-rich splicing factor 1. Intronic and exonic splicing mutations in CMS enable us to dissect molecular mechanisms underlying alternative and constitutive splicing of genes expressed at the neuromuscular junction. This is an article for the special issue XVth International Symposium on Cholinergic Mechanisms. © 2017 International Society for Neurochemistry.

  16. Functional analysis of a large set of BRCA2 exon 7 variants highlights the predictive value of hexamer scores in detecting alterations of exonic splicing regulatory elements.

    PubMed

    Di Giacomo, Daniela; Gaildrat, Pascaline; Abuli, Anna; Abdat, Julie; Frébourg, Thierry; Tosi, Mario; Martins, Alexandra

    2013-11-01

    Exonic variants can alter pre-mRNA splicing either by changing splice sites or by modifying splicing regulatory elements. Often these effects are difficult to predict and are only detected by performing RNA analyses. Here, we analyzed, in a minigene assay, 26 variants identified in the exon 7 of BRCA2, a cancer predisposition gene. Our results revealed eight new exon skipping mutations in this exon: one directly altering the 5' splice site and seven affecting potential regulatory elements. This brings the number of splicing regulatory mutations detected in BRCA2 exon 7 to a total of 11, a remarkably high number considering the total number of variants reported in this exon (n = 36), all tested in our minigene assay. We then exploited this large set of splicing data to test the predictive value of splicing regulator hexamers' scores recently established by Ke et al. (). Comparisons of hexamer-based predictions with our experimental data revealed high sensitivity in detecting variants that increased exon skipping, an important feature for prescreening variants before RNA analysis. In conclusion, hexamer scores represent a promising tool for predicting the biological consequences of exonic variants and may have important applications for the interpretation of variants detected by high-throughput sequencing. © 2013 WILEY PERIODICALS, INC.

  17. An RRM–ZnF RNA recognition module targets RBM10 to exonic sequences to promote exon exclusion

    PubMed Central

    Collins, Katherine M.; Kainov, Yaroslav A.; Christodolou, Evangelos; Ray, Debashish; Morris, Quaid; Hughes, Timothy; Taylor, Ian A.

    2017-01-01

    Abstract RBM10 is an RNA-binding protein that plays an essential role in development and is frequently mutated in the context of human disease. RBM10 recognizes a diverse set of RNA motifs in introns and exons and regulates alternative splicing. However, the molecular mechanisms underlying this seemingly relaxed sequence specificity are not understood and functional studies have focused on 3΄ intronic sites only. Here, we dissect the RNA code recognized by RBM10 and relate it to the splicing regulatory function of this protein. We show that a two-domain RRM1–ZnF unit recognizes a GGA-centered motif enriched in RBM10 exonic sites with high affinity and specificity and test that the interaction with these exonic sequences promotes exon skipping. Importantly, a second RRM domain (RRM2) of RBM10 recognizes a C-rich sequence, which explains its known interaction with the intronic 3΄ site of NUMB exon 9 contributing to regulation of the Notch pathway in cancer. Together, these findings explain RBM10's broad RNA specificity and suggest that RBM10 functions as a splicing regulator using two RNA-binding units with different specificities to promote exon skipping. PMID:28379442

  18. An RRM-ZnF RNA recognition module targets RBM10 to exonic sequences to promote exon exclusion.

    PubMed

    Collins, Katherine M; Kainov, Yaroslav A; Christodolou, Evangelos; Ray, Debashish; Morris, Quaid; Hughes, Timothy; Taylor, Ian A; Makeyev, Eugene V; Ramos, Andres

    2017-06-20

    RBM10 is an RNA-binding protein that plays an essential role in development and is frequently mutated in the context of human disease. RBM10 recognizes a diverse set of RNA motifs in introns and exons and regulates alternative splicing. However, the molecular mechanisms underlying this seemingly relaxed sequence specificity are not understood and functional studies have focused on 3΄ intronic sites only. Here, we dissect the RNA code recognized by RBM10 and relate it to the splicing regulatory function of this protein. We show that a two-domain RRM1-ZnF unit recognizes a GGA-centered motif enriched in RBM10 exonic sites with high affinity and specificity and test that the interaction with these exonic sequences promotes exon skipping. Importantly, a second RRM domain (RRM2) of RBM10 recognizes a C-rich sequence, which explains its known interaction with the intronic 3΄ site of NUMB exon 9 contributing to regulation of the Notch pathway in cancer. Together, these findings explain RBM10's broad RNA specificity and suggest that RBM10 functions as a splicing regulator using two RNA-binding units with different specificities to promote exon skipping. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Correction of Dystrophin Expression in Cells From Duchenne Muscular Dystrophy Patients Through Genomic Excision of Exon 51 by Zinc Finger Nucleases

    PubMed Central

    Ousterout, David G; Kabadi, Ami M; Thakore, Pratiksha I; Perez-Pinera, Pablo; Brown, Matthew T; Majoros, William H; Reddy, Timothy E; Gersbach, Charles A

    2015-01-01

    Duchenne muscular dystrophy (DMD) is caused by genetic mutations that result in the absence of dystrophin protein expression. Oligonucleotide-induced exon skipping can restore the dystrophin reading frame and protein production. However, this requires continuous drug administration and may not generate complete skipping of the targeted exon. In this study, we apply genome editing with zinc finger nucleases (ZFNs) to permanently remove essential splicing sequences in exon 51 of the dystrophin gene and thereby exclude exon 51 from the resulting dystrophin transcript. This approach can restore the dystrophin reading frame in ~13% of DMD patient mutations. Transfection of two ZFNs targeted to sites flanking the exon 51 splice acceptor into DMD patient myoblasts led to deletion of this genomic sequence. A clonal population was isolated with this deletion and following differentiation we confirmed loss of exon 51 from the dystrophin mRNA transcript and restoration of dystrophin protein expression. Furthermore, transplantation of corrected cells into immunodeficient mice resulted in human dystrophin expression localized to the sarcolemmal membrane. Finally, we quantified ZFN toxicity in human cells and mutagenesis at predicted off-target sites. This study demonstrates a powerful method to restore the dystrophin reading frame and protein expression by permanently deleting exons. PMID:25492562

  20. The Status of Exon Skipping as a Therapeutic Approach to Duchenne Muscular Dystrophy

    PubMed Central

    Lu, Qi-Long; Yokota, Toshifumi; Takeda, Shin'ichi; Garcia, Luis; Muntoni, Francesco; Partridge, Terence

    2011-01-01

    Duchenne muscular dystrophy (DMD) is associated with mutations in the dystrophin gene that disrupt the open reading frame whereas the milder Becker's form is associated with mutations which leave an in-frame mRNA transcript that can be translated into a protein that includes the N- and C- terminal functional domains. It has been shown that by excluding specific exons at, or adjacent to, frame-shifting mutations, open reading frame can be restored to an out-of-frame mRNA, leading to the production of a partially functional Becker-like dystrophin protein. Such targeted exclusion can be achieved by administration of oligonucleotides that are complementary to sequences that are crucial to normal splicing of the exon into the transcript. This principle has been validated in mouse and canine models of DMD with a number of variants of oligonucleotide analogue chemistries and by transduction with adeno-associated virus (AAV)-small nuclear RNA (snRNA) reagents encoding the antisense sequence. Two different oligonucleotide agents are now being investigated in human trials for splicing out of exon 51 with some early indications of success at the biochemical level. PMID:20978473

  1. Deep sequencing with intronic capture enables identification of an APC exon 10 inversion in a patient with polyposis.

    PubMed

    Shirts, Brian H; Salipante, Stephen J; Casadei, Silvia; Ryan, Shawnia; Martin, Judith; Jacobson, Angela; Vlaskin, Tatyana; Koehler, Karen; Livingston, Robert J; King, Mary-Claire; Walsh, Tom; Pritchard, Colin C

    2014-10-01

    Single-exon inversions have rarely been described in clinical syndromes and are challenging to detect using Sanger sequencing. We report the case of a 40-year-old woman with adenomatous colon polyps too numerous to count and who had a complex inversion spanning the entire exon 10 in APC (the gene encoding for adenomatous polyposis coli), causing exon skipping and resulting in a frameshift and premature protein truncation. In this study, we employed complete APC gene sequencing using high-coverage next-generation sequencing by ColoSeq, analysis with BreakDancer and SLOPE software, and confirmatory transcript analysis. ColoSeq identified a complex small genomic rearrangement consisting of an inversion that results in translational skipping of exon 10 in the APC gene. This mutation would not have been detected by traditional sequencing or gene-dosage methods. We report a case of adenomatous polyposis resulting from a complex single-exon inversion. Our report highlights the benefits of large-scale sequencing methods that capture intronic sequences with high enough depth of coverage-as well as the use of informatics tools-to enable detection of small pathogenic structural rearrangements.

  2. Deletion of exons 3-9 encompassing a mutational hot spot in the DMD gene presents an asymptomatic phenotype, indicating a target region for multiexon skipping therapy.

    PubMed

    Nakamura, Akinori; Fueki, Noboru; Shiba, Naoko; Motoki, Hirohiko; Miyazaki, Daigo; Nishizawa, Hitomi; Echigoya, Yusuke; Yokota, Toshifumi; Aoki, Yoshitsugu; Takeda, Shin'ichi

    2016-07-01

    Few cases of dystrophinopathy show an asymptomatic phenotype with mutations in the 5' (exons 3-7) hot spot in the Duchenne muscular dystrophy (DMD) gene. Our patient showed increased serum creatine kinase levels at 12 years of age. A muscle biopsy at 15 years of age led to a diagnosis of Becker muscular dystrophy. The patient showed a slight decrease in cardiac function at the age of 21 years and was administered a β-blocker, but there was no muscle involvement even at the age of 27 years. A deletion of exons 3-9 encompassing a mutational hot spot in the DMD gene was detected, and dystrophin protein expression was ∼15% that of control level. We propose that in-frame deletion of exons 3-9 may produce a functional protein, and that multiexon skipping therapy targeting these exons may be feasible for severe dystrophic patients with a mutation in the 5' hot spot of the DMD gene.

  3. Expression of exon-8-skipped kindlin-1 does not compensate for defects of Kindler syndrome.

    PubMed

    Natsuga, Ken; Nishie, Wataru; Shinkuma, Satoru; Nakamura, Hideki; Matsushima, Yoichiro; Tatsuta, Aya; Komine, Mayumi; Shimizu, Hiroshi

    2011-01-01

    Kindler syndrome (KS) is a rare, inherited skin disease characterized by blister formation and generalized poikiloderma. Mutations in KIND1, which encodes kindlin-1, are responsible for KS. c.1089del/1089+1del is a recurrent splice-site deletion mutation in KS patients. To elucidate the effects of c.1089del/1089+1del at the mRNA and protein level. Two KS patients with c.1089del/1089+1del were included in this study. Immunofluorescence analysis of KS skin samples using antibodies against the dermo-epidermal junction proteins was performed. Exon-trapping experiments were performed to isolate the mRNA sequences transcribed from genomic DNA harbouring c.1089del/1089+1del. β1 integrin activation in HeLa cells transfected with truncated KIND1 cDNA was analyzed. Immunofluorescence study showed positive expression of kindlin-1 in KS skin with c.1089del/1089+1del mutation. We identified the exon-8-skipped in-frame transcript as the main product among multiple splicing variants derived from that mutation. HeLa cells transfected with KIND1 cDNA without exon 8 showed impaired β1 integrin activation. Exon-8-coding amino acids are located in the FERM F2 domain, which is conserved among species, and the unstructured region between F2 and the pleckstrin homology domain. This study suggests that exon-8-skipped truncated kindlin-1 is functionally defective and does not compensate for the defects of KS, even though kindlin-1 expression in skin is positive. Copyright © 2010 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  4. Two-Exon Skipping within MLPH Is Associated with Coat Color Dilution in Rabbits

    PubMed Central

    Lehner, Stefanie; Gähle, Marion; Dierks, Claudia; Stelter, Ricarda; Gerber, Jonathan; Brehm, Ralph; Distl, Ottmar

    2013-01-01

    Coat color dilution turns black coat color to blue and red color to cream and is a characteristic in many mammalian species. Matings among Netherland Dwarf, Loh, and Lionhead Dwarf rabbits over two generations gave evidence for a monogenic autosomal recessive inheritance of coat colour dilution. Histological analyses showed non-uniformly distributed, large, agglomerating melanin granules in the hair bulbs of coat color diluted rabbits. We sequenced the cDNA of MLPH in two dilute and one black rabbit for polymorphism detection. In both color diluted rabbits, skipping of exons 3 and 4 was present resulting in altered amino acids at p.QGL[37-39]QWA and a premature stop codon at p.K40*. Sequencing of genomic DNA revealed a c.111-5C>A splice acceptor mutation within the polypyrimidine tract of intron 2 within MLPH. This mutation presumably causes skipping of exons 3 and 4. In 14/15 dilute rabbits, the c.111-5C>A mutation was homozygous and in a further dilute rabbit, heterozygous and in combination with a homozygous frame shift mutation within exon 6 (c.585delG). In conclusion, our results demonstrated a colour dilution associated MLPH splice variant causing a strongly truncated protein (p.Q37QfsX4). An involvement of further MLPH-associated mutations needs further investigations. PMID:24376820

  5. Nanoparticle Delivery of Antisense Oligonucleotides and Their Application in the Exon Skipping Strategy for Duchenne Muscular Dystrophy

    PubMed Central

    Falzarano, Maria Sofia; Passarelli, Chiara

    2014-01-01

    Antisense therapy is a powerful tool for inducing post-transcriptional modifications and thereby regulating target genes associated with disease. There are several classes of antisense oligonucleotides (AONs) with therapeutic use, such as double-stranded RNAs (interfering RNAs, utilized for gene silencing, and single-stranded AONs with various chemistries, which are useful for antisense targeting of micro-RNAs and mRNAs. In particular, the use of AONs for exon skipping, by targeting pre-mRNA, is proving to be a highly promising therapy for some genetic disorders like Duchenne muscular dystrophy and spinal muscular atrophy. However, AONs are unable to cross the plasma membrane unaided, and several other obstacles still remain to be overcome, in particular their instability due to their nuclease sensitivity and their lack of tissue specificity. Various drug delivery systems have been explored to improve the bioavailability of nucleic acids, and nanoparticles (NPs) have been suggested as potential vectors for DNA/RNA. This review describes the recent progress in AON conjugation with natural and synthetic delivery systems, and provides an overview of the efficacy of NP-AON complexes as an exon-skipping treatment for Duchenne muscular dystrophy. PMID:24506782

  6. MET Exon 14 Skipping Mutations in Lung Adenocarcinoma: Clinicopathologic Implications and Prognostic Values.

    PubMed

    Lee, Geun Dong; Lee, Seung Eun; Oh, Doo-Yi; Yu, Dan-Bi; Jeong, Hae Min; Kim, Jooseok; Hong, Sungyoul; Jung, Hun Soon; Oh, Ensel; Song, Ji-Young; Lee, Mi-Sook; Kim, Mingi; Jung, Kyungsoo; Kim, Jhingook; Shin, Young Kee; Choi, Yoon-La; Kim, Hyeong Ryul

    2017-08-01

    Response to mesenchymal-epithelial transition (MET) inhibitors in NSCLC with mesenchymal-epithelial transition gene (MET) exon 14 skipping (METex14) has fueled molecular screening efforts and the search for optimal therapies. However, further work is needed to refine the clinicopathologic and prognostic implications of METex14 skipping. Among 795 East Asian patients who underwent a surgical procedure for NSCLC, we screened 45 patients with quintuple-negative (EGFR-negative/KRAS-negative/anaplastic lymphoma kinase gene [ALK]-negative/ROS1-negative/ret proto-oncogene [RET]-negative) lung adenocarcinomas by using reverse-transcriptase polymerase chain reaction and found 17 patients (37.8%) with METex14 skipping. We also investigated the effect of small interfering RNA (siRNA) targeting skipping junction in cells with METex14 skipping. The median age of the 17 patients was 73 years. The acinar subtype was predominant (52.9%), followed by the solid subtype (35.3%). MET immunohistochemistry demonstrated 100% sensitivity and 70.4% specificity. Multivariate analyses showed that patients with METex14 skipping had a higher recurrence rate than those with ALK fusion (versus METex14 skipping) (hazard ratio = 0.283, 95% confidence interval: 0.119-0.670) in stage I to IIIA disease; however, the differences in overall survival were not significant after adjustment for pathologic stage (p = 0.669). Meanwhile, siRNA decreased MET-driven signaling pathways in Hs746T cells, and combined treatment with siRNA and crizotinib inhibited cell proliferation in crizotinib-resistant H596 cells. The prevalence of METex14 skipping was quite high in East Asian patients without other driver mutations in lung adenocarcinomas. METex14 skipping was associated with old age, the acinar or solid histologic subtype, and high MET immunohistochemical expression. The prognosis of patients with METex14 skipping was similar to that of patients with major driver mutations. siRNA targeting the junction of METex14 skipping could inhibit MET-driven signaling pathways in cells with METex14 skipping. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  7. Single-cut genome editing restores dystrophin expression in a new mouse model of muscular dystrophy

    PubMed Central

    Amoasii, Leonela; Long, Chengzu; Li, Hui; Mireault, Alex A.; Shelton, John M.; Sanchez-Ortiz, Efrain; McAnally, John R.; Bhattacharyya, Samadrita; Schmidt, Florian; Grimm, Dirk; Hauschka, Stephen D.; Bassel-Duby, Rhonda; Olson, Eric N.

    2017-01-01

    Duchenne muscular dystrophy (DMD) is a severe, progressive muscle disease caused by mutations in the dystrophin gene. The majority of DMD mutations are deletions that prematurely terminate the dystrophin protein. Deletions of exon 50 of the dystrophin gene are among the most common single exon deletions causing DMD. Such mutations can be corrected by skipping exon 51, thereby restoring the dystrophin reading frame. Using clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9), we generated a DMD mouse model by deleting exon 50. These ΔEx50 mice displayed severe muscle dysfunction, which was corrected by systemic delivery of adeno-associated virus encoding CRISPR/Cas9 genome editing components. We optimized the method for dystrophin reading frame correction using a single guide RNA that created reframing mutations and allowed skipping of exon 51. In conjunction with muscle-specific expression of Cas9, this approach restored up to 90% of dystrophin protein expression throughout skeletal muscles and the heart of ΔEx50 mice. This method of permanently bypassing DMD mutations using a single cut in genomic DNA represents a step toward clinical correction of DMD mutations and potentially those of other neuromuscular disorders. PMID:29187645

  8. An Ethyl-Nitrosourea-Induced Point Mutation in Phex Causes Exon Skipping, X-Linked Hypophosphatemia, and Rickets

    PubMed Central

    Carpinelli, Marina R.; Wicks, Ian P.; Sims, Natalie A.; O’Donnell, Kristy; Hanzinikolas, Katherine; Burt, Rachel; Foote, Simon J.; Bahlo, Melanie; Alexander, Warren S.; Hilton, Douglas J.

    2002-01-01

    We describe the clinical, genetic, biochemical, and molecular characterization of a mouse that arose in the first generation (G1) of a random mutagenesis screen with the chemical mutagen ethyl-nitrosourea. The mouse was observed to have skeletal abnormalities inherited with an X-linked dominant pattern of inheritance. The causative mutation, named Skeletal abnormality 1 (Ska1), was shown to be a single base pair mutation in a splice donor site immediately following exon 8 of the Phex (phosphate-regulating gene with homologies to endopeptidases located on the X-chromosome) gene. This point mutation caused skipping of exon 8 from Phex mRNA, hypophosphatemia, and features of rickets. This experimentally induced phenotype mirrors the human condition X-linked hypophosphatemia; directly confirms the role of Phex in phosphate homeostasis, normal skeletal development, and rickets; and illustrates the power of mutagenesis in exploring animal models of human disease. PMID:12414538

  9. An ethyl-nitrosourea-induced point mutation in phex causes exon skipping, x-linked hypophosphatemia, and rickets.

    PubMed

    Carpinelli, Marina R; Wicks, Ian P; Sims, Natalie A; O'Donnell, Kristy; Hanzinikolas, Katherine; Burt, Rachel; Foote, Simon J; Bahlo, Melanie; Alexander, Warren S; Hilton, Douglas J

    2002-11-01

    We describe the clinical, genetic, biochemical, and molecular characterization of a mouse that arose in the first generation (G(1)) of a random mutagenesis screen with the chemical mutagen ethyl-nitrosourea. The mouse was observed to have skeletal abnormalities inherited with an X-linked dominant pattern of inheritance. The causative mutation, named Skeletal abnormality 1 (Ska1), was shown to be a single base pair mutation in a splice donor site immediately following exon 8 of the Phex (phosphate-regulating gene with homologies to endopeptidases located on the X-chromosome) gene. This point mutation caused skipping of exon 8 from Phex mRNA, hypophosphatemia, and features of rickets. This experimentally induced phenotype mirrors the human condition X-linked hypophosphatemia; directly confirms the role of Phex in phosphate homeostasis, normal skeletal development, and rickets; and illustrates the power of mutagenesis in exploring animal models of human disease.

  10. Identification of a splicing enhancer in MLH1 using COMPARE a new assay for determination of relative RNA splicing efficiencies

    PubMed Central

    Xu, Dong-Qing; Mattox, William

    2006-01-01

    Exonic splicing enhancers (ESEs) are sequences that facilitate recognition of splice sites and prevent exon-skipping. Because ESEs are often embedded within proteincoding sequences, alterations in them can also often be interpreted as nonsense, missense or silent mutations. To correctly interpret exonic mutations and their roles in disease, it is important to develop strategies that identify ESE mutations. Potential ESEs can be found computationally in many exons but it has proven difficult to predict if a given mutation will have effects on splicing based on sequence alone. Here we describe a flexible in vitro method that can be used to functionally compare the effects of multiple sequence variants on ESE activity in a single in vitro splicing reaction. We have applied this method in parallel with conventional splicing assays to test for a splicing enhancer in exon 17 of the human MLH1 gene. Point mutations associated with hereditary nonpolyposis colorectal cancer (HNPCC) have previously been found to correlate with exon-skipping in both lymphocytes and tumors from patients. We show that sequences from this exon can replace an ESE from the mouse IgM gene to support RNA splicing in HeLa nuclear extracts. ESE activity was reduced by HNPCC point mutations in codon 659 indicating that their primary effect is on splicing. Surprisingly the strongest enhancer function mapped to a different region of the exon upstream of this codon. Together our results indicate that HNPCC point mutations in codon 659 affect an auxillary element that augments the enhancer function to ensure exon inclusion. PMID:16357104

  11. Basal exon skipping and genetic pleiotropy: A predictive model of disease pathogenesis.

    PubMed

    Drivas, Theodore G; Wojno, Adam P; Tucker, Budd A; Stone, Edwin M; Bennett, Jean

    2015-06-10

    Genetic pleiotropy, the phenomenon by which mutations in the same gene result in markedly different disease phenotypes, has proven difficult to explain with traditional models of disease pathogenesis. We have developed a model of pleiotropic disease that explains, through the process of basal exon skipping, how different mutations in the same gene can differentially affect protein production, with the total amount of protein produced correlating with disease severity. Mutations in the centrosomal protein of 290 kDa (CEP290) gene are associated with a spectrum of phenotypically distinct human diseases (the ciliopathies). Molecular biologic examination of CEP290 transcript and protein expression in cells from patients carrying CEP290 mutations, measured by quantitative polymerase chain reaction and Western blotting, correlated with disease severity and corroborated our model. We show that basal exon skipping may be the mechanism underlying the disease pleiotropy caused by CEP290 mutations. Applying our model to a different disease gene, CC2D2A (coiled-coil and C2 domains-containing protein 2A), we found that the same correlations held true. Our model explains the phenotypic diversity of two different inherited ciliopathies and may establish a new model for the pathogenesis of other pleiotropic human diseases. Copyright © 2015, American Association for the Advancement of Science.

  12. Combination Antisense Treatment for Destructive Exon Skipping of Myostatin and Open Reading Frame Rescue of Dystrophin in Neonatal mdx Mice.

    PubMed

    Lu-Nguyen, Ngoc B; Jarmin, Susan A; Saleh, Amer F; Popplewell, Linda; Gait, Michael J; Dickson, George

    2015-08-01

    The fatal X-linked Duchenne muscular dystrophy (DMD), characterized by progressive muscle wasting and muscle weakness, is caused by mutations within the DMD gene. The use of antisense oligonucleotides (AOs) modulating pre-mRNA splicing to restore the disrupted dystrophin reading frame, subsequently generating a shortened but functional protein has emerged as a potential strategy in DMD treatment. AO therapy has recently been applied to induce out-of-frame exon skipping of myostatin pre-mRNA, knocking-down expression of myostatin protein, and such an approach is suggested to enhance muscle hypertrophy/hyperplasia and to reduce muscle necrosis. Within this study, we investigated dual exon skipping of dystrophin and myostatin pre-mRNAs using phosphorodiamidate morpholino oligomers conjugated with an arginine-rich peptide (B-PMOs). Intraperitoneal administration of B-PMOs was performed in neonatal mdx males on the day of birth, and at weeks 3 and 6. At week 9, we observed in treated mice (as compared to age-matched, saline-injected controls) normalization of muscle mass, a recovery in dystrophin expression, and a decrease in muscle necrosis, particularly in the diaphragm. Our data provide a proof of concept for antisense therapy combining dystrophin restoration and myostatin inhibition for the treatment of DMD.

  13. A Dentin Sialophosphoprotein Mutation That Partially Disrupts a Splice Acceptor Site Causes Type II Dentin Dysplasia

    PubMed Central

    Lee, Sook-Kyung; Hu, Jan C.-C.; Lee, Kyung-Eun; Simmer, James P.; Kim, Jung-Wook

    2009-01-01

    The dentin sialophosphoprotein (DSPP) gene on chromosome 4q21.3 encodes the major noncollagenous protein in tooth dentin. DSPP mutations are the principal cause of dentin dysplasia type II, dentinogenesis imperfecta type II, and dentinogenesis imperfecta type III. We have identified a DSPP splice junction mutation (IVS2-6T>G) in a family with dentin dysplasia type II. The primary dentition is discolored brown with severe attrition. The mildly discolored permanent dentition has thistle-shaped pulp chambers, pulp stones, and eventual pulp obliteration. The mutation is in the sixth nucleotide from the end of intron 2, perfectly segregates with the disease phenotype, and is absent in 200 normal control chromosomes. An in vitro splicing assay shows that pre-mRNA splicing of the mutant allele generates wild-type mRNA and mRNA lacking exon 3 in approximately equal amounts. Skipping exon 3 might interfere with signal peptide cleavage, causing endoplasmic reticulum stress, and also reduce DSPP secretion, leading to haploinsufficiency. PMID:19026876

  14. Altered Splicing of the BIN1 Muscle-Specific Exon in Humans and Dogs with Highly Progressive Centronuclear Myopathy

    PubMed Central

    Böhm, Johann; Vasli, Nasim; Maurer, Marie; Cowling, Belinda; Shelton, G. Diane; Kress, Wolfram; Toussaint, Anne; Prokic, Ivana; Schara, Ulrike; Anderson, Thomas James; Weis, Joachim; Tiret, Laurent; Laporte, Jocelyn

    2013-01-01

    Amphiphysin 2, encoded by BIN1, is a key factor for membrane sensing and remodelling in different cell types. Homozygous BIN1 mutations in ubiquitously expressed exons are associated with autosomal recessive centronuclear myopathy (CNM), a mildly progressive muscle disorder typically showing abnormal nuclear centralization on biopsies. In addition, misregulation of BIN1 splicing partially accounts for the muscle defects in myotonic dystrophy (DM). However, the muscle-specific function of amphiphysin 2 and its pathogenicity in both muscle disorders are not well understood. In this study we identified and characterized the first mutation affecting the splicing of the muscle-specific BIN1 exon 11 in a consanguineous family with rapidly progressive and ultimately fatal centronuclear myopathy. In parallel, we discovered a mutation in the same BIN1 exon 11 acceptor splice site as the genetic cause of the canine Inherited Myopathy of Great Danes (IMGD). Analysis of RNA from patient muscle demonstrated complete skipping of exon 11 and BIN1 constructs without exon 11 were unable to promote membrane tubulation in differentiated myotubes. Comparative immunofluorescence and ultrastructural analyses of patient and canine biopsies revealed common structural defects, emphasizing the importance of amphiphysin 2 in membrane remodelling and maintenance of the skeletal muscle triad. Our data demonstrate that the alteration of the muscle-specific function of amphiphysin 2 is a common pathomechanism for centronuclear myopathy, myotonic dystrophy, and IMGD. The IMGD dog is the first faithful model for human BIN1-related CNM and represents a mammalian model available for preclinical trials of potential therapies. PMID:23754947

  15. A splice variant in the ACSL5 gene relates migraine with fatty acid activation in mitochondria

    PubMed Central

    Matesanz, Fuencisla; Fedetz, María; Barrionuevo, Cristina; Karaky, Mohamad; Catalá-Rabasa, Antonio; Potenciano, Victor; Bello-Morales, Raquel; López-Guerrero, Jose-Antonio; Alcina, Antonio

    2016-01-01

    Genome-wide association studies (GWAS) in migraine are providing the molecular basis of this heterogeneous disease, but the understanding of its aetiology is still incomplete. Although some biomarkers have currently been accepted for migraine, large amount of studies for identifying new ones is needed. The migraine-associated variant rs12355831:A>G (P=2 × 10−6), described in a GWAS of the International Headache Genetic Consortium, is localized in a non-coding sequence with unknown function. We sought to identify the causal variant and the genetic mechanism involved in the migraine risk. To this end, we integrated data of RNA sequences from the Genetic European Variation in Health and Disease (GEUVADIS) and genotypes from 1000 GENOMES of 344 lymphoblastoid cell lines (LCLs), to determine the expression quantitative trait loci (eQTLs) in the region. We found that the migraine-associated variant belongs to a linkage disequilibrium block associated with the expression of an acyl-coenzyme A synthetase 5 (ACSL5) transcript lacking exon 20 (ACSL5-Δ20). We showed by exon-skipping assay a direct causality of rs2256368-G in the exon 20 skipping of approximately 20 to 40% of ACSL5 RNA molecules. In conclusion, we identified the functional variant (rs2256368:A>G) affecting ACSL5 exon 20 skipping, as a causal factor linked to the migraine-associated rs12355831:A>G, suggesting that the activation of long-chain fatty acids by the spliced ACSL5-Δ20 molecules, a mitochondrial located enzyme, is involved in migraine pathology. PMID:27189022

  16. Thousands of exon skipping events differentiate among splicing patterns in sixteen human tissues.

    PubMed

    Florea, Liliana; Song, Li; Salzberg, Steven L

    2013-01-01

    Alternative splicing is widely recognized for its roles in regulating genes and creating gene diversity. However, despite many efforts, the repertoire of gene splicing variation is still incompletely characterized, even in humans. Here we describe a new computational system, ASprofile, and its application to RNA-seq data from Illumina's Human Body Map project (>2.5 billion reads).  Using the system, we identified putative alternative splicing events in 16 different human tissues, which provide a dynamic picture of splicing variation across the tissues. We detected 26,989 potential exon skipping events representing differences in splicing patterns among the tissues. A large proportion of the events (>60%) were novel, involving new exons (~3000), new introns (~16000), or both. When tracing these events across the sixteen tissues, only a small number (4-7%) appeared to be differentially expressed ('switched') between two tissues, while 30-45% showed little variation, and the remaining 50-65% were not present in one or both tissues compared.  Novel exon skipping events appeared to be slightly less variable than known events, but were more tissue-specific. Our study represents the first effort to build a comprehensive catalog of alternative splicing in normal human tissues from RNA-seq data, while providing insights into the role of alternative splicing in shaping tissue transcriptome differences. The catalog of events and the ASprofile software are freely available from the Zenodo repository ( http://zenodo.org/record/7068; doi: 10.5281/zenodo.7068) and from our web site http://ccb.jhu.edu/software/ASprofile.

  17. Skipping of exon 27 in C3 gene compromises TED domain and results in complete human C3 deficiency.

    PubMed

    da Silva, Karina Ribeiro; Fraga, Tatiana Rodrigues; Lucatelli, Juliana Faggion; Grumach, Anete Sevciovic; Isaac, Lourdes

    2016-05-01

    Primary deficiency of complement C3 is rare and usually associated with increased susceptibility to bacterial infections. In this work, we investigated the molecular basis of complete C3 deficiency in a Brazilian 9-year old female patient with a family history of consanguinity. Hemolytic assays revealed complete lack of complement-mediated hemolytic activity in the patient's serum. While levels of the complement regulatory proteins Factor I, Factor H and Factor B were normal in the patient's and family members' sera, complement C3 levels were undetectable in the patient's serum and were reduced by at least 50% in the sera of the patient's parents and brother. Additionally, no C3 could be observed in the patient's plasma and cell culture supernatants by Western blot. We also observed that patient's skin fibroblasts stimulated with Escherichia coli LPS were unable to secrete C3, which might be accumulated within the cells before being intracellularly degraded. Sequencing analysis of the patient's C3 cDNA revealed a genetic mutation responsible for the complete skipping of exon 27, resulting in the loss of 99 nucleotides (3450-3549) located in the TED domain. Sequencing of the intronic region between the exons 26 and 27 of the C3 gene (nucleotides 6690313-6690961) showed a nucleotide exchange (T→C) at position 6690626 located in a splicing donor site, resulting in the complete skipping of exon 27 in the C3 mRNA. Copyright © 2016. Published by Elsevier GmbH.

  18. A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

    PubMed Central

    Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.

    2009-01-01

    Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483

  19. A plant 5S ribosomal RNA mimic regulates alternative splicing of transcription factor IIIA pre-mRNAs.

    PubMed

    Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R

    2009-05-01

    Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.

  20. Common pathological mutations in PQBP1 induce nonsense-mediated mRNA decay and enhance exclusion of the mutant exon.

    PubMed

    Musante, Luciana; Kunde, Stella-Amrei; Sulistio, Tina O; Fischer, Ute; Grimme, Astrid; Frints, Suzanna G M; Schwartz, Charles E; Martínez, Francisco; Romano, Corrado; Ropers, Hans-Hilger; Kalscheuer, Vera M

    2010-01-01

    The polyglutamine binding protein 1 (PQBP1) gene plays an important role in X-linked mental retardation (XLMR). Nine of the thirteen PQBP1 mutations known to date affect the AG hexamer in exon 4 and cause frameshifts introducing premature termination codons (PTCs). However, the phenotype in this group of patients is variable. To investigate the pathology of these PQBP1 mutations, we evaluated their consequences on mRNA and protein expression. RT-PCRs revealed mutation-specific reduction of PQBP1 mRNAs carrying the PTCs that can be partially restored by blocking translation, thus indicating a role for the nonsense-mediated mRNA decay pathway. In addition, these mutations resulted in altered levels of PQBP1 transcripts that skipped exon 4, probably as a result of altering important splicing motifs via nonsense-associated altered splicing (NAS). This hypothesis is supported by transfection experiments using wild-type and mutant PQBP1 minigenes. Moreover, we show that a truncated PQBP1 protein is indeed present in the patients. Remarkably, patients with insertion/deletion mutations in the AG hexamer express significantly increased levels of a PQBP1 isoform, which is very likely encoded by the transcripts without exon 4, confirming the findings at the mRNA level. Our study provides significant insight into the early events contributing to the pathogenesis of the PQBP1 related XLMR disease.

  1. Lariat sequencing in a unicellular yeast identifies regulated alternative splicing of exons that are evolutionarily conserved with humans.

    PubMed

    Awan, Ali R; Manfredo, Amanda; Pleiss, Jeffrey A

    2013-07-30

    Alternative splicing is a potent regulator of gene expression that vastly increases proteomic diversity in multicellular eukaryotes and is associated with organismal complexity. Although alternative splicing is widespread in vertebrates, little is known about the evolutionary origins of this process, in part because of the absence of phylogenetically conserved events that cross major eukaryotic clades. Here we describe a lariat-sequencing approach, which offers high sensitivity for detecting splicing events, and its application to the unicellular fungus, Schizosaccharomyces pombe, an organism that shares many of the hallmarks of alternative splicing in mammalian systems but for which no previous examples of exon-skipping had been demonstrated. Over 200 previously unannotated splicing events were identified, including examples of regulated alternative splicing. Remarkably, an evolutionary analysis of four of the exons identified here as subject to skipping in S. pombe reveals high sequence conservation and perfect length conservation with their homologs in scores of plants, animals, and fungi. Moreover, alternative splicing of two of these exons have been documented in multiple vertebrate organisms, making these the first demonstrations of identical alternative-splicing patterns in species that are separated by over 1 billion y of evolution.

  2. PubMed Central

    Bello, Luca

    2016-01-01

    Accurate definition of genetic mutations causing Duchenne muscular dystrophy (DMD) has always been relevant in order to provide genetic counseling to patients and families, and helps to establish the prognosis in the case where the distinction between Duchenne, Becker, or intermediate muscular dystrophy is not obvious. As molecular treatments aimed at dystrophin restoration in DMD are increasingly available as commercialized drugs or within clinical trials, genetic diagnosis has become an indispensable tool in order to determine eligibility for these treatments. DMD patients in which multiplex ligation-dependent probe amplification (MLPA) or similar techniques show a deletion suitable to exon skipping of exons 44, 45, 51, or 53, may be currently treated with AONs targeting these exons, in the context of clinical trials, or, as is the case for exon 51 skipping in the United States, with the first commercialized drug (eteplirsen). Patients who test negative at MLPA, but in whom DMD gene sequencing shows a nonsense mutation, may be amenable for treatment with stop codon readthrough compounds such as ataluren. Novel molecular approaches such as CRISPR-Cas9 targeting of specific DMD mutations are still in the preclinical stages, but appear promising. In conclusion, an accurate genetic diagnosis represents the entrance into a new scenario of personalized medicine in DMD. PMID:28484312

  3. Interplay between DMD Point Mutations and Splicing Signals in Dystrophinopathy Phenotypes

    PubMed Central

    Juan-Mateu, Jonàs; González-Quereda, Lidia; Rodríguez, Maria José; Verdura, Edgard; Lázaro, Kira; Jou, Cristina; Nascimento, Andrés; Jiménez-Mallebrera, Cecilia; Colomer, Jaume; Monges, Soledad; Lubieniecki, Fabiana; Foncuberta, Maria Eugenia; Pascual-Pascual, Samuel Ignacio; Molano, Jesús; Baiget, Montserrat; Gallano, Pia

    2013-01-01

    DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements. PMID:23536893

  4. STAR splicing mutations cause the severe phenotype of lipoid congenital adrenal hyperplasia: insights from a novel splice mutation and review of reported cases.

    PubMed

    Camats, Núria; Pandey, Amit V; Fernández-Cancio, Mónica; Fernández, Juan M; Ortega, Ana M; Udhane, Sameer; Andaluz, Pilar; Audí, Laura; Flück, Christa E

    2014-02-01

    The steroidogenic acute regulatory protein (StAR) transports cholesterol to the mitochondria for steroidogenesis. Loss of StAR function causes lipoid congenital adrenal hyperplasia (LCAH) which is characterized by impaired synthesis of adrenal and gonadal steroids causing adrenal insufficiency, 46,XY disorder of sex development (DSD) and failure of pubertal development. Partial loss of StAR activity may cause adrenal insufficiency only. A newborn girl was admitted for mild dehydration, hyponatremia, hyperkalemia and hypoglycaemia and had normal external female genitalia without hyperpigmentation. Plasma cortisol, 17OH-progesterone, DHEA-S, androstendione and aldosterone were low, while ACTH and plasma renin activity were elevated, consistent with the diagnosis of primary adrenal insufficiency. Imaging showed normal adrenals, and cytogenetics revealed a 46,XX karyotype. She was treated with fluids, hydrocortisone and fludrocortisone. Genetic studies revealed a novel homozygous STAR mutation in the 3' acceptor splice site of intron 4, c.466-1G>A (IVS4-1G>A). To test whether this mutation would affect splicing, we performed a minigene experiment with a plasmid construct containing wild-type or mutant StAR gDNA of exons-introns 4-6 in COS-1 cells. The splicing was assessed on total RNA using RT-PCR for STAR cDNAs. The mutant STAR minigene skipped exon 5 completely and changed the reading frame. Thus, it is predicted to produce an aberrant and shorter protein (p.V156GfsX19). Computational analysis revealed that this mutant protein lacks wild-type exons 5-7 which are essential for StAR-cholesterol interaction. STAR c.466-1A skips exon 5 and causes a dramatic change in the C-terminal sequence of the protein, which is essential for StAR-cholesterol interaction. This splicing mutation is a loss-of-function mutation explaining the severe phenotype of our patient. Thus far, all reported splicing mutations of STAR cause a severe impairment of protein function and phenotype. © 2013 John Wiley & Sons Ltd.

  5. Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

    PubMed

    Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2015-03-15

    Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein molecule that alter the biosynthesis of thyroid hormones. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  6. MutPred Splice: machine learning-based prediction of exonic variants that disrupt splicing

    PubMed Central

    2014-01-01

    We have developed a novel machine-learning approach, MutPred Splice, for the identification of coding region substitutions that disrupt pre-mRNA splicing. Applying MutPred Splice to human disease-causing exonic mutations suggests that 16% of mutations causing inherited disease and 10 to 14% of somatic mutations in cancer may disrupt pre-mRNA splicing. For inherited disease, the main mechanism responsible for the splicing defect is splice site loss, whereas for cancer the predominant mechanism of splicing disruption is predicted to be exon skipping via loss of exonic splicing enhancers or gain of exonic splicing silencer elements. MutPred Splice is available at http://mutdb.org/mutpredsplice. PMID:24451234

  7. Rescue of cardiomyopathy through U7snRNA-mediated exon skipping in Mybpc3-targeted knock-in mice.

    PubMed

    Gedicke-Hornung, Christina; Behrens-Gawlik, Verena; Reischmann, Silke; Geertz, Birgit; Stimpel, Doreen; Weinberger, Florian; Schlossarek, Saskia; Précigout, Guillaume; Braren, Ingke; Eschenhagen, Thomas; Mearini, Giulia; Lorain, Stéphanie; Voit, Thomas; Dreyfus, Patrick A; Garcia, Luis; Carrier, Lucie

    2013-07-01

    Exon skipping mediated by antisense oligoribonucleotides (AON) is a promising therapeutic approach for genetic disorders, but has not yet been evaluated for cardiac diseases. We investigated the feasibility and efficacy of viral-mediated AON transfer in a Mybpc3-targeted knock-in (KI) mouse model of hypertrophic cardiomyopathy (HCM). KI mice carry a homozygous G>A transition in exon 6, which results in three different aberrant mRNAs. We identified an alternative variant (Var-4) deleted of exons 5-6 in wild-type and KI mice. To enhance its expression and suppress aberrant mRNAs we designed AON-5 and AON-6 that mask splicing enhancer motifs in exons 5 and 6. AONs were inserted into modified U7 small nuclear RNA and packaged in adeno-associated virus (AAV-U7-AON-5+6). Transduction of cardiac myocytes or systemic administration of AAV-U7-AON-5+6 increased Var-4 mRNA/protein levels and reduced aberrant mRNAs. Injection of newborn KI mice abolished cardiac dysfunction and prevented left ventricular hypertrophy. Although the therapeutic effect was transient and therefore requires optimization to be maintained over an extended period, this proof-of-concept study paves the way towards a causal therapy of HCM. © 2013 The Authors. Published by John Wiley and Sons, Ltd on behalf of EMBO.

  8. A novel point mutation (G[sup [minus]1] to T) in a 5[prime] splice donor site of intron 13 of the dystrophin gene results in exon skipping and is responsible for Becker Muscular Dystrophy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagiwara, Yoko; Nishio, Hisahide; Kitoh, Yoshihiko

    1994-01-01

    The mutations in one-third of Duchenne and Becker muscular dystrophy patients remain unknown, as they do not involve gross rearrangements of the dystrophin gene. The authors now report a defect in the splicing of precursor mRNA (pre-mRNA), resulting from a maternally inherited mutation of the dystrophin gene in a patient with Becker muscular dystrophy. This defect results from a G-to-T transversion at the terminal nucleotide of exon 13, within the 5[prime] splice site of intron 13, and causes complete skipping of exon 13 during processing of dystrophin pre-mRNA. The predicted polypeptide encoded by the aberrant mRNA is a truncated dystrophinmore » lacking 40 amino acids from the amino-proximal end of the rod domain. This is the first report of an intraexon point mutation that completely inactivates a 5[prime] splice donor site in dystrophin pre-mRNA. Analysis of the genomic context of the G[sup [minus]1]-to-T mutation at the 5[prime] splice site supports the exon-definition model of pre-mRNA splicing and contributes to the understanding of splice-site selection. 48 refs., 5 figs.« less

  9. Genetic diagnosis as a tool for personalized treatment of Duchenne muscular dystrophy.

    PubMed

    Bello, Luca; Pegoraro, Elena

    2016-12-01

    Accurate definition of genetic mutations causing Duchenne muscular dystrophy (DMD) has always been relevant in order to provide genetic counseling to patients and families, and helps to establish the prognosis in the case where the distinction between Duchenne, Becker, or intermediate muscular dystrophy is not obvious. As molecular treatments aimed at dystrophin restoration in DMD are increasingly available as commercialized drugs or within clinical trials, genetic diagnosis has become an indispensable tool in order to determine eligibility for these treatments. DMD patients in which multiplex ligation-dependent probe amplification (MLPA) or similar techniques show a deletion suitable to exon skipping of exons 44, 45, 51, or 53, may be currently treated with AONs targeting these exons, in the context of clinical trials, or, as is the case for exon 51 skipping in the United States, with the first commercialized drug (eteplirsen). Patients who test negative at MLPA, but in whom DMD gene sequencing shows a nonsense mutation, may be amenable for treatment with stop codon readthrough compounds such as ataluren. Novel molecular approaches such as CRISPR-Cas9 targeting of specific DMD mutations are still in the preclinical stages, but appear promising. In conclusion, an accurate genetic diagnosis represents the entrance into a new scenario of personalized medicine in DMD.

  10. Alternative Splicing of a Novel Inducible Exon Diversifies the CASK Guanylate Kinase Domain

    PubMed Central

    Dembowski, Jill A.; An, Ping; Scoulos-Hanson, Maritsa; Yeo, Gene; Han, Joonhee; Fu, Xiang-Dong; Grabowski, Paula J.

    2012-01-01

    Alternative pre-mRNA splicing has a major impact on cellular functions and development with the potential to fine-tune cellular localization, posttranslational modification, interaction properties, and expression levels of cognate proteins. The plasticity of regulation sets the stage for cells to adjust the relative levels of spliced mRNA isoforms in response to stress or stimulation. As part of an exon profiling analysis of mouse cortical neurons stimulated with high KCl to induce membrane depolarization, we detected a previously unrecognized exon (E24a) of the CASK gene, which encodes for a conserved peptide insertion in the guanylate kinase interaction domain. Comparative sequence analysis shows that E24a appeared selectively in mammalian CASK genes as part of a >3,000 base pair intron insertion. We demonstrate that a combination of a naturally defective 5′ splice site and negative regulation by several splicing factors, including SC35 (SRSF2) and ASF/SF2 (SRSF1), drives E24a skipping in most cell types. However, this negative regulation is countered with an observed increase in E24a inclusion after neuronal stimulation and NMDA receptor signaling. Taken together, E24a is typically a skipped exon, which awakens during neuronal stimulation with the potential to diversify the protein interaction properties of the CASK polypeptide. PMID:23008758

  11. Poly(ester amine) Composed of Polyethylenimine and Pluronic Enhance Delivery of Antisense Oligonucleotides In Vitro and in Dystrophic mdx Mice

    PubMed Central

    Wang, Mingxing; Wu, Bo; Tucker, Jason D; Bollinger, Lauren E; Lu, Peijuan; Lu, Qilong

    2016-01-01

    A series of poly(esteramine)s (PEAs) constructed from low molecular weight polyethyleneimine (LPEI) and Pluronic were evaluated for the delivery of antisense oligonuclotides (AOs), 2′-O-methyl phosphorothioate RNA (2′-OMePS) and phosphorodiamidate morpholino oligomer (PMO) in cell culture and dystrophic mdx mice. Improved exon-skipping efficiency of both 2′-OMePS and PMO was observed in the C2C12E50 cell line with all PEA polymers compared with PEI 25k or LF-2k. The degree of efficiency was found in the order of PEA 01, PEA 04 > PEA 05 > others. The in vivo study in mdx mice demonstrated enhanced exon-skipping of 2′-OMePS with the order of PEA 06 > PEA 04, PEA 07 > PEA 03 > PEA 01 > others, and much higher than PEI 25k formulated 2′-OMePS. Exon-skipping efficiency of PMO in formulation with the PEAs were significantly enhanced in the order of PEA 02 > PEA 10 > PEA 01, PEA 03 > PEA 05, PEA 07, PEA 08 > others, with PEA 02 reaching fourfold of Endo-porter formulated PMO. PEAs improve PMO delivery more effectively than 2′-OMePS delivery in vivo, and the systemic delivery evaluation further highlight the efficiency of PEA for PMO delivery in all skeletal muscle. The results suggest that the flexibility of PEA polymers could be explored for delivery of different AO chemistries, especially for antisense therapy. PMID:27483024

  12. SAM68 is a physiological regulator of SMN2 splicing in spinal muscular atrophy

    PubMed Central

    Pagliarini, Vittoria; Pelosi, Laura; Bustamante, Maria Blaire; Nobili, Annalisa; Berardinelli, Maria Grazia; D’Amelio, Marcello; Musarò, Antonio

    2015-01-01

    Spinal muscular atrophy (SMA) is a neurodegenerative disease caused by loss of motor neurons in patients with null mutations in the SMN1 gene. The almost identical SMN2 gene is unable to compensate for this deficiency because of the skipping of exon 7 during pre–messenger RNA (mRNA) processing. Although several splicing factors can modulate SMN2 splicing in vitro, the physiological regulators of this disease-causing event are unknown. We found that knockout of the splicing factor SAM68 partially rescued body weight and viability of SMAΔ7 mice. Ablation of SAM68 function promoted SMN2 splicing and expression in SMAΔ7 mice, correlating with amelioration of SMA-related defects in motor neurons and skeletal muscles. Mechanistically, SAM68 binds to SMN2 pre-mRNA, favoring recruitment of the splicing repressor hnRNP A1 and interfering with that of U2AF65 at the 3′ splice site of exon 7. These findings identify SAM68 as the first physiological regulator of SMN2 splicing in an SMA mouse model. PMID:26438828

  13. A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals.

    PubMed

    Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M

    2017-01-01

    Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.

  14. New lessons from an old gene: complex splicing and a novel cryptic exon in VHL gene cause erythrocytosis and VHL disease.

    PubMed

    Lenglet, Marion; Robriquet, Florence; Schwarz, Klaus; Camps, Carme; Couturier, Anne; Hoogewijs, David; Buffet, Alexandre; Knight, Samantha Jl; Gad, Sophie; Couvé, Sophie; Chesnel, Franck; Pacault, Mathilde; Lindenbaum, Pierre; Job, Sylvie; Dumont, Solenne; Besnard, Thomas; Cornec, Marine; Dreau, Helene; Pentony, Melissa; Kvikstad, Erika; Deveaux, Sophie; Burnichon, Nelly; Ferlicot, Sophie; Vilaine, Mathias; Mazzella, Jean-Michaël; Airaud, Fabrice; Garrec, Céline; Heidet, Laurence; Irtan, Sabine; Mantadakis, Elpis; Bouchireb, Karim; Debatin, Klaus-Michael; Redon, Richard; Bezieau, Stéphane; Bressac-de Paillerets, Brigitte; Teh, Bin Tean; Girodon, François; Randi, Maria-Luigia; Putti, Maria Caterina; Bours, Vincent; Van Wijk, Richard; Göthert, Joachim R; Kattamis, Antonis; Janin, Nicolas; Bento, Celeste; Taylor, Jenny C; Arlot-Bonnemains, Yannick; Richard, Stéphane; Gimenez-Roqueplo, Anne-Paule; Cario, Holger; Gardie, Betty

    2018-06-11

    Chuvash polycythemia is an autosomal recessive form of erythrocytosis associated with a homozygous p.Arg200Trp mutation in the von Hippel-Lindau (VHL) gene. Since this discovery, additional VHL mutations have been identified in patients with congenital erythrocytosis, in a homozygous or compound-heterozygous state. VHL is a major tumor suppressor gene, mutations in which were first described in patients presenting with von Hippel-Lindau disease, which is characterized by the development of highly vascularized tumors. Here, we identified a new VHL cryptic-exon (termed E1') deep in intron 1 that is naturally expressed in many tissues. More importantly, we identified mutations in E1' in seven families with erythrocytosis (one homozygous case and six compound-heterozygous cases with a mutation in E1' in addition to a mutation in VHL coding sequences) and in one large family with typical VHL disease but without any alteration in the other VHL exons. In this study we have shown that the mutations induced a dysregulation of the VHL splicing with excessive retention of E1' and are associated with a downregulation of VHL protein expression. In addition, we have demonstrated a pathogenic role for synonymous mutations in VHL-Exon 2 that alter splicing through E2-skipping in five families with erythrocytosis or VHL disease. In all the studied cases, the mutations differentially impact splicing, correlating with phenotype severity. This study demonstrates that cryptic-exon-retention or exon-skipping are new VHL alterations and reveals a novel complex splicing regulation of the VHL gene. These findings open new avenues for diagnosis and research into the VHL-related-hypoxia-signaling pathway. Copyright © 2018 American Society of Hematology.

  15. Premature chain termination is a unifying mechanism for COL1A1 null alleles in osteogenesis imperfecta type I cell strains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Willing, M.C.; Deschenes, S.P.; Roberts, E.J.

    Nonsense and frameshift mutations, which predict premature termination of translation, often cause a dramatic reduction in the amount of transcript from the mutant allele (nonsense-mediated mRNA decay). In some genes, these mutations also influence RNA splicing and induce skipping of the exon that contains the nonsense codon. To begin to dissect how premature termination alters the metabolism of RNA from the COL1A1 gene, we studied nonsense and frameshift mutations distributed over exons 11-49 of the gene. These mutations were originally identified in 10 unrelated families with osteogenesis imperfecta (OI) type I. We observed marked reduction in steady-state amounts of mRNAmore » from the mutant allele in both total cellular and nuclear RNA extracts of cells from affected individuals, suggesting that nonsense-mediated decay of COL1A1 RNA is a nuclear phenomenon. Position of the mutation within the gene did not influence this observation. None of the mutations induced skipping of either the exon containing the mutation or, for the frameshifts, the downstream exons with the new termination sites. Our data suggest that nonsense and frameshift mutations throughout most of the COL1A1 gene result in a null allele, which is associated with the predictable mild clinical phenotype, OI type I. 42 refs., 6 figs., 1 tab.« less

  16. Alternatively spliced Spalax heparanase inhibits extracellular matrix degradation, tumor growth, and metastasis

    PubMed Central

    Nasser, Nicola J.; Avivi, Aaron; Shafat, Itay; Edovitsky, Evgeny; Zcharia, Eyal; Ilan, Neta; Vlodavsky, Israel; Nevo, Eviatar

    2009-01-01

    Heparanase is an endoglycosidase that degrades heparan sulfate (HS) at the cell surface and in the extracellular matrix. Heparanase is expressed mainly by cancer cells, and its expression is correlated with increased tumor aggressiveness, metastasis, and angiogenesis. Here, we report the cloning of a unique splice variant (splice 36) of heparanase from the subterranean blind mole rat (Spalax). This splice variant results from skipping part of exon 3, exons 4 and 5, and part of exon 6 and functions as a dominant negative to the wild-type enzyme. It inhibits HS degradation, suppresses glioma tumor growth, and decreases experimental B16–BL6 lung colonization in a mouse model. Intriguingly, Spalax splice variant 7 of heparanase (which results from skipping of exon 7) is devoid of enzymatic activity, but unlike splice 36 it enhances tumor growth. Our results demonstrate that alternative splicing of heparanase regulates its enzymatic activity and might adapt the heparanase function to the fluctuating normoxic–hypoxic subterranean environment that Spalax experiences. Development of anticancer drugs designed to suppress tumor growth, angiogenesis, and metastasis is a major challenge, of which heparanase inhibition is a promising approach. We anticipate that the heparanase splicing model, evolved during 40 million years of Spalacid adaptation to underground life, would pave the way for the development of heparanase-based therapeutic modalities directed against angiogenesis, tumor growth, and metastasis. PMID:19164514

  17. Functional changes in Becker muscular dystrophy: implications for clinical trials in dystrophinopathies.

    PubMed

    Bello, Luca; Campadello, Paola; Barp, Andrea; Fanin, Marina; Semplicini, Claudio; Sorarù, Gianni; Caumo, Luca; Calore, Chiara; Angelini, Corrado; Pegoraro, Elena

    2016-09-01

    We performed a 1-year longitudinal study of Six Minute Walk Test (6MWT), North Star Ambulatory Assessment (NSAA), and timed function tests in Becker muscular dystrophy (BMD). Skeletal muscle dystrophin was quantified by immunoblot. We grouped deletions ending on exon 45 ("del 45-x", n = 28) or 51 ("del x-51", n = 10); isolated exon 48 deletion ("del 48", n = 10); and other mutations (n = 21). Only patients in the "del 45-x" or "other" groups became non-ambulatory (n = 5, log-rank p = n.s.) or unable to run (n = 22, p < 0.001). All measures correlated positively with dystrophin quantity and negatively with age, and were significantly more impaired in the "del 45-x" and "other" groups. After one year, NSAA score decreased significantly (-0.9 ± 1.6, p < 0.001); in the "del 45-x" group, both NSAA (-1.3 ± 1.7, p = 0.001) and 6MWT (-12 ± 31 m, p = 0.059) decreased. We conclude that patients with "del x-51" or "del 48" mutations have mild or asymptomatic BMD, while "del 45-x" mutations cause comparatively severe weakness, and functional deterioration in 1 year. Furthermore, exon 51 skipping could be more effective than exon 45 skipping in Duchenne muscular dystrophy.

  18. Emerging genetic therapies to treat Duchenne muscular dystrophy

    PubMed Central

    Nelson, Stanley F.; Crosbie, Rachelle H.; Miceli, M. Carrie; Spencer, Melissa J.

    2010-01-01

    Purpose of review Duchenne muscular dystrophy is a progressive muscle degenerative disease caused by dystrophin mutations. The purpose of this review is to highlight two emerging therapies designed to repair the primary genetic defect, called `exon skipping' and `nonsense codon suppression'. Recent findings A drug, PTC124, was identified that suppresses nonsense codon translation termination. PTC124 can lead to restoration of some dystrophin expression in human Duchenne muscular dystrophy muscles with mutations resulting in premature stops. Two drugs developed for exon skipping, PRO051 and AVI-4658, result in the exclusion of exon 51 from mature mRNA. They can restore the translational reading frame to dystrophin transcripts from patients with a particular subset of dystrophin gene deletions and lead to some restoration of dystrophin expression in affected boys' muscle in vivo. Both approaches have concluded phase I trials with no serious adverse events. Summary These novel therapies that act to correct the primary genetic defect of dystrophin deficiency are among the first generation of therapies tailored to correct specific mutations in humans. Thus, they represent paradigm forming approaches to personalized medicine with the potential to lead to life changing treatment for those affected by Duchenne muscular dystrophy. PMID:19745732

  19. TNF-α-Induced microRNAs Control Dystrophin Expression in Becker Muscular Dystrophy.

    PubMed

    Fiorillo, Alyson A; Heier, Christopher R; Novak, James S; Tully, Christopher B; Brown, Kristy J; Uaesoontrachoon, Kitipong; Vila, Maria C; Ngheim, Peter P; Bello, Luca; Kornegay, Joe N; Angelini, Corrado; Partridge, Terence A; Nagaraju, Kanneboyina; Hoffman, Eric P

    2015-09-08

    The amount and distribution of dystrophin protein in myofibers and muscle is highly variable in Becker muscular dystrophy and in exon-skipping trials for Duchenne muscular dystrophy. Here, we investigate a molecular basis for this variability. In muscle from Becker patients sharing the same exon 45-47 in-frame deletion, dystrophin levels negatively correlate with microRNAs predicted to target dystrophin. Seven microRNAs inhibit dystrophin expression in vitro, and three are validated in vivo (miR-146b/miR-374a/miR-31). microRNAs are expressed in dystrophic myofibers and increase with age and disease severity. In exon-skipping-treated mdx mice, microRNAs are significantly higher in muscles with low dystrophin rescue. TNF-α increases microRNA levels in vitro whereas NFκB inhibition blocks this in vitro and in vivo. Collectively, these data show that microRNAs contribute to variable dystrophin levels in muscular dystrophy. Our findings suggest a model where chronic inflammation in distinct microenvironments induces pathological microRNAs, initiating a self-sustaining feedback loop that exacerbates disease progression. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Comprehensive splicing functional analysis of DNA variants of the BRCA2 gene by hybrid minigenes

    PubMed Central

    2012-01-01

    Introduction The underlying pathogenic mechanism of a large fraction of DNA variants of disease-causing genes is the disruption of the splicing process. We aimed to investigate the effect on splicing of the BRCA2 variants c.8488-1G > A (exon 20) and c.9026_9030del (exon 23), as well as 41 BRCA2 variants reported in the Breast Cancer Information Core (BIC) mutation database. Methods DNA variants were analyzed with the splicing prediction programs NNSPLICE and Human Splicing Finder. Functional analyses of candidate variants were performed by lymphocyte RT-PCR and/or hybrid minigene assays. Forty-one BIC variants of exons 19, 20, 23 and 24 were bioinformatically selected and generated by PCR-mutagenesis of the wild type minigenes. Results Lymphocyte RT-PCR of c.8488-1G > A showed intron 19 retention and a 12-nucleotide deletion in exon 20, whereas c.9026_9030del did not show any splicing anomaly. Minigene analysis of c.8488-1G > A displayed the aforementioned aberrant isoforms but also exon 20 skipping. We further evaluated the splicing outcomes of 41 variants of four BRCA2 exons by minigene analysis. Eighteen variants presented splicing aberrations. Most variants (78.9%) disrupted the natural splice sites, whereas four altered putative enhancers/silencers and had a weak effect. Fluorescent RT-PCR of minigenes accurately detected 14 RNA isoforms generated by cryptic site usage, exon skipping and intron retention events. Fourteen variants showed total splicing disruptions and were predicted to truncate or eliminate essential domains of BRCA2. Conclusions A relevant proportion of BRCA2 variants are correlated with splicing disruptions, indicating that RNA analysis is a valuable tool to assess the pathogenicity of a particular DNA change. The minigene system is a straightforward and robust approach to detect variants with an impact on splicing and contributes to a better knowledge of this gene expression step. PMID:22632462

  1. Functional understanding of the diverse exon-intron structures of human GPCR genes.

    PubMed

    Hammond, Dorothy A; Olman, Victor; Xu, Ying

    2014-02-01

    The GPCR genes have a variety of exon-intron structures even though their proteins are all structurally homologous. We have examined all human GPCR genes with at least two functional protein isoforms, totaling 199, aiming to gain an understanding of what may have contributed to the large diversity of the exon-intron structures of the GPCR genes. The 199 genes have a total of 808 known protein splicing isoforms with experimentally verified functions. Our analysis reveals that 1301 (80.6%) adjacent exon-exon pairs out of the total of 1,613 in the 199 genes have either exactly one exon skipped or the intron in-between retained in at least one of the 808 protein splicing isoforms. This observation has a statistical significance p-value of 2.051762 * e(-09), assuming that the observed splicing isoforms are independent of the exon-intron structures. Our interpretation of this observation is that the exon boundaries of the GPCR genes are not randomly determined; instead they may be selected to facilitate specific alternative splicing for functional purposes.

  2. Transcriptome instability as a molecular pan-cancer characteristic of carcinomas.

    PubMed

    Sveen, Anita; Johannessen, Bjarne; Teixeira, Manuel R; Lothe, Ragnhild A; Skotheim, Rolf I

    2014-08-10

    We have previously proposed transcriptome instability as a genome-wide, pre-mRNA splicing-related characteristic of colorectal cancer. Here, we explore the hypothesis of transcriptome instability being a general characteristic of cancer. Exon-level microarray expression data from ten cancer datasets were analyzed, including breast cancer, cervical cancer, colorectal cancer, gastric cancer, lung cancer, neuroblastoma, and prostate cancer (555 samples), as well as paired normal tissue samples from the colon, lung, prostate, and stomach (93 samples). Based on alternative splicing scores across the genomes, we calculated sample-wise relative amounts of aberrant exon skipping and inclusion. Strong and non-random (P < 0.001) correlations between these estimates and the expression levels of splicing factor genes (n = 280) were found in most cancer types analyzed (breast-, cervical-, colorectal-, lung- and prostate cancer). This suggests a biological explanation for the splicing variation. Surprisingly, these associations prevailed in pan-cancer analyses. This is in contrast to the tissue and cancer specific patterns observed in comparisons across healthy tissue samples from the colon, lung, prostate, and stomach, and between paired cancer-normal samples from the same four tissue types. Based on exon-level expression profiling and computational analyses of alternative splicing, we propose transcriptome instability as a molecular pan-cancer characteristic. The affected cancers show strong and non-random associations between low expression levels of splicing factor genes, and high amounts of aberrant exon skipping and inclusion, and vice versa, on a genome-wide scale.

  3. Restoring Dystrophin Expression in Duchenne Muscular Dystrophy Muscle

    PubMed Central

    Hoffman, Eric P.; Bronson, Abby; Levin, Arthur A.; Takeda, Shin'ichi; Yokota, Toshifumi; Baudy, Andreas R.; Connor, Edward M.

    2011-01-01

    The identification of the Duchenne muscular dystrophy gene and protein in the late 1980s led to high hopes of rapid translation to molecular therapeutics. These hopes were fueled by early reports of delivering new functional genes to dystrophic muscle in mouse models using gene therapy and stem cell transplantation. However, significant barriers have thwarted translation of these approaches to true therapies, including insufficient therapeutic material (eg, cells and viral vectors), challenges in systemic delivery, and immunological hurdles. An alternative approach is to repair the patient's own gene. Two innovative small-molecule approaches have emerged as front-line molecular therapeutics: exon skipping and stop codon read through. Both approaches are in human clinical trials and aim to coax dystrophin protein production from otherwise inactive mutant genes. In the clinically severe dog model of Duchenne muscular dystrophy, the exon-skipping approach recently improved multiple functional outcomes. We discuss the status of these two methods aimed at inducing de novo dystrophin production from mutant genes and review implications for other disorders. PMID:21703390

  4. PMO Delivery System Using Bubble Liposomes and Ultrasound Exposure for Duchenne Muscular Dystrophy Treatment.

    PubMed

    Negishi, Yoichi; Ishii, Yuko; Nirasawa, Kei; Sasaki, Eri; Endo-Takahashi, Yoko; Suzuki, Ryo; Maruyama, Kazuo

    2018-01-01

    Duchenne muscular dystrophy (DMD) is a genetic disorder characterized by progressive muscle degeneration, caused by nonsense or frameshift mutations in the dystrophin (DMD) gene. Antisense oligonucleotides can be used to induce specific exon skipping; recently, a phosphorodiamidate morpholino oligomer (PMO) has been approved for clinical use in DMD. However, an efficient PMO delivery strategy is required to improve the therapeutic efficacy in DMD patients. We previously developed polyethylene glycol (PEG)-modified liposomes containing ultrasound contrast gas, "Bubble liposomes" (BLs), and found that the combination of BLs with ultrasound exposure is a useful gene delivery tool. Here, we describe an efficient PMO delivery strategy using the combination of BLs and ultrasound exposure to treat muscles in a DMD mouse model (mdx). This ultrasound-mediated BL technique can increase the PMO-mediated exon-skipping efficiency, leading to significantly increased dystrophin expression. Thus, the combination of BLs and ultrasound exposure may be a feasible PMO delivery method to improve therapeutic efficacy and reduce the PMO dosage for DMD treatment.

  5. A Novel Germline Mutation in BRCA1 Causes Exon 20 Skipping in a Korean Family with a History of Breast Cancer.

    PubMed

    Yoon, Kyong-Ah; Kong, Sun-Young; Lee, Eun Ji; Cho, Jeong Nam; Chang, Suhwan; Lee, Eun Sook

    2017-09-01

    Germline mutations in the BRCA1 and BRCA2 genes are strong genetic factors for predispositions to breast, ovarian, and other related cancers. This report describes a family with a history of breast and ovarian cancers that harbored a novel BRCA1 germline mutation. A single nucleotide deletion in intron 20, namely c.5332+4delA, was detected in a 43-year-old patient with breast cancer. This mutation led to the skipping of exon 20, which in turn resulted in the production of a truncated BRCA1 protein that was 1773 amino acids in length. The mother of the proband had died due to ovarian cancer and had harbored the same germline mutation. Ectopically expressed mutant BRCA1 protein interacted with the BARD1 protein, but showed a reduced transcriptional function, as demonstrated by the expression of cyclin B1 . This novel germline mutation in the BRCA1 gene caused familial breast and ovarian cancers.

  6. Anti-tumor efficacy of a novel CLK inhibitor via targeting RNA splicing and MYC-dependent vulnerability.

    PubMed

    Iwai, Kenichi; Yaguchi, Masahiro; Nishimura, Kazuho; Yamamoto, Yukiko; Tamura, Toshiya; Nakata, Daisuke; Dairiki, Ryo; Kawakita, Yoichi; Mizojiri, Ryo; Ito, Yoshiteru; Asano, Moriteru; Maezaki, Hironobu; Nakayama, Yusuke; Kaishima, Misato; Hayashi, Kozo; Teratani, Mika; Miyakawa, Shuichi; Iwatani, Misa; Miyamoto, Maki; Klein, Michael G; Lane, Wes; Snell, Gyorgy; Tjhen, Richard; He, Xingyue; Pulukuri, Sai; Nomura, Toshiyuki

    2018-06-01

    The modulation of pre-mRNA splicing is proposed as an attractive anti-neoplastic strategy, especially for the cancers that exhibit aberrant pre-mRNA splicing. Here, we discovered that T-025 functions as an orally available and potent inhibitor of Cdc2-like kinases (CLKs), evolutionally conserved kinases that facilitate exon recognition in the splicing machinery. Treatment with T-025 reduced CLK-dependent phosphorylation, resulting in the induction of skipped exons, cell death, and growth suppression in vitro and in vivo Further, through growth inhibitory characterization, we identified high CLK2 expression or MYC amplification as a sensitive-associated biomarker of T-025. Mechanistically, the level of CLK2 expression correlated with the magnitude of global skipped exons in response to T-025 treatment. MYC activation, which altered pre-mRNA splicing without the transcriptional regulation of CLKs, rendered cancer cells vulnerable to CLK inhibitors with synergistic cell death. Finally, we demonstrated in vivo anti-tumor efficacy of T-025 in an allograft model of spontaneous, MYC-driven breast cancer, at well-tolerated dosage. Collectively, our results suggest that the novel CLK inhibitor could have therapeutic benefits, especially for MYC-driven cancer patients. © 2018 Takeda Pharmaceutical Company Published under the terms of the CC BY 4.0 license.

  7. Moderation of phenotypic severity in dystrophic and junctional forms of epidermolysis bullosa through in-frame skipping of exons containing non-sense or frameshift mutations.

    PubMed

    McGrath, J A; Ashton, G H; Mellerio, J E; Salas-Alanis, J C; Swensson, O; McMillan, J R; Eady, R A

    1999-09-01

    Non-sense mutations on both alleles of either the type VII collagen gene (COL7A1) or the genes encoding laminin 5 (LAMA3, LAMB3, or LAMC2) usually result in clinically severe forms of recessive dystrophic or junctional epidermolysis bullosa, respectively. In this study we assessed two unrelated families whose mutations in genomic DNA predicted severe recessive dystrophic epidermolysis bullosa or junctional epidermolysis bullosa phenotypes but in whom the manifestations were milder than expected. The recessive dystrophic epidermolysis bullosa patients had a homozygous single base-pair frameshift mutation in exon 19 of COL7A1 (2470insG). Clinically, there was generalized blistering but only mild scarring. Skin biopsy revealed positive type VII collagen immunoreactivity and recognizable anchoring fibrils. The junctional epidermolysis bullosa patients were compound heterozygotes for a frameshift/non-sense combination of mutations in exons 3 and 17 of LAMB3 (29insC/Q834X). These patients did not have the lethal form of junctional epidermolysis bullosa but, as adults, displayed the milder generalized atrophic benign epidermolysis bullosa variant. There was undetectable laminin 5 staining at the dermal-epidermal junction using an antibody to the beta3 chain, but faintly positive alpha3 and gamma2 chain labeling, and there was variable hypoplasia of hemidesmosomes. To explain the milder recessive dystrophic epidermolysis bullosa and junctional epidermolysis bullosa phenotypes in these families, reverse transcription-polymerase chain reaction, using RNA extracted from frozen skin, was able to provide evidence for some rescue of mutant mRNA transcripts with restoration of the open- reading frame. In the recessive dystrophic epidermolysis bullosa patients, transcripts containing in-frame skipping of exon 19 of COL7A1 in the cDNA were detected, and in the junctional epidermolysis bullosa patients transcripts with in-frame skipping of exon 17 of LAMB3 were identified. The truncated proteins encoded by these transcripts are expected to lack certain critical domains involved in cell-matrix attachment, but may still be able to contribute to adhesion thereby moderating the severity of the skin blistering. This study shows the limitations in predicting phenotype in epidermolysis bullosa solely based on mutation analysis of genomic DNA and emphasizes the importance of immunohistochemistry, electron microscopy, and mRNA assessment as parallel investigations.

  8. Splicing of designer exons informs a biophysical model for exon definition

    PubMed Central

    Arias, Mauricio A.; Chasin, Lawrence A.

    2015-01-01

    Pre-mRNA molecules in humans contain mostly short internal exons flanked by longer introns. To explain the removal of such introns, exon recognition instead of intron recognition has been proposed. We studied this exon definition using designer exons (DEs) made up of three prototype modules of our own design: an exonic splicing enhancer (ESE), an exonic splicing silencer (ESS), and a Reference Sequence (R) predicted to be neither. Each DE was examined as the central exon in a three-exon minigene. DEs made of R modules showed a sharp size dependence, with exons shorter than 14 nt and longer than 174 nt splicing poorly. Changing the strengths of the splice sites improved longer exon splicing but worsened shorter exon splicing, effectively displacing the curve to the right. For the ESE we found, unexpectedly, that its enhancement efficiency was independent of its position within the exon. For the ESS we found a step-wise positional increase in its effects; it was most effective at the 3′ end of the exon. To apply these results quantitatively, we developed a biophysical model for exon definition of internal exons undergoing cotranscriptional splicing. This model features commitment to inclusion before the downstream exon is synthesized and competition between skipping and inclusion fates afterward. Collision of both exon ends to form an exon definition complex was incorporated to account for the effect of size; ESE/ESS effects were modeled on the basis of stabilization/destabilization. This model accurately predicted the outcome of independent experiments on more complex DEs that combined ESEs and ESSs. PMID:25492963

  9. Modulating Calcium Signals to Boost AON Exon Skipping for DMD

    DTIC Science & Technology

    2017-10-01

    NINDS $488,500/y Title: Rapid Phenotyping for Rare Variant Discovery in Autism This project is intended to use web-based recruiting to greatly...expand DNA samples available for genetic analysis to determine the heterogeneous genetic causes of autism . ACTIVE P30 AR057230-01 (Spencer

  10. Effects of systemic multiexon skipping with peptide-conjugated morpholinos in the heart of a dog model of Duchenne muscular dystrophy

    PubMed Central

    Echigoya, Yusuke; Nakamura, Akinori; Nagata, Tetsuya; Urasawa, Nobuyuki; Trieu, Nhu; Panesar, Dharminder; Kuraoka, Mutsuki; Moulton, Hong M.; Saito, Takashi; Aoki, Yoshitsugu; Iversen, Patrick; Sazani, Peter; Kole, Ryszard; Maruyama, Rika; Partridge, Terry; Takeda, Shin’ichi; Yokota, Toshifumi

    2017-01-01

    Duchenne muscular dystrophy (DMD) is a lethal genetic disorder caused by an absence of the dystrophin protein in bodywide muscles, including the heart. Cardiomyopathy is a leading cause of death in DMD. Exon skipping via synthetic phosphorodiamidate morpholino oligomers (PMOs) represents one of the most promising therapeutic options, yet PMOs have shown very little efficacy in cardiac muscle. To increase therapeutic potency in cardiac muscle, we tested a next-generation morpholino: arginine-rich, cell-penetrating peptide-conjugated PMOs (PPMOs) in the canine X-linked muscular dystrophy in Japan (CXMDJ) dog model of DMD. A PPMO cocktail designed to skip dystrophin exons 6 and 8 was injected intramuscularly, intracoronarily, or intravenously into CXMDJ dogs. Intravenous injections with PPMOs restored dystrophin expression in the myocardium and cardiac Purkinje fibers, as well as skeletal muscles. Vacuole degeneration of cardiac Purkinje fibers, as seen in DMD patients, was ameliorated in PPMO-treated dogs. Although symptoms and functions in skeletal muscle were not ameliorated by i.v. treatment, electrocardiogram abnormalities (increased Q-amplitude and Q/R ratio) were improved in CXMDJ dogs after intracoronary or i.v. administration. No obvious evidence of toxicity was found in blood tests throughout the monitoring period of one or four systemic treatments with the PPMO cocktail (12 mg/kg/injection). The present study reports the rescue of dystrophin expression and recovery of the conduction system in the heart of dystrophic dogs by PPMO-mediated multiexon skipping. We demonstrate that rescued dystrophin expression in the Purkinje fibers leads to the improvement/prevention of cardiac conduction abnormalities in the dystrophic heart. PMID:28373570

  11. Effects of systemic multiexon skipping with peptide-conjugated morpholinos in the heart of a dog model of Duchenne muscular dystrophy.

    PubMed

    Echigoya, Yusuke; Nakamura, Akinori; Nagata, Tetsuya; Urasawa, Nobuyuki; Lim, Kenji Rowel Q; Trieu, Nhu; Panesar, Dharminder; Kuraoka, Mutsuki; Moulton, Hong M; Saito, Takashi; Aoki, Yoshitsugu; Iversen, Patrick; Sazani, Peter; Kole, Ryszard; Maruyama, Rika; Partridge, Terry; Takeda, Shin'ichi; Yokota, Toshifumi

    2017-04-18

    Duchenne muscular dystrophy (DMD) is a lethal genetic disorder caused by an absence of the dystrophin protein in bodywide muscles, including the heart. Cardiomyopathy is a leading cause of death in DMD. Exon skipping via synthetic phosphorodiamidate morpholino oligomers (PMOs) represents one of the most promising therapeutic options, yet PMOs have shown very little efficacy in cardiac muscle. To increase therapeutic potency in cardiac muscle, we tested a next-generation morpholino: arginine-rich, cell-penetrating peptide-conjugated PMOs (PPMOs) in the canine X-linked muscular dystrophy in Japan (CXMD J ) dog model of DMD. A PPMO cocktail designed to skip dystrophin exons 6 and 8 was injected intramuscularly, intracoronarily, or intravenously into CXMD J dogs. Intravenous injections with PPMOs restored dystrophin expression in the myocardium and cardiac Purkinje fibers, as well as skeletal muscles. Vacuole degeneration of cardiac Purkinje fibers, as seen in DMD patients, was ameliorated in PPMO-treated dogs. Although symptoms and functions in skeletal muscle were not ameliorated by i.v. treatment, electrocardiogram abnormalities (increased Q-amplitude and Q/R ratio) were improved in CXMD J dogs after intracoronary or i.v. administration. No obvious evidence of toxicity was found in blood tests throughout the monitoring period of one or four systemic treatments with the PPMO cocktail (12 mg/kg/injection). The present study reports the rescue of dystrophin expression and recovery of the conduction system in the heart of dystrophic dogs by PPMO-mediated multiexon skipping. We demonstrate that rescued dystrophin expression in the Purkinje fibers leads to the improvement/prevention of cardiac conduction abnormalities in the dystrophic heart.

  12. A G-to-A mutation in IVS-3 of the human gamma fibrinogen gene causing afibrinogenemia due to abnormal RNA splicing.

    PubMed

    Margaglione, M; Santacroce, R; Colaizzo, D; Seripa, D; Vecchione, G; Lupone, M R; De Lucia, D; Fortina, P; Grandone, E; Perricone, C; Di Minno, G

    2000-10-01

    Congenital afibrinogenemia is a rare autosomal recessive disorder characterized by a hemorrhagic diathesis of variable severity. Although more than 100 families with this disorder have been described, genetic defects have been characterized in few cases. An investigation of a young propositus, offspring of a consanguineous marriage, with undetectable levels of functional and quantitative fibrinogen, was conducted. Sequence analysis of the fibrinogen genes showed a homozygous G-to-A mutation at the fifth nucleotide (nt 2395) of the third intervening sequence (IVS) of the gamma-chain gene. Her first-degree relatives, who had approximately half the normal fibrinogen values and showed concordance between functional and immunologic levels, were heterozygtes. The G-to-A change predicts the disappearance of a donor splice site. After transfection with a construct, containing either the wild-type or the mutated sequence, cells with the mutant construct showed an aberrant messenger RNA (mRNA), consistent with skipping of exon 3, but not the expected mRNA. Sequencing of the abnormal mRNA showed the complete absence of exon 3. Skipping of exon 3 predicts the deletion of amino acid sequence from residue 16 to residue 75 and shifting of reading frame at amino acid 76 with a premature stop codon within exon 4 at position 77. Thus, the truncated gamma-chain gene product would not interact with other chains to form the mature fibrinogen molecule. The current findings show that mutations within highly conserved IVS regions of fibrinogen genes could affect the efficiency of normal splicing, giving rise to congenital afibrinogenemia.

  13. Exon Skipping in the RET Gene Encodes Novel Isoforms That Differentially Regulate RET Protein Signal Transduction*

    PubMed Central

    Gabreski, Nicole A.; Vaghasia, Janki K.; Novakova, Silvia S.; McDonald, Neil Q.; Pierchala, Brian A.

    2016-01-01

    Rearranged during transfection (RET), a receptor tyrosine kinase that is activated by the glial cell line-derived neurotrophic factor family ligands (GFLs), plays a crucial role in the development and function of the nervous system and additionally is required for kidney development and spermatogenesis. RET encodes a transmembrane receptor that is 20 exons long and produces two known protein isoforms differing in C-terminal amino acid composition, referred to as RET9 and RET51. Studies of human pheochromocytomas identified two additional novel transcripts involving the skipping of exon 3 or exons 3, 4, and 5 and are referred to as RETΔE3 and RETΔE345, respectively. Here we report the presence of RetΔE3 and RetΔE345 in zebrafish, mice, and rats and show that these transcripts are dynamically expressed throughout development of the CNS, peripheral nervous system, and kidneys. We further explore the biochemical properties of these isoforms, demonstrating that, like full-length RET, RETΔE3 and RETΔE345 are trafficked to the cell surface, interact with all four GFRα co-receptors, and have the ability to heterodimerize with full-length RET. Signaling experiments indicate that RETΔE3 is phosphorylated in a similar manner to full-length RET. RETΔE345, in contrast, displays higher baseline autophosphorylation, specifically on the catalytic tyrosine, Tyr905, and also on one of the most important signaling residues, Tyr1062. These data provide the first evidence for a physiologic role of these isoforms in RET pathway function. PMID:27226544

  14. Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

    PubMed

    Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

    2002-06-01

    Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

  15. Abnormal splicing switch of DMD's penultimate exon compromises muscle fibre maintenance in myotonic dystrophy.

    PubMed

    Rau, Frédérique; Lainé, Jeanne; Ramanoudjame, Laetitita; Ferry, Arnaud; Arandel, Ludovic; Delalande, Olivier; Jollet, Arnaud; Dingli, Florent; Lee, Kuang-Yung; Peccate, Cécile; Lorain, Stéphanie; Kabashi, Edor; Athanasopoulos, Takis; Koo, Taeyoung; Loew, Damarys; Swanson, Maurice S; Le Rumeur, Elisabeth; Dickson, George; Allamand, Valérie; Marie, Joëlle; Furling, Denis

    2015-05-28

    Myotonic Dystrophy type 1 (DM1) is a dominant neuromuscular disease caused by nuclear-retained RNAs containing expanded CUG repeats. These toxic RNAs alter the activities of RNA splicing factors resulting in alternative splicing misregulation and muscular dysfunction. Here we show that the abnormal splicing of DMD exon 78 found in dystrophic muscles of DM1 patients is due to the functional loss of MBNL1 and leads to the re-expression of an embryonic dystrophin in place of the adult isoform. Forced expression of embryonic dystrophin in zebrafish using an exon-skipping approach severely impairs the mobility and muscle architecture. Moreover, reproducing Dmd exon 78 missplicing switch in mice induces muscle fibre remodelling and ultrastructural abnormalities including ringed fibres, sarcoplasmic masses or Z-band disorganization, which are characteristic features of dystrophic DM1 skeletal muscles. Thus, we propose that splicing misregulation of DMD exon 78 compromises muscle fibre maintenance and contributes to the progressive dystrophic process in DM1.

  16. Abnormal splicing switch of DMD's penultimate exon compromises muscle fibre maintenance in myotonic dystrophy

    PubMed Central

    Rau, Frédérique; Lainé, Jeanne; Ramanoudjame, Laetitita; Ferry, Arnaud; Arandel, Ludovic; Delalande, Olivier; Jollet, Arnaud; Dingli, Florent; Lee, Kuang-Yung; Peccate, Cécile; Lorain, Stéphanie; Kabashi, Edor; Athanasopoulos, Takis; Koo, Taeyoung; Loew, Damarys; Swanson, Maurice S.; Le Rumeur, Elisabeth; Dickson, George; Allamand, Valérie; Marie, Joëlle; Furling, Denis

    2015-01-01

    Myotonic Dystrophy type 1 (DM1) is a dominant neuromuscular disease caused by nuclear-retained RNAs containing expanded CUG repeats. These toxic RNAs alter the activities of RNA splicing factors resulting in alternative splicing misregulation and muscular dysfunction. Here we show that the abnormal splicing of DMD exon 78 found in dystrophic muscles of DM1 patients is due to the functional loss of MBNL1 and leads to the re-expression of an embryonic dystrophin in place of the adult isoform. Forced expression of embryonic dystrophin in zebrafish using an exon-skipping approach severely impairs the mobility and muscle architecture. Moreover, reproducing Dmd exon 78 missplicing switch in mice induces muscle fibre remodelling and ultrastructural abnormalities including ringed fibres, sarcoplasmic masses or Z-band disorganization, which are characteristic features of dystrophic DM1 skeletal muscles. Thus, we propose that splicing misregulation of DMD exon 78 compromises muscle fibre maintenance and contributes to the progressive dystrophic process in DM1. PMID:26018658

  17. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  18. Haploinsufficiency of the NF-κB1 Subunit p50 in Common Variable Immunodeficiency.

    PubMed

    Fliegauf, Manfred; Bryant, Vanessa L; Frede, Natalie; Slade, Charlotte; Woon, See-Tarn; Lehnert, Klaus; Winzer, Sandra; Bulashevska, Alla; Scerri, Thomas; Leung, Euphemia; Jordan, Anthony; Keller, Baerbel; de Vries, Esther; Cao, Hongzhi; Yang, Fang; Schäffer, Alejandro A; Warnatz, Klaus; Browett, Peter; Douglass, Jo; Ameratunga, Rohan V; van der Meer, Jos W M; Grimbacher, Bodo

    2015-09-03

    Common variable immunodeficiency (CVID), characterized by recurrent infections, is the most prevalent symptomatic antibody deficiency. In ∼90% of CVID-affected individuals, no genetic cause of the disease has been identified. In a Dutch-Australian CVID-affected family, we identified a NFKB1 heterozygous splice-donor-site mutation (c.730+4A>G), causing in-frame skipping of exon 8. NFKB1 encodes the transcription-factor precursor p105, which is processed to p50 (canonical NF-κB pathway). The altered protein bearing an internal deletion (p.Asp191_Lys244delinsGlu; p105ΔEx8) is degraded, but is not processed to p50ΔEx8. Altered NF-κB1 proteins were also undetectable in a German CVID-affected family with a heterozygous in-frame exon 9 skipping mutation (c.835+2T>G) and in a CVID-affected family from New Zealand with a heterozygous frameshift mutation (c.465dupA) in exon 7. Given that residual p105 and p50—translated from the non-mutated alleles—were normal, and altered p50 proteins were absent, we conclude that the CVID phenotype in these families is caused by NF-κB1 p50 haploinsufficiency. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  19. Human DBR1 modulates the recycling of snRNPs to affect alternative RNA splicing and contributes to the suppression of cancer development.

    PubMed

    Han, B; Park, H K; Ching, T; Panneerselvam, J; Wang, H; Shen, Y; Zhang, J; Li, L; Che, R; Garmire, L; Fei, P

    2017-09-21

    The contribution of RNA processing to tumorigenesis is understudied. Here, we report that the human RNA debranching enzyme (hDBR1), when inappropriately regulated, induces oncogenesis by causing RNA processing defects, for example, splicing defects. We found that wild-type p53 and hypoxia-inducible factor 1 co-regulate hDBR1 expression, and insufficient hDBR1 leads to a higher rate of exon skipping. Transcriptomic sequencing confirmed the effect of hDBR1 on RNA splicing, and metabolite profiling supported the observation that neoplasm is triggered by a decrease in hDBR1 expression both in vitro and in vivo. Most importantly, when modulating the expression of hDBR1, which was found to be generally low in malignant human tissues, higher expression of hDBR1 only affected exon-skipping activity in malignant cells. Together, our findings demonstrate previously unrecognized regulation and functions of hDBR1, with immediate clinical implications regarding the regulation of hDBR1 as an effective strategy for combating human cancer.

  20. Analysis and Prediction of Exon Skipping Events from RNA-Seq with Sequence Information Using Rotation Forest.

    PubMed

    Du, Xiuquan; Hu, Changlin; Yao, Yu; Sun, Shiwei; Zhang, Yanping

    2017-12-12

    In bioinformatics, exon skipping (ES) event prediction is an essential part of alternative splicing (AS) event analysis. Although many methods have been developed to predict ES events, a solution has yet to be found. In this study, given the limitations of machine learning algorithms with RNA-Seq data or genome sequences, a new feature, called RS (RNA-seq and sequence) features, was constructed. These features include RNA-Seq features derived from the RNA-Seq data and sequence features derived from genome sequences. We propose a novel Rotation Forest classifier to predict ES events with the RS features (RotaF-RSES). To validate the efficacy of RotaF-RSES, a dataset from two human tissues was used, and RotaF-RSES achieved an accuracy of 98.4%, a specificity of 99.2%, a sensitivity of 94.1%, and an area under the curve (AUC) of 98.6%. When compared to the other available methods, the results indicate that RotaF-RSES is efficient and can predict ES events with RS features.

  1. Adaptive Immune Response Impairs the Efficacy of Autologous Transplantation of Engineered Stem Cells in Dystrophic Dogs

    PubMed Central

    Sitzia, Clementina; Farini, Andrea; Jardim, Luciana; Razini, Paola; Belicchi, Marzia; Cassinelli, Letizia; Villa, Chiara; Erratico, Silvia; Parolini, Daniele; Bella, Pamela; da Silva Bizario, Joao Carlos; Garcia, Luis; Dias-Baruffi, Marcelo; Meregalli, Mirella; Torrente, Yvan

    2016-01-01

    Duchenne muscular dystrophy is the most common genetic muscular dystrophy. It is caused by mutations in the dystrophin gene, leading to absence of muscular dystrophin and to progressive degeneration of skeletal muscle. We have demonstrated that the exon skipping method safely and efficiently brings to the expression of a functional dystrophin in dystrophic CD133+ cells injected scid/mdx mice. Golden Retriever muscular dystrophic (GRMD) dogs represent the best preclinical model of Duchenne muscular dystrophy, mimicking the human pathology in genotypic and phenotypic aspects. Here, we assess the capacity of intra-arterial delivered autologous engineered canine CD133+ cells of restoring dystrophin expression in Golden Retriever muscular dystrophy. This is the first demonstration of five-year follow up study, showing initial clinical amelioration followed by stabilization in mild and severe affected Golden Retriever muscular dystrophy dogs. The occurrence of T-cell response in three Golden Retriever muscular dystrophy dogs, consistent with a memory response boosted by the exon skipped-dystrophin protein, suggests an adaptive immune response against dystrophin. PMID:27506452

  2. Eteplirsen in the treatment of Duchenne muscular dystrophy

    PubMed Central

    Lim, Kenji Rowel Q; Maruyama, Rika; Yokota, Toshifumi

    2017-01-01

    Duchenne muscular dystrophy is a fatal neuromuscular disorder affecting around one in 3,500–5,000 male births that is characterized by progressive muscular deterioration. It is inherited in an X-linked recessive fashion and is caused by loss-of-function mutations in the DMD gene coding for dystrophin, a cytoskeletal protein that stabilizes the plasma membrane of muscle fibers. In September 2016, the US Food and Drug Administration granted accelerated approval for eteplirsen (or Exondys 51), a drug that acts to promote dystrophin production by restoring the translational reading frame of DMD through specific skipping of exon 51 in defective gene variants. Eteplirsen is applicable for approximately 14% of patients with DMD mutations. This article extensively reviews and discusses the available information on eteplirsen to date, focusing on pharmacological, efficacy, safety, and tolerability data from preclinical and clinical trials. Issues faced by eteplirsen, particularly those relating to its efficacy, will be identified. Finally, the place of eteplirsen and exon skipping as a general therapeutic strategy in Duchenne muscular dystrophy treatment will be discussed. PMID:28280301

  3. Alternative splicing of mutually exclusive exons--a review.

    PubMed

    Pohl, Martin; Bortfeldt, Ralf H; Grützmann, Konrad; Schuster, Stefan

    2013-10-01

    Alternative splicing (AS) of pre-mRNAs in higher eukaryotes and several viruses is one major source of protein diversity. Usually, the following major subtypes of AS are distinguished: exon skipping, intron retention, and alternative 3' and 5' splice sites. Moreover, mutually exclusive exons (MXEs) represent a rare subtype. In the splicing of MXEs, two (or more) splicing events are not independent anymore, but are executed or disabled in a coordinated manner. In this review, several bioinformatics approaches for analyzing MXEs are presented and discussed. In particular, we revisit suitable definitions and nomenclatures, and bioinformatics tools for finding MXEs, adjacent and non-adjacent MXEs, clustered and grouped MXEs. Moreover, the molecular mechanisms for splicing MXEs proposed in the literature are reviewed and discussed. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  4. Nuclear sequestration of COL1A1 mRNA transcript associated with type I osteogenesis imperfecta (OI)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Primorac, D.; Stover, M.L.; McKinstry, M.B.

    Previously we identified an OI type I patient with a splice donor mutation that resulted in intron 26 retention instead of exon skipping and sequestration of normal levels of the mutant transcript in the nuclear compartment. Intron retention was consistent with the exon definition hypothesis for splice site selection since the size of the exon-intron-exon unit was less than 300 bp. Furthermore, the retained intron contained in-frame stop codons which is thought to cause the mutant RNA to remain within the nucleus rather than appearing in the cytoplasm. To test these hypotheses, genomic fragments containing the normal sequence or themore » donor mutation were cloned into a collagen minigene and expressed in stably tansfected NIH 3T3 cells. None of the modifications to the normal intron altered the level of RNA that accumulated in the cytoplasm, as expected. However none of the modifications to the mutant intron allowed accumulation of normal levels of mRNA in the cytoplasm. Moreover, in contrast to our findings in the patient`s cells only low levels of mutant transcript were found in the nucleus; a fraction of the transcript did appear in the cytoplasm which had spliced the mutant donor site correctly. Nuclear run-on experiments demonstrated equal levels of transcription from each transgene. Expression of another donor mutation known to cause in-frame exon skipping in OI type IV was accurately reproduced in the minigene in transfected 3T3 cells. Our experience suggests that either mechanism can lead to formation of a null allele possibly related to the type of splicing events surrounding the potential stop codons. Understanding the rules governing inactivation of a collagen RNA transcript may be important in designing a strategy to inactivate a dominate negative mutation associated with the more severe forms of OI.« less

  5. Alternative splicing regulated by butyrate in bovine epithelial cells.

    PubMed

    Wu, Sitao; Li, Congjun; Huang, Wen; Li, Weizhong; Li, Robert W

    2012-01-01

    As a signaling molecule and an inhibitor of histone deacetylases (HDACs), butyrate exerts its impact on a broad range of biological processes, such as apoptosis and cell proliferation, in addition to its critical role in energy metabolism in ruminants. This study examined the effect of butyrate on alternative splicing in bovine epithelial cells using RNA-seq technology. Junction reads account for 11.28 and 12.32% of total mapped reads between the butyrate-treated (BT) and control (CT) groups. 201,326 potential splicing junctions detected were supported by ≥ 3 junction reads. Approximately 94% of these junctions conformed to the consensus sequence (GT/AG) while ~3% were GC/AG junctions. No AT/AC junctions were observed. A total of 2,834 exon skipping events, supported by a minimum of 3 junction reads, were detected. At least 7 genes, their mRNA expression significantly affected by butyrate, also had exon skipping events differentially regulated by butyrate. Furthermore, COL5A3, which was induced 310-fold by butyrate (FDR <0.001) at the gene level, had a significantly higher number of junction reads mapped to Exon#8 (Donor) and Exon#11 (Acceptor) in BT. This event had the potential to result in the formation of a COL5A3 mRNA isoform with 2 of the 69 exons missing. In addition, 216 differentially expressed transcript isoforms regulated by butyrate were detected. For example, Isoform 1 of ORC1 was strongly repressed by butyrate while Isoform 2 remained unchanged. Butyrate physically binds to and inhibits all zinc-dependent HDACs except HDAC6 and HDAC10. Our results provided evidence that butyrate also regulated deacetylase activities of classical HDACs via its transcriptional control. Moreover, thirteen gene fusion events differentially affected by butyrate were identified. Our results provided a snapshot into complex transcriptome dynamics regulated by butyrate, which will facilitate our understanding of the biological effects of butyrate and other HDAC inhibitors.

  6. ANXA11 mutations prevail in Chinese ALS patients with and without cognitive dementia.

    PubMed

    Zhang, Kang; Liu, Qing; Liu, Keqiang; Shen, Dongchao; Tai, Hongfei; Shu, Shi; Ding, Qingyun; Fu, Hanhui; Liu, Shuangwu; Wang, Zhili; Li, Xiaoguang; Liu, Mingsheng; Zhang, Xue; Cui, Liying

    2018-06-01

    To investigate the genetic contribution of ANXA11 , a gene associated with amyotrophic lateral sclerosis (ALS), in Chinese ALS patients with and without cognitive dementia. Sequencing all the coding exons of ANXA11 and intron-exon boundaries in 18 familial amyotrophic lateral sclerosis (FALS), 353 unrelated sporadic amyotrophic lateral sclerosis (SALS), and 12 Chinese patients with ALS-frontotemporal lobar dementia (ALS-FTD). The transcripts in peripheral blood generated from a splicing mutation were examined by reverse transcriptase PCR. We identified 6 nonsynonymous heterozygous mutations (5 novel and 1 recurrent), 1 splice site mutation, and 1 deletion of 10 amino acids (not accounted in the mutant frequency) in 11 unrelated patients, accounting for a mutant frequency of 5.6% (1/18) in FALS, 2.3% (8/353) in SALS, and 8.3% (1/12) in ALS-FTD. The deletion of 10 amino acids was detected in 1 clinically undetermined male with an ALS family history who had atrophy in hand muscles and myotonic discharges revealed by EMG. The novel p. P36R mutation was identified in 1 FALS index, 1 patient with SALS, and 1 ALS-FTD. The splicing mutation (c.174-2A>G) caused in-frame skipping of the entire exon 6. The rest missense mutations including p.D40G, p.V128M, p.S229R, p.R302C and p.G491R were found in 6 unrelated patients with SALS. The ANXA11 gene is one of the most frequently mutated genes in Chinese patients with SALS. A canonical splice site mutation leading to skipping of the entire exon 6 further supports the loss-of-function mechanism. In addition, the study findings further expand the ANXA11 phenotype, first highlighting its pathogenic role in ALS-FTD.

  7. Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays

    PubMed Central

    Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel

    2006-01-01

    Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921

  8. Exon definition as a potential negative force against intron losses in evolution.

    PubMed

    Niu, Deng-Ke

    2008-11-13

    Previous studies have indicated that the wide variation in intron density (the number of introns per gene) among different eukaryotes largely reflects varying degrees of intron loss during evolution. The most popular model, which suggests that organisms lose introns through a mechanism in which reverse-transcribed cDNA recombines with the genomic DNA, concerns only one mutational force. Using exons as the units of splicing-site recognition, exon definition constrains the length of exons. An intron-loss event results in fusion of flanking exons and thus a larger exon. The large size of the newborn exon may cause splicing errors, i.e., exon skipping, if the splicing of pre-mRNAs is initiated by exon definition. By contrast, if the splicing of pre-mRNAs is initiated by intron definition, intron loss does not matter. Exon definition may thus be a selective force against intron loss. An organism with a high frequency of exon definition is expected to experience a low rate of intron loss throughout evolution and have a high density of spliceosomal introns. The majority of spliceosomal introns in vertebrates may be maintained during evolution not because of potential functions, but because of their splicing mechanism (i.e., exon definition). Further research is required to determine whether exon definition is a negative force in maintaining the high intron density of vertebrates. This article was reviewed by Dr. Scott W. Roy (nominated by Dr. John Logsdon), Dr.Eugene V. Koonin, and Dr. Igor B. Rogozin (nominated by Dr. Mikhail Gelfand). For the full reviews,please go to the Reviewers' comments section.

  9. Translation from a DMD exon 5 IRES results in a functional dystrophin isoform that attenuates dystrophinopathy in humans and mice.

    PubMed

    Wein, Nicolas; Vulin, Adeline; Falzarano, Maria S; Szigyarto, Christina Al-Khalili; Maiti, Baijayanta; Findlay, Andrew; Heller, Kristin N; Uhlén, Mathias; Bakthavachalu, Baskar; Messina, Sonia; Vita, Giuseppe; Passarelli, Chiara; Brioschi, Simona; Bovolenta, Matteo; Neri, Marcella; Gualandi, Francesca; Wilton, Steve D; Rodino-Klapac, Louise R; Yang, Lin; Dunn, Diane M; Schoenberg, Daniel R; Weiss, Robert B; Howard, Michael T; Ferlini, Alessandra; Flanigan, Kevin M

    2014-09-01

    Most mutations that truncate the reading frame of the DMD gene cause loss of dystrophin expression and lead to Duchenne muscular dystrophy. However, amelioration of disease severity has been shown to result from alternative translation initiation beginning in DMD exon 6 that leads to expression of a highly functional N-truncated dystrophin. Here we demonstrate that this isoform results from usage of an internal ribosome entry site (IRES) within exon 5 that is glucocorticoid inducible. We confirmed IRES activity by both peptide sequencing and ribosome profiling in muscle from individuals with minimal symptoms despite the presence of truncating mutations. We generated a truncated reading frame upstream of the IRES by exon skipping, which led to synthesis of a functional N-truncated isoform in both human subject-derived cell lines and in a new DMD mouse model, where expression of the truncated isoform protected muscle from contraction-induced injury and corrected muscle force to the same level as that observed in control mice. These results support a potential therapeutic approach for patients with mutations within the 5' exons of DMD.

  10. Genome-wide Analysis Reveals SR Protein Cooperation and Competition in Regulated Splicing

    PubMed Central

    Pandit, Shatakshi; Zhou, Yu; Shiue, Lily; Coutinho-Mansfield, Gabriela; Li, Hairi; Qiu, Jinsong; Huang, Jie; Yeo, Gene W.; Ares, Manuel; Fu, Xiang-Dong

    2013-01-01

    Summary SR proteins are well-characterized RNA binding proteins that promote exon inclusion by binding to exonic splicing enhancers (ESEs). However, it has been unclear whether regulatory rules deduced on model genes apply generally to activities of SR proteins in the cell. Here, we report global analyses of two prototypical SR proteins SRSF1 (SF2/ASF) and SRSF2 (SC35) using splicing-sensitive arrays and CLIP-seq on mouse embryo fibroblasts (MEFs). Unexpectedly, we find that these SR proteins promote both inclusion and skipping of exons in vivo, but their binding patterns do not explain such opposite responses. Further analyses reveal that loss of one SR protein is accompanied by coordinated loss or compensatory gain in the interaction of other SR proteins at the affected exons. Therefore, specific effects on regulated splicing by one SR protein actually depend on a complex set of relationships with multiple other SR proteins in mammalian genomes. PMID:23562324

  11. An RNA-splicing mutation (G{sup +51VS20}) in the Type II collagen gene (COL2A1) in a family with spondyloepiphyseal dysplasia congenita

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tiller, G.E.; Polumbo, P.A.; Weis, M.A.

    1995-02-01

    Defects in type II collagen have been demonstrated in a phenotypic continuum of chondrodysplasias that includes achondrogenesis II, hypochondrogenesis, spondyloepiphyseal dysplasia congenita (SEDC), Kniest dysplasia, and Stickler syndrome. We have determined that cartilage from a terminated fetus with an inherited form of SEDC contained both normal {alpha}1(II) collagen chains and chains that lacked amino acids 256-273 of the triple-helical domain. PCR amplification of this region of COL2A1, from genomic DNA, yielded products of normal size, while amplification of cDNA yielded a normal sized species and a shorter fragment missing exon 20. Sequence analysis of genomic DNA from the fetus revealedmore » a G{yields}T transversion at position +5 of intron 20; the affected father was also heterozygous for the mutation. Allele-specific PCR and heteroduplex analysis of a VNTR in COL2A1 independently confirmed the unaffected status of a fetus in a subsequent pregnancy. Thermodynamic calculations suggest that the mutation prevents normal splicing of exon 20 by interfering with binding of U{sub 1} small-nuclear RNA to pre-mRNA, thus leading to skipping of exon 20 in transcripts from the mutant allele. Electron micrographs of diseased cartilage showed intracellular inclusion bodies, which were stained by an antibody to {alpha}1(II) procollagen. Our findings support the hypothesis that {alpha}-chain length alterations that preserve the Gly-X-Y repeat motif of the triple helix result in partial intracellular retention of {alpha}1(II) procollagen and produce mild to moderate chondrodysplasia phenotypes. 50 refs., 6 figs., 1 tab.« less

  12. Bottom-up design of small molecules that stimulate exon 10 skipping in mutant MAPT pre-mRNA.

    PubMed

    Luo, Yiling; Disney, Matthew D

    2014-09-22

    One challenge in chemical biology is to develop small molecules that control cellular protein content. The amount and identity of proteins are influenced by the RNAs that encode them; thus, protein content in a cell could be affected by targeting mRNA. However, RNA has been traditionally difficult to target with small molecules. In this report, we describe controlling the protein products of the mutated microtubule-associated protein tau (MAPT) mature mRNA with a small molecule. MAPT mutations in exon 10 are associated with inherited frontotemporal dementia and Parkinsonism linked to chromosome 17 (FTDP-17), an incurable disease that is directly caused by increased inclusion of exon 10 in MAPT mRNA. Recent studies have shown that mutations within a hairpin at the MAPT exon 10-intron junction decrease the thermodynamic stability of the RNA, increasing binding to U1 snRNP and thus exon 10 inclusion. Therefore, we designed small molecules that bind and stabilize a mutant MAPT by using Inforna, a computational approach based on information about RNA-small-molecule interactions. The optimal compound selectively bound the mutant MAPT hairpin and thermodynamically stabilized its folding, facilitating exon 10 exclusion. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Exon Specific U1 snRNAs improve ELP1 exon 20 definition and rescue ELP1 protein expression in a Familial Dysautonomia mouse model.

    PubMed

    Donadon, Irving; Pinotti, Mirko; Rajkowska, Katarzyna; Pianigiani, Giulia; Barbon, Elena; Morini, Elisabetta; Motaln, Helena; Rogelj, Boris; Mingozzi, Federico; Slaugenhaupt, Susan A; Pagani, Franco

    2018-04-25

    Familial dysautonomia (FD) is a rare genetic disease with no treatment, caused by an intronic point mutation (c.2204 + 6T>C) that negatively affects the definition of exon 20 in the Elongator complex protein 1 gene (ELP1 also known as IKBKAP). This substitution modifies the 5' splice site and, in combination with regulatory splicing factors, induces different levels of exon 20 skipping, in various tissues. Here, we evaluated the therapeutic potential of a novel class of U1 snRNA molecules, Exon-Specific U1s (ExSpeU1s), in correcting ELP1 exon 20 recognition. Lentivirus-mediated expression of ELP1-ExSpeU1 in FD fibroblasts improved ELP1 splicing and protein levels. We next focused on a transgenic mouse model that recapitulates the same tissue-specific mis-splicing seen in FD patients. Intraperitoneal delivery of ELP1-ExSpeU1s-adeno-associated virus particles successfully increased the production of full-length human ELP1 transcript and protein. This splice-switching class of molecules is the first to specifically correct the ELP1 exon 20 splicing defect. Our data provide proof of principle of ExSpeU1s-adeno-associated virus particles as a novel therapeutic strategy for FD.

  14. Two splice variants of the bovine lactoferrin gene identified in Staphylococcus aureus isolated from mastitis in dairy cattle.

    PubMed

    Huang, J M; Wang, Z Y; Ju, Z H; Wang, C F; Li, Q L; Sun, T; Hou, Q L; Hang, S Q; Hou, M H; Zhong, J F

    2011-12-21

    Bovine lactoferrin (bLF) is a member of the transferrin family; it plays an important role in the innate immune response. We identified novel splice variants of the bLF gene in mastitis-infected and healthy cows. Reverse transcription-polymerase chain reaction (RT-PCR) and clone sequencing analysis were used to screen the splice variants of the bLF gene in the mammary gland, spleen and liver tissues. One main transcript corresponding to the bLF reference sequence was found in three tissues in both healthy and mastitis-infected cows. Quantitative real-time PCR analysis showed that the expression levels of the LF gene's main transcript were not significantly different in tissues from healthy versus mastitis-infected cows. However, the new splice variant, LF-AS2, which has the exon-skipping alternative splicing pattern, was only identified in mammary glands infected with Staphylococcus aureus. Sequencing analysis showed that the new splice variant was 251 bp in length, including exon 1, part of exon 2, part of exon 16, and exon 17. We conclude that bLF may play a role in resistance to mastitis through alternative splicing mechanisms.

  15. MET exon 14 skipping mutation in triple-negative pulmonary adenocarcinomas and pleomorphic carcinomas: An analysis of intratumoral MET status heterogeneity and clinicopathological characteristics.

    PubMed

    Kwon, Dohee; Koh, Jaemoon; Kim, Sehui; Go, Heounjeong; Kim, Young A; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Jeon, Yoon Kyung; Chung, Doo Hyun

    2017-04-01

    MET mutations leading to exon 14 skipping rarely occur in non-small cell lung cancer (NSCLC). Recently, small molecule inhibitors targeting MET mutations showed clinical benefit. However, the clinicopathological characteristics of NSCLC harboring MET mutations, and the correlation among mutations, protein expression, and gene copy number of MET in NSCLC remain unclear. Therefore, we address these issues. MET exon 14 skipping mutations were evaluated using real-time quantitative reverse-transcription-PCR (qRT-PCR) in 102 triple-negative (i.e., EGFR mutation (-)/ALK translocation (-)/KRAS mutation (-)) pulmonary adenocarcinomas, and 45 pleomorphic carcinomas. MET mutation and gene copy were also examined in microdissected tissues obtained from tumor areas with heterogeneous MET immunohistochemical expression. MET mutations were detected in 8.8% (9/102) of triple-negative adenocarcinomas and 20% (9/45) of pleomorphic carcinomas of the lung. Patients with MET-mutated adenocarcinomas was significantly older than those without MET mutations (P=0.015). The male to female and ever-to never-smoker ratios were 3:6 and 2:7, respectively, among patients with MET-mutated adenocarcinomas. All (9/9) of the MET-mutated adenocarcinomas showed acinar predominant histology with associated lepidic patterns. In contrast, the male to female and ever- to never-smoker ratios were 8:1 and 7:1, respectively, among patients with MET-mutated pleomorphic carcinomas. The carcinoma component of MET-mutated pleomorphic carcinomas was mostly adenocarcinoma of acinar pattern (8/9). MET mutation was detected by qRT-PCR in all samples with heterogeneous MET expression microdissected from five cases with MET-mutated adenocarcinoma, while MET gene amplification was detected in tumor areas expressing high MET protein levels among MET-mutated adenocarcinomas. MET-mutated NSCLC is characterized by older age in patients with adenocarcinoma and by an acinar histology and variable MET expression in patients with adenocarcinoma and pleomorphic carcinomas. Moreover, MET gene amplification might occur in the tumor cells harboring the MET mutation. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant

    PubMed Central

    Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta

    2012-01-01

    Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

  17. X-linked Alport syndrome caused by splicing mutations in COL4A5.

    PubMed

    Nozu, Kandai; Vorechovsky, Igor; Kaito, Hiroshi; Fu, Xue Jun; Nakanishi, Koichi; Hashimura, Yuya; Hashimoto, Fusako; Kamei, Koichi; Ito, Shuichi; Kaku, Yoshitsugu; Imasawa, Toshiyuki; Ushijima, Katsumi; Shimizu, Junya; Makita, Yoshio; Konomoto, Takao; Yoshikawa, Norishige; Iijima, Kazumoto

    2014-11-07

    X-linked Alport syndrome is caused by mutations in the COL4A5 gene. Although many COL4A5 mutations have been detected, the mutation detection rate has been unsatisfactory. Some men with X-linked Alport syndrome show a relatively mild phenotype, but molecular basis investigations have rarely been conducted to clarify the underlying mechanism. In total, 152 patients with X-linked Alport syndrome who were suspected of having Alport syndrome through clinical and pathologic investigations and referred to the hospital for mutational analysis between January of 2006 and January of 2013 were genetically diagnosed. Among those patients, 22 patients had suspected splice site mutations. Transcripts are routinely examined when suspected splice site mutations for abnormal transcripts are detected; 11 of them showed expected exon skipping, but others showed aberrant splicing patterns. The mutation detection strategy had two steps: (1) genomic DNA analysis using PCR and direct sequencing and (2) mRNA analysis using RT-PCR to detect RNA processing abnormalities. Six splicing consensus site mutations resulting in aberrant splicing patterns, one exonic mutation leading to exon skipping, and four deep intronic mutations producing cryptic splice site activation were identified. Interestingly, one case produced a cryptic splice site with a single nucleotide substitution in the deep intron that led to intronic exonization containing a stop codon; however, the patient showed a clearly milder phenotype for X-linked Alport syndrome in men with a truncating mutation. mRNA extracted from the kidney showed both normal and abnormal transcripts, with the normal transcript resulting in the milder phenotype. This novel mechanism leads to mild clinical characteristics. This report highlights the importance of analyzing transcripts to enhance the mutation detection rate and provides insight into genotype-phenotype correlations. This approach can clarify the cause of atypically mild phenotypes in X-linked Alport syndrome. Copyright © 2014 by the American Society of Nephrology.

  18. Therapy for Duchenne muscular dystrophy: renewed optimism from genetic approaches.

    PubMed

    Fairclough, Rebecca J; Wood, Matthew J; Davies, Kay E

    2013-06-01

    Duchenne muscular dystrophy (DMD) is a devastating progressive disease for which there is currently no effective treatment except palliative therapy. There are several promising genetic approaches, including viral delivery of the missing dystrophin gene, read-through of translation stop codons, exon skipping to restore the reading frame and increased expression of the compensatory utrophin gene. The lessons learned from these approaches will be applicable to many other disorders.

  19. Regulation of Alternative Splicing in Vivo by Overexpression of Antagonistic Splicing Factors

    NASA Astrophysics Data System (ADS)

    Caceres, Javier F.; Stamm, Stefan; Helfman, David M.; Krainer, Adrian R.

    1994-09-01

    The opposing effects of SF2/ASF and heterogeneous nuclear ribonucleoprotein (hnRNP) A1 influence alternative splicing in vitro. SF2/ASF or hnRNP A1 complementary DNAs were transiently overexpressed in HeLa cells, and the effect on alternative splicing of several cotransfected reporter genes was measured. Increased expression of SF2/ASF activated proximal 5' splice sites, promoted inclusion of a neuron-specific exon, and prevented abnormal exon skipping. Increased expression of hnRNP A1 activated distal 5' splice sites. Therefore, variations in the intracellular levels of antagonistic splicing factors influence different modes of alternative splicing in vivo and may be a natural mechanism for tissue-specific or developmental regulation of gene expression.

  20. Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

    PubMed

    Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven

    2003-04-01

    Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.

  1. Highly efficient in vivo delivery of PMO into regenerating myotubes and rescue in laminin-α2 chain-null congenital muscular dystrophy mice.

    PubMed

    Aoki, Yoshitsugu; Nagata, Tetsuya; Yokota, Toshifumi; Nakamura, Akinori; Wood, Matthew J A; Partridge, Terence; Takeda, Shin'ichi

    2013-12-15

    Phosphorodiamidate morpholino oligomer (PMO)-mediated exon skipping is among the more promising approaches to the treatment of several neuromuscular disorders including Duchenne muscular dystrophy. The main weakness of this approach arises from the low efficiency and sporadic nature of the delivery of charge-neutral PMO into muscle fibers, the mechanism of which is unknown. In this study, to test our hypothesis that muscle fibers take up PMO more efficiently during myotube formation, we induced synchronous muscle regeneration by injection of cardiotoxin into the tibialis anterior muscle of Dmd exon 52-deficient mdx52 and wild-type mice. Interestingly, by in situ hybridization, we detected PMO mainly in embryonic myosin heavy chain-positive regenerating fibers. In addition, we showed that PMO or 2'-O-methyl phosphorothioate is taken up efficiently into C2C12 myotubes when transfected 24-72 h after the induction of differentiation but is poorly taken up into undifferentiated C2C12 myoblasts suggesting efficient uptake of PMO in the early stages of C2C12 myotube formation. Next, we tested the therapeutic potential of PMO for laminin-α2 chain-null dy(3K)/dy(3K) mice: a model of merosin-deficient congenital muscular dystrophy (MDC1A) with active muscle regeneration. We confirmed the recovery of laminin-α2 chain and slightly prolonged life span following skipping of the mutated exon 4 in dy(3K)/dy(3K) mice. These findings support the idea that PMO entry into fibers is dependent on a developmental stage in myogenesis rather than on dystrophinless muscle membranes and provide a platform for developing PMO-mediated therapies for a variety of muscular disorders, such as MDC1A, that involve active muscle regeneration.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alvarez, Enrique, E-mail: ealvarez@cbm.uam.es; Castello, Alfredo; Carrasco, Luis

    Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of proteasemore » fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.« less

  3. Rare splicing defects of FAS underly severe recessive autoimmune lymphoproliferative syndrome.

    PubMed

    Agrebi, N; Ben-Mustapha, I; Matoussi, N; Dhouib, N; Ben-Ali, M; Mekki, N; Ben-Ahmed, M; Larguèche, B; Ben Becher, S; Béjaoui, M; Barbouche, M R

    2017-10-01

    Autoimmune lymphoproliferative syndrome (ALPS) is a prototypic disorder of impaired apoptosis characterized by autoimmune features and lymphoproliferation. Heterozygous germline or somatic FAS mutations associated with preserved protein expression have been described. Very rare cases of homozygous germline FAS mutations causing severe autosomal recessive form of ALPS with a complete defect of Fas expression have been reported. We report two unrelated patients from highly inbred North African population showing a severe ALPS phenotype and an undetectable Fas surface expression. Two novel homozygous mutations have been identified underlying rare splicing defects mechanisms. The first mutation breaks a branch point sequence and the second alters a regulatory exonic splicing site. These splicing defects induce the skipping of exon 6 encoding the transmembrane domain of CD95. Our findings highlight the requirement of tight regulation of FAS exon 6 splicing for balanced alternative splicing and illustrate the importance of such studies in highly consanguineous populations. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. A mechanism underlying position-specific regulation of alternative splicing

    PubMed Central

    Hamid, Fursham M.

    2017-01-01

    Abstract Many RNA-binding proteins including a master regulator of splicing in developing brain and muscle, polypyrimidine tract-binding protein 1 (PTBP1), can either activate or repress alternative exons depending on the pre-mRNA recruitment position. When bound upstream or within regulated exons PTBP1 tends to promote their skipping, whereas binding to downstream sites often stimulates inclusion. How this switch is orchestrated at the molecular level is poorly understood. Using bioinformatics and biochemical approaches we show that interaction of PTBP1 with downstream intronic sequences can activate natural cassette exons by promoting productive docking of the spliceosomal U1 snRNP to a suboptimal 5′ splice site. Strikingly, introducing upstream PTBP1 sites to this circuitry leads to a potent splicing repression accompanied by the assembly of an exonic ribonucleoprotein complex with a tightly bound U1 but not U2 snRNP. Our data suggest a molecular mechanism underlying the transition between a better-known repressive function of PTBP1 and its role as a bona fide splicing activator. More generally, we argue that the functional outcome of individual RNA contacts made by an RNA-binding protein is subject to extensive context-specific modulation.

  5. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study

    PubMed Central

    Cirak, Sebahattin; Arechavala-Gomeza, Virginia; Guglieri, Michela; Feng, Lucy; Torelli, Silvia; Anthony, Karen; Abbs, Stephen; Garralda, Maria Elena; Bourke, John; Wells, Dominic J; Dickson, George; Wood, Matthew JA; Wilton, Steve D; Straub, Volker; Kole, Ryszard; Shrewsbury, Stephen B; Sewry, Caroline; Morgan, Jennifer E; Bushby, Kate; Muntoni, Francesco

    2011-01-01

    Summary Background We report clinical safety and biochemical efficacy from a dose-ranging study of intravenously administered AVI-4658 phosphorodiamidate morpholino oligomer (PMO) in patients with Duchenne muscular dystrophy. Method We undertook an open-label, phase 2, dose-escalation study (0·5, 1·0, 2·0, 4·0, 10·0, and 20·0 mg/kg bodyweight) in ambulant patients with Duchenne muscular dystrophy aged 5–15 years with amenable deletions in DMD. Participants had a muscle biopsy before starting treatment and after 12 weekly intravenous infusions of AVI-4658. The primary study objective was to assess safety and tolerability of AVI-4658. The secondary objectives were pharmacokinetic properties and the ability of AVI-4658 to induce exon 51 skipping and dystrophin restoration by RT-PCR, immunohistochemistry, and immunoblotting. The study is registered, number NCT00844597. Findings 19 patients took part in the study. AVI-4658 was well tolerated with no drug-related serious adverse events. AVI-4658 induced exon 51 skipping in all cohorts and new dystrophin protein expression in a significant dose-dependent (p=0·0203), but variable, manner in boys from cohort 3 (dose 2 mg/kg) onwards. Seven patients responded to treatment, in whom mean dystrophin fluorescence intensity increased from 8·9% (95% CI 7·1–10·6) to 16·4% (10·8–22·0) of normal control after treatment (p=0·0287). The three patients with the greatest responses to treatment had 21%, 15%, and 55% dystrophin-positive fibres after treatment and these findings were confirmed with western blot, which showed an increase after treatment of protein levels from 2% to 18%, from 0·9% to 17%, and from 0% to 7·7% of normal muscle, respectively. The dystrophin-associated proteins α-sarcoglycan and neuronal nitric oxide synthase were also restored at the sarcolemma. Analysis of the inflammatory infiltrate indicated a reduction of cytotoxic T cells in the post-treatment muscle biopsies in the two high-dose cohorts. Interpretation The safety and biochemical efficacy that we present show the potential of AVI-4658 to become a disease-modifying drug for Duchenne muscular dystrophy. Funding UK Medical Research Council; AVI BioPharma. PMID:21784508

  6. A splicing mutation in Aryl Hydrocarbon Receptor associated with retinitis pigmentosa.

    PubMed

    Zhou, Yu; Li, Shijin; Huang, Lulin; Yang, Yeming; Zhang, Lin; Yang, Mu; Liu, Wenjing; Ramasamy, Kim; Jiang, Zhilin; Sundaresan, Periasamy; Zhu, Xianjun; Yang, Zhenglin

    2018-05-02

    Retinitis pigmentosa (RP) refers to a group of retinal degenerative diseases, which often lead to vision loss. Although 70 genes have been identified in RP patients, the genetic cause of approximately 30% of RP cases remains unknown. We aimed to identify the cause of the disease in a cohort of RP families by whole exome sequencing. A rare homozygous splicing variant, c.1160 + 1G>A, which introduced skipping of exon 9 of the aryl hydrocarbon receptor (AHR), was identified in family RD-134. This variant is very rare in several exome databases and leads to skipping of exon 9 in the transcript. AHR is expressed in the human retina and is a ligand-activated transcription factor with multiple functions. Mutant AHR failed to promote 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced Xenobiotic Responsive Element (XRE) luciferase activity. In parallel, mutation in AHR abolished activation of its downstream target gene, such as CYP1A1 and CYP1A2. To investigate the in vivo roles of Ahr in the retina, we generated a retina-specific conditional knockout mouse model of Ahr. Comparing with wildtype mouse, Ahr knockout mice exhibited reduced electroretinogram responses at 9 months of age. Retinal histology revealed Retinal histology showed the degeneration of photoreceptors with a thinner outer nuclear layer. Thus, our data demonstrate that AHR is associated with RP.

  7. Eye movements and word skipping during reading: Effects of word length and predictability

    PubMed Central

    Rayner, Keith; Slattery, Timothy J.; Drieghe, Denis; Liversedge, Simon P.

    2012-01-01

    The extent to which target words were predictable from prior context was varied: half of the target words were predictable and the other half were unpredictable. In addition, the length of the target word varied: the target words were short (4–6 letters), medium (7–9 letters), or long (10–12 letters). Length and predictability both yielded strong effects on the probability of skipping the target words and on the amount of time readers fixated the target words (when they were not skipped). However, there was no interaction in any of the measures examined for either skipping or fixation time. The results demonstrate that word predictability (due to contextual constraint) and word length have strong and independent influences on word skipping and fixation durations. Furthermore, since the long words extended beyond the word identification span, the data indicate that skipping can occur on the basis of partial information in relation to word identity. PMID:21463086

  8. Mechanistic Evaluation for Mixed-field Agglutination in the K562 Cell Study Model with Exon 3 Deletion of A1 Gene.

    PubMed

    Chen, Ding-Ping; Tseng, Ching-Ping; Lin, Chi-Jui; Wang, Wei-Ting; Sun, Chien-Feng

    2015-01-01

    In the case of blood type B3 with typical mixed-field agglutination of RBCs in the presence of anti-B or anti-AB antibody, a number of genetic alternations have been reported. It is well known that the IVS3+5G→A mutation in the B gene destroys the consensus of the splice donor site leading to exon 3 skipping during mRNA splicing. The lack of exon 3 likely causes a short stem region, producing an unstable B3 protein, and is concomitant with a decrease in B3 protein expression. Whether the phenomenon also appears in the type A blood group is of question. In this study, we evaluate whether exon 3 deletion in the blood type A gene also results in mixed-field phenotype. Site-directed mutagenesis was used to generate cDNA encoding A1 gene with exon 3 deletion. The cDNA was stably expressed in K562 cells. The expression of A antigen was compared with expression in parental K562 cells that did not express A antigen and in the stable K562 cell line expressing A(1) cDNA by flow cytometry analyses. The expression of A antigen in A1 stable cells and parental K562 cells was set as 100% and 0%, respectively. The mean relative percentage of A antigen expression for the cells of A1 with exon 3 deletion was 59.9% of A1 stable cells. Consistent with the observations of B3, which is B gene with exon 3 deletion, mixed field agglutination was observed for the cells expressing A1 with exon 3 deletion. Exon 3 deletion results in mixed field phenotype in both type A and B RBCs. However, the degree of antigen expression change for exon 3 deletion in A gene was less severe when compared with the deletion occurred in B gene. © 2015 by the Association of Clinical Scientists, Inc.

  9. Combined genetic and splicing analysis of BRCA1 c.[594-2A>C; 641A>G] highlights the relevance of naturally occurring in-frame transcripts for developing disease gene variant classification algorithms

    PubMed Central

    de la Hoya, Miguel; Soukarieh, Omar; López-Perolio, Irene; Vega, Ana; Walker, Logan C.; van Ierland, Yvette; Baralle, Diana; Santamariña, Marta; Lattimore, Vanessa; Wijnen, Juul; Whiley, Philip; Blanco, Ana; Raponi, Michela; Hauke, Jan; Wappenschmidt, Barbara; Becker, Alexandra; Hansen, Thomas V. O.; Behar, Raquel; Investigators, KConFaB; Niederacher, Diether; Arnold, Norbert; Dworniczak, Bernd; Steinemann, Doris; Faust, Ulrike; Rubinstein, Wendy; Hulick, Peter J.; Houdayer, Claude; Caputo, Sandrine M.; Castera, Laurent; Pesaran, Tina; Chao, Elizabeth; Brewer, Carole; Southey, Melissa C.; van Asperen, Christi J.; Singer, Christian F.; Sullivan, Jan; Poplawski, Nicola; Mai, Phuong; Peto, Julian; Johnson, Nichola; Burwinkel, Barbara; Surowy, Harald; Bojesen, Stig E.; Flyger, Henrik; Lindblom, Annika; Margolin, Sara; Chang-Claude, Jenny; Rudolph, Anja; Radice, Paolo; Galastri, Laura; Olson, Janet E.; Hallberg, Emily; Giles, Graham G.; Milne, Roger L.; Andrulis, Irene L.; Glendon, Gord; Hall, Per; Czene, Kamila; Blows, Fiona; Shah, Mitul; Wang, Qin; Dennis, Joe; Michailidou, Kyriaki; McGuffog, Lesley; Bolla, Manjeet K.; Antoniou, Antonis C.; Easton, Douglas F.; Couch, Fergus J.; Tavtigian, Sean; Vreeswijk, Maaike P.; Parsons, Michael; Meeks, Huong D.; Martins, Alexandra; Goldgar, David E.; Spurdle, Amanda B.

    2016-01-01

    A recent analysis using family history weighting and co-observation classification modeling indicated that BRCA1 c.594-2A > C (IVS9-2A > C), previously described to cause exon 10 skipping (a truncating alteration), displays characteristics inconsistent with those of a high risk pathogenic BRCA1 variant. We used large-scale genetic and clinical resources from the ENIGMA, CIMBA and BCAC consortia to assess pathogenicity of c.594-2A > C. The combined odds for causality considering case-control, segregation and breast tumor pathology information was 3.23 × 10−8. Our data indicate that c.594-2A > C is always in cis with c.641A > G. The spliceogenic effect of c.[594-2A > C;641A > G] was characterized using RNA analysis of human samples and splicing minigenes. As expected, c.[594-2A > C; 641A > G] caused exon 10 skipping, albeit not due to c.594-2A > C impairing the acceptor site but rather by c.641A > G modifying exon 10 splicing regulatory element(s). Multiple blood-based RNA assays indicated that the variant allele did not produce detectable levels of full-length transcripts, with a per allele BRCA1 expression profile composed of ≈70–80% truncating transcripts, and ≈20–30% of in-frame Δ9,10 transcripts predicted to encode a BRCA1 protein with tumor suppression function. We confirm that BRCA1c.[594-2A > C;641A > G] should not be considered a high-risk pathogenic variant. Importantly, results from our detailed mRNA analysis suggest that BRCA-associated cancer risk is likely not markedly increased for individuals who carry a truncating variant in BRCA1 exons 9 or 10, or any other BRCA1 allele that permits 20–30% of tumor suppressor function. More generally, our findings highlight the importance of assessing naturally occurring alternative splicing for clinical evaluation of variants in disease-causing genes. PMID:27008870

  10. Idiopathic hypogonadotropic hypogonadism in a mother and her monozygotic twins born after a single embryo transfer.

    PubMed

    Laitinen, Eeva-Maria; Tommiska, Johanna; Dunkel, Leo; Sankilampi, Ulla; Vaaralahti, Kirsi; Raivio, Taneli

    2010-04-01

    To describe a mother with idiopathic hypogonadotropic hypogonadism (IHH) and her monozygotic (MZ) twin boys who all have the same heterozygous fibroblast growth factor receptor-1 (FGFR1) gene mutation. Case report. University hospital. A 28-year-old mother with normosmic IHH gave birth to MZ twin boys after a transfer of a single frozen-thawed embryo. Clinical and biochemical evaluation of IHH. Sequence analysis of the 17 coding exons (exons 2-18) and exon-intron boundaries of FGFR1 from polymerase chain reaction-amplified genomic DNA from peripheral blood leukocytes of the subjects. Phenotypic features of the subjects. All subjects harbored a previously undescribed heterozygous FGFR1 mutation (c.2049-1 G-->C), leading to the skipping of exon 16 and thus a loss of amino acids 684-726 in the tyrosine kinase domain of the receptor. The absence of exon 16 was verified at the cDNA level. The twins manifested with microphallus, cryptorchidism, and deficient postnatal activation of the hypothalamic-pituitary-gonadal axis, findings consistent with IHH. Our report underlines that assisted reproductive techniques enable the inheritance of gene mutations causing infertility. This is the first report on the phenotypic features of MZ twins with an FGFR1 mutation. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  11. Decoding of exon splicing patterns in the human RUNX1-RUNX1T1 fusion gene.

    PubMed

    Grinev, Vasily V; Migas, Alexandr A; Kirsanava, Aksana D; Mishkova, Olga A; Siomava, Natalia; Ramanouskaya, Tatiana V; Vaitsiankova, Alina V; Ilyushonak, Ilia M; Nazarov, Petr V; Vallar, Laurent; Aleinikova, Olga V

    2015-11-01

    The t(8;21) translocation is the most widespread genetic defect found in human acute myeloid leukemia. This translocation results in the RUNX1-RUNX1T1 fusion gene that produces a wide variety of alternative transcripts and influences the course of the disease. The rules of combinatorics and splicing of exons in the RUNX1-RUNX1T1 transcripts are not known. To address this issue, we developed an exon graph model of the fusion gene organization and evaluated its local exon combinatorics by the exon combinatorial index (ECI). Here we show that the local exon combinatorics of the RUNX1-RUNX1T1 gene follows a power-law behavior and (i) the vast majority of exons has a low ECI, (ii) only a small part is represented by "exons-hubs" of splicing with very high ECI values, and (iii) it is scale-free and very sensitive to targeted skipping of "exons-hubs". Stochasticity of the splicing machinery and preferred usage of exons in alternative splicing can explain such behavior of the system. Stochasticity may explain up to 12% of the ECI variance and results in a number of non-coding and unproductive transcripts that can be considered as a noise. Half-life of these transcripts is increased due to the deregulation of some key genes of the nonsense-mediated decay system in leukemia cells. On the other hand, preferred usage of exons may explain up to 75% of the ECI variability. Our analysis revealed a set of splicing-related cis-regulatory motifs that can explain "attractiveness" of exons in alternative splicing but only when they are considered together. Cis-regulatory motifs are guides for splicing trans-factors and we observed a leukemia-specific profile of expression of the splicing genes in t(8;21)-positive blasts. Altogether, our results show that alternative splicing of the RUNX1-RUNX1T1 transcripts follows strict rules and that the power-law component of the fusion gene organization confers a high flexibility to this process. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Precise correction of the dystrophin gene in duchenne muscular dystrophy patient induced pluripotent stem cells by TALEN and CRISPR-Cas9.

    PubMed

    Li, Hongmei Lisa; Fujimoto, Naoko; Sasakawa, Noriko; Shirai, Saya; Ohkame, Tokiko; Sakuma, Tetsushi; Tanaka, Michihiro; Amano, Naoki; Watanabe, Akira; Sakurai, Hidetoshi; Yamamoto, Takashi; Yamanaka, Shinya; Hotta, Akitsu

    2015-01-13

    Duchenne muscular dystrophy (DMD) is a severe muscle-degenerative disease caused by a mutation in the dystrophin gene. Genetic correction of patient-derived induced pluripotent stem cells (iPSCs) by TALENs or CRISPR-Cas9 holds promise for DMD gene therapy; however, the safety of such nuclease treatment must be determined. Using a unique k-mer database, we systematically identified a unique target region that reduces off-target sites. To restore the dystrophin protein, we performed three correction methods (exon skipping, frameshifting, and exon knockin) in DMD-patient-derived iPSCs, and found that exon knockin was the most effective approach. We further investigated the genomic integrity by karyotyping, copy number variation array, and exome sequencing to identify clones with a minimal mutation load. Finally, we differentiated the corrected iPSCs toward skeletal muscle cells and successfully detected the expression of full-length dystrophin protein. These results provide an important framework for developing iPSC-based gene therapy for genetic disorders using programmable nucleases. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Intragenic motifs regulate the transcriptional complexity of Pkhd1/PKHD1

    PubMed Central

    Boddu, Ravindra; Yang, Chaozhe; O’Connor, Amber K.; Hendrickson, Robert Curtis; Boone, Braden; Cui, Xiangqin; Garcia-Gonzalez, Miguel; Igarashi, Peter; Onuchic, Luiz F.; Germino, Gregory G.

    2014-01-01

    Autosomal recessive polycystic kidney disease (ARPKD) results from mutations in the human PKHD1 gene. Both this gene, and its mouse ortholog, Pkhd1, are primarily expressed in renal and biliary ductal structures. The mouse protein product, fibrocystin/polyductin complex (FPC), is a 445-kDa protein encoded by a 67-exon transcript that spans >500 kb of genomic DNA. In the current study, we observed multiple alternatively spliced Pkhd1 transcripts that varied in size and exon composition in embryonic mouse kidney, liver, and placenta samples, as well as among adult mouse pancreas, brain, heart, lung, testes, liver, and kidney. Using reverse transcription PCR and RNASeq, we identified 22 novel Pkhd1 kidney transcripts with unique exon junctions. Various mechanisms of alternative splicing were observed, including exon skipping, use of alternate acceptor/donor splice sites, and inclusion of novel exons. Bioinformatic analyses identified, and exon-trapping minigene experiments validated, consensus binding sites for serine/arginine-rich proteins that modulate alternative splicing. Using site-directed mutagenesis, we examined the functional importance of selected splice enhancers. In addition, we demonstrated that many of the novel transcripts were polysome bound, thus likely translated. Finally, we determined that the human PKHD1 R760H missense variant alters a splice enhancer motif that disrupts exon splicing in vitro and is predicted to truncate the protein. Taken together, these data provide evidence of the complex transcriptional regulation of Pkhd1/PKHD1 and identified motifs that regulate its splicing. Our studies indicate that Pkhd1/PKHD1 transcription is modulated, in part by intragenic factors, suggesting that aberrant PKHD1 splicing represents an unappreciated pathogenic mechanism in ARPKD. PMID:24984783

  14. The TREAT-NMD DMD Global Database: Analysis of More than 7,000 Duchenne Muscular Dystrophy Mutations

    PubMed Central

    Bladen, Catherine L; Salgado, David; Monges, Soledad; Foncuberta, Maria E; Kekou, Kyriaki; Kosma, Konstantina; Dawkins, Hugh; Lamont, Leanne; Roy, Anna J; Chamova, Teodora; Guergueltcheva, Velina; Chan, Sophelia; Korngut, Lawrence; Campbell, Craig; Dai, Yi; Wang, Jen; Barišić, Nina; Brabec, Petr; Lahdetie, Jaana; Walter, Maggie C; Schreiber-Katz, Olivia; Karcagi, Veronika; Garami, Marta; Viswanathan, Venkatarman; Bayat, Farhad; Buccella, Filippo; Kimura, En; Koeks, Zaïda; van den Bergen, Janneke C; Rodrigues, Miriam; Roxburgh, Richard; Lusakowska, Anna; Kostera-Pruszczyk, Anna; Zimowski, Janusz; Santos, Rosário; Neagu, Elena; Artemieva, Svetlana; Rasic, Vedrana Milic; Vojinovic, Dina; Posada, Manuel; Bloetzer, Clemens; Jeannet, Pierre-Yves; Joncourt, Franziska; Díaz-Manera, Jordi; Gallardo, Eduard; Karaduman, A Ayşe; Topaloğlu, Haluk; El Sherif, Rasha; Stringer, Angela; Shatillo, Andriy V; Martin, Ann S; Peay, Holly L; Bellgard, Matthew I; Kirschner, Jan; Flanigan, Kevin M; Straub, Volker; Bushby, Kate; Verschuuren, Jan; Aartsma-Rus, Annemieke; Béroud, Christophe; Lochmüller, Hanns

    2015-01-01

    Analyzing the type and frequency of patient-specific mutations that give rise to Duchenne muscular dystrophy (DMD) is an invaluable tool for diagnostics, basic scientific research, trial planning, and improved clinical care. Locus-specific databases allow for the collection, organization, storage, and analysis of genetic variants of disease. Here, we describe the development and analysis of the TREAT-NMD DMD Global database (http://umd.be/TREAT_DMD/). We analyzed genetic data for 7,149 DMD mutations held within the database. A total of 5,682 large mutations were observed (80% of total mutations), of which 4,894 (86%) were deletions (1 exon or larger) and 784 (14%) were duplications (1 exon or larger). There were 1,445 small mutations (smaller than 1 exon, 20% of all mutations), of which 358 (25%) were small deletions and 132 (9%) small insertions and 199 (14%) affected the splice sites. Point mutations totalled 756 (52% of small mutations) with 726 (50%) nonsense mutations and 30 (2%) missense mutations. Finally, 22 (0.3%) mid-intronic mutations were observed. In addition, mutations were identified within the database that would potentially benefit from novel genetic therapies for DMD including stop codon read-through therapies (10% of total mutations) and exon skipping therapy (80% of deletions and 55% of total mutations). PMID:25604253

  15. Alternative Splice in Alternative Lice

    PubMed Central

    Tovar-Corona, Jaime M.; Castillo-Morales, Atahualpa; Chen, Lu; Olds, Brett P.; Clark, John M.; Reynolds, Stuart E.; Pittendrigh, Barry R.; Feil, Edward J.; Urrutia, Araxi O.

    2015-01-01

    Genomic and transcriptomics analyses have revealed human head and body lice to be almost genetically identical; although con-specific, they nevertheless occupy distinct ecological niches and have differing feeding patterns. Most importantly, while head lice are not known to be vector competent, body lice can transmit three serious bacterial diseases; epidemictyphus, trench fever, and relapsing fever. In order to gain insights into the molecular bases for these differences, we analyzed alternative splicing (AS) using next-generation sequencing data for one strain of head lice and one strain of body lice. We identified a total of 3,598 AS events which were head or body lice specific. Exon skipping AS events were overrepresented among both head and body lice, whereas intron retention events were underrepresented in both. However, both the enrichment of exon skipping and the underrepresentation of intron retention are significantly stronger in body lice compared with head lice. Genes containing body louse-specific AS events were found to be significantly enriched for functions associated with development of the nervous system, salivary gland, trachea, and ovarian follicle cells, as well as regulation of transcription. In contrast, no functional categories were overrepresented among genes with head louse-specific AS events. Together, our results constitute the first evidence for transcript pool differences in head and body lice, providing insights into molecular adaptations that enabled human lice to adapt to clothing, and representing a powerful illustration of the pivotal role AS can play in functional adaptation. PMID:26169943

  16. MRI roadmap-guided transendocardial delivery of exon-skipping recombinant adeno-associated virus restores dystrophin expression in a canine model of Duchenne muscular dystrophy.

    PubMed

    Barbash, I M; Cecchini, S; Faranesh, A Z; Virag, T; Li, L; Yang, Y; Hoyt, R F; Kornegay, J N; Bogan, J R; Garcia, L; Lederman, R J; Kotin, R M

    2013-03-01

    Duchenne muscular dystrophy (DMD) cardiomyopathy patients currently have no therapeutic options. We evaluated catheter-based transendocardial delivery of a recombinant adeno-associated virus (rAAV) expressing a small nuclear U7 RNA (U7smOPT) complementary to specific cis-acting splicing signals. Eliminating specific exons restores the open reading frame resulting in translation of truncated dystrophin protein. To test this approach in a clinically relevant DMD model, golden retriever muscular dystrophy (GRMD) dogs received serotype 6 rAAV-U7smOPT via the intracoronary or transendocardial route. Transendocardial injections were administered with an injection-tipped catheter and fluoroscopic guidance using X-ray fused with magnetic resonance imaging (XFM) roadmaps. Three months after treatment, tissues were analyzed for DNA, RNA, dystrophin protein, and histology. Whereas intracoronary delivery did not result in effective transduction, transendocardial injections, XFM guidance, enabled 30±10 non-overlapping injections per animal. Vector DNA was detectable in all samples tested and ranged from <1 to >3000 vector genome copies per cell. RNA analysis, western blot analysis, and immunohistology demonstrated extensive expression of skipped RNA and dystrophin protein in the treated myocardium. Left ventricular function remained unchanged over a 3-month follow-up. These results demonstrated that effective transendocardial delivery of rAAV-U7smOPT was achieved using XFM. This approach restores an open reading frame for dystrophin in affected dogs and has potential clinical utility.

  17. RNA-Seq analysis identifies aberrant RNA splicing of TRIP12 in acute myeloid leukemia patients at remission.

    PubMed

    Gao, Panke; Jin, Zhen; Cheng, Yingying; Cao, Xiangshan

    2014-10-01

    Aberrant splicing events play important roles in the pathogenesis of acute myeloid leukemia (AML). To investigate the aberrant splicing events in AML during treatment, we carried out RNA sequencing in peripheral mononuclear cell samples from a patient with complete remission. In addition to the sequencing samples, selected splicing events were confirmed and validated with real-time quantitative RT-PCR in another seven pairs of samples. A total of 4.05 and 3.39 GB clean data of the AML and remission sample were generated, respectively, and 2,223 differentially expressed genes (DEGs) were identified. Integrated with gene expression profiling on T cells from AML patients compared with healthy donors, 82 DEGs were also differentially expressed in AML CD4 T cells and CD8 T cells. Twenty-three alternative splicing events were considered to be confidential, and they were involved in many biological processes, such as RNA processing, cellular macromolecule catabolic process, and DNA binding process. An exon3-skipping event in TRIP12 was detected in patients at remission and further validated in another three independent samples. TRIP12 is an ubiquitin ligase of ARF, which suppresses aberrant cell growth by activating p53 responses. The exon3-skipping isoform of TRIP12 increased significantly after treatment. Our results may provide new understanding of AML, and the confirmed alternative splicing event of TRIP12 may be used as potential target for future investigations.

  18. FAS-antisense 1 lncRNA and production of soluble versus membrane Fas in B-cell lymphoma

    PubMed Central

    Sehgal, Lalit; Mathur, Rohit; Braun, Frank K.; Wise, Jillian F.; Berkova, Zuzana; Neelapu, Sattva; Kwak, Larry W.; Samaniego, Felipe

    2018-01-01

    Impaired Fas-mediated apoptosis is associated with poor clinical outcomes and cancer chemoresistance. Soluble Fas receptor (sFas), produced by skipping of exon 6, inhibits apoptosis by sequestering Fas ligand. Serum sFas is associated with poor prognosis of non-Hodgkin's lymphomas. We found that the alternative splicing of Fas in lymphomas is tightly regulated by a lncRNA corresponding to an antisense transcript of Fas (FAS-AS1). Levels of FAS-AS1 correlate inversely with production of sFas and FAS-AS1 binding to the RBM5 inhibits RBM5-mediated exon 6 skipping. EZH2, often mutated or overexpressed in lymphomas, hyper-methylates the FAS-AS1 promoter and represses the FAS-AS1 expression. EZH2-mediated repression of FAS-AS1 promoter can be released by DZNeP or overcome by ectopic expression of FAS-AS1, both of which increase levels of FAS-AS1 and correspondingly decrease expression of sFas. Treatment with Bruton’s tyrosine kinase (BTK) inhibitor or EZH2 knockdown decreases the levels of EZH2, RBM5 and sFas thereby enhances Fas-mediated apoptosis. This is the first report showing functional regulation of Fas repression by its antisense RNA. Our results reveal new therapeutic targets in lymphomas and provide a rationale for the use of EZH2 inhibitors or ibrutinib in combination with chemotherapeutic agents that recruit Fas for effective cell killing. PMID:24811343

  19. Assessing the residual CFTR gene expression in human nasal epithelium cells bearing CFTR splicing mutations causing cystic fibrosis

    PubMed Central

    Masvidal, Laia; Igreja, Susana; Ramos, Maria D; Alvarez, Antoni; de Gracia, Javier; Ramalho, Anabela; Amaral, Margarida D; Larriba, Sara; Casals, Teresa

    2014-01-01

    The major purpose of the present study was to quantify correctly spliced CFTR transcripts in human nasal epithelial cells from cystic fibrosis (CF) patients carrying the splicing mutations c.580-1G>T (712-1G>T) and c.2657+5G>A (2789+5G>A) and to assess the applicability of this model in CFTR therapeutic approaches. We performed the relative quantification of CFTR mRNA by reverse transcription quantitative PCR (RT-qPCR) of these splicing mutations in four groups (wild type, CF-F508del controls, CF patients and CF carriers) of individuals. In addition, in vitro assays using minigene constructs were performed to evaluate the effect of a new CF complex allele c.[2657+5G>A; 2562T>G]. Ex vivo qPCR data show that the primary consequence of both mutations at the RNA level is the skipping of their neighboring exon (6 and 16, respectively). The CFTR minigenes results mimicked the ex vivo data, as exon 16 skipping is the main aberrant transcript, and the correctly spliced transcript level was observed in a similar proportion when the c.2657+5G>A mutation is present. In summary, we provide evidence that ex vivo quantitative transcripts analysis using RT/qPCR is a robust technology that could be useful for measuring the efficacy of therapeutic approaches that attempt to achieve an increase in CFTR gene expression. PMID:24129438

  20. Generation and analysis of knock-in mice carrying pseudohypoaldosteronism type II-causing mutations in the cullin 3 gene.

    PubMed

    Araki, Yuya; Rai, Tatemitsu; Sohara, Eisei; Mori, Takayasu; Inoue, Yuichi; Isobe, Kiyoshi; Kikuchi, Eriko; Ohta, Akihito; Sasaki, Sei; Uchida, Shinichi

    2015-10-21

    Pseudohypoaldosteronism type II (PHAII) is a hereditary hypertensive disease caused by mutations in four different genes: with-no-lysine kinases (WNK) 1 and 4, Kelch-like family member 3 (KLHL3), and cullin 3 (Cul3). Cul3 and KLHL3 form an E3 ligase complex that ubiquitinates and reduces the expression level of WNK4. PHAII-causing mutations in WNK4 and KLHL3 impair WNK4 ubiquitination. However, the molecular pathogenesis of PHAII caused by Cul3 mutations is unclear. In cultured cells and human leukocytes, PHAII-causing Cul3 mutations result in the skipping of exon 9, producing mutant Cul3 protein lacking 57 amino acids. However, whether this phenomenon occurs in the kidneys and is responsible for the pathogenesis of PHAII in vivo is unknown. We generated knock-in mice carrying a mutation in the C-terminus of intron 8 of Cul3, c.1207-1G>A, which corresponds to a PHAII-causing mutation in the human Cul3 gene. Heterozygous Cul3(G(-1)A/+) knock-in mice did not exhibit PHAII phenotypes, and the skipping of exon 9 was not evident in their kidneys. However, the level of Cul3 mRNA expression in the kidneys of heterozygous knock-in mice was approximately half that of wild-type mice. Furthermore, homozygous knock-in mice were nonviable. It suggested that the mutant allele behaved like a knockout allele and did not produce Cul3 mRNA lacking exon 9. A reduction in Cul3 expression alone was not sufficient to develop PHAII in the knock-in mice. Our findings highlighted the pathogenic role of mutant Cul3 protein and provided insight to explain why PHAII-causing mutations in Cul3 cause kidney-predominant PHAII phenotypes. © 2015. Published by The Company of Biologists Ltd.

  1. A comprehensive analysis of clinical outcomes in lung cancer patients harboring a MET exon 14 skipping mutation compared to other driver mutations in an East Asian population.

    PubMed

    Gow, Chien-Hung; Hsieh, Min-Shu; Wu, Shang-Gin; Shih, Jin-Yuan

    2017-01-01

    Recurrent somatic splice-site alterations at MET exon 14 (MET Δ14 ), which result in exon skipping and MET proto-oncogene, receptor tyrosine kinase (MET) activation, have been characterised. However, their demographic features and clinical outcomes in East Asian lung cancer patients have yet to be determined. A one-step reverse transcription-polymerase chain reaction (RT-PCR), using RNA samples from 850 East Asian lung cancer patients, was performed in order to detect MET Δ14 and five other major driver mutations, including those in the EGFR, KRAS, ALK, HER2, and ROS1 genes. Immunohistochemistry (IHC) was used to confirm the overexpression of MET in patients harbouring the MET Δ14 mutation. We analysed the demographic data and clinical outcomes of MET Δ14 mutation positive lung cancer patients and compared them to those of MET Δ14 mutation negative lung cancer patients. In total, 27 lung adenocarcinoma (ADC) patients and 1 squamous cell carcinoma patient with the MET Δ14 mutation were identified. The overall incidence was 3.3% for lung cancer and 4.0% for lung ADC. IHC demonstrated that the majority of lung cancer patients harboring a MET Δ14 mutation exhibited a strong cytoplasmic expression of MET. MET Δ14 mutation positive patients were generally quite elderly individuals. Stage IV MET Δ14 mutation positive lung cancer patients receiving no specific anti-MET therapy were observed to have a similar overall survival (OS) compared to patients in the all negative group (P>0.05). In the multivariate analysis, mutation status was found not to be a major risk factor for OS in lung cancer patients without appropriate tyrosine kinase inhibitors treatment. The OS of MET Δ14 mutation positive lung cancer patients is comparable to that of the major driver gene mutation negative lung cancer patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Modeling the human MTM1 p.R69C mutation in murine Mtm1 results in exon 4 skipping and a less severe myotubular myopathy phenotype

    PubMed Central

    Pierson, Christopher R.; Dulin-Smith, Ashley N.; Durban, Ashley N.; Marshall, Morgan L.; Marshall, Jordan T.; Snyder, Andrew D.; Naiyer, Nada; Gladman, Jordan T.; Chandler, Dawn S.; Lawlor, Michael W.; Buj-Bello, Anna; Dowling, James J.; Beggs, Alan H.

    2012-01-01

    X-linked myotubular myopathy (MTM) is a severe neuromuscular disease of infancy caused by mutations of MTM1, which encodes the phosphoinositide lipid phosphatase, myotubularin. The Mtm1 knockout (KO) mouse has a severe phenotype and its short lifespan (8 weeks) makes it a challenge to use as a model in the testing of certain preclinical therapeutics. Many MTM patients succumb early in life, but some have a more favorable prognosis. We used human genotype–phenotype correlation data to develop a myotubularin-deficient mouse model with a less severe phenotype than is seen in Mtm1 KO mice. We modeled the human c.205C>T point mutation in Mtm1 exon 4, which is predicted to introduce the p.R69C missense change in myotubularin. Hemizygous male Mtm1 p.R69C mice develop early muscle atrophy prior to the onset of weakness at 2 months. The median survival period is 66 weeks. Histopathology shows small myofibers with centrally placed nuclei. Myotubularin protein is undetectably low because the introduced c.205C>T base change induced exon 4 skipping in most mRNAs, leading to premature termination of myotubularin translation. Some full-length Mtm1 mRNA bearing the mutation is present, which provides enough myotubularin activity to account for the relatively mild phenotype, as Mtm1 KO and Mtm1 p.R69C mice have similar muscle phosphatidylinositol 3-phosphate levels. These data explain the basis for phenotypic variability among human patients with MTM1 p.R69C mutations and establish the Mtm1 p.R69C mouse as a valuable model for the disease, as its less severe phenotype will expand the scope of testable preclinical therapies. PMID:22068590

  3. Antisense Masking of an hnRNP A1/A2 Intronic Splicing Silencer Corrects SMN2 Splicing in Transgenic Mice

    PubMed Central

    Hua, Yimin; Vickers, Timothy A.; Okunola, Hazeem L.; Bennett, C. Frank; Krainer, Adrian R.

    2008-01-01

    survival of motor neuron 2, centromeric (SMN2) is a gene that modifies the severity of spinal muscular atrophy (SMA), a motor-neuron disease that is the leading genetic cause of infant mortality. Increasing inclusion of SMN2 exon 7, which is predominantly skipped, holds promise to treat or possibly cure SMA; one practical strategy is the disruption of splicing silencers that impair exon 7 recognition. By using an antisense oligonucleotide (ASO)-tiling method, we systematically screened the proximal intronic regions flanking exon 7 and identified two intronic splicing silencers (ISSs): one in intron 6 and a recently described one in intron 7. We analyzed the intron 7 ISS by mutagenesis, coupled with splicing assays, RNA-affinity chromatography, and protein overexpression, and found two tandem hnRNP A1/A2 motifs within the ISS that are responsible for its inhibitory character. Mutations in these two motifs, or ASOs that block them, promote very efficient exon 7 inclusion. We screened 31 ASOs in this region and selected two optimal ones to test in human SMN2 transgenic mice. Both ASOs strongly increased hSMN2 exon 7 inclusion in the liver and kidney of the transgenic animals. Our results show that the high-resolution ASO-tiling approach can identify cis-elements that modulate splicing positively or negatively. Most importantly, our results highlight the therapeutic potential of some of these ASOs in the context of SMA. PMID:18371932

  4. Novel LAMP2 mutations in Chinese patients with Danon disease cause varying degrees of clinical severity.

    PubMed

    Luo, Su-shan; Xi, Jian-ying; Cai, Shuang; Zhao, Chong-bo; Lu, Jia-hong; Zhu, Wen-hua; Lin, Jie; Qiao, Kai; Wang, Yin; Ye, Zhu-rong

    2014-01-01

    Danon disease is an Xlinked dominant lysosomal glycogen storage disorder characterized by cardiomyopathy, skeletal myopathy, and mental retardation. This study described two Chinese cases of Danon disease in order to broaden the phenotypic and genetic spectrum. Clinical data were collected and LAMP2 mutations were analyzed. Patient A had fluctuating limb weakness during 6 months follow-up and was diagnosed with drug-induced myopathy due to anti-hepatitis B therapy with lamivudine. However, the first muscle biopsy with large cytoplasmic vacuoles confused the diagnosis and led to the second biopsy that allowed for the final diagnosis. Patient B had severe cardiac disturbances leading to sudden death. Molecularly, patient A harbored a synonymous mutation adjacent to the exon 6-intron 6 junction; mRNA analysis provided evidence that totally abolished the donor site and caused skipping of exon 6. Patient B harbored a frame-shift deletion mutation in exon 3 (c.396delA) leading to a truncated protein. To our knowledge, this is the first report of Danon disease caused by a synonymous exon mutation that affected mRNA splicing, which indicates that a synonymous substitution may not be silent when it is in the exon sequences close to the splice sites. It is also the first description of Danon disease clinically presenting as druginduced myopathy at onset; the pathological changes might be the key point for making a differential diagnosis. *These two authors contributed equally to this work.

  5. Genomic structure and chromosomal mapping of the human CD22 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilson, G.L.; Kozlow, E.; Kehrl, J.H.

    1993-06-01

    The human CD22 gene is expressed specifically in B lymphocytes and likely has an important function in cell-cell interactions. A nearly full length human CD22 cDNA clone was used to isolate genomic clones that span the CD22 gene. The CD22 gene is spread over 22 kb of DNA and is composed of 15 exons. The first exon contains the major transcriptional start sites. The translation initiation codon is located in exon 3, which also encodes a portion of the signal peptide. Exons 4 to 10 encode the seven Ig domains of CD22, exon 11 encodes the transmembrane domain, exons 12more » to 15 encode the intracytoplasmic domain of CD22, and exon 15 also contains the 3' untranslated region. A minor form of CD22 mRNA likely results from splicing of exon 5 to exon 8, skipping exons 6 and 7. A 4.6-kb Xbal fragment of the CD22 gene was used to map the chromosomal location of CD22 by fluorescence in situ hybridization. The hybridization locus was identified by combining fluorescent images of the probe with the chromosomal banding pattern generated by an Alu probe. The results demonstrate the CD22 is located within the band region q13.1 of chromosome 19. Two closely clustered major transcription start sites and several minor start sites were mapped by primer extension. Similarly to many other lymphoid-specific genes, the CD22 promoter lacks an obvious TATA box. Approximately 4 kb of DNA 5' of the transcription start sites were sequenced and found to contain multiple Alu elements. Potential binding sites for the transcriptional factors NF-kB, AP-1, and Oct-2 are located within 300 bp 5' of the major transcription start sites. A 400-bp fragment (bp -339 through +71) of the CD22 promoter region was subcloned into a pGEM-chloramphenicol acetyltransferase vector and after transfection into B and T cells was found to be active in both B and T cells. 45 refs., 7 figs., 2 tabs.« less

  6. A mutation in an alternative untranslated exon of hexokinase 1 associated with hereditary motor and sensory neuropathy -- Russe (HMSNR).

    PubMed

    Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald J A; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

    2009-12-01

    Hereditary Motor and Sensory Neuropathy -- Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to approximately 70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to approximately 26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS).

  7. A mutation in an alternative untranslated exon of hexokinase 1 associated with Hereditary Motor and Sensory Neuropathy – Russe (HMSNR)

    PubMed Central

    Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald JA; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

    2009-01-01

    Hereditary Motor and Sensory Neuropathy – Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to ∼70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to ∼26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS). PMID:19536174

  8. Molecular Characterization of the Llamas (Lama glama) Casein Cluster Genes Transcripts (CSN1S1, CSN2, CSN1S2, CSN3) and Regulatory Regions

    PubMed Central

    Pauciullo, Alfredo; Erhardt, Georg

    2015-01-01

    In the present paper, we report for the first time the characterization of llama (Lama glama) caseins at transcriptomic and genetic level. A total of 288 casein clones transcripts were analysed from two lactating llamas. The most represented mRNA populations were those correctly assembled (85.07%) and they encoded for mature proteins of 215, 217, 187 and 162 amino acids respectively for the CSN1S1, CSN2, CSN1S2 and CSN3 genes. The exonic subdivision evidenced a structure made of 21, 9, 17 and 6 exons for the αs1-, β-, αs2- and κ-casein genes respectively. Exon skipping and duplication events were evidenced. Two variants A and B were identified in the αs1-casein gene as result of the alternative out-splicing of the exon 18. An additional exon coding for a novel esapeptide was found to be cryptic in the κ-casein gene, whereas one extra exon was found in the αs2-casein gene by the comparison with the Camelus dromedaries sequence. A total of 28 putative phosphorylated motifs highlighted a complex heterogeneity and a potential variable degree of post-translational modifications. Ninety-six polymorphic sites were found through the comparison of the lama casein cDNAs with the homologous camel sequences, whereas the first description and characterization of the 5’- and 3’-regulatory regions allowed to identify the main putative consensus sequences involved in the casein genes expression, thus opening the way to new investigations -so far- never achieved in this species. PMID:25923814

  9. Molecular Characterization of the Llamas (Lama glama) Casein Cluster Genes Transcripts (CSN1S1, CSN2, CSN1S2, CSN3) and Regulatory Regions.

    PubMed

    Pauciullo, Alfredo; Erhardt, Georg

    2015-01-01

    In the present paper, we report for the first time the characterization of llama (Lama glama) caseins at transcriptomic and genetic level. A total of 288 casein clones transcripts were analysed from two lactating llamas. The most represented mRNA populations were those correctly assembled (85.07%) and they encoded for mature proteins of 215, 217, 187 and 162 amino acids respectively for the CSN1S1, CSN2, CSN1S2 and CSN3 genes. The exonic subdivision evidenced a structure made of 21, 9, 17 and 6 exons for the αs1-, β-, αs2- and κ-casein genes respectively. Exon skipping and duplication events were evidenced. Two variants A and B were identified in the αs1-casein gene as result of the alternative out-splicing of the exon 18. An additional exon coding for a novel esapeptide was found to be cryptic in the κ-casein gene, whereas one extra exon was found in the αs2-casein gene by the comparison with the Camelus dromedaries sequence. A total of 28 putative phosphorylated motifs highlighted a complex heterogeneity and a potential variable degree of post-translational modifications. Ninety-six polymorphic sites were found through the comparison of the lama casein cDNAs with the homologous camel sequences, whereas the first description and characterization of the 5'- and 3'-regulatory regions allowed to identify the main putative consensus sequences involved in the casein genes expression, thus opening the way to new investigations -so far- never achieved in this species.

  10. Molecular Cloning and Characterization of the Human ErbB4 Gene: Identification of Novel Splice Isoforms in the Developing and Adult Brain

    PubMed Central

    Tan, Wei; Dean, Michael; Law, Amanda J.

    2010-01-01

    ErbB4 is a growth factor receptor tyrosine kinase essential for neurodevelopment. Genetic variation in ErbB4 is associated with schizophrenia and risk-associated polymorphisms predict overexpression of ErbB4 CYT-1 isoforms in the brain in the disorder. The molecular mechanism of association is unclear because the polymorphisms flank exon 3 of the gene and reside 700 kb distal to the CYT-1 defining exon. We hypothesized that the polymorphisms are indirectly associated with ErbB4 CYT-1 via splicing of exon 3 on the CYT-1 background. We report via cloning and sequencing of adult and fetal human brain cDNA libraries the identification of novel splice isoforms of ErbB4, whereby exon 3 is skipped (del.3). ErbB4 del.3 transcripts exist as CYT-2 isoforms and are predicted to produce truncated proteins. Furthermore, our data refine the structure of the human ErbB4 gene, clarify that juxtamembrane (JM) splice variants of ErbB4, JM-a and JM-b respectively, are characterized by the replacement of a 75 nucleotide (nt) sequence with a 45-nt insertion, and demonstrate that there are four alternative exons in the gene. Our analyses reveal that novel splice variants of ErbB4 exist in the developing and adult human brain and, given the failure to identify ErbB4 del.3 CYT-1 transcripts, suggest that the association of risk polymorphisms in the ErbB4 gene with CYT-1 transcript levels is not mediated via an exon 3 splicing event. PMID:20886074

  11. Molecular analysis of Hurler syndrome in Druze and Muslim Arab patients in Israel: Multiple allelic mutations of the IDUA gene in a small geographic area

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bach, G.; Moskowitz, S.M.; Tieu, P.T.

    1993-08-01

    The mutations underlying Hurler syndrome (mucopolysaccharidosis IH) in Druze and Muslim Israeli Arab patients have been characterized. Four alleles were identified, using a combination of (a) PCR amplification of reverse-transcribed RNA or genomic DNA segments, (b) cycle sequencing of PCR products, and (c) restriction-enzyme analysis. One allele has two amino acid substitutions, Gly[sub 409][yields]Arg in exon 9 and Ter[yields]Cys in exon 14. The other three alleles have mutations in exon 2 (Tyr[sub 64][yields]Ter), exon 7 (Gln[sub 310][yields]Ter), or exon 8 (Thr[sub 366][yields]Pro). Transfection of mutagenized cDNAs into Cos-1 cells showed that two missense mutations, Thr[sub 366][yields]Pro and Ter[yields]Cys, permitted themore » expression of only trace amounts of [alpha]-L-iduronidase activity, whereas Gly[sub 409][yields]Arg permitted the expression of 60% as much enzyme as did the normal cDNA. The nonsense mutations were associated with abnormalities of RNA processing: (1) both a very low level of mRNA and skipping of exon 2 for Tyr[sub 64][yields]Ter and (2) utilization of a cryptic splice site for Gln[sub 310][yields]Ter. In all instances, the probands were found homozygous, and the parents heterozygous, for the mutant alleles, as anticipated from the consanguinity in each family. The two-mutation allele was identified in a family from Gaza; the other three alleles were found in seven families, five of them Druze, residing in a very small area of northern Israel. Since such clustering suggests a classic founder effect, the presence of three mutant alleles of the IDUA gene was unexpected. 28 refs., 4 figs., 3 tabs.« less

  12. Breakfast skipping is associated with cyberbullying and school bullying victimization. A school-based cross-sectional study.

    PubMed

    Sampasa-Kanyinga, Hugues; Roumeliotis, Paul; Farrow, Claire V; Shi, Yuanfeng F

    2014-08-01

    Breakfast skipping is a health concern that has well-known negative consequences physically and psychologically. It is therefore important to understand why children skip breakfast. The purpose of this study was to establish whether the experience of bullying and cyberbullying impacts upon breakfast skipping and to further evaluate whether the inability for youths to cope with bullying victimization affects their mental health (depression), and in turn predicts breakfast skipping. Data were obtained from the Eastern Ontario 2011 Youth Risk Behaviour Survey, a cross-sectional regional school-based survey of middle and high school students (11-20 years old) across the five counties of Eastern Ontario, Canada (N = 3035). Self-reported data about children's experiences of bullying victimization, breakfast eating habits, socio-economical status, depression, and other risk behaviours were analysed. Approximately half of the participants (50.4%) reported not eating breakfast on a regular basis: 26.3% and 24.1% reported often (usually eat breakfast three times or more per week) and frequent (usually eat breakfast twice a week or less) breakfast skipping behaviour, respectively. Victims of both cyberbullying and school bullying presented greater likelihood of often (adjusted relative risk ratio (RR) = 1.55; 95% confidence interval (CI) = 1.17-2.06) and frequent (RR = 1.97; 95% CI = 1.28-3.03) breakfast skipping. Mediation analysis further showed that depression fully mediated the relationship between school bullying victimization and frequent breakfast skipping. Moreover, depression partially mediated the associations between both cyberbullying and school bullying with frequent breakfast skipping. These findings highlight the potential interrelationships between cyberbullying, school bullying and depression in predicting unhealthy breakfast skipping behaviour in children. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Global Profiling and Molecular Characterization of Alternative Splicing Events Misregulated in Lung Cancer ▿ †

    PubMed Central

    Misquitta-Ali, Christine M.; Cheng, Edith; O'Hanlon, Dave; Liu, Ni; McGlade, C. Jane; Tsao, Ming Sound; Blencowe, Benjamin J.

    2011-01-01

    Alternative splicing (AS) is a widespread mechanism underlying the generation of proteomic and regulatory complexity. However, which of the myriad of human AS events play important roles in disease is largely unknown. To identify frequently occurring AS events in lung cancer, we used AS microarray profiling and reverse transcription-PCR (RT-PCR) assays to survey patient-matched normal and adenocarcinoma tumor tissues from the lungs of 29 individuals diagnosed with non-small cell lung cancer (NSCLC). Of 5,183 profiled alternative exons, four displayed tumor-associated changes in the majority of the patients. These events affected transcripts from the VEGFA, MACF1, APP, and NUMB genes. Similar AS changes were detected in NUMB and APP transcripts in primary breast and colon tumors. Tumor-associated increases in NUMB exon 9 inclusion correlated with reduced levels of NUMB protein expression and activation of the Notch signaling pathway, an event that has been linked to tumorigenesis. Moreover, short hairpin RNA (shRNA) knockdown of NUMB followed by isoform-specific rescue revealed that expression of the exon 9-skipped (nontumor) isoform represses Notch target gene activation whereas expression of the exon 9-included (tumor) isoform lacks this activity and is capable of promoting cell proliferation. The results thus reveal widespread AS changes in NSCLC that impact cell signaling in a manner that likely contributes to tumorigenesis. PMID:21041478

  14. Global profiling and molecular characterization of alternative splicing events misregulated in lung cancer.

    PubMed

    Misquitta-Ali, Christine M; Cheng, Edith; O'Hanlon, Dave; Liu, Ni; McGlade, C Jane; Tsao, Ming Sound; Blencowe, Benjamin J

    2011-01-01

    Alternative splicing (AS) is a widespread mechanism underlying the generation of proteomic and regulatory complexity. However, which of the myriad of human AS events play important roles in disease is largely unknown. To identify frequently occurring AS events in lung cancer, we used AS microarray profiling and reverse transcription-PCR (RT-PCR) assays to survey patient-matched normal and adenocarcinoma tumor tissues from the lungs of 29 individuals diagnosed with non-small cell lung cancer (NSCLC). Of 5,183 profiled alternative exons, four displayed tumor-associated changes in the majority of the patients. These events affected transcripts from the VEGFA, MACF1, APP, and NUMB genes. Similar AS changes were detected in NUMB and APP transcripts in primary breast and colon tumors. Tumor-associated increases in NUMB exon 9 inclusion correlated with reduced levels of NUMB protein expression and activation of the Notch signaling pathway, an event that has been linked to tumorigenesis. Moreover, short hairpin RNA (shRNA) knockdown of NUMB followed by isoform-specific rescue revealed that expression of the exon 9-skipped (nontumor) isoform represses Notch target gene activation whereas expression of the exon 9-included (tumor) isoform lacks this activity and is capable of promoting cell proliferation. The results thus reveal widespread AS changes in NSCLC that impact cell signaling in a manner that likely contributes to tumorigenesis.

  15. A novel deletion in the splice donor site of MLH1 exon 6 in a Japanese colon cancer patient with Lynch syndrome.

    PubMed

    Yamaguchi, Junya; Sato, Yuri; Kita, Mizuho; Nomura, Sachio; Yamamoto, Noriko; Kato, Yo; Ishikawa, Yuichi; Arai, Masami

    2015-10-01

    Lynch syndrome is an autosomal dominantly inherited disease that is characterized by a predisposition to cancers, mainly colorectal cancer. Germline mutations of DNA mismatch repair genes such as MLH1, MSH2, MSH6 and PMS2 have been described in patients with Lynch syndrome. Here, we report deletion of 2 bp in the splice donor site of the MLH1 exon 6 (c.545+4_545+5delCA) in a 48-year-old Japanese woman with Lynch syndrome. RT-PCR direct sequencing analysis revealed that this mutation led to an increase in the level of an MLH1 transcript in which exon 6 was skipped, and may cause a frameshift (p.E153FfsX8). Therefore, this mutation appears to be pathogenic and is responsible for Lynch syndrome. Additionally, analysis of the patient's tumor cells indicated microsatellite instability high phenotype and loss of the MLH1 and PMS2 proteins. To our knowledge, this is a germline splice site mutation of MLH1 that has not been reported previously. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Genome-wide association between DNA methylation and alternative splicing in an invertebrate

    PubMed Central

    2012-01-01

    Background Gene bodies are the most evolutionarily conserved targets of DNA methylation in eukaryotes. However, the regulatory functions of gene body DNA methylation remain largely unknown. DNA methylation in insects appears to be primarily confined to exons. Two recent studies in Apis mellifera (honeybee) and Nasonia vitripennis (jewel wasp) analyzed transcription and DNA methylation data for one gene in each species to demonstrate that exon-specific DNA methylation may be associated with alternative splicing events. In this study we investigated the relationship between DNA methylation, alternative splicing, and cross-species gene conservation on a genome-wide scale using genome-wide transcription and DNA methylation data. Results We generated RNA deep sequencing data (RNA-seq) to measure genome-wide mRNA expression at the exon- and gene-level. We produced a de novo transcriptome from this RNA-seq data and computationally predicted splice variants for the honeybee genome. We found that exons that are included in transcription are higher methylated than exons that are skipped during transcription. We detected enrichment for alternative splicing among methylated genes compared to unmethylated genes using fisher’s exact test. We performed a statistical analysis to reveal that the presence of DNA methylation or alternative splicing are both factors associated with a longer gene length and a greater number of exons in genes. In concordance with this observation, a conservation analysis using BLAST revealed that each of these factors is also associated with higher cross-species gene conservation. Conclusions This study constitutes the first genome-wide analysis exhibiting a positive relationship between exon-level DNA methylation and mRNA expression in the honeybee. Our finding that methylated genes are enriched for alternative splicing suggests that, in invertebrates, exon-level DNA methylation may play a role in the construction of splice variants by positively influencing exon inclusion during transcription. The results from our cross-species homology analysis suggest that DNA methylation and alternative splicing are genetic mechanisms whose utilization could contribute to a longer gene length and a slower rate of gene evolution. PMID:22978521

  17. Maple Syrup Urine Disease in Cypriot Families: Identification of Three Novel Mutations and Biochemical Characterization of the p.Thr211Met Mutation in the E1α Subunit

    PubMed Central

    Georgiou, Theodoros; Chuang, Jacinta L.; Wynn, R. Max; Stylianidou, Goula; Korson, Mark; Chuang, David T.

    2009-01-01

    We report five mutations, three of them novel, responsible for maple syrup urine disease in four unrelated Cypriot families. The five children studied are the first cases of classic maple syrup urine disease to be reported among Cypriots. The first novel mutation identified is a single-base deletion in exon 6 of the Elα gene (c.718delG), which leads to a frameshift after Ala240 and to a stop codon 89 residues further downstream. The other two novel mutations identified are in the Elβ subunit: a two-base deletion in exon 6, c.662_663delCC, which leads to a frameshift after Ala221 and creates a stop codon 17 residues further downstream, as well as a splice mutation, IVS3[+3]delA, which results in the skipping of exon 3. The two known mutations identified are in the Elα gene: the G > C transversion at the 3′-splice acceptor site, (IVS5-1G > C), which results in the deletion of the entire exon 6, and the missense mutation in exon 5 (c.632C > T), which corresponds to a p.Thr211Met substitution. The p.Thr211Met substitution is located in a potassium-ion pocket in the E1 component required for stability of the bound cofactor thiamine diphosphate. The mutant E1 protein harboring the p.Thr211Met substitution was shown unable to bind thiamine diphosphate, leading to undetectable E1 activity. PMID:19715473

  18. Mutation in Pyrroline-5-Carboxylate Reductase 1 Gene in Families with Cutis Laxa Type 2

    PubMed Central

    Guernsey, Duane L.; Jiang, Haiyan; Evans, Susan C.; Ferguson, Meghan; Matsuoka, Makoto; Nightingale, Mathew; Rideout, Andrea L.; Provost, Sylvie; Bedard, Karen; Orr, Andrew; Dubé, Marie-Pierre; Ludman, Mark; Samuels, Mark E.

    2009-01-01

    Autosomal-recessive cutis laxa type 2 (ARCL2) is a multisystem disorder characterized by the appearance of premature aging, wrinkled and lax skin, joint laxity, and a general developmental delay. Cutis laxa includes a family of clinically overlapping conditions with confusing nomenclature, generally requiring molecular analyses for definitive diagnosis. Six genes are currently known to mutate to yield one of these related conditions. We ascertained a cohort of typical ARCL2 patients from a subpopulation isolate within eastern Canada. Homozygosity mapping with high-density SNP genotyping excluded all six known genes, and instead identified a single homozygous region near the telomere of chromosome 17, shared identically by state by all genotyped affected individuals from the families. A putative pathogenic variant was identified by direct DNA sequencing of genes within the region. The single nucleotide change leads to a missense mutation adjacent to a splice junction in the gene encoding pyrroline-5-carboxylate reductase 1 (PYCR1). Bioinformatic analysis predicted a pathogenic effect of the variant on splice donor site function. Skipping of the associated exon was confirmed in RNA from blood lymphocytes of affected homozygotes and heterozygous mutation carriers. Exon skipping leads to deletion of the reductase functional domain-coding region and an obligatory downstream frameshift. PYCR1 plays a critical role in proline biosynthesis. Pathogenicity of the genetic variant in PYCR1 is likely, given that a similar clinical phenotype has been documented for mutation carriers of another proline biosynthetic enzyme, pyrroline-5-carboxylate synthase. Our results support a significant role for proline in normal development. PMID:19576563

  19. Alternative Splice in Alternative Lice.

    PubMed

    Tovar-Corona, Jaime M; Castillo-Morales, Atahualpa; Chen, Lu; Olds, Brett P; Clark, John M; Reynolds, Stuart E; Pittendrigh, Barry R; Feil, Edward J; Urrutia, Araxi O

    2015-10-01

    Genomic and transcriptomics analyses have revealed human head and body lice to be almost genetically identical; although con-specific, they nevertheless occupy distinct ecological niches and have differing feeding patterns. Most importantly, while head lice are not known to be vector competent, body lice can transmit three serious bacterial diseases; epidemictyphus, trench fever, and relapsing fever. In order to gain insights into the molecular bases for these differences, we analyzed alternative splicing (AS) using next-generation sequencing data for one strain of head lice and one strain of body lice. We identified a total of 3,598 AS events which were head or body lice specific. Exon skipping AS events were overrepresented among both head and body lice, whereas intron retention events were underrepresented in both. However, both the enrichment of exon skipping and the underrepresentation of intron retention are significantly stronger in body lice compared with head lice. Genes containing body louse-specific AS events were found to be significantly enriched for functions associated with development of the nervous system, salivary gland, trachea, and ovarian follicle cells, as well as regulation of transcription. In contrast, no functional categories were overrepresented among genes with head louse-specific AS events. Together, our results constitute the first evidence for transcript pool differences in head and body lice, providing insights into molecular adaptations that enabled human lice to adapt to clothing, and representing a powerful illustration of the pivotal role AS can play in functional adaptation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Gaucher disease: A G[sup +1][yields]A[sup +1] IVS2 splice donor site mutation causing exon 2 skipping in the acid [beta]-glucosidase mRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Guo-Shun; Grabowski, G.A.

    1992-10-01

    Gaucher disease is the most frequent lysosomal storage disease and the most prevalent Jewish genetic disease. About 30 identified missense mutations are causal to the defective activity of acid [beta]-glucosidase in this disease. cDNAs were characterized from a moderately affected 9-year-old Ashkenazi Jewish Gaucher disease type 1 patient whose 80-years-old, enzyme-deficient, 1226G (Asn[sup 370][yields]Ser [N370S]) homozygous grandfather was nearly asymptomatic. Sequence analyses revealed four populations of cDNAs with either the 1226G mutation, an exact exon 2 ([Delta] EX2) deletion, a deletion of exon 2 and the first 115 bp of exon 3 ([Delta] EX2-3), or a completely normal sequence. Aboutmore » 50% of the cDNAs were the [Delta] EX2, the [Delta] EX2-3, and the normal cDNAs, in a ratio of 6:3:1. Specific amplification and characterization of exon 2 and 5[prime] and 3[prime] intronic flanking sequences from the structural gene demonstrated clones with either the normal sequence or with a G[sup +1][yields]A[sup +1] transition at the exon 2/intron 2 boundary. This mutation destroyed the splice donor consensus site (U1 binding site) for mRNA processing. This transition also was present at the corresponding exon/intron boundary of the highly homologous pseudogene. This new mutation, termed [open quotes]IVS2 G[sup +1],[close quotes] is the first in the Ashkenazi Jewish population. The occurrence of this [open quotes]pseudogene[close quotes]-type mutation in the structural gene indicates the role of acid [beta]-glucosidase pseudogene and structural gene rearrangements in the pathogenesis of this disease. 33 refs., 8 figs., 1 tab.« less

  1. The relationship between breakfast skipping, chronotype, and glycemic control in type 2 diabetes.

    PubMed

    Reutrakul, Sirimon; Hood, Megan M; Crowley, Stephanie J; Morgan, Mary K; Teodori, Marsha; Knutson, Kristen L

    2014-02-01

    Breakfast skipping is associated with obesity and an increased risk of type 2 diabetes. Later chronotypes, individuals who have a preference for later bed and wake times, often skip breakfast. The aim of the study was to explore the relationships among breakfast skipping, chronotype, and glycemic control in type 2 diabetes patients. We collected sleep timing and 24-h dietary recall from 194 non-shift-working type 2 diabetes patients who were being followed in outpatient clinics. Mid-sleep time on free days (MSF) was used as an indicator of chronotype. Hemoglobin A1C (HbA1C) values were obtained from medical records. Hierarchical linear regression analyses controlling for demographic, sleep, and dietary variables were computed to determine whether breakfast skipping was associated with HbA1C. Additional regression analyses were performed to test if this association was mediated by chronotype. There were 22 participants (11.3%) who self-reported missing breakfast. Breakfast skippers had significantly higher HbA1C levels, higher body mass indices (BMI), and later MSF than breakfast eaters. Breakfast skipping was significantly associated with higher HbA1C values (B = 0.108, p = 0.01), even after adjusting for age, sex, race, BMI, number of diabetes complications, insulin use, depressive symptoms, perceived sleep debt, and percentage of daily caloric intake at dinner. The relationship between breakfast skipping and HbA1C was partially mediated by chronotype. In summary, breakfast skipping is associated with a later chronotype. Later chronotype and breakfast skipping both contribute to poorer glycemic control, as indicated by higher HbA1C levels. Future studies are needed to confirm these findings and determine whether behavioral interventions targeting breakfast eating or sleep timing may improve glycemic control in patients with type 2 diabetes.

  2. Mutations Preventing Regulated Exon Skipping in MET Cause Osteofibrous Dysplasia

    PubMed Central

    Gray, Mary J.; Kannu, Peter; Sharma, Swarkar; Neyt, Christine; Zhang, Dongping; Paria, Nandina; Daniel, Philip B.; Whetstone, Heather; Sprenger, Hans-Georg; Hammerschmidt, Philipp; Weng, Angela; Dupuis, Lucie; Jobling, Rebekah; Mendoza-Londono, Roberto; Dray, Michael; Su, Peiqiang; Wilson, Megan J.; Kapur, Raj P.; McCarthy, Edward F.; Alman, Benjamin A.; Howard, Andrew; Somers, Gino R.; Marshall, Christian R.; Manners, Simon; Flanagan, Adrienne M.; Rathjen, Karl E.; Karol, Lori A.; Crawford, Haemish; Markie, David M.; Rios, Jonathan J.; Wise, Carol A.; Robertson, Stephen P.

    2015-01-01

    The periosteum contributes to bone repair and maintenance of cortical bone mass. In contrast to the understanding of bone development within the epiphyseal growth plate, factors that regulate periosteal osteogenesis have not been studied as intensively. Osteofibrous dysplasia (OFD) is a congenital disorder of osteogenesis and is typically sporadic and characterized by radiolucent lesions affecting the cortical bone immediately under the periosteum of the tibia and fibula. We identified germline mutations in MET, encoding a receptor tyrosine kinase, that segregate with an autosomal-dominant form of OFD in three families and a mutation in a fourth affected subject from a simplex family and with bilateral disease. Mutations identified in all families with dominant inheritance and in the one simplex subject with bilateral disease abolished the splice inclusion of exon 14 in MET transcripts, which resulted in a MET receptor (METΔ14) lacking a cytoplasmic juxtamembrane domain. Splice exclusion of this domain occurs during normal embryonic development, and forced induction of this exon-exclusion event retarded osteoblastic differentiation in vitro and inhibited bone-matrix mineralization. In an additional subject with unilateral OFD, we identified a somatic MET mutation, also affecting exon 14, that substituted a tyrosine residue critical for MET receptor turnover and, as in the case of the METΔ14 mutations, had a stabilizing effect on the mature protein. Taken together, these data show that aberrant MET regulation via the juxtamembrane domain subverts core MET receptor functions that regulate osteogenesis within cortical diaphyseal bone. PMID:26637977

  3. Genome-wide and caste-specific DNA methylomes of the ants Camponotus floridanus and Harpegnathos saltator

    PubMed Central

    Bonasio, Roberto; Li, Qiye; Lian, Jinmin; Mutti, Navdeep S.; Jin, Lijun; Zhao, Hongmei; Zhang, Pei; Wen, Ping; Xiang, Hui; Ding, Yun; Jin, Zonghui; Shen, Steven S.; Wang, Zongji; Wang, Wen; Wang, Jun; Berger, Shelley L.; Liebig, Jürgen; Zhang, Guojie; Reinberg, Danny

    2012-01-01

    SUMMARY Background Ant societies comprise individuals belonging to different castes characterized by specialized morphologies and behaviors. Because ant embryos can follow different developmental trajectories, epigenetic mechanisms must play a role in caste determination. Ants have a full set of DNA methyltransferase and their genomes contain methylcytosine. To determine the relationship between DNA methylation and phenotypic plasticity in ants, we obtained and compared the genome-wide methylomes of different castes and developmental stages of Camponotus floridanus and Harpegnathos saltator. Results In the ant genomes, methylcytosines are found both in CpG and non-CpG contexts and are strongly enriched at exons of active genes. Changes in exonic DNA methylation correlate with alternative splicing events such as exon skipping and alternative splice site selection. Several genes exhibit caste-specific and developmental changes in DNA methylation that are conserved between the two species, including genes involved in reproduction, telomere maintenance, and noncoding RNA metabolism. Several loci are methylated and expressed monoallelically, and in some cases the choice of methylated allele depends on the caste. Conclusions These first ant methylomes and their intra- and inter-species comparison reveal an exonic methylation pattern that points to a connection between DNA methylation and splicing. The presence of monoallelic DNA methylation and the methylation of non-CpG sites in all samples suggest roles in genome regulation in these social insects, including the intriguing possibility of parental or caste-specific genomic imprinting. PMID:22885060

  4. A syndrome of microcephaly, short stature, polysyndactyly, and dental anomalies caused by a homozygous KATNB1 mutation.

    PubMed

    Yigit, Gökhan; Wieczorek, Dagmar; Bögershausen, Nina; Beleggia, Filippo; Möller-Hartmann, Claudia; Altmüller, Janine; Thiele, Holger; Nürnberg, Peter; Wollnik, Bernd

    2016-03-01

    Using whole-exome sequencing, we identified a homozygous acceptor splice-site mutation in intron 6 of the KATNB1 gene in a patient from a consanguineous Turkish family who presented with congenital microcephaly, lissencephaly, short stature, polysyndactyly, and dental abnormalities. cDNA analysis revealed complete loss of the natural acceptor splice-site resulting either in the usage of an alternative, exonic acceptor splice-site inducing a frame-shift and premature protein truncation or, to a minor extent, in complete skipping of exon 7. Both effects most likely lead to complete loss of KATNB1 function. Homozygous and compound heterozygous mutations in KATNB1 have very recently been described as a cause of microcephaly with brain malformations and seizures. We extend the KATNB1 associated phenotype by describing a syndrome characterized by primordial dwarfism, lissencephaly, polysyndactyly, and dental anomalies, which is caused by a homozygous truncating KATNB1 mutation. © 2015 Wiley Periodicals, Inc.

  5. Characterization of three types of human alpha s1-casein mRNA transcripts.

    PubMed Central

    Johnsen, L B; Rasmussen, L K; Petersen, T E; Berglund, L

    1995-01-01

    Here we report the molecular cloning and sequencing of three types of human alpha s1-casein transcripts and present evidence indicating that exon skipping is responsible for deleted mRNA transcripts. The largest transcript comprised 981 bp encoding a signal peptide of 15 amino acids followed by the mature alpha s1-casein sequence of 170 amino acids. Human alpha s1-casein has been reported to exist naturally as a multimer in complex with kappa-casein in mature human milk, thereby being unique among alpha s1-caseins [Rasmussen, Due and Petersen (1995) Comp. Biochem. Physiol., in the press]. The present demonstration of three cysteines in the mature protein provides a molecular explanation of the interactions in this complex. Tissue-specific expression of human alpha s1-casein was indicated by Northern-blot analysis. In addition, two cryptic exons were localized in the bovine alpha s1-casein gene. Images Figure 3 PMID:7619062

  6. Gene therapies that restore dystrophin expression for the treatment of Duchenne muscular dystrophy

    PubMed Central

    Robinson-Hamm, Jacqueline N.; Gersbach, Charles A.

    2016-01-01

    Duchenne muscular dystrophy is one of the most common inherited genetic diseases and is caused by mutations to the DMD gene that encodes the dystrophin protein. Recent advances in genome editing and gene therapy offer hope for the development of potential therapeutics. Truncated versions of the DMD gene can be delivered to the affected tissues with viral vectors and show promising results in a variety of animal models. Genome editing with the CRISPR/Cas9 system has recently been used to restore dystrophin expression by deleting one or more exons of the DMD gene in patient cells and in a mouse model that led to functional improvement of muscle strength. Exon skipping with oligonucleotides has been successful in several animal models and evaluated in multiple clinical trials. Next-generation oligonucleotide formulations offer significant promise to build on these results. All these approaches to restoring dystrophin expression are encouraging, but many hurdles remain. This review summarizes the current state of these technologies and summarizes considerations for their future development. PMID:27542949

  7. Splice junction mutations at the Menkes locus that maintain some proper splicing are associated with milder clinical phenotypes, including typical occipital horn syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaler, S.G.; Gahl, W.A.

    1994-09-01

    Menkes disease is an X linked recessive disorder of copper metabolism produced by abnormalities in a gene that encodes a copper transporting ATPase. The clinical spectrum of Menkes disease includes a range of neurological severity from the classical type to the occipital horn syndrome (OHS) in which slightly subnormal intelligence or signs of autonomic dysfunction are the only neurologic abnormalities. We previously documented a distinctive, less severe Menkes phenotype associated with a +3 intronic splice donor mutation at the 3{prime} end of the gene in which exon skipping occurred but some normally spliced message was also detectable. We now reportmore » a similar splicing mutation in a patient with a typical OHS phenotype an A to G transition at the 2 exonic position of a splice donor site in the middle of the Menkes coding sequence. Some normally sized transcripts are evident by RT-PCR of lymphoblast mRNA from this individual, as well as 2 truncated fragments generated by exon skipping and activation of a cryptic splice acceptor site, respectively. The predicted effect of the mutation on the gene product involves a serine to glycine substitution in a noncritical region of the Menkes ATPase from the patient`s normally sized message, and premature termination due to translational frameshift in both truncated transcripts. The mutation eliminates a Dde 1 restriction site in the gene which provided a method to rapidly screen other family members, and revealed that the patient`s mother is a non-carrier. The mutational base change was not present in 25 normal X chromosomes studied. Preliminary analysis of the Menkes locus in 5 other Menkes disease families indicates aberrant mRNA splicing in 2. Our findings confirm allelism at the Menkes locus, indicate that splice mutations are relatively common mutational event in Menkes disease, and suggest that splice mutations in which some normal splicing is preserved may underlie milder Menkes disease variants, including OHS.« less

  8. The N Terminus of the Retinoblastoma Protein Inhibits DNA Replication via a Bipartite Mechanism Disrupted in Partially Penetrant Retinoblastomas

    PubMed Central

    Borysov, Sergiy I.; Nepon-Sixt, Brook S.

    2015-01-01

    The N-terminal domain of the retinoblastoma (Rb) tumor suppressor protein (RbN) harbors in-frame exon deletions in partially penetrant hereditary retinoblastomas and is known to impair cell growth and tumorigenesis. However, how such RbN deletions contribute to Rb tumor- and growth-suppressive functions is unknown. Here we establish that RbN directly inhibits DNA replication initiation and elongation using a bipartite mechanism involving N-terminal exons lost in cancer. Specifically, Rb exon 7 is necessary and sufficient to target and inhibit the replicative CMG helicase, resulting in the accumulation of inactive CMGs on chromatin. An independent N-terminal loop domain, which forms a projection, specifically blocks DNA polymerase α (Pol-α) and Ctf4 recruitment without affecting DNA polymerases ε and δ or the CMG helicase. Individual disruption of exon 7 or the projection in RbN or Rb, as occurs in inherited cancers, partially impairs the ability of Rb/RbN to inhibit DNA replication and block G1-to-S cell cycle transit. However, their combined loss abolishes these functions of Rb. Thus, Rb growth-suppressive functions include its ability to block replicative complexes via bipartite, independent, and additive N-terminal domains. The partial loss of replication, CMG, or Pol-α control provides a potential molecular explanation for how N-terminal Rb loss-of-function deletions contribute to the etiology of partially penetrant retinoblastomas. PMID:26711265

  9. Seven novel mutations in the factor XIII A-subunit gene causing hereditary factor XIII deficiency in 10 unrelated families.

    PubMed

    Vysokovsky, A; Saxena, R; Landau, M; Zivelin, A; Eskaraev, R; Rosenberg, N; Seligsohn, U; Inbal, A

    2004-10-01

    Hereditary factor (F)XIII deficiency is a rare bleeding disorder mostly due to mutations in FXIII A subunit. We studied the molecular basis of FXIII deficiency in patients from 10 unrelated families originating from Israel, India and Tunisia. Exons 2-15 of genomic DNA consisting of coding regions and intron/exon boundaries were amplified and sequenced. Structural analysis of the mutations was undertaken by computer modeling. Seven novel mutations were identified in the FXIIIA gene. The propositus from the Ethiopian-Jewish family was found to be a compound heterozygote for two novel mutations: a 10-bp deletion in exon 12 at nucleotides 1652-1661 (followed by 22 altered amino acids and termination codon) and Ala318Val mutation. The propositus of the Tunisian family was homozygous for C insertion after nucleotide 863 within a stretch of six cytosines of exon 7. This insertion results in generation of eight altered amino acids followed by a termination codon downstream. The propositus from Indian-Jewish origin was found to be homozygous for G to T substitution at IVS 11 [+1] resulting in skipping of exons 10 and 11. In addition to the Ala318Val mutation, three of the novel mutations identified are missense mutations: Arg260Leu, Thr398Asn and Gly210Arg each occurring in a homozygous state in an Israeli-Arab and two Indian families, respectively. Structure-function correlation analysis by computer modeling of the new missense mutations predicted that Gly210Arg will cause protein misfolding, Ala318Val and Thr398Asn will interfere with the catalytic process or protein stability, and Arg260Leu will impair dimerization.

  10. Genetic Testing Confirmed the Early Diagnosis of X-Linked Hypophosphatemic Rickets in a 7-Month-Old Infant

    PubMed Central

    Poon, Kok Siong; Sng, Andrew Anjian; Ho, Cindy Weili; Koay, Evelyn Siew-Chuan

    2015-01-01

    Loss-of-function mutations in the phosphate regulating gene with homologies to endopeptidases on the X-chromosome (PHEX) have been causally associated with X-linked hypophosphatemic rickets (XLHR). The early diagnosis of XLHR in infants is challenging when it is based solely on clinical features and biochemical findings. We report a 7-month-old boy with a family history of hypophosphatemic rickets., who demonstrated early clinical evidence of rickets, although serial biochemical findings could not definitively confirm rickets. A sequencing assay targeting the PHEX gene was first performed on the mother’s DNA to screen for mutations in the 5′UTR, 22 coding exons, and the exon-intron junctions. Targeted mutation analysis and mRNA studies were subsequently performed on the boys’ DNA to investigate the pathogenicity of the identified mutation. Genetic screening of the PHEX gene revealed a novel mutation, c.1080-2A>C, at the splice acceptor site in intron 9. The detection of an aberrant mRNA transcript with skipped (loss of) exon 10 establishes its pathogenicity and confirms the diagnosis of XLHR in this infant. Genetic testing of the PHEX gene resulted in early diagnosis of XLHR, thus enabling initiation of therapy and prevention of progressive rachitic changes in the infant. PMID:26904698

  11. Novel MSH2 splice-site mutation in a young patient with Lynch syndrome

    PubMed Central

    Liccardo, Raffaella; De Rosa, Marina; Izzo, Paola; Duraturo, Francesca

    2018-01-01

    Lynch Syndrome (LS) is associated with germline mutations in one of the mismatch repair (MMR) genes, including MutL homolog 1 (MLH1), MutS homolog 2 (MSH2), MSH6, PMS1 homolog 2, mismatch repair system component (PMS2), MLH3 and MSH3. The mutations identified in MMR genes are point mutations or large rearrangements. The point mutations are certainly pathogenetic whether they determine formation of truncated protein. The mutations that arise in splice sites are classified as ‘likely pathogenic’ variants. In the present study, a novel splicing mutation was identified, (named c.212-1g>a), in the MSH2 gene. This novel mutation in the consensus splice site of MSH2 exon 2 leads to the loss of the canonical splice site, without skipping in-frame of exon 2; also with the formation of 2 aberrant transcripts, due to the activation of novel splice sites in exon 2. This mutation was identified in a young patient who developed colon cancer at the age of 26 years and their belongs to family that met the ‘Revised Amsterdam Criteria’. The present study provided insight into the molecular mechanism determining the pathogenicity of this novel MSH2 mutation and it reaffirms the importance of genetic testing in LS. PMID:29568967

  12. Dystrophin restoration therapy improves both the reduced excitability and the force drop induced by lengthening contractions in dystrophic mdx skeletal muscle.

    PubMed

    Roy, Pauline; Rau, Fredérique; Ochala, Julien; Messéant, Julien; Fraysse, Bodvael; Lainé, Jeanne; Agbulut, Onnik; Butler-Browne, Gillian; Furling, Denis; Ferry, Arnaud

    2016-01-01

    The greater susceptibility to contraction-induced skeletal muscle injury (fragility) is an important dystrophic feature and tool for testing preclinic dystrophin-based therapies for Duchenne muscular dystrophy. However, how these therapies reduce the muscle fragility is not clear. To address this question, we first determined the event(s) of the excitation-contraction cycle which is/are altered following lengthening (eccentric) contractions in the mdx muscle. We found that the immediate force drop following lengthening contractions, a widely used measure of muscle fragility, was associated with reduced muscle excitability. Moreover, the force drop can be mimicked by an experimental reduction in muscle excitation of uninjured muscle. Furthermore, the force drop was not related to major neuromuscular transmission failure, excitation-contraction uncoupling, and myofibrillar impairment. Secondly, and importantly, the re-expression of functional truncated dystrophin in the muscle of mdx mice using an exon skipping strategy partially prevented the reductions in both force drop and muscle excitability following lengthening contractions. We demonstrated for the first time that (i) the increased susceptibility to contraction-induced muscle injury in mdx mice is mainly attributable to reduced muscle excitability; (ii) dystrophin-based therapy improves fragility of the dystrophic skeletal muscle by preventing reduction in muscle excitability.

  13. Kinetin improves IKBKAP mRNA splicing in patients with familial dysautonomia

    PubMed Central

    Axelrod, Felicia B.; Liebes, Leonard; Gold-von Simson, Gabrielle; Mendoza, Sandra; Mull, James; Leyne, Maire; Norcliffe-Kaufmann, Lucy; Kaufmann, Horacio; Slaugenhaupt, Susan A.

    2011-01-01

    Familial dysautonomia (FD) is caused by an intronic splice mutation in the IKBKAP gene that leads to partial skipping of exon 20 and tissue-specific reduction in I-κ-B kinase complex associated protein/ elongation protein 1 (IKAP/ELP-1) expression. Kinetin (6-furfurylaminopurine) has been shown to improve splicing and increase wild-type IKBKAP mRNA and IKAP protein expression in FD cell lines and carriers. To determine if oral kinetin treatment could alter mRNA splicing in FD subjects and was tolerable, we administered kinetin to eight FD individuals homozygous for the splice mutation. Subjects received 23.5 mg/Kg/day for 28 days. An increase in wild-type IKBKAP mRNA expression in leukocytes was noted after eight days in six of eight individuals; after 28 days the mean increase as compared to baseline was significant (p=0.002). We have demonstrated that kinetin is tolerable in this medically fragile population. Not only did kinetin produce the desired effect on splicing in FD patients, but also that effect appears to improve with time despite lack of dose change. This is the first report of a drug that produces in vivo mRNA splicing changes in individuals with FD and supports future long-term trials to determine if kinetin will prove therapeutic in FD patients. PMID:21775922

  14. RNA-Seq profiling reveals aberrant RNA splicing in patient with adult acute myeloid leukemia during treatment.

    PubMed

    Li, X-y; Yao, X; Li, S-n; Suo, A-l; Ruan, Z-p; Liang, X; Kong, Y; Zhang, W-g; Yao, Y

    2014-01-01

    Multiple genetic alterations that affect the process of acute myeloid leukemia (AML) have been discovered, and more evidence also indicates that aberrant splicing plays an important role in cancer. We present a RNA-Seq profiling of an AML patient with complete remission after treatment, to analyze the aberrant splicing of genes during treatment. We sequenced 3.97 and 3.32 Gbp clean data of the AML and remission sample, respectively. Firstly, by analyzing biomarkers associated with AML, to assist normal clinical tests, we confirmed that the patient was anormal karyo type, with NPM1 and IDH2 mutations and deregulation patterns of related genes, such as BAALC, ERG, MN1 and HOX family. Then, we performed alternative splicing detection of the AML and remission sample. We detected 91 differentially splicing events in 68 differentially splicing genes (DSGs) by mixture of isoforms (MISO). Considering Psi values (Ψ) and confidence intervals, 25 differentially expressed isoforms were identified as more confident isoforms, which were associated with RNA processing, cellular macromolecule catabolic process and DNA binding according to GO enrichment analysis. An exon2-skipping event in oncogene FOS (FBJ murine osteosarcoma viral oncogene homolog) were detected and validated in this study. FOS has a critical function in regulating cell proliferation, differentiation and transformation. The exon2-skipping isoform of FOS was increased significantly after treatment. All the data and information of RNA-Seq provides highly accurate and comprehensive supplements to conventional clinical tests of AML. Moreover, the splicing aberrations would be another source for biomarker and even therapeutic target discovery. More information of splicing may also assist the better understanding of leukemogenesis.

  15. Differential HFE Gene Expression Is Regulated by Alternative Splicing in Human Tissues

    PubMed Central

    Proença, Daniela; Faustino, Paula

    2011-01-01

    Background The pathophysiology of HFE-derived Hereditary Hemochromatosis and the function of HFE protein in iron homeostasis remain uncertain. Also, the role of alternative splicing in HFE gene expression regulation and the possible function of the corresponding protein isoforms are still unknown. The aim of this study was to gain insights into the physiological significance of these alternative HFE variants. Methodology/Principal Findings Alternatively spliced HFE transcripts in diverse human tissues were identified by RT-PCR, cloning and sequencing. Total HFE transcripts, as well as two alternative splicing transcripts were quantified using a real-time PCR methodology. Intracellular localization, trafficking and protein association of GFP-tagged HFE protein variants were analysed in transiently transfected HepG2 cells by immunoprecipitation and immunofluorescence assays. Alternatively spliced HFE transcripts present both level- and tissue-specificity. Concerning the exon 2 skipping and intron 4 inclusion transcripts, the liver presents the lowest relative level, while duodenum presents one of the highest amounts. The protein resulting from exon 2 skipping transcript is unable to associate with β2M and TfR1 and reveals an ER retention. Conversely, the intron 4 inclusion transcript gives rise to a truncated, soluble protein (sHFE) that is mostly secreted by cells to the medium in association with β2M. Conclusions/Significance HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism. Among the corresponding proteins, a sHFE isoform stands out, which upon being secreted into the bloodstream, may act in remote tissues. It could be either an agonist or antagonist of the full length HFE, through hepcidin expression regulation in the liver or by controlling dietary iron absorption in the duodenum. PMID:21407826

  16. Differential HFE gene expression is regulated by alternative splicing in human tissues.

    PubMed

    Martins, Rute; Silva, Bruno; Proença, Daniela; Faustino, Paula

    2011-03-03

    The pathophysiology of HFE-derived Hereditary Hemochromatosis and the function of HFE protein in iron homeostasis remain uncertain. Also, the role of alternative splicing in HFE gene expression regulation and the possible function of the corresponding protein isoforms are still unknown. The aim of this study was to gain insights into the physiological significance of these alternative HFE variants. Alternatively spliced HFE transcripts in diverse human tissues were identified by RT-PCR, cloning and sequencing. Total HFE transcripts, as well as two alternative splicing transcripts were quantified using a real-time PCR methodology. Intracellular localization, trafficking and protein association of GFP-tagged HFE protein variants were analysed in transiently transfected HepG2 cells by immunoprecipitation and immunofluorescence assays. Alternatively spliced HFE transcripts present both level- and tissue-specificity. Concerning the exon 2 skipping and intron 4 inclusion transcripts, the liver presents the lowest relative level, while duodenum presents one of the highest amounts. The protein resulting from exon 2 skipping transcript is unable to associate with β2M and TfR1 and reveals an ER retention. Conversely, the intron 4 inclusion transcript gives rise to a truncated, soluble protein (sHFE) that is mostly secreted by cells to the medium in association with β2M. HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism. Among the corresponding proteins, a sHFE isoform stands out, which upon being secreted into the bloodstream, may act in remote tissues. It could be either an agonist or antagonist of the full length HFE, through hepcidin expression regulation in the liver or by controlling dietary iron absorption in the duodenum.

  17. A TALEN-Exon Skipping Design for a Bethlem Myopathy Model in Zebrafish.

    PubMed

    Radev, Zlatko; Hermel, Jean-Michel; Elipot, Yannick; Bretaud, Sandrine; Arnould, Sylvain; Duchateau, Philippe; Ruggiero, Florence; Joly, Jean-Stéphane; Sohm, Frédéric

    2015-01-01

    Presently, human collagen VI-related diseases such as Ullrich congenital muscular dystrophy (UCMD) and Bethlem myopathy (BM) remain incurable, emphasizing the need to unravel their etiology and improve their treatments. In UCMD, symptom onset occurs early, and both diseases aggravate with ageing. In zebrafish fry, morpholinos reproduced early UCMD and BM symptoms but did not allow to study the late phenotype. Here, we produced the first zebrafish line with the human mutation frequently found in collagen VI-related disorders such as UCMD and BM. We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA. This mutation at a splice donor site is the first example of a template-independent modification of splicing induced in zebrafish using a targetable nuclease. This technique is readily expandable to other organisms and can be instrumental in other disease studies. Histological and ultrastructural analyzes of homozygous and heterozygous mutant fry and 3 months post-fertilization (mpf) fish revealed co-dominantly inherited abnormal myofibers with disorganized myofibrils, enlarged sarcoplasmic reticulum, altered mitochondria and misaligned sarcomeres. Locomotion analyzes showed hypoxia-response behavior in 9 mpf col6a1 mutant unseen in 3 mpf fish. These symptoms worsened with ageing as described in patients with collagen VI deficiency. Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders.

  18. Exon skipping of AGAMOUS homolog PrseAG in developing double flowers of Prunus lannesiana (Rosaceae).

    PubMed

    Liu, Zhixiong; Zhang, Dandan; Liu, Di; Li, Fenglan; Lu, Hai

    2013-02-01

    KEY MESSAGE : Two transcript isoforms of AGAMOUS homologs, from single and double flower Prunus lannesiana, respectively, showed different functions. The Arabidopsis floral homeotic C function gene AGAMOUS (AG) confers stamen and carpel identity. Loss of AG function results in homeotic conversions of stamens into petals and formation of double flowers. In order to present a molecular dissection of a double-flower cultivar in Prunus lannesiana (Rosaceae), we isolated and identified a single-copy gene, AG homolog from two genetically cognate P. lannesiana bearing single and double flowers, respectively. Sequence analysis revealed that the AG homolog, prseag-1, from double flowers showed a 170-bp exon skipping as compared to PrseAG (Prunus serrulata AGAMOUS) from the single flowers. Genomic DNA sequence revealed that abnormal splicing resulted in mutant prseag-1 protein with the C-terminal AG motifs I and II deletions. In addition, protein sequence alignment and phylogenetic analyses revealed that the PrseAG was grouped into the euAG lineage. A semi-quantitative PCR analysis showed that the expression of PrseAG was restricted to reproductive organs of stamens and carpels in single flowers of P. lannesiana 'speciosa', while the prseag-1 mRNA was highly transcribed throughout the petals, stamens, and carpels in double flowers from 'Albo-rosea'. The transgenic Arabidopsis containing 35S::PrseAG displayed extremely early flowering, bigger stamens and carpels and homeotic conversion of petals into staminoid organs, but ectopic expression of prseag-1 could not mimic the phenotypic ectopic expression of PrseAG in Arabidopsis. In general, this study provides evidences to show that double flower 'Albo-rosea' is a putative C functional ag mutant in P. lannesiana.

  19. A TALEN-Exon Skipping Design for a Bethlem Myopathy Model in Zebrafish

    PubMed Central

    Elipot, Yannick; Bretaud, Sandrine; Arnould, Sylvain; Duchateau, Philippe; Ruggiero, Florence; Joly, Jean-Stéphane; Sohm, Frédéric

    2015-01-01

    Presently, human collagen VI-related diseases such as Ullrich congenital muscular dystrophy (UCMD) and Bethlem myopathy (BM) remain incurable, emphasizing the need to unravel their etiology and improve their treatments. In UCMD, symptom onset occurs early, and both diseases aggravate with ageing. In zebrafish fry, morpholinos reproduced early UCMD and BM symptoms but did not allow to study the late phenotype. Here, we produced the first zebrafish line with the human mutation frequently found in collagen VI-related disorders such as UCMD and BM. We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA. This mutation at a splice donor site is the first example of a template-independent modification of splicing induced in zebrafish using a targetable nuclease. This technique is readily expandable to other organisms and can be instrumental in other disease studies. Histological and ultrastructural analyzes of homozygous and heterozygous mutant fry and 3 months post-fertilization (mpf) fish revealed co-dominantly inherited abnormal myofibers with disorganized myofibrils, enlarged sarcoplasmic reticulum, altered mitochondria and misaligned sarcomeres. Locomotion analyzes showed hypoxia-response behavior in 9 mpf col6a1 mutant unseen in 3 mpf fish. These symptoms worsened with ageing as described in patients with collagen VI deficiency. Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders. PMID:26221953

  20. Clinical characteristics of non-small cell lung cancer harboring mutations in exon 20 of EGFR or HER2.

    PubMed

    Takeda, Masayuki; Sakai, Kazuko; Hayashi, Hidetoshi; Tanaka, Kaoru; Tanizaki, Junko; Takahama, Takayuki; Haratani, Koji; Nishio, Kazuto; Nakagawa, Kazuhiko

    2018-04-20

    Unlike common epidermal growth factor receptor gene ( EGFR ) mutations that confer sensitivity to tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer (NSCLC), mutations in exon 20 of either EGFR or the human EGFR2 gene ( HER2 ) are associated with insensitivity to EGFR-TKIs, with treatment options for patients with such mutations being limited. Clinical characteristics, outcome of EGFR-TKI or nivolumab treatment, and the presence of coexisting mutations were reviewed for NSCLC patients with exon-20 mutations of EGFR or HER2 as detected by routine application of an amplicon-based next-generation sequencing panel. Between July 2013 and June 2017, 206 patients with pathologically confirmed lung cancer were screened for genetic alterations including HER2 and EGFR mutations. Ten patients harbored HER2 exon-20 insertions (one of whom also carried an exon-19 deletion of EGFR ), and 12 patients harbored EGFR exon-20 mutations. Five of the 13 patients with EGFR mutations were treated with EGFR-TKIs, two of whom manifested a partial response, two stable disease, and one progressive disease. Among the seven patients treated with nivolumab, one patient manifested a partial response, three stable disease, and three progressive disease, with most (86%) of these patients discontinuing treatment as a result of disease progression within 4 months. The H1047R mutation of PIK3CA detected in one patient was the only actionable mutation coexisting with the exon-20 mutations of EGFR or HER2 . Potentially actionable mutations thus rarely coexist with exon-20 mutations of EGFR or HER2 , and EGFR-TKIs and nivolumab show limited efficacy in patients with such exon-20 mutations.

  1. Lnx2 ubiquitin ligase is essential for exocrine cell differentiation in the early zebrafish pancreas

    PubMed Central

    Won, Minho; Ro, Hyunju; Dawid, Igor B.

    2015-01-01

    The gene encoding the E3 ubiquitin ligase Ligand of Numb protein-X (Lnx)2a is expressed in the ventral-anterior pancreatic bud of zebrafish embryos in addition to its expression in the brain. Knockdown of Lnx2a by using an exon 2/intron 2 splice morpholino resulted in specific inhibition of the differentiation of ventral bud derived exocrine cell types, with little effect on endocrine cell types. A frame shifting null mutation in lnx2a did not mimic this phenotype, but a mutation that removed the exon 2 splice donor site did. We found that Lnx2b functions in a redundant manner with its paralog Lnx2a. Inhibition of lnx2a exon 2/3 splicing causes exon 2 skipping and leads to the production of an N-truncated protein that acts as an interfering molecule. Thus, the phenotype characterized by inhibition of exocrine cell differentiation requires inactivation of both Lnx2a and Lnx2b. Human LNX1 is known to destabilize Numb, and we show that inhibition of Numb expression rescues the Lnx2a/b-deficient phenotype. Further, Lnx2a/b inhibition leads to a reduction in the number of Notch active cells in the pancreas. We suggest that Lnx2a/b function to fine tune the regulation of Notch through Numb in the differentiation of cell types in the early zebrafish pancreas. Further, the complex relationships among genotype, phenotype, and morpholino effect in this case may be instructive in the ongoing consideration of morpholino use. PMID:26392552

  2. Lnx2 ubiquitin ligase is essential for exocrine cell differentiation in the early zebrafish pancreas.

    PubMed

    Won, Minho; Ro, Hyunju; Dawid, Igor B

    2015-10-06

    The gene encoding the E3 ubiquitin ligase Ligand of Numb protein-X (Lnx)2a is expressed in the ventral-anterior pancreatic bud of zebrafish embryos in addition to its expression in the brain. Knockdown of Lnx2a by using an exon 2/intron 2 splice morpholino resulted in specific inhibition of the differentiation of ventral bud derived exocrine cell types, with little effect on endocrine cell types. A frame shifting null mutation in lnx2a did not mimic this phenotype, but a mutation that removed the exon 2 splice donor site did. We found that Lnx2b functions in a redundant manner with its paralog Lnx2a. Inhibition of lnx2a exon 2/3 splicing causes exon 2 skipping and leads to the production of an N-truncated protein that acts as an interfering molecule. Thus, the phenotype characterized by inhibition of exocrine cell differentiation requires inactivation of both Lnx2a and Lnx2b. Human LNX1 is known to destabilize Numb, and we show that inhibition of Numb expression rescues the Lnx2a/b-deficient phenotype. Further, Lnx2a/b inhibition leads to a reduction in the number of Notch active cells in the pancreas. We suggest that Lnx2a/b function to fine tune the regulation of Notch through Numb in the differentiation of cell types in the early zebrafish pancreas. Further, the complex relationships among genotype, phenotype, and morpholino effect in this case may be instructive in the ongoing consideration of morpholino use.

  3. SplicingTypesAnno: annotating and quantifying alternative splicing events for RNA-Seq data.

    PubMed

    Sun, Xiaoyong; Zuo, Fenghua; Ru, Yuanbin; Guo, Jiqiang; Yan, Xiaoyan; Sablok, Gaurav

    2015-04-01

    Alternative splicing plays a key role in the regulation of the central dogma. Four major types of alternative splicing have been classified as intron retention, exon skipping, alternative 5 splice sites or alternative donor sites, and alternative 3 splice sites or alternative acceptor sites. A few algorithms have been developed to detect splice junctions from RNA-Seq reads. However, there are few tools targeting at the major alternative splicing types at the exon/intron level. This type of analysis may reveal subtle, yet important events of alternative splicing, and thus help gain deeper understanding of the mechanism of alternative splicing. This paper describes a user-friendly R package, extracting, annotating and analyzing alternative splicing types for sequence alignment files from RNA-Seq. SplicingTypesAnno can: (1) provide annotation for major alternative splicing at exon/intron level. By comparing the annotation from GTF/GFF file, it identifies the novel alternative splicing sites; (2) offer a convenient two-level analysis: genome-scale annotation for users with high performance computing environment, and gene-scale annotation for users with personal computers; (3) generate a user-friendly web report and additional BED files for IGV visualization. SplicingTypesAnno is a user-friendly R package for extracting, annotating and analyzing alternative splicing types at exon/intron level for sequence alignment files from RNA-Seq. It is publically available at https://sourceforge.net/projects/splicingtypes/files/ or http://genome.sdau.edu.cn/research/software/SplicingTypesAnno.html. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  4. Multiple Isoforms of ANRIL in Melanoma Cells: Structural Complexity Suggests Variations in Processing.

    PubMed

    Sarkar, Debina; Oghabian, Ali; Bodiyabadu, Pasani K; Joseph, Wayne R; Leung, Euphemia Y; Finlay, Graeme J; Baguley, Bruce C; Askarian-Amiri, Marjan E

    2017-06-27

    The long non-coding RNA ANRIL , antisense to the CDKN2B locus, is transcribed from a gene that encompasses multiple disease-associated polymorphisms. Despite the identification of multiple isoforms of ANRIL , expression of certain transcripts has been found to be tissue-specific and the characterisation of ANRIL transcripts remains incomplete. Several functions have been associated with ANRIL . In our judgement, studies on ANRIL functionality are premature pending a more complete appreciation of the profusion of isoforms. We found differential expression of ANRIL exons, which indicates that multiple isoforms exist in melanoma cells. In addition to linear isoforms, we identified circular forms of ANRIL ( circANRIL ). Further characterisation of circANR IL in two patient-derived metastatic melanoma cell lines (NZM7 and NZM37) revealed the existence of a rich assortment of circular isoforms. Moreover, in the two melanoma cell lines investigated, the complements of circANRIL isoforms were almost completely different. Novel exons were also discovered. We also found the family of linear ANRIL was enriched in the nucleus, whilst the circular isoforms were enriched in the cytoplasm and they differed markedly in stability. With respect to the variable processing of circANRIL species, bioinformatic analysis indicated that intronic Arthrobacter luteus (Alu) restriction endonuclease inverted repeats and exon skipping were not involved in selection of back-spliced exon junctions. Based on our findings, we hypothesise that " ANRIL " has wholly distinct dual sets of functions in melanoma. This reveals the dynamic nature of the locus and constitutes a basis for investigating the functions of ANRIL in melanoma.

  5. Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose-escalation, proof-of-concept study

    PubMed Central

    Kinali, Maria; Arechavala-Gomeza, Virginia; Feng, Lucy; Cirak, Sebahattin; Hunt, David; Adkin, Carl; Guglieri, Michela; Ashton, Emma; Abbs, Stephen; Nihoyannopoulos, Petros; Garralda, Maria Elena; Rutherford, Mary; Mcculley, Caroline; Popplewell, Linda; Graham, Ian R; Dickson, George; Wood, Matthew JA; Wells, Dominic J; Wilton, Steve D; Kole, Ryszard; Straub, Volker; Bushby, Kate; Sewry, Caroline; Morgan, Jennifer E; Muntoni, Francesco

    2009-01-01

    Summary Background Mutations that disrupt the open reading frame and prevent full translation of DMD, the gene that encodes dystrophin, underlie the fatal X-linked disease Duchenne muscular dystrophy. Oligonucleotides targeted to splicing elements (splice switching oligonucleotides) in DMD pre-mRNA can lead to exon skipping, restoration of the open reading frame, and the production of functional dystrophin in vitro and in vivo, which could benefit patients with this disorder. Methods We did a single-blind, placebo-controlled, dose-escalation study in patients with DMD recruited nationally, to assess the safety and biochemical efficacy of an intramuscular morpholino splice-switching oligonucleotide (AVI-4658) that skips exon 51 in dystrophin mRNA. Seven patients with Duchenne muscular dystrophy with deletions in the open reading frame of DMD that are responsive to exon 51 skipping were selected on the basis of the preservation of their extensor digitorum brevis (EDB) muscle seen on MRI and the response of cultured fibroblasts from a skin biopsy to AVI-4658. AVI-4658 was injected into the EDB muscle; the contralateral muscle received saline. Muscles were biopsied between 3 and 4 weeks after injection. The primary endpoint was the safety of AVI-4658 and the secondary endpoint was its biochemical efficacy. This trial is registered, number NCT00159250. Findings Two patients received 0·09 mg AVI-4658 in 900 μL (0·9%) saline and five patients received 0·9 mg AVI-4658 in 900 μL saline. No adverse events related to AVI-4658 administration were reported. Intramuscular injection of the higher-dose of AVI-4658 resulted in increased dystrophin expression in all treated EDB muscles, although the results of the immunostaining of EDB-treated muscle for dystrophin were not uniform. In the areas of the immunostained sections that were adjacent to the needle track through which AVI-4658 was given, 44–79% of myofibres had increased expression of dystrophin. In randomly chosen sections of treated EDB muscles, the mean intensity of dystrophin staining ranged from 22% to 32% of the mean intensity of dystrophin in healthy control muscles (mean 26·4%), and the mean intensity was 17% (range 11–21%) greater than the intensity in the contralateral saline-treated muscle (one-sample paired t test p=0·002). In the dystrophin-positive fibres, the intensity of dystrophin staining was up to 42% of that in healthy muscle. We showed expression of dystrophin at the expected molecular weight in the AVI-4658-treated muscle by immunoblot. Interpretation Intramuscular AVI-4658 was safe and induced the expression of dystrophin locally within treated muscles. This proof-of-concept study has led to an ongoing systemic clinical trial of AVI-4658 in patients with DMD. Funding UK Department of Health. PMID:19713152

  6. Looking the cow in the eye: deletion in the NID1 gene is associated with recessive inherited cataract in Romagnola cattle.

    PubMed

    Murgiano, Leonardo; Jagannathan, Vidhya; Calderoni, Valerio; Joechler, Monika; Gentile, Arcangelo; Drögemüller, Cord

    2014-01-01

    Cataract is a known condition leading to opacification of the eye lens causing partial or total blindness. Mutations are known to cause autosomal dominant or recessive inherited forms of cataracts in humans, mice, rats, guinea pigs and dogs. The use of large-sized animal models instead of those using mice for the study of this condition has been discussed due to the small size of rodent lenses. Four juvenile-onset cases of bilateral incomplete immature nuclear cataract were recently observed in Romagnola cattle. Pedigree analysis suggested a monogenic autosomal recessive inheritance. In addition to the cataract, one of the cases displayed abnormal head movements. Genome-wide association and homozygosity mapping and subsequent whole genome sequencing of a single case identified two perfectly associated sequence variants in a critical interval of 7.2 Mb on cattle chromosome 28: a missense point mutation located in an uncharacterized locus and an 855 bp deletion across the exon 19/intron 19 border of the bovine nidogen 1 (NID1) gene (c.3579_3604+829del). RT-PCR showed that NID1 is expressed in bovine lenses while the transcript of the second locus was absent. The NID1 deletion leads to the skipping of exon 19 during transcription and is therefore predicted to cause a frameshift and premature stop codon (p.1164fs27X). The truncated protein lacks a C-terminal domain essential for binding with matrix assembly complexes. Nidogen 1 deficient mice show neurological abnormalities and highly irregular crystal lens alterations. This study adds NID1 to the list of candidate genes for inherited cataract in humans and is the first report of a naturally occurring mutation leading to non-syndromic catarct in cattle provides a potential large animal model for human cataract.

  7. cDNA cloning and initial characterization of CYP3A43, a novel human cytochrome P450.

    PubMed

    Domanski, T L; Finta, C; Halpert, J R; Zaphiropoulos, P G

    2001-02-01

    The RACE amplification technology was used on a novel CYP3A-like exon 1 sequence detected during the reverse transcriptase/polymerase chain reaction analysis of human CYP3A gene expression. This resulted in the identification of cDNAs encompassing the complete coding sequence of a new member of the CYP3A gene subfamily, CYP3A43. Interestingly, the majority of the cDNAs identified were characterized by alternative splicing events such as exon skipping and complete or partial intron inclusion. CYP3A43 expression was detected in liver, kidney, pancreas, and prostate. The amino acid sequence is 75% identical to that of CYP3A4 and CYP3A5 and 71% identical to CYP3A7. CYP3A43 differs from CYP3A4 at six amino acid residues, found within the putative substrate recognition sites of CYP3A4, that are known to be determinants of substrate selectivity. The N terminus of CYP3A43 was modified for efficient expression of the protein in Escherichia coli, and a 6X histidine tag was added at the C terminus to facilitate purification. CYP3A43 gave a reduced carbon monoxide difference spectra with an absorbance maximum at 450 nm. The level of heterologous expression was significantly lower than that observed for CYP3A4 and CYP3A5. Immunoblot analyses revealed that CYP3A43 comigrates with CYP3A4 in polyacrylamide gel electrophoresis but does separate from CYP3A5. Monooxygenase assays were performed under a variety of conditions, several of which yielded reproducible, albeit low, testosterone hydroxylase activity. The findings from this study demonstrate that there is a novel CYP3A member expressed in human tissues, although its relative contribution to drug metabolism has yet to be ascertained.

  8. Bi-specific splice-switching PMO oligonucleotides conjugated via a single peptide active in a mouse model of Duchenne muscular dystrophy

    PubMed Central

    Shabanpoor, Fazel; McClorey, Graham; Saleh, Amer F.; Järver, Peter; Wood, Matthew J.A.; Gait, Michael J.

    2015-01-01

    The potential for therapeutic application of splice-switching oligonucleotides (SSOs) to modulate pre-mRNA splicing is increasingly evident in a number of diseases. However, the primary drawback of this approach is poor cell and in vivo oligonucleotide uptake efficacy. Biological activities can be significantly enhanced through the use of synthetically conjugated cationic cell penetrating peptides (CPPs). Studies to date have focused on the delivery of a single SSO conjugated to a CPP, but here we describe the conjugation of two phosphorodiamidate morpholino oligonucleotide (PMO) SSOs to a single CPP for simultaneous delivery and pre-mRNA targeting of two separate genes, exon 23 of the Dmd gene and exon 5 of the Acvr2b gene, in a mouse model of Duchenne muscular dystrophy. Conjugations of PMOs to a single CPP were carried out through an amide bond in one case and through a triazole linkage (‘click chemistry’) in the other. The most active bi-specific CPP–PMOs demonstrated comparable exon skipping levels for both pre-mRNA targets when compared to individual CPP–PMO conjugates both in cell culture and in vivo in the mdx mouse model. Thus, two SSOs with different target sequences conjugated to a single CPP are biologically effective and potentially suitable for future therapeutic exploitation. PMID:25468897

  9. A novel whole exon deletion in WWOX gene causes early epilepsy, intellectual disability and optic atrophy.

    PubMed

    Ben-Salem, Salma; Al-Shamsi, Aisha M; John, Anne; Ali, Bassam R; Al-Gazali, Lihadh

    2015-05-01

    Recent studies have implicated the WW domain-containing oxidoreductase encoding gene (WWOX) in a severe form of autosomal recessive neurological disorder. This condition showed an overlapping spectrum of clinical features including spinocerebellar ataxia associated with generalized seizures and delayed psychomotor development to growth retardation, spasticity, and microcephaly. We evaluated a child from a consanguineous Emirati family that presented at birth with growth retardation, microcephaly, epileptic seizures, and later developed spasticity and delayed psychomotor development. Screening for deletions and duplications using whole-chromosomal microarray analysis identified a novel homozygous microdeletion encompassing exon 5 of the WWOX gene. Analysis of parental DNA indicated that this deletion was inherited from both parents and lies within a large region of homozygosity. Sanger sequencing of the cDNA showed that the deletion resulted in exon 5 skipping leading to a frame-shift and creating a premature stop codon at amino acid position 212. Quantification of mRNA revealed striking low level of WWOX expression in the child and moderate level of expression in the mother compared to a healthy control. To the best of our knowledge, this is the first homozygous germline structural variation in WWOX gene resulting in truncated transcripts that were presumably subject to NMD pathway. Our findings extend the clinical and genetic spectrum of WWOX mutations and support a crucial role of this gene in neurological development.

  10. EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

    PubMed

    Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

    2014-11-01

    The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

  11. Novel mechanism of conjoined gene formation in the human genome.

    PubMed

    Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

    2012-03-01

    Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

  12. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

    PubMed Central

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

    2016-01-01

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

  13. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

    PubMed

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

    2016-01-12

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

  14. Phenotypic diversity in patients with lipodystrophy associated with LMNA mutations.

    PubMed

    Mory, Patricia B; Crispim, Felipe; Freire, Maria Beatriz S; Salles, João Eduardo N; Valério, Cynthia M; Godoy-Matos, Amelio F; Dib, Sérgio A; Moisés, Regina S

    2012-09-01

    Mutations in LMNA have been linked to diverse disorders called laminopathies, which display heterogeneous phenotypes and include diseases affecting muscles, axonal neurons, progeroid syndromes, and lipodystrophies. Among the lipodystrophies, LMNA mutations have been reported most frequently in patients with familial partial lipodystrophy (FPLD) of the Dunnigan variety; however, phenotypic heterogeneity in the pattern of body fat loss has been observed. In this study, we searched for LMNA mutations in patients with various forms of lipodystrophy. We studied 21 unrelated individuals with lipodystrophy. Subjects underwent a complete clinical evaluation and were classified as typical FPLD (n=12), atypical partial lipodystrophy (n=7), or generalized lipodystrophy (n=2). Molecular analysis of LMNA gene, analysis of body fat by dual-energy X-ray absorptiometry, and biochemical measurements were performed. ALL PATIENTS WITH TYPICAL FPLD WERE FOUND TO CARRY LMNA MUTATIONS: seven patients harbored the heterozygous p.R482W (c.1444C>T), two patients harbored the p.R482Q (c.1445G>A), and two individuals harbored the novel heterozygous variant p.N466D (c.1396A>G), all in exon 8. Also, a homozygous p.R584H (c.1751 G>A) mutation in exon 11 was found. Among patients with atypical partial lipodystrophy, two of them were found to have LMNA mutations: a novel heterozygous p.R582C variation (c.1744 C>T) in exon 11 and a heterozygous substitution p.R349W (c.1045C>T) in exon 6. Among patients with generalized lipodystrophy, only one harbored LMNA mutation, a heterozygous p.T10I (c.29C>T) in exon 1. We have identified LMNA mutations in phenotypically diverse lipodystrophies. Also, our study broadens the spectrum of LMNA mutations in lipodystrophy.

  15. Two novel partial deletions of LDL-receptor gene in Italian patients with familial hypercholesterolemia (FH Siracusa and FH Reggio Emilia).

    PubMed

    Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S

    1996-03-01

    In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.

  16. ATP-binding cassette subfamily A, member 4 intronic variants c.4773+3A>G and c.5461-10T>C cause Stargardt disease due to defective splicing.

    PubMed

    Jonsson, Frida; Westin, Ida Maria; Österman, Lennart; Sandgren, Ola; Burstedt, Marie; Holmberg, Monica; Golovleva, Irina

    2018-02-20

    Inherited retinal dystrophies (IRDs) represent a group of progressive conditions affecting the retina. There is a great genetic heterogeneity causing IRDs, and to date, more than 260 genes are associated with IRDs. Stargardt disease, type 1 (STGD1) or macular degeneration with flecks, STGD1 represents a disease with early onset, central visual impairment, frequent appearance of yellowish flecks and mutations in the ATP-binding cassette subfamily A, member 4 (ABCA4) gene. A large number of intronic sequence variants in ABCA4 have been considered pathogenic although their functional effect was seldom demonstrated. In this study, we aimed to reveal how intronic variants present in patients with Stargardt from the same Swedish family affect splicing. The splicing of the ABCA4 gene was studied in human embryonic kidney cells, HEK293T, and in human retinal pigment epithelium cells, ARPE-19, using a minigene system containing variants c.4773+3A>G and c.5461-10T>C. We showed that both ABCA4 variants, c.4773+3A>G and c.5461-10T>C, cause aberrant splicing of the ABCA4 minigene resulting in exon skipping. We also demonstrated that splicing of ABCA4 has different outcomes depending on transfected cell type. Two intronic variants c.4773+3A>G and c.5461-10T>C, both predicted to affect splicing, are indeed disease-causing mutations due to skipping of exons 33, 34, 39 and 40 of ABCA4 gene. The experimental proof that ABCA4 mutations in STGD patients affect protein function is crucial for their inclusion to future clinical trials; therefore, functional testing of all ABCA4 intronic variants associated with Stargardt disease by minigene technology is desirable. © 2018 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  17. Genetic diagnosis of familial hypercholesterolaemia: the importance of functional analysis of potential splice-site mutations.

    PubMed

    Bourbon, M; Duarte, M A; Alves, A C; Medeiros, A M; Marques, L; Soutar, A K

    2009-05-01

    Familial hypercholesterolemia (FH) results from defective low-density lipoprotein receptor (LDLR) activity, mainly due to LDLR gene defects. Of the many different LDLR mutations found in patients with FH, about 6% of single base substitutions are located near or within introns, and are predicted to result in exon skipping, retention of an intron, or activation of cryptic sites during mRNA splicing. This paper reports on the Portuguese FH Study, which found 10 such mutations, 6 of them novel. For the mutations that have not been described before or those whose effect on function have not been analysed, their effect on splicing was investigated, using reverse transcriptase PCR analysis of LDLR mRNA from freshly isolated blood mononuclear cells. Two of these variants (c.313+6 T-->C, c.2389G-->T (p.V776L)) caused exon skipping, and one caused retention of an intron (c.1359-5C-->G), whereas two others (c.2140+5 G-->A and c.1061-8T-->C) had no apparent effect. Any effect of c.1185G-->C (p.V374V) on splicing could not be determined because it was on an allele with a promoter mutation (-42C-->G) that was probably not transcribed. Variants in four patients lost to follow-up could not be tested experimentally, but they almost certainly affect splicing because they disrupt the invariant AG or GT in acceptor (c.818-2A-->G) or donor (c.1060+1G-->A, c.1845+1delG and c.2547+1G-->A) spice sites. These findings emphasise that care must be taken before reporting the presence or absence of a splice-site mutation in the LDLR gene for diagnostic purposes. The study also shows that relatively simple, quick and inexpensive RNA assays can evaluate putative splicing mutations that are not always predictable by available software, thereby reducing genetic misdiagnosis of patients with FH.

  18. Novel Nine-Exon AR Transcripts (Exon 1/Exon 1b/Exons 2-8) in Normal and Cancerous Breast and Prostate Cells.

    PubMed

    Hu, Dong Gui; McKinnon, Ross A; Hulin, Julie-Ann; Mackenzie, Peter I; Meech, Robyn

    2016-12-27

    Nearly 20 different transcripts of the human androgen receptor (AR) are reported with two currently listed as Refseq isoforms in the NCBI database. Isoform 1 encodes wild-type AR (type 1 AR) and isoform 2 encodes the variant AR45 (type 2 AR). Both variants contain eight exons: they share common exons 2-8 but differ in exon 1 with the canonical exon 1 in isoform 1 and the variant exon 1b in isoform 2. Splicing of exon 1 or exon 1b is reported to be mutually exclusive. In this study, we identified a novel exon 1b (1b/TAG) that contains an additional TAG trinucleotide upstream of exon 1b. Moreover, we identified AR transcripts in both normal and cancerous breast and prostate cells that contained either exon 1b or 1b/TAG spliced between the canonical exon 1 and exon 2, generating nine-exon AR transcripts that we have named isoforms 3a and 3b. The proteins encoded by these new AR variants could regulate androgen-responsive reporters in breast and prostate cancer cells under androgen-depleted conditions. Analysis of type 3 AR-GFP fusion proteins showed partial nuclear localization in PC3 cells under androgen-depleted conditions, supporting androgen-independent activation of the AR. Type 3 AR proteins inhibited androgen-induced growth of LNCaP cells. Microarray analysis identified a small set of type 3a AR target genes in LNCaP cells, including genes known to modulate growth and proliferation of prostate cancer ( PCGEM1 , PEG3 , EPHA3 , and EFNB2 ) or other types of human cancers ( TOX3 , ST8SIA4 , and SLITRK3 ), and genes that are diagnostic/prognostic biomarkers of prostate cancer ( GRINA3 , and BCHE ).

  19. Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene.

    PubMed

    Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

    2014-01-01

    Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (< 8 g/L) and severe clinical symptoms. The albumin gene of the index case was screened by single-strand conformation polymorphism, heteroduplex analysis, and direct DNA sequencing. The effect of the splicing mutation was evaluated by examining the cDNA obtained by reverse transcriptase - polymerase chain reaction (RT-PCR) from the albumin mRNA extracted from proband's leukocytes. DNA sequencing revealed that the proband is homozygous, and both parents are heterozygous, for a novel G>A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5' splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia.

  20. Identification of an elaborate NK-specific system regulating HLA-C expression

    PubMed Central

    Ivarsson, Martin A.; Walker-Sperling, Victoria E.; Subleski, Jeff; Johnson, Jenna K.; Wright, Paul W.; Carrington, Mary; McVicar, Daniel W.

    2018-01-01

    The HLA-C gene appears to have evolved in higher primates to serve as a dominant source of ligands for the KIR2D family of inhibitory MHC class I receptors. The expression of NK cell-intrinsic MHC class I has been shown to regulate the murine Ly49 family of MHC class I receptors due to the interaction of these receptors with NK cell MHC in cis. However, cis interactions have not been demonstrated for the human KIR and HLA proteins. We report the discovery of an elaborate NK cell-specific system regulating HLA-C expression, indicating an important role for HLA-C in the development and function of NK cells. A large array of alternative transcripts with differences in intron/exon content are generated from an upstream NK-specific HLA-C promoter, and exon content varies between HLA-C alleles due to SNPs in splice donor/acceptor sites. Skipping of the first coding exon of HLA-C generates a subset of untranslatable mRNAs, and the proportion of untranslatable HLA-C mRNA decreases as NK cells mature, correlating with increased protein expression by mature NK cells. Polymorphism in a key Ets-binding site of the NK promoter has generated HLA-C alleles that lack significant promoter activity, resulting in reduced HLA-C expression and increased functional activity. The NK-intrinsic regulation of HLA-C thus represents a novel mechanism controlling the lytic activity of NK cells during development. PMID:29329284

  1. A Splice Defect in the EDA Gene in Dogs with an X-Linked Hypohidrotic Ectodermal Dysplasia (XLHED) Phenotype.

    PubMed

    Waluk, Dominik P; Zur, Gila; Kaufmann, Ronnie; Welle, Monika M; Jagannathan, Vidhya; Drögemüller, Cord; Müller, Eliane J; Leeb, Tosso; Galichet, Arnaud

    2016-09-08

    X-linked hypohidrotic ectodermal dysplasia (XLHED) caused by variants in the EDA gene represents the most common ectodermal dysplasia in humans. We investigated three male mixed-breed dogs with an ectodermal dysplasia phenotype characterized by marked hypotrichosis and multifocal complete alopecia, almost complete absence of sweat and sebaceous glands, and altered dentition with missing and abnormally shaped teeth. Analysis of SNP chip genotypes and whole genome sequence data from the three affected dogs revealed that the affected dogs shared the same haplotype on a large segment of the X-chromosome, including the EDA gene. Unexpectedly, the whole genome sequence data did not reveal any nonsynonymous EDA variant in the affected dogs. We therefore performed an RNA-seq experiment on skin biopsies to search for changes in the transcriptome. This analysis revealed that the EDA transcript in the affected dogs lacked 103 nucleotides encoded by exon 2. We speculate that this exon skipping is caused by a genetic variant located in one of the large introns flanking this exon, which was missed by whole genome sequencing with the illumina short read technology. The altered EDA transcript splicing most likely causes the observed ectodermal dysplasia in the affected dogs. These dogs thus offer an excellent opportunity to gain insights into the complex splicing processes required for expression of the EDA gene, and other genes with large introns. Copyright © 2016 Waluk et al.

  2. ABCA4 midigenes reveal the full splice spectrum of all reported noncanonical splice site variants in Stargardt disease.

    PubMed

    Sangermano, Riccardo; Khan, Mubeen; Cornelis, Stéphanie S; Richelle, Valerie; Albert, Silvia; Garanto, Alejandro; Elmelik, Duaa; Qamar, Raheel; Lugtenberg, Dorien; van den Born, L Ingeborgh; Collin, Rob W J; Cremers, Frans P M

    2018-01-01

    Stargardt disease is caused by variants in the ABCA4 gene, a significant part of which are noncanonical splice site (NCSS) variants. In case a gene of interest is not expressed in available somatic cells, small genomic fragments carrying potential disease-associated variants are tested for splice abnormalities using in vitro splice assays. We recently discovered that when using small minigenes lacking the proper genomic context, in vitro results do not correlate with splice defects observed in patient cells. We therefore devised a novel strategy in which a bacterial artificial chromosome was employed to generate midigenes, splice vectors of varying lengths (up to 11.7 kb) covering almost the entire ABCA4 gene. These midigenes were used to analyze the effect of all 44 reported and three novel NCSS variants on ABCA4 pre-mRNA splicing. Intriguingly, multi-exon skipping events were observed, as well as exon elongation and intron retention. The analysis of all reported NCSS variants in ABCA4 allowed us to reveal the nature of aberrant splicing events and to classify the severity of these mutations based on the residual fraction of wild-type mRNA. Our strategy to generate large overlapping splice vectors carrying multiple exons, creating a toolbox for robust and high-throughput analysis of splice variants, can be applied to all human genes. © 2018 Sangermano et al.; Published by Cold Spring Harbor Laboratory Press.

  3. Tannic acid facilitates expression of the polypyrimidine tract binding protein and alleviates deleterious inclusion of CHRNA1 exon P3A due to an hnRNP H-disrupting mutation in congenital myasthenic syndrome

    PubMed Central

    Bian, Yang; Masuda, Akio; Matsuura, Tohru; Ito, Mikako; Okushin, Kazuya; Engel, Andrew G.; Ohno, Kinji

    2009-01-01

    We recently reported that the intronic splice-site mutation IVS3-8G>A of CHRNA1 that encodes the muscle nicotinic acetylcholine receptor α subunit disrupts binding of a splicing repressor, hnRNP H. This, in turn, results in exclusive inclusion of the downstream exon P3A. The P3A(+) transcript encodes a non-functional α subunit that comprises 50% of the transcripts in normal human skeletal muscle, but its functional significance remains undetermined. In an effort to search for a potential therapy, we screened off-label effects of 960 bioactive chemical compounds and found that tannic acid ameliorates the aberrant splicing due to IVS3-8G>A but without altering the expression of hnRNP H. Therefore, we searched for another splicing trans-factor. We found that the polypyrimidine tract binding protein (PTB) binds close to the 3′ end of CHRNA1 intron 3, that PTB induces skipping of exon P3A and that tannic acid increases the expression of PTB in a dose-dependent manner. Deletion assays of the PTB promoter region revealed that the tannic acid-responsive element is between positions −232 and −74 from the translation initiation site. These observations open the door to the discovery of novel therapies based on PTB overexpression and to detecting possible untoward effects of the overexpression. PMID:19147685

  4. [Observation on gene polymorphism of Rh blood group in Chinese Han nationality].

    PubMed

    Lan, Jiong-Cai; Wang, Cong-Rong; Wei, Ya-Ming; Zhou, Hua-You; Cao, Qiong; Zhang, Yin-Ze; Jiang, KuReXi; Wu, Da-Lin; Liu, Zhong

    2003-12-01

    To observe the gene polymorphism of Rh blood group in unrelated random individuals and families for Chinese Han nationality, polymerase chain reaction-sequence specific primer (PCR-SSP) was used to amplify the Rh C/E gene, RhD gene, exons, intron 2 and 10, insert and Rh Box in 160 blood samples of RhD positive unrelated individuals and 71 samples of RhD negative unrelated individuals and 7 samples of families whose probands were RhD-negative. The results showed that RhD genes of RhD-negative individuals with C antigens were polymorphism, three forms were found for D exon including intact, partial deletion and complete deletion exons. Insert fragments and Rh Box were found in most cases of families whose probands were RhD-negative and its inheritance accorded with the Mendel's Law, and it did not affect the expression of RhD gene. "Normal" RhD exon 4 amplifying product was not found in all of the samples. It was concluded that gene structure of the RhD-negative in Chinese was polymorphism, intact, partial deletion and complete deletion exons were found in the individuals with C antigen and probably existed specific D (nf) Ce haplotype. The function of insert was uncertain. The Rh gene sequences of Chinese Han nationality are different from those of Caucasian and the Rh gene library based on Han nationality should be established.

  5. An index-based algorithm for fast on-line query processing of latent semantic analysis

    PubMed Central

    Li, Pohan; Wang, Wei

    2017-01-01

    Latent Semantic Analysis (LSA) is widely used for finding the documents whose semantic is similar to the query of keywords. Although LSA yield promising similar results, the existing LSA algorithms involve lots of unnecessary operations in similarity computation and candidate check during on-line query processing, which is expensive in terms of time cost and cannot efficiently response the query request especially when the dataset becomes large. In this paper, we study the efficiency problem of on-line query processing for LSA towards efficiently searching the similar documents to a given query. We rewrite the similarity equation of LSA combined with an intermediate value called partial similarity that is stored in a designed index called partial index. For reducing the searching space, we give an approximate form of similarity equation, and then develop an efficient algorithm for building partial index, which skips the partial similarities lower than a given threshold θ. Based on partial index, we develop an efficient algorithm called ILSA for supporting fast on-line query processing. The given query is transformed into a pseudo document vector, and the similarities between query and candidate documents are computed by accumulating the partial similarities obtained from the index nodes corresponds to non-zero entries in the pseudo document vector. Compared to the LSA algorithm, ILSA reduces the time cost of on-line query processing by pruning the candidate documents that are not promising and skipping the operations that make little contribution to similarity scores. Extensive experiments through comparison with LSA have been done, which demonstrate the efficiency and effectiveness of our proposed algorithm. PMID:28520747

  6. An index-based algorithm for fast on-line query processing of latent semantic analysis.

    PubMed

    Zhang, Mingxi; Li, Pohan; Wang, Wei

    2017-01-01

    Latent Semantic Analysis (LSA) is widely used for finding the documents whose semantic is similar to the query of keywords. Although LSA yield promising similar results, the existing LSA algorithms involve lots of unnecessary operations in similarity computation and candidate check during on-line query processing, which is expensive in terms of time cost and cannot efficiently response the query request especially when the dataset becomes large. In this paper, we study the efficiency problem of on-line query processing for LSA towards efficiently searching the similar documents to a given query. We rewrite the similarity equation of LSA combined with an intermediate value called partial similarity that is stored in a designed index called partial index. For reducing the searching space, we give an approximate form of similarity equation, and then develop an efficient algorithm for building partial index, which skips the partial similarities lower than a given threshold θ. Based on partial index, we develop an efficient algorithm called ILSA for supporting fast on-line query processing. The given query is transformed into a pseudo document vector, and the similarities between query and candidate documents are computed by accumulating the partial similarities obtained from the index nodes corresponds to non-zero entries in the pseudo document vector. Compared to the LSA algorithm, ILSA reduces the time cost of on-line query processing by pruning the candidate documents that are not promising and skipping the operations that make little contribution to similarity scores. Extensive experiments through comparison with LSA have been done, which demonstrate the efficiency and effectiveness of our proposed algorithm.

  7. Early Clinical Diagnosis of PC1/3 Deficiency in a Patient With a Novel Homozygous PCSK1 Splice-Site Mutation.

    PubMed

    Härter, Bettina; Fuchs, Irene; Müller, Thomas; Akbulut, Ulas Emre; Cakir, Murat; Janecke, Andreas R

    2016-04-01

    Autosomal recessive proprotein convertase 1/3 (PC1/3) deficiency, caused by mutations in the PCSK1 gene, is characterized by severe congenital malabsorptive diarrhea, early-onset obesity, and certain endocrine abnormalities. We suspected PC1/3 deficiency in a 4-month-old girl based on the presence of congenital diarrhea and polyuria. Sequencing the whole coding region and splice sites detected a novel homozygous PCSK1 splice-site mutation, c.544-2A>G, in the patient. The mutation resulted in the skipping of exon 5, the generation of a premature termination codon, and nonsense-mediated PCSK1 messenger ribonucleic acid decay, which was demonstrated in complementary DNA derived from fibroblasts.

  8. Neonatal Marfan Syndrome: Report of a Case with an Inherited Splicing Mutation outside the Neonatal Domain

    PubMed Central

    Le Gloan, Laurianne; Hauet, Quentin; David, Albert; Hanna, Nadine; Arfeuille, Chloé; Arnaud, Pauline; Boileau, Catherine; Romefort, Bénédicte; Benbrik, Nadir; Gournay, Véronique; Joram, Nicolas; Baron, Olivier; Isidor, Bertrand

    2016-01-01

    We report a child and her mother affected by Marfan syndrome. The child presented with a phenotype of neonatal Marfan syndrome, revealed by acute and refractory heart failure, finally leading to death within the first 4 months of life. Her mother had a common clinical presentation. Genetic analysis revealed an inherited FBN1 mutation. This intronic mutation (c.6163+3_6163+6del), undescribed to date, leads to exon 49 skipping, corresponding to in-frame deletion of 42 amino acids (p.Ile2014_Asp2055del). FBN1 next-generation sequencing did not show any argument for mosaicism. Association in the same family of severe neonatal and classical Marfan syndrome illustrates the intrafamilial phenotype variability. PMID:27022329

  9. Neonatal Marfan Syndrome: Report of a Case with an Inherited Splicing Mutation outside the Neonatal Domain.

    PubMed

    Le Gloan, Laurianne; Hauet, Quentin; David, Albert; Hanna, Nadine; Arfeuille, Chloé; Arnaud, Pauline; Boileau, Catherine; Romefort, Bénédicte; Benbrik, Nadir; Gournay, Véronique; Joram, Nicolas; Baron, Olivier; Isidor, Bertrand

    2016-02-01

    We report a child and her mother affected by Marfan syndrome. The child presented with a phenotype of neonatal Marfan syndrome, revealed by acute and refractory heart failure, finally leading to death within the first 4 months of life. Her mother had a common clinical presentation. Genetic analysis revealed an inherited FBN1 mutation. This intronic mutation (c.6163+3_6163+6del), undescribed to date, leads to exon 49 skipping, corresponding to in-frame deletion of 42 amino acids (p.Ile2014_Asp2055del). FBN1 next-generation sequencing did not show any argument for mosaicism. Association in the same family of severe neonatal and classical Marfan syndrome illustrates the intrafamilial phenotype variability.

  10. The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing.

    PubMed

    Makeyev, Eugene V; Zhang, Jiangwen; Carrasco, Monica A; Maniatis, Tom

    2007-08-03

    Both microRNAs and alternative pre-mRNA splicing have been implicated in the development of the nervous system (NS), but functional interactions between these two pathways are poorly understood. We demonstrate that the neuron-specific microRNA miR-124 directly targets PTBP1 (PTB/hnRNP I) mRNA, which encodes a global repressor of alternative pre-mRNA splicing in nonneuronal cells. Among the targets of PTBP1 is a critical cassette exon in the pre-mRNA of PTBP2 (nPTB/brPTB/PTBLP), an NS-enriched PTBP1 homolog. When this exon is skipped, PTBP2 mRNA is subject to nonsense-mediated decay (NMD). During neuronal differentiation, miR-124 reduces PTBP1 levels, leading to the accumulation of correctly spliced PTBP2 mRNA and a dramatic increase in PTBP2 protein. These events culminate in the transition from non-NS to NS-specific alternative splicing patterns. We also present evidence that miR-124 plays a key role in the differentiation of progenitor cells to mature neurons. Thus, miR-124 promotes NS development, at least in part by regulating an intricate network of NS-specific alternative splicing.

  11. Becker muscular dystrophy due to an intronic splicing mutation inducing a dual dystrophin transcript.

    PubMed

    Todeschini, Alice; Gualandi, Francesca; Trabanelli, Cecilia; Armaroli, Annarita; Ravani, Anna; Fanin, Marina; Rota, Silvia; Bello, Luca; Ferlini, Alessandra; Pegoraro, Elena; Padovani, Alessandro; Filosto, Massimiliano

    2016-10-01

    We describe a 29-year-old patient who complained of left thigh muscle weakness since he was 23 and of moderate proximal weakness of both lower limbs with difficulty in climbing stairs and running since he was 27. Mild weakness of iliopsoas and quadriceps muscles and muscle atrophy of both the distal forearm and thigh were observed upon clinical examination. He harboured a novel c.1150-3C>G substitution in the DMD gene, affecting the intron 10 acceptor splice site and causing exon 11 skipping and an out-of-frame transcript. However, protein of normal molecular weight but in reduced amounts was observed on Western Blot analysis. Reverse transcription analysis on muscle RNA showed production, via alternative splicing, of a transcript missing exon 11 as well as a low abundant full-length transcript which is enough to avoid the severe Duchenne phenotype. Our study showed that a reduced amount of full length dystrophin leads to a mild form of Becker muscular dystrophy. These results confirm earlier findings that low amounts of dystrophin can be associated with a milder phenotype, which is promising for therapies aiming at dystrophin restoration. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Correlating In Vitro Splice Switching Activity With Systemic In Vivo Delivery Using Novel ZEN-modified Oligonucleotides.

    PubMed

    Hammond, Suzan M; McClorey, Graham; Nordin, Joel Z; Godfrey, Caroline; Stenler, Sofia; Lennox, Kim A; Smith, C I Edvard; Jacobi, Ashley M; Varela, Miguel A; Lee, Yi; Behlke, Mark A; Wood, Matthew J A; Andaloussi, Samir E L

    2014-11-25

    Splice switching oligonucleotides (SSOs) induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, "ZEN™") to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2'-O-methyl (2'OMe) oligonucleotide, increasing melting temperature and potency over unmodified 2'OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2'OMe phosphorothioate (PS) oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2'OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized.

  13. Novel Nine-Exon AR Transcripts (Exon 1/Exon 1b/Exons 2–8) in Normal and Cancerous Breast and Prostate Cells

    PubMed Central

    Hu, Dong Gui; McKinnon, Ross A.; Hulin, Julie-Ann; Mackenzie, Peter I.; Meech, Robyn

    2016-01-01

    Nearly 20 different transcripts of the human androgen receptor (AR) are reported with two currently listed as Refseq isoforms in the NCBI database. Isoform 1 encodes wild-type AR (type 1 AR) and isoform 2 encodes the variant AR45 (type 2 AR). Both variants contain eight exons: they share common exons 2–8 but differ in exon 1 with the canonical exon 1 in isoform 1 and the variant exon 1b in isoform 2. Splicing of exon 1 or exon 1b is reported to be mutually exclusive. In this study, we identified a novel exon 1b (1b/TAG) that contains an additional TAG trinucleotide upstream of exon 1b. Moreover, we identified AR transcripts in both normal and cancerous breast and prostate cells that contained either exon 1b or 1b/TAG spliced between the canonical exon 1 and exon 2, generating nine-exon AR transcripts that we have named isoforms 3a and 3b. The proteins encoded by these new AR variants could regulate androgen-responsive reporters in breast and prostate cancer cells under androgen-depleted conditions. Analysis of type 3 AR-GFP fusion proteins showed partial nuclear localization in PC3 cells under androgen-depleted conditions, supporting androgen-independent activation of the AR. Type 3 AR proteins inhibited androgen-induced growth of LNCaP cells. Microarray analysis identified a small set of type 3a AR target genes in LNCaP cells, including genes known to modulate growth and proliferation of prostate cancer (PCGEM1, PEG3, EPHA3, and EFNB2) or other types of human cancers (TOX3, ST8SIA4, and SLITRK3), and genes that are diagnostic/prognostic biomarkers of prostate cancer (GRINA3, and BCHE). PMID:28035996

  14. Comprehensive analysis of pyrimidine metabolism in 450 children with unspecific neurological symptoms using high-pressure liquid chromatography-electrospray ionization tandem mass spectrometry.

    PubMed

    Schmidt, C; Hofmann, U; Kohlmüller, D; Mürdter, T; Zanger, U M; Schwab, M; Hoffmann, G F

    2005-01-01

    To evaluate the significance of inborn metabolic disorders of the pyrimidine degradation pathway, 450 children with unspecific neurological symptoms were comprehensively studied; 200 healthy children were recruited as controls. Uracil and thymine as well as their degradation products in urine were determined with an improved method based on reversed-phase HPLC coupled with electrospray ionization tandem mass spectrometry and detection by multiple-reaction monitoring using stable-isotope-labelled reference compounds as internal standards. From the results of the control group we established age-related reference ranges of all pyrimidine degradation products. In the patient group, two children with dihydropyrimidine dehydrogenase (DPYD) deficiency were identified; one of these was homozygous for the exon 14-skipping mutation of the DPYD gene. In addition, two patients with high uracil, dihydrouracil and beta-ureidopropionate were found to have ornithine transcarbamylase deficiency. In the urine of 9 patients, beta-alanine was markedly elevated owing to treatment with vigabatrin, an irreversible inhibitor of GABA transaminase, which interferes with beta-alanine breakdown. Four patients had exclusively high levels of beta-aminoisobutyrate (beta-AIB) due to a low activity of the D-beta-AIB-pyruvate aminotransferase, probably without clinical significance. In conclusion, quantitative investigation of pyrimidine metabolites in children with unexplained neurological symptoms, particularly epileptic seizures with or without psychomotor retardation, can be recommended as a helpful tool for diagnosis in clinical practice. Sensitive methods and age-related reference ranges enable the detection of partial enzyme deficiencies.

  15. Circular RNAs in Cancer – Lessons Learned From microRNAs

    PubMed Central

    Dragomir, Mihnea; Calin, George A.

    2018-01-01

    Circular RNAs (circRNA) are RNA molecules built from fragments of linear pre-messenger RNAs and other linear RNA species through a process termed “back-splicing” in which the 3′ and 5′ ends are joined together giving rise to a covalently uninterrupted loop. circRNAs are not new members of the RNA world; they were first discovered in the early 1990s. The novelty is their abundance in the mammalian cells, as recently thousands of circRNAs were discovered and annotated. The biogenesis of circRNAs is a partially characterized process, regulated by three different mechanisms: exon skipping, intron pairing, and RNA-binding proteins. On the other hand, the function of circRNAs remains largely unknown and only a handful of singular reports describe in detail the biological roles of some circular transcripts. In a very short period of time, numerous circRNAs were associated with various cancer types and were also identified in bodily fluids with the potential of being disease-specific biomarkers. In this review, we briefly describe the biogenesis and function of circRNAs and present the circular transcripts that were more than once reported in literature to be associated with cancer. Finally, we point out some of the difficulties encountered in the study of circRNAs in cancer, as we consider that taking these into account could accelerate and improve our understanding of the biologic and translational use of circRNAs in human diseases. PMID:29911069

  16. Targeting HER2 aberrations as actionable drivers in lung cancers: phase II trial of the pan-HER tyrosine kinase inhibitor dacomitinib in patients with HER2-mutant or amplified tumors

    PubMed Central

    Kris, M. G.; Camidge, D. R.; Giaccone, G.; Hida, T.; Li, B. T.; O'Connell, J.; Taylor, I.; Zhang, H.; Arcila, M. E.; Goldberg, Z.; Jänne, P. A.

    2015-01-01

    Background HER2 mutations and amplifications have been identified as oncogenic drivers in lung cancers. Dacomitinib, an irreversible inhibitor of HER2, EGFR (HER1), and HER4 tyrosine kinases, has demonstrated activity in cell-line models with HER2 exon 20 insertions or amplifications. Here, we studied dacomitinib in patients with HER2-mutant or amplified lung cancers. Patients and methods As a prespecified cohort of a phase II study, we included patients with stage IIIB/IV lung cancers with HER2 mutations or amplification. We gave oral dacomitinib at 30–45 mg daily in 28-day cycles. End points included partial response rate, overall survival, and toxicity. Results We enrolled 30 patients with HER2-mutant (n = 26, all in exon 20 including 25 insertions and 1 missense mutation) or HER2-amplified lung cancers (n = 4). Three of 26 patients with tumors harboring HER2 exon 20 mutations [12%; 95% confidence interval (CI) 2% to 30%] had partial responses lasting 3+, 11, and 14 months. No partial responses occurred in four patients with tumors with HER2 amplifications. The median overall survival was 9 months from the start of dacomitinib (95% CI 7–21 months) for patients with HER2 mutations and ranged from 5 to 22 months with amplifications. Treatment-related toxicities included diarrhea (90%; grade 3/4: 20%/3%), dermatitis (73%; grade 3/4: 3%/0%), and fatigue (57%; grade 3/4: 3%/0%). One patient died on study likely due to an interaction of dacomitinib with mirtazapine. Conclusions Dacomitinib produced objective responses in patients with lung cancers with specific HER2 exon 20 insertions. This observation validates HER2 exon 20 insertions as actionable targets and justifies further study of HER2-targeted agents in specific HER2-driven lung cancers. ClinicalTrials.gov NCT00818441. PMID:25899785

  17. DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

    PubMed

    Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

    2006-02-01

    Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

  18. Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene

    PubMed Central

    Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

    2014-01-01

    Introduction: Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (< 8 g/L) and severe clinical symptoms. Materials and methods: The albumin gene of the index case was screened by single-strand conformation polymorphism, heteroduplex analysis, and direct DNA sequencing. The effect of the splicing mutation was evaluated by examining the cDNA obtained by reverse transcriptase - polymerase chain reaction (RT-PCR) from the albumin mRNA extracted from proband’s leukocytes. Results: DNA sequencing revealed that the proband is homozygous, and both parents are heterozygous, for a novel G>A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5′ splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Conclusions: Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia. PMID:24627724

  19. Infertility due to congenital absence of vas deferens in mainly caused by variable exon 9 skipping of the CFTR gene in heterozygous males for cystic fibrosis mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chillon, M.; Casals, T.; Nunes, V.

    1994-09-01

    About 65% or the individuals with congenital bilateral absence of the vas deferens (CBAVD) have mutations in at least one of the CFTR alleles. We have studied the phenotypic effects of the CFTR gene intron 8 polyT tract 5T allele in 90 CBAVD subjects and in parents of CF patients. This group was compared with normal individuals, and with fathers and mothers of CF patients. Allele 5T was significantly associated with CBAVD (19.6%) when compared to the general population (5.2%) ({chi}{sup 2} = 33.3%; p<<0.0001). It was represented poorly in fathers of CF patients (1.3%). Mutations were identified in onemore » (60%) or both CFTR alleles (8.9%) of CBAVD patients. Heterozygosity for the 5T allele was strongly associated with heterozygosity for CF mutations ({chi}{sup 2} = 10.9; p<0.0004). The strong correlation between allele 5T and CBAVD, together with the low frequency of this allele in fathers of CF patients, demonstrates that variable {Delta}exon 9 produces infertility in males if associated with a CF mutation on the other chromosome. The 30% of CBAVD cases with only one CFTR mutation and without a 5T-allele may be due to other molecular mechanisms involving CFTR, distinct from {Delta}exon 9. Since there is a relatively high proportion of CBAVD without CF mutations (25%), other gene(s), distinct from CFTR, may have a role in the CBAVD phenotype.« less

  20. Splicing-related single nucleotide polymorphism of RAB, member of RAS oncogene family like 2B (RABL2B) jeopardises semen quality in Chinese Holstein bulls.

    PubMed

    Wang, Xiuge; Cui, Xiaohui; Zhang, Yan; Hao, Haisheng; Ju, Zhihua; Liu, Deyu; Jiang, Qiang; Yang, Chunhong; Sun, Yan; Wang, Changfa; Huang, Jinming; Zhu, Huabin

    2017-11-01

    RAB, member of RAS oncogene family like 2B (RABL2B) is a member of a poorly characterised clade of the RAS GTPase superfamily, which plays an essential role in male fertility, sperm intraflagellar transport and tail assembly. In the present study, we identified a novel RABL2B splice variant in bovine testis and spermatozoa. This splice variant, designated RABL2B-TV, is characterised by exon 2 skipping. Moreover, a single nucleotide polymorphism (SNP), namely c.125G>A, was found within the exonic splicing enhancer (ESE) motif, indicating that the SNP caused the production of the RABL2B-TV aberrant splice variant. This was demonstrated by constructing a pSPL3 exon capturing vector with different genotypes and transfecting these vectors into murine Leydig tumour cell line (MLTC-1) cells. Expression of the RABL2B-TV transcript was lower in semen from high- versus low-performance bulls. Association analysis showed that sperm deformity rate was significantly lower in Chinese Holstein bulls with the GG or GA genotype than in bulls with the AA genotype (P<0.05). In addition, initial sperm motility was significantly higher in individuals with the GG or GA genotype than in individuals with the AA genotype (P<0.05). The findings of the present study suggest that the difference in semen quality in bulls with different RABL2B genotypes is generated via an alternative splicing mechanism caused by a functional SNP within the ESE motif.

  1. A novel ALMS1 splice mutation in a non-obese juvenile-onset insulin-dependent syndromic diabetic patient

    PubMed Central

    Sanyoura, May; Woudstra, Cédric; Halaby, George; Baz, Patrick; Senée, Valérie; Guillausseau, Pierre-Jean; Zalloua, Pierre; Julier, Cécile

    2014-01-01

    Insulin-dependent juvenile-onset diabetes may occur in the context of rare syndromic presentations suggesting monogenic inheritance rather than common multifactorial autoimmune type 1 diabetes. Here, we report the case of a Lebanese patient diagnosed with juvenile-onset insulin-dependent diabetes presenting ketoacidosis, early-onset retinopathy with optic atrophy, hearing loss, diabetes insipidus, epilepsy, and normal weight and stature, who later developed insulin resistance. Despite similarities with Wolfram syndrome, we excluded the WFS1 gene as responsible for this disease. Using combined linkage and candidate gene study, we selected ALMS1, responsible for Alström syndrome, as a candidate gene. We identified a novel splice mutation in intron 18 located 3 bp before the intron–exon junction (IVS18-3T>G), resulting in exon 19 skipping and consequent frameshift generating a truncated protein (V3958fs3964X). The clinical presentation of the patient significantly differed from typical Alström syndrome by the absence of truncal obesity and short stature, and by the presence of ketoacidotic insulin-dependent diabetes, optic atrophy and diabetes insipidus. Our observation broadens the clinical spectrum of Alström syndrome and suggests that ALMS1 mutations may be considered in patients who initially present with an acute onset of insulin-dependent diabetes. PMID:23652376

  2. Human Splicing Finder: an online bioinformatics tool to predict splicing signals.

    PubMed

    Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

    2009-05-01

    Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-beta Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5' and 3' splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project.

  3. Human Splicing Finder: an online bioinformatics tool to predict splicing signals

    PubMed Central

    Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

    2009-01-01

    Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-β Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5′ and 3′ splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project. PMID:19339519

  4. ISS-N1 makes the First FDA-approved Drug for Spinal Muscular Atrophy

    PubMed Central

    Ottesen, Eric W.

    2017-01-01

    Abstract Spinal muscular atrophy (SMA) is one of the leading genetic diseases of children and infants. SMA is caused by deletions or mutations of Survival Motor Neuron 1 (SMN1) gene. SMN2, a nearly identical copy of SMN1, cannot compensate for the loss of SMN1 due to predominant skipping of exon 7. While various regulatory elements that modulate SMN2 exon 7 splicing have been proposed, intronic splicing silencer N1 (ISS-N1) has emerged as the most promising target thus far for antisense oligonucleotide-mediated splicing correction in SMA. Upon procuring exclusive license from the University of Massachussets Medical School in 2010, Ionis Pharmaceuticals (formerly ISIS Pharamaceuticals) began clinical development of Spinraza™ (synonyms: Nusinersen, IONIS-SMNRX, ISIS-SMNRX), an antisense drug based on ISS-N1 target. Spinraza™ showed very promising results at all steps of the clinical development and was approved by US Food and Drug Administration (FDA) on December 23, 2016. Spinraza™ is the first FDA-approved treatment for SMA and the first antisense drug to restore expression of a fully functional protein via splicing correction. The success of Spinraza™ underscores the potential of intronic sequences as promising therapeutic targets and sets the stage for further improvement of antisense drugs based on advanced oligonucleotide chemistries and delivery protocols. PMID:28400976

  5. The MicroRNA miR-124 Promotes Neuronal Differentiation by Triggering Brain-Specific Alternative Pre-mRNA Splicing

    PubMed Central

    Makeyev, Eugene V.; Zhang, Jiangwen; Carrasco, Monica A.; Maniatis, Tom

    2011-01-01

    SUMMARY Both microRNAs and alternative pre-mRNA splicing have been implicated in the development of the nervous system (NS), but functional interactions between these two pathways are poorly understood. We demonstrate that the neuron-specific microRNA miR-124 directly targets PTBP1 (PTB/hnRNP I) mRNA, which encodes a global repressor of alternative pre-mRNA splicing in nonneuronal cells. Among the targets of PTBP1 is a critical cassette exon in the pre-mRNA of PTBP2 (nPTB/brPTB/PTBLP), an NS-enriched PTBP1 homolog. When this exon is skipped, PTBP2 mRNA is subject to nonsense-mediated decay (NMD). During neuronal differentiation, miR-124 reduces PTBP1 levels, leading to the accumulation of correctly spliced PTBP2 mRNA and a dramatic increase in PTBP2 protein. These events culminate in the transition from non-NS to NS-specific alternative splicing patterns. We also present evidence that miR-124 plays a key role in the differentiation of progenitor cells to mature neurons. Thus, miR-124 promotes NS development, at least in part by regulating an intricate network of NS-specific alternative splicing. PMID:17679093

  6. Cationic PMMA nanoparticles bind and deliver antisense oligoribonucleotides allowing restoration of dystrophin expression in the mdx mouse.

    PubMed

    Rimessi, Paola; Sabatelli, Patrizia; Fabris, Marina; Braghetta, Paola; Bassi, Elena; Spitali, Pietro; Vattemi, Gaetano; Tomelleri, Giuliano; Mari, Lara; Perrone, Daniela; Medici, Alessandro; Neri, Marcella; Bovolenta, Matteo; Martoni, Elena; Maraldi, Nadir M; Gualandi, Francesca; Merlini, Luciano; Ballestri, Marco; Tondelli, Luisa; Sparnacci, Katia; Bonaldo, Paolo; Caputo, Antonella; Laus, Michele; Ferlini, Alessandra

    2009-05-01

    For subsets of Duchenne muscular dystrophy (DMD) mutations, antisense oligoribonucleotide (AON)-mediated exon skipping has proven to be efficacious in restoring the expression of dystrophin protein. In the mdx murine model systemic delivery of AON, recognizing the splice donor of dystrophin exon 23, has shown proof of concept. Here, we show that using cationic polymethylmethacrylate (PMMA) (marked as T1) nanoparticles loaded with a low dose of 2'-O-methyl-phosphorothioate (2'OMePS) AON delivered by weekly intraperitoneal (IP) injection (0.9 mg/kg/week), could restore dystrophin expression in body-wide striated muscles. Delivery of an identical dose of naked AON did not result in detectable dystrophin expression. Transcription, western, and immunohistochemical analysis showed increased levels of dystrophin transcript and protein, and correct localization at the sarcolemma. This study shows that T1 nanoparticles have the capacity to bind and convoy AONs in body-wide muscle tissues and to reduce the dose required for dystrophin rescue. By immunofluorescence and electron microscopy studies, we highlighted the diffusion pathways of this compound. This nonviral approach may valuably improve the therapeutic usage of AONs in DMD as well as the delivery of RNA molecules with many implications in both basic research and medicine.

  7. The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

    1994-12-31

    Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

  8. A more accurate detection of codon 72 polymorphism and LOH of the TP53 gene.

    PubMed

    Baccouche, Sami; Mabrouk, Imed; Said, Salem; Mosbah, Ali; Jlidi, Rachid; Gargouri, Ali

    2003-01-10

    The polymorphism at codon 72 of the TP53 gene has been extensively studied for its involvement in cancerogenesis and loss of heterozygosity (LOH) detection. Usually, the exon 4 of the TP53 gene is amplified by polymerase chain reaction (PCR) on DNA extracted from blood and tumor tissues, then digested by AccII. In the case of heterozygosity, the comparison of AccII profile from blood and tumor DNA PCR products allowed the identification of a potential LOH in the TP53 locus. This method can be hindered by a partial AccII digestion and/or DNA contamination of non-tumor cells. To circumvent these problems, we have developed a new approach by using the AccII restriction site between exon 4 and exon 6. The PCR amplification of exon 4-6, followed by AccII digestion allowed us to detect without ambiguity any LOH case.

  9. Splicing analysis for exonic and intronic mismatch repair gene variants associated with Lynch syndrome confirms high concordance between minigene assays and patient RNA analyses

    PubMed Central

    van der Klift, Heleen M; Jansen, Anne M L; van der Steenstraten, Niki; Bik, Elsa C; Tops, Carli M J; Devilee, Peter; Wijnen, Juul T

    2015-01-01

    A subset of DNA variants causes genetic disease through aberrant splicing. Experimental splicing assays, either RT-PCR analyses of patient RNA or functional splicing reporter minigene assays, are required to evaluate the molecular nature of the splice defect. Here, we present minigene assays performed for 17 variants in the consensus splice site regions, 14 exonic variants outside these regions, and two deep intronic variants, all in the DNA mismatch-repair (MMR) genes MLH1, MSH2, MSH6, and PMS2, associated with Lynch syndrome. We also included two deep intronic variants in APC and PKD2. For one variant (MLH1 c.122A>G), our minigene assay and patient RNA analysis could not confirm the previously reported aberrant splicing. The aim of our study was to further investigate the concordance between minigene splicing assays and patient RNA analyses. For 30 variants results from patient RNA analyses were available, either performed by our laboratory or presented in literature. Some variants were deliberately included in this study because they resulted in multiple aberrant transcripts in patient RNA analysis, or caused a splice effect other than the prevalent exon skip. While both methods were completely concordant in the assessment of splice effects, four variants exhibited major differences in aberrant splice patterns. Based on the present and earlier studies, together showing an almost 100% concordance of minigene assays with patient RNA analyses, we discuss the weight given to minigene splicing assays in the current criteria proposed by InSiGHT for clinical classification of MMR variants. PMID:26247049

  10. Effects of PTCs on nonsense-mediated mRNA decay are dependent on PTC location.

    PubMed

    Moon, Heegyum; Zheng, Xuexiu; Loh, Tiing Jen; Jang, Ha Na; Liu, Yongchao; Jung, Da-Woon; Williams, Darren R; Shen, Haihong

    2017-03-01

    The récepteur d'origine nantais (RON) gene is a proto-oncogene that is responsible for encoding the human macrophage-stimulating protein (MSP) 1 receptor. MSP activation induces RON-mediated cell dissociation, migration and matrix invasion. Isoforms of RON that exclude exons 5 and 6 encode the RONΔ160 protein, which promotes cell transformation in vitro and tumor metastasis in vivo . Premature termination codons (PTCs) in exons activate the nonsense-mediated mRNA decay (NMD) signaling pathway. The present study demonstrated that PTCs at various locations in the alternative exons 5 and 6 could induce NMD of the majority of the spliced, or partially spliced, isoforms. However, the isoforms that excluded exon 6 or exons 5 and 6 were markedly increased when produced from mutated minigenes with inserted PTCs. Furthermore, the unspliced isoform of intron 5 was not observed to be decreased by the presence of PTCs. Notably, these effects may be dependent on the location of the PTCs. The current study demonstrated a novel mechanism underlying the regulation of NMD in alternative splicing.

  11. Interaction of the Transcription Start Site Core Region and Transcription Factor YY1 Determine Ascorbate Transporter SVCT2 Exon 1a Promoter Activity

    PubMed Central

    Qiao, Huan; May, James M.

    2012-01-01

    Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872

  12. ACTG: novel peptide mapping onto gene models.

    PubMed

    Choi, Seunghyuk; Kim, Hyunwoo; Paek, Eunok

    2017-04-15

    In many proteogenomic applications, mapping peptide sequences onto genome sequences can be very useful, because it allows us to understand origins of the gene products. Existing software tools either take the genomic position of a peptide start site as an input or assume that the peptide sequence exactly matches the coding sequence of a given gene model. In case of novel peptides resulting from genomic variations, especially structural variations such as alternative splicing, these existing tools cannot be directly applied unless users supply information about the variant, either its genomic position or its transcription model. Mapping potentially novel peptides to genome sequences, while allowing certain genomic variations, requires introducing novel gene models when aligning peptide sequences to gene structures. We have developed a new tool called ACTG (Amino aCids To Genome), which maps peptides to genome, assuming all possible single exon skipping, junction variation allowing three edit distances from the original splice sites, exon extension and frame shift. In addition, it can also consider SNVs (single nucleotide variations) during mapping phase if a user provides the VCF (variant call format) file as an input. Available at http://prix.hanyang.ac.kr/ACTG/search.jsp . eunokpaek@hanyang.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  13. A novel heterozygous intronic mutation in POU1F1 is associated with combined pituitary hormone deficiency.

    PubMed

    Takagi, Masaki; Kamasaki, Hotaka; Yagi, Hiroko; Fukuzawa, Ryuji; Narumi, Satoshi; Hasegawa, Tomonobu

    2017-02-27

    POU class 1 homeobox 1 (POU1F1) regulates pituitary cell-specific gene expression of somatotropes, lactotropes, and thyrotropes. In humans, two POU1F1 isoforms (long and short isoform), which are generated by the alternative use of the splice acceptor site for exon 2, have been identified. To date, more than 30 POU1F1 mutations in patients with combined pituitary hormone deficiency (CPHD) have been described. All POU1F1 variants reported to date affect both the short and long isoforms of the POU1F1 protein; therefore, it is unclear at present whether a decrease in the function of only one of these two isoforms is sufficient for disease onset in humans. Here, we described a sibling case of CPHD carrying a heterozygous mutation in intron 1 of POU1F1. In vitro experiments showed that this mutation resulted in exon 2-skipping of only in the short isoform of POU1F1, while the long isoform remained intact. This result strongly suggests the possibility, for the first time, that isolated mutations in the short isoform of POU1F1 could be sufficient for induction of POU1F1-related CPHD. This finding improves our understanding of the molecular mechanisms, and developmental course associated with mutations in POU1F1.

  14. ISS-N1 makes the First FDA-approved Drug for Spinal Muscular Atrophy.

    PubMed

    Ottesen, Eric W

    2017-01-01

    Spinal muscular atrophy (SMA) is one of the leading genetic diseases of children and infants. SMA is caused by deletions or mutations of Survival Motor Neuron 1 ( SMN1 ) gene. SMN2 , a nearly identical copy of SMN1 , cannot compensate for the loss of SMN1 due to predominant skipping of exon 7. While various regulatory elements that modulate SMN2 exon 7 splicing have been proposed, intronic splicing silencer N1 (ISS-N1) has emerged as the most promising target thus far for antisense oligonucleotide-mediated splicing correction in SMA. Upon procuring exclusive license from the University of Massachussets Medical School in 2010, Ionis Pharmaceuticals (formerly ISIS Pharamaceuticals) began clinical development of Spinraza ™ (synonyms: Nusinersen, IONIS-SMN RX , ISIS-SMN RX ), an antisense drug based on ISS-N1 target. Spinraza ™ showed very promising results at all steps of the clinical development and was approved by US Food and Drug Administration (FDA) on December 23, 2016. Spinraza ™ is the first FDA-approved treatment for SMA and the first antisense drug to restore expression of a fully functional protein via splicing correction. The success of Spinraza ™ underscores the potential of intronic sequences as promising therapeutic targets and sets the stage for further improvement of antisense drugs based on advanced oligonucleotide chemistries and delivery protocols.

  15. Repair of pre-mRNA splicing

    PubMed Central

    Nlend, Rachel Nlend; Meyer, Kathrin

    2010-01-01

    Recent analyses of complete genomes have revealed that alternative splicing became more prevalent and important during eukaryotic evolution. Alternative splicing augments the protein repertoire—particularly that of the human genome—and plays an important role in the development and function of differentiated cell types. However, splicing is also extremely vulnerable, and defects in the proper recognition of splicing signals can give rise to a variety of diseases. In this review, we discuss splicing correction therapies, by using the inherited disease Spinal Muscular Atrophy (SMA) as an example. This lethal early childhood disorder is caused by deletions or other severe mutations of SMN1, a gene coding for the essential survival of motoneurons protein. A second gene copy present in humans and few non-human primates, SMN2, can only partly compensate for the defect because of a single nucleotide change in exon 7 that causes this exon to be skipped in the majority of mRNAs. Thus SMN2 is a prime therapeutic target for SMA. In recent years, several strategies based on small molecule drugs, antisense oligonucleotides or in vivo expressed RNAs have been developed that allow a correction of SMN2 splicing. For some of these, a therapeutic benefit has been demonstrated in mouse models for SMA. This means that clinical trials of such splicing therapies for SMA may become possible in the near future. PMID:20523126

  16. X-exome sequencing identifies a HDAC8 variant in a large pedigree with X-linked intellectual disability, truncal obesity, gynaecomastia, hypogonadism and unusual face.

    PubMed

    Harakalova, Magdalena; van den Boogaard, Marie-Jose; Sinke, Richard; van Lieshout, Stef; van Tuil, Marc C; Duran, Karen; Renkens, Ivo; Terhal, Paulien A; de Kovel, Carolien; Nijman, Ies J; van Haelst, Mieke; Knoers, Nine V A M; van Haaften, Gijs; Kloosterman, Wigard; Hennekam, Raoul C M; Cuppen, Edwin; Ploos van Amstel, Hans Kristian

    2012-08-01

    We present a large Dutch family with seven males affected by a novel syndrome of X-linked intellectual disability, hypogonadism, gynaecomastia, truncal obesity, short stature and recognisable craniofacial manifestations resembling but not identical to Wilson-Turner syndrome. Seven female relatives show a much milder expression of the phenotype. We performed X chromosome exome (X-exome) sequencing in five individuals from this family and identified a novel intronic variant in the histone deacetylase 8 gene (HDAC8), c.164+5G>A, which disturbs the normal splicing of exon 2 resulting in exon skipping, and introduces a premature stop at the beginning of the histone deacetylase catalytic domain. The identified variant completely segregates in this family and was absent in 96 Dutch controls and available databases. Affected female carriers showed a notably skewed X-inactivation pattern in lymphocytes in which the mutated X-chromosome was completely inactivated. HDAC8 is a member of the protein family of histone deacetylases that play a major role in epigenetic gene silencing during development. HDAC8 specifically controls the patterning of the skull with the mouse HDAC8 knock-out showing craniofacial deformities of the skull. The present family provides the first evidence for involvement of HDAC8 in a syndromic form of intellectual disability.

  17. Mutations and new polymorphic changes in the TCOF1 gene of patients with oculo-auriculo-vertebral spectrum and Treacher-Collins syndrome.

    PubMed

    Su, Pen-Hua; Yu, Ju-Shan; Chen, Jia-Yuh; Chen, Suh-Jen; Li, Shuan-Yow; Chen, Hsiao-Neng

    2007-10-01

    Oculo-auriculo-vertebral spectrum, the exact genetic predisposition of which has not yet been resolved, is characterized by varying degrees of the prevalently unilateral underdevelopment of craniofacial structures and spinal anomalies. Here, we analyzed four cases exhibiting multiple features of oculo-auriculo-vertebral spectrum and one case with Treacher-Collins syndrome. The cranium was analyzed using three-dimensional computed tomography, which reliably identifies craniofacial malformations. We detected one typical oculo-auriculo-vertebral spectrum patient who had a missense mutation in exon 9 of the TCOF1 gene complex and two silent mutations in exons 10 and 23, three partial oculo-auriculo-vertebral spectrum patients who had no detectable mutations in the TCOF1 gene complex, and one Treacher-Collins syndrome patient who had a nonsense mutation in exon 14. All five patients had eight previously reported polymorphic changes in the TCOF1 exons 10, 11, 12, 16, 21, 22, and 23, and four unreported polymorphisms in exons 9, 17, and 22 that were also detected in 51 Taiwanese control patients. These observations strongly suggest that the TCOF1 genetic changes observed in these five patients might be related to oculo-auriculo-vertebral spectrum symptoms.

  18. An Overview of Recent Therapeutics Advances for Duchenne Muscular Dystrophy.

    PubMed

    Mah, Jean K

    2018-01-01

    Duchenne muscular dystrophy (DMD) is the most common form of muscular dystrophy in childhood. Mutations of the DMD gene destabilize the dystrophin associated glycoprotein complex in the sarcolemma. Ongoing mechanical stress leads to unregulated influx of calcium ions into the sarcoplasm, with activation of proteases, release of proinflammatory cytokines, and mitochondrial dysfunction. Cumulative damage and reparative failure leads to progressive muscle necrosis, fibrosis, and fatty replacement. Although there is presently no cure for DMD, scientific advances have led to many potential disease-modifying treatments, including dystrophin replacement therapies, upregulation of compensatory proteins, anti-inflammatory agents, and other cellular targets. Recently approved therapies include ataluren for stop codon read-through and eteplirsen for exon 51 skipping of eligible individuals. The purpose of this chapter is to summarize the clinical features of DMD, to describe current outcome measures used in clinical studies, and to highlight new emerging therapies for affected individuals.

  19. New approaches to the treatment of orphan genetic disorders: Mitigating molecular pathologies using chemicals.

    PubMed

    Velho, Renata V; Sperb-Ludwig, Fernanda; Schwartz, Ida V D

    2015-08-01

    With the advance and popularization of molecular techniques, the identification of genetic mutations that cause diseases has increased dramatically. Thus, the number of laboratories available to investigate a given disorder and the number of subsequent diagnosis have increased over time. Although it is necessary to identify mutations and provide diagnosis, it is also critical to develop specific therapeutic approaches based on this information. This review aims to highlight recent advances in mutation-targeted therapies with chemicals that mitigate mutational pathology at the molecular level, for disorders that, for the most part, have no effective treatment. Currently, there are several strategies being used to correct different types of mutations, including the following: the identification and characterization of translational readthrough compounds; antisense oligonucleotide-mediated splicing redirection; mismatch repair; and exon skipping. These therapies and other approaches are reviewed in this paper.

  20. Deep learning meets ontologies: experiments to anchor the cardiovascular disease ontology in the biomedical literature.

    PubMed

    Arguello Casteleiro, Mercedes; Demetriou, George; Read, Warren; Fernandez Prieto, Maria Jesus; Maroto, Nava; Maseda Fernandez, Diego; Nenadic, Goran; Klein, Julie; Keane, John; Stevens, Robert

    2018-04-12

    Automatic identification of term variants or acceptable alternative free-text terms for gene and protein names from the millions of biomedical publications is a challenging task. Ontologies, such as the Cardiovascular Disease Ontology (CVDO), capture domain knowledge in a computational form and can provide context for gene/protein names as written in the literature. This study investigates: 1) if word embeddings from Deep Learning algorithms can provide a list of term variants for a given gene/protein of interest; and 2) if biological knowledge from the CVDO can improve such a list without modifying the word embeddings created. We have manually annotated 105 gene/protein names from 25 PubMed titles/abstracts and mapped them to 79 unique UniProtKB entries corresponding to gene and protein classes from the CVDO. Using more than 14 M PubMed articles (titles and available abstracts), word embeddings were generated with CBOW and Skip-gram. We setup two experiments for a synonym detection task, each with four raters, and 3672 pairs of terms (target term and candidate term) from the word embeddings created. For Experiment I, the target terms for 64 UniProtKB entries were those that appear in the titles/abstracts; Experiment II involves 63 UniProtKB entries and the target terms are a combination of terms from PubMed titles/abstracts with terms (i.e. increased context) from the CVDO protein class expressions and labels. In Experiment I, Skip-gram finds term variants (full and/or partial) for 89% of the 64 UniProtKB entries, while CBOW finds term variants for 67%. In Experiment II (with the aid of the CVDO), Skip-gram finds term variants for 95% of the 63 UniProtKB entries, while CBOW finds term variants for 78%. Combining the results of both experiments, Skip-gram finds term variants for 97% of the 79 UniProtKB entries, while CBOW finds term variants for 81%. This study shows performance improvements for both CBOW and Skip-gram on a gene/protein synonym detection task by adding knowledge formalised in the CVDO and without modifying the word embeddings created. Hence, the CVDO supplies context that is effective in inducing term variability for both CBOW and Skip-gram while reducing ambiguity. Skip-gram outperforms CBOW and finds more pertinent term variants for gene/protein names annotated from the scientific literature.

  1. Consortium for Osteogenesis Imperfecta Mutations in the Helical Domain of Type I Collagen: Regions Rich in Lethal Mutations Align With Collagen Binding Sites for Integrins and Proteoglycans

    PubMed Central

    Marini, Joan C.; Forlino, Antonella; Cabral, Wayne A.; Barnes, Aileen M.; San Antonio, James D.; Milgrom, Sarah; Hyland, James C.; Körkkö, Jarmo; Prockop, Darwin J.; De Paepe, Anne; Coucke, Paul; Symoens, Sofie; Glorieux, Francis H.; Roughley, Peter J.; Lund, Alan M.; Kuurila-Svahn, Kaija; Hartikka, Heini; Cohn, Daniel H.; Krakow, Deborah; Mottes, Monica; Schwarze, Ulrike; Chen, Diana; Yang, Kathleen; Kuslich, Christine; Troendle, James; Dalgleish, Raymond; Byers, Peter H.

    2014-01-01

    Osteogenesis imperfecta (OI) is a generalized disorder of connective tissue characterized by fragile bones and easy susceptibility to fracture. Most cases of OI are caused by mutations in type I collagen. We have identified and assembled structural mutations in type I collagen genes (COL1A1 and COL1A2, encoding the proα1(I) and proα2(I) chains, respectively) that result in OI. Quantitative defects causing type I OI were not included. Of these 832 independent mutations, 682 result in substitution for glycine residues in the triple helical domain of the encoded protein and 150 alter splice sites. Distinct genotype–phenotype relationships emerge for each chain. One-third of the mutations that result in glycine substitutions in α1(I) are lethal, especially when the substituting residues are charged or have a branched side chain. Substitutions in the first 200 residues are nonlethal and have variable outcome thereafter, unrelated to folding or helix stability domains. Two exclusively lethal regions (helix positions 691–823 and 910–964) align with major ligand binding regions (MLBRs), suggesting crucial interactions of collagen monomers or fibrils with integrins, matrix metalloproteinases (MMPs), fibronectin, and cartilage oligomeric matrix protein (COMP). Mutations in COL1A2 are predominantly nonlethal (80%). Lethal substitutions are located in eight regularly spaced clusters along the chain, supporting a regional model. The lethal regions align with proteoglycan binding sites along the fibril, suggesting a role in fibril–matrix interactions. Recurrences at the same site in α2(I) are generally concordant for outcome, unlike α1(I). Splice site mutations comprise 20% of helical mutations identified in OI patients, and may lead to exon skipping, intron inclusion, or the activation of cryptic splice sites. Splice site mutations in COL1A1 are rarely lethal; they often lead to frameshifts and the mild type I phenotype. In α2(I), lethal exon skipping events are located in the carboxyl half of the chain. Our data on genotype–phenotype relationships indicate that the two collagen chains play very different roles in matrix integrity and that phenotype depends on intracellular and extracellular events. PMID:17078022

  2. Reconciling newborn screening and a novel splice variant in BTD associated with partial biotinidase deficiency: A BabySeq Project case report.

    PubMed

    Murry, Jaclyn B; Machini, Kalotina; Ceyhan-Birsoy, Ozge; Kritzer, Amy; Krier, Joel B; Lebo, Matthew S; Fayer, Shawn; Genetti, Casie A; Vannoy, Grace E; Yu, Timothy W; Agrawal, Pankaj B; Parad, Richard B; Holm, Ingrid A; McGuire, Amy L; Green, Robert C; Beggs, Alan H; Rehm, Heidi L; Project, The BabySeq

    2018-05-04

    Here, we report a newborn female infant from the well-baby cohort of the BabySeq Project who was identified with compound heterozygous BTD gene variants. The two identified variants included a well-established pathogenic variant (c.1612C>T, p.Arg538Cys) that causes profound biotinidase deficiency (BTD) in homozygosity. In addition, a novel splice variant (c.44+1G>A, p.?) was identified in the invariant splice donor region of intron 1, potentially predictive of loss of function. The novel variant was predicted to impact splicing of exon 1; however, given the absence of any reported pathogenic variants in exon 1 and the presence of alternative splicing with exon 1 absent in most tissues in the GTEx database, we assigned an initial classification of uncertain significance. Follow-up medical record review of state mandated newborn screen (NBS) results revealed an initial out-of-range biotinidase activity level. Levels from a repeat NBS sample barely passed cut-off into the normal range. To determine whether the infant was biotinidase deficient, subsequent diagnostic enzyme activity testing was performed, confirming partial BTD, and resulted in a change of management for this patient. This led to reclassification of the novel splice variant based on these results. In conclusion, combining the genetic and NBS results together prompted clinical follow-up that confirmed partial biotinidase deficiency, and informed this novel splice site's reclassification emphasizing the importance of combining iterative genetic and phenotypic evaluations. Cold Spring Harbor Laboratory Press.

  3. Potentially pathogenic germline CHEK2 c.319+2T>A among multiple early-onset cancer families.

    PubMed

    Dominguez-Valentin, Mev; Nakken, Sigve; Tubeuf, Hélène; Vodak, Daniel; Ekstrøm, Per Olaf; Nissen, Anke M; Morak, Monika; Holinski-Feder, Elke; Martins, Alexandra; Møller, Pål; Hovig, Eivind

    2018-01-01

    To study the potential contribution of genes other than BRCA1/2, PTEN, and TP53 to the biological and clinical characteristics of multiple early-onset cancers in Norwegian families, including early-onset breast cancer, Cowden-like and Li-Fraumeni-like syndromes (BC, CSL and LFL, respectively). The Hereditary Cancer Biobank from the Norwegian Radium Hospital was used to identify early-onset BC, CSL or LFL for whom no pathogenic variants in BRCA1/2, PTEN, or TP53 had been found in routine diagnostic DNA sequencing. Forty-four cancer susceptibility genes were selected and analyzed by our in-house designed TruSeq amplicon-based assay for targeted sequencing. Protein- and RNA splicing-dedicated in silico analyses were performed for all variants of unknown significance (VUS). Variants predicted as the more likely to affect splicing were experimentally analyzed by minigene assay. We identified a CSL individual carrying a variant in CHEK2 (c.319+2T>A, IVS2), here considered as likely pathogenic. Out of the five VUS (BRCA2, CDH1, CHEK2, MAP3K1, NOTCH3) tested in the minigene splicing assay, only NOTCH3 c.14090C>T (p.Ser497Leu) showed a significant effect on RNA splicing, notably by inducing partial skipping of exon 9. Among 13 early-onset BC, CSL and LFL patients, gene panel sequencing identified a potentially pathogenic variant in CHEK2 that affects a canonical RNA splicing signal. Our study provides new information on genetic loci that may affect the risk of developing cancer in these patients and their families, demonstrating that genes presently not routinely tested in molecular diagnostic settings may be important for capturing cancer predisposition in these families.

  4. Transtheoretical Model Based Exercise Counseling Combined with Music Skipping Rope Exercise on Childhood Obesity.

    PubMed

    Ham, Ok Kyung; Sung, Kyung Mi; Lee, Bo Gyeong; Choi, Hee Won; Im, Eun-Ok

    2016-06-01

    The purpose was to evaluate the effects of a transtheoretical model (TTM) based exercise counseling offered with music skipping rope exercise on components of the TTM (stages of change, decisional balance, and self-efficacy), body mass index, glucose, and lipid profile of overweight/obese children in Korea. This study used a nonequivalent pretest and posttest experimental study design. A total of 75 overweight/obese children participated in the study. Eight sessions of exercise counseling combined with music skipping rope exercise for 12 weeks were offered for children in the experimental group, while one session of exercise counseling with music skipping rope exercise for 12 weeks was offered for children in the control group. Outcomes were measured at baseline, and 6 months after the intervention. After the intervention, self-efficacy significantly improved among children in the experimental group (p = .049), while these children maintained their baseline BMI at 6-month follow-up (p > .05). Among children in the control group, BMI significantly increased (p < .05). Fasting blood sugar significantly increased for both groups after the intervention (p < .05). However, a greater increase was observed for the control group. Our study partially supports the hypothesis that a TTM-based exercise intervention is effective in maintaining BMI and improving self-efficacy of overweight/obese children. The TTM-based counseling combined with exercise classes has potential to control weight among overweight/obese children, while involvement of parents and children in the development of the theory-based intervention may generate further benefits regarding health and well-being of overweight/obese children. Copyright © 2016. Published by Elsevier B.V.

  5. Quantitation of normal CFTR mRNA in CF patients with splice-site mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Z.; Olsen, J.C.; Silverman, L.M.

    Previously we identified two mutations in introns of the CFTR gene associated with partially active splice sites and unusual clinical phenotypes. One mutation in intron 19 (3849+10 kb C to T) is common in CF patients with normal sweat chloride values; an 84 bp sequence from intron 19, which contains a stop codon, is inserted between exon 19 and exon 20 in most nasal CFTR transcripts. The other mutation in intron 14B (2789+5 G to A) is associated with elevated sweat chloride levels, but mild pulmonary disease; exon 14B (38 bp) is spliced out of most nasal CFTR transcipts. Themore » remaining CFTR cDNA sequences, other than the 84 bp insertion of exon 14B deletion, are identical to the published sequence. To correlate genotype and phenotype, we used quantitative RT-PCR to determine the levels of normally-spliced CFTR mRNA in nasal epithelia from these patients. CFTR cDNA was amplified (25 cycles) by using primers specific for normally-spliced species, {gamma}-actin cDNA was amplified as a standard.« less

  6. Afatinib and Cetuximab in Four Patients With EGFR Exon 20 Insertion-Positive Advanced NSCLC.

    PubMed

    van Veggel, Bianca; de Langen, Adrianus J; Hashemi, Sayed M S; Monkhorst, Kim; Heideman, Daniëlle A M; Thunnissen, Erik; Smit, Egbert F

    2018-04-24

    EGFR exon 20 insertions comprise 4% to 9% of EGFR mutated NSCLC. Despite being an oncogenic driver, they are associated with primary resistance to EGFR tyrosine kinase inhibitors (TKIs). We hypothesized that dual EGFR blockade with afatinib, an irreversible EGFR TKI, and cetuximab, a monoclonal antibody against EGFR, could induce tumor responses. Four patients with EGFR exon 20 insertion-positive NSCLC were treated with afatinib 40 mg once daily and cetuximab 250 mg/m 2 to 500 mg/m 2 every 2 weeks. All patients had stage IV adenocarcinoma of the lung harboring an EGFR exon 20 insertion mutation. Previous lines of treatment consisted of platinum doublet chemotherapy (n = 4) and EGFR TKI (n = 2). Three of four patients showed a partial response according to Response Evaluation Criteria in Solid Tumors (RECIST 1.1). Median progression-free survival was 5.4 months (95% confidence interval: 0.0 - 14.2 months; range 2.7 months - 17.6 months). Toxicity was manageable with appropriate skin management and dose reduction being required in two patients. Dual EGFR blockade with afatinib and cetuximab may induce tumor responses in patients with EGFR exon 20 insertion-positive NSCLC. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  7. Alternative RNA splicing and gastric cancer.

    PubMed

    Li, Ying; Yuan, Yuan

    2017-07-01

    Alternative splicing (AS) linked to diseases, especially to tumors. Recently, more and more studies focused on the relationship between AS and gastric cancer (GC). This review surveyed the hot topic from four aspects: First, the common types of AS in cancer, including exon skipping, intron retention, mutually exclusive exon, alternative 5 ' or 3' splice site, alternative first or last exon and alternative 3' untranslated regions. Second, basic mechanisms of AS and its relationship with cancer. RNA splicing in eukaryotes follows the GT-AG rule by both cis-elements and trans-acting factors regulatory. Through RNA splicing, different proteins with different forms and functions can be produced and may be associated with carcinogenesis. Third, AS types of GC-related genes and their splicing variants. In this paper, we listed 10 common genes with AS and illustrated its possible molecular mechanisms owing to genetic variation (mutation and /or polymorphism). Fourth, the splicing variants of GC-associated genes and gastric carcinogenesis, invasion and metastasis. Many studies have found that the different splicing variants of the same gene are differentially expressed in GC and its precancerous diseases, suggesting AS has important implications in GC development. Taking together, this review highlighted the role of AS and splicing variants in the process of GC. We hope that this is not only beneficial to advances in the study field of GC, but also can provide valuable information to other similar tumor research.Although we already know some gene splicing and splicing variants play an important role in the development of GC, but many phenomena and mechanisms are still unknown. For example, how the tumor microenvironment and signal transduction pathway effect the forming and function of AS? Unfortunately, this review did not cover the contents because the current study is limited. It is no doubt that clarifying the phenomena and mechanisms of these unknown may help to reveal the relationship of AS with complex tumor genetic variation and the occurrence and development of tumors. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Multidrug resistance in epilepsy and polymorphisms in the voltage-gated sodium channel genes SCN1A, SCN2A, and SCN3A: correlation among phenotype, genotype, and mRNA expression.

    PubMed

    Kwan, Patrick; Poon, Wai Sang; Ng, Ho-Keung; Kang, David E; Wong, Virginia; Ng, Ping Wing; Lui, Colin H T; Sin, Ngai Chuen; Wong, Ka S; Baum, Larry

    2008-11-01

    Many antiepileptic drugs (AEDs) prevent seizures by blocking voltage-gated brain sodium channels. However, treatment is ineffective in 30% of epilepsy patients, which might, at least in part, result from polymorphisms of the sodium channel genes. We investigated the association of AED responsiveness with genetic polymorphisms and correlated any association with mRNA expression of the neuronal sodium channels. We performed genotyping of tagging and candidate single nucleotide polymorphisms (SNPs) of SCN1A, 2A, and 3A in 471 Chinese epilepsy patients (272 drug responsive and 199 drug resistant). A total of 27 SNPs were selected based on the HapMap database. Genotype distributions in drug-responsive and drug-resistant patients were compared. SCN2A mRNA was quantified by real-time PCR in 24 brain and 57 blood samples. Its level was compared between patients with different genotypes of an SCN2A SNP found to be associated with drug responsiveness. SCN2A IVS7-32A>G (rs2304016) A alleles were associated with drug resistance (odds ratio = 2.1, 95% confidence interval: 1.2-3.7, P=0.007). Haplotypes containing the IVS7-32A>G allele A were also associated with drug resistance. IVS7-32A>G is located within the putative splicing branch site for splicing exons 7 and 9. PCR of reverse-transcribed RNA from blood or brain of patients with different IVS7-32A>G genotypes using primers in exons 7 and 9 showed no skipping of exon 8, and real-time PCR showed no difference in SCN2A mRNA levels among genotypes. Results of this study suggest an association between SCN2A IVS7-32A>G and AED responsiveness, without evidence of an effect on splicing or mRNA expression.

  9. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

  10. A novel TFF2 splice variant (ΔEX2TFF2) correlates with longer overall survival time in cholangiocarcinoma

    PubMed Central

    KAMLUA, SURASEE; PATRAKITKOMJORN, SIRIPORN; JEARANAIKOON, PATCHAREE; MENHENIOTT, TREVELYAN R.; GIRAUD, ANDREW S.; LIMPAIBOON, TEMDUANG

    2012-01-01

    Trefoil factor 2 (TFF2) is a member of trefoil factor family found to be overexpressed in many cancers including cholangiocarcinoma (CCA). The majority of studies have focused on wild-type TFF2 (wtTFF2) expression, but information regarding alternative splicing variants of TFF2 mRNA has not been reported. In this study, we aimed to identify and quantify a novel TFF2 splice variant in cholangiocarcinoma (CCA). Seventy-eight tumors and 15 normal adjacent tissues were quantified for the expression of the TFF2 splice variant relative to wild-type (wt) TFF2 mRNA using quantitative reverse transcriptase polymerase chain reaction (QRT-PCR). The ratio of TFF2 splice variant against wtTFF2 was analyzed for associations with clinical parameters. We found a novel TFF2 splice variant, exon 2 skipping (ΔEX2TFF2), resulting in a stop codon (TAG) at exon 1. The ΔEX2TFF2/wtTFF2 ratio in tumors was significantly higher than in normal tissue (P<0.01). Interestingly, high ΔEX2TFF2/wtTFF2 ratio was significantly associated with good prognosis compared with low ratio (P=0.017). In contrast, the presence of wtTFF2 protein was associated with poor survival of CCA patients (P=0.034). This is the first report of a trefoil factor splice variant and its potential application as a prognostic biomarker in CCA. PMID:22159958

  11. How the discovery of ISS-N1 led to the first medical therapy for spinal muscular atrophy

    PubMed Central

    Singh, Natalia N.; Howell, Matthew D.; Androphy, Elliot J.; Singh, Ravindra N.

    2017-01-01

    Spinal muscular atrophy (SMA), a prominent genetic disease of infant mortality, is caused by low levels of survival motor neuron (SMN) protein owing to deletions or mutations of the SMN1 gene. SMN2, a nearly identical copy of SMN1 present in humans, cannot compensate for the loss of SMN1 due to predominant skipping of exon 7 during pre-mRNA splicing. With the recent FDA approval of nusinersen (Spinraza™), the potential for correction of SMN2 exon 7 splicing as a SMA therapy has been affirmed. Nusinersen is an antisense oligonucleotide that targets intronic splicing silencer N1 (ISS-N1) discovered in 2004 at the University of Massachusetts Medical School. ISS-N1 has emerged as the model target for testing the therapeutic efficacy of antisense oligonucleotides using different chemistries as well as different mouse models of SMA. Here we provide a historical account of events that led to the discovery of ISS-N1 and describe the impact of independent validations that raised the profile of ISS-N1 as one of the most potent antisense targets for the treatment of a genetic disease. Recent approval of nusinersen provides a much-needed boost for antisense technology that is just beginning to realize its potential. Beyond treating SMA, the ISS-N1 target offers myriad potentials for perfecting various aspects of the nucleic-acid-based technology for the amelioration of the countless number of pathological conditions. PMID:28485722

  12. How the discovery of ISS-N1 led to the first medical therapy for spinal muscular atrophy.

    PubMed

    Singh, N N; Howell, M D; Androphy, E J; Singh, R N

    2017-09-01

    Spinal muscular atrophy (SMA), a prominent genetic disease of infant mortality, is caused by low levels of survival motor neuron (SMN) protein owing to deletions or mutations of the SMN1 gene. SMN2, a nearly identical copy of SMN1 present in humans, cannot compensate for the loss of SMN1 because of predominant skipping of exon 7 during pre-mRNA splicing. With the recent US Food and Drug Administration approval of nusinersen (Spinraza), the potential for correction of SMN2 exon 7 splicing as an SMA therapy has been affirmed. Nusinersen is an antisense oligonucleotide that targets intronic splicing silencer N1 (ISS-N1) discovered in 2004 at the University of Massachusetts Medical School. ISS-N1 has emerged as the model target for testing the therapeutic efficacy of antisense oligonucleotides using different chemistries as well as different mouse models of SMA. Here, we provide a historical account of events that led to the discovery of ISS-N1 and describe the impact of independent validations that raised the profile of ISS-N1 as one of the most potent antisense targets for the treatment of a genetic disease. Recent approval of nusinersen provides a much-needed boost for antisense technology that is just beginning to realize its potential. Beyond treating SMA, the ISS-N1 target offers myriad potentials for perfecting various aspects of the nucleic-acid-based technology for the amelioration of the countless number of pathological conditions.

  13. A de novo mosaic mutation of PHEX in a boy with hypophosphatemic rickets.

    PubMed

    Weng, Chen; Chen, Jiao; Sun, Li; Zhou, Zhong-Wei; Feng, Xue; Sun, Jun-Hui; Lu, Ling-Ping; Yu, Ping; Qi, Ming

    2016-03-01

    X-linked dominant hypophosphatemic rickets (XLHR), is characterized mainly by renal phosphate wasting with hypophosphatemia, short stature and abnormal bone mineralization. PHEX, located at Xp22.1-p22.2, is the gene causing XLHR. We aim to characterize the pathogenesis of a Chinese boy who is apparently 'heterozygous' in PHEX gene. Direct sequencing showed two peaks: one was a wild-type 'G' and the other was one base substitution to 'A', though the patient was a male. TA clone assay clearly showed each sequences and the ratios. The mutation effect was predicted via bioinformatics and validated by exon-trapping assay. Real-time PCR was applied to determine the copy number of PHEX. TA clone assay showed the frequency of normal (G) to mutant allele (A) as 19:13. Normal karyotype and real-time PCR results indicate the normal copy number of PHEX. This splice site mutation leads to 4 bp of exon 18 skipping out causing frame shift p.Gly590Glufs*28 that ends up with a loss of active site and Zn(2+)-binding site of PHEX, which probably interfere with renal phosphate reabsorption and bone mineralization. In conclusion, mutation at conserved splice acceptor site resulted in aberrant splicing, ending up with a damaged protein product. This novel mutation is de novo in mosaic pattern that may be induced during early postzygotic period. Taking mosaic somatic mutation of PHEX into consideration is strongly suggested in genetic counseling and etiology research for XLHR.

  14. Identification of Alternative Splicing and Fusion Transcripts in Non-Small Cell Lung Cancer by RNA Sequencing.

    PubMed

    Hong, Yoonki; Kim, Woo Jin; Bang, Chi Young; Lee, Jae Cheol; Oh, Yeon-Mok

    2016-04-01

    Lung cancer is the most common cause of cancer related death. Alterations in gene sequence, structure, and expression have an important role in the pathogenesis of lung cancer. Fusion genes and alternative splicing of cancer-related genes have the potential to be oncogenic. In the current study, we performed RNA-sequencing (RNA-seq) to investigate potential fusion genes and alternative splicing in non-small cell lung cancer. RNA was isolated from lung tissues obtained from 86 subjects with lung cancer. The RNA samples from lung cancer and normal tissues were processed with RNA-seq using the HiSeq 2000 system. Fusion genes were evaluated using Defuse and ChimeraScan. Candidate fusion transcripts were validated by Sanger sequencing. Alternative splicing was analyzed using multivariate analysis of transcript sequencing and validated using quantitative real time polymerase chain reaction. RNA-seq data identified oncogenic fusion genes EML4-ALK and SLC34A2-ROS1 in three of 86 normal-cancer paired samples. Nine distinct fusion transcripts were selected using DeFuse and ChimeraScan; of which, four fusion transcripts were validated by Sanger sequencing. In 33 squamous cell carcinoma, 29 tumor specific skipped exon events and six mutually exclusive exon events were identified. ITGB4 and PYCR1 were top genes that showed significant tumor specific splice variants. In conclusion, RNA-seq data identified novel potential fusion transcripts and splice variants. Further evaluation of their functional significance in the pathogenesis of lung cancer is required.

  15. Dystrophin-deficient large animal models: translational research and exon skipping

    PubMed Central

    Yu, Xinran; Bao, Bo; Echigoya, Yusuke; Yokota, Toshifumi

    2015-01-01

    Duchenne muscular dystrophy (DMD) is an X-linked recessive genetic disorder caused by mutations in the dystrophin gene. Affecting approximately 1 in 3,600-9337 boys, DMD patients exhibit progressive muscle degeneration leading to fatality as a result of heart or respiratory failure. Despite the severity and prevalence of the disease, there is no cure available. While murine models have been successfully used in illustrating the mechanisms of DMD, their utility in DMD research is limited due to their mild disease phenotypes such as lack of severe skeletal muscle and cardiac symptoms. To address the discrepancy between the severity of disease displayed by murine models and human DMD patients, dystrophin-deficient dog models with a splice site mutation in intron 6 were established. Examples of these are Golden Retriever muscular dystrophy and beagle-based Canine X-linked muscular dystrophy. These large animal models are widely employed in therapeutic DMD research due to their close resemblance to the severity of human patient symptoms. Recently, genetically tailored porcine models of DMD with deleted exon 52 were developed by our group and others, and can potentially act as a new large animal model. While therapeutic outcomes derived from these large animal models can be more reliably extrapolated to DMD patients, a comprehensive understanding of these models is still needed. This paper will discuss recent progress and future directions of DMD studies with large animal models such as canine and porcine models. PMID:26396664

  16. A contracted DNA repeat in LHX3 intron 5 is associated with aberrant splicing and pituitary dwarfism in German shepherd dogs.

    PubMed

    Voorbij, Annemarie M W Y; van Steenbeek, Frank G; Vos-Loohuis, Manon; Martens, Ellen E C P; Hanson-Nilsson, Jeanette M; van Oost, Bernard A; Kooistra, Hans S; Leegwater, Peter A

    2011-01-01

    Dwarfism in German shepherd dogs is due to combined pituitary hormone deficiency of unknown genetic cause. We localized the recessively inherited defect by a genome wide approach to a region on chromosome 9 with a lod score of 9.8. The region contains LHX3, which codes for a transcription factor essential for pituitary development. Dwarfs have a deletion of one of six 7 bp repeats in intron 5 of LHX3, reducing the intron size to 68 bp. One dwarf was compound heterozygous for the deletion and an insertion of an asparagine residue in the DNA-binding homeodomain of LHX3, suggesting involvement of the gene in the disorder. An exon trapping assay indicated that the shortened intron is not spliced efficiently, probably because it is too small. We applied bisulfite conversion of cytosine to uracil in RNA followed by RT-PCR to analyze the splicing products. The aberrantly spliced RNA molecules resulted from either skipping of exon 5 or retention of intron 5. The same splicing defects were observed in cDNA derived from the pituitary of dwarfs. A survey of similarly mutated introns suggests that there is a minimal distance requirement between the splice donor and branch site of 50 nucleotides. In conclusion, a contraction of a DNA repeat in intron 5 of canine LHX3 leads to deficient splicing and is associated with pituitary dwarfism.

  17. A Contracted DNA Repeat in LHX3 Intron 5 Is Associated with Aberrant Splicing and Pituitary Dwarfism in German Shepherd Dogs

    PubMed Central

    Voorbij, Annemarie M. W. Y.; van Steenbeek, Frank G.; Vos-Loohuis, Manon; Martens, Ellen E. C. P.; Hanson-Nilsson, Jeanette M.; van Oost, Bernard A.; Kooistra, Hans S.; Leegwater, Peter A.

    2011-01-01

    Dwarfism in German shepherd dogs is due to combined pituitary hormone deficiency of unknown genetic cause. We localized the recessively inherited defect by a genome wide approach to a region on chromosome 9 with a lod score of 9.8. The region contains LHX3, which codes for a transcription factor essential for pituitary development. Dwarfs have a deletion of one of six 7 bp repeats in intron 5 of LHX3, reducing the intron size to 68 bp. One dwarf was compound heterozygous for the deletion and an insertion of an asparagine residue in the DNA-binding homeodomain of LHX3, suggesting involvement of the gene in the disorder. An exon trapping assay indicated that the shortened intron is not spliced efficiently, probably because it is too small. We applied bisulfite conversion of cytosine to uracil in RNA followed by RT-PCR to analyze the splicing products. The aberrantly spliced RNA molecules resulted from either skipping of exon 5 or retention of intron 5. The same splicing defects were observed in cDNA derived from the pituitary of dwarfs. A survey of similarly mutated introns suggests that there is a minimal distance requirement between the splice donor and branch site of 50 nucleotides. In conclusion, a contraction of a DNA repeat in intron 5 of canine LHX3 leads to deficient splicing and is associated with pituitary dwarfism. PMID:22132174

  18. Performance enhancing water skipping: successive free surface impacts of elastic spheres

    NASA Astrophysics Data System (ADS)

    Hurd, Randy; Truscott, Tadd; Belden, Jesse

    2014-11-01

    From naval gunners skipping cannonballs to children skipping stones, physicists have long been enamored with the repeated ricochet of objects on the water surface. Elastic spheres, such as the toy Waboba ball, make water skipping more accessible to the masses by expanding the range of impact parameters over which objects can be skipped. For example, it is not difficult to achieve more than twenty skips with such spheres, where skipping a stone twenty times is very difficult. In this talk we discuss the dynamics of water skipping elastic spheres over several successive skips. High-speed video captured using a unique experimental setup reveals how dynamics change with each skip as a result of lost kinetic energy. We place these observations in the context of previous work on single oblique impacts to identify material vibration modes that are excited during ricochet. The material modes excited with each successive impact are seen to decay from high-energy modes to low energy modes until water entry finally occurs. A model for estimating skipping outcome from initial conditions is proposed.

  19. Skipping of Chinese characters does not rely on word-based processing.

    PubMed

    Lin, Nan; Angele, Bernhard; Hua, Huimin; Shen, Wei; Zhou, Junyi; Li, Xingshan

    2018-02-01

    Previous eye-movement studies have indicated that people tend to skip extremely high-frequency words in sentence reading, such as "the" in English and "/de" in Chinese. Two alternative hypotheses have been proposed to explain how this frequent skipping happens in Chinese reading: one assumes that skipping happens when the preview has been fully identified at the word level (word-based skipping); the other assumes that skipping happens whenever the preview character is easy to identify regardless of whether lexical processing has been completed or not (character-based skipping). Using the gaze-contingent display change paradigm, we examined the two hypotheses by substituting the preview of the third character of a four-character Chinese word with the high-frequency Chinese character "/de", which should disrupt the ongoing word-level processing. The character-based skipping hypothesis predicts that this manipulation will enhance the skipping probability of the target character (i.e., the third character of the target word), because the character "/de" has much higher character frequency than the original character. The word-based skipping hypothesis instead predicts a reduction of the skipping probability of the target character because the presence of the character "/de" is lexically infelicitous at word level. The results supported the character-based skipping hypothesis, indicating that in Chinese reading the decision of skipping a character can be made before integrating it into a word.

  20. Deletion of the Noncoding GNAS Antisense Transcript Causes Pseudohypoparathyroidism Type Ib and Biparental Defects of GNAS Methylation in cis

    PubMed Central

    Chillambhi, Smitha; Turan, Serap; Hwang, Daw-Yang; Chen, Hung-Chun; Jüppner, Harald; Bastepe, Murat

    2010-01-01

    Context: GNAS encodes the α-subunit of the stimulatory G protein as well as additional imprinted transcripts including the maternally expressed NESP55 and the paternally expressed XLαs, antisense, and A/B transcripts. Most patients with pseudohypoparathyroidism type Ib (PHP-Ib) exhibit imprinting defects affecting the maternal GNAS allele, which are thought to reduce/abolish Gsα expression in renal proximal tubules and thereby cause resistance to PTH. Objective: Our objective was to define the genetic defect in a previously unreported family with autosomal dominant PHP-Ib. Design and Setting: Analyses of serum and urine chemistries and of genomic DNA and lymphoblastoid-derived RNA were conducted at a tertiary hospital and research laboratory. Patients: Affected individuals presented with muscle weakness and/or paresthesia and showed hypocalcemia, hyperphosphatemia, and elevated serum PTH. Obligate carriers were healthy and revealed no obvious abnormality in mineral ion homeostasis. Results: A novel 4.2-kb microdeletion was discovered in the affected individuals and the obligate carriers, ablating two noncoding GNAS antisense exons while preserving the NESP55 exon. On maternal transmission, the deletion causes loss of all maternal GNAS imprints, partial gain of NESP55 methylation, and PTH resistance. Paternal transmission of the mutation leads to epigenetic alterations in cis, including a partial loss of NESP55 methylation and a partial gain of A/B methylation. Conclusions: The identified deletion points to a unique cis-acting element located telomeric of the NESP55 exon that is critical for imprinting both GNAS alleles. These findings provide novel insights into the molecular mechanisms underlying PHP and GNAS imprinting. PMID:20444925

  1. Novel promoters and coding first exons in DLG2 linked to developmental disorders and intellectual disability.

    PubMed

    Reggiani, Claudio; Coppens, Sandra; Sekhara, Tayeb; Dimov, Ivan; Pichon, Bruno; Lufin, Nicolas; Addor, Marie-Claude; Belligni, Elga Fabia; Digilio, Maria Cristina; Faletra, Flavio; Ferrero, Giovanni Battista; Gerard, Marion; Isidor, Bertrand; Joss, Shelagh; Niel-Bütschi, Florence; Perrone, Maria Dolores; Petit, Florence; Renieri, Alessandra; Romana, Serge; Topa, Alexandra; Vermeesch, Joris Robert; Lenaerts, Tom; Casimir, Georges; Abramowicz, Marc; Bontempi, Gianluca; Vilain, Catheline; Deconinck, Nicolas; Smits, Guillaume

    2017-07-19

    Tissue-specific integrative omics has the potential to reveal new genic elements important for developmental disorders. Two pediatric patients with global developmental delay and intellectual disability phenotype underwent array-CGH genetic testing, both showing a partial deletion of the DLG2 gene. From independent human and murine omics datasets, we combined copy number variations, histone modifications, developmental tissue-specific regulation, and protein data to explore the molecular mechanism at play. Integrating genomics, transcriptomics, and epigenomics data, we describe two novel DLG2 promoters and coding first exons expressed in human fetal brain. Their murine conservation and protein-level evidence allowed us to produce new DLG2 gene models for human and mouse. These new genic elements are deleted in 90% of 29 patients (public and in-house) showing partial deletion of the DLG2 gene. The patients' clinical characteristics expand the neurodevelopmental phenotypic spectrum linked to DLG2 gene disruption to cognitive and behavioral categories. While protein-coding genes are regarded as well known, our work shows that integration of multiple omics datasets can unveil novel coding elements. From a clinical perspective, our work demonstrates that two new DLG2 promoters and exons are crucial for the neurodevelopmental phenotypes associated with this gene. In addition, our work brings evidence for the lack of cross-annotation in human versus mouse reference genomes and nucleotide versus protein databases.

  2. Exon 2-mediated c-myc mRNA decay in vivo is independent of its translation.

    PubMed Central

    Pistoi, S; Roland, J; Babinet, C; Morello, D

    1996-01-01

    We have previously shown that the steady-state level of c-myc mRNA in vivo is primarily controlled by posttranscriptional regulatory mechanisms. To identify the sequences involved in this process, we constructed a series of H-2/myc transgenic lines in which various regions of the human c-MYC gene were placed under the control of the quasi-ubiquitous H-2K class I regulatory sequences. We demonstrated that the presence of one of the two coding exons, exon 2 or exon 3, is sufficient to confer a level of expression of transgene mRNA similar to that of endogenous c-myc in various adult tissues as well as after partial hepatectomy or after protein synthesis inhibition. We now focus on the molecular mechanisms involved in modulation of expression of mRNAs containing c-myc exon 2 sequences, with special emphasis on the coupling between translation and c-myc mRNA turnover. We have undertaken an analysis of expression, both at the mRNA level and at the protein level, of new transgenic constructs in which the translation is impaired either by disruption of the initiation codon or by addition of stop codons upstream of exon 2. Our results show that the translation of c-myc exon 2 is not required for regulated expression of the transgene in the different situations analyzed, and therefore they indicate that the mRNA destabilizing function of exon 2 is independent of translation by ribosomes. Our investigations also reveal that, in the thymus, some H-2/myc transgenes express high levels of mRNA but low levels of protein. Besides the fact that these results suggest the existence of tissue-specific mechanisms that control c-myc translatability in vivo, they also bring another indication of the uncoupling of c-myc mRNA translation and degradation. PMID:8756668

  3. Water Bouncing Balls: how material stiffness affects water entry

    NASA Astrophysics Data System (ADS)

    Truscott, Tadd

    2014-03-01

    It is well known that one can skip a stone across the water surface, but less well known that a ball can also be skipped on water. Even though 17th century ship gunners were aware that cannonballs could be skipped on the water surface, they did not know that using elastic spheres rather than rigid ones could greatly improve skipping performance (yet would have made for more peaceful volleys). The water bouncing ball (Waboba®) is an elastic ball used in a game of aquatic keep away in which players pass the ball by skipping it along the water surface. The ball skips easily along the surface creating a sense that breaking the world record for number of skips could easily be achieved (51 rock skips Russell Byers 2007). We investigate the physics of skipping elastic balls to elucidate the mechanisms by which they bounce off of the water. High-speed video reveals that, upon impact with the water, the balls create a cavity and deform significantly due to the extreme elasticity; the flattened spheres resemble skipping stones. With an increased wetted surface area, a large hydrodynamic lift force is generated causing the ball to launch back into the air. Unlike stone skipping, the elasticity of the ball plays an important roll in determining the success of the skip. Through experimentation, we demonstrate that the deformation timescale during impact must be longer than the collision time in order to achieve a successful skip. Further, several material deformation modes can be excited upon free surface impact. The effect of impact velocity and angle on the two governing timescales and material wave modes are also experimentally investigated. Scaling for the deformation and collision times are derived and used to establish criteria for skipping in terms of relevant physical parameters.

  4. Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population.

    PubMed

    Kutsuma, Ayano; Nakajima, Kei; Suwa, Kaname

    2014-01-01

    Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20-75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08-1.28), P = 0.0003, and 1.37 (1.24-1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population.

  5. Reading skill and word skipping: Implications for visual and linguistic accounts of word skipping.

    PubMed

    Eskenazi, Michael A; Folk, Jocelyn R

    2015-11-01

    We investigated whether high-skill readers skip more words than low-skill readers as a result of parafoveal processing differences based on reading skill. We manipulated foveal load and word length, two variables that strongly influence word skipping, and measured reading skill using the Nelson-Denny Reading Test. We found that reading skill did not influence the probability of skipping five-letter words, but low-skill readers were less likely to skip three-letter words when foveal load was high. Thus, reading skill is likely to influence word skipping when the amount of information in the parafovea falls within the word identification span. We interpret the data in the context of visual-based (extended optimal viewing position model) and linguistic based (E-Z Reader model) accounts of word skipping. The models make different predictions about how and why a word and skipped; however, the data indicate that both models should take into account the fact that different factors influence skipping rates for high- and low-skill readers. (c) 2015 APA, all rights reserved).

  6. Genomic organization of the neurofibromatosis 1 gene (NF1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Y.; O`Connell, P.; Huntsman Breidenbach, H.

    Neurofibromatosis 1 maps to chromosome band 17q11.2, and the NF1 locus has been partially characterized. Even though the full-length NF1 cDNA has been sequenced, the complete genomic structure of the NF1 gene has not been elucidated. The 5{prime} end of NF1 is embedded in a CpG island containing a NotI restriction site, and the remainder of the gene lies in the adjacent 350-kb NotI fragment. In our efforts to develop a comprehensive screen for NF1 mutations, we have isolated genomic DNA clones that together harbor the entire NF1 cDNA sequence. We have identified all intron-exon boundaries of the coding regionmore » and established that it is composed of 59 exons. Furthermore, we have defined the 3{prime}-untranslated region (3{prime}-UTR) of the NF1 gene; it spans approximately 3.5 kb of genomic DNA sequence and is continuous with the stop codon. Oligonucleotide primer pairs synthesized from exon-flanking DNA sequences were used in the polymerase chain reaction with cloned, chromosome 17-specific genomic DNA as template to amplify NF1 exons 1 through 27b and the exon containing the 3{prime}-UTR separately. This information should be useful for implementing a comprehensive NF1 mutation screen using genomic DNA as template. 41 refs., 3 figs., 2 tabs.« less

  7. Skipped Stage Modeling and Testing of the CPAS Main Parachutes

    NASA Technical Reports Server (NTRS)

    Varela, Jose G.; Ray, Eric S.

    2013-01-01

    The Capsule Parachute Assembly System (CPAS) has undergone the transition from modeling a skipped stage event using a simulation that treats a cluster of parachutes as a single composite canopy to the capability of simulating each parachute individually. This capability along with data obtained from skipped stage flight tests has been crucial in modeling the behavior of a skipping canopy as well as the crowding effect on non-skipping ("lagging") neighbors. For the finite mass inflation of CPAS Main parachutes, the cluster is assumed to inflate nominally through the nominal fill time, at which point the skipping parachute continues inflating. This sub-phase modeling method was used to reconstruct three flight tests involving skipped stages. Best fit inflation parameters were determined for both the skipping and lagging canopies.

  8. Correlates of meal skipping in young adults: a systematic review.

    PubMed

    Pendergast, Felicity J; Livingstone, Katherine M; Worsley, Anthony; McNaughton, Sarah A

    2016-12-01

    Meal skipping rates may be highest during young adulthood, a period of transition and development. Although these dietary behaviours may increase future risk of chronic disease, limited research has investigated correlates of meal skipping in young adults. A systematic literature search was conducted to identify studies that investigated correlates of meal skipping behaviours in young adults (aged 18-30 years). EBSCO host, MEDLINE Complete, Global Health, Scopus, EMBASE, Web of Science and Informit platforms were searched for eligible articles. Correlates were defined as any factor that was either associated with meal skipping or was self-reported by the participant to have an influence on meal skipping. Randomised controlled trials, prospective cohort studies, case-control studies, nested case-control studies, cross-sectional studies, and longitudinal studies were eligible for inclusion. Three-hundred and thirty-one articles were identified, 141 full-text articles assessed for eligibility, resulting in 35 included studies. Multiple methodological and reporting weaknesses were apparent in the reviewed studies with 28 of the 35 studies scoring a negative rating in the risk of bias assessment. Meal skipping (any meal), defined as the skipping of any meal throughout the day, was reported in 12 studies with prevalence ranging between 5 and 83%. The remaining 25 studies identified specific meals and their skipping rates, with breakfast the most frequently skipped meal 14-88% compared to lunch 8-57% and dinner 4-57%. Lack of time was consistently reported as an important correlate of meal skipping, compared with correlates such as cost and weight control, while sex was the most commonly reported associated correlate. Breakfast skipping was more common among men while lunch or dinner skipping being more common among women. This review is the first to examine potential correlates of meal skipping in young adults. Future research would benefit from stronger design and reporting strategies, using a standardised approach for measuring and defining meal skipping.

  9. Dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor T790M mutation: A case report.

    PubMed

    Uemura, Takehiro; Oguri, Tetsuya; Okayama, Minami; Furuta, Hiromi; Kanemitsu, Yoshihiro; Takakuwa, Osamu; Ohkubo, Hirotsugu; Takemura, Masaya; Maeno, Ken; Ito, Yutaka; Niimi, Akio

    2017-04-01

    We herein report a case of dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor ( EGFR ) T790M mutation encoded in exon 20. The patient was a 59-year-old woman with EGFR exon 19 deletion-positive lung adenocarcinoma, who relapsed with multiple brain metastases. Computed tomography-guided biopsy of the left pleural tumor revealed adenocarcinoma harboring an EGFR exon 19 deletion and an EGFR T790M mutation encoded in exon 20. The patient was treated with osimertinib, a third-generation EGFR tyrosine kinase inhibitor. Two days after treatment initiation, the patient displayed profound disturbance of consciousness, possibly due to carcinomatous meningitis, and treatment had to be discontinued due to difficulty in taking osimertinib. However, the patient gradually started to recover consciousness and, after 3 days, she was again able to take osimertinib. One month after the initiation of osimertinib treatment, magnetic resonance imaging revealed an apparent reduction in brain metastases. The patient is currently under continued treatment with osimertinib. At the last follow-up (February, 2017) she exhibited partial response to the treatment.

  10. Novel inactivating mutations of the DCAF17 gene in American and Turkish families cause male infertility and female subfertility in the mouse model.

    PubMed

    Gurbuz, F; Desai, S; Diao, F; Turkkahraman, D; Wranitz, F; Wood-Trageser, M; Shin, Y-H; Kotan, L D; Jiang, H; Witchel, S; Gurtunca, N; Yatsenko, S; Mysliwec, D; Topaloglu, K; Rajkovic, A

    2018-04-01

    Loss-of-function DCAF17 variants cause hypogonadism, partial alopecia, diabetes mellitus, mental retardation, and deafness with variable clinical presentation. DCAF17 pathogenic variants have been largely reported in the Middle Eastern populations, but the incidence in American families is rare and animal models are lacking. Exome sequencing in 5 women with syndromic hypergonadotropic hypogonadism from 2 unrelated families revealed novel pathogenic variants in the DCAF17 gene. DCAF17 exon 2 (c.127-1G > C) novel homozygous variants were discovered in 4 Turkish siblings, while 1 American was compound heterozygous for 1-stop gain variant in exon 5 (c.C535T; p.Gln179*) and previously described stop gain variant in exon 9 (c.G906A; p.Trp302*). A mouse model mimicking loss of function in exon 2 of Dcaf17 was generated using CRISPR/Cas9 and showed female subfertility and male infertility. Our results identify 2 novel variants, and show that Dcaf17 plays a significant role in mammalian gonadal development and infertility. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. [Sequence analysis of LEAFY homologous gene from Dendrobium moniliforme and application for identification of medicinal Dendrobium].

    PubMed

    Xing, Wen-Rui; Hou, Bei-Wei; Guan, Jing-Jiao; Luo, Jing; Ding, Xiao-Yu

    2013-04-01

    The LEAFY (LFY) homologous gene of Dendrobium moniliforme (L.) Sw. was cloned by new primers which were designed based on the conservative region of known sequences of orchid LEAFY gene. Partial LFY homologous gene was cloned by common PCR, then we got the complete LFY homologous gene Den LFY by Tail-PCR. The complete sequence of DenLFY gene was 3 575 bp which contained three exons and two introns. Using BLAST method, comparison analysis among the exon of LFY homologous gene indicted that the DenLFY gene had high identity with orchids LFY homologous, including the related fragment of PhalLFY (84%) in Phalaenopsis hybrid cultivar, LFY homologous gene in Oncidium (90%) and in other orchid (over 80%). Using MP analysis, Dendrobium is found to be the sister to Oncidium and Phalaenopsis. Homologous analysis demonstrated that the C-terminal amino acids were highly conserved. When the exons and introns were separately considered, exons and the sequence of amino acid were good markers for the function research of DenLFY gene. The second intron can be used in authentication research of Dendrobium based on the length polymorphism between Dendrobium moniliforme and Dendrobium officinale.

  12. Processing "the" in the Parafovea: Are Articles Skipped Automatically?

    ERIC Educational Resources Information Center

    Angele, Bernhard; Rayner, Keith

    2013-01-01

    One of the words that readers of English skip most often is the definite article "the". Most accounts of reading assume that in order for a reader to skip a word, it must have received some lexical processing. The definite article is skipped so regularly, however, that the oculomotor system might have learned to skip the letter string…

  13. Circular RNAs: Unexpected outputs of many protein-coding genes

    PubMed Central

    Wilusz, Jeremy E.

    2017-01-01

    ABSTRACT Pre-mRNAs from thousands of eukaryotic genes can be non-canonically spliced to generate circular RNAs, some of which accumulate to higher levels than their associated linear mRNA. Recent work has revealed widespread mechanisms that dictate whether the spliceosome generates a linear or circular RNA. For most genes, circular RNA biogenesis via backsplicing is far less efficient than canonical splicing, but circular RNAs can accumulate due to their long half-lives. Backsplicing is often initiated when complementary sequences from different introns base pair and bring the intervening splice sites close together. This process is further regulated by the combinatorial action of RNA binding proteins, which allow circular RNAs to be expressed in unique patterns. Some genes do not require complementary sequences to generate RNA circles and instead take advantage of exon skipping events. It is still unclear what most mature circular RNAs do, but future investigations into their functions will be facilitated by recently described methods to modulate circular RNA levels. PMID:27571848

  14. Transcriptome Meta-Analysis of Lung Cancer Reveals Recurrent Aberrations in NRG1 and Hippo Pathway Genes

    PubMed Central

    Dhanasekaran, Saravana M.; Balbin, O. Alejandro; Chen, Guoan; Nadal, Ernest; Kalyana-Sundaram, Shanker; Pan, Jincheng; Veeneman, Brendan; Cao, Xuhong; Malik, Rohit; Vats, Pankaj; Wang, Rui; Huang, Stephanie; Zhong, Jinjie; Jing, Xiaojun; Iyer, Matthew; Wu, Yi-Mi; Harms, Paul W.; Lin, Jules; Reddy, Rishindra; Brennan, Christine; Palanisamy, Nallasivam; Chang, Andrew C.; Truini, Anna; Truini, Mauro; Robinson, Dan R.; Beer, David G.; Chinnaiyan, Arul M.

    2014-01-01

    Lung cancer is emerging as a paradigm for disease molecular subtyping, facilitating targeted therapy based on driving somatic alterations. Here, we perform transcriptome analysis of 153 samples representing lung adenocarcinomas, squamous cell carcinomas, large cell lung cancer, adenoid cystic carcinomas and cell lines. By integrating our data with The Cancer Genome Atlas and published sources, we analyze 753 lung cancer samples for gene fusions and other transcriptomic alterations. We show that higher numbers of gene fusions is an independent prognostic factor for poor survival in lung cancer. Our analysis confirms the recently reported CD74-NRG1 fusion and suggests that NRG1, NF1 and Hippo pathway fusions may play important roles in tumors without known driver mutations. In addition, we observe exon skipping events in c-MET, which are attributable to splice site mutations. These classes of genetic aberrations may play a significant role in the genesis of lung cancers lacking known driver mutations. PMID:25531467

  15. Brooke-Spiegler syndrome presenting multiple concurrent cutaneous and parotid gland neoplasms: cytologic findings on fine-needle sample and description of a novel mutation of the CYLD gene.

    PubMed

    Malzone, Maria Gabriella; Campanile, Anna Cipolletta; Losito, Nunzia Simona; Longo, Francesco; Perri, Francesco; Caponigro, Francesco; Schiavone, Concetta; Ionna, Franco; Maiello, Francesco; Martinuzzi, Claudia; Nasti, Sabina; Botti, Gerardo; Fulciniti, Franco

    2015-08-01

    Multiple dermal cylindromas and membranous basal cell adenoma of parotid gland in a 67-year-old woman with Brooke-Spiegler syndrome (BSS) were examined by fine-needle cytology. Histology, immunochemistry, and CYLD germline mutation testing were also performed. Cytomorphology and immunochemistry of the two lesions showed basaloid neoplasms, remarkably similar, composed by proliferating epithelial cells of basal type accompanied by a smaller proportion of myoepithelial cells. CYLD gene showed a novel germline splice acceptor site mutation (c.2042-1G>C) with skipping of the entire exon 15. The occurrence of analogous tumors, dermal cylindromas, and membranous basal cell adenoma of the parotid gland, in the same patient may result from the action of a single gene on ontogenetically similar stem cells. Therefore, patients with BSS should be offered a genetic counselling for an early and correct diagnosis. © 2015 Wiley Periodicals, Inc.

  16. Diverse functions of myosin VI elucidated by an isoform-specific α-helix domain

    PubMed Central

    Magistrati, Elisa; Molteni, Erika; Lupia, Michela; Soffientini, Paolo; Rottner, Klemens; Cavallaro, Ugo; Pozzoli, Uberto; Mapelli, Marina; Walters, Kylie J.; Polo, Simona

    2016-01-01

    Myosin VI functions in endocytosis and cell motility. Alternative splicing of myosin VI mRNA generates two distinct isoform types, myosin VIshort and myosin VIlong, which differ in the C-terminal region. Their physiological and pathological role remains unknown. Here we identified an isoform-specific regulatory helix, named α2-linker that defines specific conformations and hence determines the target selectivity of human myosin VI. The presence of the α2-linker structurally defines a novel clathrin-binding domain that is unique to myosin VIlong and masks the known RRL interaction motif. This finding is relevant to ovarian cancer, where alternative myosin VI splicing is aberrantly regulated, and exon skipping dictates cell addiction to myosin VIshort for tumor cell migration. The RRL interactor optineurin contributes to this process by selectively binding myosin VIshort. Thus the α2-linker acts like a molecular switch that assigns myosin VI to distinct endocytic (myosin VIlong) or migratory (myosin VIshort) functional roles. PMID:26950368

  17. Diverse functions of myosin VI elucidated by an isoform-specific α-helix domain.

    PubMed

    Wollscheid, Hans-Peter; Biancospino, Matteo; He, Fahu; Magistrati, Elisa; Molteni, Erika; Lupia, Michela; Soffientini, Paolo; Rottner, Klemens; Cavallaro, Ugo; Pozzoli, Uberto; Mapelli, Marina; Walters, Kylie J; Polo, Simona

    2016-04-01

    Myosin VI functions in endocytosis and cell motility. Alternative splicing of myosin VI mRNA generates two distinct isoform types, myosin VI(short) and myosin VI(long), which differ in the C-terminal region. Their physiological and pathological roles remain unknown. Here we identified an isoform-specific regulatory helix, named the α2-linker, that defines specific conformations and hence determines the target selectivity of human myosin VI. The presence of the α2-linker structurally defines a new clathrin-binding domain that is unique to myosin VI(long) and masks the known RRL interaction motif. This finding is relevant to ovarian cancer, in which alternative myosin VI splicing is aberrantly regulated, and exon skipping dictates cell addiction to myosin VI(short) in tumor-cell migration. The RRL interactor optineurin contributes to this process by selectively binding myosin VI(short). Thus, the α2-linker acts like a molecular switch that assigns myosin VI to distinct endocytic (myosin VI(long)) or migratory (myosin VI(short)) functional roles.

  18. Stabilization of the μ-opioid receptor by truncated single transmembrane splice variants through a chaperone-like action.

    PubMed

    Xu, Jin; Xu, Ming; Brown, Taylor; Rossi, Grace C; Hurd, Yasmin L; Inturrisi, Charles E; Pasternak, Gavril W; Pan, Ying-Xian

    2013-07-19

    The μ-opioid receptor gene, OPRM1, undergoes extensive alternative pre-mRNA splicing, as illustrated by the identification of an array of splice variants generated by both 5' and 3' alternative splicing. The current study reports the identification of another set of splice variants conserved across species that are generated through exon skipping or insertion that encodes proteins containing only a single transmembrane (TM) domain. Using a Tet-Off system, we demonstrated that the truncated single TM variants can dimerize with the full-length 7-TM μ-opioid receptor (MOR-1) in the endoplasmic reticulum, leading to increased expression of MOR-1 at the protein level by a chaperone-like function that minimizes endoplasmic reticulum-associated degradation. In vivo antisense studies suggested that the single TM variants play an important role in morphine analgesia, presumably through modulation of receptor expression levels. Our studies suggest the functional roles of truncated receptors in other G protein-coupled receptor families.

  19. Diagnosis of Xeroderma pigmentosum variant in a young patient with two novel mutations in the POLH gene.

    PubMed

    De Palma, Armando; Morren, Marie-Anne; Ged, Cécile; Pouvelle, Caroline; Taïeb, Alain; Aoufouchi, Said; Sarasin, Alain

    2017-09-01

    We describe the characterization of Xeroderma Pigmentosum variant (XPV) in a young Caucasian patient with phototype I, who exhibited a high sensitivity to sunburn and multiple cutaneous tumors at the age of 15 years. Two novel mutations in the POLH gene, which encodes the translesion DNA polymerase η, with loss of function due to two independent exon skippings, are reported to be associated as a compound heterozygous state in the patient. Western blot analysis performed on proteins from dermal fibroblasts derived from the patient and analysis of the mutation spectrum on immunoglobulin genes produced during the somatic hypermutation process in his memory B cells, show the total absence of translesion polymerase η activity in the patient. The total lack of Polη activity, necessary to bypass in an error-free manner UVR-induced pyrimidine dimers following sun exposure, explains the early unusual clinical appearance of this patient. © 2017 Wiley Periodicals, Inc.

  20. Mutations of the RTEL1 Helicase in a Hoyeraal-Hreidarsson Syndrome Patient Highlight the Importance of the ARCH Domain.

    PubMed

    Jullien, Laurent; Kannengiesser, Caroline; Kermasson, Laetitia; Cormier-Daire, Valérie; Leblanc, Thierry; Soulier, Jean; Londono-Vallejo, Arturo; de Villartay, Jean-Pierre; Callebaut, Isabelle; Revy, Patrick

    2016-05-01

    The DNA helicase RTEL1 participates in telomere maintenance and genome stability. Biallelic mutations in the RTEL1 gene account for the severe telomere biology disorder characteristic of the Hoyeraal-Hreidarsson syndrome (HH). Here, we report a HH patient (P4) carrying two novel compound heterozygous mutations in RTEL1: a premature stop codon (c.949A>T, p.Lys317*) and an intronic deletion leading to an exon skipping and an in-frame deletion of 25 amino-acids (p.Ile398_Lys422). P4's cells exhibit short and dysfunctional telomeres similarly to other RTEL1-deficient patients. 3D structure predictions indicated that the p.Ile398_Lys422 deletion affects a part of the helicase ARCH domain, which lines the pore formed with the core HD and the iron-sulfur cluster domains and is highly specific of sequences from the eukaryotic XPD family members. © 2016 WILEY PERIODICALS, INC.

  1. Selection response to DNA testing for canine ceroid lipofuscinosis in Tibetan terriers.

    PubMed

    Kluth, Susanne; Eckardt, Judith; Distl, Ottmar

    2014-09-01

    A late onset form of canine ceroid lipofuscinosis (CCL) is prevalent in Tibetan terriers. The disease is inherited as a monogenic recessive trait caused by aberrant exon skipping in ATP13A2. The aim of the present study was to analyse the frequencies of this mutation in Tibetan terriers registered with the German club for Tibetan dog breeds (Internationaler Klub für Tibetische Hunderassen, KTR) from 1987 to 2012 and to determine responses to selection following the introduction of DNA testing in 2010. The study included DNA extracted from blood samples from 1120/1240 (90.3%) Tibetan terriers registered with the KTR, including 405/420 (96.4%) registered breeding dogs. Mutant allele frequencies before the introduction of DNA testing were 0.20-0.28 in the registered and breeding dog populations, respectively, decreasing to 0.09 and 0.14, respectively, following the introduction of DNA testing. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Social Inequalities in Young Children’s Meal Skipping Behaviors: The Generation R Study

    PubMed Central

    Wijtzes, Anne I.; Jansen, Wilma; Jaddoe, Vincent W. V.; Franco, Oscar H.; Hofman, Albert; van Lenthe, Frank J.; Raat, Hein

    2015-01-01

    Background Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. Methods We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Results Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Conclusion Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children’s meal skipping behaviors is warranted. PMID:26225757

  3. Social Inequalities in Young Children's Meal Skipping Behaviors: The Generation R Study.

    PubMed

    Wijtzes, Anne I; Jansen, Wilma; Jaddoe, Vincent W V; Franco, Oscar H; Hofman, Albert; van Lenthe, Frank J; Raat, Hein

    2015-01-01

    Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children's meal skipping behaviors is warranted.

  4. Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population

    PubMed Central

    Kutsuma, Ayano; Suwa, Kaname

    2014-01-01

    Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20–75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08–1.28), P = 0.0003, and 1.37 (1.24–1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population. PMID:24982814

  5. Television viewing, computer game play and book reading during meals are predictors of meal skipping in a cross-sectional sample of 12-, 14- and 16-year-olds.

    PubMed

    Custers, Kathleen; Van den Bulck, Jan

    2010-04-01

    To examine whether television viewing, computer game playing or book reading during meals predicts meal skipping with the aim of watching television, playing computer games or reading books (media meal skipping). A cross-sectional study was conducted using a standardized self-administered questionnaire. Analyses were controlled for age, gender and BMI. Data were obtained from a random sample of adolescents in Flanders, Belgium. Seven hundred and ten participants aged 12, 14 and 16 years. Of the participants, 11.8 % skipped meals to watch television, 10.5 % skipped meals to play computer games and 8.2 % skipped meals to read books. Compared with those who did not use these media during meals, the risk of skipping meals in order to watch television was significantly higher for those children who watched television during meals (2.9 times higher in those who watched television during at least one meal a day). The risk of skipping meals for computer game playing was 9.5 times higher in those who played computer games weekly or more while eating, and the risk of meal skipping in order to read books was 22.9 times higher in those who read books during meals less than weekly. The more meals the respondents ate with the entire family, the less likely they were to skip meals to watch television. The use of media during meals predicts meal skipping for using that same medium. Family meals appear to be inversely related to meal skipping for television viewing.

  6. Hyb-Seq: Combining target enrichment and genome skimming for plant phylogenomics1

    PubMed Central

    Weitemier, Kevin; Straub, Shannon C. K.; Cronn, Richard C.; Fishbein, Mark; Schmickl, Roswitha; McDonnell, Angela; Liston, Aaron

    2014-01-01

    • Premise of the study: Hyb-Seq, the combination of target enrichment and genome skimming, allows simultaneous data collection for low-copy nuclear genes and high-copy genomic targets for plant systematics and evolution studies. • Methods and Results: Genome and transcriptome assemblies for milkweed (Asclepias syriaca) were used to design enrichment probes for 3385 exons from 768 genes (>1.6 Mbp) followed by Illumina sequencing of enriched libraries. Hyb-Seq of 12 individuals (10 Asclepias species and two related genera) resulted in at least partial assembly of 92.6% of exons and 99.7% of genes and an average assembly length >2 Mbp. Importantly, complete plastomes and nuclear ribosomal DNA cistrons were assembled using off-target reads. Phylogenomic analyses demonstrated signal conflict between genomes. • Conclusions: The Hyb-Seq approach enables targeted sequencing of thousands of low-copy nuclear exons and flanking regions, as well as genome skimming of high-copy repeats and organellar genomes, to efficiently produce genome-scale data sets for phylogenomics. PMID:25225629

  7. Nanopolymers improve delivery of exon skipping oligonucleotides and concomitant dystrophin expression in skeletal muscle of mdx mice

    PubMed Central

    Williams, Jason H; Schray, Rebecca C; Sirsi, Shashank R; Lutz, Gordon J

    2008-01-01

    Background Exon skipping oligonucleotides (ESOs) of 2'O-Methyl (2'OMe) and morpholino chemistry have been shown to restore dystrophin expression in muscle fibers from the mdx mouse, and are currently being tested in phase I clinical trials for Duchenne Muscular Dystrophy (DMD). However, ESOs remain limited in their effectiveness because of an inadequate delivery profile. Synthetic cationic copolymers of poly(ethylene imine) (PEI) and poly(ethylene glycol) (PEG) are regarded as effective agents for enhanced delivery of nucleic acids in various applications. Results We examined whether PEG-PEI copolymers can facilitate ESO-mediated dystrophin expression after intramuscular injections into tibialis anterior (TA) muscles of mdx mice. We utilized a set of PEG-PEI copolymers containing 2 kDa PEI and either 550 Da or 5 kDa PEG, both of which bind 2'OMe ESOs with high affinity and form stable nanoparticulates with a relatively low surface charge. Three weekly intramuscular injections of 5 μg of ESO complexed with PEI2K-PEG550 copolymers resulted in about 500 dystrophin-positive fibers and about 12% of normal levels of dystrophin expression at 3 weeks after the initial injection, which is significantly greater than for injections of ESO alone, which are known to be almost completely ineffective. In an effort to enhance biocompatibility and cellular uptake, the PEI2K-PEG550 and PEI2K-PEG5K copolymers were functionalized by covalent conjugation with nanogold (NG) or adsorbtion of colloidal gold (CG), respectively. Surprisingly, using the same injection and dosing regimen, we found no significant difference in dystrophin expression by Western blot between the NG-PEI2K-PEG550, CG-PEI2K-PEG5K, and non-functionalized PEI2K-PEG550 copolymers. Dose-response experiments using the CG-PEI2K-PEG5K copolymer with total ESO ranging from 3–60 μg yielded a maximum of about 15% dystrophin expression. Further improvements in dystrophin expression up to 20% of normal levels were found at 6 weeks after 10 twice-weekly injections of the NG-PEI2K-PEG550 copolymer complexed with 5 μg of ESO per injection. This injection and dosing regimen showed over 1000 dystrophin-positive fibers. H&E staining of all treated muscle groups revealed no overt signs of cytotoxicity. Conclusion We conclude that PEGylated PEI2K copolymers are efficient carriers for local delivery of 2'OMe ESOs and warrant further development as potential therapeutics for treatment of DMD. PMID:18384691

  8. Photos

    Science.gov Websites

    Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Los Alamos National Laboratory Search Site submit About Mission Business Newsroom Publications Los Alamos National Innovation Research Capabilities Deploying Innovation Technology Opportunities Innovation in New Mexico Los

  9. Newsroom

    Science.gov Websites

    Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Los Alamos National Laboratory Search Site submit About Mission Business Newsroom Publications Los Alamos National Innovation Research Capabilities Deploying Innovation Technology Opportunities Innovation in New Mexico Los

  10. Platinum coat color in red fox (Vulpes vulpes) is caused by a mutation in an autosomal copy of KIT.

    PubMed

    Johnson, J L; Kozysa, A; Kharlamova, A V; Gulevich, R G; Perelman, P L; Fong, H W F; Vladimirova, A V; Oskina, I N; Trut, L N; Kukekova, A V

    2015-04-01

    The red fox (Vulpes vulpes) demonstrates a variety of coat colors including platinum, a common phenotype maintained in farm-bred fox populations. Foxes heterozygous for the platinum allele have a light silver coat and extensive white spotting, whereas homozygosity is embryonic lethal. Two KIT transcripts were identified in skin cDNA from platinum foxes. The long transcript was identical to the KIT transcript of silver foxes, whereas the short transcript, which lacks exon 17, was specific to platinum. The KIT gene has several copies in the fox genome: an autosomal copy on chromosome 2 and additional copies on the B chromosomes. To identify the platinum-specific KIT sequence, the genomes of one platinum and one silver fox were sequenced. A single nucleotide polymorphism (SNP) was identified at the first nucleotide of KIT intron 17 in the platinum fox. In platinum foxes, the A allele of the SNP disrupts the donor splice site and causes exon 17, which is part of a segment that encodes a conserved tyrosine kinase domain, to be skipped. Complete cosegregation of the A allele with the platinum phenotype was confirmed by linkage mapping (LOD 25.59). All genotyped farm-bred platinum foxes from Russia and the US were heterozygous for the SNP (A/G), whereas foxes with different coat colors were homozygous for the G allele. Identification of the platinum mutation suggests that other fox white-spotting phenotypes, which are allelic to platinum, would also be caused by mutations in the KIT gene. © 2015 Stichting International Foundation for Animal Genetics.

  11. Transcriptome Bioinformatical Analysis of Vertebrate Stages of Schistosoma japonicum Reveals Alternative Splicing Events

    PubMed Central

    Wang, Xinye; Xu, Xindong; Lu, Xingyu; Zhang, Yuanbin; Pan, Weiqing

    2015-01-01

    Alternative splicing is a molecular process that contributes greatly to the diversification of proteome and to gene functions. Understanding the mechanisms of stage-specific alternative splicing can provide a better understanding of the development of eukaryotes and the functions of different genes. Schistosoma japonicum is an infectious blood-dwelling trematode with a complex lifecycle that causes the tropical disease schistosomiasis. In this study, we analyzed the transcriptome of Schistosoma japonicum to discover alternative splicing events in this parasite, by applying RNA-seq to cDNA library of adults and schistosomula. Results were validated by RT-PCR and sequencing. We found 11,623 alternative splicing events among 7,099 protein encoding genes and average proportion of alternative splicing events per gene was 42.14%. We showed that exon skip is the most common type of alternative splicing events as found in high eukaryotes, whereas intron retention is the least common alternative splicing type. According to intron boundary analysis, the parasite possesses same intron boundaries as other organisms, namely the classic “GT-AG” rule. And in alternative spliced introns or exons, this rule is less strict. And we have attempted to detect alternative splicing events in genes encoding proteins with signal peptides and transmembrane helices, suggesting that alternative splicing could change subcellular locations of specific gene products. Our results indicate that alternative splicing is prevalent in this parasitic worm, and that the worm is close to its hosts. The revealed secretome involved in alternative splicing implies new perspective into understanding interaction between the parasite and its host. PMID:26407301

  12. A base substitution in the donor site of intron 12 of KIT gene is responsible for the dominant white coat colour of blue fox (Alopex lagopus).

    PubMed

    Yan, S Q; Hou, J N; Bai, C Y; Jiang, Y; Zhang, X J; Ren, H L; Sun, B X; Zhao, Z H; Sun, J H

    2014-04-01

    The dominant white coat colour of farmed blue fox is inherited as a monogenic autosomal dominant trait and is suggested to be embryonic lethal in the homozygous state. In this study, the transcripts of KIT were identified by RT-PCR for a dominant white fox and a normal blue fox. Sequence analysis showed that the KIT transcript in normal blue fox contained the full-length coding sequence of 2919 bp (GenBank Acc. No KF530833), but in the dominant white individual, a truncated isoform lacking the entire exon 12 specifically co-expressed with the normal transcript. Genomic DNA sequencing revealed that a single nucleotide polymorphism (c.1867+1G>T) in intron 12 appeared only in the dominant white individuals and a 1-bp ins/del polymorphism in the same intron showed in individuals representing two different coat colours. Genotyping results of the SNP with PCR-RFLP in 185 individuals showed all 90 normal blue foxes were homozygous for the G allele, and all dominant white individuals were heterozygous. Due to the truncated protein with a deletion of 35 amino acids and an amino acid replacement (p.Pro623Ala) located in the conserved ATP binding domain, we propose that the mutant receptor had absent tyrosine kinase activity. These findings reveal that the base substitution at the first nucleotide of intron 12 of KIT gene, resulting in skipping of exon 12, is a causative mutation responsible for the dominant white phenotype of blue fox. © 2013 Stichting International Foundation for Animal Genetics.

  13. Genome-Wide Associations of CD46 and IFI44L Genetic Variants with Neutralizing Antibody Response to Measles Vaccine

    PubMed Central

    Haralambieva, Iana H.; Ovsyannikova, Inna G.; Kennedy, Richard B.; Larrabee, Beth R.; Zimmermann, Michael T.; Grill, Diane E.; Schaid, Daniel J.; Poland, Gregory A.

    2017-01-01

    Background Population-based studies have revealed 2 to 10% measles vaccine failure rate even after two vaccine doses. While the mechanisms behind this remain unknown, we hypothesized that host genetic factors are likely to be involved. Methods We performed a genome-wide association study of measles specific neutralizing antibody and IFNγ ELISPOT response in a combined sample of 2,872 subjects. Results We identified two distinct chromosome 1 regions (previously associated with MMR-related febrile seizures), associated with vaccine-induced measles neutralizing antibody titers. The 1q32 region contained 20 significant SNPs in/around the measles virus receptor-encoding CD46 gene, including the intronic rs2724384 (p-value = 2.64x10−09) and rs2724374 (p-value = 3.16x10−09) SNPs. The 1q31.1 region contained nine significant SNPs in/around IFI44L, including the intronic rs1333973 (p-value = 1.41x10−10) and the missense rs273259 (His73Arg, p-value = 2.87x10−10) SNPs. Analysis of differential exon usage with mRNA-Seq data and RT-PCR suggests the involvement of rs2724374 minor G allele in the CD46 STP region exon B skipping, resulting in shorter CD46 isoforms. Conclusions Our study reveals common CD46 and IFI44L SNPs associated with measles-specific humoral immunity, and highlights the importance of alternative splicing/virus cellular receptor isoform usage as a mechanism explaining inter-individual variation in immune response after live measles vaccine. PMID:28289848

  14. Delineation of C12orf65-related phenotypes: a genotype-phenotype relationship.

    PubMed

    Spiegel, Ronen; Mandel, Hanna; Saada, Ann; Lerer, Issy; Burger, Ayala; Shaag, Avraham; Shalev, Stavit A; Jabaly-Habib, Haneen; Goldsher, Dorit; Gomori, John M; Lossos, Alex; Elpeleg, Orly; Meiner, Vardiella

    2014-08-01

    C12orf65 participates in the process of mitochondrial translation and has been shown to be associated with a spectrum of phenotypes, including early onset optic atrophy, progressive encephalomyopathy, peripheral neuropathy, and spastic paraparesis.We used whole-genome homozygosity mapping as well as exome sequencing and targeted gene sequencing to identify novel C12orf65 disease-causing mutations in seven affected individuals originating from two consanguineous families. In four family members affected with childhood-onset optic atrophy accompanied by slowly progressive peripheral neuropathy and spastic paraparesis, we identified a homozygous frame shift mutation c.413_417 delAACAA, which predicts a truncated protein lacking the C-terminal portion. In the second family, we studied three affected individuals who presented with early onset optic atrophy, peripheral neuropathy, and spastic gait in addition to moderate intellectual disability. Muscle biopsy in two of the patients revealed decreased activities of the mitochondrial respiratory chain complexes I and IV. In these patients, we identified a homozygous splice mutation, g.21043 T>A (c.282+2 T>A) which leads to skipping of exon 2. Our study broadens the phenotypic spectrum of C12orf65 defects and highlights the triad of optic atrophy, axonal neuropathy and spastic paraparesis as its key clinical features. In addition, a clear genotype-phenotype correlation is anticipated in which deleterious mutations which disrupt the GGQ-containing domain in the first coding exon are expected to result in a more severe phenotype, whereas down-stream C-terminal mutations may result in a more favorable phenotype, typically lacking cognitive impairment.

  15. Maternal and best friends' influences on meal-skipping behaviours.

    PubMed

    Pearson, Natalie; Williams, Lauren; Crawford, David; Ball, Kylie

    2012-09-01

    Skipping meals is particularly common during adolescence and can have a detrimental effect on multiple aspects of adolescent health. Understanding the correlates of meal-skipping behaviours is important for the design of nutrition interventions. The present study examined maternal and best friends' influences on adolescent meal-skipping behaviours. Frequency of skipping breakfast, lunch and dinner was assessed using a Web-based survey completed by 3001 adolescent boys and girls from years 7 and 9 of secondary schools in Victoria, Australia. Perceived best friend and maternal meal skipping, modelling of healthy eating (eating healthy food, limiting junk food, eating fruit and vegetables) and weight watching were assessed. Best friend and maternal factors were differentially associated with meal-skipping behaviours. For example, boys and girls who perceived that their best friend often skipped meals were more likely to skip lunch (OR = 2·01, 95 % CI 1·33, 3·04 and OR = 1·93, 95 % CI 1·41, 2·65; P < 0·001). Boys and girls who perceived that their mother often skipped meals were more likely to skip breakfast (OR = 1·48, 95 % CI 1·01, 2·15; P < 0·05 and OR = 1·93, 95 % CI 1·42, 2·59; P < 0·001) and lunch (OR = 2·05, 95 % CI 1·35, 3·12 and OR = 2·02, 95 % CI 1·43, 2·86; P < 0·001). Educating adolescents on how to assess and interpret unhealthy eating behaviours that they observe from significant others may be one nutrition promotion strategy to reduce meal-skipping behaviour. The involvement of mothers may be particularly important in such efforts. Encouraging a peer subculture that promotes regular consumption of meals and educates adolescents on the detrimental impact of meal-skipping behaviour on health may also offer a promising nutrition promotion strategy.

  16. A phase II trial of regorafenib in patients with metastatic and/or a unresectable gastrointestinal stromal tumor harboring secondary mutations of exon 17.

    PubMed

    Yeh, Chun-Nan; Chen, Ming-Huang; Chen, Yen-Yang; Yang, Ching-Yao; Yen, Chueh-Chuan; Tzen, Chin-Yuan; Chen, Li-Tzong; Chen, Jen-Shi

    2017-07-04

    Gastrointestinal stromal tumors (GISTs) are caused by the constitutive activation of KIT or platelet-derived growth factor receptor alpha (PDGFRA) mutations. Imatinib selectively inhibits KIT and PDGFR, leading to disease control for 80%-90% of patients with metastatic GIST. Imatinib resistance can occur within a median of 2-3 years due to secondary mutations in KIT. According to preclinical studies, both imatinib and sunitinib are ineffective against exon 17 mutations. However, the treatment efficacy of regorafenib for patients with GIST with exon 17 mutations is still unknown. Documented patients with GIST with exon 17 mutations were enrolled in this study. Patients received 160 mg of oral regorafenib daily on days 1-21 of a 28-day cycle. The primary end point of this trial was the clinical benefit rate (CBR; i.e., complete or partial response [PR], as well as stable disease [SD]) at 16 weeks. The secondary end points of this study included progression free survival (PFS), overall survival, and safety. Between June 2014 to May 2016, 18 patients were enrolled (15 of which were eligible for response evaluation). The CBR at 16 weeks was 93.3% (14 of 15; 6 PR and 8 SD). The median PFS was 22.1 months. The most common grade 3 toxicities were hand-and-foot skin reactions (10 of 18; 55.6%), followed by hypertension (5 of 18; 27.8%). Regorafenib significantly prolonged PFS in patients with advanced GIST harboring secondary mutations of exon 17. A phase III trial of regorafenib versus placebo is warranted. This trial is registered at ClinicalTrials.gov in November 2015, number NCT02606097.Key message: This phase II trial was conducted to assess the efficacy and safety of regorafenib in patients with GIST with exon 17 mutations. The results provide strong evidence that regorafenib significantly prolonged PFS in patients with advanced GIST harboring secondary mutations of exon 17.

  17. Stability in skipping gaits

    NASA Astrophysics Data System (ADS)

    Andrada, Emanuel; Müller, Roy; Blickhan, Reinhard

    2016-11-01

    As an alternative to walking and running, humans are able to skip. However, adult humans avoid it. This fact seems to be related to the higher energetic costs associated with skipping. Still, children, some birds, lemurs and lizards use skipping gaits during daily locomotion. We combined experimental data on humans with numerical simulations to test whether stability and robustness motivate this choice. Parameters for modelling were obtained from 10 male subjects. They locomoted using unilateral skipping along a 12 m runway. We used a bipedal spring loaded inverted pendulum to model and to describe the dynamics of skipping. The subjects displayed higher peak ground reaction forces and leg stiffness in the first landing leg (trailing leg) compared to the second landing leg (leading leg). In numerical simulations, we found that skipping is stable across an amazing speed range from skipping on the spot to fast running speeds. Higher leg stiffness in the trailing leg permits longer strides at same system energy. However, this strategy is at the same time less robust to sudden drop perturbations than skipping with a stiffer leading leg. A slightly higher stiffness in the leading leg is most robust, but might be costlier.

  18. Processing the in the parafovea: are articles skipped automatically?

    PubMed

    Angele, Bernhard; Rayner, Keith

    2013-03-01

    One of the words that readers of English skip most often is the definite article the. Most accounts of reading assume that in order for a reader to skip a word, it must have received some lexical processing. The definite article is skipped so regularly, however, that the oculomotor system might have learned to skip the letter string t-h-e automatically. We tested whether skipping of articles in English is sensitive to context information or whether it is truly automatic in the sense that any occurrence of the letter string the will trigger a skip. This was done using the gaze-contingent boundary paradigm (Rayner, 1975) to provide readers with false parafoveal previews of the article the. All experimental sentences contained a short target verb, the preview of which could be correct (i.e., identical to the actual subsequent word in the sentence; e.g., ace), a nonword (tda), or an infelicitous article preview (the). Our results indicated that readers tended to skip the infelicitous the previews frequently, suggesting that, in many cases, they seemed to be unable to detect the syntactic anomaly in the preview and based their skipping decision solely on the orthographic properties of the article. However, there was some evidence that readers sometimes detected the anomaly, as they also showed increased skipping of the pretarget word in the the preview condition. (c) 2013 APA, all rights reserved.

  19. Monitoring pyrethroid insecticide resistance in major malaria vector Anopheles culicifacies: comparison of molecular tools and conventional susceptibility test.

    PubMed

    Djadid, Navid Dinparast; Forouzesh, Flora; Karimi, Mohsen; Raeisi, Ahmad; Hassan-Zehi, Abdoulghaffar; Zakeri, Sedigheh

    2007-07-01

    Anopheles culicifacies is a main malaria vector in southeastern part of Iran, bordring Afghanistan and Pakistan. So far, resistance to DDT, dieldrin, malathion and partial tolerance to pyrethroids has been reported in An. stephensi, but nothing confirmed on resistance status of An. culicifacies in Iran. In current study, along with WHO routine susceptibility test with DDT (4%), dieldrin (0.4%), malathion (5%), permethrin (0.25%), lambadacyhalothrin (0.1%), and deltamethrin 0.025, we cloned and sequenced segment VI of domain II (SII6) in voltage-gated sodium channel (vgsc) gene of An. culicifacies specimens collected in Sistan and Baluchistan province (Iran). A 221-bp amplified fragment showed 91% and 93% similarity with exon I and exon II of An. gambiae. The size of intron II in An. culicifacies is 62 bp, while in An. gambiae is 57 bp. The major difference within An. culicifacies specimens and also with An. gambiae is in position 29 of exon I, which led to substitution of Leu to His amino acid. This data will act as first report on partial sequence of vgsc gene and its polymorphism in An. culicifacies. A Leu to His amino acid substitution detected upstream the formerly known knockdown resistance (kdr) mutation site could be an indication for other possible mutations related to insecticide resistance. However, the result of WHO susceptibility test carried out in Baluchistan of Iran revealed a level of tolerance to DDT and dieldrin, but almost complete susceptibility to pyrethroids in An. culicifacies. We postulate that the molecular diagnostic tool developed for detection and identification of kdr-related mutations in An. culicifacies, could be useful in monitoring insecticide resistance in Iran and neighbouring countries such as Pakistan and Afghanistan. A phylogenetic tree also constructed based on the sequence of exon I and II, which readily separated An. culicifacies populations from An. stephensi, An. fluviatilis and An. gambiae.

  20. Chromosomal localization and partial genomic structure of the human peroxisome proliferator activated receptor-gamma (hPPAR gamma) gene.

    PubMed

    Beamer, B A; Negri, C; Yen, C J; Gavrilova, O; Rumberger, J M; Durcan, M J; Yarnall, D P; Hawkins, A L; Griffin, C A; Burns, D K; Roth, J; Reitman, M; Shuldiner, A R

    1997-04-28

    We determined the chromosomal localization and partial genomic structure of the coding region of the human PPAR gamma gene (hPPAR gamma), a nuclear receptor important for adipocyte differentiation and function. Sequence analysis and long PCR of human genomic DNA with primers that span putative introns revealed that intron positions and sizes of hPPAR gamma are similar to those previously determined for the mouse PPAR gamma gene[13]. Fluorescent in situ hybridization localized hPPAR gamma to chromosome 3, band 3p25. Radiation hybrid mapping with two independent primer pairs was consistent with hPPAR gamma being within 1.5 Mb of marker D3S1263 on 3p25-p24.2. These sequences of the intron/exon junctions of the 6 coding exons shared by hPPAR gamma 1 and hPPAR gamma 2 will facilitate screening for possible mutations. Furthermore, D3S1263 is a suitable polymorphic marker for linkage analysis to evaluate PPAR gamma's potential contribution to genetic susceptibility to obesity, lipoatrophy, insulin resistance, and diabetes.

  1. Impairment of different protein domains causes variable clinical presentation within Pitt-Hopkins syndrome and suggests intragenic molecular syndromology of TCF4.

    PubMed

    Bedeschi, Maria Francesca; Marangi, Giuseppe; Calvello, Maria Rosaria; Ricciardi, Stefania; Leone, Francesca Pia Chiara; Baccarin, Marco; Guerneri, Silvana; Orteschi, Daniela; Murdolo, Marina; Lattante, Serena; Frangella, Silvia; Keena, Beth; Harr, Margaret H; Zackai, Elaine; Zollino, Marcella

    2017-11-01

    Pitt-Hopkins syndrome is a neurodevelopmental disorder characterized by severe intellectual disability and a distinctive facial gestalt. It is caused by haploinsufficiency of the TCF4 gene. The TCF4 protein has different functional domains, with the NLS (nuclear localization signal) domain coded by exons 7-8 and the bHLH (basic Helix-Loop-Helix) domain coded by exon 18. Several alternatively spliced TCF4 variants have been described, allowing for translation of variable protein isoforms. Typical PTHS patients have impairment of at least the bHLH domain. To which extent impairment of the remaining domains contributes to the final phenotype is not clear. There is recent evidence that certain loss-of-function variants disrupting TCF4 are associated with mild ID, but not with typical PTHS. We describe a frameshift-causing partial gene deletion encompassing exons 4-6 of TCF4 in an adult patient with mild ID and nonspecific facial dysmorphisms but without the typical features of PTHS, and a c.520C > T nonsense variant within exon 8 in a child presenting with a severe phenotype largely mimicking PTHS, but lacking the typical facial dysmorphism. Investigation on mRNA, along with literature review, led us to suggest a preliminary phenotypic map of loss-of-function variants affecting TCF4. An intragenic phenotypic map of loss-of-function variants in TCF4 is suggested here for the first time: variants within exons 1-4 and exons 4-6 give rise to a recurrent phenotype with mild ID not in the spectrum of Pitt-Hopkins syndrome (biallelic preservation of both the NLS and bHLH domains); variants within exons 7-8 cause a severe phenotype resembling PTHS but in absence of the typical facial dysmorphism (impairment limited to the NLS domain); variants within exons 9-19 cause typical Pitt-Hopkins syndrome (impairment of at least the bHLH domain). Understanding the TCF4 molecular syndromology can allow for proper nosology in the current era of whole genomic investigations. Copyright © 2017. Published by Elsevier Masson SAS.

  2. Dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor T790M mutation: A case report

    PubMed Central

    Uemura, Takehiro; Oguri, Tetsuya; Okayama, Minami; Furuta, Hiromi; Kanemitsu, Yoshihiro; Takakuwa, Osamu; Ohkubo, Hirotsugu; Takemura, Masaya; Maeno, Ken; Ito, Yutaka; Niimi, Akio

    2017-01-01

    We herein report a case of dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor (EGFR) T790M mutation encoded in exon 20. The patient was a 59-year-old woman with EGFR exon 19 deletion-positive lung adenocarcinoma, who relapsed with multiple brain metastases. Computed tomography-guided biopsy of the left pleural tumor revealed adenocarcinoma harboring an EGFR exon 19 deletion and an EGFR T790M mutation encoded in exon 20. The patient was treated with osimertinib, a third-generation EGFR tyrosine kinase inhibitor. Two days after treatment initiation, the patient displayed profound disturbance of consciousness, possibly due to carcinomatous meningitis, and treatment had to be discontinued due to difficulty in taking osimertinib. However, the patient gradually started to recover consciousness and, after 3 days, she was again able to take osimertinib. One month after the initiation of osimertinib treatment, magnetic resonance imaging revealed an apparent reduction in brain metastases. The patient is currently under continued treatment with osimertinib. At the last follow-up (February, 2017) she exhibited partial response to the treatment. PMID:28413660

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerr, J.M.; Fisher, L.W.; Termine, J.D.

    The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less

  4. CINT - Center for Integrated Nanotechnologies

    Science.gov Websites

    Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Search Site submit Facilities Discovery Platform Integration Lab User Facilities LUMOS Research Science Thrusts Integration Challenges Accepted User Proposals Data Management Becoming a User Call for Proposals Proposal Guidelines

  5. A protocol of rope skipping exercise for primary school children: A pilot test

    NASA Astrophysics Data System (ADS)

    Radzi, A. N. M.; Rambely, A. S.; Chellapan, K.

    2014-06-01

    This paper aims to investigate the methods and sample used in rope skipping as an exercise approach. A systematic literature review was approached in identifying skipping performance in the related researches. The methods were compared to determine the best methodological approach for the targeted skipping based research measure. A pilot test was performed among seven students below 12 years old. As the outcome of the review, a skipping protocol design has been proposed for 10 years old primary school students. The proposed protocol design is to be submitted to PPUKM Ethical Committee for approval prior to its implementation in investigation memory enhancement in relation to designed skipping activities.

  6. The effect of high- and low-frequency previews and sentential fit on word skipping during reading

    PubMed Central

    Angele, Bernhard; Laishley, Abby; Rayner, Keith; Liversedge, Simon P.

    2014-01-01

    In a previous gaze-contingent boundary experiment, Angele and Rayner (2012) found that readers are likely to skip a word that appears to be the definite article the even when syntactic constraints do not allow for articles to occur in that position. In the present study, we investigated whether the word frequency of the preview of a three-letter target word influences a reader’s decision to fixate or skip that word. We found that the word frequency rather than the felicitousness (syntactic fit) of the preview affected how often the upcoming word was skipped. These results indicate that visual information about the upcoming word trumps information from the sentence context when it comes to making a skipping decision. Skipping parafoveal instances of the therefore may simply be an extreme case of skipping high-frequency words. PMID:24707791

  7. The Relation between Breakfast Skipping and School Performance in Adolescents

    ERIC Educational Resources Information Center

    Boschloo, Annemarie; Ouwehand, Carolijn; Dekker, Sanne; Lee, Nikki; de Groot, Renate; Krabbendam, Lydia; Jolles, Jelle

    2012-01-01

    Breakfast skipping is common in adolescents, but research on the effects of breakfast skipping on school performance is scarce. This current cross-sectional survey study of 605 adolescents aged 11-18 years investigated whether adolescents who habitually skip breakfast have lower end-of-term grades than adolescents who eat breakfast daily.…

  8. Is snack consumption associated with meal skipping in children and adolescents? The CASPIAN-IV study.

    PubMed

    Kelishadi, Roya; Mozafarian, Nafiseh; Qorbani, Mostafa; Motlagh, Mohammad Esmaeil; Safiri, Saeid; Ardalan, Gelayol; Keikhah, Mojtaba; Rezaei, Fatemeh; Heshmat, Ramin

    2017-06-01

    The present inquiry set to assess the relationship between snack consumption and meal skipping in Iranian children and adolescents. Overall, 14,880 students, aged 6-18 years, were selected via multistage cluster sampling method from rural and urban areas of 30 provinces of Iran. A validated questionnaire of food behaviors including questions on snacks consumption and taking/skipping meals was completed. Consuming and skipping meals and their related factors were reported in both crude and adjusted models. Overall, 13,486 students with a mean age of 12.47 ± 3.36 years completed the study (90.6% participation rate). Among them, 32.08, 8.89, and 10.90% skipped breakfast, lunch, and dinner, respectively. Compared to their counterpart groups, the frequency of meal skipping was higher in girls, urban inhabitants, and students in higher school grades (P < 0.05). Snack consumption was associated with an increased odds ratio of meal skipping in many types of snack groups. Meal skipping and snack consumption were frequent among Iranian children and adolescents. Evidence based interventions are proposed to improve the students' eating habits.

  9. Ten Novel Mutations in Chinese Patients with Megalencephalic Leukoencephalopathy with Subcortical Cysts and a Long-Term Follow-Up Research

    PubMed Central

    Cao, Binbin; Yan, Huifang; Guo, Mangmang; Xie, Han; Wu, Ye; Gu, Qiang; Xiao, Jiangxi; Shang, Jing; Yang, Yanling; Xiong, Hui; Niu, Zhengping; Wu, Xiru; Jiang, Yuwu; Wang, Jingmin

    2016-01-01

    Objective Megalencephalic leukoencephalopathy with subcortical cysts (MLC, OMIM 604004) is a rare neurological deterioration disease. We aimed to clarify clinical and genetic features of Chinese MLC patients. Methods Clinical information and peripheral venous blood of 20 patients and their families were collected, Sanger-sequencing and Multiple Ligation-dependent Probe Amplification were performed to make genetic analysis. Splicing-site mutation was confirmed with RT-PCR. UPD was detected by haplotype analysis. Follow-up study was performed through telephone for 27 patients. Results Out of 20 patients, macrocephaly, classic MRI features, motor development delay and cognitive impairment were detected in 20(100%), 20(100%), 17(85%) and 4(20%) patients, respectively. 20(100%) were clinically diagnosed with MLC. 19(95%) were genetically diagnosed with 10 novel mutations in MLC1, MLC1 and GlialCAM mutations were identified in 15 and 4 patients, respectively. Deletion mutation from exon4 to exon9 and a homozygous point mutation due to maternal UPD of chromosome22 in MLC1 were found firstly. c.598-2A>C in MLC1 leads to the skip of exon8. c.772-1G>C in MLC1 accounting for 15.5%(9/58) alleles in Chinese patients might be a founder or a hot-spot mutation. Out of 27 patients in the follow-up study, head circumference was ranged from 56cm to 61cm in patients older than 5yeas old, with a median of 57cm. Motor development delay and cognitive impairment were detected in 22(81.5%) and 5(18.5%) patients, respectively. Motor and cognitive deterioration was found in 5 (18.5%) and 2 patients (7.4%), respectively. Improvements and MRI recovery were first found in Chinese patients. Rate of seizures (45.5%), transient motor retrogress (45.5%) and unconsciousness (13.6%) after head trauma was much higher than that after fever (18.2%, 9.1%, 0%, respectively). Significance It’s a clinical and genetic analysis and a follow-up study for largest sample of Chinese MLC patients, identifying 10 novel mutations, expanding mutation spectrums and discovering clinical features of Chinese MLC patients. PMID:27322623

  10. Novel splice-site and missense mutations in the ALDH1A3 gene underlying autosomal recessive anophthalmia/microphthalmia.

    PubMed

    Semerci, C Nur; Kalay, Ersan; Yıldırım, Cem; Dinçer, Tuba; Olmez, Akgün; Toraman, Bayram; Koçyiğit, Ali; Bulgu, Yunus; Okur, Volkan; Satıroğlu-Tufan, Lale; Akarsu, Nurten A

    2014-06-01

    This study aimed to identify the underlying genetic defect responsible for anophthalmia/microphthalmia. In total, two Turkish families with a total of nine affected individuals were included in the study. Affymetrix 250 K single nucleotide polymorphism genotyping and homozygosity mapping were used to identify the localisation of the genetic defect in question. Coding region of the ALDH1A3 gene was screened via direct sequencing. cDNA samples were generated from primary fibroblast cell cultures for expression analysis. Reverse transcriptase PCR (RT-PCR) analysis was performed using direct sequencing of the obtained fragments. The causative genetic defect was mapped to chromosome 15q26.3. A homozygous G>A substitution (c.666G>A) at the last nucleotide of exon 6 in the ALDH1A3 gene was identified in the first family. Further cDNA sequencing of ALDH1A3 showed that the c.666G>A mutation caused skipping of exon 6, which predicted in-frame loss of 43 amino acids (p.Trp180_Glu222del). A novel missense c.1398C>A mutation in exon 12 of ALDH1A3 that causes the substitution of a conserved asparagine by lysine at amino acid position 466 (p.Asn466Lys) was observed in the second family. No extraocular findings-except for nevus flammeus in one affected individual and a variant of Dandy-Walker malformation in another affected individual-were observed. Autistic-like behaviour and mental retardation were observed in three cases. In conclusion, novel ALDH1A3 mutations identified in the present study confirm the pivotal role of ALDH1A3 in human eye development. Autistic features, previously reported as an associated finding, were considered to be the result of social deprivation and inadequate parenting during early infancy in the presented families. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  11. A User’s Guide to the SEVP (Stabilized Error Vector Propagation) Solver: An Efficient Direct Solver for Elliptic Partial Differential Equations

    DTIC Science & Technology

    1989-04-13

    19 5.3 The Solution, BSM2 , BSM3 . ...................................... 21 6. Description of test example...are modified for the boundary conditions. The sections on the preprocessor subroutine BSM1 and the solution subroutines BSM2 , BSM3 may be skipped by...interior row j = N-1 to the solution error C5 on the second row j = IE(2) of the last block, so that P3 = C5 R31 (5.18) 20 5.3 The Solution. BSM2

  12. Children's Perceptions of Parental Attitude Affecting Breakfast Skipping in Primary Sixth-Grade Students

    ERIC Educational Resources Information Center

    Cheng, Tereza Sy; Tse, Lap Ah; Yu, Ignatius Tak-Sun; Griffiths, Sian

    2008-01-01

    Background: Breakfast skipping is an international public health concern. This study investigated the prevalence of breakfast skipping among primary sixth-grade students in Hong Kong and the impact of students' perceptions of parental attitudes on breakfast skipping. Methods: A total of 426 students aged 10-14 years in 4 local schools participated…

  13. Metabolic and Cardiorespiratory Responses of Young Women to Skipping and Jogging.

    ERIC Educational Resources Information Center

    Allen, T. Earl; And Others

    1987-01-01

    Nine 18- to 29-year-old females were studied while jogging and skipping at treadmill speeds of 4.0, 4.8, and 5.4 miles per hour. Comparison of metabolic demand, musculoskeletal stress, and perceived exertion indicated skipping imposed significantly greater metabolic demands and caused higher heart rates than jogging. Skipping was also rated more…

  14. Reading Skill and Word Skipping: Implications for Visual and Linguistic Accounts of Word Skipping

    ERIC Educational Resources Information Center

    Eskenazi, Michael A.; Folk, Jocelyn R.

    2015-01-01

    We investigated whether high-skill readers skip more words than low-skill readers as a result of parafoveal processing differences based on reading skill. We manipulated foveal load and word length, two variables that strongly influence word skipping, and measured reading skill using the Nelson-Denny Reading Test. We found that reading skill did…

  15. Evidence for skipped spawning in a potamodromous cyprinid, humpback chub (Gila cypha), with implications for demographic parameter estimates

    USGS Publications Warehouse

    Pearson, Kristen Nicole; Kendall, William L.; Winkelman, Dana L.; Persons, William R.

    2015-01-01

    Our findings reveal evidence for skipped spawning in a potamodromous cyprinid, humpback chub (HBC; Gila cypha  ). Using closed robust design mark-recapture models, we found, on average, spawning HBC transition to the skipped spawning state () with a probability of 0.45 (95% CRI (i.e. credible interval): 0.10, 0.80) and skipped spawners remain in the skipped spawning state () with a probability of 0.60 (95% CRI: 0.26, 0.83), yielding an average spawning cycle of every 2.12 years, conditional on survival. As a result, migratory skipped spawners are unavailable for detection during annual sampling events. If availability is unaccounted for, survival and detection probability estimates will be biased. Therefore, we estimated annual adult survival probability (S), while accounting for skipped spawning, and found S remained reasonably stable throughout the study period, with an average of 0.75 ((95% CRI: 0.66, 0.82), process varianceσ2 = 0.005), while skipped spawning probability was highly dynamic (σ2 = 0.306). By improving understanding of HBC spawning strategies, conservation decisions can be based on less biased estimates of survival and a more informed population model structure.

  16. Risk of mental health problems in adolescents skipping meals: The Korean National Health and Nutrition Examination Survey 2010 to 2012.

    PubMed

    Lee, Gyungjoo; Han, Kyungdo; Kim, Hyunju

    Adolescents frequently skip meals, doing so even more than once per day. This is associated with more mental health problems. This study identified mental health problems' associations with skipping meals and the frequency thereof among adolescents. This cross-sectional population-based study used a data set of 1,413 adolescents from the 2010 to 2012 Korean National Health and Nutrition Examination Survey. Hierarchical multivariable logistic regression was conducted to determine the risk of mental health problems, including stress, depressive mood, and suicidal ideation in relation to skipping meals and the frequency thereof per day. Breakfast skipping significantly increased the risks of stress and depressive mood. Stress, depressive mood, and suicidal ideation were significantly prevalent as the daily frequency of skipping meals increased. Specific strategies should be developed at government or school level to decrease the frequency of skipping meals per day, associated with serious mental health problems in adolescents. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Association between the dopamine D4 receptor gene exon III variable number of tandem repeats and political attitudes in female Han Chinese

    PubMed Central

    Ebstein, Richard P.; Monakhov, Mikhail V.; Lu, Yunfeng; Jiang, Yushi; Lai, Poh San; Chew, Soo Hong

    2015-01-01

    Twin and family studies suggest that political attitudes are partially determined by an individual's genotype. The dopamine D4 receptor gene (DRD4) exon III repeat region that has been extensively studied in connection with human behaviour, is a plausible candidate to contribute to individual differences in political attitudes. A first United States study provisionally identified this gene with political attitude along a liberal–conservative axis albeit contingent upon number of friends. In a large sample of 1771 Han Chinese university students in Singapore, we observed a significant main effect of association between the DRD4 exon III variable number of tandem repeats and political attitude. Subjects with two copies of the 4-repeat allele (4R/4R) were significantly more conservative. Our results provided evidence for a role of the DRD4 gene variants in contributing to individual differences in political attitude particularly in females and more generally suggested that associations between individual genes, and neurochemical pathways, contributing to traits relevant to the social sciences can be provisionally identified. PMID:26246555

  18. Duplication polymorphisms in exon 4 of κ-casein gene in yak breeds/populations.

    PubMed

    Pingcuo, S; Gao, J; Jiang, Z R; Jin, S Y; Fu, C Y; Liu, X; Huang, L; Zheng, Y C

    2015-08-28

    The objective of this study was to compare 12 bp-duplication polymorphisms in exon 4 of the κ-casein gene among 3 breeds/populations of yak (Bos grunniens). Genomic DNA was extracted from yak blood or muscle samples (N = 211) and a partial sequence of exon 4 of κ-casein gene was amplified by polymerase chain reaction. A polyacrylamide gel electrophoresis assay of the products (169 bp) revealed 2 variants. These variants differed in a 12-bp duplication of the nucleotide sequence corresponding to amino acids 147-150 (Glu-Ala-Ser-Pro) or 148-151 (Ala-Ser-Pro-Glu). The genotype frequency and gene frequency of the 2 κ-casein variants differed among the 3 yak breeds/populations. The long form of the κ-casein gene was the predominant allele, and the Jiulong yak showed the highest frequency of the short form variant of the κ-casein gene. In addition, 2 nucleotide differences resulting in amino acid substitutions were also identified in yaks. These results are significant for designing a breeding strategy to improve the genetic makeup of yak herds.

  19. Association between the dopamine D4 receptor gene exon III variable number of tandem repeats and political attitudes in female Han Chinese.

    PubMed

    Ebstein, Richard P; Monakhov, Mikhail V; Lu, Yunfeng; Jiang, Yushi; Lai, Poh San; Chew, Soo Hong

    2015-08-22

    Twin and family studies suggest that political attitudes are partially determined by an individual's genotype. The dopamine D4 receptor gene (DRD4) exon III repeat region that has been extensively studied in connection with human behaviour, is a plausible candidate to contribute to individual differences in political attitudes. A first United States study provisionally identified this gene with political attitude along a liberal-conservative axis albeit contingent upon number of friends. In a large sample of 1771 Han Chinese university students in Singapore, we observed a significant main effect of association between the DRD4 exon III variable number of tandem repeats and political attitude. Subjects with two copies of the 4-repeat allele (4R/4R) were significantly more conservative. Our results provided evidence for a role of the DRD4 gene variants in contributing to individual differences in political attitude particularly in females and more generally suggested that associations between individual genes, and neurochemical pathways, contributing to traits relevant to the social sciences can be provisionally identified. © 2015 The Author(s).

  20. Skipping breakfast and 5‐year changes in body mass index and waist circumference in Japanese men and women

    PubMed Central

    Yoshita, K.; Nakamura, K.; Miura, K.; Takamura, T.; Nagasawa, S.Y.; Morikawa, Y.; Kido, T.; Naruse, Y.; Nogawa, K.; Suwazono, Y.; Sasaki, S.; Ishizaki, M.; Nakagawa, H.

    2017-01-01

    Summary Objective This study investigated the relationship between frequency of skipping breakfast and annual changes in body mass index (BMI) and waist circumference (WC). Methods The participants were 4,430 factory employees. BMI and WC were measured repeatedly at annual medical examinations over a 5‐year period. The association between frequency of skipping breakfast at the baseline examination and annual changes in anthropometric indices was evaluated using the generalized estimating equation method. Results The mean (standard deviation) BMI was 23.3 (3.0) kg m−2 for men and 21.9 (3.6) kg m−2 for women; and the mean WC was 82.6 (8.7) cm for men and 77.8 (9.8) cm for women. During the follow‐up period, mean BMI increased by 0.2 kg m−2 for men and women, and mean WC increased by 1.1 cm for men and 1.0 cm for women. The annual change in the BMI of men who skipped breakfast four to six times per week was 0.061 kg m−2 higher, and that of those who skipped breakfast seven times per week was 0.046 kg m−2 higher, compared with those who did not skip breakfast. Annual changes in the WC of male participants who skipped breakfast seven times per week was 0.248 cm higher than that of those who did not skip breakfast. Skipping breakfast was not associated with changes in BMI or WC in women. Conclusions Skipping breakfast was closely associated with annual changes in BMI and WC among men, and eating breakfast more than four times per week may prevent the excessive body weight gain associated with skipping breakfast. PMID:28702211

  1. Water Surface Impact and Ricochet of Deformable Elastomeric Spheres

    NASA Astrophysics Data System (ADS)

    Hurd, Randy C.

    Soft and deformable silicone rubber spheres ricochet from a water surface when rigid spheres and disks (or skipping stones) cannot. This dissertation investigates why these objects are able to skip so successfully. High speed cameras allow us to see that these unique spheres deform significantly as they impact the water surface, flattening into pancake-like shapes with greater area. Though the water entry behavior of deformable spheres deviates from that of rigid spheres, our research shows that if this deformation is accounted for, their behavior can be predicted from previously established methods. Soft spheres skip more easily because they deform significantly when impacting the water surface. We present a diagram which enables the prediction of a ricochet from sphere impact conditions such as speed and angle. Experiments and mathematical representations of the sphere skipping both show that these deformable spheres skip more readily because deformation momentarily increases sphere area and produces an attack angle with the water which is favorable to skipping. Predictions from our mathematical representation of sphere skipping agree strongly with observations from experiments. Even when a sphere was allowed to skip multiple times in the laboratory, the mathematical predictions show good agreement with measured impact conditions through subsequent skipping events. While studying multiple impact events in an outdoor setting, we discovered a previously unidentified means of skipping, which is unique to deformable spheres. This new skipping occurs when a relatively soft sphere first hits the water at a high speed and low impact angle and the sphere begins to rotate very quickly. This quick rotation causes the sphere to stretch into a shape similar to an American football and maintain this shape while it spins. The sphere is observed to move nearly parallel with the water surface with the tips of this "football" dipping into the water as it rotates and the sides passing just over the surface. This sequence of rapid impact events give the impression that the sphere is walking across the water surface.

  2. Mutations in KIAA0753 cause Joubert syndrome associated with growth hormone deficiency

    PubMed Central

    Stephen, Joshi; Vilboux, Thierry; Mian, Luhe; Kuptanon, Chulaluck; Sinclair, Courtney M.; Yildirimli, Deniz; Maynard, Dawn M.; Bryant, Joy; Fischer, Roxanne; Vemulapalli, Meghana; Mullikin, James C.; Huizing, Marjan; Gahl, William A.

    2017-01-01

    Joubert syndrome and related disorders (JSRD) are a heterogeneous group of ciliopathies defined based on the mid-hindbrain abnormalities that result in the characteristic “molar tooth sign” on brain imaging. The core clinical findings of JSRD are hypotonia, developmental delay, abnormal eye movements and breathing abnormalities. To date, more than 30 JSRD genes that encode proteins important for structure and/or function of cilia have been identified. Here, we present 2 siblings with Joubert syndrome associated with growth hormone deficiency. Whole exome sequencing of the family identified compound heterozygous mutations in KIAA0753, i.e., a missense mutation (p.Arg257Gly) and an intronic mutation (c.2359-1G>C). The intronic mutation alters normal splicing by activating a cryptic acceptor splice site in exon 16. The novel acceptor site skips nine nucleotides, deleting three amino acids from the protein coding frame. KIAA0753 (OFIP) is a centrosome and pericentriolar satellite protein, previously not known to cause Joubert syndrome. We present comprehensive clinical descriptions of the Joubert syndrome patients as well as the cellular phenotype of defective ciliogenesis in the patients’ fibroblasts. PMID:28220259

  3. Mutations in KIAA0753 cause Joubert syndrome associated with growth hormone deficiency.

    PubMed

    Stephen, Joshi; Vilboux, Thierry; Mian, Luhe; Kuptanon, Chulaluck; Sinclair, Courtney M; Yildirimli, Deniz; Maynard, Dawn M; Bryant, Joy; Fischer, Roxanne; Vemulapalli, Meghana; Mullikin, James C; Huizing, Marjan; Gahl, William A; Malicdan, May Christine V; Gunay-Aygun, Meral

    2017-04-01

    Joubert syndrome and related disorders (JSRD) are a heterogeneous group of ciliopathies defined based on the mid-hindbrain abnormalities that result in the characteristic "molar tooth sign" on brain imaging. The core clinical findings of JSRD are hypotonia, developmental delay, abnormal eye movements and breathing abnormalities. To date, more than 30 JSRD genes that encode proteins important for structure and/or function of cilia have been identified. Here, we present 2 siblings with Joubert syndrome associated with growth hormone deficiency. Whole exome sequencing of the family identified compound heterozygous mutations in KIAA0753, i.e., a missense mutation (p.Arg257Gly) and an intronic mutation (c.2359-1G>C). The intronic mutation alters normal splicing by activating a cryptic acceptor splice site in exon 16. The novel acceptor site skips nine nucleotides, deleting three amino acids from the protein coding frame. KIAA0753 (OFIP) is a centrosome and pericentriolar satellite protein, previously not known to cause Joubert syndrome. We present comprehensive clinical descriptions of the Joubert syndrome patients as well as the cellular phenotype of defective ciliogenesis in the patients' fibroblasts.

  4. Germline mutations in ETV6 are associated with thrombocytopenia, red cell macrocytosis and predisposition to lymphoblastic leukemia

    PubMed Central

    Lee-Sherick, Alisa B.; Callaghan, Michael; Noris, Patrizia; Savoia, Anna; Rajpurkar, Madhvi; Jones, Kenneth; Gowan, Katherine; Balduini, Carlo; Pecci, Alessandro; Gnan, Chiara; De Rocco, Daniela; Doubek, Michael; Li, Ling; Lu, Lily; Leung, Richard; Landolt-Marticorena, Carolina; Hunger, Stephen; Heller, Paula; Gutierrez-Hartmann, Arthur; Xiayuan, Liang; Pluthero, Fred G.; Rowley, Jesse W.; Weyrich, Andrew S.

    2015-01-01

    Some familial platelet disorders are associated with predisposition to leukemia, myelodysplastic syndrome (MDS) or dyserythropoietic anemia.1,2 We identified a family with autosomal dominant thrombocytopenia, high erythrocyte mean corpuscular volume (MCV) and two occurrences of B-cell precursor acute lymphoblastic leukemia (ALL). Whole exome sequencing identified a heterozygous single nucleotide change in ETV6 (Ets Variant Gene 6), c.641C>T, encoding a p.Pro214Leu substitution in the central domain, segregating with thrombocytopenia and elevated MCV. A screen of 23 families with similar phenotype found two with ETV6 mutations. One family had the p.Pro214Leu mutation and one individual with ALL. The other family had a c.1252A>G transition producing a p.Arg418Gly substitution in the DNA binding domain, with alternative splicing and exon-skipping. Functional characterization of these mutations showed aberrant cellular localization of mutant and endogenous ETV6, decreased transcriptional repression and altered megakaryocyte maturation. Our findings underscore a key role for ETV6 in platelet formation and leukemia predisposition. PMID:25807284

  5. Nemaline myopathy and distal arthrogryposis associated with an autosomal recessive TNNT3 splice variant.

    PubMed

    Sandaradura, Sarah A; Bournazos, Adam; Mallawaarachchi, Amali; Cummings, Beryl B; Waddell, Leigh B; Jones, Kristi J; Troedson, Christopher; Sudarsanam, Annapurna; Nash, Benjamin M; Peters, Gregory B; Algar, Elizabeth M; MacArthur, Daniel G; North, Kathryn N; Brammah, Susan; Charlton, Amanda; Laing, Nigel G; Wilson, Meredith J; Davis, Mark R; Cooper, Sandra T

    2018-03-01

    A male neonate presented with severe weakness, hypotonia, contractures and congenital scoliosis. Skeletal muscle specimens showed marked atrophy and degeneration of fast fibers with striking nemaline rods and hypertrophy of slow fibers that were ultrastructurally normal. A neuromuscular gene panel identified a homozygous essential splice variant in TNNT3 (chr11:1956150G > A, NM_006757.3:c.681+1G > A). TNNT3 encodes skeletal troponin-T fast and is associated with autosomal dominant distal arthrogryposis. TNNT3 has not previously been associated with nemaline myopathy (NM), a rare congenital myopathy linked to defects in proteins associated with thin filament structure and regulation. cDNA studies confirmed pathogenic consequences of the splice variant, eliciting exon-skipping and intron retention events leading to a frameshift. Western blot showed deficiency of troponin-T fast protein with secondary loss of troponin-I fast . We establish a homozygous splice variant in TNNT3 as the likely cause of severe congenital NM with distal arthrogryposis, characterized by specific involvement of Type-2 fibers and deficiency of troponin-T fast . © 2017 Wiley Periodicals, Inc.

  6. Multi-level omics analysis in a murine model of dystrophin loss and therapeutic restoration.

    PubMed

    Roberts, Thomas C; Johansson, Henrik J; McClorey, Graham; Godfrey, Caroline; Blomberg, K Emelie M; Coursindel, Thibault; Gait, Michael J; Smith, C I Edvard; Lehtiö, Janne; El Andaloussi, Samir; Wood, Matthew J A

    2015-12-01

    Duchenne muscular dystrophy (DMD) is a classical monogenic disorder, a model disease for genomic studies and a priority candidate for regenerative medicine and gene therapy. Although the genetic cause of DMD is well known, the molecular pathogenesis of disease and the response to therapy are incompletely understood. Here, we describe analyses of protein, mRNA and microRNA expression in the tibialis anterior of the mdx mouse model of DMD. Notably, 3272 proteins were quantifiable and 525 identified as differentially expressed in mdx muscle (P < 0.01). Therapeutic restoration of dystrophin by exon skipping induced widespread shifts in protein and mRNA expression towards wild-type expression levels, whereas the miRNome was largely unaffected. Comparison analyses between datasets showed that protein and mRNA ratios were only weakly correlated (r = 0.405), and identified a multitude of differentially affected cellular pathways, upstream regulators and predicted miRNA-target interactions. This study provides fundamental new insights into gene expression and regulation in dystrophic muscle. © The Author 2015. Published by Oxford University Press.

  7. Rice cyclophilin OsCYP18-2 is translocated to the nucleus by an interaction with SKIP and enhances drought tolerance in rice and Arabidopsis.

    PubMed

    Lee, Sang Sook; Park, Hyun Ji; Yoon, Dae Hwa; Kim, Beom-Gi; Ahn, Jun Cheul; Luan, Sheng; Cho, Hye Sun

    2015-10-01

    Cyclophilin 18-2 (CYP18-2) genes, homologues of human peptidyl-prolyl isomerase-like 1 (PPiL1), are conserved across multicellular organisms and Schizosaccharomyces pombe. Although PPiL1 is known to interact with ski-interacting protein (SKIP), a transcriptional co-regulator and spliceosomal component, there have been no functional analyses of PPiL1 homologues in plants. Rice cyclophilin 18-2 (OsCYP18-2) bound directly to amino acids 56-95 of OsSKIP and its binding was independent of cyclosporin A, a cyclophilin-binding drug. Moreover, OsCYP18-2 exhibited PPIase activity regardless of its interaction with OsSKIP. Therefore, the binding site for OsCYP18-2's interaction with SKIP was distinct from the PPIase active site. OsCYP18-2's interaction with SKIP full-length protein enabled OsCYP18-2's translocation from the cytoplasm into the nucleus and AtSKIP interacted in planta with both AtCYP18-2 and OsCYP18-2. Drought and salt stress induced similar expression of OsCYP18-2 and OsSKIP. Overexpression of OsCYP18-2 in transgenic rice and Arabidopsis thaliana plants enhanced drought tolerance and altered expression and pre-mRNA splicing patterns of stress-related genes in Arabidopsis under drought conditions. Furthermore, OsCYP18-2 caused transcriptional activation with/without OsSKIP in the GAL4 system of yeast; thus the OsSKIP-OsCYP18-2 interaction has an important role in the transcriptional and post-transcriptional regulation of stress-related genes and increases tolerance to drought stress. © 2015 John Wiley & Sons Ltd.

  8. Associations between perceived friends' support of healthy eating and meal skipping in adolescence.

    PubMed

    Rosenrauch, Sharon; Ball, Kylie; Lamb, Karen E

    2017-12-01

    Meal skipping is a relatively common behaviour during adolescence. As peer influence increases during adolescence, friendship groups may play a role in determining eating patterns such as meal skipping. The current study examined cross-sectional and longitudinal associations between perceived friends' support of healthy eating and breakfast and lunch skipping among adolescents. Survey of intrapersonal, social and environmental factors that may influence eating patterns at baseline (2004/05) and follow-up (2006/07). Thirty-seven secondary schools in Victoria, Australia. Sample of 1785 students aged 12-15 years at baseline. Adolescents who reported that their friends sometimes or often ate healthy foods with them were less likely (adjusted OR; 95 % CI) to skip breakfast (sometimes: 0·71; 0·57, 0·90; often: 0·54; 0·38, 0·76) or lunch (sometimes: 0·61; 0·41, 0·89; often: 0·59; 0·37, 0·94) at baseline than those who reported their friends never or rarely displayed this behaviour. Although this variable was associated with lunch skipping at follow-up, there was no evidence of an association with breakfast skipping at follow-up. There was no evidence of an association between perceived encouragement of healthy eating, and an inconsistent relationship between perceived discouragement of junk food consumption, and meal skipping. Friends eating healthy foods together may serve to reduce meal skipping during early adolescence, possibly due to the influence of directly observable behaviour and shared beliefs held by those in the same friendship group. Verbal encouragement or discouragement from friends may be less impactful an influence on meal skipping (than directly observable behaviours) in adolescents.

  9. The combined unhealthy behaviors of breakfast skipping and smoking are associated with the prevalence of diabetes mellitus.

    PubMed

    Nishiyama, Midori; Muto, Takashi; Minakawa, Toshihiro; Shibata, Toshie

    2009-08-01

    Skipping breakfast has been considered a representative unhealthy behavior, but there is little information about the combined effects of breakfast skipping and other unhealthy health habits, especially smoking. First this cross-sectional study investigated unhealthy behaviors among breakfast skippers, and then examined the impact of the combined association of skipping breakfast and smoking on health. A total of 1,200 adults living in one Japanese community were sent questionnaires to elicit data on age, gender, breakfast-eating frequency, and other lifestyle habits. A total 603 of people returned their questionnaires (response rate: 50.3%), and 493 (230 men and 263 women) questionnaires were considered appropriate for analysis. Smoking rate in men (mean age, 53.7 years) and women (mean age, 50.4 years) was 41.3%, and 9.5%, respectively. Skipping breakfast was more prevalent in people under age 50 years (p < 0.001), and was related to other unhealthy behaviors. Binary logistic regression identified current smoking as the most significant factor related to breakfast skipping (3.10, 95%CI 1.50-6.39). Other factors included, age younger than 50 years (3.04, 95%CI 1.31-7.06) and poor sleeping quality (2.06, 95%CI 1.00-4.25). After examining the combined impact of skipping breakfast and smoking, the highest odds ratio for a diagnosis of diabetes mellitus was found among those who smoked and skipped breakfast (4.68, 95% CI: 1.46-15.05). Moreover, skipping breakfast among non-smokers showed a high association with perceived stress (2.83, 95% CI: 1.05-7.61). In conclusion, the combined unhealthy behaviors of skipping breakfast and smoking are associated with the prevalence of diabetes mellitus.

  10. Modeling the ferrochelatase c.315-48C modifier mutation for erythropoietic protoporphyria (EPP) in mice

    PubMed Central

    Bansode, Vijay B.; Koentgen, Frank; Trüb, Judith; Pelczar, Pawel; Schneider-Yin, Xiaoye; Minder, Elisabeth I.

    2017-01-01

    ABSTRACT Erythropoietic protoporphyria (EPP) is caused by deficiency of ferrochelatase (FECH), which incorporates iron into protoporphyrin IX (PPIX) to form heme. Excitation of accumulated PPIX by light generates oxygen radicals that evoke excessive pain and, after longer light exposure, cause ulcerations in exposed skin areas of individuals with EPP. Moreover, ∼5% of the patients develop a liver dysfunction as a result of PPIX accumulation. Most patients (∼97%) have a severe FECH mutation (Mut) in trans to an intronic polymorphism (c.315-48C), which reduces ferrochelatase synthesis by stimulating the use of an aberrant 3′ splice site 63 nt upstream of the normal site for exon 4. In contrast, with the predominant c.315-48T allele, the correct splice site is mostly used, and individuals with a T/Mut genotype do not develop EPP symptoms. Thus, the C allele is a potential target for therapeutic approaches that modify this splicing decision. To provide a model for pre-clinical studies of such approaches, we engineered a mouse containing a partly humanized Fech gene with the c.315-48C polymorphism. F1 hybrids obtained by crossing these mice with another inbred line carrying a severe Fech mutation (named m1Pas) show a very strong EPP phenotype that includes elevated PPIX in the blood, enlargement of liver and spleen, anemia, as well as strong pain reactions and skin lesions after a short period of light exposure. In addition to the expected use of the aberrant splice site, the mice also show a strong skipping of the partly humanized exon 3. This will limit the use of this model for certain applications and illustrates that engineering of a hybrid gene may have unforeseeable consequences on its splicing. PMID:28093505

  11. IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.

    PubMed

    Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

    2016-11-07

    The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

  12. The molecular basis of Canavan (Aspartoacylase deficiency) disease in European non-Jewish patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shaag, A.; Anikster, Y.; Glustein, J.Z.

    Canavan disease is an infantile neurodegenerative disease that is due to aspartoacylase deficiency. The disease has been reported mainly in Ashkenazi Jews but also occurs in other ethnic groups. Determination of enzymatic activity for carrier detection and prenatal diagnosis is considered unreliable. In the present study, nine mutations were found in the aspartoacylase gene of 19 non-Jewish patients. These included four point mutations (A305E [39.5% of the mutated alleles], C218X [15.8%], F2955 [2.6%], and G274R [5.3%]); four deletion mutations (827delGT [5.3%], 870del4 [2.6%], 566del7 [2.6%], and 527del6 [2.6%]); and one exon skip (527del108 [5.3%]). The A305E mutation is pan-European andmore » probably the most ancient mutation, identified in patients of Greek, Polish, Danish, French, Spanish, Italian, and British origin. In contrast, the G274R and 527del108 mutations were found only in patients of Turkish origin, and the C218X mutation was identified only in patients of Gypsy origin. Homozygosity for the A305E mutation was identified in patients with both the severe and the mild forms of Canavan disease. Mutations were identified in 31 of the 38 alleles, resulting in an overall detection rate of 81.6%. All nine mutations identified in non-Jewish patients reside in exons 4-6 of the aspartoacylase gene. The results would enable accurate genetic counseling in the families of 13 (68.4%) of 19 patients, in whom two mutations were identified in the aspartoacylase cDNA. 19 refs., 9 figs., 3 tabs.« less

  13. Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

    PubMed

    Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M

    2015-05-15

    The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

  14. Using a minigene approach to characterize a novel splice site mutation in human F7 gene causing inherited factor VII deficiency in a Chinese pedigree.

    PubMed

    Yu, T; Wang, X; Ding, Q; Fu, Q; Dai, J; Lu, Y; Xi, X; Wang, H

    2009-11-01

    Factor VII deficiency which transmitted as an autosomal recessive disorder is a rare haemorrhagic condition. The aim of this study was to identify the molecular genetic defect and determine its functional consequences in a Chinese pedigree with FVII deficiency. The proband was diagnosed as inherited coagulation FVII deficiency by reduced plasma levels of FVII activity (4.4%) and antigen (38.5%). All nine exons and their flanking sequence of F7 gene were amplified by polymerase chain reaction (PCR) for the proband and the PCR products were directly sequenced. The compound heterozygous mutations of F7 (NM_000131.3) c.572-1G>A and F7 (NM_000131.3) c.1165T>G; p.Cys389Gly were identified in the proband's F7 gene. To investigate the splicing patterns associated with F7 c.572-1G>A, ectopic transcripts in leucocytes of the proband were analyzed. F7 minigenes, spanning from intron 4 to intron 7 and carrying either an A or a G at position -1 of intron 5, were constructed and transiently transfected into human embryonic kidney (HEK) 293T cells, followed by RT-PCR analysis. The aberrant transcripts from the F7 c.572-1G>A mutant allele were not detected by ectopic transcription study. Sequencing of the RT-PCR products from the mutant transfectant demonstrated the production of an erroneously spliced mRNA with exon 6 skipping, whereas a normal splicing occurred in the wide type transfectant. The aberrant mRNA produced from the F7 c.572-1G>A mutant allele is responsible for the factor VII deficiency in this pedigree.

  15. Identification and characterization of ALK kinase splicing isoforms in non-small-cell lung cancer

    PubMed Central

    de Figueiredo-Pontes, Lorena Lobo; Wong, Daisy Wing-Sze; Tin, Vick Pui-Chi; Chung, Lap-Ping; Yasuda, Hiroyuki; Yamaguchi, Norihiro; Nakayama, Sohei; Jänne, Pasi Antero; Wong, Maria Pik; Kobayashi, Susumu Soeda; Costa, Daniel Botelho

    2014-01-01

    Purpose: Anaplastic lymphoma kinase (ALK) rearrangements are present in an important subset of non-small-cell lung cancer (NSCLC) and predict for response to the tyrosine kinase inhibitor crizotinib. In this study, we evaluated the yet unknown frequency and functional role of ALK splicing isoforms in NSCLC. Experimental Design: We analyzed 270 cases of NSCLC for ALK kinase domain splicing aberrations, and in addition generated constructs with full length EML4-ALK (E13;A20) and a splicing isoform. Results: Splicing isoforms of the kinase domain of ALK - including complete skipping of exon 23 (ALKdel23, ALK p.I1171fs*42) and exon 27 (ALKdel27, ALK p.T1312fs*0) - were identified in 11.1% (30/270 cases) of NSCLC, and these changes co-existed with ALK rearrangements, KRAS mutations and EGFR mutations. ALK splicing isoforms were observed with full length EML4-ALK in crizotinib-naïve and treated NSCLCs. ALK T1312fs*0 was unable to render cells solely dependent on ALK signaling. Unlike EML4-ALK and EML4-ALK p.L1196M, EML4-ALK T1312fs*0 did not autophosphorylate ALK or other phospho-tyrosine sites. Co-expression of equal amounts of EML4-ALK T1312fs*0 and EML4-ALK did not result in resistance to crizotinib, while co-expression of EML4-ALK L1196M with EML4-ALK resulted in resistance to inhibition of ALK by crizotinib. Conclusions: ALK kinase splicing isoforms were present in NSCLC and even if translated seemed to be non-functional variants of ALK. PMID:24419423

  16. IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells

    PubMed Central

    Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

    2016-01-01

    The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein. PMID:27827994

  17. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  18. Peripheral type of choline acetyltransferase: biological and evolutionary implications for novel mechanisms in cholinergic system.

    PubMed

    Bellier, J-P; Kimura, H

    2011-12-01

    The peripheral type of choline acetyltransferase (pChAT) is an isoform of the well-studied common type of choline acetyltransferase (cChAT), the synthesizing enzyme of acetylcholine. Since pChAT arises by exons skipping, its amino acid sequence is similar to that of cChAT, except the lack of a continuous peptide sequence encoded by all the four exons from 6 to 9. While cChAT expression has been observed in both the central and peripheral nervous systems, pChAT is preferentially expressed in the peripheral nervous system. pChAT appears to be a reliable marker for the visualization of peripheral cholinergic neurons and their processes, whereas other conventional markers including cChAT have not been used successfully for it. In mammals like rodents, pChAT immunoreactivity has been observed in most, if not all, physiologically identified peripheral cholinergic structures such as all parasympathetic postganglionic neurons and most neurons of the enteric nervous system. In addition, pChAT has been found in many peripheral neurons that are derived from the neural crest. These include sensory neurons of the trigeminal ganglion and the dorsal root ganglion, and sympathetic postganglionic neurons. Recent studies moreover indicate that pChAT, as well as cChAT, appears ubiquitously expressed among various species not only of vertebrate mammals but also of invertebrate mollusks. This finding implies that the alternative splicing mechanism to generate pChAT and cChAT has been preserved during evolution, probably for some functional benefits. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. SEPTIN12 Genetic Variants Confer Susceptibility to Teratozoospermia

    PubMed Central

    Lin, Ying-Hung; Wang, Ya-Yun; Chen, Hau-Inh; Kuo, Yung-Che; Chiou, Yu-Wei; Lin, Hsi-Hui; Wu, Ching-Ming; Hsu, Chao-Chin; Chiang, Han-Sun; Kuo, Pao-Lin

    2012-01-01

    It is estimated that 10–15% of couples are infertile and male factors account for about half of these cases. With the advent of intracytoplasmic sperm injection (ICSI), many infertile men have been able to father offspring. However, teratozoospermia still remains a big challenge to tackle. Septins belong to a family of cytoskeletal proteins with GTPase activity and are involved in various biological processes e.g. morphogenesis, compartmentalization, apoptosis and cytokinesis. SEPTIN12, identified by c-DNA microarray analysis of infertile men, is exclusively expressed in the post meiotic male germ cells. Septin12+/+/Septin12+/− chimeric mice have multiple reproductive defects including the presence of immature sperm in the semen, and sperm with bent neck (defect of the annulus) and nuclear DNA damage. These facts make SEPTIN12 a potential sterile gene in humans. In this study, we sequenced the entire coding region of SEPTIN12 in infertile men (n = 160) and fertile controls (n = 200) and identified ten variants. Among them is the c.474 G>A variant within exon 5 that encodes part of the GTP binding domain. The variant creates a novel splice donor site that causes skipping of a portion of exon 5, resulting in a truncated protein lacking the C-terminal half of SEPTIN12. Most individuals homozygous for the c.474 A allele had teratozoospermia (abnormal sperm <14%) and their sperm showed bent tail and de-condensed nucleus with significant DNA damage. Ex vivo experiment showed truncated SEPT12 inhibits filament formation in a dose-dependent manner. This study provides the first causal link between SEPTIN12 genetic variant and male infertility with distinctive sperm pathology. Our finding also suggests vital roles of SEPT12 in sperm nuclear integrity and tail development. PMID:22479503

  20. Tissue-Specific Reduction in Splicing Efficiency of IKBKAP Due to the Major Mutation Associated with Familial Dysautonomia

    PubMed Central

    Cuajungco, Math P.; Leyne, Maire; Mull, James; Gill, Sandra P.; Lu, Weining; Zagzag, David; Axelrod, Felicia B.; Maayan, Channa; Gusella, James F.; Slaugenhaupt, Susan A.

    2003-01-01

    We recently identified a mutation in the I-κB kinase associated protein (IKBKAP) gene as the major cause of familial dysautonomia (FD), a recessive sensory and autonomic neuropathy. This alteration, located at base pair 6 of the intron 20 donor splice site, is present on >99.5% of FD chromosomes and results in tissue-specific skipping of exon 20. A second FD mutation, a missense change in exon 19 (R696P), was seen in only four patients heterozygous for the major mutation. Here, we have further characterized the consequences of the major mutation by examining the ratio of wild-type to mutant (WT:MU) IKBKAP transcript in EBV-transformed lymphoblast lines, primary fibroblasts, freshly collected blood samples, and postmortem tissues from patients with FD. We consistently found that WT IKBKAP transcripts were present, albeit to varying extents, in all cell lines, blood, and postmortem FD tissues. Further, a corresponding decrease in the level of WT protein is seen in FD cell lines and tissues. The WT:MU ratio in cultured lymphoblasts varied with growth phase but not with serum concentration or inclusion of antibiotics. Using both densitometry and real-time quantitative polymerase chain reaction, we found that relative WT:MU IKBKAP RNA levels were highest in cultured patient lymphoblasts and lowest in postmortem central and peripheral nervous tissues. These observations suggest that the relative inefficiency of WT IKBKAP mRNA production from the mutant alleles in the nervous system underlies the selective degeneration of sensory and autonomic neurons in FD.Therefore, exploration of methods to increase the WT:MU IKBKAP transcript ratio in the nervous system offers a promising approach for developing an effective therapy for patients with FD. PMID:12577200

  1. Word skipping: effects of word length, predictability, spelling and reading skill.

    PubMed

    Slattery, Timothy J; Yates, Mark

    2017-08-31

    Readers eyes often skip over words as they read. Skipping rates are largely determined by word length; short words are skipped more than long words. However, the predictability of a word in context also impacts skipping rates. Rayner, Slattery, Drieghe and Liversedge (2011) reported an effect of predictability on word skipping for even long words (10-13 characters) that extend beyond the word identification span. Recent research suggests that better readers and spellers have an enhanced perceptual span (Veldre & Andrews, 2014). We explored whether reading and spelling skill interact with word length and predictability to impact word skipping rates in a large sample (N=92) of average and poor adult readers. Participants read the items from Rayner et al. (2011) while their eye movements were recorded. Spelling skill (zSpell) was assessed using the dictation and recognition tasks developed by Sally Andrews and colleagues. Reading skill (zRead) was assessed from reading speed (words per minute) and accuracy of three 120 word passages each with 10 comprehension questions. We fit linear mixed models to the target gaze duration data and generalized linear mixed models to the target word skipping data. Target word gaze durations were significantly predicted by zRead while, the skipping likelihoods were significantly predicted by zSpell. Additionally, for gaze durations, zRead significantly interacted with word predictability as better readers relied less on context to support word processing. These effects are discussed in relation to the lexical quality hypothesis and eye movement models of reading.

  2. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Solera, J.; Magallon, M.; Martin-Villar, J.

    1992-02-01

    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

  3. Underdominant KCC3b R31I association with blood sodium concentration in domestic sheep suggests role in oligomer function

    USDA-ARS?s Scientific Manuscript database

    KCC3 and KCC1 are potassium chloride transporters with partially overlapping function, and KCC3 knockout mice exhibit hypertension. Two KCC3 isoforms differ by alternate promoters and first coding exons: KCC3a is widely expressed, and KCC3b is highly expressed in kidney proximal convoluted tubule. W...

  4. Red-Green Color Vision Impairment in Duchenne Muscular Dystrophy

    PubMed Central

    Costa, Marcelo Fernandes ; Oliveira, Andre Gustavo Fernandes ; Feitosa-Santana, Claudia ; Zatz, Mayana ; Ventura, Dora Fix 

    2007-01-01

    The present study evaluated the color vision of 44 patients with Duchenne muscular dystrophy (DMD) (mean age 14.8 years; SD 4.9) who were submitted to a battery of four different color tests: Cambridge Colour Test (CCT), Neitz Anomaloscope, Ishihara, and American Optical Hardy-Rand-Rittler (AO H-R-R). Patients were divided into two groups according to the region of deletion in the dystrophin gene: upstream of exon 30 (n=12) and downstream of exon 30 (n=32). The control group was composed of 70 age-matched healthy male subjects with no ophthalmological complaints. Of the patients with DMD, 47% (21/44) had a red-green color vision defect in the CCT, confirmed by the Neitz Anomaloscope with statistical agreement (P<.001). The Ishihara and the AO H-R-R had a lower capacity to detect color defects—5% and 7%, respectively, with no statistical similarity between the results of these two tests nor between CCT and Anomaloscope results (P>.05). Of the patients with deletion downstream of exon 30, 66% had a red-green color defect. No color defect was found in the patients with deletion upstream of exon 30. A negative correlation between the color thresholds and age was found for the controls and patients with DMD, suggesting a nonprogressive color defect. The percentage (66%) of patients with a red-green defect was significantly higher than the expected <10% for the normal male population (P<.001). In contrast, patients with DMD with deletion upstream of exon 30 had normal color vision. This color defect might be partially explained by a retina impairment related to dystrophin isoform Dp260. PMID:17503325

  5. Imatinib in systemic mastocytosis: a phase IV clinical trial in patients lacking exon 17 KIT mutations and review of the literature

    PubMed Central

    Alvarez-Twose, Iván; Matito, Almudena; Morgado, José Mário; Sánchez-Muñoz, Laura; Jara-Acevedo, María; García-Montero, Andrés; Mayado, Andrea; Caldas, Carolina; Teodósio, Cristina; Muñoz-González, Javier Ignacio; Mollejo, Manuela; Escribano, Luis; Orfao, Alberto

    2017-01-01

    Resistance to imatinib has been recurrently reported in systemic mastocytosis (SM) carrying exon 17 KIT mutations. We evaluated the efficacy and safety of imatinib therapy in 10 adult SM patients lacking exon 17 KIT mutations, 9 of which fulfilled criteria for well-differentiated SM (WDSM). The World Health Organization 2008 disease categories among WDSM patients were mast cell (MC) leukemia (n = 3), indolent SM (n = 3) and cutaneous mastocytosis (n = 3); the remainder case had SM associated with a clonal haematological non-MC disease. Patients were given imatinib for 12 months −400 or 300 mg daily depending on the presence vs. absence of > 30% bone marrow (BM) MCs and/or signs of advanced disease–. Absence of exon 17 KIT mutations was confirmed in highly-purified BM MCs by peptide nucleic acid-mediated PCR, while mutations involving other exons were investigated by direct sequencing of purified BM MC DNA. Complete response (CR) was defined as resolution of BM MC infiltration, skin lesions, organomegalies and MC-mediator release-associated symptoms, plus normalization of serum tryptase. Criteria for partial response (PR) included ≥ 50% reduction in BM MC infiltration and improvement of skin lesions and/or organomegalies. Treatment was well-tolerated with an overall response rate of 50%, including early and sustained CR in four patients, three of whom had extracellular mutations of KIT, and PR in one case. This later patient and all non-responders (n = 5) showed wild-type KIT. These results together with previous data from the literature support the relevance of the KIT mutational status in selecting SM patients who are candidates for imatinib therapy. PMID:28978170

  6. Imatinib in systemic mastocytosis: a phase IV clinical trial in patients lacking exon 17 KIT mutations and review of the literature.

    PubMed

    Alvarez-Twose, Iván; Matito, Almudena; Morgado, José Mário; Sánchez-Muñoz, Laura; Jara-Acevedo, María; García-Montero, Andrés; Mayado, Andrea; Caldas, Carolina; Teodósio, Cristina; Muñoz-González, Javier Ignacio; Mollejo, Manuela; Escribano, Luis; Orfao, Alberto

    2017-09-15

    Resistance to imatinib has been recurrently reported in systemic mastocytosis (SM) carrying exon 17 KIT mutations. We evaluated the efficacy and safety of imatinib therapy in 10 adult SM patients lacking exon 17 KIT mutations, 9 of which fulfilled criteria for well-differentiated SM (WDSM). The World Health Organization 2008 disease categories among WDSM patients were mast cell (MC) leukemia ( n = 3), indolent SM ( n = 3) and cutaneous mastocytosis ( n = 3); the remainder case had SM associated with a clonal haematological non-MC disease. Patients were given imatinib for 12 months -400 or 300 mg daily depending on the presence vs. absence of > 30% bone marrow (BM) MCs and/or signs of advanced disease-. Absence of exon 17 KIT mutations was confirmed in highly-purified BM MCs by peptide nucleic acid-mediated PCR, while mutations involving other exons were investigated by direct sequencing of purified BM MC DNA. Complete response (CR) was defined as resolution of BM MC infiltration, skin lesions, organomegalies and MC-mediator release-associated symptoms, plus normalization of serum tryptase. Criteria for partial response (PR) included ≥ 50% reduction in BM MC infiltration and improvement of skin lesions and/or organomegalies. Treatment was well-tolerated with an overall response rate of 50%, including early and sustained CR in four patients, three of whom had extracellular mutations of KIT , and PR in one case. This later patient and all non-responders ( n = 5) showed wild-type KIT . These results together with previous data from the literature support the relevance of the KIT mutational status in selecting SM patients who are candidates for imatinib therapy.

  7. Multiple splicing defects in an intronic false exon.

    PubMed

    Sun, H; Chasin, L A

    2000-09-01

    Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

  8. Characterization of an apparently synonymous F5 mutation causing aberrant splicing and factor V deficiency.

    PubMed

    Nuzzo, F; Bulato, C; Nielsen, B I; Lee, K; Wielders, S J; Simioni, P; Key, N S; Castoldi, E

    2015-03-01

    Coagulation factor V (FV) deficiency is a rare autosomal recessive bleeding disorder. We investigated a patient with severe FV deficiency (FV:C < 3%) and moderate bleeding symptoms. Thrombin generation experiments showed residual FV expression in the patient's plasma, which was quantified as 0.7 ± 0.3% by a sensitive prothrombinase-based assay. F5 gene sequencing identified a novel missense mutation in exon 4 (c.578G>C, p.Cys193Ser), predicting the abolition of a conserved disulphide bridge, and an apparently synonymous variant in exon 8 (c.1281C>G). The observation that half of the patient's F5 mRNA lacked the last 18 nucleotides of exon 8 prompted us to re-evaluate the c.1281C>G variant for its possible effects on splicing. Bioinformatics sequence analysis predicted that this transversion would activate a cryptic donor splice site and abolish an exonic splicing enhancer. Characterization in a F5 minigene model confirmed that the c.1281C>G variant was responsible for the patient's splicing defect, which could be partially corrected by a mutation-specific morpholino antisense oligonucleotide. The aberrantly spliced F5 mRNA, whose stability was similar to that of the normal mRNA, encoded a putative FV mutant lacking amino acids 427-432. Expression in COS-1 cells indicated that the mutant protein is poorly secreted and not functional. In conclusion, the c.1281C>G mutation, which was predicted to be translationally silent and hence neutral, causes FV deficiency by impairing pre-mRNA splicing. This finding underscores the importance of cDNA analysis for the correct assessment of exonic mutations. © 2014 John Wiley & Sons Ltd.

  9. A multi-locus analysis of phylogenetic relationships within grass subfamily Pooideae (Poaceae) inferred from sequences of nuclear single copy gene regions compared with plastid DNA.

    PubMed

    Hochbach, Anne; Schneider, Julia; Röser, Martin

    2015-06-01

    To investigate phylogenetic relationships within the grass subfamily Pooideae we studied about 50 taxa covering all recognized tribes, using one plastid DNA (cpDNA) marker (matK gene-3'trnK exon) and for the first time four nuclear single copy gene loci. DNA sequence information from two parts of the nuclear genes topoisomerase 6 (Topo6) spanning the exons 8-13 and 17-19, the exons 9-13 encoding plastid acetyl-CoA-carboxylase (Acc1) and the partial exon 1 of phytochrome B (PhyB) were generated. Individual and nuclear combined data were evaluated using maximum parsimony, maximum likelihood and Bayesian methods. All of the phylogenetic results show Brachyelytrum and the tribe Nardeae as earliest diverging lineages within the subfamily. The 'core' Pooideae (Hordeeae and the Aveneae/Poeae tribe complex) are also strongly supported, as well as the monophyly of the tribes Brachypodieae, Meliceae and Stipeae (except PhyB). The beak grass tribe Diarrheneae and the tribe Duthieeae are not monophyletic in some of the analyses. However, the combined nuclear DNA (nDNA) tree yields the highest resolution and the best delimitation of the tribes, and provides the following evolutionary hypothesis for the tribes: Brachyelytrum, Nardeae, Duthieeae, Meliceae, Stipeae, Diarrheneae, Brachypodieae and the 'core' Pooideae. Within the individual datasets, the phylogenetic trees obtained from Topo6 exon 8-13 shows the most interesting results. The divergent positions of some clone sequences of Ampelodesmos mauritanicus and Trikeraia pappiformis, for instance, may indicate a hybrid origin of these stipoid taxa. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Skip residues modulate the structural properties of the myosin rod and guide thick filament assembly

    DOE PAGES

    Taylor, Keenan C.; Buvoli, Massimo; Korkmaz, Elif Nihal; ...

    2015-07-06

    The rod of sarcomeric myosins directs thick filament assembly and is characterized by the insertion of four skip residues that introduce discontinuities in the coiled-coil heptad repeats. We report in this paper that the regions surrounding the first three skip residues share high structural similarity despite their low sequence homology. Near each of these skip residues, the coiled-coil transitions to a nonclose-packed structure inducing local relaxation of the superhelical pitch. Moreover, molecular dynamics suggest that these distorted regions can assume different conformationally stable states. In contrast, the last skip residue region constitutes a true molecular hinge, providing C-terminal rod flexibility.more » Assembly of myosin with mutated skip residues in cardiomyocytes shows that the functional importance of each skip residue is associated with rod position and reveals the unique role of the molecular hinge in promoting myosin antiparallel packing. By defining the biophysical properties of the rod, the structures and molecular dynamic calculations presented here provide insight into thick filament formation, and highlight the structural differences occurring between the coiled-coils of myosin and the stereotypical tropomyosin. Finally, in addition to extending our knowledge into the conformational and biological properties of coiled-coil discontinuities, the molecular characterization of the four myosin skip residues also provides a guide to modeling the effects of rod mutations causing cardiac and skeletal myopathies.« less

  11. Aetiological diagnosis of male sex ambiguity: a collaborative study.

    PubMed

    Morel, Yves; Rey, Rodolfo; Teinturier, Cécile; Nicolino, Marc; Michel-Calemard, Laurence; Mowszowicz, Irène; Jaubert, Francis; Fellous, Marc; Chaussain, Jean-Louis; Chatelain, Pierre; David, Michel; Nihoul-Fékété, Claire; Forest, Maguelone G; Josso, Nathalie

    2002-01-01

    A collaborative study, supported by the Biomed2 Programme of the European Community, was initiated to optimise the aetiological diagnosis in genetic or gonadal males with intersex disorders, a total of 67 patients with external sexual ambiguity, testicular tissue and/or a XY karyotype. In patients with gonadal dysgenesis or true hermaphroditism, the incidence of vaginal development was 100%, a uterus was present in 60%; uni or bilateral cryptorchidism was seen in nearly all cases of testicular dysgenesis (99%) but in only 57% of true hermaphrodites. Mean serum levels of anti-mullerian hormone and of serum testosterone response to chorionic gonadotropin stimulation were significantly decreased in both conditions, by comparison with patients with unexplained male pseudohermaphroditism or partial androgen insensitivity (PAIS). Mutations in the androgen receptor, 90% within exons 2-8, were detected in patients with PAIS. Clinically, a vaginal pouch was present in 90%, cryptorchidism in 36%. In 52% of cases, no diagnosis could be reached, despite an exhaustive clinical and laboratory work-up, including routine sequencing of exons 2-8 of the androgen receptor. By comparison with PAIS, unexplained male pseudohermaphroditism was characterised by a lower incidence of vaginal pouch (55%) and cryptorchidism (22%) but a high incidence of prematurity/intrauterine growth retardation (30%) or mild malformations (14%). reaching an aetiological diagnosis in cases of male intersex is difficult because of the variability of individual cases. Hormonal tests may help to discriminate between partial androgen insensitivity and gonadal dysgenesis/true hermaphroditism but are of less use for differentiating from unexplained male pseudohermaphroditism. Sequencing of exons 2-8 of the androgen receptor after study of testosterone precursors following human chorionic gonadotrophin stimulation is recommended when gonadal dysgenesis and true hermaphroditism can be excluded.

  12. Mathematical modeling for optimizing skip-stop rail transit operation strategy using genetic algorithm.

    DOT National Transportation Integrated Search

    2012-03-01

    "With skip-stop rail transit operation, transit agencies can reduce their operating costs and fleet size, : and passengers can experience reduced in-transit travel times without extra track and technological : improvement. However, since skip-stop op...

  13. Characterization of porcine SKIP gene in skeletal muscle development: polymorphisms, association analysis, expression and regulation of cell growth in C2C12 cells.

    PubMed

    Xiong, Qi; Chai, Jin; Deng, Changyan; Jiang, Siwen; Liu, Yang; Huang, Tao; Suo, Xiaojun; Zhang, Nian; Li, Xiaofeng; Yang, Qianping; Chen, Mingxin; Zheng, Rong

    2012-12-01

    Skeletal muscle and kidney-enriched inositol phosphatase (SKIP) was identified as a 5'-inositol phosphatase that hydrolyzes phosphatidylinositol (3,4,5)-triphosphate (PI(3,4,5)P3) to PI(3,4)P2 and negatively regulates insulin-induced phosphatidylinositol 3-kinase signaling in skeletal muscle. In this study, two new single nucleotide polymorphisms (SNPs) in porcine SKIP introns 1 and 6 were detected. The C1092T locus in intron 1 showed significant associations with some meat traits, whereas the A17G locus in intron 6 showed significant associations with some carcass traits. Expression analysis showed that porcine SKIP is upregulated at d 65 of gestation and Meishan fetuses have higher and prolonged expression of SKIP compared to Large White at d 100 of gestation. Ectopic expression of porcine SKIP decreased insulin-induced cell proliferation and promoted serum starvation-induced cell cycle arrest in G0/G1 phase in C2C12. Our results suggest that SKIP plays a negative regulatory role in skeletal muscle development partly by preventing cell proliferation. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  14. Gait biomechanics of skipping are substantially different than those of running.

    PubMed

    McDonnell, Jessica; Willson, John D; Zwetsloot, Kevin A; Houmard, Joseph; DeVita, Paul

    2017-11-07

    The inherit injury risk associated with high-impact exercises calls for alternative ways to achieve the benefits of aerobic exercise while minimizing excessive stresses to body tissues. Skipping presents such an alternative, incorporating double support, flight, and single support phases. We used ground reaction forces (GRFs), lower extremity joint torques and powers to compare skipping and running in 20 healthy adults. The two consecutive skipping steps on each limb differed significantly from each other, and from running. Running had the longest step length, the highest peak vertical GRF, peak knee extensor torque, and peak knee negative and positive power and negative and positive work. Skipping had the greater cadence, peak horizontal GRF, peak hip and ankle extensor torques, peak ankle negative power and work, and peak ankle positive power. The second vs first skipping step had the shorter step length, higher cadence, peak horizontal GRF, peak ankle extensor torque, and peak ankle negative power, negative work, and positive power and positive work. The first skipping step utilized predominately net negative joint work (eccentric muscle action) while the second utilized predominately net positive joint work (concentric muscle action). The skipping data further highlight the persistence of net negative work performed at the knee and net positive work performed at the ankle across locomotion gaits. Evidence of step segregation was seen in distribution of the braking and propelling impulses and net work produced across the hip, knee, and ankle joints. Skipping was substantially different than running and was temporally and spatially asymmetrical with successive foot falls partitioned into a dominant function, either braking or propelling whereas running had a single, repeated step in which both braking and propelling actions were performed equally. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. 78 FR 42819 - Proposed Collection; Comment Request for Form 709

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-17

    ... 709, United States Gift (and Generation-Skipping Transfer) Tax Return. DATES: Written comments should....gov . SUPPLEMENTARY INFORMATION: Title: United States Gift (and Generation-Skipping Transfer) Tax... transfers subject to the gift and generation-skipping transfer taxes and to compute these taxes. The IRS...

  16. 75 FR 38179 - Proposed Collection; Comment Request for Form 709

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-01

    ... 709, United States Gift (and Generation-Skipping Transfer) Tax Return. DATES: Written comments should....gov . SUPPLEMENTARY INFORMATION: Title: United States Gift (and Generation-Skipping Transfer) Tax... transfers subject to the gift and generation-skipping transfer taxes and to compute these taxes. The IRS...

  17. 78 FR 46688 - Proposed Collection; Comment Request for Form 706

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-01

    ... 706, United States Estate (and Generation-Skipping Transfer) Tax Return. DATES: Written comments... INFORMATION: Title: United States Estate (and Generation-Skipping Transfer) Tax Return. OMB Number: 1545-0015... imposed by Internal Revenue Code section 2001 and the Federal generation-skipping transfer (GST) tax...

  18. 26 CFR 26.2612-1 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2612-1 Definitions. (a... person. Only one direct skip occurs when a single transfer of property skips two or more generations. See... termination is a taxable termination with respect to the distributed property. (3) Simultaneous terminations...

  19. 26 CFR 26.2612-1 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2612-1 Definitions. (a... person. Only one direct skip occurs when a single transfer of property skips two or more generations. See... termination is a taxable termination with respect to the distributed property. (3) Simultaneous terminations...

  20. The Timing of Grade Skipping

    ERIC Educational Resources Information Center

    Kuo, Yi-Lung; Lohman, David F.

    2011-01-01

    The purposes of this study were to investigate the following: (a) the impact of sex, ethnicity, socioeconomic status, and family income on the likelihood of whole-grade skipping between kindergarten and Grade 7 and (b) the effects of grade skipping during elementary or middle school on students' academic achievement in high school. The authors…

  1. 1999 Survey of Active Duty Personnel: Administration, Datasets, and Codebook. Appendix G: Frequency and Percentage Distributions for Variables in the Survey Analysis Files.

    DTIC Science & Technology

    2000-12-01

    A SKIP FLAG INDICATING THE RESULT OF CHECKING THE RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP...RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP PATTERN. SEE TABLE D-5, NOTE 2, IN APPENDIX D. G-52...RESULT OF CHECKING THE RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP PATTERN. SEE TABLE D-5

  2. Reinforcement of a minor alternative splicing event in MYO7A due to a missense mutation results in a mild form of retinopathy and deafness.

    PubMed

    Ben Rebeh, Imen; Morinière, Madeleine; Ayadi, Leila; Benzina, Zeineb; Charfedine, Ilhem; Feki, Jamel; Ayadi, Hammadi; Ghorbel, Abdelmonem; Baklouti, Faouzi; Masmoudi, Saber

    2010-09-30

    Recessive mutations of the myosin VIIA (MYO7A) gene are reported to be responsible for both a deaf-blindness syndrome (Usher type 1B [USH1B] and atypical Usher syndrome) and nonsyndromic hearing loss (HL; Deafness, Neurosensory, Autosomal Recessive 2 [DFNB2]). The existence of DFNB2 is controversial, and often there is no relationship between the type and location of the MYO7A mutations corresponding to the USH1B and DFNB2 phenotype. We investigated the molecular determinant of a mild form of retinopathy in association with a subtle splicing modulation of MYO7A mRNA. Affected members underwent detailed audiologic and ocular characterization. DNA samples from family members were genotyped with polymorphic microsatellite markers. Sequencing of MYO7A was performed. Endogenous lymphoid RNA analysis and a splicing minigene assay were used to study the effect of the c.1935G>A mutation. Funduscopy showed mild retinitis pigmentosa in adults with HL. Microsatellite analysis showed linkage to markers in the region on chromosome 11q13.5. Sequencing of MYO7A revealed a mutation in the last nucleotide of exon 16 (c.1935G>A), which corresponds to a substitution of a methionine to an isoleucine residue at amino acid 645 of the myosin VIIA. However, structural prediction of the molecular model of myosin VIIA shows that this amino acid replacement induces only minor structural changes in the immediate environment of the mutation and thus does not alter the overall native structure. We found that, although predominantly included in mature mRNA, exon 16 is in fact alternatively spliced in control cells and that the mutation at the very last position is associated with a switch toward a predominant exclusion of that exon. This observation was further supported using a splicing minigene transfection assay; the c.1935G>A mutation was found to trigger a partial impairment of the adjacent donor splice site, suggesting that the unique change at the last position of the exon is responsible for the enhanced exon exclusion in this family. This study shows how an exonic mutation that weakens the 5' splice site enhances a minor alternative splicing without abolishing a complete exclusion of the exon and therefore causes a less severe retinitis pigmentosa than the USH1B-associated alleles. It would be interesting to examine a possible correlation between intrafamilial phenotypic variability and the subtle variation in exon 16 inclusion, probably related to genetic background specificities.

  3. SKIPing With Head Start Teachers: Influence of T-SKIP on Object-Control Skills.

    PubMed

    Brian, Ali; Goodway, Jacqueline D; Logan, Jessica A; Sutherland, Sue

    2017-12-01

    Children from disadvantaged settings are at risk for delays in their object-control (OC) skills. Fundamental motor skill interventions, such as the Successful Kinesthetic Instruction for Preschoolers (SKIP) Program, are highly successful when led by motor development experts. However, few preschools employ such experts. This study examined the extent to which Head Start teachers delivering an 8-week teacher-led SKIP (T-SKIP) intervention elicited learning of OC skills for Head Start children. Head Start teachers (n = 5) delivered T-SKIP for 8 weeks (450 min). Control teachers (n = 5) implemented the typical standard of practice, or well-equipped free play. All children (N = 122) were pretested and posttested on the OC Skill subscale of the Test of Gross Motor Development-2. Descriptive analyses at pretest identified 81% of the children were developmentally delayed in OC skills (below the 30th percentile). A 2-level hierarchical linear model demonstrated the effectiveness of T-SKIP with significant differences (β = 4.70), t(8) = 7.02, p < .001, η2 = .56, between T-SKIP children (n = 63) and control children (n = 59) at posttest. Head Start teachers who delivered T-SKIP could bring about positive changes in children's OC skills, thereby remediating the initial developmental delays presented. Control children remained delayed in their OC skills in spite of daily well-equipped free play, giving rise to concerns about their future motor competence and physical activity levels.

  4. Association of polymorphisms in genes of factors involved in regulation of splicing of cystic fibrosis transmembrane conductance regulator mRNA with acute respiratory distress syndrome in children with pneumonia.

    PubMed

    Perez-Marques, Francesca; Simpson, Pippa; Yan, Ke; Quasney, Michael W; Halligan, Nadine; Merchant, Daniel; Dahmer, Mary K

    2016-09-05

    Previous work has demonstrated a strong association between lung injury in African American children with pneumonia and a polymorphic (TG)mTn region in cystic fibrosis transmembrane conductance (CFTR) involved in the generation of a nonfunctional CFTR protein lacking exon 9. A number of splicing factors that regulate the inclusion/exclusion of exon 9 have been identified. The objective of this study was to determine whether genetic variants in these splicing factors were associated with acute respiratory distress syndrome (ARDS) in children with pneumonia. This is a prospective cohort genetic association study of lung injury in African American and non-Hispanic Caucasian children with community-acquired pneumonia evaluated in the emergency department or admitted to the hospital. Linkage-disequilibrium-tag single nucleotide polymorphisms (LD-tag SNPs) in genes of the following splicing factors (followed by gene name) involved in exon 9 skipping PTB1 (PTBP1), SRp40 (SFRS1), SR2/ASF (SFRS5), TDP-43 (TARDBP), TIA-1 (TIA1), and U2AF(65) (U2AF2) were genotyped. SNPs in the gene of the splicing factor CELF2 (CELF2) were selected by conservation score. Multivariable analysis was used to examine association between genotypes and ARDS. The African American cohort (n = 474) had 29 children with ARDS and the non-Hispanic Caucasian cohort (n = 304) had 32 children with ARDS. In the African American group multivariable analysis indicated that three variants in CELF2, rs7068124 (p = 0.004), rs3814634 (p = 0.032) and rs10905928 (p = 0.044), and two in TIA1, rs2592178 (p = 0.005) and rs13402990 (p = 0.018) were independently associated with ARDS. In the non-Hispanic Caucasian group, a single variant in CELF2, rs2277212 (p = 0.014), was associated with increased risk of developing ARDS. The data indicate that SNPs in CELF2 may be associated with the risk of developing ARDS in both African American and non-Hispanic Caucasian children with pneumonia and suggest that the potential role of the splicing factor CELF2 in ARDS should be explored further.

  5. 26 CFR 26.2632-1 - Allocation of GST exemption.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

  6. 26 CFR 26.2632-1 - Allocation of GST exemption.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

  7. 26 CFR 26.2632-1 - Allocation of GST exemption.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

  8. 26 CFR 26.2632-1 - Allocation of GST exemption.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

  9. 26 CFR 26.2653-1 - Taxation of multiple skips.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Taxation of multiple skips. 26.2653-1 Section 26.2653-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE...-1 Taxation of multiple skips. (a) General rule. If property is held in trust immediately after a GST...

  10. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  11. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  12. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 14 2013-04-01 2013-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  13. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 14 2014-04-01 2013-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  14. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 14 2012-04-01 2012-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  15. 26 CFR 26.2653-1 - Taxation of multiple skips.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Taxation of multiple skips. 26.2653-1 Section 26.2653-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND... Taxation of multiple skips. (a) General rule. If property is held in trust immediately after a GST, solely...

  16. One Way to Design a Valence-Skip Compound.

    PubMed

    Hase, I; Yanagisawa, T; Kawashima, K

    2017-12-01

    Valence-skip compound is a good candidate with high T c and low anisotropy because it has a large attractive interaction at the site of valence-skip atom. However, it is not easy to synthesize such compound because of (i) the instability of the skipping valence state, (ii) the competing charge order, and (iii) that formal valence may not be true in some compounds. In the present study, we show several examples of the valence-skip compounds and discuss how we can design them by first principles calculations. Furthermore, we calculated the electronic structure of a promising candidate of valence skipping compound RbTlCl 3 from first principles. We confirmed that the charge-density wave (CDW) is formed in this compound, and the Tl atoms in two crystallographic different sites take the valence Tl 1+ and Tl 3+ . Structure optimization study reveals that this CDW is stable at the ambient pressure, while this CDW gap can be collapsed when we apply pressure with several gigapascals. In this metallic phase, we can expect a large charge fluctuation and a large electron-phonon interaction.

  17. Is breakfast skipping associated with physical activity among U.S. adolescents? A cross-sectional study of adolescents aged 12-19 years, National Health and Nutrition Examination Survey (NHANES).

    PubMed

    Lyerly, Jordan E; Huber, Larissa R; Warren-Findlow, Jan; Racine, Elizabeth F; Dmochowski, Jacek

    2014-04-01

    To examine the association between breakfast skipping and physical activity among US adolescents aged 12-19 years. A cross-sectional study of nationally representative 2007-2008 National Health and Nutrition Examination Survey (NHANES) data. Breakfast skipping was assessed by two 24 h dietary recalls. Physical activity was self-reported by participants and classified based on meeting national recommendations for physical activity for the appropriate age group. Multiple logistic regression analysis was used to model the association between breakfast skipping and physical activity while controlling for confounders. A total of 936 adolescents aged 12-19 years in the USA. After adjusting for family income, there was no association between breakfast skipping and meeting physical activity guidelines for age among adolescents aged 12-19 years (OR = 0.95, 95% CI 0.56, 1.32). Findings from the study differ from previous research findings on breakfast skipping and physical activity. Therefore, further research that uses large, nationally representative US samples and national recommended guidelines for physical activity is needed.

  18. Accurate predictor-corrector skip entry guidance for low lift-to-drag ratio spacecraft

    NASA Astrophysics Data System (ADS)

    Enmi, Y.; Qian, W.; He, K.; Di, D.

    2018-06-01

    This paper develops numerical predictor-corrector skip en try guidance for vehicles with low lift-to-drag L/D ratio during the skip entry phase of a Moon return mission. The guidance method is composed of two parts: trajectory planning before entry and closed-loop gu idance during skip entry. The result of trajectory planning before entry is able to present an initial value for predictor-corrector algorithm in closed-loop guidance for fast convergence. The magnitude of bank angle, which is parameterized as a linear function of the range-to-go, is modulated to satisfy the downrange requirements. The sign of the bank ang le is determined by the bank-reversal logic. The predictor-corrector algorithm repeatedly applied onboard in each guidance cycle to realize closed-loop guidance in the skip entry phase. The effectivity of the proposed guidance is validated by simulations in nominal conditions, including skip entry, loft entry, and direct entry, as well as simulations in dispersion conditions considering the combination disturbance of the entry interface, the aerodynamic coefficients, the air density, and the mass of the vehicle.

  19. Breakfast Skipping, Extreme Commutes, and the Sex Composition at Birth.

    PubMed

    Mazumder, Bhashkar; Seeskin, Zachary

    2015-01-01

    A growing body of literature has shown that environmental exposures in the period around conception can affect the sex ratio at birth through selective attrition that favors the survival of female conceptuses. Glucose availability is considered a key indicator of the fetal environment, and its absence as a result of meal skipping may inhibit male survival. We hypothesize that breakfast skipping during pregnancy may lead to a reduction in the fraction of male births. Using time use data from the United States we show that women with commute times of 90 minutes or longer are 20 percentage points more likely to skip breakfast. Using U.S. census data we show that women with commute times of 90 minutes or longer are 1.2 percentage points less likely to have a male child under the age of 2. Under some assumptions, this implies that routinely skipping breakfast around the time of conception leads to a 6 percentage point reduction in the probability of a male child. Skipping breakfast during pregnancy may therefore constitute a poor environment for fetal health more generally.

  20. The influence of the metastasis pattern of mediastinal lymph nodes on the postoperative radiotherapy’s efficacy for the IIIA-pN2 non-small-cell lung cancer: a retrospective analysis of 220 patients

    PubMed Central

    Zhang, Baozhong; Zhao, Lujun; Yuan, Zhiyong; Pang, Qingsong; Wang, Ping

    2016-01-01

    Objective The use of postoperative radiotherapy (PORT) remains controversial for Stage IIIA-N2 non-small-cell lung cancer (NSCLC) patients, a possible reason is that IIIA-pN2 NSCLC diseases are a heterogeneous group with different clinicopathologic features. The aim of this research was to prove whether the mediastinal lymph nodes’ (LNs) skipping status could indicate the necessity of the PORT for the pN2 NSCLC patients. Methods The skip metastasis was defined as pN0N2 (no N1 LN involved), and nonskip metastasis was pN1N2 (one or more N1 LNs involved). Patients were divided into two groups: LNs nonskip and LNs skip, and postoperative chemoradiotherapy (POCRT) and postoperative chemotherapy. Then, the LN nonskip and LN skip groups were further divided into subgroups: POCRT and point of care testing (POCT) for subgroup analysis. Results There were 220 cases included in the analysis, and 43 of them received PORT. On univariate analysis, the median 3-year progression-free survival (PFS) was, respectively, 16 months (27.7%) for the LN skip group and 11 months (15.3%) for the LN nonskip group (P=0.001). The median 3-year overall survival (OS) was, respectively, 35 months (47.0%) for the LN skip group and 27 months (38.7%) for the LN nonskip group (P=0.025). The median 3-year local recurrence-free survival (LRFS) was, respectively, 25 months (41.0%) for the LN skip group and19 months (29.9%) for the LN nonskip group (P=0.014). The median 3-year distant metastasis-free survival (DMFS) was, respectively, 22 months (32.5%) for the LN skip group and 15 months (20.4%) for the LN nonskip group (P=0.013). The median 3-year PFS was, respectively, 17 months (25.6%) for the POCRT group and 12 months (18.6%) for the POCT group (P=0.037). Although the POCRT group showed better OS, LRFS, and DMFS than the POCT group, the results showed no statistical significance. In subgroup analysis, there was no statistical significance in the Kaplan–Meier analysis between subgroups, but it showed that POCRT resulted in better PFS, OS, and DMFS in both LN skip and LN nonskip subgroups; this advantage was more obvious in the LN skip subgroup. Conclusion The LN skip status is closely related to the survival of the IIIA-N2 NSCLC disease, and the LN skip patients may get more benefit in PFS and LRFS than the LN nonskip patients from PORT. PMID:27785064

  1. 26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

  2. 26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

  3. 26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

  4. 26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

  5. 26 CFR 26.2611-1 - Generation-skipping transfer defined.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2611... either a direct skip, a taxable distribution, or a taxable termination. See § 26.2612-1 for the definition of these terms. The determination as to whether an event is a GST is made by reference to the most...

  6. 7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

  7. 7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

  8. 7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

  9. 7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

  10. Characterization of variegate porphyria mutations using a minigene approach.

    PubMed

    Granata, Barbara Xoana; Baralle, Marco; De Conti, Laura; Parera, Victoria; Rossetti, Maria Victoria

    2015-01-01

    Porphyrias are a group of metabolic diseases that affect the skin and/or nervous system. In 2008, three unrelated patients were diagnosed with variegate porphyria at the CIPYP (Centro de Investigaciones sobre Porfirinas y Porfirias). Sequencing of the protoporphyrinogen oxidase gene, the gene altered in this type of porphyria, revealed three previously undescribed mutations: c.338+3insT, c.807G>A, and c.808-1G>C. As these mutations do not affect the protein sequence, we hypothesized that they might be splicing mutations. RT-PCRs performed on the patient's mRNAs showed normal mRNA or no amplification at all. This result indicated that the aberrant spliced transcript is possibly being degraded. In order to establish whether they were responsible or not for the patient's disease by causing aberrant splicing, we utilized a minigene approach. We found that the three mutations lead to exon skipping; therefore, the abnormal mRNAs are most likely degraded by a mechanism such as nonsense-mediated decay. In conclusion, these mutations are responsible for the disease because they alter the normal splicing pathway, thus providing a functional explanation for the appearance of disease and highlighting the use of minigene assays to complement transcript analysis.

  11. Antisense pre-treatment increases gene therapy efficacy in dystrophic muscles.

    PubMed

    Peccate, Cécile; Mollard, Amédée; Le Hir, Maëva; Julien, Laura; McClorey, Graham; Jarmin, Susan; Le Heron, Anita; Dickson, George; Benkhelifa-Ziyyat, Sofia; Piétri-Rouxel, France; Wood, Matthew J; Voit, Thomas; Lorain, Stéphanie

    2016-08-15

    In preclinical models for Duchenne muscular dystrophy, dystrophin restoration during adeno-associated virus (AAV)-U7-mediated exon-skipping therapy was shown to decrease drastically after six months in treated muscles. This decline in efficacy is strongly correlated with the loss of the therapeutic AAV genomes, probably due to alterations of the dystrophic myofiber membranes. To improve the membrane integrity of the dystrophic myofibers at the time of AAV-U7 injection, mdx muscles were pre-treated with a single dose of the peptide-phosphorodiamidate morpholino (PPMO) antisense oligonucleotides that induced temporary dystrophin expression at the sarcolemma. The PPMO pre-treatment allowed efficient maintenance of AAV genomes in mdx muscles and enhanced the AAV-U7 therapy effect with a ten-fold increase of the protein level after 6 months. PPMO pre-treatment was also beneficial to AAV-mediated gene therapy with transfer of micro-dystrophin cDNA into muscles. Therefore, avoiding vector genome loss after AAV injection by PPMO pre-treatment would allow efficient long-term restoration of dystrophin and the use of lower and thus safer vector doses for Duchenne patients. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Beta-ketothiolase deficiency: An unusual cause of recurrent ketoacidosis.

    PubMed

    Kılıç-Yıldırım, Gonca; Durmuş-Aydoğdu, Sultan; Ceylaner, Serdar; Sass, Jörn Oliver

    2017-01-01

    Kılıç-Yıldırım G, Durmuş-Aydoğdu S, Ceylaner S, Sass JO. Beta-ketothiolase deficiency: An unusual cause of recurrent ketoacidosis. Turk J Pediatr 2017; 59: 471-474. Beta-ketothiolase deficiency (mitochondrial acetoacetyl-CoA thiolase, MAT or T2 deficiency) is a rare autosomal recessive disorder of isoleucine and ketone body metabolism due to acetyl-CoA acetyltransferase-1 (ACAT1) gene mutations. The disease is characterized by recurrent episodes of ketoasidosis which starts with vomiting and followed by dehydration and tachypnea. Here, we present a patient who was admitted to the hospital with severe acidosis and dehydration because of vomiting induced by protein rich nutrient and was diagnosed with MAT deficiency. 3-hydroxy-butyric acid, acetoacetic acid and 3-hydroxy-iso-valeric acid levels were significantly increased and tiglyglycine as trace amount in the urine organic acid analysis of the patient. Genetic analysis for ACAT-1 showed compound heterozygosity for the mutations c.949G > A (p.D317N) and c.951C > T (p.D317D), which both are known to cause exon 10 skipping and to be pathogenic missense mutations.

  13. PubMed Central

    DE LOS ANGELES BEYTÍA, MARIA; VRY, JULIA; KIRSCHNER, JANBERND

    2012-01-01

    Duchenne muscular dystrophy (DMD) is a disease linked to the X-chromosome which affects 1 in 3,600-6,000 newborn males. It is manifested by the absence of the dystrophin protein in muscle fibres, which causes progressive damage leading to death in the third decade of life. The only medication so far shown to be effective in delaying the progression of this illness are corticosteroids, which have been shown to increase muscle strength in randomised controlled studies; long-term studies have demonstrated that they prolong walking time and retard the progression of respiratory dysfunction, dilated cardiomyopathy and scoliosis. Several potential drugs are now being investigated. Genetic therapy, involving the insertion of a dystrophin gene through a vector, has proven effective in animals but not humans. Currently under clinical study is Ataluren, a molecule that binds with ribosomes and may allow the insertion of an aminoacid in the premature termination codon, and exon-skipping, which binds with RNA and excludes specific sites of RNA splicing, producing a dystrophin that is smaller but functional. There are also studies attempting to modulate other muscular proteins, such as myostatin and utrophin, to reduce symptoms. This paper does not address cardiomyopathy treatment in DMD patients. PMID:22655510

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gehrmann, Thies; Pelkmans, Jordi F.; Lugones, Luis G.

    Recent genome-wide studies have demonstrated that fungi possess the machinery to alternatively splice pre-mRNA. However, there has not been a systematic categorization of the functional impact of alternative splicing in a fungus. We investigate alternative splicing and its functional consequences in the model mushroom forming fungus Schizophyllum commune. Alternative splicing was demonstrated for 2,285 out of 12,988 expressed genes, resulting in 20% additional transcripts. Intron retentions were the most common alternative splicing events, accounting for 33% of all splicing events, and 43% of the events in coding regions. On the other hand, exon skipping events were rare in coding regionsmore » (1%) but enriched in UTRs where they accounted for 57% of the events. Specific functional groups, including transcription factors, contained alternatively spliced genes. Alternatively spliced transcripts were regulated differently throughout development in 19% of the 2,285 alternatively spliced genes. Notably, 69% of alternatively spliced genes have predicted alternative functionality by loss or gain of functional domains, or by acquiring alternative subcellular locations. S. commune exhibits more alternative splicing than any other studied fungus. Finally, taken together, alternative splicing increases the complexity of the S. commune proteome considerably and provides it with a rich repertoire of alternative functionality that is exploited dynamically.« less

  15. Genetic therapeutic approaches for Duchenne muscular dystrophy.

    PubMed

    Foster, Helen; Popplewell, Linda; Dickson, George

    2012-07-01

    Despite an expansive wealth of research following the discovery of the DMD gene 25 years ago, there is still no curative treatment for Duchenne muscular dystrophy. However, there are currently many promising lines of research, including cell-based therapies and pharmacological reagents to upregulate dystrophin via readthrough of nonsense mutations or by upregulation of the dystrophin homolog utrophin. Here we review genetic-based therapeutic strategies aimed at the amelioration of the DMD phenotype. These include the reintroduction of a copy of the DMD gene into an affected tissue by means of a viral vector; correction of the mutated DMD transcript by antisense oligonucleotide-induced exon skipping to restore the open reading frame; and direct modification of the DMD gene at a chromosomal level through genome editing. All these approaches are discussed in terms of the more recent advances, and the hurdles to be overcome if a comprehensive and effective treatment for DMD is to be found. These hurdles include the need to target all musculature of the body. Therefore any potential treatment would need to be administered systemically. In addition, any treatment needs to have a long-term effect, with the possibility of readministration, while avoiding any potentially detrimental immune response to the vector or transgene.

  16. A 76-bp deletion in the Mip gene causes autosomal dominant cataract in Hfi mice.

    PubMed

    Sidjanin, D J; Parker-Wilson, D M; Neuhäuser-Klaus, A; Pretsch, W; Favor, J; Deen, P M; Ohtaka-Maruyama, C; Lu, Y; Bragin, A; Skach, W R; Chepelinsky, A B; Grimes, P A; Stambolian, D E

    2001-06-15

    Hfi is a dominant cataract mutation where heterozygotes show hydropic lens fibers and homozygotes show total lens opacity. The Hfi locus was mapped to the distal part of mouse chromosome 10 close to the major intrinsic protein (Mip), which is expressed only in cell membranes of lens fibers. Molecular analysis of Mip revealed a 76-bp deletion that resulted in exon 2 skipping in Mip mRNA. In Hfi/Hfi this deletion resulted in a complete absence of the wildtype Mip. In contrast, Hfi/+ animals had the same amount of wildtype Mip as +/+. Results from pulse-chase expression studies excluded hetero-oligomerization of wildtype and mutant Mip as a possible mechanism for cataract formation in the Hfi/+. We propose that the cataract phenotype in the Hfi heterozygote mutant is due to a detrimental gain of function by the mutant Mip resulting in either cytotoxicity or disruption in processing of other proteins important for the lens. Cataract formation in the Hfi/Hfi mouse is probably a combined result of both the complete loss of wildtype Mip and a gain of function of the mutant Mip. Copyright 2001 Academic Press.

  17. Sweets, snacking habits, and skipping meals in children and adolescents on intensive insulin treatment.

    PubMed

    Øverby, N C; Margeirsdottir, H D; Brunborg, C; Dahl-Jørgensen, K; Andersen, L F

    2008-08-01

    To examine the association between skipping meals and snacking events and dietary and clinical characteristics in children and adolescents using modern insulin treatment. Dietary intake was recorded for 4 d in food diaries in 655 young diabetic patients. Number of meals and snacking events was recorded in a separated questionnaire, while clinical data were obtained from case record forms. Skipping meals refer to consuming a main meal (e.g., breakfast) five times a week or less. Modern insulin treatment may favor a more flexible lifestyle. This study shows that there are fewer young diabetic patients who skip meals than non-diabetic controls (p < 0.001) even when using modern intensified insulin treatment. However, skipping meals among young diabetic patients was associated with negative characteristics such as having suboptimal hemoglobin A1c (HbA1c) (OR 4.7, p = 0.02), higher low-density lipoprotein (LDL) cholesterol levels (OR 4.0, p < 0.001), watching more TV (OR 3.6, p < 0.001), being overweight (OR 2.8, p = 0.03), as well as having a higher intake of added sugar (OR 2.1, p = 0.01) and lower intake of fiber (OR 0.2, p = 0.04) compared with those not skipping meals. Having more than two snacking events during the day was associated with higher HbA1c, higher intake of added sugar and sweets, and spending more hours in front of the TV or personal computer. In general, fewer children and adolescents with type 1 diabetes skip meals compared with healthy peers. Those who skip meals and have more snacking events have poorer glycemic control and less healthy dietary and leisure habits.

  18. Elastic spheres can walk on water.

    PubMed

    Belden, Jesse; Hurd, Randy C; Jandron, Michael A; Bower, Allan F; Truscott, Tadd T

    2016-02-04

    Incited by public fascination and engineering application, water-skipping of rigid stones and spheres has received considerable study. While these objects can be coaxed to ricochet, elastic spheres demonstrate superior water-skipping ability, but little is known about the effect of large material compliance on water impact physics. Here we show that upon water impact, very compliant spheres naturally assume a disk-like geometry and dynamic orientation that are favourable for water-skipping. Experiments and numerical modelling reveal that the initial spherical shape evolves as elastic waves propagate through the material. We find that the skipping dynamics are governed by the wave propagation speed and by the ratio of material shear modulus to hydrodynamic pressure. With these insights, we explain why softer spheres skip more easily than stiffer ones. Our results advance understanding of fluid-elastic body interaction during water impact, which could benefit inflatable craft modelling and, more playfully, design of elastic aquatic toys.

  19. Elastic spheres can walk on water

    PubMed Central

    Belden, Jesse; Hurd, Randy C.; Jandron, Michael A.; Bower, Allan F.; Truscott, Tadd T.

    2016-01-01

    Incited by public fascination and engineering application, water-skipping of rigid stones and spheres has received considerable study. While these objects can be coaxed to ricochet, elastic spheres demonstrate superior water-skipping ability, but little is known about the effect of large material compliance on water impact physics. Here we show that upon water impact, very compliant spheres naturally assume a disk-like geometry and dynamic orientation that are favourable for water-skipping. Experiments and numerical modelling reveal that the initial spherical shape evolves as elastic waves propagate through the material. We find that the skipping dynamics are governed by the wave propagation speed and by the ratio of material shear modulus to hydrodynamic pressure. With these insights, we explain why softer spheres skip more easily than stiffer ones. Our results advance understanding of fluid-elastic body interaction during water impact, which could benefit inflatable craft modelling and, more playfully, design of elastic aquatic toys. PMID:26842860

  20. Out-of-pocket drug costs and drug utilization patterns of postmenopausal Medicare beneficiaries with osteoporosis.

    PubMed

    Conwell, Leslie Jackson; Esposito, Dominick; Garavaglia, Susan; Meadows, Eric S; Colby, Margaret; Herrera, Vivian; Goldfarb, Seth; Ball, Daniel; Marciniak, Martin

    2011-08-01

    The Medicare Part D coverage gap has been associated with lower adherence and drug utilization and higher discontinuation. Because osteoporosis has a relatively high prevalence among Medicare-eligible postmenopausal women, we examined changes in utilization of osteoporosis medications during this coverage gap. The purpose of this study was to investigate changes in out-of-pocket (OOP) drug costs and utilization associated with the Medicare Part D coverage gap among postmenopausal beneficiaries with osteoporosis. This retrospective analysis of 2007 pharmacy claims focuses on postmenopausal female Medicare beneficiaries enrolled in full-, partial-, or no-gap exposure standard or Medicare Advantage prescription drug plans (PDPs), retiree drug subsidy (RDS) plans, or the low-income subsidy program. We compared beneficiaries with osteoporosis who were taking teriparatide (Eli Lilly and Company, Indianapolis, Indiana) (n = 5657) with matched samples of beneficiaries who were taking nonteriparatide osteoporosis medications (NTO; n = 16,971) or who had other chronic conditions (OCC; n = 16,971). We measured average monthly prescription drug fills and OOP costs, medication discontinuation, and skipping. More than half the sample reached the coverage gap; OOP costs then rose for teriparatide users enrolled in partial- or full-gap exposure plans (increase of 121% and 186%; $300 and $349) but fell for those in no-gap exposure PDPs or RDS plans (decrease of 49% and 30%; $131 and $40). OOP costs for beneficiaries in partial- or full-gap exposure PDPs increased >120% (increase of $144 and $176) in the NTO group and nearly doubled for the OCC group (increase of $124 and $151); these OOP costs were substantially lower than those for teriparatide users. Both teriparatide users and NTO group members discontinued or skipped medications more often than persons in the OCC group, regardless of plan or benefit design. Medication discontinuation and OOP costs among beneficiaries with osteoporosis were highest for those enrolled in Part D plans with a coverage gap. Providers should be aware of potential cost-related nonadherence among Medicare beneficiaries taking osteoporosis medications. Copyright © 2011 Elsevier HS Journals, Inc. All rights reserved.

  1. 40 CFR 61.243-2 - Alternative standards for valves in VHAP service-skip period leak detection and repair.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... VHAP service-skip period leak detection and repair. 61.243-2 Section 61.243-2 Protection of Environment... AIR POLLUTANTS National Emission Standard for Equipment Leaks (Fugitive Emission Sources) § 61.243-2 Alternative standards for valves in VHAP service—skip period leak detection and repair. (a)(1) An owner or...

  2. 40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

  3. 40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

  4. 40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

  5. 40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

  6. 40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

  7. 40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

  8. 40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

  9. 40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

  10. 40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

  11. 40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

  12. Water walking - an evolution of water surface skipping

    NASA Astrophysics Data System (ADS)

    Hurd, Randy; Belden, Jesse; Jandron, Michael; Bower, Allan; Holekamp, Sean; Truscott, Tadd

    2017-11-01

    Previous work has shown that elastomeric spheres skip more easily than disk-shaped stones. This is due to increased lift stemming from sphere deformation, which provides an increased cross-sectional area and favorable attack angle upon impact. We extend lift models developed for individual impacts to long-range multiple impact events and compare the estimates to experimental results, which show good agreement. Additionally, a surprising new mode of skipping is observed that resembles water-walking, wherein a quickly rotating sphere produces small successive impacts allowing it to move parallel to the water surface. The dynamics of this new multiple skip behavior are rationalized analytically and tested experimentally.

  13. New scene change control scheme based on pseudoskipped picture

    NASA Astrophysics Data System (ADS)

    Lee, Youngsun; Lee, Jinwhan; Chang, Hyunsik; Nam, Jae Y.

    1997-01-01

    A new scene change control scheme which improves the video coding performance for sequences that have many scene changed pictures is proposed in this paper. The scene changed pictures except intra-coded picture usually need more bits than normal pictures in order to maintain constant picture quality. The major idea of this paper is how to obtain extra bits which are needed to encode scene changed pictures. We encode a B picture which is located before a scene changed picture like a skipped picture. We call such a B picture as a pseudo-skipped picture. By generating the pseudo-skipped picture like a skipped picture. We call such a B picture as a pseudo-skipped picture. By generating the pseudo-skipped picture, we can save some bits and they are added to the originally allocated target bits to encode the scene changed picture. The simulation results show that the proposed algorithm improves encoding performance about 0.5 to approximately 2.0 dB of PSNR compared to MPEG-2 TM5 rate controls scheme. In addition, the suggested algorithm is compatible with MPEG-2 video syntax and the picture repetition is not recognizable.

  14. Performance Analysis of Stop-Skipping Scheduling Plans in Rail Transit under Time-Dependent Demand

    PubMed Central

    Cao, Zhichao; Yuan, Zhenzhou; Zhang, Silin

    2016-01-01

    Stop-skipping is a key method for alleviating congestion in rail transit, where schedules are sometimes difficult to implement. Several mechanisms have been proposed and analyzed in the literature, but very few performance comparisons are available. This study formulated train choice behavior estimation into the model considering passengers’ perception. If a passenger’s train path can be identified, this information would be useful for improving the stop-skipping schedule service. Multi-performance is a key characteristic of our proposed five stop-skipping schedules, but quantified analysis can be used to illustrate the different effects of well-known deterministic and stochastic forms. Problems in the novel category of forms were justified in the context of a single line rather than transit network. We analyzed four deterministic forms based on the well-known A/B stop-skipping operating strategy. A stochastic form was innovatively modeled as a binary integer programming problem. We present a performance analysis of our proposed model to demonstrate that stop-skipping can feasibly be used to improve the service of passengers and enhance the elasticity of train operations under demand variations along with an explicit parametric discussion. PMID:27420087

  15. Performance Analysis of Stop-Skipping Scheduling Plans in Rail Transit under Time-Dependent Demand.

    PubMed

    Cao, Zhichao; Yuan, Zhenzhou; Zhang, Silin

    2016-07-13

    Stop-skipping is a key method for alleviating congestion in rail transit, where schedules are sometimes difficult to implement. Several mechanisms have been proposed and analyzed in the literature, but very few performance comparisons are available. This study formulated train choice behavior estimation into the model considering passengers' perception. If a passenger's train path can be identified, this information would be useful for improving the stop-skipping schedule service. Multi-performance is a key characteristic of our proposed five stop-skipping schedules, but quantified analysis can be used to illustrate the different effects of well-known deterministic and stochastic forms. Problems in the novel category of forms were justified in the context of a single line rather than transit network. We analyzed four deterministic forms based on the well-known A/B stop-skipping operating strategy. A stochastic form was innovatively modeled as a binary integer programming problem. We present a performance analysis of our proposed model to demonstrate that stop-skipping can feasibly be used to improve the service of passengers and enhance the elasticity of train operations under demand variations along with an explicit parametric discussion.

  16. Deletion of exons 9 and 10 of the Presenilin 1 gene in a patient with Early-onset Alzheimer Disease generates longer amyloid seeds.

    PubMed

    Le Guennec, Kilan; Veugelen, Sarah; Quenez, Olivier; Szaruga, Maria; Rousseau, Stéphane; Nicolas, Gaël; Wallon, David; Fluchere, Frédérique; Frébourg, Thierry; De Strooper, Bart; Campion, Dominique; Chávez-Gutiérrez, Lucía; Rovelet-Lecrux, Anne

    2017-08-01

    Presenilin 1 (PSEN1) mutations are the main cause of autosomal dominant Early-onset Alzheimer Disease (EOAD). Among them, deletions of exon 9 have been reported to be associated with a phenotype of spastic paraparesis. Using exome data from a large sample of 522 EOAD cases and 584 controls to search for genomic copy-number variations (CNVs), we report here a novel partial, in-frame deletion of PSEN1, removing both exons 9 and 10. The patient presented with memory impairment associated with spastic paraparesis, both starting from the age of 56years. He presented a positive family history of EOAD. We performed functional analysis to elucidate the impact of this novel deletion on PSEN1 activity as part of the γ-secretase complex. The deletion does not affect the assembly of a mature protease complex but has an extreme impact on its global endopeptidase activity. The mutant carboxypeptidase-like activity is also strongly impaired and the deleterious mutant effect leads to an incomplete digestion of long Aβ peptides and enhances the production of Aβ43, which has been shown to be potently amyloidogenic and neurotoxic in vivo. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene.

    PubMed

    Gonçalves, Ana; Oliveira, Jorge; Coelho, Teresa; Taipa, Ricardo; Melo-Pires, Manuel; Sousa, Mário; Santos, Rosário

    2017-10-03

    A broad mutational spectrum in the dystrophin ( DMD ) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD , adding to the diversity of mutational events that give rise to D/BMD.

  18. Screening strategies for a highly polymorphic gene: DHPLC analysis of the Fanconi anemia group A gene.

    PubMed

    Rischewski, J; Schneppenheim, R

    2001-01-30

    Patients with Fanconi anemia (Fanc) are at risk of developing leukemia. Mutations of the group A gene (FancA) are most common. A multitude of polymorphisms and mutations within the 43 exons of the gene are described. To examine the role of heterozygosity as a risk factor for malignancies, a partially automatized screening method to identify aberrations was needed. We report on our experience with DHPLC (WAVE (Transgenomic)). PCR amplification of all 43 exons from one individual was performed on one microtiter plate on a gradient thermocycler. DHPLC analysis conditions were established via melting curves, prediction software, and test runs with aberrant samples. PCR products were analyzed twice: native, and after adding a WT-PCR product. Retention patterns were compared with previously identified polymorphic PCR products or mutants. We have defined the mutation screening conditions for all 43 exons of FancA using DHPLC. So far, 40 different sequence variations have been detected in more than 100 individuals. The native analysis identifies heterozygous individuals, and the second run detects homozygous aberrations. Retention patterns are specific for the underlying sequence aberration, thus reducing sequencing demand and costs. DHPLC is a valuable tool for reproducible recognition of known sequence aberrations and screening for unknown mutations in the highly polymorphic FancA gene.

  19. Breakfast skipping as a risk correlate of overweight and obesity in school-going ethnic Fijian adolescent girls

    PubMed Central

    Thompson-McCormick, Jonas J; Thomas, Jennifer J; Bainivualiku, Asenaca; Khan, A Nisha; Becker, Anne E

    2013-01-01

    The prevalence of overweight and obesity has increased globally, and population data suggest that it is also increasing among ethnic Fijian youth. Among numerous behavioural changes contributing to overweight in youth residing in nations undergoing rapid economic and social change, meal skipping has not been examined as a potential risk factor. The study objectives were to assess the prevalence of overweight, obesity, and breakfast skipping and examine their cross-sectional association in a community sample of school-going ethnic Fijian adolescent girls (n=523). We measured height and weight, and assessed dietary patterns, eating pathology, dimensions of acculturation, and other socio-demographic and cultural data by self-report. We observed a high prevalence of both overweight (41%, including 15% who were obese) and breakfast skipping (68%). In addition, in multivariable analyses unadjusted for eating pathology, we found that more frequent breakfast skipping was associated with greater odds of overweight (odds ratio (OR)=1.15, confidence interval (CI)=1.06, 1.26, p<0.01) and obesity (OR=1.18, CI=1.05, 1.33, p<0.01). Regression models adjusting for eating pathology attenuated this relation so that it was non-significant, but demonstrated that greater eating pathology was associated with greater odds of both overweight and obesity. Future research is necessary to clarify the relation among breakfast skipping, eating pathology, and overweight in ethnic Fijian girls, and to identify whether breakfast skipping may be a modifiable risk factor for overweight in this population. PMID:20805082

  20. Relationship between Breakfast Skipping and Obesity among Elderly: Cross-Sectional Analysis of the HEIJO-KYO Study.

    PubMed

    Otaki, N; Obayashi, K; Saeki, K; Kitagawa, M; Tone, N; Kurumatani, N

    2017-01-01

    Breakfast skipping is reported to be associated with obesity in children and younger populations; however, few studies report the association among elderly. The purpose of this study was to investigate the relationships between breakfast skipping and obesity prevalence among elderly. Cross-sectional study. Community-dwelling elderly in Nara, Japan. 1052 elderly participants (mean age: 71.6 years). Obesity and breakfast skipping were defined as body mass index of ≥25 kg/m2 and skipping breakfast one or more times per week, respectively. Two hundred and seventy-two participants (25.9%) were classified as obese and forty-one (3.9%) were as breakfast skippers. Obesity prevalence was significantly higher in breakfast skippers than in breakfast eaters (43.9% vs. 25.1%, P = 0.007). In multivariable logistic regression analysis adjusted for potential confounders (age, sex and alcohol consumption), breakfast skippers showed significantly higher odds ratio (OR) for obesity than breakfast eaters (OR, 2.23; 95% confidence interval, 1.17-4.27; P = 0.015), which continued to be significant after further adjustment for socioeconomic status. In addition, breakfast skippers showed significantly lower daily potassium (P <0.001) and dietary fibre intakes (P = 0.001) and lower subjective physical activity (P = 0.035) than breakfast eaters. Breakfast skipping was significantly associated with obesity among elderly. Poor diet quality and physical inactivity may be potential intermediators underlying the association between breakfast skipping and obesity.

  1. The relationship of breakfast skipping and type of breakfast consumption with nutrient intake and weight status in children and adolescents: the National Health and Nutrition Examination Survey 1999-2006

    USDA-ARS?s Scientific Manuscript database

    National data comparing nutrient intakes and anthropometric measures in children and adolescents in the United States who skip breakfast or consume different types of breakfasts are limited. The objective was to examine the relationship between breakfast skipping and type of breakfast consumed with ...

  2. Skip trajectory flight of a ramjet-powered hypersonic vehicle

    NASA Astrophysics Data System (ADS)

    Fomin, V. M.; Aulchenko, S. M.; Zvegintsev, V. I.

    2010-07-01

    Possible skip trajectories of a flying vehicle with a periodically actuated ramjet are numerically simulated. An optimal choice of ramjet actuation areas and duration is demonstrated to ensure the maximum flight range with a given amount of the fuel. The main advantage of skip trajectories is found to be a significant (by an order of magnitude) decrease in thermal loads on the flying vehicle.

  3. An examination of the role of feeding regimens in regulating metabolism during the broiler breeder grower period. 1. Hepatic lipid metabolism.

    PubMed

    de Beer, M; Rosebrough, R W; Russell, B A; Poch, S M; Richards, M P; Coon, C N

    2007-08-01

    A trial was conducted to determine the effects of feeding regimens on hepatic lipid metabolism in 16-wk-old broiler breeder pullets. A flock of 350 Cobb 500 breeder pullets was divided into 2 at 4 wk of age and fed either every day (ED) or skip-a-day (SKIP) from 4 to 16 wk of age. Total feed intake did not differ between the 2 groups. At 112 d, 52 randomly selected ED-fed pullets, and 76 SKIP-fed pullets were individually caged and fed a 74-g (ED) or 148-g (SKIP) meal. Four pullets from each group were killed at intervals after feeding and livers were collected, weighed, and snap-frozen for determination of lipogenic gene expression. Total RNA was isolated from livers using Trizol reagent and then quantitatively measured by noting the optical density 260:280 ratio and qualitatively measured by gel electrophoresis. The expression of certain regulatory genes in metabolism [acetyl coenzyme A carboxylase; fatty acid synthase; malic enzyme (MAE); isocitrate dehydrogenase (ICDH); and aspartate aminotransferase (AAT)] were determined by real-time reverse-transcription PCR. Remaining liver portions were analyzed for enzyme activity of MAE, ICDH, and AAT as well as glycogen and lipid contents. Liver weight was higher in SKIP than in ED birds. Feeding caused dramatic increases in liver weight, glycogen, and lipids of SKIP birds. Expression of acetyl coenzyme A carboxylase, FAS, and MAE genes were increased in SKIP birds 12 and 24 h after feeding, with the increases in MAE expression from 0 to 24 h after feeding being of the greatest magnitude. In contrast, SKIP decreased ICDH and AAT gene expression, which parallels findings noted in fasting-refeeding experiments conducted with much younger birds. Skip-a-day feeding resulted in far greater changes in gene expression compared with ED, which was indicative of the inconsistent supply of nutrients in such regimens. Enzyme activity of MAE, ICDH, and AAT was reflective of noted changes in gene expression. In summary, the feeding regimen greatly affected hepatic gene expression in breeder pullets.

  4. Media use as a reason for meal skipping and fast eating in secondary school children.

    PubMed

    Van den Bulck, J; Eggermont, S

    2006-04-01

    This study examined self-reported meal skipping and eating faster than usual with the goal of watching television or playing computer games. Respondents reported their media use and indicated how often they skipped a meal to watch a favourite television programme or to play a computer game, and how often they ate faster than usual in order to watch television or play a computer game. Respondents were 2546 adolescents of 13 (first year of secondary school) and 16 years (fourth year of secondary school) of age. About one respondent in 10 skipped at least one meal every week for either television viewing or computer game playing. Weekly meal skipping for television viewing occurs more regularly in boys and first-year students, but particularly in teenagers who view 5 h or more daily (15% of the sample). The category of teenagers who play computer games four times a week or more (25.3% of the sample) is at increased risk of meal skipping; those who play more than four times a week are 10 times more likely weekly to skip a meal. A quarter of the adolescents eat faster at least once a week to be able to watch television or play a computer game. Regardless of gender and school year, teenagers' risk of eating faster progressively increases with their use of the media. Those who watch 4 h or more daily are about seven times more likely to skip a meal for television and those who play computer games at least four times a week are nine times more likely weekly to skip a meal. Unhealthy eating habits can be a side effect of heavy or excessive media use. Teenagers' use of television or game computers during nonworking or out-of-school hours partly displaces the amount of time that needs to be spent at meals. Practitioners and educators may try to encourage or restore a pattern of healthful meal consumption habits by reducing the amount of media use, and by supporting parental rule-making regarding children's eating habits and media use.

  5. Optimized P2A for reporter gene insertion into Nipah virus results in efficient ribosomal skipping and wild-type lethality.

    PubMed

    Park, Arnold; Yun, Tatyana; Hill, Terence E; Ikegami, Tetsuro; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Freiberg, Alexander N; Lee, Benhur

    2016-04-01

    Incorporation of reporter genes within virus genomes is an indispensable tool for interrogation of virus biology and pathogenesis. In previous work, we incorporated a fluorophore into a viral ORF by attaching it to the viral gene via a P2A ribosomal skipping sequence. This recombinant Nipah virus, however, was attenuated in vitro relative to WT virus. In this work, we determined that inefficient ribosomal skipping was a major contributing factor to this attenuation. Inserting a GSG linker before the P2A sequence resulted in essentially complete skipping, significantly improved growth in vitro, and WT lethality in vivo. To the best of our knowledge, this represents the first time a recombinant virus of Mononegavirales with integration of a reporter into a viral ORF has been compared with the WT virus in vivo. Incorporating the GSG linker for improved skipping efficiency whenever functionally important is a critical consideration for recombinant virus design.

  6. Autosomal-recessive congenital cerebellar ataxia is caused by mutations in metabotropic glutamate receptor 1.

    PubMed

    Guergueltcheva, Velina; Azmanov, Dimitar N; Angelicheva, Dora; Smith, Katherine R; Chamova, Teodora; Florez, Laura; Bynevelt, Michael; Nguyen, Thai; Cherninkova, Sylvia; Bojinova, Veneta; Kaprelyan, Ara; Angelova, Lyudmila; Morar, Bharti; Chandler, David; Kaneva, Radka; Bahlo, Melanie; Tournev, Ivailo; Kalaydjieva, Luba

    2012-09-07

    Autosomal-recessive congenital cerebellar ataxia was identified in Roma patients originating from a small subisolate with a known strong founder effect. Patients presented with global developmental delay, moderate to severe stance and gait ataxia, dysarthria, mild dysdiadochokinesia, dysmetria and tremors, intellectual deficit, and mild pyramidal signs. Brain imaging revealed progressive generalized cerebellar atrophy, and inferior vermian hypoplasia and/or a constitutionally small brain were observed in some patients. Exome sequencing, used for linkage analysis on extracted SNP genotypes and for mutation detection, identified two novel (i.e., not found in any database) variants located 7 bp apart within a unique 6q24 linkage region. Both mutations cosegregated with the disease in five affected families, in which all ten patients were homozygous. The mutated gene, GRM1, encodes metabotropic glutamate receptor mGluR1, which is highly expressed in cerebellar Purkinje cells and plays an important role in cerebellar development and synaptic plasticity. The two mutations affect a gene region critical for alternative splicing and the generation of receptor isoforms; they are a 3 bp exon 8 deletion and an intron 8 splicing mutation (c.2652_2654del and c.2660+2T>G, respectively [RefSeq accession number NM_000838.3]). The functional impact of the deletion is unclear and is overshadowed by the splicing defect. Although ataxia lymphoblastoid cell lines expressed GRM1 at levels comparable to those of control cells, the aberrant transcripts skipped exon 8 or ended in intron 8 and encoded various species of nonfunctional receptors either lacking the transmembrane domain and containing abnormal intracellular tails or completely missing the tail. The study implicates mGluR1 in human hereditary ataxia. It also illustrates the potential of the Roma founder populations for mutation identification by exome sequencing. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  7. Transcriptomic profile analysis of mouse neural tube development by RNA-Seq.

    PubMed

    Yu, Juan; Mu, Jianbing; Guo, Qian; Yang, Lihong; Zhang, Juan; Liu, Zhizhen; Yu, Baofeng; Zhang, Ting; Xie, Jun

    2017-09-01

    The neural tube is the primordium of the central nervous system (CNS) in which its development is not entirely clear. Understanding the cellular and molecular basis of neural tube development could, therefore, provide vital clues to the mechanism of neural tube defects (NTDs). Here, we investigated the gene expression profiles of three different time points (embryonic day (E) 8.5, 9.5 and 10.5) of mouse neural tube by using RNA-seq approach. About 391 differentially expressed genes (DEGs) were screened during mouse neural tube development, including 45 DEGs involved in CNS development, among which Bmp2, Ascl1, Olig2, Lhx1, Wnt7b and Eomes might play the important roles. Of 45 DEGs, Foxp2, Eomes, Hoxb3, Gpr56, Hap1, Nkx2-1, Sez6l2, Wnt7b, Tbx20, Nfib, Cntn1 and Dcx had different isoforms, and the opposite expression pattern of different isoforms was observed for Gpr56, Nkx2-1 and Sez6l2. In addition, alternative splicing, such as mutually exclusive exon, retained intron, skipped exon and alternative 3' splice site was identified in 10 neural related differentially splicing genes, including Ngrn, Ddr1, Dctn1, Dnmt3b, Ect2, Map2, Mbnl1, Meis2, Vcan and App. Moreover, seven neural splicing factors, such as Nova1/2, nSR100/Srrm4, Elavl3/4, Celf3 and Rbfox1 were differentially expressed during mouse neural tube development. Interestingly, nine DEGs identified above were dysregulated in retinoic acid-induced NTDs model, indicating the possible important role of these genes in NTDs. Taken together, our study provides more comprehensive information on mouse neural tube development, which might provide new insights on NTDs occurrence. © 2017 IUBMB Life, 69(9):706-719, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

  8. Genomic organization of the human mi-er1 gene and characterization of alternatively spliced isoforms: regulated use of a facultative intron determines subcellular localization.

    PubMed

    Paterno, Gary D; Ding, Zhihu; Lew, Yuan-Y; Nash, Gord W; Mercer, F Corinne; Gillespie, Laura L

    2002-07-24

    mi-er1 (previously called er1) is a fibroblast growth factor-inducible early response gene activated during mesoderm induction in Xenopus embryos and encoding a nuclear protein that functions as a transcriptional activator. The human orthologue of mi-er1 was shown to be upregulated in breast carcinoma cell lines and breast tumours when compared to normal breast cells. In this report, we investigate the structure of the human mi-er1 (hmi-er1) gene and characterize the alternatively spliced transcripts and protein isoforms. hmi-er1 is a single copy gene located at 1p31.2 and spanning 63 kb. It contains 17 exons and includes one skipped exon, a facultative intron and three polyadenylation signals to produce 12 transcripts encoding six distinct proteins. hmi-er1 transcripts were expressed at very low levels in most human adult tissues and the mRNA isoform pattern varied with the tissue. The 12 transcripts encode proteins containing a common internal sequence with variable N- and C-termini. Three distinct N- and two distinct C-termini were identified, giving rise to six protein isoforms. The two C-termini differ significantly in size and sequence and arise from alternate use of a facultative intron to produce hMI-ER1alpha and hMI-ER1beta. In all tissues except testis, transcripts encoding the beta isoform were predominant. hMI-ER1alpha lacks the predicted nuclear localization signal and transfection assays revealed that, unlike hMI-ER1beta, it is not a nuclear protein, but remains in the cytoplasm. Our results demonstrate that alternate use of a facultative intron regulates the subcellular localization of hMI-ER1 proteins and this may have important implications for hMI-ER1 function.

  9. Functional Studies and In Silico Analyses to Evaluate Non-Coding Variants in Inherited Cardiomyopathies.

    PubMed

    Frisso, Giulia; Detta, Nicola; Coppola, Pamela; Mazzaccara, Cristina; Pricolo, Maria Rosaria; D'Onofrio, Antonio; Limongelli, Giuseppe; Calabrò, Raffaele; Salvatore, Francesco

    2016-11-10

    Point mutations are the most common cause of inherited diseases. Bioinformatics tools can help to predict the pathogenicity of mutations found during genetic screening, but they may work less well in determining the effect of point mutations in non-coding regions. In silico analysis of intronic variants can reveal their impact on the splicing process, but the consequence of a given substitution is generally not predictable. The aim of this study was to functionally test five intronic variants ( MYBPC3 -c.506-2A>C, MYBPC3 -c.906-7G>T, MYBPC3 -c.2308+3G>C, SCN5A -c.393-5C>A, and ACTC1 -c.617-7T>C) found in five patients affected by inherited cardiomyopathies in the attempt to verify their pathogenic role. Analysis of the MYBPC3 -c.506-2A>C mutation in mRNA from the peripheral blood of one of the patients affected by hypertrophic cardiac myopathy revealed the loss of the canonical splice site and the use of an alternative splicing site, which caused the loss of the first seven nucleotides of exon 5 ( MYBPC3 -G169AfsX14). In the other four patients, we generated minigene constructs and transfected them in HEK-293 cells. This minigene approach showed that MYBPC3 -c.2308+3G>C and SCN5A -c.393-5C>A altered pre-mRNA processing, thus resulting in the skipping of one exon. No alterations were found in either MYBPC3 -c.906-7G>T or ACTC1 -c.617-7T>C. In conclusion, functional in vitro analysis of the effects of potential splicing mutations can confirm or otherwise the putative pathogenicity of non-coding mutations, and thus help to guide the patient's clinical management and improve genetic counseling in affected families.

  10. A Large Scale Code Resolution Service Network in the Internet of Things

    PubMed Central

    Yu, Haining; Zhang, Hongli; Fang, Binxing; Yu, Xiangzhan

    2012-01-01

    In the Internet of Things a code resolution service provides a discovery mechanism for a requester to obtain the information resources associated with a particular product code immediately. In large scale application scenarios a code resolution service faces some serious issues involving heterogeneity, big data and data ownership. A code resolution service network is required to address these issues. Firstly, a list of requirements for the network architecture and code resolution services is proposed. Secondly, in order to eliminate code resolution conflicts and code resolution overloads, a code structure is presented to create a uniform namespace for code resolution records. Thirdly, we propose a loosely coupled distributed network consisting of heterogeneous, independent; collaborating code resolution services and a SkipNet based code resolution service named SkipNet-OCRS, which not only inherits DHT's advantages, but also supports administrative control and autonomy. For the external behaviors of SkipNet-OCRS, a novel external behavior mode named QRRA mode is proposed to enhance security and reduce requester complexity. For the internal behaviors of SkipNet-OCRS, an improved query algorithm is proposed to increase query efficiency. It is analyzed that integrating SkipNet-OCRS into our resolution service network can meet our proposed requirements. Finally, simulation experiments verify the excellent performance of SkipNet-OCRS. PMID:23202207

  11. A large scale code resolution service network in the Internet of Things.

    PubMed

    Yu, Haining; Zhang, Hongli; Fang, Binxing; Yu, Xiangzhan

    2012-11-07

    In the Internet of Things a code resolution service provides a discovery mechanism for a requester to obtain the information resources associated with a particular product code immediately. In large scale application scenarios a code resolution service faces some serious issues involving heterogeneity, big data and data ownership. A code resolution service network is required to address these issues. Firstly, a list of requirements for the network architecture and code resolution services is proposed. Secondly, in order to eliminate code resolution conflicts and code resolution overloads, a code structure is presented to create a uniform namespace for code resolution records. Thirdly, we propose a loosely coupled distributed network consisting of heterogeneous, independent; collaborating code resolution services and a SkipNet based code resolution service named SkipNet-OCRS, which not only inherits DHT’s advantages, but also supports administrative control and autonomy. For the external behaviors of SkipNet-OCRS, a novel external behavior mode named QRRA mode is proposed to enhance security and reduce requester complexity. For the internal behaviors of SkipNet-OCRS, an improved query algorithm is proposed to increase query efficiency. It is analyzed that integrating SkipNet-OCRS into our resolution service network can meet our proposed requirements. Finally, simulation experiments verify the excellent performance of SkipNet-OCRS.

  12. Skipped words and fixated words are processed differently during reading.

    PubMed

    Eskenazi, Michael A; Folk, Jocelyn R

    2015-04-01

    The purpose of this study was to investigate whether words are processed differently when they are fixated during silent reading than when they are skipped. According to a serial processing model of eye movement control (e.g., EZ Reader) skipped words are fully processed (Reichle, Rayner, Pollatsek, Behavioral and Brain Sciences, 26(04):445-476, 2003), whereas in a parallel processing model (e.g., SWIFT) skipped words do not need to be fully processed (Engbert, Nuthmann, Richter, Kliegl, Psychological Review, 112(4):777-813, 2005). Participants read 34 sentences with target words embedded in them while their eye movements were recorded. All target words were three-letter, low-frequency, and unpredictable nouns. After the reading session, participants completed a repetition priming lexical decision task with the target words from the reading session included as the repetition prime targets, with presentation of those same words during the reading task acting as the prime. When participants skipped a word during the reading session, their reaction times on the lexical decision task were significantly longer (M = 656.42 ms) than when they fixated the word (M = 614.43 ms). This result provides evidence that skipped words are sometimes not processed to the same degree as fixated words during reading.

  13. Factors associated with skipping breakfast among Inner Mongolia medical students in China.

    PubMed

    Sun, Juan; Yi, He; Liu, Zhiyue; Wu, Yan; Bian, Jiang; Wu, Yanyan; Eshita, Yuki; Li, Gaimei; Zhang, Qing; Yang, Ying

    2013-01-17

    Few studies on the breakfast consumption habits of medical students in China have been carried out. The aim of the present study was to determine the prevalence of skipping breakfast and factors associated with skipping breakfast among medical students in Inner Mongolia of China, and to assist in the design of interventions to improve breakfast consumption habits of medical college students in this region. From December 2010 to January 2011 a cross-sectional survey was conducted among medical students in the Inner Mongolia Medical College using a self-administered questionnaire. The prevalence of skipping breakfast in relation to lifestyle habits was described and factors associated with breakfast consumption were identified using multiple logistic regression analysis. The overall prevalence of skipping breakfast was 41.7% and 23.5% for males and females, respectively. The Faculty of Medicine Information Management had the highest breakfast skipping prevalence. Logistic regression models found that the main factors associated with breakfast consumption habits among medical students were gender, class years of education, monthly expenses, faculty, appetite, sleeping quality, and the learning process; monthly expenses, sleeping quality, and the learning process showed a dose-dependent relationship. Breakfast consumption was associated with many factors, most importantly monthly expenses, sleeping quality and the learning process. The prevalence of skipping breakfast is significantly higher compared recently reported figures for medical students in western countries and other areas of China. Improvement of breakfast education should be considered for students in which higher monthly expenses, poor sleeping quality, or a laborious learning process have been identified.

  14. A novel mechanism of myostatin regulation by its alternative splicing variant during myogenesis in avian species.

    PubMed

    Shin, Sangsu; Song, Yan; Ahn, Jinsoo; Kim, Eunsoo; Chen, Paula; Yang, Shujin; Suh, Yeunsu; Lee, Kichoon

    2015-11-15

    Myostatin (MSTN) is a key negative regulator of muscle growth and development, and an increase of muscle mass is achieved by inhibiting MSTN signaling. In the current study, five alternative splicing isoforms of MSTN mRNAs in avian species were identified in various tissues. Among these five, three truncated forms of myostatin, MSTN-B, -C, and -E created premature stop codons and produced partial MSTN prodomains encoded from exon 1. MSTN-B is the second dominant isoform following full-length MSTN-A, and their expression was dynamically regulated during muscle development of chicken, turkey, and quail in vivo and in vitro. To clarify the function of MSTN-B, two stable cell lines of quail myoblasts (QM7) were generated to overexpress MSTN-A or MSTN-B. Interestingly, MSTN-B promoted both cell proliferation and differentiation similar to the function of the MSTN prodomain to counteract the negative role of MSTN on myogenesis. The coimmunoprecipitation assay revealed that MSTN-B binds to MSTN-A and reduces the generation of mature MSTN. Furthermore, the current study demonstrated that the partial prodomain encoded from exon 1 is critical for binding of MSTN-B to MSTN-A. Altogether, these data imply that alternative splicing isoforms of MSTN could negatively regulate pro-myostatin processing in muscle cells and prevent MSTN-mediated inhibition of myogenesis in avian species. Copyright © 2015 the American Physiological Society.

  15. The Human CHRNA7 and CHRFAM7A Genes: A Review of the Genetics, Regulation, and Function

    PubMed Central

    Sinkus, Melissa L.; Graw, Sharon; Freedman, Robert; Ross, Randal G.; Lester, Henry A.; Leonard, Sherry

    2015-01-01

    The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is ubiquitously expressed in both the central nervous system and in the periphery. CHRNA7 is genetically linked to multiple disorders with cognitive deficits, including schizophrenia, bipolar disorder, ADHD, epilepsy, Alzheimer’s disease, and Rett syndrome. The regulation of CHRNA7 is complex; more than a dozen mechanisms are known, one of which is a partial duplication of the parent gene. Exons 5-10 of CHRNA7 on chromosome 15 were duplicated and inserted 1.6 Mb upstream of CHRNA7, interrupting an earlier partial duplication of two other genes. The chimeric CHRFAM7A gene product, dupα7, assembles with α7 subunits, resulting in a dominant negative regulation of function. The duplication is human specific, occurring neither in primates nor in rodents. The duplicated α7 sequence in exons 5-10 of CHRFAM7A is almost identical to CHRNA7, and thus is not completely queried in high throughput genetic studies (GWAS). Further, pre-clinical animal models of the α7nAChR utilized in drug development research do not have CHRFAM7A (dupα7) and cannot fully model human drug responses. The wide expression of CHRNA7, its multiple functions and modes of regulation present challenges for study of this gene in disease. PMID:25701707

  16. Live-cell imaging visualizes frequent mitotic skipping during senescence-like growth arrest in mammary carcinoma cells exposed to ionizing radiation.

    PubMed

    Suzuki, Masatoshi; Yamauchi, Motohiro; Oka, Yasuyoshi; Suzuki, Keiji; Yamashita, Shunichi

    2012-06-01

    Senescence-like growth arrest in human solid carcinomas is now recognized as the major outcome of radiotherapy. This study was designed to analyze cell cycle during the process of senescence-like growth arrest in mammary carcinoma cells exposed to X-rays. Fluorescent ubiquitination-based cell cycle indicators were introduced into the human mammary carcinoma cell line MCF-7. Cell cycle was sequentially monitored by live-cell imaging for up to 5 days after exposure to 10 Gy of X-rays. Live-cell imaging revealed that cell cycle transition from G2 to G1 phase without mitosis, so-called mitotic skipping, was observed in 17.1% and 69.8% of G1- and G2-irradiated cells, respectively. Entry to G1 phase was confirmed by the nuclear accumulation of mKO(2)-hCdt1 as well as cyclin E, which was inversely correlated to the accumulation of G2-specific markers such as mAG-hGeminin and CENP-F. More than 90% of cells skipping mitosis were persistently arrested in G1 phase and showed positive staining for the senescent biochemical marker, which is senescence-associated ß-galactosidase, indicating induction of senescence-like growth arrest accompanied by mitotic skipping. While G2 irradiation with higher doses of X-rays induced mitotic skipping in approximately 80% of cells, transduction of short hairpin RNA (shRNA) for p53 significantly suppressed mitotic skipping, suggesting that ionizing radiation-induced mitotic skipping is associated with p53 function. The present study found the pathway of senescence-like growth arrest in G1 phase without mitotic entry following G2-irradiation. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Precursor processes of human self-initiated action.

    PubMed

    Khalighinejad, Nima; Schurger, Aaron; Desantis, Andrea; Zmigrod, Leor; Haggard, Patrick

    2018-01-15

    A gradual buildup of electrical potential over motor areas precedes self-initiated movements. Recently, such "readiness potentials" (RPs) were attributed to stochastic fluctuations in neural activity. We developed a new experimental paradigm that operationalized self-initiated actions as endogenous 'skip' responses while waiting for target stimuli in a perceptual decision task. We compared these to a block of trials where participants could not choose when to skip, but were instead instructed to skip. Frequency and timing of motor action were therefore balanced across blocks, so that conditions differed only in how the timing of skip decisions was generated. We reasoned that across-trial variability of EEG could carry as much information about the source of skip decisions as the mean RP. EEG variability decreased more markedly prior to self-initiated compared to externally-triggered skip actions. This convergence suggests a consistent preparatory process prior to self-initiated action. A leaky stochastic accumulator model could reproduce this convergence given the additional assumption of a systematic decrease in input noise prior to self-initiated actions. Our results may provide a novel neurophysiological perspective on the topical debate regarding whether self-initiated actions arise from a deterministic neurocognitive process, or from neural stochasticity. We suggest that the key precursor of self-initiated action may manifest as a reduction in neural noise. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Effect of innovative building design on physical activity.

    PubMed

    Nicoll, Gayle; Zimring, Craig

    2009-01-01

    Stair climbing can be a low-cost and relatively accessible way to add everyday physical activity, but many building stairwells are inaccessible or unpleasant and elevators are far more convenient. This study explores the use of and attitude toward stairs in an innovative office building where the main elevators for able-bodied users stop only at every third floor ("skip-stop" elevators). These users are expected to walk up or down nearby stairs that have been made open and appealing ("skip-stop" stairs). The study takes advantage of a natural experiment. Some workers' offices were clustered around the skip-stop elevator and the stairs, whereas others had access to a traditional elevator core, that is, an elevator that stopped at each floor with nearby fire exit stairs. Stair use on the open skip-stop stairs and enclosed fire stairs was measured using infrared monitors and card-reader activity logs. An online survey of employees (N=299, a 17.4% response rate) gathered information on stair use and attitudes and behaviors toward physical activity; interviews with key personnel identified major implementation issues. The skip-stop stair was used 33 times more than the enclosed stair of the traditional elevator core, with 72% of survey participants reporting daily stair use. Although implementation issues related to organizational objectives, costs, security, barrier-free accessibility, and building codes exist, the skip-stop feature offers a successful strategy for increasing stair use in workplaces.

  19. TCOF1 gene encodes a putative nucleolar phosphoprotein that exhibits mutations in Treacher Collins Syndrome throughout its coding region.

    PubMed

    Wise, C A; Chiang, L C; Paznekas, W A; Sharma, M; Musy, M M; Ashley, J A; Lovett, M; Jabs, E W

    1997-04-01

    Treacher Collins Syndrome (TCS) is the most common of the human mandibulofacial dysostosis disorders. Recently, a partial TCOF1 cDNA was identified and shown to contain mutations in TCS families. Here we present the entire exon/intron genomic structure and the complete coding sequence of TCOF1. TCOF1 encodes a low complexity protein of 1,411 amino acids, whose predicted protein structure reveals repeated motifs that mirror the organization of its exons. These motifs are shared with nucleolar trafficking proteins in other species and are predicted to be highly phosphorylated by casein kinase. Consistent with this, the full-length TCOF1 protein sequence also contains putative nuclear and nucleolar localization signals. Throughout the open reading frame, we detected an additional eight mutations in TCS families and several polymorphisms. We postulate that TCS results from defects in a nucleolar trafficking protein that is critically required during human craniofacial development.

  20. TCOF1 gene encodes a putative nucleolar phosphoprotein that exhibits mutations in Treacher Collins Syndrome throughout its coding region

    PubMed Central

    Wise, Carol A.; Chiang, Lydia C.; Paznekas, William A.; Sharma, Mridula; Musy, Maurice M.; Ashley, Jennifer A.; Lovett, Michael; Jabs, Ethylin W.

    1997-01-01

    Treacher Collins Syndrome (TCS) is the most common of the human mandibulofacial dysostosis disorders. Recently, a partial TCOF1 cDNA was identified and shown to contain mutations in TCS families. Here we present the entire exon/intron genomic structure and the complete coding sequence of TCOF1. TCOF1 encodes a low complexity protein of 1,411 amino acids, whose predicted protein structure reveals repeated motifs that mirror the organization of its exons. These motifs are shared with nucleolar trafficking proteins in other species and are predicted to be highly phosphorylated by casein kinase. Consistent with this, the full-length TCOF1 protein sequence also contains putative nuclear and nucleolar localization signals. Throughout the open reading frame, we detected an additional eight mutations in TCS families and several polymorphisms. We postulate that TCS results from defects in a nucleolar trafficking protein that is critically required during human craniofacial development. PMID:9096354

  1. Partial deletion of the AGXT gene (EX1_EX7del): A new genotype in hyperoxaluria type 1.

    PubMed

    Nogueira, P K; Vuong, T S; Bouton, O; Maillard, A; Marchand, M; Rolland, M O; Cochat, P; Bozon, D

    2000-04-01

    Primary hyperoxaluria type 1 (PH1) is a rare autosomal (2q37.3) recessive metabolic disease caused by a deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate amino transferase. Molecular heterogeneity is important in PH1 as most of the patients (if the parents are unrelated) are compound heterozygotes for rare mutations. We describe the first large deletion in the AGXT gene, removing exons 1 to 7 (EX1_EX7del) that was responsible for one case of severe PH1. This 10 kb deletion was identified by Southern blotting of genomic DNA digested by Xba I and hybridized with different exonic probes. Both parents (from Turkey) are first cousin and carry the deletion. It is of note that the presently reported patient did not exhibit any AGT catalytic activity and even so, he progressed towards end-stage renal disease only at 19 years old. Copyright 2000 Wiley-Liss, Inc.

  2. Fire Safety

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... able to reliably rescue themselves. Know What to Do in a Fire Test any closed doors with ...

  3. Variable penetrance of hypogonadism in a sibship with Kallmann syndrome due to a deletion of the KAL gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parenti, G.; Rizzolo, M.G.; Ghezzi, M.

    We report on the clinical and molecular characterization of 3 sibs with X-linked ichthyosis and variable expression of Kallmann syndrome. One of the affected brothers had mild hyposmia and showed normal pubertal progression. However, we demonstrated the same partial deletion of the X-linked Kallmann gene, sparing the first exon in the mildly affected patient as well as in one of his severely affected brothers. 13 refs., 1 fig., 1 tab.

  4. Precession and circularization of elliptical space-tether motion

    NASA Technical Reports Server (NTRS)

    Chapel, Jim D.; Grosserode, Patrick

    1993-01-01

    In this paper, we present a simplified analytic model for predicting motion of long space tethers. The perturbation model developed here addresses skip rope motion, where each end of the tether is held in place and the middle of the tether swings with a motion similar to that of a child's skip rope. If the motion of the tether midpoint is elliptical rather than circular, precession of the ellipse complicates the procedures required to damp this motion. The simplified analytic model developed in this paper parametrically predicts the precession of elliptical skip rope motion. Furthermore, the model shows that elliptic skip rope motion will circularize when damping is present in the longitudinal direction. Compared with high-fidelity simulation results, this simplified model provides excellent predictions of these phenomena.

  5. Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene

    PubMed Central

    Gonçalves, Ana; Coelho, Teresa; Melo-Pires, Manuel; Sousa, Mário

    2017-01-01

    A broad mutational spectrum in the dystrophin (DMD) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD, adding to the diversity of mutational events that give rise to D/BMD. PMID:28972564

  6. Improving Family Communications

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... do the same. More Tips To Improve Communication Do Give clear, age-appropriate directions such as, "When ...

  7. Sleep Apnea Detection

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... the night Sleepiness during the day Difficulty paying attention Behavior problems If you notice any of these ...

  8. Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal).

    PubMed

    Branco, Claudia C; Gomes, Cidália T; De Fez, Laura; Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

    2015-01-01

    Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations- c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family's HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40-2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins--the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G;340+4T>C] has a role, as genetic predisposition factor, on iron overload in the São Miguel population. Independent replication studies in other populations are needed to confirm this association.

  9. Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal)

    PubMed Central

    Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G.; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

    2015-01-01

    Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations– c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family’s HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40−2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins—the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G;340+4T>C] has a role, as genetic predisposition factor, on iron overload in the São Miguel population. Independent replication studies in other populations are needed to confirm this association. PMID:26501199

  10. What Is a Neonatologist?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... care during your pregnancy. What Kind of Training Do Neonatologists Have? Neonatologists are medical doctors who have ...

  11. Posttranscriptional mRNA processing as a mechanism for regulation of human A1 adenosine receptor expression.

    PubMed Central

    Ren, H; Stiles, G L

    1994-01-01

    The human A1 adenosine receptor gene contains six exons with exons 1, 2, 3, 4, and part of 5 representing 5' untranslated regions. Reverse transcription-PCR with exon-specific primers showed two distinct transcripts containing either exons 3, 5, and 6 or exons 4, 5, and 6, with exons 3 and 4 being mutually exclusive. No mature mRNAs containing exons 1 and 2 have been detected. All human tissues that express any A1 receptors contain mRNA with exons 4, 5, and 6. Tissues which express high levels of A1 receptors contain mRNA with exons 3, 5, and 6. Exon 4 contains two upstream ATG codons whereas exon 3 contains none. COS cells transfected with expression vectors containing exon 4 (exons 1-6, 3-6, or Ex4-6) express much lower levels of A1 receptors than vectors without exon 4 (exons 3, 5, and 6). Mutation of upstream ATG codons in exon 4 leads to 3- to 7-fold increased A1 receptor expression, up to the level seen with the construct containing exons 3, 5, and 6. Thus, in human tissues "basal" levels of A1 receptors can be expressed by use of mRNA containing exons 4, 5, and 6, but when high levels are needed, alternative transcripts with exons 3, 5, and 6 are produced. Images PMID:8197148

  12. Anti-inflammatory drugs for Duchenne muscular dystrophy: focus on skeletal muscle-releasing factors.

    PubMed

    Miyatake, Shouta; Shimizu-Motohashi, Yuko; Takeda, Shin'ichi; Aoki, Yoshitsugu

    2016-01-01

    Duchenne muscular dystrophy (DMD), an incurable and a progressive muscle wasting disease, is caused by the absence of dystrophin protein, leading to recurrent muscle fiber damage during contraction. The inflammatory response to fiber damage is a compelling candidate mechanism for disease exacerbation. The only established pharmacological treatment for DMD is corticosteroids to suppress muscle inflammation, however this treatment is limited by its insufficient therapeutic efficacy and considerable side effects. Recent reports show the therapeutic potential of inhibiting or enhancing pro- or anti-inflammatory factors released from DMD skeletal muscles, resulting in significant recovery from muscle atrophy and dysfunction. We discuss and review the recent findings of DMD inflammation and opportunities for drug development targeting specific releasing factors from skeletal muscles. It has been speculated that nonsteroidal anti-inflammatory drugs targeting specific inflammatory factors are more effective and have less side effects for DMD compared with steroidal drugs. For example, calcium channels, reactive oxygen species, and nuclear factor-κB signaling factors are the most promising targets as master regulators of inflammatory response in DMD skeletal muscles. If they are combined with an oligonucleotide-based exon skipping therapy to restore dystrophin expression, the anti-inflammatory drug therapies may address the present therapeutic limitation of low efficiency for DMD.

  13. Normal growth and muscle dysfunction in X-linked hypophosphatemic rickets associated with a novel mutation in the PHEX gene.

    PubMed

    Makras, Polyzois; Hamdy, Neveen A T; Kant, Sarina G; Papapoulos, Socrates E

    2008-04-01

    X-linked hypophosphatemic rickets (XLH) is characterized by hypophosphatemia and growth retardation. Early diagnosis and treatment improve growth. Our objective was to describe long-term observations of a family with XLH due to a novel mutation of the PHEX gene with unusual clinical features, including normal growth. The mother and her two sons were followed in the same institution for nearly 30 yr. The mother had hypophosphatemia and normal height (Z score, -0.6) without ever receiving any treatment. Her two sons achieved final heights of 183.7 cm (Z score, -0.01) and 182.7 cm (Z score, -0.18), respectively, despite late initiation of treatment with phosphate and low serum phosphate levels. In addition, they had reversible proximal myopathy that took about 7 yr to resolve in one of them. Direct sequencing of the PHEX gene revealed a new splice site mutation in intron 4 of the gene (IVS4+6T-->C) resulting in skipping of exon 4. Three members of a family with XLH due to a novel mutation of the PHEX gene had a normal growth pattern despite late diagnosis and treatment of the two boys and no treatment at all of their mother. The pathophysiological basis of this phenotype-genotype association warrants further investigation.

  14. Systematic profiling of alternative splicing signature reveals prognostic predictor for ovarian cancer.

    PubMed

    Zhu, Junyong; Chen, Zuhua; Yong, Lei

    2018-02-01

    The majority of genes are alternatively spliced and growing evidence suggests that alternative splicing is modified in cancer and is associated with cancer progression. Systematic analysis of alternative splicing signature in ovarian cancer is lacking and greatly needed. We profiled genome-wide alternative splicing events in 408 ovarian serous cystadenocarcinoma (OV) patients in TCGA. Seven types of alternative splicing events were curated and prognostic analyses were performed with predictive models and splicing network built for OV patients. Among 48,049 mRNA splicing events in 10,582 genes, we detected 2,611 alternative splicing events in 2,036 genes which were significant associated with overall survival of OV patients. Exon skip events were the most powerful prognostic factors among the seven types. The area under the curve of the receiver-operator characteristic curve for prognostic predictor, which was built with top significant alternative splicing events, was 0.937 at 2,000 days of overall survival, indicating powerful efficiency in distinguishing patient outcome. Interestingly, splicing correlation network suggested obvious trends in the role of splicing factors in OV. In summary, we built powerful prognostic predictors for OV patients and uncovered interesting splicing networks which could be underlying mechanisms. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Schizophyllum commune has an extensive and functional alternative splicing repertoire

    PubMed Central

    Gehrmann, Thies; Pelkmans, Jordi F.; Lugones, Luis G.; Wösten, Han A. B.; Abeel, Thomas; Reinders, Marcel J. T.

    2016-01-01

    Recent genome-wide studies have demonstrated that fungi possess the machinery to alternatively splice pre-mRNA. However, there has not been a systematic categorization of the functional impact of alternative splicing in a fungus. We investigate alternative splicing and its functional consequences in the model mushroom forming fungus Schizophyllum commune. Alternative splicing was demonstrated for 2,285 out of 12,988 expressed genes, resulting in 20% additional transcripts. Intron retentions were the most common alternative splicing events, accounting for 33% of all splicing events, and 43% of the events in coding regions. On the other hand, exon skipping events were rare in coding regions (1%) but enriched in UTRs where they accounted for 57% of the events. Specific functional groups, including transcription factors, contained alternatively spliced genes. Alternatively spliced transcripts were regulated differently throughout development in 19% of the 2,285 alternatively spliced genes. Notably, 69% of alternatively spliced genes have predicted alternative functionality by loss or gain of functional domains, or by acquiring alternative subcellular locations. S. commune exhibits more alternative splicing than any other studied fungus. Taken together, alternative splicing increases the complexity of the S. commune proteome considerably and provides it with a rich repertoire of alternative functionality that is exploited dynamically. PMID:27659065

  16. Widespread alternative and aberrant splicing revealed by lariat sequencing

    PubMed Central

    Stepankiw, Nicholas; Raghavan, Madhura; Fogarty, Elizabeth A.; Grimson, Andrew; Pleiss, Jeffrey A.

    2015-01-01

    Alternative splicing is an important and ancient feature of eukaryotic gene structure, the existence of which has likely facilitated eukaryotic proteome expansions. Here, we have used intron lariat sequencing to generate a comprehensive profile of splicing events in Schizosaccharomyces pombe, amongst the simplest organisms that possess mammalian-like splice site degeneracy. We reveal an unprecedented level of alternative splicing, including alternative splice site selection for over half of all annotated introns, hundreds of novel exon-skipping events, and thousands of novel introns. Moreover, the frequency of these events is far higher than previous estimates, with alternative splice sites on average activated at ∼3% the rate of canonical sites. Although a subset of alternative sites are conserved in related species, implying functional potential, the majority are not detectably conserved. Interestingly, the rate of aberrant splicing is inversely related to expression level, with lowly expressed genes more prone to erroneous splicing. Although we validate many events with RNAseq, the proportion of alternative splicing discovered with lariat sequencing is far greater, a difference we attribute to preferential decay of aberrantly spliced transcripts. Together, these data suggest the spliceosome possesses far lower fidelity than previously appreciated, highlighting the potential contributions of alternative splicing in generating novel gene structures. PMID:26261211

  17. Autosomal Dominant Growth Hormone Deficiency (Type II).

    PubMed

    Alatzoglou, Kyriaki S; Kular, Dalvir; Dattani, Mehul T

    2015-06-01

    Isolated growth hormone deficiency (IGHD) is the commonest pituitary hormone deficiency resulting from congenital or acquired causes, although for most patients its etiology remains unknown. Among the known factors, heterozygous mutations in the growth hormone gene (GH1) lead to the autosomal dominant form of GHD, also known as type II GHD. In many cohorts this is the commonest form of congenital isolated GHD and is mainly caused by mutations that affect the correct splicing of GH-1. These mutations cause skipping of the third exon and lead to the production of a 17.5-kDa GH isoform that exerts a dominant negative effect on the secretion of the wild type GH. The identification of these mutations has clinical implications for the management of patients, as there is a well-documented correlation between the severity of the phenotype and the increased expression of the 17.5-kDa isoform. Patients with type II GHD have a variable height deficit and severity of GHD and may develop additional pituitary hormone defiencies over time, including ACTH, TSH and gonadotropin deficiencies. Therefore, their lifelong follow-up is recommended. Detailed studies on the effect of heterozygous GH1 mutations on the trafficking, secretion and action of growth hormone can elucidate their mechanism on a cellular level and may influence future treatment options for GHD type II.

  18. Schizophyllum commune has an extensive and functional alternative splicing repertoire

    DOE PAGES

    Gehrmann, Thies; Pelkmans, Jordi F.; Lugones, Luis G.; ...

    2016-09-23

    Recent genome-wide studies have demonstrated that fungi possess the machinery to alternatively splice pre-mRNA. However, there has not been a systematic categorization of the functional impact of alternative splicing in a fungus. We investigate alternative splicing and its functional consequences in the model mushroom forming fungus Schizophyllum commune. Alternative splicing was demonstrated for 2,285 out of 12,988 expressed genes, resulting in 20% additional transcripts. Intron retentions were the most common alternative splicing events, accounting for 33% of all splicing events, and 43% of the events in coding regions. On the other hand, exon skipping events were rare in coding regionsmore » (1%) but enriched in UTRs where they accounted for 57% of the events. Specific functional groups, including transcription factors, contained alternatively spliced genes. Alternatively spliced transcripts were regulated differently throughout development in 19% of the 2,285 alternatively spliced genes. Notably, 69% of alternatively spliced genes have predicted alternative functionality by loss or gain of functional domains, or by acquiring alternative subcellular locations. S. commune exhibits more alternative splicing than any other studied fungus. Finally, taken together, alternative splicing increases the complexity of the S. commune proteome considerably and provides it with a rich repertoire of alternative functionality that is exploited dynamically.« less

  19. Late onset of neutral lipid storage disease due to novel PNPLA2 mutations causing total loss of lipase activity in a patient with myopathy and slight cardiac involvement.

    PubMed

    Missaglia, Sara; Maggi, Lorenzo; Mora, Marina; Gibertini, Sara; Blasevich, Flavia; Agostoni, Piergiuseppe; Moro, Laura; Cassandrini, Denise; Santorelli, Filippo Maria; Gerevini, Simonetta; Tavian, Daniela

    2017-05-01

    Neutral lipid storage disease with myopathy (NLSDM) presents with skeletal muscle myopathy and severe dilated cardiomyopathy in nearly 40% of cases. NLSDM is caused by mutations in the PNPLA2 gene, which encodes the adipose triglyceride lipase (ATGL). Here we report clinical and genetic findings of a patient carrying two novel PNPLA2 mutations (c.696+4A>G and c.553_565delGTCCCCCTTCTCG). She presented at age 39 with right upper limb abduction weakness slowly progressing over the years with asymmetric involvement of proximal upper and lower limb muscles. Cardiological evaluation through ECG and heart echo scan was normal until the age 53, when mild left ventricular diastolic dysfunction was detected. Molecular analysis revealed that only one type of PNPLA2 transcript, with exon 5 skipping, was expressed in patient cells. Such aberrant mRNA causes the production of a shorter ATGL protein, lacking part of the catalytic domain. This is an intriguing case, displaying severe PNPLA2 mutations with clinical presentation characterized by slight cardiac impairment and full expression of severe asymmetric myopathy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  20. FOX-2 Dependent Splicing of Ataxin-2 Transcript Is Affected by Ataxin-1 Overexpression

    PubMed Central

    Welzel, Franziska; Kaehler, Christian; Isau, Melanie; Hallen, Linda; Lehrach, Hans; Krobitsch, Sylvia

    2012-01-01

    Alternative splicing is a fundamental posttranscriptional mechanism for controlling gene expression, and splicing defects have been linked to various human disorders. The splicing factor FOX-2 is part of a main protein interaction hub in a network related to human inherited ataxias, however, its impact remains to be elucidated. Here, we focused on the reported interaction between FOX-2 and ataxin-1, the disease-causing protein in spinocerebellar ataxia type 1. In this line, we further evaluated this interaction by yeast-2-hybrid analyses and co-immunoprecipitation experiments in mammalian cells. Interestingly, we discovered that FOX-2 localization and splicing activity is affected in the presence of nuclear ataxin-1 inclusions. Moreover, we observed that FOX-2 directly interacts with ataxin-2, a protein modulating spinocerebellar ataxia type 1 pathogenesis. Finally, we provide evidence that splicing of pre-mRNA of ataxin-2 depends on FOX-2 activity, since reduction of FOX-2 levels led to increased skipping of exon 18 in ataxin-2 transcripts. Most striking, we observed that ataxin-1 overexpression has an effect on this splicing event as well. Thus, our results demonstrate that FOX-2 is involved in splicing of ataxin-2 transcripts and that this splicing event is altered by overexpression of ataxin-1. PMID:22666429

  1. Anti-inflammatory drugs for Duchenne muscular dystrophy: focus on skeletal muscle-releasing factors

    PubMed Central

    Miyatake, Shouta; Shimizu-Motohashi, Yuko; Takeda, Shin’ichi; Aoki, Yoshitsugu

    2016-01-01

    Duchenne muscular dystrophy (DMD), an incurable and a progressive muscle wasting disease, is caused by the absence of dystrophin protein, leading to recurrent muscle fiber damage during contraction. The inflammatory response to fiber damage is a compelling candidate mechanism for disease exacerbation. The only established pharmacological treatment for DMD is corticosteroids to suppress muscle inflammation, however this treatment is limited by its insufficient therapeutic efficacy and considerable side effects. Recent reports show the therapeutic potential of inhibiting or enhancing pro- or anti-inflammatory factors released from DMD skeletal muscles, resulting in significant recovery from muscle atrophy and dysfunction. We discuss and review the recent findings of DMD inflammation and opportunities for drug development targeting specific releasing factors from skeletal muscles. It has been speculated that nonsteroidal anti-inflammatory drugs targeting specific inflammatory factors are more effective and have less side effects for DMD compared with steroidal drugs. For example, calcium channels, reactive oxygen species, and nuclear factor-κB signaling factors are the most promising targets as master regulators of inflammatory response in DMD skeletal muscles. If they are combined with an oligonucleotide-based exon skipping therapy to restore dystrophin expression, the anti-inflammatory drug therapies may address the present therapeutic limitation of low efficiency for DMD. PMID:27621596

  2. Emerging strategies for cell and gene therapy of the muscular dystrophies

    PubMed Central

    Muir, Lindsey A.; Chamberlain, Jeffrey S.

    2016-01-01

    The muscular dystrophies are a heterogeneous group of over 40 disorders that are characterised by muscle weakness and wasting. The most common are Duchenne muscular dystrophy and Becker muscular dystrophy, which result from mutations within the gene encoding dystrophin; myotonic dystrophy type 1, which results from an expanded trinucleotide repeat in the myotonic dystrophy protein kinase gene; and facioscapulohumeral dystrophy, which is associated with contractions in the subtelomeric region of human chromosome 1. Currently the only treatments involve clinical management of symptoms, although several promising experimental strategies are emerging. These include gene therapy using adeno-associated viral, lentiviral and adenoviral vectors and nonviral vectors, such as plasmid DNA. Exon-skipping and cell-based therapies have also shown promise in the effective treatment and regeneration of dystrophic muscle. The availability of numerous animal models for Duchenne muscular dystrophy has enabled extensive testing of a wide range of therapeutic approaches for this type of disorder. Consequently, we focus here on the therapeutic developments for Duchenne muscular dystrophy as a model of the types of approaches being considered for various types of dystrophy. We discuss the advantages and limitations of each therapeutic strategy, as well as prospects and recent successes in the context of future clinical applications. PMID:19555515

  3. CAPER 3.0: A Scalable Cloud-Based System for Data-Intensive Analysis of Chromosome-Centric Human Proteome Project Data Sets.

    PubMed

    Yang, Shuai; Zhang, Xinlei; Diao, Lihong; Guo, Feifei; Wang, Dan; Liu, Zhongyang; Li, Honglei; Zheng, Junjie; Pan, Jingshan; Nice, Edouard C; Li, Dong; He, Fuchu

    2015-09-04

    The Chromosome-centric Human Proteome Project (C-HPP) aims to catalog genome-encoded proteins using a chromosome-by-chromosome strategy. As the C-HPP proceeds, the increasing requirement for data-intensive analysis of the MS/MS data poses a challenge to the proteomic community, especially small laboratories lacking computational infrastructure. To address this challenge, we have updated the previous CAPER browser into a higher version, CAPER 3.0, which is a scalable cloud-based system for data-intensive analysis of C-HPP data sets. CAPER 3.0 uses cloud computing technology to facilitate MS/MS-based peptide identification. In particular, it can use both public and private cloud, facilitating the analysis of C-HPP data sets. CAPER 3.0 provides a graphical user interface (GUI) to help users transfer data, configure jobs, track progress, and visualize the results comprehensively. These features enable users without programming expertise to easily conduct data-intensive analysis using CAPER 3.0. Here, we illustrate the usage of CAPER 3.0 with four specific mass spectral data-intensive problems: detecting novel peptides, identifying single amino acid variants (SAVs) derived from known missense mutations, identifying sample-specific SAVs, and identifying exon-skipping events. CAPER 3.0 is available at http://prodigy.bprc.ac.cn/caper3.

  4. Serum proteomic profiling reveals fragments of MYOM3 as potential biomarkers for monitoring the outcome of therapeutic interventions in muscular dystrophies

    PubMed Central

    Rouillon, Jérémy; Poupiot, Jérôme; Zocevic, Aleksandar; Amor, Fatima; Léger, Thibaut; Garcia, Camille; Camadro, Jean-Michel; Wong, Brenda; Pinilla, Robin; Cosette, Jérémie; Coenen-Stass, Anna M.L.; Mcclorey, Graham; Roberts, Thomas C.; Wood, Matthew J.A.; Servais, Laurent; Udd, Bjarne; Voit, Thomas; Richard, Isabelle; Svinartchouk, Fedor

    2015-01-01

    Therapy-responsive biomarkers are an important and unmet need in the muscular dystrophy field where new treatments are currently in clinical trials. By using a comprehensive high-resolution mass spectrometry approach and western blot validation, we found that two fragments of the myofibrillar structural protein myomesin-3 (MYOM3) are abnormally present in sera of Duchenne muscular dystrophy (DMD) patients, limb-girdle muscular dystrophy type 2D (LGMD2D) and their respective animal models. Levels of MYOM3 fragments were assayed in therapeutic model systems: (1) restoration of dystrophin expression by antisense oligonucleotide-mediated exon-skipping in mdx mice and (2) stable restoration of α-sarcoglycan expression in KO-SGCA mice by systemic injection of a viral vector. Following administration of the therapeutic agents MYOM3 was restored toward wild-type levels. In the LGMD model, where different doses of vector were used, MYOM3 restoration was dose-dependent. MYOM3 fragments showed lower inter-individual variability compared with the commonly used creatine kinase assay, and correlated better with the restoration of the dystrophin-associated protein complex and muscle force. These data suggest that the MYOM3 fragments hold promise for minimally invasive assessment of experimental therapies for DMD and other neuromuscular disorders. PMID:26060189

  5. SMARCB1/INI1 maternal germ line mosaicism in schwannomatosis.

    PubMed

    Hulsebos, T J M; Kenter, S B; Jakobs, M E; Baas, F; Chong, B; Delatycki, M B

    2010-01-01

    Schwannomatosis is characterized by the development of multiple schwannomas of the nervous system, but without the occurrence of vestibular schwannomas. Most cases of schwannomatosis are thought to be sporadic, representing the first case in a family due to a new mutation in the causative gene. We recently identified SMARCB1/INI1 as a schwannomatosis-predisposing gene. Here, we analyzed this gene in a schwannomatosis family with two affected children, but with clinically unaffected parents. Both affected individuals carried a constitutional SMARCB1 mutation, c.1118+ 1G>A, that changes the donor splice site sequence of intron 8, causing skipping of exon 8 and resulting in the in-frame deletion of 132 nucleotides in the transcript. The mutation was not evident in constitutional DNA of the parents. Haplotyping revealed that the chromosome 22 segment that carries the mutant SMARCB1 allele originated from the mother. She transferred the same chromosome 22 segment, however, with a wild-type SMARCB1 copy, to a third unaffected child. Our findings indicate that the mother is germ line mosaic for the SMARCB1 mutation. In conclusion, our study shows for the first time that germ line mosaicism may occur in schwannomatosis, which has implications for genetic counseling in this disease.

  6. What Is a Pediatric Endocrinologist?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... and the teen years. What Kind of Training Do Pediatric Endocrinologists Have? Pediatric endocrinologists are medical doctors ...

  7. What Is a Pediatric Urologist?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... to treat your child. What Kind of Training Do Pediatric Urologists Have? Pediatric urologists are medical doctors ...

  8. Emotional Development: 1 Year Olds

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... her regain her composure is to give her attention and reassurance when she needs it. Snapping at ...

  9. What Is a Pediatric Infectious Diseases Specialist?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... through the teen years. What Kind of Training Do Pediatric Infectious Diseases Specialists Have? Pediatric infectious diseases ...

  10. How to Keep Your Sleeping Baby Safe

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... any of the recommendations listed. What You Can Do: Recommendations for Infant Sleep Safety Until their first ...

  11. What Is a Pediatric Critical Care Specialist?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... offered in the PICU. What Kind of Training Do Pediatric Critical Care Specialists Have? Pediatric critical care ...

  12. SKIP Is a Component of the Spliceosome Linking Alternative Splicing and the Circadian Clock in Arabidopsis[W

    PubMed Central

    Wang, Xiaoxue; Wu, Fangming; Xie, Qiguang; Wang, Huamei; Wang, Ying; Yue, Yanling; Gahura, Ondrej; Ma, Shuangshuang; Liu, Lei; Cao, Ying; Jiao, Yuling; Puta, Frantisek; McClung, C. Robertson; Xu, Xiaodong; Ma, Ligeng

    2012-01-01

    Circadian clocks generate endogenous rhythms in most organisms from cyanobacteria to humans and facilitate entrainment to environmental diurnal cycles, thus conferring a fitness advantage. Both transcriptional and posttranslational mechanisms are prominent in the basic network architecture of circadian systems. Posttranscriptional regulation, including mRNA processing, is emerging as a critical step for clock function. However, little is known about the molecular mechanisms linking RNA metabolism to the circadian clock network. Here, we report that a conserved SNW/Ski-interacting protein (SKIP) domain protein, SKIP, a splicing factor and component of the spliceosome, is involved in posttranscriptional regulation of circadian clock genes in Arabidopsis thaliana. Mutation in SKIP lengthens the circadian period in a temperature-sensitive manner and affects light input and the sensitivity of the clock to light resetting. SKIP physically interacts with the spliceosomal splicing factor Ser/Arg-rich protein45 and associates with the pre-mRNA of clock genes, such as PSEUDORESPONSE REGULATOR7 (PRR7) and PRR9, and is necessary for the regulation of their alternative splicing and mRNA maturation. Genome-wide investigations reveal that SKIP functions in regulating alternative splicing of many genes, presumably through modulating recognition or cleavage of 5′ and 3′ splice donor and acceptor sites. Our study addresses a fundamental question on how the mRNA splicing machinery contributes to circadian clock function at a posttranscriptional level. PMID:22942380

  13. Skipping meals and alcohol consumption. The regulation of energy intake and expenditure among weight loss participants.

    PubMed

    Carels, Robert A; Young, Kathleen M; Coit, Carissa; Clayton, Anna Marie; Spencer, Alexis; Wagner, Marissa

    2008-11-01

    Research suggests that specific eating patterns (e.g., eating breakfast) may be related to favorable weight status. This investigation examined the relationship between eating patterns (i.e., skipping meals; consuming alcohol) and weight loss treatment outcomes (weight loss, energy intake, energy expenditure, and duration of exercise). Fifty-four overweight or obese adults (BMI> or =27 kg/m(2)) participated in a self-help or therapist-assisted weight loss program. Daily energy intake from breakfast, lunch, dinner, and alcoholic beverages, total daily energy intake, total daily energy expenditure, physical activity, and weekly weight loss were assessed. On days that breakfast or dinner was skipped, or alcoholic beverages were not consumed, less total daily energy was consumed compared to days that breakfast, dinner, or alcoholic beverages were consumed. On days that breakfast or alcohol was consumed, daily energy expenditure (breakfast only) and duration of exercise were higher compared to days that breakfast or alcohol was not consumed. Individuals who skipped dinner or lunch more often had lower energy expenditure and exercise duration than individuals who skipped dinner or lunch less often. Individuals who consumed alcohol more often had high daily energy expenditure than individuals who consumed alcohol less often. Skipping meals or consuming alcoholic beverages was not associated with weekly weight loss. In this investigation, weight loss program participants may have compensated for excess energy intake from alcoholic beverages and meals with greater daily energy expenditure and longer exercise duration.

  14. Skimming and Skipping Stones

    ERIC Educational Resources Information Center

    Humble, Steve

    2007-01-01

    This article presents an example of skimming and skipping stone motion in mathematical terms available to students studying A-level mathematics. The theory developed in the article postulates a possible mathematical model that is verified by experimental results.

  15. What is the Best Way to Treat Diarrhea?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... starts making normal amounts of urine again. Reminder–Do's and Don'ts Do Watch for signs of ...

  16. Safety for Your Child: Birth to 6 Months

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... seat, will behave better, so you can pay attention to your driving. Make your newborn’s first ride ...

  17. Catalyst-free synthesis of skipped dienes from phosphorus ylides, allylic carbonates, and aldehydes via a one-pot SN2' allylation-Wittig strategy.

    PubMed

    Xu, Silong; Zhu, Shaoying; Shang, Jian; Zhang, Junjie; Tang, Yuhai; Dou, Jianwei

    2014-04-18

    A catalyst-free allylic alkylation of stabilized phosphorus ylides with allylic carbonates via a regioselective SN2' process is presented. Subsequent one-pot Wittig reaction with both aliphatic and aromatic aldehydes as well as ketenes provides structurally diverse skipped dienes (1,4-dienes) in generally high yields and moderate to excellent stereoselectivity with flexible substituent patterns. This one-pot SN2' allylation-Wittig strategy constitutes a convenient and efficient synthetic method for highly functionalized skipped dienes from readily available starting materials.

  18. Another face of the Treacher Collins syndrome (TCOF1) gene: identification of additional exons.

    PubMed

    So, Rolando B; Gonzales, Bianca; Henning, Dale; Dixon, Jill; Dixon, Michael J; Valdez, Benigno C

    2004-03-17

    Treacher Collins syndrome (TCS) is characterized by an abnormality in craniofacial development during early embryogenesis. TCS is caused by mutations in the gene TCOF1, which encodes the nucleolar phosphoprotein treacle. Genetic and proteomic characterizations of TCS/treacle are based on the previously reported 26 exons of TCOF1. Here, we report the identification of 231-nucleotide (nt) exon 6A (between exons 6 and 7) and 108-nt exon 16A (between exons 16 and 17). Isoforms with exon 6A are up to 3.7-fold more abundant than alternatively spliced variants without exon 6A, but only minor isoforms contain exon 16A. Exon 6A encodes a peptide sequence containing basic and acidic domains similar to 10 other exons of TCOF1. Unlike the other exons, exon 6A encodes a nuclear localization signal (NLS) which does not, however, alter the nucleolar localization of full-length treacle. The discovery of exons 6A and 16A is relevant to mutational analysis of the TCOF1 gene in TCS patients, and to functional analysis of its gene product.

  19. Power inverter implementing phase skipping control

    DOEpatents

    Somani, Utsav; Amirahmadi, Ahmadreza; Jourdan, Charles; Batarseh, Issa

    2016-10-18

    A power inverter includes a DC/AC inverter having first, second and third phase circuitry coupled to receive power from a power source. A controller is coupled to a driver for each of the first, second and third phase circuitry (control input drivers). The controller includes an associated memory storing a phase skipping control algorithm, wherein the controller is coupled to receive updating information including a power level generated by the power source. The drivers are coupled to control inputs of the first, second and third phase circuitry, where the drivers are configured for receiving phase skipping control signals from the controller and outputting mode selection signals configured to dynamically select an operating mode for the DC/AC inverter from a Normal Control operation and a Phase Skipping Control operation which have different power injection patterns through the first, second and third phase circuitry depending upon the power level.

  20. A Comparison of Two Skip Entry Guidance Algorithms

    NASA Technical Reports Server (NTRS)

    Rea, Jeremy R.; Putnam, Zachary R.

    2007-01-01

    The Orion capsule vehicle will have a Lift-to-Drag ratio (L/D) of 0.3-0.35. For an Apollo-like direct entry into the Earth's atmosphere from a lunar return trajectory, this L/D will give the vehicle a maximum range of about 2500 nm and a maximum crossrange of 216 nm. In order to y longer ranges, the vehicle lift must be used to loft the trajectory such that the aerodynamic forces are decreased. A Skip-Trajectory results if the vehicle leaves the sensible atmosphere and a second entry occurs downrange of the atmospheric exit point. The Orion capsule is required to have landing site access (either on land or in water) inside the Continental United States (CONUS) for lunar returns anytime during the lunar month. This requirement means the vehicle must be capable of flying ranges of at least 5500 nm. For the L/D of the vehicle, this is only possible with the use of a guided Skip-Trajectory. A skip entry guidance algorithm is necessary to achieve this requirement. Two skip entry guidance algorithms have been developed: the Numerical Skip Entry Guidance (NSEG) algorithm was developed at NASA/JSC and PredGuid was developed at Draper Laboratory. A comparison of these two algorithms will be presented in this paper. Each algorithm has been implemented in a high-fidelity, 6 degree-of-freedom simulation called the Advanced NASA Technology Architecture for Exploration Studies (ANTARES). NASA and Draper engineers have completed several monte carlo analyses in order to compare the performance of each algorithm in various stress states. Each algorithm has been tested for entry-to-target ranges to include direct entries and skip entries of varying length. Dispersions have been included on the initial entry interface state, vehicle mass properties, vehicle aerodynamics, atmosphere, and Reaction Control System (RCS). Performance criteria include miss distance to the target, RCS fuel usage, maximum g-loads and heat rates for the first and second entry, total heat load, and control system saturation. The comparison of the performance criteria has led to a down select and guidance merger that will take the best ideas from each algorithm to create one skip entry guidance algorithm for the Orion vehicle.

Top