Impact of vacuum anneal at low temperature on Al2O3/In-based III-V interfaces

NASA Astrophysics Data System (ADS)

Martinez, E.; Grampeix, H.; Desplats, O.; Herrera-Gomez, A.; Ceballos-Sanchez, O.; Guerrero, J.; Yckache, K.; Martin, F.

2012-06-01

We report on the effect of vacuum anneal on interfacial oxides formed between Al2O3 and III-V semiconductors. On InGaAs, no interfacial oxide is detected after annealing at 600 °C under UHV whereas annealing under secondary vacuum favours the regrowth of thin InGaOx interfacial oxide. Lowering the temperature at 400 °C highlights the effect of III-V substrates since In-OH bonds are only formed on InAs by OH release from TMA/H2O deposited alumina. On InGaAs, regrowth of InGaOx is observed, as a result of preferential oxidation of Ga. On InP, a transition from InPOx to POx is highlighted.

[Destructive mastoiditis with thrombosis of the sigmoid sinus in a 8 year-old child presenting with concomitant chicken pox].

PubMed

Bogomil'skiĭ, M R; Polunin, M M; Ivanenko, A M; Poliakov, A A

2014-01-01

The specific clinical feature of mastoidities that developed in a patient presenting with chicken pox was the rapid progress in temporal bone destruction with partial thrombosis of the sigmoid sinusis in the absence of typical manifestations of mastoiditis. The pronounced destructive changes found in a series of CT images were regarded as the indications for urgent antromastoidotomy with the puncture of the sigmoid sinusis.

Extraction of Molybdenum from Molybdenite Concentrates with Hydrometallurgical Processing

NASA Astrophysics Data System (ADS)

Jiang, Kaixi; Wang, Yufang; Zou, Xiaoping; Zhang, Lei; Liu, Sanping

2012-11-01

Molybdenite concentrates are usually treated by roasting, but low-concentration SO2 pollution is an associated problem. A hydrometallurgical process with pressure oxidation leaching (POX) and solvent extraction (SX) was developed in recent years. During POX, the oxidation of molybdenum (Mo) is above 98%. More than 95% of the rhenium (Re) and 15% to 20% of the Mo are leached into solution. The sulfur in the concentrate is converted to H2SO4, which results in high acidity of the solution. SX was used to recover the Re and Mo from the solution. The extraction of Re and Mo were above 98%. The loaded organic reagent is stripped with ammonia. More than 98% of the Mo can be stripped from the organic phase. Compared with the roasting process, the total recovery of Mo increased from 93% to 97% and that of Re from 60% to 90% when POX and SX are utilized.

In vitro skin decontamination of the organophosphorus pesticide Paraoxon with nanometric cerium oxide CeO2.

PubMed

Salerno, Alicia; Devers, Thierry; Bolzinger, Marie-Alexandrine; Pelletier, Jocelyne; Josse, Denis; Briançon, Stéphanie

2017-04-01

Organophosphorus compounds (OP), which mainly penetrate via the percutaneous pathway, represent a threat for both military and civilians. Body surface decontamination is vital to prevent victims poisoning. The development of a cost-effective formulation, which could be efficient and easy to handle in case of mass contamination, is therefore crucial. Metal oxides nanoparticles, due their large surface areas and the large amount of highly reactive sites, present high reactivity towards OP. First, this study aimed at evaluating the reaction of CeO 2 nanoparticles, synthetized by microwave path and calcined at 500 or 600 °C, with Paraoxon (POX) in aqueous solution. Results showed that both nanoparticles degraded 60%-70% of POX. CeO 2 calcined at 500 °C, owing to its larger specific area, was the most effective. Moreover, the degradation was significantly increased under Ultra-Violet irradiation (initial degradation rate doubled). Then, skin decontamination was studied in vitro using the Franz cell method with pig-ear skin samples. CeO 2 powder and an aqueous suspension of CeO 2 (CeO 2 -W) were applied 1 h after POX exposure. The efficiency of decontamination, including removal and/or degradation of POX, was compared to Fuller's earth (FE) and RSDL lotion which are, currently, the most efficient systems for skin decontamination. CeO 2 -W and RSDL were the most efficient to remove POX from the skin surface and decrease skin absorption by 6.4 compared to the control not decontaminated. FE reduced significantly (twice) the absorbed fraction of POX, contrarily to CeO 2 powder. Considering only the degradation rate of POX, the products ranged in the order CeO 2  > RSDL > CeO 2 -W > FE (no degradation). This study showed that CeO 2 nanoparticles are a promising material for skin decontamination of OP if formulated as a dispersion able to remove POX like CeO 2 -W and to degrade it as CeO 2 powder. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Lipid-modifying enzymes in oat and faba bean.

PubMed

Yang, Zhen; Piironen, Vieno; Lampi, Anna-Maija

2017-10-01

The aim was to study lipase, lipoxygenase (LOX) and peroxygenase (POX) activities in oat and faba bean samples to be able to evaluate their potential in formation of lipid-derived off-flavours. Lipase and LOX activities were measured by spectroscopy, and POX activities via the formation of epoxides. An ultra-high performance liquid chromatography method was developed to study the formation of fatty acid epoxides. The epoxides of esters were measured by gas chromatography. Mass spectroscopy was used to verify the identity of the epoxides. Both oat and faba bean possessed high lipase activities. In faba bean, LOX catalysed the formation of hydroperoxides, whose break-down products are the likely cause of off-flavours. Since oat had low LOX activity, autoxidation is needed to initiate lipid oxidation. Oat had high POX activity, which is able to convert hydroperoxides to epoxy and hydroxy fatty acids that could contribute significantly to off-flavours. POX activity in the faba bean was low. Thus, in faba bean volatile lipid oxidation products could rapidly be formed by LOX, whereas in oat reactions are slower due to the need of autoxidation prior to further reactions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Comparative evaluation of oxidative enzyme activities during adventitious rooting in the cuttings of grapevine rootstocks.

PubMed

Kose, Cafer; Erdal, Serkan; Kaya, Ozkan; Atici, Okkeş

2011-03-15

This study investigated changes in peroxidase (POX) and polyphenol oxidase (PPO) activities through adventitious rooting in hardwood cuttings of grapevine rootstocks. Three grapevine rootstocks with different propensity to produce adventitious roots were selected: recalcitrant (Ramsey), non-recalcitrant (Rupestris du Lot) and intermediate (99R) cultivars. The averages of root number at 65 days were 96 in Lot, 76 in 99R and 30 in Ramsey. Both enzyme activities characteristically increased before adventitious rooting, regardless of rooting ability of the rootstocks, and then decreased. POX activity increased in Ramsey cuttings at 22 days, in Lot and 99R cuttings at 14 days after planting, and then decreased gradually until 51 days. The highest POX activity was determined in Ramsey rootstock with the highest rooting ability and the lowest activity was determined in the rootstocks with the lowest rooting ability. PPO activity gradually increased in Ramsey rootstock cuttings from 10 days to 22 days, in Lot and 99R cuttings at 14 days, and then decreased until 51 days. A significant correlation was identified between high POX activity and adventitious rooting capability in rootstocks, but the same result was not determined with PPO activity. A recalcitrant rooting variety cannot increase POX activity sufficiently before rooting. Therefore applications that could increase POX activity in stem cuttings during rooting may facilitate increased rooting in such rootstocks. Copyright © 2011 Society of Chemical Industry.

Differential induction of peroxisomal beta-oxidation enzymes by clofibric acid and aspirin in piglet tissues.

PubMed

Yu, X X; Odle, J; Drackley, J K

2001-11-01

Peroxisomal beta-oxidation (POX) of fatty acids is important in lipid catabolism and thermogenesis. To investigate the effects of peroxisome proliferators on peroxisomal and mitochondrial beta-oxidation in piglet tissues, newborn pigs (1-2 days old) were allowed ad libitum access to milk replacer supplemented with 0.5% clofibric acid (CA) or 1% aspirin for 14 days. CA increased ratios of liver weight to body weight (P < 0.07), kidney weight to body weight (P < 0.05), and heart weight to body weight (P < 0.001). Aspirin decreased daily food intake and final body weight but increased the ratio of heart weight to body weight (P < 0.01). In liver, activities of POX, fatty acyl-CoA oxidase (FAO), total carnitine palmitoyltransferase (CPT), and catalase were 2.7-, 2.2-, 1.5-fold, and 33% greater, respectively, for pigs given CA than for control pigs. In heart, these variables were 2.2-, 4.1-, 1.9-, and 1.8-fold greater, respectively, for pigs given CA than for control pigs. CA did not change these variables in either kidney or muscle, except that CPT activity was increased approximately 110% (P < 0.01) in kidney. Aspirin increased only hepatic FAO and CPT activities. Northern blot analysis revealed that CA increased the abundance of catalase mRNA in heart by approximately 2.2-fold. We conclude that 1) POX and CPT in newborn pigs can be induced by peroxisomal proliferators with tissue specificity and 2) the relatively smaller induction of POX in piglets (compared with that in young or adult rodents) may be related to either age or species differences.

Oxidative stress induction by Prunus necrotic ringspot virus infection in apricot seeds.

PubMed

Amari, Khalid; Díaz-Vivancos, Pedro; Pallás, Vincente; Sánchez-Pina, María Amelia; Hernández, José Antonio

2007-10-01

Prunus necrotic ringspot rvirus (PNRSV) was able to invade the immature apricot seed including the embryo. The amount of virus was very high inside the embryo compared with that present in the cotyledons. PNRSV infection produced an oxidative stress in apricot seeds as indicated by the increase in lipid peroxidation, measured as thiobarbituric acid-reactive substances. This lipid peroxidation increase was parallelled with an imbalance in the seed antioxidant enzymes. A significant decrease in the ascorbate-GSH cycle enzymes as well as in peroxidase (POX) activity took place in infected seeds, suggesting a low capability to eliminate H2O2. No changes in superoxide dismutase (SOD) or catalase activity were observed. A significant decrease in polyphenoloxidase (PPO) activity was also observed. Native PAGE revealed the presence of three different SOD activity bands in apricot seeds: a Mn-containing SOD and two CuZn-containing SODs. Only an isozyme with catalase, glutathione reductase (GR) or PPO activity was detected in both healthy and infected apricot seeds. Regarding POX staining, three bands with POX activity were detected in native gels in both healthy and infected seeds. The gel results emphasise that the drop detected in POX, GR and PPO activities in PNRSV-infected apricot seeds by kinetic analyses was also evident from the results obtained by native PAGE. The oxidative stress and the imbalance in the antioxidant systems from PNRSV-infected apricot seeds resemble the hypersensitive response observed in some virus-host interactions. This defence mechanism would inactivate PNRSV during seed formation and/or the storage period or even during seed germination. Those results can explain the decrease in seed germination and the low transmission of PNRSV by seeds in apricot trees.

DEMONSTRATION OF THE HIPOX ADVANCED OXIDATION TECHNOLOGY FOR THE TREATMENT OF MTBE-CONTAMINATED GROUNDWATER

EPA Science Inventory

The HiPOx technology is an advanced oxidation process that incorporates high-precision delivery of ozone and hydrogen peroxide to chemically destroy organic contaminants with the promise of minimizing bromate formation. A MTBE-contaminated groundwater from the Ventura County Nav...

Partial oxidation of liquid hydrocarbons in the presence of oxygen-conducting supports: Effect of catalyst layer deposition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, M.; Berry, D.; Shekhawt, D.

2010-01-01

Ni-substituted barium hexaaluminate (BNHA) catalysts supported onto gadolinium-doped ceria (GDC), an oxygen-conductor, were prepared using two different methods: (1) conventional incipient wetness impregnation (IWI), in which a non-porous GDC support was impregnated in the conventional manner with aqueous precursors, then dried and calcined to form a supported hexaaluminate, and (2) solid-state mixing (SSM), in which solid hexaaluminate and GDC particles were mechanically ground together and thermally treated to produce a final catalyst. These catalysts were compared to bulk, unsupported BNHA; 3 wt% Ni/alumina; and 3 wt% Ni/GDC (the latter two prepared by conventional impregnation) for the partial oxidation (POX) ofmore » n-tetradecane. The reaction studies included examining the effect of 50 ppm S as dibenzothiophene (DBT) and 5 wt% 1-methylnaphthalene (MN) on the product yield under POX conditions. Temperature programmed oxidation (TPO) was used to characterize carbon formation in the reactor. The materials were characterized by BET, ICP-OES, XRD, and SEM/EDS prior to the reaction tests. Characterization of the two GDC-supported BNHA catalysts prior to the reaction studies indicated no significant differences in the bulk composition, surface area, and crystal structure. However, SEM images showed a larger amount of exposed GDC support surface area for the material prepared by IWI. Both of the GDC-supported BNHA materials demonstrated greatly reduced deactivation, with significantly reduced carbon formation compared to bulk BNHA. This was attributed to the oxygen-conducting property of the GDC, which reduced the rate of deactivation of the reaction sites by DBT and MN. The material prepared by IWI demonstrated more stable hydrogen and carbon monoxide yield than the material prepared by SSM. Although both catalysts deactivated in the presence of DBT and MN, the activity of the catalyst prepared by IWI recovered activity more quickly after the contaminants were removed. This material also maintained >50% of its initial hydrogen yield for more than 4 h after exposure to DBT and MN, while the hydrogen for the material prepared by SSM dropped to this same level within 2 h. Incipient wetness impregnation appears to provide a higher degree of interaction between the oxygenconducting GDC support and the hexaaluminate, resulting in less rapid deactivation, which appears to be due primarily to carbon deposition.« less

Comparison of responses of salivary antioxidant markers to exhaustive aerobic exercise in smoker and non-smoker young girls.

PubMed

Arazi, Hamid; Simaei, Esmat; Taati, Behzad

2016-10-01

Smoking is known as a serious global public health problem, and is also an important risk factor for oral diseases and cause of oxidative stress and cellular damage. Saliva is the first biological medium encountered during inhalation of cigarette smoke. Additionally, previous studies demonstrated that exhaustive aerobic exercise could increase oxidative stress and cellular damage. Therefore, the main aim of this study was to compare the response of salivary antioxidants (peroxides (POX), uric acid (UA), 1-1dipheny l-2-picrylhydrazyl hydrate (DPPH) of exhaustive aerobic exercise between healthy smoker and non-smoker young girls. Ten smokers and 10 non-smokers were enrolled for this study. Subjects performed a progressive cycle ergometer with an initial load of 50 W that was increased 50Wevery 3 minutes at the speed of 60rpm, until exhaustion. Un-stimulated saliva samples were collected before, immediately and 1 hour after exercise. The results showed that POX activity and UA concentration significantly increased immediately after exercise in both groups when compared to the pre exercise values (P<0.01). The level of salivary POX of non-smokers were greater than smokers immediately after exercise (P<0.01). Aerobic exercise caused a decrease in salivary DPPH activity immediately and 1 h after exercise in both groups (P<0.01). When the DPPH values were compared between smoker and non-smoker subjects, a significant decrease was observed in smokers immediately and 1 h after exercise (P<0.01). In conclusion, aerobic exercise was induced oxidative stress in both groups but oxidative stress in smoking females was greater.

Studies on the serological relationships between avian pox, sheep pox, goat pox and vaccinia viruses

PubMed Central

Uppal, P. K.; Nilakantan, P. R.

1970-01-01

By using neutralization, complement fixation and immunogel-diffusion tests, it has been demonstrated that cross-reactions occur between various avian pox viruses and between sheep pox and goat pox viruses. No such reactions were demonstrated between avian pox viruses and vaccinia virus or between avian pox and sheep pox and goat pox viruses. Furthermore, no serological relationship was demonstrable between vaccinia virus and sheep pox and goat pox viruses. PMID:4989854

Toxic effects of boron on growth and antioxidant system parameters of maize (Zea mays L.) roots.

PubMed

Esim, Nevzat; Tiryaki, Deniz; Karadagoglu, Omer; Atici, Okkes

2013-10-01

The aim of this study was to investigate the possible oxidative stress and the antioxidant response, which were caused on maize by boron (B). For this, 11- and 15-day-old maize seedlings were subjected to 2 or 4 mM B in the form of boric acid (H₃BO₃) for 2 and/or 6 days. At the end of the treatment period, root length, hydrogen peroxide (H₂O₂) content, malondialdehyde (MDA) content and the antioxidant enzymes superoxide dismutase (SOD), peroxidase (POX) and catalase (CAT) were measured. The results revealed that root length of plants, activity of antioxidative enzymes such as SOD, POX and CAT and also H₂O₂ contents and MDA levels were seriously affected by excess B. These results suggested that the oxidative stress occurred due to the toxic effect of B.

Occurrence and characterization of plum pox virus strain D isolates from European Russia and Crimea.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna; Kudryavtseva, Anna; Prikhodko, Yuri; Mitrofanova, Irina

2016-02-01

Numerous plum pox virus (PPV) strain D isolates have been found in geographically distant regions of European Russia and the Crimean peninsula on different stone fruit hosts. Phylogenetic analysis of their partial and complete genomes suggests multiple introductions of PPV-D into Russia. Distinct natural isolates from Prunus tomentosa were found to bear unique amino acid substitutions in the N-terminus of the coat protein (CP) that may contribute to the adaptation of PPV-D to this host. Serological analysis using the PPV-D-specific monoclonal antibody 4DG5 provided further evidence that mutations at positions 58 and 59 of the CP are crucial for antibody binding.

Exploring the potential of the permanganate oxidation method as a tool to monitor soil quality in agricultural upland systems of Southeast Asia

NASA Astrophysics Data System (ADS)

Hepp, Catherine M.; Bruun, Thilde Bech; de Neergaard, Andreas

2014-05-01

The transition to more intensified upland systems is having an impact on the soil quality, defined as the ability of a soil to both provide and maintain essential services to an ecosystem. As many tropical upland soils are inherently low in quality, it is essential that impacts be monitored. Soil quality is assessed by using a combination of parameters that serve as indicators and cover the soil chemical, biological and physical properties. An ideal indicator should be sensitive to changes in the environment and management practices and should be widely accessible, meaning low resource requirement (i.e. time and equipment). Total organic carbon (TOC) content is a commonly used indicator of soil quality as it is linked to many soil functions and processes; however analysis is costly and requires access to advanced instrumental facilities, rendering it unsuited for many developing countries. An alternative indicator is the soil fraction dominated by easily decomposable carbon; this may be measured by treating soil samples with 0.2M potassium permanganate (KMnO4), an oxidizing agent which is thought to mimic the enzymes released by the soil microbial community. The advantage of this method is that it is accessible: it is fast, requires little resource input and is field appropriate. There is no consensus however as to which soil carbon fraction the method targets. Furthermore Skjemstad et al. (2006) has indicated that KMnO4 may oxidise charcoal, a component of the non-labile carbon pool; this has implications for the suitability of the method when used for soils of shifting cultivation systems. The purpose of this study was to investigate the potential of permanganate oxidizable carbon (Pox C) as a reliable indicator of soil quality in agricultural upland systems in Northern Lao PDR. Focus was placed on the relations between Pox C and other soil quality parameters (bulk density, pH, CEC, TOC, total N, exchangeable K, plant available P) and upland rice yields. The ability of KMnO4 to oxidize charcoal was also a focus however, as the study is still in its initial stage, no results can be discussed. Volumetric soil samples (at the surface and at 10 cm) and upland rice yield measurements were taken from three fields with three plots that were previously left fallow for five years (n=9; soil n=81). Pearson's Correlation test and Stepwise Regression analysis was done using SPSS v 16.0 for Windows. Results show that Pox C is significantly correlated to the measured soil parameters in a manner similar to TOC. Both are positively correlated to the soil nutrients: Total N %, P Avail and K Exch; Pox C however had a stronger correlation to K Exch than TOC. This affirms the important role of Pox C in soil processes in the biological, chemical and physical spheres. Furthermore, the regression analysis identified Pox C as an influencing factor for the variations seen in upland rice yields. It is concluded that Pox C is a suitable indicator for soil quality and may be useful in monitoring changes in the soil quality of agricultural upland systems.

Pre-treatment with melatonin decreases abamectin induced toxicity in a nocturnal insect Spodoptera litura (Lepidoptera: Noctuidae).

PubMed

Subala, Subramanian P; Zubero, Eduardo E; Alatorre-Jimenez, Moises A; Shivakumar, Muthugounder S

2017-12-01

Oxidative stress is an important component of the mechanism of pesticide toxicity. The aim of the present study was to investigate the time-dependent melatonin effects against abamectin-induced oxidative stress in a S.litura model. Larvae were divided into 5 different groups; (1) control group,(2) Melatonin group (4.3×10 -5 M/100ml diet), (3) Abamectin group 1.5ml/L, (4) Pre-melatonin treated group (PM) (4.3×10 -5 M/100ml diet) before abamectin exposure 1.5ml/L, (5) Post-melatonin treated group (TM) after abamectin exposure. Melatonin was supplemented via artificial diet in PM and TM animals during 24h. Midgut, fatbody, and hemolymph, were collected for the analysis of oxidative stress markers (Total ROS, GSH, nitrite, TBARS, LPO), antioxidant enzyme levels (SOD, GST, CAT, POX, APOX) in fifth instar larvae. Midgut damage was examined by using morphological analysis. Our results observed that ABA group showed significant changes (p<0.001) in the ROS and carbonyl content in midgut. The increase of antioxidant enzyme levels (SOD, CAT, POX, and APOX) in midgut was led by the continuous free radical scavenger cascade of melatonin. Significant (p<0.01) increases in CAT and APOX levels were seen in the fatbody of PM and TM treated insects. In conclusion, the results of the study revealed that abamectin toxicity generates oxidative stress in the insect, while pre-melatonin treatment reduces this damage due to its antioxidant properties, especially POX levels in midgut, fatbody, and hemolymph. Therefore, indoleamine can play a vital role curtailing the abamectin toxicity in time dependent manner in S.litura. Copyright © 2017 Elsevier B.V. All rights reserved.

Reprogramming of proline and glutamine metabolism contributes to the proliferative and metabolic responses regulated by oncogenic transcription factor c-MYC

PubMed Central

Liu, Wei; Le, Anne; Hancock, Chad; Lane, Andrew N.; Dang, Chi V.; Fan, Teresa W.-M.; Phang, James M.

2012-01-01

In addition to glycolysis, the oncogenic transcription factor c-MYC (MYC) stimulates glutamine catabolism to fuel growth and proliferation of cancer cells through up-regulating glutaminase (GLS). Glutamine is converted to glutamate by GLS, entering the tricarboxylic acid cycle as an important energy source. Less well-recognized, glutamate can also be converted to proline through Δ1-pyrroline-5-carboxylate (P5C) and vice versa. This study suggests that some MYC-induced cellular effects are due to MYC regulation of proline metabolism. Proline oxidase, also known as proline dehydrogenase (POX/PRODH), the first enzyme in proline catabolism, is a mitochondrial tumor suppressor that inhibits proliferation and induces apoptosis. MiR-23b* mediates POX/PRODH down-regulation in human kidney tumors. MiR-23b* is processed from the same transcript as miR-23b; the latter inhibits the translation of GLS. Using MYC-inducible human Burkitt lymphoma model P493 and PC3 human prostate cancer cells, we showed that MYC suppressed POX/PRODH expression primarily through up-regulating miR-23b*. The growth inhibition in the absence of MYC was partially reversed by POX/PRODH knockdown, indicating the importance of suppression of POX/PRODH in MYC-mediated cellular effects. Interestingly, MYC not only inhibited POX/PRODH, but also markedly increased the enzymes of proline biosynthesis from glutamine, including P5C synthase and P5C reductase 1. MYC-induced proline biosynthesis from glutamine was directly confirmed using 13C,15N-glutamine as a tracer. The metabolic link between glutamine and proline afforded by MYC emphasizes the complexity of tumor metabolism. Further studies of the relationship between glutamine and proline metabolism should provide a deeper understanding of tumor metabolism while enabling the development of novel therapeutic strategies. PMID:22615405

Collisional excitation of interstellar PO(X2Π) by He: new ab initio potential energy surfaces and scattering calculations

NASA Astrophysics Data System (ADS)

Lique, François; Jiménez-Serra, Izaskun; Viti, Serena; Marinakis, Sarantos

2018-01-01

We present the first ab initio potential energy surfaces (PESs) for the PO(X2Π)-He van der Waals system. The PESs were obtained using the open-shell partially spin-restricted coupled cluster approach with single, double and perturbative triple excitations [UCCSD(T)]. The augmented correlation-consistent polarized valence triple-zeta (aug-cc-pVTZ) basis set was employed supplemented by mid-bond functions. Integral and differential cross sections for the rotational excitation in PO-He collisions were calculated using the new PES and compared with results in similar systems. Finally, our work presents the first hyperfine-resolved cross sections for this system that are needed for accurate modelling in astrophysical environments.

Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

PubMed

Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

2014-10-09

A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

Comparison of Fiber Optic and Conduit Attenuated Total Reflection (ATR) Fourier Transform Infrared (FT-IR) Setup for In-Line Fermentation Monitoring.

PubMed

Koch, Cosima; Posch, Andreas E; Herwig, Christoph; Lendl, Bernhard

2016-12-01

The performance of a fiber optic and an optical conduit in-line attenuated total reflection mid-infrared (IR) probe during in situ monitoring of Penicillium chrysogenum fermentation were compared. The fiber optic probe was connected to a sealed, portable, Fourier transform infrared (FT-IR) process spectrometer via a plug-and-play interface. The optical conduit, on the other hand, was connected to a FT-IR process spectrometer via a knuckled probe with mirrors that had to be adjusted prior to each fermentation, which were purged with dry air. Penicillin V (PenV) and its precursor phenoxyacetic acid (POX) concentrations were determined by online high-performance liquid chromatography and the obtained concentrations were used as reference to build partial least squares regression models. Cross-validated root-mean-square errors of prediction were found to be 0.2 g L -1 (POX) and 0.19 g L -1 (PenV) for the fiber optic setup and 0.17 g L -1 (both POX and PenV) for the conduit setup. Higher noise-levels and spectrum-to-spectrum variations of the fiber optic setup lead to higher noise of estimated (i.e., unknown) POX and PenV concentrations than was found for the conduit setup. It seems that trade-off has to be made between ease of handling (fiber optic setup) and measurement accuracy (optical conduit setup) when choosing one of these systems for bioprocess monitoring. © The Author(s) 2016.

Large Cellular Inclusions Accumulate in Arabidopsis Roots Exposed to Low-Sulfur Conditions1[OPEN

PubMed Central

Popov, Vladimir A.; Mathur, Jaideep; Benfey, Philip N.

2015-01-01

Sulfur is vital for primary and secondary metabolism in plant roots. To understand the molecular and morphogenetic changes associated with loss of this key macronutrient, we grew Arabidopsis (Arabidopsis thaliana) seedlings in low-sulfur conditions. These conditions induced a cascade of cellular events that converged to produce a profound intracellular phenotype defined by large cytoplasmic inclusions. The inclusions, termed low-sulfur Pox, show cell type- and developmental zone-specific localization. Transcriptome analysis suggested that low sulfur causes dysfunction of the glutathione/ascorbate cycle, which reduces flavonoids. Genetic and biochemical evidence indicated that low-sulfur Pox are the result of peroxidase-catalyzed oxidation of quercetin in roots grown under sulfur-depleted conditions. PMID:26099270

A lumpy skin disease virus deficient of an IL-10 gene homologue provides protective immunity against virulent capripoxvirus challenge in sheep and goats.

PubMed

Boshra, Hani; Truong, Thang; Nfon, Charles; Bowden, Timothy R; Gerdts, Volker; Tikoo, Suresh; Babiuk, Lorne A; Kara, Pravesh; Mather, Arshad; Wallace, David B; Babiuk, Shawn

2015-11-01

Sheep and goat pox continue to be important livestock diseases that pose a major threat to the livestock industry in many regions in Africa and Asia. Currently, several live attenuated vaccines are available and used in endemic countries to control these diseases. One of these is a partially attenuated strain of lumpy skin disease virus (LSDV), KS-1, which provides cross-protection against both sheep pox and goat pox. However, when used in highly stressed dairy cattle to protect against lumpy skin disease (LSD) the vaccine can cause clinical disease. In order to develop safer vaccines effective against all three diseases, a pathogenic strain of LSDV (Warmbaths [WB], South Africa) was attenuated by removing a putative virulence factor gene (IL-10-like) using gene knockout (KO) technology. This construct (LSDV WB005KO) was then evaluated as a vaccine for sheep and goats against virulent capripoxvirus challenge. Sheep and goats were vaccinated with the construct and the animals were observed for 21days. The vaccine appeared to be safe, and did not cause disease, although it induced minor inflammation at the injection site similar to that caused by other attenuated sheep and goat pox vaccines. In addition, no virus replication was detected in blood, oral or nasal swabs using real-time PCR following vaccination and low levels of neutralising antibodies were detected in both sheep and goats. Leukocytes isolated from vaccinated animals following vaccination elicited capripoxvirus-specific IFN-γ secretion, suggesting that immunity was also T-cell mediated. Following challenge with virulent capripoxvirus, vaccinated sheep and goats were found to be completely protected and exhibited no clinical disease. Furthermore, real-time PCR of blood samples at various time points suggested that viremia was absent in both groups of vaccinated animals, as opposed to capripoxvirus-related clinical disease and viremia observed in the unvaccinated animals. These findings suggest that this novel knockout strain of LSDV has potential as a vaccine to protect livestock against sheep pox and goat pox. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

Poly(2-oxazoline)s as Polymer Therapeutics

PubMed Central

Luxenhofer, Robert; Han, Yingchao; Schulz, Anita; Tong, Jing; He, Zhijian; Kabanov, Alexander V.; Jordan, Rainer

2013-01-01

Poly(2-oxazoline)s (POx) are currently discussed as an upcoming platform for biomaterials design and especially for polymer therapeutics. POx meets several requirements needed for the development of next-generation polymer therapeutics such as biocompatibility, high modulation of solubility, variation of size, architecture as well as chemical functionality. Although in the early 1990s first and promising POx-based systems were presented but the field lay dormant for almost two decades. Only very recently, POx based polymer therapeutics came back into the focus of very intensive research. In this review, we give an overview on the chemistry and physicochemical properties of POx and summarize the research of POx-protein conjugates, POx-drug conjugates, POx-based polyplexes and POx micelles for drug delivery. PMID:22865555

Expression of Aluminum-Induced Genes in Transgenic Arabidopsis Plants Can Ameliorate Aluminum Stress and/or Oxidative Stress1

PubMed Central

Ezaki, Bunichi; Gardner, Richard C.; Ezaki, Yuka; Matsumoto, Hideaki

2000-01-01

To examine the biological role of Al-stress-induced genes, nine genes derived from Arabidopsis, tobacco (Nicotiana tabacum L.), wheat (Triticum aestivum L.), and yeast (Saccharomyces cerevisiae) were expressed in Arabidopsis ecotype Landsberg. Lines containing eight of these genes were phenotypically normal and were tested in root elongation assays for their sensitivity to Al, Cd, Cu, Na, Zn, and to oxidative stresses. An Arabidopsis blue-copper-binding protein gene (AtBCB), a tobacco glutathione S-transferase gene (parB), a tobacco peroxidase gene (NtPox), and a tobacco GDP-dissociation inhibitor gene (NtGDI1) conferred a degree of resistance to Al. Two of these genes, AtBCB and parB, and a peroxidase gene from Arabidopsis (AtPox) also showed increased resistance to oxidative stress induced by diamide, while parB conferred resistance to Cu and Na. Al content of Al-treated root tips was reduced in the four Al-resistant plant lines compared with wild-type Ler-0, as judged by morin staining. All four Al-resistant lines also showed reduced staining of roots with 2′,7′-dichloro fluorescein diacetate (H2DCFDA), an indicator of oxidative stress. We conclude that Al-induced genes can serve to protect against Al toxicity, and also provide genetic evidence for a link between Al stress and oxidative stress in plants. PMID:10712528

Partial Oxidation of Hydrocarbons in a Segmented Bed Using Oxide-based Catalysts and Oxygen-conducting Supports

NASA Astrophysics Data System (ADS)

Smith, Mark W.

Two objectives for the catalytic reforming of hydrocarbons to produce synthesis gas are investigated herein: (1) the effect of oxygen-conducting supports with partially substituted mixed-metal oxide catalysts, and (2) a segmented bed approach using different catalyst configurations. Excess carbon deposition was the primary cause of catalyst deactivation, and was the focus of the experiments for both objectives. The formation and characterization of deposited carbon was examined after reaction for one of the selected catalysts to determine the quantity and location of the carbon on the catalyst surface leading to deactivation. A nickel-substituted barium hexaaluminate (BNHA), with the formula BaAl 11.6Ni0.4O18.8, and a Rh-substituted lanthanum zirconate pyrochlore (LCZR) with the formula La1.89Ca0.11 Zr1.89Rh0.11, were combined with two different doped ceria supports. These supports were gadolinium-doped ceria (GDC) and zirconium-doped ceria (ZDC). The active catalyst phases were combined with the supports in different ratios using different synthesis techniques. The catalysts were characterized using several different techniques and were tested under partial oxidation (POX) of n-tetradecane (TD), a diesel fuel surrogate. It was found that the presence of GDC and ZDC reduced the formation of carbon for both catalysts; the optimal ratio of catalyst to support was different for the hexaaluminate and the pyrochlore; a loading of 20 wt% of the pyrochlore with ZDC produced the most stable performance in the presence of common fuel contaminants (>50 h); and, the incipient wetness impregnation synthesis method of applying the active catalyst to the support produced more stable product yields than the catalyst prepared by a solid-state mixing technique. Different hexaaluminate and pyrochlore catalysts were used in different configurations in a segmented bed approach. The first strategy was to promote the indirect reforming mechanism by placing a combustion catalyst in the reactor inlet, followed by a reforming catalyst. This approach demonstrated that BNHA can be used in the reactor inlet to promote combustion with 1 wt% Rh-substituted pyrochlore in the reactor outlet, but the combustion catalyst should fill less than 50% of the reactor. The second approach placed specific catalysts in regions of the reactor that have conditions in which they are less likely to deactivate. This showed the most benefit in the use of a sulfur-tolerant noble metal catalyst in the reactor outlet. The carbon formation study was conducted on a 2 wt% Rh-substituted pyrochlore. POX of TD for various run times, followed by temperature programmed oxidation, revealed two different types of carbon deposits in the catalyst bed: carbon that burned off at relatively low temperature (LTC), and carbon that burned off at higher temperatures (HTC). The LTC reached a steady state level within two hours of reaction, and was determined not to lead to catalyst deactivation. The HTC continued to accumulate with time on stream. A mathematical expression was developed to predict the rate of formation of the HTC for a given set of reaction conditions (O/C = 1.25). This expression was modified from data from a test under different reaction conditions (O/C = 1.1) for one length of time, and was found to predict the carbon formation for a different run time within 3%.

Results From the New Jersey Statewide Critical Congenital Heart Defects Screening Program

PubMed Central

Garg, Lorraine F.; Van Naarden Braun, Kim; Knapp, Mary M.; Anderson, Terry M.; Koppel, Robert I.; Hirsch, Daniel; Beres, Leslie M.; Hyg, MS; Sweatlock, Joseph; Olney, Richard S.; Glidewell, Jill; Hinton, Cynthia F.; Kemper, Alex R.

2015-01-01

BACKGROUND AND OBJECTIVE New Jersey was the first state to implement legislatively mandated newborn pulse oximetry screening (POxS) in all licensed birthing facilities to detect critical congenital heart defects (CCHDs). The objective of this report was to evaluate implementation of New Jersey’s statewide POxS mandate. METHODS A 2-pronged approach was used to collect data on infants screened in all New Jersey birthing facilities from August 31, 2011, through May 31, 2012. Aggregate screening results were submitted by each birthing facility. Data on failed screens and clinical characteristics of those newborns were reported to the New Jersey Birth Defects Registry (NJBDR). Three indicators were used to distinguish the added value of mandated POxS from standard clinical care: prenatal congenital heart defect diagnosis, cardiology consultation or echocardiogram indicated or performed before PoxS, or clinical findings at the time of POxS warranting a pulse oximetry measurement. RESULTS Of 75 324 live births in licensed New Jersey birthing facilities, 73 320 were eligible for screening, of which 99% were screened. Forty-nine infants with failed POxS were reported to the NJBDR, 30 of whom had diagnostic evaluations solely attributable to the mandated screening. Three of the 30 infants had previously unsuspected CCHDs and 17 had other diagnoses or non-CCHD echocardiogram findings. CONCLUSIONS In the first 9 months after implementation, New Jersey achieved a high statewide screening rate and established surveillance mechanisms to evaluate the unique contribution of POxS. The screening mandate identified 3 infants with previously unsuspected CCHDs that otherwise might have resulted in significant morbidity and mortality and also identified other significant secondary targets such as sepsis and pneumonia. PMID:23858425

9 CFR 113.326 - Avian Pox Vaccine.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false Avian Pox Vaccine. 113.326 Section 113... Vaccines § 113.326 Avian Pox Vaccine. Fowl Pox Vaccine and Pigeon Pox Vaccine shall be prepared from virus... this section shall be used for preparing the production seed virus for vaccine production. All serials...

9 CFR 113.326 - Avian Pox Vaccine.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 9 Animals and Animal Products 1 2014-01-01 2014-01-01 false Avian Pox Vaccine. 113.326 Section 113... Vaccines § 113.326 Avian Pox Vaccine. Fowl Pox Vaccine and Pigeon Pox Vaccine shall be prepared from virus... this section shall be used for preparing the production seed virus for vaccine production. All serials...

9 CFR 113.326 - Avian Pox Vaccine.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Avian Pox Vaccine. 113.326 Section 113... Vaccines § 113.326 Avian Pox Vaccine. Fowl Pox Vaccine and Pigeon Pox Vaccine shall be prepared from virus... this section shall be used for preparing the production seed virus for vaccine production. All serials...

9 CFR 113.326 - Avian Pox Vaccine.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Avian Pox Vaccine. 113.326 Section 113... Vaccines § 113.326 Avian Pox Vaccine. Fowl Pox Vaccine and Pigeon Pox Vaccine shall be prepared from virus... this section shall be used for preparing the production seed virus for vaccine production. All serials...

9 CFR 113.326 - Avian Pox Vaccine.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Avian Pox Vaccine. 113.326 Section 113... Vaccines § 113.326 Avian Pox Vaccine. Fowl Pox Vaccine and Pigeon Pox Vaccine shall be prepared from virus... this section shall be used for preparing the production seed virus for vaccine production. All serials...

Pox in mourning doves in the United States

USGS Publications Warehouse

Locke, L.N.

1961-01-01

Pox infection has occurrcd in mourning doves in at least 8 states on 12 separate occasions. Unsuccessful attempts were made to transmit both fowl pox (chicken isolate) and passerine pox (cowbird isolate) to mourning doves.

Calcium signals and caspase-12 participated in paraoxon-induced apoptosis in EL4 cells.

PubMed

Li, Lan; Cao, Zhiheng; Jia, Pengfei; Wang, Ziren

2010-04-01

In order to investigate whether calcium signals participate in paraoxon (POX)-induced apoptosis in EL4 cells, real-time laser scanning confocal microscopy (LSCM) was used to detect Ca(2+) changes during the POX application. Apoptotic rates of EL4 cells and caspase-12 expression were also evaluated. POX (1-10nM) increased intracellular calcium concentration ([Ca(2+)]i) in EL4 cells in a dose-dependent manner at early stage (0-2h) of POX application, and apoptotic rates of EL4 cells after treatment with POX for 16h were also increased in a dose-dependent manner. Pre-treatment with EGTA, heparin or procaine attenuated POX-induced [Ca(2+)]i elevation and apoptosis. Additionally, POX up-regulated caspase-12 expression in a dose-dependent manner, and pre-treatment with EGTA, heparin or procaine significantly inhibited POX-induced increase of caspase-12 expression. Our results suggested that POX induced [Ca(2+)]i elevation in EL4 cells at the early stage of POX-induced apoptosis, which might involve Ca(2+) efflux from the endoplasmic reticulum (ER) and Ca(2+) influx from extracellular medium. Calcium signals and caspase-12 were important upstream messengers in POX-induced apoptosis in EL4 cells. The ER-associated pathway possibly operated in this apoptosis. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Psittacine pox virus: virus isolation and identification, transmission, and cross-challenge studies in parrots and chickens.

PubMed

Boosinger, T R; Winterfield, R W; Feldman, D S; Dhillon, A S

1982-01-01

An avian pox virus was isolated from Amazon parrots dying with severe diphtheritic oral, esophageal, and crop lesions. The virus was propagated on chorioallantoic membranes (CAM) of 10-day-old chicken embryos, and a homogenate of the infected CAM was rubbed vigorously onto the conjunctiva, oral mucosa, and defeathered follicles of two healthy Amazon parrots and three conures. All experimental birds developed cutaneous and ocular pox lesions, and one parrot developed oral pox lesions. Specific-pathogen-free chicks inoculated with the virus isolate developed skin lesions identical to those of the parrots. Chickens vaccinated with fowl and pigeon pox vaccines and inoculated with the psittacine isolate developed lesions typical of avian pox. Chickens vaccinated with the psittacine virus were susceptible to fowl and pigeon pox virus infection. This pox virus isolate may thus be regarded as a potential pathogen for chickens.

A POX on Renal Cancer Cells | Center for Cancer Research

Cancer.gov

Proline oxidase, or POX, is an enzyme responsible for metabolizing the amino acid proline. POX contributes to the regulation of cell death that occurs when cellular systems malfunction, a process called apoptosis. Previous studies have determined that levels of POX are reduced in several types of human cancer. Likewise, many cancer cells become resistant to apoptosis, suggesting a link between POX and cancer cell survival.

Detection and partial molecular characterization of atypical plum pox virus isolates from naturally infected sour cherry.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna

2013-06-01

Atypical isolates of plum pox virus (PPV) were discovered in naturally infected sour cherry in urban ornamental plantings in Moscow, Russia. The isolates were detected by polyclonal double antibody sandwich ELISA and RT-PCR using universal primers specific for the 3'-non-coding and coat protein (CP) regions of the genome but failed to be recognized by triple antibody sandwich ELISA with the universal monoclonal antibody 5B and by RT-PCR using primers specific to for PPV strains D, M, C and W. Sequence analysis of the CP genes of nine isolates revealed 99.2-100 % within-group identity and 62-85 % identity to conventional PPV strains. Phylogenetic analysis showed that the atypical isolates represent a group that is distinct from the known PPV strains. Alignment of the N-terminal amino acid sequences of CP demonstrated their close similarity to those of a new tentative PPV strain, CR.

Efficacy of a commercial canarypox vaccine for protecting Hawai'i 'Amakihi from field isolates of avipoxvirus

USGS Publications Warehouse

Atkinson, Carter T.; Wiegand, Kimberly C.; Triglia, Dennis; Jarvi, Susan I.

2010-01-01

At least three variants of avian pox virus are present in Hawai’i - Fowlpox from domestic poultry and a group of genetically distinct viruses that cluster within two clades (Pox Variant 1 and Pox Variant 2) that are most similar to Canarypox based on DNA sequence of the virus 4b core protein gene. We tested whether Hawai’i ‘Amakihi can be protected from wild virus isolates with an attenuated live Canarypox vaccine that is closely related to isolates that cluster within clade 1 (Pox Variant 1) based on sequence of the attenuated Canarypox virus 4b core protein. Thirty-one (31) Hawai`i ‘Amakihi (Hemignathus virens) with no prior physical evidence of pox infection were collected on Mauna Kea from xeric, high elevation habitats with low pox prevalence and randomly divided into two groups. One group of 16 was vaccinated with Poximmune C® while the other group received a sham vaccination with virus diluent. Four of 15 (27%) vaccinated birds developed potentially life-threatening disseminated lesions or lesions of unusually long duration, while one bird never developed a vaccine-associated lesion or “take”. After vaccine-associated lesions healed, vaccinated birds were randomly divided into three groups of five and challenged with either a wild isolate of Fowlpox, a Hawai`i `Amakihi isolate of a Canarypox-like virus from clade 1 (Pox Variant 1) or a Hawai`i `Amakihi isolate of a Canarypox-like virus from clade 2 (Pox Variant 2). Similarly, three random groups of five unvaccinated ‘Amakihi were challenged with the same virus isolates. Vaccinated and unvaccinated ‘Amakihi challenged with Fowlpox had transient infections with no clinical signs of infection. Mortality in vaccinated ‘Amakihi that were challenged with Pox Variant 1 and Pox Variant 2 ranged from 0% (0/5) for Pox Variant 1 to 60% (3/5) for Pox Variant 2. Mortality in unvaccinated ‘Amakihi ranged from 40% (2/5) for Pox Variant 1 to 100% (5/5) for Pox Variant 2. While the vaccine provided some protection against Pox Variant 1, serious side effects and low efficacy against Pox Variant 2 make it risky to use in captive or wild honeycreepers.

Efficacy of commercial canarypox vaccine for protecting Hawai'i 'Amakihi from field isolates of Avipoxvirus

USGS Publications Warehouse

Atkinson, Carter T.; Wiegand, Kimberly C.; Triglia, Dennis; Jarvi, Susan I.

2010-01-01

At least three variants of avian pox virus are present in Hawai‘i - Fowlpox from domestic poultry and a group of genetically distinct viruses that cluster within two clades (Pox Variant 1 and Pox Variant 2) that are most similar to Canarypox based on DNA sequence of the virus 4b core protein gene. We tested whether Hawai‘i ‘Amakihi can be protected from wild virus isolates with an attenuated live Canarypox vaccine that is closely related to isolates that cluster within clade 1 (Pox Variant 1) based on sequence of the attenuated Canarypox virus 4b core protein. Thirty-one (31) Hawai`i ‘Amakihi (Hemignathus virens) with no prior physical evidence of pox infection were collected on Mauna Kea from xeric, high elevation habitats with low pox prevalence and randomly divided into two groups. One group of 16 was vaccinated with Poximmune C® while the other group received a sham vaccination with virus diluent. Four of 15 (27%) vaccinated birds developed potentially life-threatening disseminated lesions or lesions of unusually long duration, while one bird never developed a vaccine-associated lesion or "take". After vaccine-associated lesions healed, vaccinated birds were randomly divided into three groups of five and challenged with either a wild isolate of Fowlpox, a Hawai`i `Amakihi isolate of a Canarypox-like virus from clade 1 (Pox Variant 1) or a Hawai`i `Amakihi isolate of a Canarypox-like virus from clade 2 (Pox Variant 2). Similarly, three random groups of five unvaccinated ‘Amakihi were challenged with the same virus isolates. Vaccinated and unvaccinated ‘Amakihi challenged with Fowlpox had transient infections with no clinical signs of infection. Mortality in vaccinated ‘Amakihi that were challenged with Pox Variant 1 and Pox Variant 2 ranged from 0% (0/5) for Pox Variant 1 to 60% (3/5) for Pox Variant 2. Mortality in unvaccinated ‘Amakihi ranged from 40% (2/5) for Pox Variant 1 to 100% (5/5) for Pox Variant 2. While the vaccine provided some protection against Pox Variant 1, serious side effects and low efficacy against Pox Variant 2 make it risky to use in captive or wild honeycreepers.

Alpha-tocopherol-dependent salt tolerance is more related with auxin synthesis rather than enhancement antioxidant defense in soybean roots.

PubMed

Sereflioglu, Seda; Dinler, Burcu Seckin; Tasci, Eda

2017-03-01

In this paper, we describe the alleviated effects of alpha-tocopherol (α-T) on oxidative damage and its possible role as a signal transmitter in plants during salt stress. The results show that exogenously applied α-T under salt stress increased root length and weight, but reduced hydrogen peroxide (H 2 O 2 ), superoxide anion radical (O 2 . -) and malondialdehyde (MDA) content in soybean roots. The proline content was reduced by α-T treatment. Interestingly, endogenous auxin (IAA) level was significantly increased after α-T application as compared to salt stress alone. Moreover, α-T reduced significantly superoxide dismutase (SOD) enzyme and isoenzyme activity but upregulated peroxidase (POX) 2, 3 and glutathione-s-transferase (GST) 1, 3 isoenzyme expression. However, ascorbate peroxidase (APX) enzyme activity was not affected at all. Consequently, the results show that α-T serves as a signal molecule under salinity from leaves to roots by increasing remarkably endogenous IAA levels and increasing partially antioxidant activity in roots.

Pralidoxime inhibits paraoxon-induced depression of rocuronium-neuromuscular block in a time-dependent fashion.

PubMed

Narimatsu, Eichi; Niiya, Tomohisa; Takahashi, Kazunobu; Yamauchi, Masanori; Yamakage, Michiaki

2012-07-01

The composite effects of organophosphorus (OP)-cholinesterase (ChE) inhibitors and oximes on the actions of nondepolarizing neuromuscular blockers in acute OP-ChE inhibitor intoxication have not been evaluated in detail. We investigated the effects of paraoxon (Pox) (an OP-ChE inhibitor) and pralidoxime (PAM) (an oxime) on the nondepolarizing neuromuscular blocking action of rocuronium. Isometric twitch tensions of rat left phrenic nerve-hemidiaphragm preparations elicited by indirect (phrenic nerve) supramaximal stimulation at 0.1 Hz were evaluated. Analysis of variance with post hoc testing was used for statistical comparison, and P < .05 was accepted as significant. Rocuronium reduced the indirectly elicited twitch tensions in normal (50% inhibitory concentration [IC(50)], 9.84 [9.64-10.04] μM, mean [95% confidence interval]) and all pretreated diaphragms (P < .01, n = 6) in a concentration-dependent fashion. Paraoxon caused a rightward shift in the rocuronium concentration-twitch tension curve (IC(50), 15.48 [15.24-15.72] μM). The rightward shift was completely inhibited by previous copretreatment (IC(50), 9.98 [9.77-10.20] μM) and partially inhibited by simultaneous copretreatment (IC(50), 11.68 [11.45-11.91] μM) with PAM but was not inhibited by subsequent copretreatment (IC(50), 13.69 [13.39-13.99] μM) with PAM (P < .01, n = 6). Atropine did not influence the rightward shift (P < .01, n = 6). Paraoxon depressed rocuronium-induced neuromuscular block by inhibiting ChEs, and the action of Pox was inhibited by PAM. Pralidoxime acts more intensely when applied earlier. The time-dependent effect of PAM indicates that the preceding presence of PAM in proximity to ChEs before Pox is necessary for definite suppression of the Pox-induced ChE inhibition. Copyright © 2012 Elsevier Inc. All rights reserved.

Calcium plays a key role in paraoxon-induced apoptosis in EL4 cells by regulating both endoplasmic reticulum- and mitochondria-associated pathways.

PubMed

Li, Lan; Du, Yi; Ju, Furong; Ma, Shunxiang; Zhang, Shengxiang

2016-01-01

Paraoxon (POX) is one of the most toxic organophosphorus pesticides, but its toxic mechanisms associated with apoptosis remain unclear. The aim of this study was to investigate calcium-associated mechanisms in POX-induced apoptosis in EL4 cells. EL4 cells were exposed to POX for 0-16 h. EGTA was used to chelate Ca(2+ ) in extracellular medium, and heparin and procaine were used to inhibit Ca(2+ )efflux from the endoplasmic reticulum (ER). Z-ATAD-FMK was used to inhibit caspase-12 activity. The apoptotic rate assay, western blotting and immunocytochemistry (ICC) were used to reveal the mechanisms of POX-induced apoptosis. POX significantly increased the expression and activation of caspase-12 and caspase-3, enhanced expression of calpain 1 and calpain 2, and induced the release of cyt c, but did not change the expression of Grp 78. Inhibiting caspase-12 activity alleviated POX-induced upregulation of calpain 1 and caspase-3, promoted POX-induced upregulation of calpain 2, and reduced POX-induced cyt c release, suggesting that there was a cross-talk between the ER-associated pathway and mitochondria-associated apoptotic signals. Attenuating intracellular calcium concentration with EGTA, heparin or procaine decreased POX-induced upregulation of calpain 1, calpain 2, caspase-12 and caspase-3, and reduced POX-induced cyt c release. After pretreatment with EGTA or procaine, POX significantly promoted expression of Grp 78. Calcium played a key role in POX-induced apoptosis in EL4 cells by regulating both ER- and mitochondria-associated pathways. The cross-talk of ER- and mitochondria-associated pathways was accomplished through calcium signal.

Functional Consequences of Intracellular Proline Levels Manipulation Affecting PRODH/POX-Dependent Pro-Apoptotic Pathways in a Novel in Vitro Cell Culture Model.

PubMed

Zareba, Ilona; Surazynski, Arkadiusz; Chrusciel, Marcin; Miltyk, Wojciech; Doroszko, Milena; Rahman, Nafis; Palka, Jerzy

2017-01-01

The effect of impaired intracellular proline availability for proline dehydrogenase/proline oxidase (PRODH/POX)-dependent apoptosis was studied. We generated a constitutively knocked-down PRODH/POX MCF-7 breast cancer cell line (MCF-7shPRODH/POX) as a model to analyze the functional consequences of impaired intracellular proline levels. We have used inhibitor of proline utilization in collagen biosynthesis, 2-metoxyestradiol (MOE), inhibitor of prolidase that generate proline, rapamycin (Rap) and glycyl-proline (GlyPro), substrate for prolidase. Collagen and DNA biosynthesis were evaluated by radiometric assays. Cell viability was determined using Nucleo-Counter NC-3000. The activity of prolidase was determined by colorimetric assay. Expression of proteins was assessed by Western blot and immunofluorescence bioimaging. Concentration of proline was analyzed by liquid chromatography with mass spectrometry. PRODH/POX knockdown decreased DNA and collagen biosynthesis, whereas increased prolidase activity and intracellular proline level in MCF-7shPRODH/POX cells. All studied compounds decreased cell viability in MCF-7 and MCF-7shPRODH/POX cells. DNA biosynthesis was similarly inhibited by Rap and MOE in both cell lines, but GlyPro inhibited the process only in MCF-7shPRODH/POX and MOE+GlyPro only in MCF-7 cells. All the compounds inhibited collagen biosynthesis, increased prolidase activity and cytoplasmic proline level in MCF-7shPRODH/POX cells and contributed to the induction of pro-survival mode only in MCF-7shPRODH/POX cells. In contrast, all studied compounds upregulated expression of pro-apoptotic protein only in MCF-7 cells. PRODH/POX was confirmed as a driver of apoptosis and proved the eligibility of MCF-7shPRODH/POX cell line as a highly effective model to elucidate the different mechanisms underlying proline utilization or generation in PRODH/POX-dependent pro-apoptotic pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.

Allelic variation at the rpv1 locus controls partial resistance to Plum pox virus infection in Arabidopsis thaliana.

PubMed

Poque, S; Pagny, G; Ouibrahim, L; Chague, A; Eyquard, J-P; Caballero, M; Candresse, T; Caranta, C; Mariette, S; Decroocq, V

2015-06-25

Sharka is caused by Plum pox virus (PPV) in stone fruit trees. In orchards, the virus is transmitted by aphids and by grafting. In Arabidopsis, PPV is transferred by mechanical inoculation, by biolistics and by agroinoculation with infectious cDNA clones. Partial resistance to PPV has been observed in the Cvi-1 and Col-0 Arabidopsis accessions and is characterized by a tendency to escape systemic infection. Indeed, only one third of the plants are infected following inoculation, in comparison with the susceptible Ler accession. Genetic analysis showed this partial resistance to be monogenic or digenic depending on the allelic configuration and recessive. It is detected when inoculating mechanically but is overcome when using biolistic or agroinoculation. A genome-wide association analysis was performed using multiparental lines and 147 Arabidopsis accessions. It identified a major genomic region, rpv1. Fine mapping led to the positioning of rpv1 to a 200 kb interval on the long arm of chromosome 1. A candidate gene approach identified the chloroplast phosphoglycerate kinase (cPGK2) as a potential gene underlying the resistance. A virus-induced gene silencing strategy was used to knock-down cPGK2 expression, resulting in drastically reduced PPV accumulation. These results indicate that rpv1 resistance to PPV carried by the Cvi-1 and Col-0 accessions is linked to allelic variations at the Arabidopsis cPGK2 locus, leading to incomplete, compatible interaction with the virus.

Hairy root transgene expression analysis of a secretory peroxidase (PvPOX1) from common bean infected by Fusarium wilt.

PubMed

Xue, Renfeng; Wu, Xingbo; Wang, Yingjie; Zhuang, Yan; Chen, Jian; Wu, Jing; Ge, Weide; Wang, Lanfen; Wang, Shumin; Blair, Matthew W

2017-07-01

Plant peroxidases (POXs) are one of the most important redox enzymes in the defense responses. However, the large number of different plant POX genes makes it necessary to carefully confirm the function of each paralogous POX gene in specific tissues and disease interactions. Fusarium wilt is a devastating disease of common bean caused by Fusarium oxysporum f. sp. phaseoli. In this study, we evaluated a peroxidase gene, PvPOX1, from a resistant common bean genotype, CAAS260205 and provided direct evidence for PvPOX1's role in resistance by transforming the resistant allele into a susceptible common bean genotype, BRB130, via hairy root transformation using Agrobacterium rhizogenes. Analysis of PvPOX1 gene over-expressing hairy roots showed it increased resistance to Fusarium wilt both in the roots and the rest of transgenic plants. Meanwhile, the PvPOX1 expressive level, the peroxidase activity and hydrogen peroxide (H 2 O 2 ) accumulation were also enhanced in the interaction. The result showed that the PvPOX1 gene played an essential role in Fusarium wilt resistance through the occurrence of reactive oxygen species (ROS) induced hypersensitive response. Therefore, PvPOX1 expression was proven to be a valuable gene for further analysis which can strengthen host defense response against Fusarium wilt through a ROS activated resistance mechanism. Copyright © 2017 Elsevier B.V. All rights reserved.

Development of status epilepticus, sustained calcium elevations and neuronal injury in a rat survival model of lethal paraoxon intoxication

PubMed Central

Deshpande, Laxmikant S.; Carter, Dawn S.; Phillips, Kristin F.; Blair, Robert E.; DeLorenzo, Robert J.

2014-01-01

Paraoxon (POX) is an active metabolite of organophosphate (OP) pesticide parathion that has been weaponized and used against civilian populations. Exposure to POX produces high mortality. OP poisoning is often associated with chronic neurological disorders. In this study, we optimize a rat survival model of lethal POX exposures in order to mimic both acute and long-term effects of POX intoxication. Male Sprague-Dawley rats injected with POX (4 mg/kg, ice-cold PBS, s.c.) produced a rapid cholinergic crisis that evolved into status epilepticus (SE) and death within 6–8 min. The EEG profile for POX induced SE was characterized and showed clinical and electrographic seizures with 7–10 Hz spike activity. Treatment of 100% lethal POX intoxication with an optimized three drug regimen (atropine, 2 mg/kg, i.p., 2-PAM, 25 mg/kg, i.m. and diazepam, 5 mg/kg, i.p.) promptly stopped SE and reduced acute mortality to 12% and chronic mortality to 18%. This model is ideally suited to test effective countermeasures against lethal POX exposure. Animals that survived the POX SE manifested prolonged elevations in hippocampal [Ca2+]i (Ca2+ plateau) and significant multifocal neuronal injury. POX SE induced Ca2+ plateau had its origin in Ca2+ release from intracellular Ca2+ stores since inhibition of ryanodine/ IP3 receptor lowered elevated Ca2+ levels post SE. POX SE induced neuronal injury and alterations in Ca2+ dynamics may underlie some of the long term morbidity associated with OP toxicity. PMID:24785379

75 FR 81087 - Plum Pox Virus; Update of Quarantined Areas

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-27

.... APHIS-2010-0089] Plum Pox Virus; Update of Quarantined Areas AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION: Interim rule and request for comments. SUMMARY: We are amending the plum pox virus.... SUPPLEMENTARY INFORMATION: Background The plum pox virus (PPV) is an extremely serious viral disease of plants...

Chicken pox in pregnancy : an obstetric concern.

PubMed

Wiwanitkit, Viroj

2010-10-01

Chicken pox is a common viral infection presenting with fever and discrete vesicular lesions. This infection can be widely detected in developing countries, especially for those tropical countries. The pregnant can get chicken pox, and this becomes an important obstetrical concern. In this specific paper, the author hereby details and discusses on chicken pox in pregnancy. Clinical presentation, diagnosis, treatment, and prevention are briefly summarized. In addition, the effects of chicken pox on pregnancy as well as the vertical transmission are also documented.

CHICKEN POX IN PREGNANCY : AN OBSTETRIC CONCERN

PubMed Central

Wiwanitkit, Viroj

2010-01-01

Chicken pox is a common viral infection presenting with fever and discrete vesicular lesions. This infection can be widely detected in developing countries, especially for those tropical countries. The pregnant can get chicken pox, and this becomes an important obstetrical concern. In this specific paper, the author hereby details and discusses on chicken pox in pregnancy. Clinical presentation, diagnosis, treatment, and prevention are briefly summarized. In addition, the effects of chicken pox on pregnancy as well as the vertical transmission are also documented. PMID:21430880

Multi-fuel reformers for fuel cells used in transportation. Phase 1: Multi-fuel reformers

NASA Astrophysics Data System (ADS)

1994-05-01

DOE has established the goal, through the Fuel Cells in Transportation Program, of fostering the rapid development and commercialization of fuel cells as economic competitors for the internal combustion engine. Central to this goal is a safe feasible means of supplying hydrogen of the required purity to the vehicular fuel cell system. Two basic strategies are being considered: (1) on-board fuel processing whereby alternative fuels such as methanol, ethanol or natural gas stored on the vehicle undergo reformation and subsequent processing to produce hydrogen, and (2) on-board storage of pure hydrogen provided by stationary fuel processing plants. This report analyzes fuel processor technologies, types of fuel and fuel cell options for on-board reformation. As the Phase 1 of a multi-phased program to develop a prototype multi-fuel reformer system for a fuel cell powered vehicle, the objective of this program was to evaluate the feasibility of a multi-fuel reformer concept and to select a reforming technology for further development in the Phase 2 program, with the ultimate goal of integration with a DOE-designated fuel cell and vehicle configuration. The basic reformer processes examined in this study included catalytic steam reforming (SR), non-catalytic partial oxidation (POX) and catalytic partial oxidation (also known as Autothermal Reforming, or ATR). Fuels under consideration in this study included methanol, ethanol, and natural gas. A systematic evaluation of reforming technologies, fuels, and transportation fuel cell applications was conducted for the purpose of selecting a suitable multi-fuel processor for further development and demonstration in a transportation application.

Proline oxidase promotes tumor cell survival in hypoxic tumor microenvironments

PubMed Central

Liu, Wei; Glunde, Kristine; Bhujwalla, Zaver M.; Raman, Venu; Sharma, Anit; Phang, James M.

2012-01-01

Proline is a readily released stress substrate that can be metabolized by proline oxidase (POX) to generate either reactive oxygen species to induce apoptosis or autophagy or ATP during times of nutrient stress. However, the contribution of proline metabolism to tumorigenesis in hypoxic microenvironments has not been explored. In this study, we investigated the different functions of POX under hypoxia and glucose depletion. We found that hypoxia induced POX expression in cancer cells in vitro and that POX upregulation co-localized with hypoxic tissues in vivo. In addition, the combination of hypoxia and low-glucose showed additive effects on POX expression. Similar to conditions of low glucose, hypoxia-mediated POX induction was dependent on AMP-activated protein kinase (AMPK) activation, but was independent of HIF-1α and HIF-2α. Under low-glucose and combined low-glucose and hypoxic conditions, proline catabolized by POX was used preferentially for ATP production, whereas under hypoxia, POX mediated autophagic signaling for survival by generating ROS. Although the specific mechanism was different for hypoxia and glucose deprivation, POX consistently contributed to tumor cell survival under these conditions. Together, our findings offer new insights into the metabolic reprogramming of tumor cells present within a hostile microenvironment and suggest that proline metabolism is a potential target for cancer therapeutics. PMID:22609800

Seroprevalence of fowl pox antibody in indigenous chickens in jos north and South council areas of plateau state, Nigeria: implication for vector vaccine.

PubMed

Adebajo, Meseko Clement; Ademola, Shittu Ismail; Oluwaseun, Akinyede

2012-01-01

Fowl pox is a viral disease of domestic and wild birds. The large size of the genome makes it a useful vector for recombinant DNA technology. Although the disease has been described in both commercial and indigenous chickens in Nigeria, data are limited on seroprevalence in free range chickens. Such data are, however, important in the design and implementation of fowl pox virus vector vaccine. We surveyed current antibody status to fowl pox virus in free range chickens by testing 229 sera collected from 10 villages in Jos North and Jos South LGA of Plateau State Nigeria. Sera were analyzed by AGID against standard fowl pox antigen. Fifty-two of the 229 (23%) tested sera were positive for fowl pox virus antibody, and the log titre in all positive specimen was >2. Thirty (21%) and twenty-two (27%) of the samples from Jos South and Jos North, respectively, tested positive. This was, however, not statistically significant (P = 0.30). Generally the study showed a significant level of antibody to fowl pox virus in the study area. This observation may hinder effective use of fowl pox vectored viral vaccine. Fowl pox control is recommended to reduce natural burden of the disease.

Seroprevalence of Fowl Pox Antibody in Indigenous Chickens in Jos North and South Council Areas of Plateau State, Nigeria: Implication for Vector Vaccine

PubMed Central

Adebajo, Meseko Clement; Ademola, Shittu Ismail; Oluwaseun, Akinyede

2012-01-01

Fowl pox is a viral disease of domestic and wild birds. The large size of the genome makes it a useful vector for recombinant DNA technology. Although the disease has been described in both commercial and indigenous chickens in Nigeria, data are limited on seroprevalence in free range chickens. Such data are, however, important in the design and implementation of fowl pox virus vector vaccine. We surveyed current antibody status to fowl pox virus in free range chickens by testing 229 sera collected from 10 villages in Jos North and Jos South LGA of Plateau State Nigeria. Sera were analyzed by AGID against standard fowl pox antigen. Fifty-two of the 229 (23%) tested sera were positive for fowl pox virus antibody, and the log titre in all positive specimen was >2. Thirty (21%) and twenty-two (27%) of the samples from Jos South and Jos North, respectively, tested positive. This was, however, not statistically significant (P = 0.30). Generally the study showed a significant level of antibody to fowl pox virus in the study area. This observation may hinder effective use of fowl pox vectored viral vaccine. Fowl pox control is recommended to reduce natural burden of the disease. PMID:23762578

[Impact of universal vaccination against chicken pox in Navarre, 2006-2010].

PubMed

Cenoz, M García; Catalán, J Castilla; Zamarbide, F Irisarri; Berastegui, M Arriazu; Gurrea, A Barricarte

2011-01-01

In 2007 universal vaccination against chicken pox was introduced in the vaccine calendar of Navarre. The aim of this study is to evaluate the impact of this measure on the incidence of chicken pox in both the vaccinated cohorts (direct effect) and in the unvaccinated cohorts (indirect effect). Chicken pox is a disease of individualized compulsory notification. We analyzed the annual incidence by age groups between 2006 and 2010. Hospital admittances with chicken pox or complicated chicken pox as the principal diagnosis were taken from the minimum basic data set on hospital discharges for the years 2006 to 2009. The incidence of chicken pox has fallen by 93.0%, from 8.04 cases per 1,000 inhabitants in 2006 to 0.56 per 1,000 inhabitants in 2010 (p<0,0001). In children from 1 to 6 years (vaccinated cohorts), the incidence of chicken pox has fallen by 96.3%. In the cohorts vaccinated at 10 and 14 years, a fall of 93.6% can also be observed in children from 10 to 14 years, and of 85.0% in those of 15 to 19 years. In the unvaccinated age groups we can observe falls of 88.2% in children under one year, of 73.3% in those of 7 to 9 years, and of 84.6% in people over 20 years. In 2006 there were 25 hospital admissions due to chicken pox in Navarre and in 2009 this figure fell to 7. The rate of admissions fell by 71%. The introduction of universal chicken pox vaccination in Navarre has resulted in a rapid and very steep reduction of the incidence of chicken pox in both vaccinated and unvaccinated people.

The Different Physiological and Antioxidative Responses of Zucchini and Cucumber to Sewage Sludge Application.

PubMed

Wyrwicka, Anna; Urbaniak, Magdalena

2016-01-01

The present study investigates the effect of soil amended with sewage sludge on oxidative changes in zucchini and cucumber plants (Cucurbitaceae) and the consequent activation of their antioxidative systems and detoxification mechanisms. The plants were grown in pots containing soil amended with three concentrations of sewage sludge (1.8 g, 5.4 g and 10.8 g per pot), while controls were potted with vegetable soil. The activities of three antioxidative enzymes, ascorbate peroxidase (APx), catalase (CAT) and guaiacol peroxidase (POx), were assessed, as well as of the detoxifying enzyme S-glutathione transferase (GST). Lipid peroxidation was evaluated by measuring the extent of oxidative damage; α-tocopherol content, the main lipophilic antioxidant, was also measured. Visible symptoms of leaf blade damage after sewage sludge application occurred only on the zucchini plants. The zucchini and cucumber plants showed a range of enzymatic antioxidant responses to sewage sludge application. While APx and POx activities increased significantly with increasing sludge concentration in the zucchini plants, they decreased in the cucumber plants. Moreover, although the activity of these enzymes increased gradually with increasing doses of sewage sludge, these levels fell at the highest dose. An inverse relationship between peroxidases activity and CAT activity was observed in both investigated plant species. In contrast, although GST activity increased progressively with sludge concentration in both the zucchini and cucumber leaves, the increase in GST activity was greater in the zucchini plants, being visible at the lowest dose used. The results indicate that signs of sewage sludge toxicity were greater in zucchini than cucumber, and its defense reactions were mainly associated with increases in APx, POx and GST activity.

The Different Physiological and Antioxidative Responses of Zucchini and Cucumber to Sewage Sludge Application

PubMed Central

Wyrwicka, Anna; Urbaniak, Magdalena

2016-01-01

The present study investigates the effect of soil amended with sewage sludge on oxidative changes in zucchini and cucumber plants (Cucurbitaceae) and the consequent activation of their antioxidative systems and detoxification mechanisms. The plants were grown in pots containing soil amended with three concentrations of sewage sludge (1.8 g, 5.4 g and 10.8 g per pot), while controls were potted with vegetable soil. The activities of three antioxidative enzymes, ascorbate peroxidase (APx), catalase (CAT) and guaiacol peroxidase (POx), were assessed, as well as of the detoxifying enzyme S-glutathione transferase (GST). Lipid peroxidation was evaluated by measuring the extent of oxidative damage; α-tocopherol content, the main lipophilic antioxidant, was also measured. Visible symptoms of leaf blade damage after sewage sludge application occurred only on the zucchini plants. The zucchini and cucumber plants showed a range of enzymatic antioxidant responses to sewage sludge application. While APx and POx activities increased significantly with increasing sludge concentration in the zucchini plants, they decreased in the cucumber plants. Moreover, although the activity of these enzymes increased gradually with increasing doses of sewage sludge, these levels fell at the highest dose. An inverse relationship between peroxidases activity and CAT activity was observed in both investigated plant species. In contrast, although GST activity increased progressively with sludge concentration in both the zucchini and cucumber leaves, the increase in GST activity was greater in the zucchini plants, being visible at the lowest dose used. The results indicate that signs of sewage sludge toxicity were greater in zucchini than cucumber, and its defense reactions were mainly associated with increases in APx, POx and GST activity. PMID:27327659

A POX on Renal Cancer Cells | Center for Cancer Research

Cancer.gov

Proline oxidase, or POX, is an enzyme responsible for metabolizing the amino acid proline. POX contributes to the regulation of cell death that occurs when cellular systems malfunction, a process called apoptosis. Previous studies have determined that levels of POX are reduced in several types of human cancer. Likewise, many cancer cells become resistant to apoptosis,

Loop-mediated isothermal amplification assay for rapid and sensitive detection of sheep pox and goat pox viruses in clinical samples.

PubMed

Venkatesan, G; Balamurugan, V; Bhanuprakash, V; Singh, R K; Pandey, A B

2016-06-01

A Loop-mediated isothermal amplification (LAMP) assay targeting the highly conserved DNA polymerase gene of capripox virus genome was developed and evaluated for rapid detection of sheep pox and goat pox viruses. The optimized LAMP assay is found specific and sensitive for amplification of target DNA with a diagnostic sensitivity and specificity of 96.6% and 100% respectively compared to quantitative PCR. The detection rate of LAMP, PCR and Q-PCR assays is found to be 81.5%, 67% and 83% respectively. This LAMP assay has the potential for rapid clinical diagnosis and surveillance of sheep pox and goat pox in field diagnostic laboratories. Copyright © 2016 Elsevier Ltd. All rights reserved.

Initial reactive sticking coefficient of O 2 on Si(111)-7 × 7 at elevated temperatures

NASA Astrophysics Data System (ADS)

Shklyaev, A. A.; Suzuki, Takanori

1996-05-01

Kinetics of the initial stage of oxide growth in the reaction of oxygen with Si(111)-7 × 7 at temperatures from room temperature to Ttr, and pressures from 5 × 10 -9 to 2 × 10 -7 Torr are investigated with optical second-harmonic generation, here temperature from oxide growth to Si etching without oxide growth. At a fixed pressure, the initial reactive sticking coefficient ( S0), obtained from the rate of oxide growth, decreases with increasing temperature to S0=0 at Ttr. We have found that the initial reacti sticking coefficient depends on the O 2 pressure. At temperatures above 320°C, the whole temperature dependence of S0 is situated in the region of higher temperatures for higher O 2 pressures ( Pox). Moreover, an additional bend in the temperature dependence of S0 is observed for Pox>1 × 10 -8 Torr near Ttr. A precursor-mediated adsorption model involving the reaction of formation is considered. The parameters of this model, obtained from the best fits to the experimental data, show that oxide growth rate constant increases and volatile SiO formation rate constant decreases as a function of O 2 pressure. At zero oxide coverage, the pressure dependence of the reaction rate constants is suggested to originate from interaction in the layer of the chemisorbed precursor species, whose coverage depends on the O 2 pressure. The volatile SiO formation is described by a three-step sequential two-channel process through the chemisorbed O 2 precursor species, whereas one of the channels with a larger activation energy is suggested to induce the additional bend in S0( T) near Ttr at higher O 2 pressures.

Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus mutans

PubMed Central

Liu, Lei

2012-01-01

Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002

[EFFECTIVENESS OF PREVENTIVE VACCINE PROPHYLAXIS OF CHICKEN POX IN MILITARY COLLECTIVES].

PubMed

Dubodelov, D V; Rybin, V V; Rikhter, V V; Yaroslavtsev, V V; Gritsik, A A; Kazanova, A S; Lavrov, V F; Semenenko, T A; Kuzin, S N

2015-01-01

Study the effectiveness of preventive vaccine prophylaxis of chicken pox in military collectives. In the focus of chicken pox, 200 servicemen of the new addition by conscription were immunized once against chicken pox; 97 servicemen by conscription of the new addition (comparison group) were not vaccinated. Epidemiologic and immunologic effectiveness of conduction of preventive vaccine prophylaxis in chicken pox focus were studied. In the group of 200 soldiers, that were present in the focus of infection and were immunized once against chicken pox, only 2 cases of this disease were registered (10 per thousand). In the comparison group, that consisted of 97 unvaccinated servicemen, chicken pox disease was registered in 7 individuals (72 per thousand). Epidemiologic effectiveness of preventive vaccine prophylaxis of chicken pox amounted to 86%. Immunologic effectiveness of vaccination 2-3 weeks after the immunization was 42%, and 2 months after--44%. Local reactions in the form of hyperemia (up to 1.5 cm) and edema were noted in 10% of the vaccinated at the location of preparation administration; in 1.7%--general reaction in the form of temperature increase to 37.8°C was observed. Post-vaccinal complications in the immunized group were not detected. Preventive vaccination of servicemen allows to minimize the spread of chicken pox, however can not serve as means of complete elimination of the infection from military collectives.

40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

Interpersonal Tension: A Two-Factor Approach to the POX Situation.

ERIC Educational Resources Information Center

Gupta, Mahesh

1985-01-01

A theoretical explanation, in terms of a two-factor approach to a Person-Other-Issue (POX) Situation is offered, in an attempt to fill the void that exists in the face of the Heider-Newcomb controversy about POX balance. Validity and parsimony is demonstrated by applying it to some of the POX data reported in earlier studies. (Author/BL)

Effect of yoga exercise therapy on oxidative stress indicators with end-stage renal disease on hemodialysis

PubMed Central

Gordon, Lorenzo; McGrowder, Donovan A; Pena, Yeiny T; Cabrera, Elsa; Lawrence-Wright, Marilyn B

2013-01-01

Background: Oxidative stress promotes endothelial dysfunction and atherosclerosis in chronic renal disease. Objectives: This study investigated the impact of Hatha yoga on oxidative stress indicators and oxidant status, in patients with end-stage renal disease (ESRD) on hemodialysis. Design: This prospective randomized study consisted of 33 ESRD patients in the Hatha yoga exercise group who were matched with 35 ESRD patients in the control group. Outcome Measures: The oxidative stress indicators (malondialdehyde - MDA, protein oxidation - POX, phospholipase A2 - PLA2 activity) and the oxidative status (superoxide dismutase (SOD) and catalase activities) were determined in the blood samples taken at the pre-hemodialysis treatment, at baseline (0 months) and after four months. Results: In patients in the Hatha yoga exercise group, lipid peroxidation, as indicated by MDA decreased by 4.0% after four months (P = 0.096). There was also a significant reduction in the activity of PLA from 2.68 ± 0.02 IU / L to 2.34 IU / L (− 12.7%; P = 0.010) and POX from 2.28 ± 0.02 nmol / mg to 2.22 ± 0.01 nmol / mg (− 22.6%; P = 0.0001). The activity of SOD significantly increased from 12.91 ± 0.17 U / L to 13.54 ± 0.15 U / L (4.65%; P = 0.0001) and catalase from 79.83 ± 0.63 U / L to 80.54 ± 0.80 U / L (0.90%; P = 0.0001). There was a significant correlation between the pre-hemodialysis oxidative stress parameters at the zero month and after four months for the activities of PLA (r = 0.440), catalase (r = 0.872), and SOD (r = 0.775). Conclusions: These findings suggest that the Hatha yoga exercise has therapeutic, preventative, and protective effects in ESRD subjects, by decreasing oxidative stress. PMID:23440311

Comparison of content in phenolic compounds, polyphenol oxidase, and peroxidase in grains of fifty sorghum varieties from burkina faso.

PubMed

Dicko, Mamoudou H; Hilhorst, Riet; Gruppen, Harry; Traore, Alfred S; Laane, Colja; van Berkel, Willem J H; Voragen, Alphons G J

2002-06-19

Analysis of fifty sorghum [Sorghum bicolor (L.) Moench] varieties used in Burkina Faso showed that they have different contents of phenolic compounds, peroxidase (POX), and polyphenol oxidase (PPO). Most of the varieties (82%) had a tannin content less than 0.25% (w/w). POX specific activity was higher than the monophenolase and o-diphenolase specific activities of PPO. For POX, there was a diversity of isoforms among varieties. No clear correlation could be made between the quantitative composition of the grain in phenolics, PPO, and POX, and resistance of plant to pathogens. In general, varieties good for a thick porridge preparation ("tô") had low phenolic compounds content and a medium POX activity. From the red varieties, those used for local beer ("dolo") had a high content in phenolic compounds and PPO, and a low POX activity. The variety considered good for couscous had a low POX content. The characteristics might be useful as selection markers for breeding for specific applications.

A method for aircraft afterburner combustion without flameholders

NASA Astrophysics Data System (ADS)

Birmaher, Shai

2009-12-01

State of the art aircraft afterburners employ spray bars to inject fuel and flameholders to stabilize the combustion process. Such afterburner designs significantly increase the length (and thus weight), pressure losses, and observability of the engine. This thesis presents a feasibility study of a compact 'prime and trigger' (PAT) afterburner concept that eliminates the fuel spray bars and flameholders and, thus, eliminates the above-mentioned problems. In this concept, afterburner fuel is injected just upstream or in between the turbine stages. As the fuel travels through the turbine stages, it evaporates, mixes with the bulk flow, and undergoes some chemical reactions without any significant heat release, a process referred to as 'priming'. Downstream of the turbine stages, combustion could take place through autoignition. However, if fuel autoignition does not occur or if autoignition does not produce a combustion zone that is stable and highly efficient, then a low power pilot, or 'trigger', can be used to control the combustion process. The envisioned trigger for the PAT concept is a jet of product gas from ultra-rich hydrocarbon/air combustion that is injected through the afterburner liner. This 'partial oxidation' (POx) gas, which consists mostly of H2, CO, and diluents, rapidly produces radicals and heat that accelerate the autoignition of the primed mixture and, thus, provide an anchor point for the afterburner combustion process. The objective of this research was to demonstrate the feasibility of the PAT concept by showing that (1) combustion of fuel injected within or upstream of turbine stages can occur only downstream of the turbine stages, and (2) the combustion zone is compact, stable and efficient. This was accomplished using two experimental facilities, a developed theoretical model, and Chemkin simulations. The first facility, termed the Afterburner Facility (AF), simulated the bulk flow temperature, velocity and O2 content through a turbojet combustor, turbine stage and afterburner. To model the PAT concept, Jet-A was injected upstream of the simulated turbine stage and a H2 jet was used to trigger the primed Jet-A combustion process downstream of the turbine stage. H2 was used because POx gas was not available for experiments. The second facility, termed the Propane Autoignition Combustor (PAC), was essentially a scaled-down, simplified version of the AF. The PAC experiments focused on the trigger stage of the PAT concept, using H 2 in lieu of POx gas and employing measurement techniques that were in some ways more detailed than in the AF experiments. The developed model simulated the physics of fuel priming in the AF and predicted the Jet-A autoignition location. It was used to predict and interpret the AF results and to study the feasibility of the PAT concept at pressures outside the AF operating range. Finally, the Chemkin simulations were used to examine the effect of several POx gas compositions on the Jet-A/vitiated-air autoignition process; to compare the POx and H2 triggers; and to explore several reasons for why POx gas and H2 are suitable trigger mechanisms. he experimental, theoretical, and numerical results obtained in this investigation indicated that the PAT concept provides a feasible approach to afterburner combustion. The experiments in the AF showed that the ignition delay of Jet-A is sufficiently long to allow fuel injection within turbine stages without significant heat release upstream of the afterburner. In the AF experiments without the H2 trigger, Jet-A combustion was achieved through autoignition; however, the autoignition combustion zone exhibited large axial fluctuations and low combustion efficiency. The H2 trigger was able to shift the combustion zone upstream, make it more compact, reduce fluctuations in its axial position, and raise the combustion efficiency to nearly 100%. The PAC experiments also showed that a H2 trigger can shift the combustion zone upstream, make it more compact, and increase the combustion efficiency. The PAC results were obtained with lower O 2 content and higher equivalence ratios than in the AF. Therefore, the combined AF and PAC results suggested that the PAT concept is feasible over a wide range of operating conditions. The developed model showed good agreement with the AF results. It also predicted that the PAT concept is feasible at bulk flow pressures outside the AF operating range. Finally, the Chemkin results showed that both the H2 and POx gas triggers can significantly reduce the ignition delay time of primed Jet-A/vitiated air mixtures. Thus, POx gas is a suitable trigger for the PAT concept and should be tested in future experimental investigations.

Emergence of a Novel Avian Pox Disease in British Tit Species

PubMed Central

Lawson, Becki; Lachish, Shelly; Colvile, Katie M.; Durrant, Chris; Peck, Kirsi M.; Toms, Mike P.; Sheldon, Ben C.; Cunningham, Andrew A.

2012-01-01

Avian pox is a viral disease with a wide host range. In Great Britain, avian pox in birds of the Paridae family was first diagnosed in a great tit (Parus major) from south-east England in 2006. An increasing number of avian pox incidents in Paridae have been reported each year since, indicative of an emergent infection. Here, we utilise a database of opportunistic reports of garden bird mortality and morbidity to analyse spatial and temporal patterns of suspected avian pox throughout Great Britain, 2006–2010. Reports of affected Paridae (211 incidents) outnumbered reports in non-Paridae (91 incidents). The majority (90%) of Paridae incidents involved great tits. Paridae pox incidents were more likely to involve multiple individuals (77.3%) than were incidents in non-Paridae hosts (31.9%). Unlike the small wart-like lesions usually seen in non-Paridae with avian pox in Great Britain, lesions in Paridae were frequently large, often with an ulcerated surface and caseous core. Spatial analyses revealed strong clustering of suspected avian pox incidents involving Paridae hosts, but only weak, inconsistent clustering of incidents involving non-Paridae hosts. There was no spatial association between Paridae and non-Paridae incidents. We documented significant spatial spread of Paridae pox from an origin in south-east England; no spatial spread was evident for non-Paridae pox. For both host clades, there was an annual peak of reports in August/September. Sequencing of the avian poxvirus 4b core protein produced an identical viral sequence from each of 20 great tits tested from Great Britain. This sequence was identical to that from great tits from central Europe and Scandinavia. In contrast, sequence variation was evident amongst virus tested from 17 non-Paridae hosts of 5 species. Our findings show Paridae pox to be an emerging infectious disease in wild birds in Great Britain, apparently originating from viral incursion from central Europe or Scandinavia. PMID:23185231

Emergence of a novel avian pox disease in British tit species.

PubMed

Lawson, Becki; Lachish, Shelly; Colvile, Katie M; Durrant, Chris; Peck, Kirsi M; Toms, Mike P; Sheldon, Ben C; Cunningham, Andrew A

2012-01-01

Avian pox is a viral disease with a wide host range. In Great Britain, avian pox in birds of the Paridae family was first diagnosed in a great tit (Parus major) from south-east England in 2006. An increasing number of avian pox incidents in Paridae have been reported each year since, indicative of an emergent infection. Here, we utilise a database of opportunistic reports of garden bird mortality and morbidity to analyse spatial and temporal patterns of suspected avian pox throughout Great Britain, 2006-2010. Reports of affected Paridae (211 incidents) outnumbered reports in non-Paridae (91 incidents). The majority (90%) of Paridae incidents involved great tits. Paridae pox incidents were more likely to involve multiple individuals (77.3%) than were incidents in non-Paridae hosts (31.9%). Unlike the small wart-like lesions usually seen in non-Paridae with avian pox in Great Britain, lesions in Paridae were frequently large, often with an ulcerated surface and caseous core. Spatial analyses revealed strong clustering of suspected avian pox incidents involving Paridae hosts, but only weak, inconsistent clustering of incidents involving non-Paridae hosts. There was no spatial association between Paridae and non-Paridae incidents. We documented significant spatial spread of Paridae pox from an origin in south-east England; no spatial spread was evident for non-Paridae pox. For both host clades, there was an annual peak of reports in August/September. Sequencing of the avian poxvirus 4b core protein produced an identical viral sequence from each of 20 great tits tested from Great Britain. This sequence was identical to that from great tits from central Europe and Scandinavia. In contrast, sequence variation was evident amongst virus tested from 17 non-Paridae hosts of 5 species. Our findings show Paridae pox to be an emerging infectious disease in wild birds in Great Britain, apparently originating from viral incursion from central Europe or Scandinavia.

From backwater to mainstream

USGS Publications Warehouse

Allen, J.A.

1993-01-01

Pox infection has occurrcd in mourning doves in at least 8 states on 12 separate occasions. Unsuccessful attempts were made to transmit both fowl pox (chicken isolate) and passerine pox (cowbird isolate) to mourning doves.

Evaluation of Cytology for Diagnosing Avian Pox in Wild Turkeys ( Meleagris gallopavo).

PubMed

Hydock, Kira; Brown, Holly; Nemeth, Nicole; Poulson, Rebecca; Casalena, Mary Jo; Johnson, Joshua B; Brown, Justin

2018-03-01

Avian pox virus is a common cause of proliferative skin disease in wild turkeys ( Meleagris gallopavo); however, other etiologies may produce grossly indistinguishable lesions. Common methods for diagnosing avian pox include histopathology, virus isolation, and PCR. While these methods are sufficient in most cases, each has their limitations. Cytology is a cost-effective and rapid approach that may be useful when traditional diagnostics are not feasible. The objective of this study was to evaluate the performance of cytology relative to histopathology and PCR for avian pox diagnosis in wild turkeys. Fifty wild turkeys were submitted for necropsy due to nodular skin lesions on unfeathered skin of the head. Of these, five had similar skin lesions on the unfeathered legs and 26 had plaques on the mucosa of the oropharynx or esophagus. Representative skin, oropharyngeal, and esophageal lesions from all birds were examined with cytology and histopathology. Skin lesions on the head of each bird were also tested for avian pox virus via PCR. Histopathology and PCR were equally sensitive in diagnosing avian pox from skin lesions on the head. There were no significant differences between cytologic and histopathologic diagnosis of avian pox from skin lesions on the head (sensitivity = 97.4%, specificity = 100.0%), legs (sensitivity = 75.0%, specificity = 100.0%), or from lesions in the oropharynx and esophagus (sensitivity of 62.5%). Similarly, there were no significant differences between PCR and cytology for diagnosis of pox viral skin lesions of the head. Relative to PCR detection of avian pox virus, cytology had a sensitivity of 90.0% and a specificity of 90.0%. These results suggest that cytology is a useful tool for diagnosis of avian pox in wild turkeys.

Squamous cell carcinoma-like and pox lesions occurring simultaneously in chorioallantoic membranes of chicken embryos inoculated with materials from squamous cell carcinoma and pox lesions in broiler chickens.

PubMed

Fallavena, L C; Rodrigues, N C; Moraes, H L; Salle, C T; da Silva, A B; Nascimento, V P; Rodrigues, O

1997-01-01

The finding of closely associated squamous cell carcinoma (SCC)-like lesions and pox lesions in chorioallantoic membranes (CAMs) inoculated with skin and palate samples taken from broilers is described. The samples were obtained from two broilers coming from different flocks that were not vaccinated against fowl pox. Both birds presented skin lesions, which were diagnosed in one bird as fowl pox, and in the other as SCC. After inoculation of CAMs with fresh tissues from both birds, histologic examination revealed, in all CAMs, lesions that were characteristic of fowl pox together with lesions consistent with those seen in the skin of broilers affected with SCC. This finding was unexpected and may shed some light on the etiology of SCC.

Sub-chronic exposure to paraoxon neither induces nor exacerbates diabetes mellitus in Wistar rat.

PubMed

Nurulain, Syed M; Petroianu, Georg; Shafiullah, Mohamed; Kalász, Huba; Oz, Murat; Saeed, Tariq; Adem, Abdu; Adeghate, Ernest

2013-10-01

There is an increasing belief that organophosphorus compounds (OPCs) impair glucose homeostasis and cause hyperglycemia and diabetes mellitus. The present study was undertaken to investigate the putative diabetogenic effect of sub-lethal and sub-chronic exposure to paraoxon (POX), an extremely hazardous OPC used in pesticides. The effect of paraoxon on streptozotocin-induced diabetic rats was also examined. Each rat was injected with 100 nmol of POX 5 days per week for 6 weeks. Blood glucose levels and red blood cell acetylcholinesterase activity were measured weekly. Biochemical analysis and morphological studies were performed at the end of the experiment. The results revealed that POX neither induces nor exacerbates diabetes mellitus in experimental rats. Liver and kidney/body weight ratios revealed statistically insignificant differences when compared with controls. Biochemical analysis of urine samples showed a small but not significant increase in protein level in all groups. Urine bilirubin was significantly higher in the diabetes + POX group when compared with the control group. The number of blood cells in urine was significantly higher in the POX-treated group compared with the control group. Hyperglycemia was noted in the diabetes and diabetes + POX groups, but neither in the saline control nor in POX-treated normal rats. Electron microscopy of POX-treated pancreas did not show any morphological changes in beta cells. These results suggest that POX does not cause diabetes mellitus at sub-lethal sub-chronic exposure. Copyright © 2012 John Wiley & Sons, Ltd.

Prey: Thamnophis hammondii (Two-striped Garter Snake)

USGS Publications Warehouse

Ervin, E.L.; Fisher, R.N.

2001-01-01

Pox infection has occurrcd in mourning doves in at least 8 states on 12 separate occasions. Unsuccessful attempts were made to transmit both fowl pox (chicken isolate) and passerine pox (cowbird isolate) to mourning doves.

Molecular detection of avian pox virus from nodular skin and mucosal fibrinonecrotic lesions of Iranian backyard poultry.

PubMed

Gholami-Ahangaran, Majid; Zia-Jahromi, Noosha; Namjoo, Abdolrasul

2014-02-01

In recent years, some outbreaks of skin lesions suspected to be avian pox were observed in the backyard poultry in different parts of western areas in Iran. Consequently, 328 backyard poultries with suspected signs of avian pox virus infection were sampled. All birds showed nodular lesions on unfeathered head skin and/or fibronecrotic lesions on mucus membrane of the oral cavity and upper respiratory tract. For histopathological analysis, the sections of tissue samples from cutaneous lesions of examined birds were stained with H&E method. For PCR, after DNA extraction a 578-bp fragment of avian pox virus from 4b core protein gene was amplified. Results showed 217 and 265 out of 328 (66.1 and 80.7%, respectively) samples were positive for avian pox virus on histopathological and PCR examination, respectively. In this study, the samples that had intracytoplasmic inclusion bodies on pathologic examination were PCR positive. This study revealed that PCR is a valuable tool for identification of an avian pox virus and that the frequency of pox infection in backyard poultry in western areas of Iran is high.

Biological Warfare Improved Response Program (BW-IRP) CDC/DoD Smallpox Workshop

DTIC Science & Technology

2005-01-01

national surveillance effort. Awareness of unique symptoms will need to be raised by training clinicians. For example, adults presenting with chicken pox ...no case definitions but rather visual recognition cards. Presently, the chicken pox definition has been modified to create a smallpox definition. The...the last 2 weeks • Pharmaceuticals prescribed or issued for chicken pox • A number of suspected cases of chicken pox • Reports of rashes, especially a

Avian pox in Magellanic Penguins (Spheniscus magellanicus).

PubMed

Kane, Olivia J; Uhart, Marcela M; Rago, Virginia; Pereda, Ariel J; Smith, Jeffrey R; Van Buren, Amy; Clark, J Alan; Boersma, P Dee

2012-07-01

Avian pox is an enveloped double-stranded DNA virus that is mechanically transmitted via arthropod vectors or mucosal membrane contact with infectious particles or birds. Magellanic Penguins (Spheniscus magellanicus) from two colonies (Punta Tombo and Cabo Dos Bahías) in Argentina showed sporadic, nonepidemic signs of avian pox during five and two of 29 breeding seasons (1982-2010), respectively. In Magellanic Penguins, avian pox expresses externally as wart-like lesions around the beak, flippers, cloaca, feet, and eyes. Fleas (Parapsyllus longicornis) are the most likely arthropod vectors at these colonies. Three chicks with cutaneous pox-like lesions were positive for Avipoxvirus and revealed phylogenetic proximity with an Avipoxvirus found in Black-browed Albatross (Thalassarche melanophrys) from the Falkland Islands in 1987. This proximity suggests a long-term circulation of seabird Avipoxviruses in the southwest Atlantic. Avian pox outbreaks in these colonies primarily affected chicks, often resulted in death, and were not associated with handling, rainfall, or temperature.

The role of nitric oxide in basal and induced resistance in relation with hydrogen peroxide and antioxidant enzymes.

PubMed

Keshavarz-Tohid, Vahid; Taheri, Parissa; Taghavi, Seyed Mohsen; Tarighi, Saeed

2016-07-20

Nitric oxide (NO) is one of the main signal molecules, which is involved in plant growth and development and can change regular physiological activity in biotic and abiotic stresses. In this study, the role of NO in induced resistance with Pseudomonas fluorescent (CHA0) and basal resistance against Rhizoctonia solani in bean plant was investigated. Our results revealed that P. fluorescent and R. solani can increase NO production at 6h post inoculation (hpi). Also, using the NO donor S-nitroso-N-acetyl D-penicillamine (SNAP) led to increase NO and bean plant resistance against R. solani. Utilizing the NO scavenger, 2-(4-carboxyphenyl)-4,4,5,5-tetramethy-limidazoline-1-oxyl-3-oxide (cPTIO), not only decreased basal resistance but also reduced induced resistance. In continue, the activity of antioxidant enzymes was studied in the former treatments. SNAP, CHA0 and R. solani increased the activity of peroxidase (POX), catalase (CAT) and ascorbate peroxidase (APX) at 6, 12 and 24h post inoculation (hpi). In contrast, using cPTIO and R. solani simultaneously (cPTIO+R) showed reduction in activity of POX and APX at 6 hpi. The cPTIO+R treatment increased POX, APX and CAT activity at 12 and 24 hpi. Hydrogen peroxide (H 2 O 2 ) monitoring in the leaf discs clarified that SNAP can increase H 2 O 2 production like CHA0 and R. solani. On the other hand, SNAP increased the resistance level of leaf discs against R. solani. Treating the leaf discs with cPTIO led to decrease resistance against the pathogen. These leaf discs showed reduction in H 2 O 2 production at 6 hpi and suddenly enhanced H 2 O 2 generation was observed at 24hpi. This study showed that CHA0 can increase NO level in bean plants. NO induced H 2 O 2 generation and regulated redox state of the host plant. This interaction resulted in significant defense against the pathogen. Copyright © 2016 Elsevier GmbH. All rights reserved.

Chromatographic analysis of toxic phosphylated oximes (POX): a brief overview.

PubMed

Becker, Christian; Worek, Franz; John, Harald

2010-10-01

Poisoning with organophosphorus compounds (OP), e.g. pesticides and nerve agents, causes inhibition of acetylcholinesterase (AChE) by phosphylation of the active site serine residue. Consequently, accumulation of stimulating acetylcholine in the synaptic cleft induces cholinergic crisis which ultimately may lead to death. For standard causal therapy, enzyme reactivators are administered representing oxime derivatives of quarternary pyridinium compounds, e.g. pralidoxime (2-PAM), obidoxime and HI 6. The mechanism of action includes removal of the phosphyl moiety by a nucleophilic attack of the oximate molecule substituting the enzyme and forming a phosphylated oxime (POX). POX is produced in stoichiometric amounts of reactivated enzyme and exhibits a significantly enhanced toxicity (inhibition rate constant) when compared to the parent OP. However, stability of POX under physiological conditions appears to be highly limited. Nevertheless, the presence of POX reveals a potential critical issue for both therapeutic efficacy in vivo and pharmacokinetic and pharmacodynamic (PK-PD) modelling based on cholinesterase activity data. Detailed characterization represents an important need for elaboration of the entire oxime pharmacology.Nevertheless, reports on POX toxicity and analysis are quite rare and may therefore be indicative of the challenge of POX analysis. This review provides a concise overview of chromatographic approaches applied to POX separation. Chromatography represents the key technology for POX purification and quantification in kinetic in vitro studies using buffers and biological fluids. Applications based on reversed-phase chromatography (RPC), ion pair chromatography (IPC) and an affinity approach as well as thin layer chromatography (TLC) are discussed and novel applications and data are presented. Copyright © 2010 John Wiley & Sons, Ltd.

Identification and phylogenetic analysis of a sheep pox virus isolated from the Ningxia Hui Autonomous Region of China.

PubMed

Zhu, X L; Yang, F; Li, H X; Dou, Y X; Meng, X L; Li, H; Luo, X N; Cai, X P

2013-05-14

An outbreak of sheep pox was investigated in the Ningxia Hui Autonomous Region in China. Through immunofluorescence testing, isolated viruses, polymerase chain reaction identification, and electron microscopic examination, the isolated strain was identified as a sheep pox virus. The virus was identified through sequence and phylogenetic analysis of the P32 gene, open reading frame (ORF) 095, and ORF 103 genes. This study is the first to use the ORF 095 and ORF 103 genes as candidate genes for the analysis of sheep pox. The results showed that the ORF 095 and ORF 103 genes could be used for the genotyping of the sheep pox virus.

Polyacetal Carboxylic Acids: a New Group of Antiviral Polyanions

PubMed Central

Claes, P.; Billiau, A.; De Clercq, E.; Desmyter, J.; Schonne, E.; Vanderhaeghe, H.; De Somer, P.

1970-01-01

Chlorite-oxidized oxypolysaccharides are polyacetal carboxylic acids. They inhibited the cytopathic effect of vesicular stomatitis virus in mouse embryo cell cultures challenged at low input multiplicity. After intraperitoneal injection of these compounds in mice, interferon appeared in the circulation. The compounds also protected mice against lethal mengovirus infection and against the development of experimental pox lesions on the tail. Chlorite-oxidized oxyamylose was antiviral only when at least 64% of the glucopyranose units were oxidized, an observation which suggested a correlation between charge density and antiviral effect. The antiviral activity was also influenced by the molecular weight, as demonstrated by the fact that chlorite-oxidized dextrans which had a high intrinsic viscosity were more active than those with low intrinsic viscosity. PMID:4314553

Troglitazone induced apoptosis via PPARγ activated POX-induced ROS formation in HT29 cells.

PubMed

Wang, Jing; Lv, XiaoWen; Shi, JiePing; Hu, XiaoSong; DU, YuGuo

2011-08-01

In order to investigate the potential mechanisms in troglitazone-induced apoptosis in HT29 cells, the effects of PPARγ and POX-induced ROS were explored. [3- (4, 5)-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide (MTT) assay, Annexin V and PI staining using FACS, plasmid transfection, ROS formation detected by DCFH staining, RNA interference, RT-PCR & RT-QPCR, and Western blotting analyses were employed to investigate the apoptotic effect of troglitazone and the potential role of PPARγ pathway and POX-induced ROS formation in HT29 cells. Troglitazone was found to inhibit the growth of HT29 cells by induction of apoptosis. During this process, mitochondria related pathways including ROS formation, POX expression and cytochrome c release increased, which were inhibited by pretreatment with GW9662, a specific antagonist of PPARγ. These results illustrated that POX upregulation and ROS formation in apoptosis induced by troglitazone was modulated in PPARγ-dependent pattern. Furthermore, the inhibition of ROS and apoptosis after POX siRNA used in troglitazone-treated HT29 cells indicated that POX be essential in the ROS formation and PPARγ-dependent apoptosis induced by troglitazone. The findings from this study showed that troglitazone-induced apoptosis was mediated by POX-induced ROS formation, at least partly, via PPARγ activation. Copyright © 2011 The Editorial Board of Biomedical and Environmental Sciences. Published by Elsevier B.V. All rights reserved.

Paraoxon induces apoptosis in EL4 cells via activation of mitochondrial pathways.

PubMed

Saleh, A M; Vijayasarathy, C; Masoud, L; Kumar, L; Shahin, A; Kambal, A

2003-07-01

The toxicity of organophosphorus compounds, such as paraoxon (POX), is due to their anticholinesterase action. Recently, we have shown that, at noncholinergic doses (1 to 10 nM), POX (the bioactive metabolite of parathion) causes apoptotic cell death in murine EL4 T-lymphocytic leukemia cell line through activation of caspase-3. In this study, by employing caspase-specific inhibitors, we extend our observations to elucidate the sequence of events involved in POX-stimulated apoptosis. Pretreatment of EL4 cells with the caspase-9-specific inhibitor zLEHD-fmk attenuated POX-induced apoptosis in a dose-dependent manner, whereas the caspase-8 inhibitor zIETD-fmk had no effect. Furthermore, the activation of caspase-9, -8, and -3 in response to POX treatment was completely inhibited in the presence of zLEHD-fmk, implicating the involvement of caspase 9-dependent mitochondrial pathways in POX-stimulated apoptosis. Indeed, under both in vitro and in vivo conditions, POX triggered a dose- and time-dependent translocation of cytochrome c from mitochondria into the cytosol, as assessed by Western blot analysis. Investigation of the mechanism of cytochrome c release revealed that POX disrupted mitochondrial transmembrane potential. Neither this effect nor cytchrome c release was dependent on caspase activation, since the general inhibitor of the caspase family zVAD-fmk did not influence both processes. Finally, POX treatment also resulted in a time-dependent up-regulation and translocation of the proapoptotic molecule Bax to mitochondria. Inhibition of this event by zVAD-fmk suggests that the activation and translocation of Bax to mitochondria is subsequent to activation of the caspase cascades. The results indicate that POX induces apoptosis in EL4 cells through a direct effect on mitochondria by disrupting its transmembrane potential, causing the release of cytochrome c into the cytosol and subsequent activation of caspase-9. Inhibition of this specific pathway might provide a useful strategy to minimize organophosphate-induced poisoning.

Recombinant sheep pox virus proteins elicit neutralizing antibodies

USDA-ARS?s Scientific Manuscript database

The aim of this study was to evaluate the immunogenicity and neutralizing activity of bacterially-expressed sheep pox virus (SPPV) structural proteins as candidate subunit vaccines to control sheep pox disease. SPPV structural proteins were identified by sequence homology with proteins from vaccinia...

Acute pancreatitis: rare complication of chicken pox in an immunocompetent host.

PubMed

Kumar, Sunil; Jain, A P; Pandit, A K

2007-01-01

Chicken pox is a highly contagious infection, caused by the varicella zoster virus. Although generally a benign, self-limited disease, varicella may be associated with serious complications especially in adults. We present acute pancreatitis- a rare complication, in otherwise healthy patients suffering from chicken pox. The presence of pancreatitis in association with chickenpox in immunocompetent patients can influence the outcome of the latter. This interesting case will hopefully increase awareness about this complication and its fatality in chicken pox.

Biodegradable poly(vinyl alcohol)/polyoxalate electrospun nanofibers for hydrogen peroxide-triggered drug release.

PubMed

Phromviyo, Nutthakritta; Lert-Itthiporn, Aurachat; Swatsitang, Ekaphan; Chompoosor, Apiwat

2015-01-01

Release of drugs in a controlled and sustainable manner is of great interest for treating some inflammatory diseases, drug delivery, and cosmetics. In this work, we demonstrated the control release of a drug from composite nanofibers mediated by hydrogen peroxide. Composite nanofibers of polyvinyl alcohol (PVA)/polyoxalate (PVA/POX NFs) blended at various weight ratios were successfully prepared by electrospinning. Rhodamine B (RB) was used as a model of drug and was initially loaded into the POX portion. The morphology of NFs was characterized using scanning electron microscopy (SEM). The functional groups presented in the NFs were characterized using IR spectroscopy. In vitro release behavior and cell toxicity of nanofibers were also investigated using the MTT assay. The results indicated that POX content had a significant effect on the size and release profiles of nanofibers. Microstructure analysis revealed that sizes of PVA/POX NFs increased with increasing POX content, ranging from 214 to 422 nm. Release profiles of RB at 37 °C were non-linear and showed different release mechanisms. The mechanism of drug release depended on the chemical composition of the NFs. RB release from the NFs with highest POX content was caused by the degradation of the nanofiber matrix, whereas the RB release in lower POX content NFs was caused by diffusion. The NFs with POX showed a loss of structural integrity in the presence of hydrogen peroxide as seen using SEM. The MTT assay showed that composite nanofibers had minimal cytotoxicity. We anticipate that nanofibrous PVA/POX can potentially be used to target numerous inflammatory diseases that overproduce hydrogen peroxide and may become a potential candidate for use as a local drug delivery vehicle.

A Novel Role of Proline Oxidase in HIV-1 Envelope Glycoprotein-induced Neuronal Autophagy*

PubMed Central

Pandhare, Jui; Dash, Sabyasachi; Jones, Bobby; Villalta, Fernando; Dash, Chandravanu

2015-01-01

Proline oxidase (POX) catalytically converts proline to pyrroline-5-carboxylate. This catabolic conversion generates reactive oxygen species (ROS) that triggers cellular signaling cascades including autophagy and apoptosis. This study for the first time demonstrates a role of POX in HIV-1 envelope glycoprotein (gp120)-induced neuronal autophagy. HIV-1 gp120 is a neurotoxic factor and is involved in HIV-1-associated neurological disorders. However, the mechanism of gp120-mediated neurotoxicity remains unclear. Using SH-SY5Y neuroblastoma cells as a model, this study demonstrates that gp120 treatment induced POX expression and catalytic activity. Concurrently, gp120 also increased intracellular ROS levels. However, increased ROS had a minimal effect on neuronal apoptosis. Further investigation indicated that the immediate cellular response to increased ROS paralleled with induction of autophagy markers, beclin-1 and LC3-II. These data lead to the hypothesis that neuronal autophagy is activated as a cellular protective response to the toxic effects of gp120. A direct and functional role of POX in gp120-mediated neuronal autophagy was examined by inhibition and overexpression studies. Inhibition of POX activity by a competitive inhibitor “dehydroproline” decreased ROS levels concomitant with reduced neuronal autophagy. Conversely, overexpression of POX in neuronal cells increased ROS levels and activated ROS-dependent autophagy. Mechanistic studies suggest that gp120 induces POX by targeting p53. Luciferase reporter assays confirm that p53 drives POX transcription. Furthermore, data demonstrate that gp120 induces p53 via binding to the CXCR4 co-receptor. Collectively, these results demonstrate a novel role of POX as a stress response metabolic regulator in HIV-1 gp120-associated neuronal autophagy. PMID:26330555

Class III peroxidases in cellulose deficient cultured maize cells during cell wall remodelling.

PubMed

Martínez-Rubio, Romina; Acebes, José Luis; Encina, Antonio; Kärkönen, Anna

2018-02-21

Maize (Zea mays L.) suspension-cultured cells habituated to a cellulose biosynthesis inhibitor 2,6-dichlorobenzonitrile (DCB) have a modified cell wall, in which the reduction in the cellulose content is compensated by a network of highly cross-linked feruloylated arabinoxylans and the deposition of lignin-like polymers. For both arabinoxylan cross-linking and lignin polymerization, class III peroxidases (POXs) have been demonstrated to have a prominent role. For the first time, a comparative study of POX activity and isoforms in control and cellulose-impaired cells has been addressed, also taking into account their cellular distribution in different compartments. Proteins from the spent medium (SM), soluble cellular (SC), ionically (ICW) and covalently bound cell wall protein fractions were assayed for total and specific peroxidase activity by using coniferyl and sinapyl alcohol and ferulic acid as substrates. The isoPOX profile was obtained by isoelectric focusing. POX activity was higher in DCB-habituated than in non-habituated cells in all protein fractions at all cell culture stages. For all substrates assayed, SC and ICW fractions showed higher activity at the early-log growth phase than at the late-log phase. However, the highest POX activity in the spent medium was found at the late-log phase. According to the isoPOX profiles, the highest diversity of isoPOXs was detected in the ICW and SM protein fractions. The latter fraction contained isoPOXs with higher activity in DCB-habituated cells. Some of the isoPOXs detected could be involved in cross-linking of arabinoxylans and in the lignin-like polymer formation in DCB-habituated cells. This article is protected by copyright. All rights reserved.

Fabrication of Josephson Junction without shadow evaporation

NASA Astrophysics Data System (ADS)

Wu, Xian; Ku, Hsiangsheng; Long, Junling; Pappas, David

We developed a new method of fabricating Josephson Junction (Al/AlOX/Al) without shadow evaporation. Statistics from room temperature junction resistance and measurement of qubits are presented. Unlike the traditional ``Dolan Bridge'' technique, this method requires two individual lithographies and straight evaporations of Al. Argon RF plasma is used to remove native AlOX after the first evaporation, followed by oxidation and second Al evaporation. Junction resistance measured at room temperature shows linear dependence on Pox (oxidation pressure), √{tox} (oxidation time), and inverse proportional to junction area. We have seen 100% yield of qubits made with this method. This method is promising because it eliminates angle dependence during Junction fabrication, facilitates large scale qubits fabrication.

Genetic susceptibility, colony size, and water temperature drive white-pox disease on the coral Acropora palmata.

PubMed

Muller, Erinn M; van Woesik, Robert

2014-01-01

Outbreaks of coral diseases are one of the greatest threats to reef corals in the Caribbean, yet the mechanisms that lead to coral diseases are still largely unknown. Here we examined the spatial-temporal dynamics of white-pox disease on Acropora palmata coral colonies of known genotypes. We took a Bayesian approach, using Integrated Nested Laplace Approximation algorithms, to examine which covariates influenced the presence of white-pox disease over seven years. We showed that colony size, genetic susceptibility of the coral host, and high-water temperatures were the primary tested variables that were positively associated with the presence of white-pox disease on A. palmata colonies. Our study also showed that neither distance from previously diseased individuals, nor colony location, influenced the dynamics of white-pox disease. These results suggest that white-pox disease was most likely a consequence of anomalously high water temperatures that selectively compromised the oldest colonies and the most susceptible coral genotypes.

Genetic Susceptibility, Colony Size, and Water Temperature Drive White-Pox Disease on the Coral Acropora palmata

PubMed Central

Muller, Erinn M.; van Woesik, Robert

2014-01-01

Outbreaks of coral diseases are one of the greatest threats to reef corals in the Caribbean, yet the mechanisms that lead to coral diseases are still largely unknown. Here we examined the spatial-temporal dynamics of white-pox disease on Acropora palmata coral colonies of known genotypes. We took a Bayesian approach, using Integrated Nested Laplace Approximation algorithms, to examine which covariates influenced the presence of white-pox disease over seven years. We showed that colony size, genetic susceptibility of the coral host, and high-water temperatures were the primary tested variables that were positively associated with the presence of white-pox disease on A. palmata colonies. Our study also showed that neither distance from previously diseased individuals, nor colony location, influenced the dynamics of white-pox disease. These results suggest that white-pox disease was most likely a consequence of anomalously high water temperatures that selectively compromised the oldest colonies and the most susceptible coral genotypes. PMID:25372835

Proline oxidase silencing induces proline-dependent pro-survival pathways in MCF-7 cells

PubMed Central

Zareba, Ilona; Celinska-Janowicz, Katarzyna; Surazynski, Arkadiusz; Miltyk, Wojciech; Palka, Jerzy

2018-01-01

Proline degradation by proline dehydrogenase/proline oxidase (PRODH/POX) contributes to apoptosis or autophagy. The identification of specific pathway of apoptosis/survival regulation is the aim of this study. We generated knocked-down PRODH/POX MCF-7 breast cancer cells (MCF-7shPRODH/POX). PRODH/POX silencing did not affect cell viability. However, it contributed to decrease in DNA and collagen biosynthesis, increase in prolidase activity and intracellular proline concentration as well as increase in the expression of iNOS, NF-κB, mTOR, HIF-1α, COX-2, AMPK, Atg7 and Beclin-1 in MCF-7shPRODH/POX cells. In these cells, glycyl-proline (GlyPro, substrate for prolidase) further inhibited DNA and collagen biosynthesis, maintained high prolidase activity, intracellular concentration of proline and up-regulated HIF-1α, AMPK, Atg7 and Beclin-1, compared to GlyPro-treated MCF-7 cells. In MCF-7 cells, GlyPro increased collagen biosynthesis, concentration of proline and expression of caspase-3, cleaved caspases -3 and -9, iNOS, NF-κB, COX-2 and AMPKβ. PRODH/POX knock-down contributed to pro-survival autophagy pathways in MCF-7 cells and GlyPro-derived proline augmented this process. However, GlyPro induced apoptosis in PRODH/POX-expressing MCF-7 cells as detected by up-regulation of active caspases -3 and -9. The data suggest that PRODH/POX silencing induces autophagy in MCF-7 cells and GlyPro-derived proline supports this process. PMID:29568391

Differential antioxidative response of tolerant and sensitive maize (Zea mays L.) genotypes to drought stress at reproductive stage.

PubMed

Chugh, Vishal; Kaur, Narinder; Grewal, M S; Gupta, Anil K

2013-04-01

The role of oxidative stress management was evaluated in two maize (Zea mays L.) genotypes - Parkash (drought-resistant) and Paras (drought-sensitive), subjected to drought stress during reproductive stage. Alterations in their antioxidant pools - glutathione (GSH) and ascorbic acid (AsA) combined with activities of enzymes glutathione reductase (GR), ascorbate peroxidase (APX), peroxidase (POX) and catalase (CAT) involved in defense against oxidative stress and stress parameters, namely chlorophyll (Chl), hydrogen peroxide (H2O2) and malondialdehyde (MDA) were investigated in flag leaves from silk emergence till maturity. The drought caused transient increase in GR, APX, POX and CAT activities in drought-tolerant genotype (Parkash) which decreased at later stages with the extended period of drought stress. However, in Paras, drought stress caused decrease in activities of GR and CAT from initial period of stress till the end of experiment, except for POX which showed slight increase in activity. A significant increase in GSH content was observed in Parkash till 35 days after silking (DAS), whereas in Paras, GSH content remained lower than irrigated till maturity. Parkash which had higher AsA and Chl contents, also showed lower H2O2 and MDA levels than Paras under drought stress conditions. However, at the later stages, decline in antioxidant enzyme activities in Parkash due to severe drought stress led to enhanced membrane damage, as revealed by the accumulation of MDA. Our data indicated that significant activation of antioxidant system in Parkash might be responsible for its drought-tolerant behavior under drought stress and helped it to cope with the stress up to a definite period. Thus, the results indicate that antioxidant status and lipid peroxidation in flag leaves can be used as indices of drought tolerance in maize plants and also as potential biochemical targets for the crop improvement programmes to develop drought-tolerant cultivars.

7 CFR 301.74-3 - Quarantined areas.

Code of Federal Regulations, 2010 CFR

2010-01-01

... SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Plum Pox § 301.74-3 Quarantined areas. (a... quarantined area in paragraph (c) of this section each State, or each portion of a State, in which plum pox... to believe that plum pox is present, or that the Administrator considers necessary to quarantine...

Avian Pox in Native Captive Psittacines, Brazil, 2015.

PubMed

Esteves, Felipe C B; Marín, Sandra Y; Resende, Maurício; Silva, Aila S G; Coelho, Hannah L G; Barbosa, Mayara B; D'Aparecida, Natália S; de Resende, José S; Torres, Ana C D; Martins, Nelson R S

2017-01-01

To investigate an outbreak of avian pox in psittacines in a conservation facility, we examined 94 birds of 10 psittacine species, including sick and healthy birds. We found psittacine pox virus in 23 of 27 sick birds and 4 of 67 healthy birds. Further characterization is needed for these isolates.

Sequential treatment with intradermal incision (intracision) and 2,940-nm Er:YAG laser for chicken pox scars.

PubMed

Lee, Sang Ju; Kim, Young Koo; Choi, Sun Young; Park, Kui Young; Seo, Seong Jun

2014-01-01

Boxcar scars, such as chicken pox scars, are round to oval depressions with sharply defined vertical edges. Subcision is a simple and safe procedure for treatment of atrophic and depressed scars, but boxcar scars are generally not eliminated by subcision. Intradermal incision technique (intracision) can treat chicken pox scars by untethering fibrotic strands, raising collagen synthesis, and having additional intradermal blood pocket formation. We have found that chicken pox scars further improve when intracision is followed by laser skin resurfacing. © 2013 Wiley Periodicals, Inc.

Electrochemical characterization of the pyranose 2-oxidase variant N593C shows a complete loss of the oxidase function with full preservation of substrate (dehydrogenase) activity† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c6cp06009a Click here for additional data file.

PubMed Central

Brugger, Dagmar; Sützl, Leander; Zahma, Kawah; Haltrich, Dietmar; Peterbauer, Clemens K.

2016-01-01

This study presents the first electrochemical characterization of the pyranose oxidase (POx) variant N593C (herein called POx-C), which is considered a promising candidate for future glucose-sensing applications. The resulting cyclic voltammograms obtained in the presence of various concentrations of glucose and mediator (1,4-benzoquinone, BQ), as well as the control experiments by addition of catalase, support the conclusion of a complete suppression of the oxidase function and oxygen reactivity at POx-C. Additionally, these electrochemical experiments demonstrate, contrary to previous biochemical studies, that POx-C has a fully retained enzymatic activity towards glucose. POx-C was immobilized on a special screen-printed electrode (SPE) based on carbon ink and grafted with gold-nanoparticles (GNP). Suppression of the oxygen reactivity at N593C-POx variant is a prerequisite for utilizing POx in electrochemical applications for glucose sensing. To our knowledge, this is the first report presented in the literature showing an absolute conversion of an oxidase into a fully active equivalent dehydrogenase via a single residue exchange. PMID:27808302

[Monkey-pox, a model of emergent then reemergent disease].

PubMed

Georges, A J; Matton, T; Courbot-Georges, M C

2004-01-01

The recent emergence of monkey pox in the United States of America highlights the problem (known for other infectious agents) of dissemination of pathogens outside their endemic area, and of subsequent global threats of variable gravity according to agents. It is a real emergency since monkey pox had been confined to Africa for several decades, where small epidemics occurred from time to time, monkey pox is a "miniature smallpox" which, in Africa, evolves on an endemic (zoonotic) mode with, as reservoirs, several species of wild rodents (mainly squirrels) and some monkey species. It can be accidentally transmitted to man then develops as epidemics, sometimes leading to death. The virus was imported in 2003 in the United States of America, via Gambia rats and wild squirrels (all African species), and infected prairie dogs (which are now in fashion as pets), then crossed the species barrier to man. In the United States of America, screening campaigns, epidemiological investigations, and subsequent treatments led to a rapid control of the epidemic, which is a model of emergent disease for this country. Therapeutic and preventive measures directly applicable to monkey pox are discussed. They can also be applied against other pox virus infections (including smallpox). The risk of criminal introduction of pox viruses is discussed since it is, more than ever, a real worldwide threat.

Oxidative Stress Induced in Sunflower Seedling Roots by Aqueous Dry Olive-Mill Residues

PubMed Central

Garrido, Inmaculada; García-Sánchez, Mercedes; Casimiro, Ilda; Casero, Pedro Joaquin; García-Romera, Inmaculada; Ocampo, Juan Antonio; Espinosa, Francisco

2012-01-01

The contamination of soils with dry olive-mill residue can represent a serious problem as being an environmental stressor in plants. It has been demonstrated that inoculation of aqueous extract of olive oil-mill residue (ADOR) with saprobe fungi removes some phenolic compounds. In this paper we studied the effect of ADOR uninoculated or inoculated with saprobe fungi in sunflower seedling roots. The germination and root growth, O2·- generation, superoxide dismutase (SOD) and extracellular peroxidases (EC-POXs) activities, and the content of some metabolites involved in the tolerance of stress were tested. The roots germinated in ADOR uninoculated show a decrease in meristem size, resulting in a reduction of the root length and fresh weight, and in the number of layers forming the cortex, but did not alter the dry weight, protein and soluble amino acid content. ADOR caused the decreases in O2·- generation and EC-POX′s activities and protein oxidation, but enhanced SOD activity, lipid peroxidation and proline content. Fluorescence imaging showed that ADOR induced O2·- and H2O2 accumulation in the roots. The increase in SOD and the decrease in EC-POX′s activities might be involved in the enhancement of H2O2 content and lipid peroxidation. Control roots treated with ADOR for 10 min show an oxidative burst. Roots germinated in ADOR inoculated with saprobe fungi partially recovered normal levels of ROS, morphological characteristics and antioxidant activities. These results suggested that treatment with ADOR caused a phytotoxic effect during germination inducing an oxidative stress. The inoculation of ADOR with saprobe fungi limited the stress. PMID:23049960

Oxygen-Inducible Conversion of Lactate to Acetate in Heterofermentative Lactobacillus brevis ATCC 367.

PubMed

Guo, Tingting; Zhang, Li; Xin, Yongping; Xu, ZhenShang; He, Huiying; Kong, Jian

2017-11-01

Lactobacillus brevis is an obligatory heterofermentative lactic acid bacterium that produces high levels of acetate, which improve the aerobic stability of silages against deterioration caused by yeasts and molds. However, the mechanism involved in acetate accumulation has yet to be elucidated. Here, experimental evidence indicated that aerobiosis resulted in the conversion of lactate to acetate after glucose exhaustion in L. brevis ATCC 367 (GenBank accession number NC_008497). To elucidate the conversion pathway, in silico analysis showed that lactate was first converted to pyruvate by the reverse catalytic reaction of lactate dehydrogenase (LDH); subsequently, pyruvate conversion to acetate might be mediated by pyruvate dehydrogenase (PDH) or pyruvate oxidase (POX). Transcriptional analysis indicated that the pdh and pox genes of L. brevis ATCC 367 were upregulated 37.92- and 18.32-fold, respectively, by oxygen and glucose exhaustion, corresponding to 5.32- and 2.35-fold increases in the respective enzyme activities. Compared with the wild-type strain, the transcription and enzymatic activity of PDH remained stable in the Δ pox mutant, while those of POX increased significantly in the Δ pdh mutant. More lactate but less acetate was produced in the Δ pdh mutant than in the wild-type and Δ pox mutant strains, and more H 2 O 2 (a product of the POX pathway) was produced in the Δ pdh mutant. We speculated that the high levels of aerobic acetate accumulation in L. brevis ATCC 367 originated mainly from the reuse of lactate to produce pyruvate, which was further converted to acetate by the predominant and secondary functions of PDH and POX, respectively. IMPORTANCE PDH and POX are two possible key enzymes involved in aerobic acetate accumulation in lactic acid bacteria (LAB). It is currently thought that POX plays the major role in aerobic growth in homofermentative LAB and some heterofermentative LAB, while the impact of PDH remains unclear. In this study, we reported that both PDH and POX worked in the aerobic conversion of lactate to acetate in L. brevis ATCC 367, in dominant and secondary roles, respectively. Our findings will further develop the theory of aerobic metabolism by LAB. Copyright © 2017 American Society for Microbiology.

Oxygen-Inducible Conversion of Lactate to Acetate in Heterofermentative Lactobacillus brevis ATCC 367

PubMed Central

Guo, Tingting; Zhang, Li; Xin, Yongping; Xu, ZhenShang; He, Huiying

2017-01-01

ABSTRACT Lactobacillus brevis is an obligatory heterofermentative lactic acid bacterium that produces high levels of acetate, which improve the aerobic stability of silages against deterioration caused by yeasts and molds. However, the mechanism involved in acetate accumulation has yet to be elucidated. Here, experimental evidence indicated that aerobiosis resulted in the conversion of lactate to acetate after glucose exhaustion in L. brevis ATCC 367 (GenBank accession number NC_008497). To elucidate the conversion pathway, in silico analysis showed that lactate was first converted to pyruvate by the reverse catalytic reaction of lactate dehydrogenase (LDH); subsequently, pyruvate conversion to acetate might be mediated by pyruvate dehydrogenase (PDH) or pyruvate oxidase (POX). Transcriptional analysis indicated that the pdh and pox genes of L. brevis ATCC 367 were upregulated 37.92- and 18.32-fold, respectively, by oxygen and glucose exhaustion, corresponding to 5.32- and 2.35-fold increases in the respective enzyme activities. Compared with the wild-type strain, the transcription and enzymatic activity of PDH remained stable in the Δpox mutant, while those of POX increased significantly in the Δpdh mutant. More lactate but less acetate was produced in the Δpdh mutant than in the wild-type and Δpox mutant strains, and more H2O2 (a product of the POX pathway) was produced in the Δpdh mutant. We speculated that the high levels of aerobic acetate accumulation in L. brevis ATCC 367 originated mainly from the reuse of lactate to produce pyruvate, which was further converted to acetate by the predominant and secondary functions of PDH and POX, respectively. IMPORTANCE PDH and POX are two possible key enzymes involved in aerobic acetate accumulation in lactic acid bacteria (LAB). It is currently thought that POX plays the major role in aerobic growth in homofermentative LAB and some heterofermentative LAB, while the impact of PDH remains unclear. In this study, we reported that both PDH and POX worked in the aerobic conversion of lactate to acetate in L. brevis ATCC 367, in dominant and secondary roles, respectively. Our findings will further develop the theory of aerobic metabolism by LAB. PMID:28842545

Sterile Protection against Plasmodium knowlesi in Rhesus Monkeys from a Malaria Vaccine: Comparison of Heterologous Prime Boost Strategies

PubMed Central

Jiang, George; Shi, Meng; Conteh, Solomon; Richie, Nancy; Banania, Glenna; Geneshan, Harini; Valencia, Anais; Singh, Priti; Aguiar, Joao; Limbach, Keith; Kamrud, Kurt I.; Rayner, Jonathan; Smith, Jonathan; Bruder, Joseph T.; King, C. Richter; Tsuboi, Takafumi; Takeo, Satoru; Endo, Yaeta; Doolan, Denise L.; Richie, Thomas L.; Weiss, Walter R.

2009-01-01

Using newer vaccine platforms which have been effective against malaria in rodent models, we tested five immunization regimens against Plasmodium knowlesi in rhesus monkeys. All vaccines included the same four P. knowlesi antigens: the pre-erythrocytic antigens CSP, SSP2, and erythrocytic antigens AMA1, MSP1. We used four vaccine platforms for prime or boost vaccinations: plasmids (DNA), alphavirus replicons (VRP), attenuated adenovirus serotype 5 (Ad), or attenuated poxvirus (Pox). These four platforms combined to produce five different prime/boost vaccine regimens: Pox alone, VRP/Pox, VRP/Ad, Ad/Pox, and DNA/Pox. Five rhesus monkeys were immunized with each regimen, and five Control monkeys received a mock vaccination. The time to complete vaccinations was 420 days. All monkeys were challenged twice with 100 P. knowlesi sporozoites given IV. The first challenge was given 12 days after the last vaccination, and the monkeys receiving the DNA/Pox vaccine were the best protected, with 3/5 monkeys sterilely protected and 1/5 monkeys that self-cured its parasitemia. There was no protection in monkeys that received Pox malaria vaccine alone without previous priming. The second sporozoite challenge was given 4 months after the first. All 4 monkeys that were protected in the first challenge developed malaria in the second challenge. DNA, VRP and Ad5 vaccines all primed monkeys for strong immune responses after the Pox boost. We discuss the high level but short duration of protection in this experiment and the possible benefits of the long interval between prime and boost. PMID:19668343

Prevalence of pox-like lesions and malaria in forest bird communitites on leeward Mauna Loa volcano, Hawaii

USGS Publications Warehouse

Atkinson, C.T.; Lease, J.K.; Dusek, Robert J.; Samuel, M.D.

2005-01-01

Introduced avian pox virus and malaria have had devastating impacts on native Hawaiian forest birds, yet little has been published about their prevalence and distribution in forest bird communities outside of windward Hawaii Island. We surveyed native and non-native forest birds for these two diseases at three different elevations on leeward Mauna Loa Volcano at the Kona Forest Unit of Hakalau Forest National Wildlife Refuge. Prevalence of malaria by both serology and microscopy varied by elevation and ranged from 28% at 710 m to 13% at 1830 m. Prevalence of pox-like lesions also varied by altitude, ranging in native species from 10% at 710 m to 2% at 1830 m. Native species at all elevations had the highest prevalence of malarial antibody and pox-like lesions. By contrast, pox-like lesions were not detected in individuals of four non-native species and only 5% of Japanese White-eye (Zosterops japonicus) was positive for malaria. A significantly high proportion of birds with pox-like lesions also had serological evidence of concurrent, chronic malarial infections, suggesting an interaction between these diseases, dual transmission of both diseases by the primary mosquito vector (Culex quinquefasciatus) or complete recovery of some pox-infected birds without loss of toes. Results from this study document high prevalence of malaria and pox at this refuge. Development of effective disease control strategies will be important for restoration of remnant populations of the endangered 'Akiapola'au (Hemignathus munroi), Hawaii Creeper (Oreomystis mana), and Hawaii 'Akepa (Loxops coccineus coccineus) that still occur on the refuge.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Edward jenner and the small pox vaccine.

PubMed

Smith, Kendall A

2011-01-01

Edward Jenner, who discovered that it is possible to vaccinate against Small Pox using material from Cow Pox, is rightly the man who started the science of immunology. However, over the passage of time many of the details surrounding his astounding discovery have been lost or forgotten. Also, the environment within which Jenner worked as a physician in the countryside, and the state of the art of medicine and society are difficult to appreciate today. It is important to recall that people were still being bled at the time, to relieve the presence of evil humors. Accordingly, this review details Jenner's discovery and attempts to place it in historical context. Also, the vaccine that Jenner used, which decreased the prevalence of Small Pox worldwide in his own time, and later was used to eradicate Small Pox altogether, is discussed in light of recent data.

Varicella-associated purpura fulminans: chicken pox is not always benign.

PubMed

Abdulmalik, A; Al-Ateeqi, W; Al-Khawari, M; Al-Osaimi, S

2006-01-01

To report a 6-year-old boy with post-chicken pox purpura fulminans (PF). A 6-year-old boy presented with purpura of the legs that rapidly progressed to other parts of the limbs and the buttocks. The patient had had chicken pox 10 days prior to presentation. He was afebrile and the chicken pox lesions were dry. He received anti-coagulants, a large volume of fresh frozen plasma, immunoglobulin and steroids. The skin lesions regressed but both hands and parts of the lower limbs remained necrotic; the patient was transferred to an orthopaedic hospital for amputation and skin grafting. This case report shows that PF can occur as a post-infection syndrome after primary varicella. Early and aggressive treatment of post-chicken pox PF might reduce the mortality and morbidity associated with this condition. Copyright 2006 S. Karger AG, Basel.

How to hold an ethical pox party.

PubMed

Jamrozik, Euzebiusz

2018-04-01

Pox parties are a controversial alternative to vaccination for diseases such as chickenpox. Such parties involve parents infecting non-immune children by exposing them to a contagious child. If successful, infection will usually lead to immunity, thus preventing infection later in life, which, for several vaccine-preventable diseases, is more severe than childhood infection. Some may consider pox parties more morally objectionable than opting out of vaccination through non-medical exemptions. In this paper, I argue that this is not the case. Pox parties involve immediate risk of harm for children and reduce future harms, whereas opting out of vaccination places children at long-term risk of harms that increase with time, at least for some pathogens. Regarding harm to others through onward transmission of infection, this can be easily prevented in the case of pox parties-given the relatively controlled timing of infection-by quarantining attendees after the party, whereas opting out of vaccination involves risks to others that are more difficult to control. I defend three criteria for an ethical pox party: (1) that the disease is sufficiently low risk, (2) that parents consent to their child's attendance and (3) that children exposed to infection are quarantined and isolated appropriately. I argue that, if these criteria are met, pox parties are morally preferable to non-vaccination; such parties involve less risk to non-consenting others and, for some pathogens in some cases, even involve less risk for the children who participate. Thus, policies that permit non-medical exemption to vaccination should also permit ethical pox parties. Alternatively, if pox parties are not permitted, then vaccination should be mandated for those without medical contraindication. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Effects of fuel processing methods on industrial scale biogas-fuelled solid oxide fuel cell system for operating in wastewater treatment plants

NASA Astrophysics Data System (ADS)

Farhad, Siamak; Yoo, Yeong; Hamdullahpur, Feridun

The performance of three solid oxide fuel cell (SOFC) systems, fuelled by biogas produced through anaerobic digestion (AD) process, for heat and electricity generation in wastewater treatment plants (WWTPs) is studied. Each system has a different fuel processing method to prevent carbon deposition over the anode catalyst under biogas fuelling. Anode gas recirculation (AGR), steam reforming (SR), and partial oxidation (POX) are the methods employed in systems I-III, respectively. A planar SOFC stack used in these systems is based on the anode-supported cells with Ni-YSZ anode, YSZ electrolyte and YSZ-LSM cathode, operated at 800 °C. A computer code has been developed for the simulation of the planar SOFC in cell, stack and system levels and applied for the performance prediction of the SOFC systems. The key operational parameters affecting the performance of the SOFC systems are identified. The effect of these parameters on the electrical and CHP efficiencies, the generated electricity and heat, the total exergy destruction, and the number of cells in SOFC stack of the systems are studied. The results show that among the SOFC systems investigated in this study, the AGR and SR fuel processor-based systems with electrical efficiency of 45.1% and 43%, respectively, are suitable to be applied in WWTPs. If the entire biogas produced in a WWTP is used in the AGR or SR fuel processor-based SOFC system, the electricity and heat required to operate the WWTP can be completely self-supplied and the extra electricity generated can be sold to the electrical grid.

Harnessing hyperthermostable lactonase from Sulfolobus solfataricus for biotechnological applications

PubMed Central

Rémy, Benjamin; Plener, Laure; Poirier, Laetitia; Elias, Mikael; Daudé, David; Chabrière, Eric

2016-01-01

Extremozymes have gained considerable interest as they could meet industrial requirements. Among these, SsoPox is a hyperthermostable enzyme isolated from the archaeon Sulfolobus solfataricus. This enzyme is a lactonase catalyzing the hydrolysis of acyl-homoserine lactones; these molecules are involved in Gram-negative bacterial communication referred to as quorum sensing. SsoPox exhibits promiscuous phosphotriesterase activity for the degradation of organophosphorous chemicals including insecticides and chemical warfare agents. Owing to its bi-functional catalytic abilities as well as its intrinsic stability, SsoPox is appealing for many applications, having potential uses in the agriculture, defense, food and health industries. Here we investigate the biotechnological properties of the mutant SsoPox-W263I, a variant with increased lactonase and phosphotriesterase activities. We tested enzyme resistance against diverse process-like and operating conditions such as heat resistance, contact with organic solvents, sterilization, storage and immobilization. Bacterial secreted materials from both Gram-negative and positive bacteria were harmless on SsoPox-W263I activity and could reactivate heat-inactivated enzyme. SsoPox showed resistance to harsh conditions demonstrating that it is an extremely attractive enzyme for many applications. Finally, the potential of SsoPox-W263I to be active at subzero temperature is highlighted and discussed in regards to the common idea that hyperthermophile enzymes are nearly inactive at low temperatures. PMID:27876889

Gulf of Maine Seals - Populations, Problems and Priorities

DTIC Science & Technology

2010-06-01

3) rabies, (4) leptospirosis, (5) herpes, (6) toxoplasmosis, (7) pox, (8) lung worms, (9) Vibrio spp. and (10) harmful algal bloom toxins (HABs...Toxoplasmosis Pox Lungworms Vibrio HABs - We need to identify categories of disease and classify diseases opposed to simply stating that...infections Pox Vibrio Morbilli Pneumonia Dermatitis Alopecia Septicemia Body condition Dehydration Foreign body ingestion Natural

Poxvirus Antigen Staining of Immune Cells as a Biomarker to Predict Disease Outcome in Monkeypox and Cowpox Virus Infection in Non-Human Primates

PubMed Central

Song, Haifeng; Janosko, Krisztina; Johnson, Reed F.; Qin, Jing; Josleyn, Nicole; Jett, Catherine; Byrum, Russell; Claire, Marisa St.; Dyall, Julie; Blaney, Joseph E.; Jennings, Gerald; Jahrling, Peter B.

2013-01-01

Infection of non-human primates (NHPs) such as rhesus and cynomolgus macaques with monkeypox virus (MPXV) or cowpox virus (CPXV) serve as models to study poxvirus pathogenesis and to evaluate vaccines and anti-orthopox therapeutics. Intravenous inoculation of macaques with high dose of MPXV (>1–2×107 PFU) or CPXV (>102 PFU) results in 80% to 100% mortality and 66 to 100% mortality respectively. Here we report that NHPs with positive detection of poxvirus antigens in immune cells by flow cytometric staining, especially in monocytes and granulocytes succumbed to virus infection and that early positive pox staining is a strong predictor for lethality. Samples from four independent studies were analyzed. Eighteen NHPs from three different experiments were inoculated with two different MPXV strains at lethal doses. Ten NHPs displayed positive pox-staining and all 10 NHPs reached moribund endpoint. In contrast, none of the three NHPs that survived anticipated lethal virus dose showed apparent virus staining in the monocytes and granulocytes. In addition, three NHPs that were challenged with a lethal dose of MPXV and received cidofovir treatment were pox-antigen negative and all three NHPs survived. Furthermore, data from a CPXV study also demonstrated that 6/9 NHPs were pox-antigen staining positive and all 6 NHPs reached euthanasia endpoint, while the three survivors were pox-antigen staining negative. Thus, we conclude that monitoring pox-antigen staining in immune cells can be used as a biomarker to predict the prognosis of virus infection. Future studies should focus on the mechanisms and implications of the pox-infection of immune cells and the correlation between pox-antigen detection in immune cells and disease progression in human poxviral infection. PMID:23577120

AN EPIZOOTIC OF EMERGING NOVEL AVIAN POX IN CARRION CROWS (CORVUS CORONE) AND LARGE-BILLED CROWS (CORVUS MACRORHYNCHOS) IN JAPAN.

PubMed

Fukui, Daisuke; Nakamura, Makiko; Yamaguchi, Tsuyoshi; Takenaka, Makiko; Murakami, Mami; Yanai, Tokuma; Fukushi, Hideto; Yanagida, Kazumi; Bando, Gen; Matsuno, Keita; Nagano, Masashi; Tsubota, Toshio

2016-04-28

In 2006-10, an epizootic of emerging avian pox occurred in Carrion Crows ( Corvus corone ) and Large-billed Crows ( Corvus macrorhynchos ), leading to mortality of juvenile crows in Hokkaido, the northernmost island of Japan. We diagnosed 27 crows with proliferative skin lesions (19 carcasses and eight biopsied cases [one in zoo captivity]) as avian pox clinically, histopathologically by detection of Avipoxvirus-specific 4b core protein (P4b) gene, and epidemiologically. The fatal cases demonstrated intensively severe infection and aggressive lesions with secondary bacterial infection. Since the first identification of avian pox in Sapporo, Japan, in 2006, the frequency of mortality events has increased, peaking in 2007-08. Mortalities have subsequently occurred in other areas, suggesting disease expansion. In Sapporo, prevalence of avian pox evaluated by field censuses during 2007-12 was 17.6% (6.6-27.2%), peaked during 2007-08 and 2008-09, and then decreased. All diseased crows were juveniles, except for one adult. The number of crows assembling in the winter roosts had been stable for >10 yr; however, it declined in 2007-08, decreased by about 50% in 2008-09, and recovered to the previous level in 2009-10, correlated with the avian pox outbreak. Thus, avian pox probably contributed to the unusual crow population decline. All P4b sequences detected in six specimens in Sapporo were identical and different from any previously reported sequences. The sequence detected in the zoo-kept crow was distinct from any reported clades, and interspecies transmission was suspected. This report demonstrates an emerging novel avian pox in the Japanese avifauna and in global populations of Carrion Crows and Large-billed Crows. Longitudinal monitoring is needed to evaluate its impact on the crow population.

Edward Jenner and the Small Pox Vaccine

PubMed Central

Smith, Kendall A.

2011-01-01

Edward Jenner, who discovered that it is possible to vaccinate against Small Pox using material from Cow Pox, is rightly the man who started the science of immunology. However, over the passage of time many of the details surrounding his astounding discovery have been lost or forgotten. Also, the environment within which Jenner worked as a physician in the countryside, and the state of the art of medicine and society are difficult to appreciate today. It is important to recall that people were still being bled at the time, to relieve the presence of evil humors. Accordingly, this review details Jenner’s discovery and attempts to place it in historical context. Also, the vaccine that Jenner used, which decreased the prevalence of Small Pox worldwide in his own time, and later was used to eradicate Small Pox altogether, is discussed in light of recent data. PMID:22566811

Atypical distribution of fowl pox lesions in broilers.

PubMed

Sentíes-Cué, C G; Charlton, B R; Woolcock, P; Bickford, A A; Cooper, G; Bland, M

2010-12-01

An unusual cutaneous fowl pox outbreak occurred in 8-wk-old broilers in California. Rounded and longitudinal, proliferative scratch-associated lesions were found only in feathered areas of the body. Both sides of the hip, the lower abdomen, pericloacal area, and lateral lower neck area were involved. The head, legs, feet, and toes did not have lesions. Birds in only one section of one of five houses were affected. Fifteen percent condemnations occurred in birds from the affected house due to the skin lesions. A diagnosis of fowl pox was achieved by histopathology, viral isolation, and direct electron microscopy. The unusual distribution of pox lesions was assumed to be associated with skin scratches. There was no evidence that mosquitoes or other types of insects were involved in this outbreak. To the knowledge of the authors, this is the first report of this kind of unusual fowl pox in the United States.

Enhanced salt-induced antioxidative responses involve a contribution of polyamine biosynthesis in grapevine plants.

PubMed

Ikbal, Fatima Ezzohra; Hernández, José Antonio; Barba-Espín, Gregorio; Koussa, Tayeb; Aziz, Aziz; Faize, Mohamed; Diaz-Vivancos, Pedro

2014-06-15

The possible involvement of polyamines in the salt stress adaptation was investigated in grapevine (Vitis vinifera L.) plantlets focusing on photosynthesis and oxidative metabolism. Salt stress resulted in the deterioration of plant growth and photosynthesis, and treatment of plantlets with methylglyoxal-bis(guanylhydrazone) (MGBG), a S-adenosylmethionine decarboxylase (SAMDC) inhibitor, enhanced the salt stress effect. A decrease in PSII quantum yield (Fv/Fm), effective PSII quantum yield (Y(II)) and coefficient of photochemical quenching (qP) as well as increases in non-photochemical quenching (NPQ) and its coefficient (qN) was observed by these treatments. Salt and/or MGBG treatments also triggered an increase in lipid peroxidation and reactive oxygen species (ROS) accumulation as well as an increase of superoxide dismutase (SOD) and peroxidase (POX) activities, but not ascorbate peroxidase (APX) activity. Salt stress also resulted in an accumulation of oxidized ascorbate (DHA) and a decrease in reduced glutathione. MGBG alone or in combination with salt stress increased monodehydroascorbate reductase (MDHAR), SOD and POX activities and surprisingly no accumulation of DHA was noticed following treatment with MGBG. These salt-induced responses correlated with the maintaining of high level of free and conjugated spermidine and spermine, whereas a reduction of agmatine and putrescine levels was observed, which seemed to be amplified by the MGBG treatment. These results suggest that maintaining polyamine biosynthesis through the enhanced SAMDC activity in grapevine leaf tissues under salt stress conditions could contribute to the enhanced ROS scavenging activity and a protection of photosynthetic apparatus from oxidative damages. Copyright © 2014 Elsevier GmbH. All rights reserved.

Database of Autotransplants for Breast Cancer.

DTIC Science & Technology

1996-12-01

Infections (Indicate code for atypical bacteria; 301 Herpes Simplex (HSV1, HSV2) list bacterium for non-atypical bacteria.) 302 Herpes Zoster ( Chicken pox ...for non-atypical bacteria.) 302 Herpes Zoster ( Chicken pox , Varicella) 303 Cytomegalovirus (CMV) 100 Atypical bacteria, not otherwise specified 304... Chicken pox , Varicella) 303 Cytomegalovirus (CMV) 100 Atypical bacteria, not otherwise specified 304 Adenovirus 101 Coxiella 305 Enterovirus (Coxsackie

Bioterrorism Preparedness for Infectious Disease (BTPID) Proposal

DTIC Science & Technology

2007-01-01

approximately $210,000/ year x 5 years. (Pending) Safety, Tolerability and Immunogenicity of ACAM3000 Modified Vaccinia Ankara (MVA) Small Pox ...Hospital. • (Pending) Safety, Tolerability and Immunogenicity of ACAM3000 Modified Vaccinia Ankara (MVA) Small Pox Vaccine in HIV-Seropositive...choosing optimal pox virus derived vectors as vaccines in terms of reducing clinical reactogenicity and inducing dendritic cell (DC) aturation. 2006 Elsevier

A Mutation in the PoxA Gene of Salmonella enterica Serovar Typhimurium Results in Altered Protein Production, Elevated Susceptibility to Environmental Challenges, and Decreased Swine Colonization

USDA-ARS?s Scientific Manuscript database

Using signature-tagged mutagenesis of Salmonella enterica serovar Typhimurium (S. Typhimurium), a mutation in the poxA gene (STM4344; yjeA; poxR), encoding a putative lysyl-tRNA synthetase, was previously identified by our research group which caused decreased survival in an ex vivo swine stomach co...

Avian pox

USGS Publications Warehouse

Hansen, W.

1999-01-01

Avian pox is the common name for a mild-to-severe, slowdeveloping disease of birds that is caused by a large virus belonging to the avipoxvirus group, a subgroup of poxviruses. This group contains several similar virus strains; some strains have the ability to infect several groups or species of birds but others appear to be species-specific. Mosquitoes are common mechanical vectors or transmitters of this disease. Avian pox is transmitted when a mosquito feeds on an infected bird that has viremia or pox virus circulating in its blood, or when a mosquito feeds on virus-laden secretions seeping from a pox lesion and then feeds on another bird that is susceptible to that strain of virus. Contact with surfaces or exposure to air-borne particles contaminated with poxvirus can also result in infections when virus enters the body through abraded skin or the conjunctiva or the mucous membrane lining that covers the front part of the eyeball and inner surfaces of the eyelids of the eye.

A Mutation in the Putative Lysl-tRNA Synthetase Gene, PoxR of Salmonella enterica Serovar Typhimurium Results in Altered Protein Production, Elevated Susceptibility to Environmental Challenges and Decreased Swine Colonization

USDA-ARS?s Scientific Manuscript database

Using signature-tagged mutagenesis, a mutation in the poxR gene of Salmonella enterica serovar Typhimurium was identified with decreased survival in an ex vivo swine stomach content assay(Bearson et al. Appl Environ Microbiol. 72:2829-36). Gastrointestinal colonization and fecal shedding of the pox...

Database of Autotransplants for Breast Cancer.

DTIC Science & Technology

1998-11-01

atypical bacteria in Q.79, 81.) 301 Herpes Simplex (HSV1, HSV2) 100 Atypical bacteria, not otherwise specified 302 Herpes Zoster ( Chicken pox , Varicella...100 Atypical bacteria, not otherwise specified 302 Herpes Zoster ( Chicken pox , Varicella) 101 Coxiella 303 Cytomegalovirus (CMV) 102 Legionella 304...atypical bacteria in Q.329, 330.) 301 Herpes Simplex (HSV1, HSV2) 100 Atypical bacteria, not otherwise specified 302 Herpes Zoster ( Chicken pox , Vadcella

Infectious and Hazardous Waste Protocol for Medical Facilities

DTIC Science & Technology

1991-03-01

possible, have a known immune status to that disease (e.g., chicken pox ). Caregivers who have no immunity or unknown immune status should not provide care...employees living in barracks who are diagnosed as having a highly communicable disease which has a respiratory transmission route (such as chicken pox ...high-risk patients (i.e., neonates, young infants, COPD, immune compromised) until acute symptoms resolve. Varicella ( Chicken pox ) Active Yes Until all

Worldwide Report, Epidemiology

DTIC Science & Technology

1985-12-26

them to take their chlldrerv outside the village-for treats rnent of measles, chicken - pox and small- pox . {The result of this superstition was the...within two days of the attack. The village inmates, out of ignorance, treated them with neem leaves as they used to do in case of chicken pox . Having...Migrants v (Penang THE STAR, 30 Oct 85) JU Briefs ~2 Jaundice Cases - b - MEXICO National AIDS Statistics: New Study Facility ( Mexico City

Development of loop-mediated isothermal amplification assay for specific and rapid detection of differential goat pox virus and sheep pox virus.

PubMed

Zhao, Zhixun; Fan, Bin; Wu, Guohua; Yan, Xinmin; Li, Yingguo; Zhou, Xiaoli; Yue, Hua; Dai, Xueling; Zhu, Haixia; Tian, Bo; Li, Jian; Zhang, Qiang

2014-01-17

Capripox viruses are economically important pathogens in goat and sheep producing areas of the world, with specific focus on goat pox virus (GTPV), sheep pox virus (SPPV) and the Lumpy Skin Disease virus (LSDV). Clinically, sheep pox and goat pox have the same symptoms and cannot be distinguished serologically. This presents a real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Capripox outbreaks. A LAMP method was developed for the specific differential detection of GTPV and SPPV using three sets of LAMP primers designed on the basis of ITR sequences. Reactions were performed at 62°C for either 45 or 60 min, and specificity confirmed by successful differential detection of several GTPV and SPPV isolates. No cross reactivity with Orf virus, foot-and-mouth disease virus (FMDV), A. marginale Lushi isolate, Mycoplasma mycoides subsp. capri, Chlamydophila psittaci, Theileria ovis, T. luwenshuni, T. uilenbergi or Babesia sp was noted. RFLP-PCR analysis of 135 preserved epidemic materials revealed 48 samples infected with goat pox and 87 infected with sheep pox, with LAMP test results showing a positive detection for all samples. When utilizing GTPV and SPPV genomic DNA, the universal LAMP primers (GSPV) and GTPV LAMP primers displayed a 100% detection rate; while the SPPV LAMP detection rate was 98.8%, consistent with the laboratory tested results. In summary, the three sets of LAMP primers when combined provide an analytically robust method able to fully distinguish between GTPV and SPPV. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of GTPV and SPPV infections, with the potential to be standardized as a detection method for Capripox viruses in endemic areas.

Dark adaptation during systemic hypoxia induced by chronic respiratory insufficiency.

PubMed

Thylefors, Joakim; Piitulainen, Eeva; Havelius, Ulf

2009-03-01

To investigate dark adaptation during hypoxia in patients with chronic respiratory failure. At three visits, dark adaptation was recorded by computerized dark adaptometry in 13 patients with chronic respiratory insufficiency treated by long-term oxygen therapy. At visits 1 and 3, the patients were administered their usual oxygen supplement. At visit 2, no oxygen was given. At each visit, an analysis of arterial blood gases measured pH, partial pressure of O(2) (Pao(2)), partial pressure of CO(2) (Paco(2)), base excess (BE), standard bicarbonate (HCO(3)), and arterial oxygen saturation. Pulse oximetry (POX) was also recorded. Significant differences were recorded between visits 1 and 2 and between visits 2 and 3 for Pao(2), arterial oxygen saturation, and POX; no differences were found for pH, Paco(2), BE, or HCO(3). No differences were seen between visits 1 and 3 for any of the laboratory parameters. All patients had normal and unchanged dark adaptation at the three visits. Hypoxia in chronic respiratory insufficiency was associated with normal dark adaptation, in contrast to hypoxia in healthy persons at high altitudes, which is known to produce impaired dark adaptation. The result may partly reflect the influence of Paco(2) on the lumen of choroidal and retinal vessels. At high altitudes, with hypocapnic vasoconstriction the oxygen supply to the retina is further compromised, resulting in reduced dark adaptation. The authors hypothesize that respiratory insufficiency with hypercapnia or normocapnia will have larger choroidal and retinal vessel lumens, added to by further dilation of retinal vessels during hypoxia. The tentative net effect would be preserved dark adaptation.

Nascent Phosphorus Oxide

NASA Astrophysics Data System (ADS)

Sumida, David Shuji

PO(X('2)(PI)) is produced via the collision-free infrared multiple photon dissociation (IRMPD) of volatile organophosphorus molecules, and is detected by 2-frequency 2-photon ionization, using the B('2)(SIGMA)('+) state to provide a spectral signature from which X('2)(PI) populations are obtained. Sequential dissociations occur during the IR laser photolysis, in which nascent fragments continue to undergo IRMPD, and PO(X('2)(PI)) accrues from a series of bond fission reactions. Nascent vibrational, rotational, and translational excitations are in sensible accord with this mechanism, except for a few rotational states near J = 19.5. Unlike the nuclear degrees of freedom, the PO(X('2)(PI)) spin-orbit states are populated quite selectively. The ('2)(PI)(,3/2) state, lying only 224 cm('-1) above the ('2)(PI)(,1/2) ground state, contains only (TURN)11% of the population, compared to 34% for a 300K sample. This result is unambiguous; it persists with all precursors, laser fluences, etc., and is verified by comparisons to spectra obtained using a microwave discharge, a flame, and when thermalizing nascent excitations with an inert diluent. This result underscores the sanctity of the separate potential surfaces which correlate to the product spin -orbit states, and the small amount of ('2)(PI)(,3/2) population can be accounted for by non-adiabatic coupling during dissociation, and/or 'freezing' the amount of S(,1) character in an excited precursor in which S(,0) and S(,1) are coupled non-radiatively. We note that such electronic specificity should be dealt with in the analogous recombination reactions. (Copies available exclusively from Micrographics Department, Doheny Library, USC, Los Angeles, CA 90089.).

Oxygen relieves the CO2 and acetate dependency of Lactobacillus johnsonii NCC 533.

PubMed

Hertzberger, Rosanne Y; Pridmore, R David; Gysler, Christof; Kleerebezem, Michiel; Teixeira de Mattos, M Joost

2013-01-01

Oxygen relieves the CO2 and acetate dependency of Lactobacillus johnsonii NCC 533. The probiotic Lactobacillus johnsonii NCC 533 is relatively sensitive to oxidative stress; the presence of oxygen causes a lower biomass yield due to early growth stagnation. We show however that oxygen can also be beneficial to this organism as it relieves the requirement for acetate and CO2 during growth. Both on agar- and liquid-media, anaerobic growth of L. johnsonii NCC 533 requires CO2 supplementation of the gas phase. Switching off the CO2 supply induces growth arrest and cell death. The presence of molecular oxygen overcomes the CO2 dependency. Analogously, L. johnsonii NCC 533 strictly requires media with acetate to sustain anaerobic growth, although supplementation at a level that is 100-fold lower (120 microM) than the concentration in regular growth medium for lactobacilli already suffices for normal growth. Analogous to the CO2 requirement, oxygen supply relieves this acetate-dependency for growth. The L. johnsonii NCC 533 genome indicates that this organism lacks genes coding for pyruvate formate lyase (PFL) and pyruvate dehydrogenase (PDH), both CO2 and acetyl-CoA producing systems. Therefore, C1- and C2- compound production is predicted to largely depend on pyruvate oxidase activity (POX). This proposed role of POX in C2/C1-generation is corroborated by the observation that in a POX deficient mutant of L. johnsonii NCC 533, oxygen is not able to overcome acetate dependency nor does it relieve the CO2 dependency.

Oxygen Relieves the CO2 and Acetate Dependency of Lactobacillus johnsonii NCC 533

PubMed Central

Hertzberger, Rosanne Y.; Pridmore, R. David; Gysler, Christof; Kleerebezem, Michiel; Teixeira de Mattos, M. Joost

2013-01-01

Oxygen relieves the CO2 and acetate dependency of Lactobacillus johnsonii NCC 533. The probiotic Lactobacillus johnsonii NCC 533 is relatively sensitive to oxidative stress; the presence of oxygen causes a lower biomass yield due to early growth stagnation. We show however that oxygen can also be beneficial to this organism as it relieves the requirement for acetate and CO2 during growth. Both on agar- and liquid-media, anaerobic growth of L. johnsonii NCC 533 requires CO2 supplementation of the gas phase. Switching off the CO2 supply induces growth arrest and cell death. The presence of molecular oxygen overcomes the CO2 dependency. Analogously, L. johnsonii NCC 533 strictly requires media with acetate to sustain anaerobic growth, although supplementation at a level that is 100-fold lower (120 microM) than the concentration in regular growth medium for lactobacilli already suffices for normal growth. Analogous to the CO2 requirement, oxygen supply relieves this acetate-dependency for growth. The L. johnsonii NCC 533 genome indicates that this organism lacks genes coding for pyruvate formate lyase (PFL) and pyruvate dehydrogenase (PDH), both CO2 and acetyl-CoA producing systems. Therefore, C1- and C2- compound production is predicted to largely depend on pyruvate oxidase activity (POX). This proposed role of POX in C2/C1-generation is corroborated by the observation that in a POX deficient mutant of L. johnsonii NCC 533, oxygen is not able to overcome acetate dependency nor does it relieve the CO2 dependency. PMID:23468944

Fatal pox infection in a rough-legged hawk

USGS Publications Warehouse

Pearson, G.L.; Pass, D.A.; Beggs, E.C.

1975-01-01

Natural pox infection occurred in a free-living rough-legged hawk (Buteo lagopus) in northeastern North Dakota. Gross, histological and electron microscopic findings were typical of pox infection, and characteristic lesions developed in red-tailed hawks (Buteo jamaicensis) but not in great horned owls (Bubo virginianus) following inoculation with case material. Death of the rough-legged hawk was attributed to starvation resulting from inability to capture prey and to blood loss from foot lesions.

Modeling sheep pox disease from the 1994-1998 epidemic in Evros Prefecture, Greece.

PubMed

Malesios, C; Demiris, N; Abas, Z; Dadousis, K; Koutroumanidis, T

2014-10-01

Sheep pox is a highly transmissible disease which can cause serious loss of livestock and can therefore have major economic impact. We present data from sheep pox epidemics which occurred between 1994 and 1998. The data include weekly records of infected farms as well as a number of covariates. We implement Bayesian stochastic regression models which, in addition to various explanatory variables like seasonal and environmental/meteorological factors, also contain serial correlation structure based on variants of the Ornstein-Uhlenbeck process. We take a predictive view in model selection by utilizing deviance-based measures. The results indicate that seasonality and the number of infected farms are important predictors for sheep pox incidence. Copyright © 2014 Elsevier Ltd. All rights reserved.

Effective Surface Passivation of InP Nanowires by Atomic-Layer-Deposited Al2O3 with POx Interlayer

PubMed Central

2017-01-01

III/V semiconductor nanostructures have significant potential in device applications, but effective surface passivation is critical due to their large surface-to-volume ratio. For InP such passivation has proven particularly difficult, with substantial depassivation generally observed following dielectric deposition on InP surfaces. We present a novel approach based on passivation with a phosphorus-rich interfacial oxide deposited using a low-temperature process, which is critical to avoid P-desorption. For this purpose we have chosen a POx layer deposited in a plasma-assisted atomic layer deposition (ALD) system at room temperature. Since POx is known to be hygroscopic and therefore unstable in atmosphere, we encapsulate this layer with a thin ALD Al2O3 capping layer to form a POx/Al2O3 stack. This passivation scheme is capable of improving the photoluminescence (PL) efficiency of our state-of-the-art wurtzite (WZ) InP nanowires by a factor of ∼20 at low excitation. If we apply the rate equation analysis advocated by some authors, we derive a PL internal quantum efficiency (IQE) of 75% for our passivated wires at high excitation. Our results indicate that it is more reliable to calculate the IQE as the ratio of the integrated PL intensity at room temperature to that at 10 K. By this means we derive an IQE of 27% for the passivated wires at high excitation (>10 kW cm–2), which constitutes an unprecedented level of performance for undoped InP nanowires. This conclusion is supported by time-resolved PL decay lifetimes, which are also shown to be significantly higher than previously reported for similar wires. The passivation scheme displays excellent long-term stability (>7 months) and is additionally shown to substantially improve the thermal stability of InP surfaces (>300 °C), significantly expanding the temperature window for device processing. Such effective surface passivation is a key enabling technology for InP nanowire devices such as nanolasers and solar cells. PMID:28885032

Side-by-side comparison of gene-based smallpox vaccine with MVA in nonhuman primates.

PubMed

Golden, Joseph W; Josleyn, Matthew; Mucker, Eric M; Hung, Chien-Fu; Loudon, Peter T; Wu, T C; Hooper, Jay W

2012-01-01

Orthopoxviruses remain a threat as biological weapons and zoonoses. The licensed live-virus vaccine is associated with serious health risks, making its general usage unacceptable. Attenuated vaccines are being developed as alternatives, the most advanced of which is modified-vaccinia virus Ankara (MVA). We previously developed a gene-based vaccine, termed 4pox, which targets four orthopoxvirus antigens, A33, B5, A27 and L1. This vaccine protects mice and non-human primates from lethal orthopoxvirus disease. Here, we investigated the capacity of the molecular adjuvants GM-CSF and Escherichia coli heat-labile enterotoxin (LT) to enhance the efficacy of the 4pox gene-based vaccine. Both adjuvants significantly increased protective antibody responses in mice. We directly compared the 4pox plus LT vaccine against MVA in a monkeypox virus (MPXV) nonhuman primate (NHP) challenge model. NHPs were vaccinated twice with MVA by intramuscular injection or the 4pox/LT vaccine delivered using a disposable gene gun device. As a positive control, one NHP was vaccinated with ACAM2000. NHPs vaccinated with each vaccine developed anti-orthopoxvirus antibody responses, including those against the 4pox antigens. After MPXV intravenous challenge, all control NHPs developed severe disease, while the ACAM2000 vaccinated animal was well protected. All NHPs vaccinated with MVA were protected from lethality, but three of five developed severe disease and all animals shed virus. All five NHPs vaccinated with 4pox/LT survived and only one developed severe disease. None of the 4pox/LT-vaccinated animals shed virus. Our findings show, for the first time, that a subunit orthopoxvirus vaccine delivered by the same schedule can provide a degree of protection at least as high as that of MVA.

Pulse Oximetry and Auscultation for Congenital Heart Disease Detection.

PubMed

Hu, Xiao-Jing; Ma, Xiao-Jing; Zhao, Qu-Ming; Yan, Wei-Li; Ge, Xiao-Ling; Jia, Bing; Liu, Fang; Wu, Lin; Ye, Ming; Liang, Xue-Cun; Zhang, Jing; Gao, Yan; Zhai, Xiao-Wen; Huang, Guo-Ying

2017-10-01

Pulse oximetry (POX) has been confirmed as a specific screening modality for critical congenital heart disease (CCHD), with moderate sensitivity. However, POX is not able to detect most serious and critical cardiac lesions (major congenital heart disease [CHD]) without hypoxemia. In this study, we investigated the accuracy and feasibility of the addition of cardiac auscultation to POX as a screening method for asymptomatic major CHD. A multicenter prospective observational screening study was conducted at 15 hospitals in Shanghai between July 1, 2012, and December 31, 2014. Newborns with either an abnormal POX or cardiac auscultation were defined as screen positive. All screen-positive newborns underwent further echocardiography. False-negative results were identified by clinical follow-up, parents' feedback, and telephone review. We assessed the accuracy of POX plus cardiac auscultation for the detection of major CHD. CHD screening was completed in all 15 hospitals, with a screening rate of 94.0% to 99.8%. In total, 167 190 consecutive asymptomatic newborn infants were screened, of which 203 had major CHD (44 critical and 159 serious). The sensitivity of POX plus cardiac auscultation was 95.5% (95% confidence interval 84.9%-98.7%) for CCHD and 92.1% (95% confidence interval 87.7%-95.1%) for major CHD. The false-positive rate was 1.2% for detecting CCHD and 1.1% for detecting major CHD. In our current study, we show that using POX plus cardiac auscultation significantly improved the detection rate of major CHD in the early neonatal stage, with high sensitivity and a reasonable false-positive rate. It provides strong evidence and a reliable method for neonatal CHD screening. Copyright © 2017 by the American Academy of Pediatrics.

Individual and Population-Level Impacts of an Emerging Poxvirus Disease in a Wild Population of Great Tits

PubMed Central

Lachish, Shelly; Bonsall, Michael B.; Lawson, Becki; Cunningham, Andrew A.; Sheldon, Ben C.

2012-01-01

Emerging infectious diseases of wildlife can have severe effects on host populations and constitute a pressing problem for biodiversity conservation. Paridae pox is an unusually severe form of avipoxvirus infection that has recently been identified as an emerging infectious disease particularly affecting an abundant songbird, the great tit (Parus major), in Great Britain. In this study, we study the invasion and establishment of Paridae pox in a long-term monitored population of wild great tits to (i) quantify the impact of this novel pathogen on host fitness and (ii) determine the potential threat it poses to population persistence. We show that Paridae pox significantly reduces the reproductive output of great tits by reducing the ability of parents to fledge young successfully and rear those young to independence. Our results also suggested that pathogen transmission from diseased parents to their offspring was possible, and that disease entails severe mortality costs for affected chicks. Application of multistate mark-recapture modelling showed that Paridae pox causes significant reductions to host survival, with particularly large effects observed for juvenile survival. Using an age-structured population model, we demonstrate that Paridae pox has the potential to reduce population growth rate, primarily through negative impacts on host survival rates. However, at currently observed prevalence, significant disease-induced population decline seems unlikely, although pox prevalence may be underestimated if capture probability of diseased individuals is low. Despite this, because pox-affected model populations exhibited lower average growth rates, this emerging infectious disease has the potential to reduce the resilience of populations to other environmental factors that reduce population size. PMID:23185263

Side-by-Side Comparison of Gene-Based Smallpox Vaccine with MVA in Nonhuman Primates

PubMed Central

Golden, Joseph W.; Josleyn, Matthew; Mucker, Eric M.; Hung, Chien-Fu; Loudon, Peter T.; Wu, T. C.; Hooper, Jay W.

2012-01-01

Orthopoxviruses remain a threat as biological weapons and zoonoses. The licensed live-virus vaccine is associated with serious health risks, making its general usage unacceptable. Attenuated vaccines are being developed as alternatives, the most advanced of which is modified-vaccinia virus Ankara (MVA). We previously developed a gene-based vaccine, termed 4pox, which targets four orthopoxvirus antigens, A33, B5, A27 and L1. This vaccine protects mice and non-human primates from lethal orthopoxvirus disease. Here, we investigated the capacity of the molecular adjuvants GM-CSF and Escherichia coli heat-labile enterotoxin (LT) to enhance the efficacy of the 4pox gene-based vaccine. Both adjuvants significantly increased protective antibody responses in mice. We directly compared the 4pox plus LT vaccine against MVA in a monkeypox virus (MPXV) nonhuman primate (NHP) challenge model. NHPs were vaccinated twice with MVA by intramuscular injection or the 4pox/LT vaccine delivered using a disposable gene gun device. As a positive control, one NHP was vaccinated with ACAM2000. NHPs vaccinated with each vaccine developed anti-orthopoxvirus antibody responses, including those against the 4pox antigens. After MPXV intravenous challenge, all control NHPs developed severe disease, while the ACAM2000 vaccinated animal was well protected. All NHPs vaccinated with MVA were protected from lethality, but three of five developed severe disease and all animals shed virus. All five NHPs vaccinated with 4pox/LT survived and only one developed severe disease. None of the 4pox/LT-vaccinated animals shed virus. Our findings show, for the first time, that a subunit orthopoxvirus vaccine delivered by the same schedule can provide a degree of protection at least as high as that of MVA. PMID:22860117

Epizootiology and effect of avian pox on Hawaiian forest birds

USGS Publications Warehouse

van Riper, Charles; van Riper, Sandra G.; Hansen, Wallace R.

2002-01-01

We determined prevalence and altitudinal distribution of forest birds infected with avian pox at 16 locations on Hawaii, from sea level to tree line in mesic and xeric habitats, during 1977–1980. Isolates from lesions were cultured in the laboratory for positive identification of Poxvirus avium. Infected birds from the wild were brought into the laboratory to assess differences in the course of infection in native versus introduced species. We also documented distributions and activity cycles of potential avian pox vectors.Native forest birds were (1) more susceptible to avian pox infection than were introduced species, (2) most likely to be infected during the wet season, and (3) found to have a higher prevalence in mesic when compared to xeric forests. Avian pox occurred in forest birds at all elevations, but highest levels were in the mid-elevational ranges (∼1,200 m) where vectors and native birds had the greatest overlap. Temporal and elevational differences in prevalence were apparent throughout the annual cycle. Avian pox probably did not reach epizootic proportions on Hawaii until after introduction of the mosquito and domestic birds in the early 1800s, and since then has had a negative effect on the population dynamics of native forest birds. Today, this introduced disease is an important factor that should be considered in future conservation efforts that are directed at the recovery of native forest birds in Hawaii.

Triage for Civil Support. Using Military Medical Assets to Respond to Terrorist Attacks

DTIC Science & Technology

2004-01-01

chicken pox , ma- laria, viral syndromes, and meningitis gave way to the suspicion that one or more of the pa- tients may have contracted smallpox. While...awaiting the results of an infectious disease consultation on a patient that appeared to be too ill to have chicken pox (raising the strong suspicion...Whiteman Air Force Base (home to 150 nuclear-armed ICBMs). • (April 2003) A misdiagnosis of chicken pox as smallpox at a major Nashville hospital

The Role of the U.S. Army Forces Command in Project New Arrivals. Reception and Care of Refugees from Vietnam,

DTIC Science & Technology

1981-09-01

epidemic of chicken pox in the refugee area became a cause for concern because of the arrival of 368 Thai Dams (also known as Black Thais) from Thailand...wounds which, coupled with the refugees’ lowered resistance resulting from the vaccinations and travel fatigue and the presence of chicken pox in the...lengthy and expensive treat- ment required -- and chicken pox which ravaged both children and adults. The latter disease did not consititue a significant

[Chicken pox recurrence revealing a renal adenocarcinoma in an adult].

PubMed

Thieulent, N; Grezard, P; Wolf, F; Barrut, D; Perrot, H

2000-09-01

A new episode of chicken pox in adults who had a well documented infection previously is usually observed in immunocompromised individuals. The principal immunodeficiency factors are hematology diseases, acquired immunodeficiency disease and old age. We report here the case of a young woman who after a contaminating contact presented a recurrence of typical chicken pox. Morphological investigations evidenced a right kidney tumor which pathology revealed to be a renal adenocarcinoma. We discuss this pathological association and review cases reported in the literature.

Resolution of chicken pox neuroretinitis with oral acyclovir: a case report.

PubMed

Biswas, Jyotirmay; Nagpal, Amit; Chopra, Sumeet; Karna, Satya

2003-12-01

It is usual to consider chicken pox as a benign infectious disease with a few anterior segment ocular complications like conjunctivitis, keratitis, episcleritis, scleritis, iridocyclitis, and glaucoma. The retinal manifestations are necrotising retinitis, vitritis, neuroretinitis, and retinal detachments. We report a case of neuroretinitis following chicken pox in a 23-year-old male. The complication was resolved by treatment with oral acyclovir in combination with systemic steroids. This report highlights the necessity for fundus examination in cases of chickenpox exhibiting visual symptoms.

Evaluation of a commercial vaccine against avian poxvirus in turkeys kept in the backyard system in the state of Yucatan, Mexico.

PubMed

Estrella-Tec, J E; Gutiérrez-Ruiz, E J; Ramírez-González, S; Aranda-Cirerol, F; Santos-Ricalde, R; Puerto-Nájera, J L

2013-12-01

One hundred and sixty 1-month-old turkey poults were delivered to 40 households in four communities of the State of Yucatan, Mexico. The poults were divided into two populations, one vaccinated and the other non-vaccinated against avian pox. During three months, monthly visits were carried out in order to monitor the appearance of lesions suggesting avian pox in the birds delivered. Each turkey was clinically examined, searching for characteristic avian pox lesions that were classified according to the degree of severity observed. The true incidence rate and the cumulative incidence rate of avian pox were determined and the true incidence and cumulative incidence rates of mortality were determined and the relative risks calculated. The true incidence rates for avian pox in vaccinated and non-vaccinated birds were 1.5 and 1.47 respectively. The cumulative incidence rates were 0.94 and 0.90 for vaccinated and non-vaccinated birds, respectively. The comparison for the whole period between vaccinated and non-vaccinated groups did not show a significant statistical difference for mortality. However, when mortality was compared between vaccinated and non-vaccinated turkeys for each month of the study, there was a statistically significant difference for the first month (relative risk = 0.216, confidence interval 0.069 to 0.676). In addition, when the severity of pox lesions between groups was compared, statistically significant differences were found in favour of the vaccinated birds (P < 0.0001).

Failure of a recombinant fowl poxvirus vaccine containing an avian influenza hemagglutinin gene to provide consistent protection against influenza in chickens preimmunized with a fowl pox vaccine.

PubMed

Swayne, D E; Beck, J R; Kinney, N

2000-01-01

Vaccines against mildly pathogenic avian influenza (AI) have been used in turkeys within the United States as part of a comprehensive control strategy. Recently, AI vaccines have been used in control programs against highly pathogenic (HP) AI of chickens in Pakistan and Mexico. A recombinant fowl pox-AI hemagglutinin subtype (H) 5 gene insert vaccine has been shown to protect specific-pathogen-free chickens from HP H5 AI virus (AIV) challenge and has been licensed by the USDA for emergency use. The ability of the recombinant fowl pox vaccine to protect chickens preimmunized against fowl pox is unknown. In the current study, broiler breeders (BB) and white leghorn (WL) pullets vaccinated with a control fowl poxvirus vaccine (FP-C) and/or a recombinant fowl poxvirus vaccine containing an H5 hemagglutinin gene insert (FP-HA) were challenged with a HP H5N2 AIV isolated from chickens in Mexico. When used alone, the FP-HA vaccine protected BB and WL chickens from lethal challenge, but when given as a secondary vaccine after a primary FP-C immunization, protection against a HP AIV challenge was inconsistent. Both vaccines protected against virulent fowl pox challenge. This lack of consistent protection against HPAI may limit use to chickens without previous fowl pox vaccinations. In addition, prior exposure to field fowl poxvirus could be expected to limit protection induced by this vaccine.

Seasonal variation and trend of chicken pox in the southern region of Saudi Arabia (2007-2012).

PubMed

Saleh, Noha; Al Moghazy, Bassem

2014-12-01

Chicken pox is a contagious disease caused by varicella zoster virus. Children are most susceptible to infection. In 1998, the WHO recommended that routine childhood varicella vaccination be considered in countries where the disease is a relatively important public health concern. There are few data on the trends of chicken pox. We aimed to evaluate the trend of chicken pox in Saudi Arabia (KSA) during the period 2007-2012. Data were collected by retrospective review of the existing anonymous surveillance records and book registries of chicken pox cases at the preventive medicine department of Armed Forces Hospital of the Southern Region of Saudi Arabia from 2007 to 2012. The collected data included the number, age, and sex of registered cases. A seasonal pattern was clearly demonstrated, with peak in March and April. There was also a decreasing trend from 2007 to 2012. Most cases occurred in the age group 4-15 years. The number of infected male patients was a little higher compared with female patients. These results indicate success in controlling the disease in the southern region of Saudi Arabia, which may be attributed to the implementation of public health interventions targeted at reducing infectious diseases (such as the introduction of varicella zoster vaccine in 2008). We recommend that a future study be conducted on the severity of chicken pox infection in adults (hospitalization, complications, and death) and a national survey among adults for the seroprevalence of markers of infection with varicella zoster.

The activity of antioxidant enzymes in response to salt stress in safflower (Carthamus tinctorius L.) and sunflower (Helianthus annuus L.) seedlings raised from seed treated with chitosan.

PubMed

Jabeen, Nusrat; Ahmad, Rafiq

2013-05-01

Salt tolerance is a complex trait which involves the coordinated action of many genes that perform a variety of functions, such as ion sequestration, metabolic adjustment, osmotic adjustment and antioxidative defence. In this article, the growth and the generation and scavenging of reactive oxygen species (ROS) under normal (ECiw [Electrical conductivity of irrigation water] = 0.5 dS m(-1)) and salt stress conditions (ECiw = 3.4, 6.1, 8.6 and 10.8 dS m(-1) ) in relation to the priming of seeds of the two important oil yielding crops, i.e. safflower and sunflower, with different concentrations of chitosan [0% (control), 0.25%, 0.50%, 0.75%] is discussed. Induced salinity stress significantly decreased germination percentage, germination rate, length and weight of root and shoot, and protein content. Proline content, malondialdehyde content (MDA), catalase (CAT) and peroxidase (POX) activity increased at 10.8 dS m(-1). Under control conditions there were no significant differences in germination percentage among different concentrations of chitosan, whereas CAT and POX activity were increased by low concentrations of chitosan. With increasing salt stress, low concentrations of chitosan increased germination percentage but decreased MDA and proline contents and CAT and POX activity. Generation of ROS seems to be unavoidable under normal conditions and the activity of antioxidant enzymes in plants varies in terms of ROS generation under salt stress. However, the data indicate that plants subjected to salt stress-induced oxidative stress and the low concentrations of chitosan exhibited positive effects on salt stress alleviation through the reduction of enzyme activity in both crops. © 2012 Society of Chemical Industry.

Characterization of sour cherry isolates of plum pox virus from the Volga Basin in Russia reveals a new cherry strain of the virus.

PubMed

Glasa, Miroslav; Prikhodko, Yuri; Predajňa, Lukáš; Nagyová, Alžbeta; Shneyder, Yuri; Zhivaeva, Tatiana; Subr, Zdeno; Cambra, Mariano; Candresse, Thierry

2013-09-01

Plum pox virus (PPV) is the causal agent of sharka, the most detrimental virus disease of stone fruit trees worldwide. PPV isolates have been assigned into seven distinct strains, of which PPV-C regroups the genetically distinct isolates detected in several European countries on cherry hosts. Here, three complete and several partial genomic sequences of PPV isolates from sour cherry trees in the Volga River basin of Russia have been determined. The comparison of complete genome sequences has shown that the nucleotide identity values with other PPV isolates reached only 77.5 to 83.5%. Phylogenetic analyses clearly assigned the RU-17sc, RU-18sc, and RU-30sc isolates from cherry to a distinct cluster, most closely related to PPV-C and, to a lesser extent, PPV-W. Based on their natural infection of sour cherry trees and genomic characterization, the PPV isolates reported here represent a new strain of PPV, for which the name PPV-CR (Cherry Russia) is proposed. The unique amino acids conserved among PPV-CR and PPV-C cherry-infecting isolates (75 in total) are mostly distributed within the central part of P1, NIa, and the N terminus of the coat protein (CP), making them potential candidates for genetic determinants of the ability to infect cherry species or of adaptation to these hosts. The variability observed within 14 PPV-CR isolates analyzed in this study (0 to 2.6% nucleotide divergence in partial CP sequences) and the identification of these isolates in different localities and cultivation conditions suggest the efficient establishment and competitiveness of the PPV-CR in the environment. A specific primer pair has been developed, allowing the specific reverse-transcription polymerase chain reaction detection of PPV-CR isolates.

An inquiry into the causes and effects of the variolae (or Cow-pox. 1798).

PubMed

Jenson, Alfred B; Ghim, Shin-Je; Sundberg, John P

2016-03-01

Few papers have had a greater impact on the health of the human species than the simple, yet elegant, observations and clinical trials of Edward Jenner with what was at the time called the Cow Pox. In fact, this was a naturally attenuated rodent (probably rat) pox that could infect horses and, through farriers and farm hands, dairy cattle. While commonly called the Cow Pox at the time, Jenner's transmission studies between humans used infectious materials from horses. His methods provided protection from the serious effects of smallpox infections. In 1977, smallpox was considered to be eradicated, although people continue to be infected by pox viruses from other mammalian species. We consider this to be our 'favorite historical paper' because it emphasizes careful clinical observation followed by relatively simple clinical testing can have a profound influence on human health, even when almost nothing is known about the underlying molecular mechanisms. Continued follow-up with strict attention to detail resulted in a crude but effective way to deal with an epidemic, methods still used today for containing infectious diseases. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

PubMed

Rawal, H C; Singh, N K; Sharma, T R

2013-01-01

Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

Vitiligo iridis and glaucoma: a rare sequelae of small pox.

PubMed

Kavitha, S; Patel, S R; Mohini, P; Venkatesh, R; Sengupta, S

2015-10-01

Vitiligo iridis refers to focal areas of iris atrophy as sequelae of small pox infection. We report a series of patients with unilateral vitiligo iridis, some of whom presented with secondary open-angle glaucoma. Three patients with vitiligo iridis underwent a comprehensive ophthalmic examination including intraocular pressure (IOP) measurement, slit lamp biomicroscopy, gonioscopy, and fundus evaluation. Patients' facial features were also documented and photographed. All patients were in their sixth decade. Two out the three had elevated IOP (52 mm Hg and 36 mm Hg) in the same eye as vitiligo iridis, at initial presentation. Gonioscopy showed patchy iris hyperpigmentation and fundus evaluation showed glaucomatous optic disc changes in the involved eye. One patient responded favourably to topical antiglaucoma medications, whereas the other was taken up for combined phacoemulsification-trabeculectomy with good results. The third patient had normal IOP in the involved eye. All three patients gave a history of small pox in childhood and had pitted facial scars typical of previous small pox infection. Vitiligo iridis may be associated with the secondary glaucoma as a long-term sequelae of small pox. It may be prudent to periodically follow-up such patients for development of raised IOP in the future.

Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

PubMed Central

Rawal, H. C.; Singh, N. K.; Sharma, T. R.

2013-01-01

Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future. PMID:23671845

Hepatoprotective and antioxidant effects of single clove garlic against CCl4-induced hepatic damage in rabbits.

PubMed

Naji, Khalid Mohammed; Al-Shaibani, Elham Shukri; Alhadi, Fatima A; Al-Soudi, Safa'a Abdulrzaq; D'souza, Myrene R

2017-08-17

The increase in demand and consumption of single clove garlic or 'Solo garlic' (Allium sativum) has resulted in an increase in research on its therapeutic properties. The present study aims to evaluate the antioxidant activities, oxidant-scavenging efficiency and preventive effects of SCG (single clove garlic) and MCG (multi clove garlic) on CCl 4 -induced acute hepatotoxicity in male rabbits. For this purpose, rabbits were orally administered with 3 ml of CCl 4 /kg of body weight, followed by 0.8 g of MCG or SCG/kg twice a week for three successive weeks. Oxidative hepatotoxicity was then assessed. SCG extracts exhibited higher antioxidant capacity than the MCG extract. Scavenging ability of SCG showed significant (p < 0.05) elevation against 2,2-diphenyl-1-picrylhydrazyl (DPPH) and superoxide radicals in comparison to MCG. In addition, total phenolic content of SCG was significantly elevated (p < 0.001), thereby suggesting that the composition of garlic storage constituents varies with the number of cloves present. CCl 4 -induced hepatotoxicity demonstrated histological changes including severe damage in the structure of liver tissues which correlated well to oxidative stress levels. Simultaneously, administration of SCG resulted in a significant reduction of serum alkaline phosphatase (ALP), aspartate aminotransferase (AST), alanine aminotransferase (ALT), and total bilirubin (TB) levels in addition to improvement in some histological parameters. Low levels of lipid peroxidation (malondialdehyde, MDA) (p < 0.001), along with a huge reduction in peroxidase (POx) (p < 0.001) revealed protection against oxidative toxicity in the liver homogenate. Higher levels of catalase (CAT) (p < 0.001) and superoxide dismutase (SOD) (p < 0.05) when compared to the MCG test (TM) group indicates that removal of H 2 O 2 is based on CAT activity in SCG test (TS) group rather than the POx activity demonstrated in the former group. The present study indicates that SCG possesses more protective ability than MCG against CCl 4 -induced liver injury and might be an effective alternative medicine against acute oxidative liver toxicity.

Reforming options for hydrogen production from fossil fuels for PEM fuel cells

NASA Astrophysics Data System (ADS)

Ersoz, Atilla; Olgun, Hayati; Ozdogan, Sibel

PEM fuel cell systems are considered as a sustainable option for the future transport sector in the future. There is great interest in converting current hydrocarbon based transportation fuels into hydrogen rich gases acceptable by PEM fuel cells on-board of vehicles. In this paper, we compare the results of our simulation studies for 100 kW PEM fuel cell systems utilizing three different major reforming technologies, namely steam reforming (SREF), partial oxidation (POX) and autothermal reforming (ATR). Natural gas, gasoline and diesel are the selected hydrocarbon fuels. It is desired to investigate the effect of the selected fuel reforming options on the overall fuel cell system efficiency, which depends on the fuel processing, PEM fuel cell and auxiliary system efficiencies. The Aspen-HYSYS 3.1 code has been used for simulation purposes. Process parameters of fuel preparation steps have been determined considering the limitations set by the catalysts and hydrocarbons involved. Results indicate that fuel properties, fuel processing system and its operation parameters, and PEM fuel cell characteristics all affect the overall system efficiencies. Steam reforming appears as the most efficient fuel preparation option for all investigated fuels. Natural gas with steam reforming shows the highest fuel cell system efficiency. Good heat integration within the fuel cell system is absolutely necessary to achieve acceptable overall system efficiencies.

A comparison of hydrogen, methanol and gasoline as fuels for fuel cell vehicles: implications for vehicle design and infrastructure development

NASA Astrophysics Data System (ADS)

Ogden, Joan M.; Steinbugler, Margaret M.; Kreutz, Thomas G.

All fuel cells currently being developed for near term use in electric vehicles require hydrogen as a fuel. Hydrogen can be stored directly or produced onboard the vehicle by reforming methanol, or hydrocarbon fuels derived from crude oil (e.g., gasoline, diesel, or middle distillates). The vehicle design is simpler with direct hydrogen storage, but requires developing a more complex refueling infrastructure. In this paper, we present modeling results comparing three leading options for fuel storage onboard fuel cell vehicles: (a) compressed gas hydrogen storage, (b) onboard steam reforming of methanol, (c) onboard partial oxidation (POX) of hydrocarbon fuels derived from crude oil. We have developed a fuel cell vehicle model, including detailed models of onboard fuel processors. This allows us to compare the vehicle performance, fuel economy, weight, and cost for various vehicle parameters, fuel storage choices and driving cycles. The infrastructure requirements are also compared for gaseous hydrogen, methanol and gasoline, including the added costs of fuel production, storage, distribution and refueling stations. The delivered fuel cost, total lifecycle cost of transportation, and capital cost of infrastructure development are estimated for each alternative. Considering both vehicle and infrastructure issues, possible fuel strategies leading to the commercialization of fuel cell vehicles are discussed.

Chicken pox infection in patients undergoing chemotherapy: A retrospective analysis from a tertiary care center in India.

PubMed

Noronha, Vanita; Ostwal, Vikas; Ramaswamy, Anant; Joshi, Amit; Nair, Reena; Banavali, Shripad D; Prabhash, Kumar

There is paucity of data on the incidence, severity and management of chicken pox in patients receiving active chemotherapy for cancer. From October 2010 to October 2011, patients were included in this study if they developed a chicken pox infection during their chemotherapy. The details of patients' cancer diagnosis and treatment along with clinical and epidemiological data of the chicken pox infections were assessed from a prospectively maintained database. Twenty-four patients had a chicken pox infection while receiving chemotherapy and/or radiotherapy. The median age of the patients was 21 years, and two-thirds of the patients had solid tumor malignancies. Overall, eight (33%) patients had complications, six (25%) patients had febrile neutropenia, four (17%) had diarrhea/mucositis, and four (17%) had pneumonia. The median time for recovery of the infection and complications in the patients was 9.5 days (5-29 days), whereas for neutropenic patients, it was 6.5 days (3-14 days). The median time for recovery from chicken pox infections in neutropenic patients was 10 days (5-21 days), compared with 8.5 days (0-29 days) in non-neutropenic patients (P=0.84). The median time for recovery from infections was 8.5 days in patients with comorbidities (N=4), which was the same for patients with no comorbidities. The clinical presentation and complication rates of chicken pox in cancer patients, who were on active chemotherapy, are similar to the normal population. The recovery from a varicella infection and complications may be delayed in patients with neutropenia. The varicella infection causes a therapy delay in 70% of patients. Aggressive antiviral therapy, supportive care and isolation of the index cases remain the backbone of treatment. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

Acute pancreatitis : complication of chicken pox in an immunocompetent host.

PubMed

Roy, Pinaki; Maity, Pranab; Basu, Arindam; Dey, Somitra; Das, Biman; Ghosh, U S

2012-12-01

Chicken pox is a benign self limited disease. But it may rarely be complicated with acute pancreatitis in otherwise healthy patient. We present a case of varicella pancreatitis and its marked recovery with acyclovir.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Seroprevalence of Sheep and Goat Pox, Peste Des Petits Ruminants and Rift Valley Fever in Saudi Arabia.

PubMed

Boshra, Hani; Truong, Thang; Babiuk, Shawn; Hemida, Maged Gomaa

2015-01-01

Sheep and goat pox, peste des petits ruminants and Rift Valley fever are important diseases of small ruminant livestock. Sheep and goat pox, along with peste des petits ruminants, are endemic throughout most of Africa, Asia and the Middle East. Whereas Rift Valley fever is endemic in Africa, outbreaks in the Middle East have been reported over the past decade, including the Arabian Peninsula. Saudi Arabia is a major importer of livestock, and understanding the prevalence of these viral infections would be useful for disease control. In this study, sera from sheep and goats were collected from 3 regions in Saudi Arabia. They were evaluated for antibodies specific to sheep and goat pox, peste des petits ruminants and Rift Valley fever by virus neutralization assays. To the best of our knowledge, this is the first study to evaluate the seroprevalence of these viruses in sheep and goats.

Plum pox virus capsid protein suppresses plant pathogen-associated molecular pattern (PAMP)-triggered immunity.

PubMed

Nicaise, Valerie; Candresse, Thierry

2017-08-01

The perception of pathogen-associated molecular patterns (PAMPs) by immune receptors launches defence mechanisms referred to as PAMP-triggered immunity (PTI). Successful pathogens must suppress PTI pathways via the action of effectors to efficiently colonize their hosts. So far, plant PTI has been reported to be active against most classes of pathogens, except viruses, although this defence layer has been hypothesized recently as an active part of antiviral immunity which needs to be suppressed by viruses for infection success. Here, we report that Arabidopsis PTI genes are regulated upon infection by viruses and contribute to plant resistance to Plum pox virus (PPV). Our experiments further show that PPV suppresses two early PTI responses, the oxidative burst and marker gene expression, during Arabidopsis infection. In planta expression of PPV capsid protein (CP) was found to strongly impair these responses in Nicotiana benthamiana and Arabidopsis, revealing its PTI suppressor activity. In summary, we provide the first clear evidence that plant viruses acquired the ability to suppress PTI mechanisms via the action of effectors, highlighting a novel strategy employed by viruses to escape plant defences. © 2016 BSPP AND JOHN WILEY & SONS LTD.

Ripening and storage conditions of Chétoui and Arbequina olives: Part II. Effect on olive endogenous enzymes and virgin olive oil secoiridoid profile determined by high resolution mass spectrometry.

PubMed

Hachicha Hbaieb, Rim; Kotti, Faten; Cortes-Francisco, Nuria; Caixach, Josep; Gargouri, Mohamed; Vichi, Stefania

2016-11-01

Several factors affect virgin olive oil (VOO) phenolic profile. The aim of this study was to monitor olive hydrolytic (β-glucosidase) and oxidative (peroxydase, POX, and polyphenoloxydase, PPO) enzymes during olive ripening and storage and to determine their capacity to shape VOO phenolic profile. To this end, olives from the cultivars Chétoui and Arbequina were stored at 4°C or 25°C for 4weeks and their enzymatic activities and oil phenolic profiles were compared to those of ripening olives. We observed different trends in enzymes activities according to cultivar and storage temperature. Secoiridoid compounds, determined by high resolution mass spectrometry (HRMS), and their deacetoxylated, oxygenated, and deacetoxy-oxygenated derivatives were identified and their contents differed between the cultivars according to olive ripening degree and storage conditions. These differences could be due to β-glucosidase, POX and PPO activities changes during olive ripening and storage. Results also show that oxidised phenolic compounds could be a marker of VOO ''freshness". Copyright © 2016 Elsevier Ltd. All rights reserved.

Toxicity of diesel water accommodated fraction toward microalgae, Pseudokirchneriella subcapitata and Chlorella sp. MM3.

PubMed

Ramadass, Kavitha; Megharaj, Mallavarapu; Venkateswarlu, Kadiyala; Naidu, Ravi

2017-08-01

Diesel is a commonly used fuel and a key pollutant on water surface through leaks and accidental spills, thus creating risk directly to planktons as well as other aquatic organisms. We assessed the toxicty of diesel and its water accommodated fraction (WAF) towards two microalgal species, Pseudokirchneriella subcapitata and Chlorella sp. MM3. The toxicity criteria included were: chlorophyll a content as a growth parameter and induction of enzyme activities linked to oxidative stress. Increase in concentrations of diesel or its WAF significantly increased toxicity towards growth, measured in terms of chlorophyll a content in both the algae. Activities of antioxidant enzymes such as superoxide dismutase (SOD), peroxidase (POX) and catalase (CAT) in response to addition of diesel or diesel WAF to the microalgal cultures were dose-dependent. Diesel WAF was more toxic than diesel itself, suggesting that use of WAF may be more relevant for environmental risk assessment of diesel. The overall response of the antioxidant enzymes to toxicants' stress followed the order: POX≥SOD>CAT. The present study clearly demonstrated the use of SOD, POX and CAT as suitable biomarkers for assessing diesel pollution in aquatic ecosystem. Copyright © 2017 Elsevier Inc. All rights reserved.

Assessment of nanofiltration and reverse osmosis potentialities to recover metals, sulfuric acid, and recycled water from acid gold mining effluent.

PubMed

Ricci, Bárbara C; Ferreira, Carolina D; Marques, Larissa S; Martins, Sofia S; Amaral, Míriam C S

This work assessed the potential of nanofiltration (NF) and reverse osmosis (RO) to treat acid streams contaminated with metals, such as effluent from the pressure oxidation process (POX) used in refractory gold ore processing. NF and RO were evaluated in terms of rejections of sulfuric acid and metals. Regarding NF, high sulfuric acid permeation (∼100%), was observed, while metals were retained with high efficiencies (∼90%), whereas RO led to high acid rejections (<88%) when conducted in pH values higher than 1. Thus, sequential use of NF and RO was proved to be a promising treatment for sulfuric acid solutions contaminated by metals, such as POX effluent. In this context, a purified acid stream could be recovered in NF permeate, which could be further concentrated in RO. Recovered acid stream could be reused in the gold ore processing or commercialized. A metal-enriched stream could be also recovered in NF retentate and transferred to a subsequent metal recovery stage. In addition, considering the high acid rejection obtained through the proposed system, RO permeate could be used as recycling water.

Characterization of structure and activity of garlic peroxidase (POX(1B)).

PubMed

El Ichi, Sarra; Miodek, Anna; Sauriat-Dorizon, Hélène; Mahy, Jean-Pierre; Henry, Céline; Marzouki, Mohamed Nejib; Korri-Youssoufi, Hafsa

2011-01-01

Structural characterization and study of the activity of new POX(1B) protein from garlic which has a high peroxidase activity and can be used as a biosensor for the detection of hydrogen peroxide and phenolic compounds were performed and compared with the findings for other heme peroxidases. The structure-function relationship was investigated by analysis of the spectroscopic properties and correlated to the structure determined by a new generation of high-performance hybrid mass spectrometers. The reactivity of the enzyme was analyzed by studies of the redox activity toward various ligands and the reactivity with various substrates. We demonstrated that, in the case of garlic peroxidase, the heme group is pentacoordinated, and has an histidine as a proximal ligand. POX(1B) exhibited a high affinity for hydrogen peroxide as well as various reducing cosubstrates. In addition, high enzyme specificity was demonstrated. The k(cat) and K(M) values were 411 and 400 mM(-1) s(-1) for 3,3',5,5'-tetramethylbenzidine and 2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid), respectively. Furthermore, the reduction of nitro compounds in the presence of POX(1B) was demonstrated by iron(II) nitrosoalkane complex assay. In addition, POX(1B) showed a great potential for application for drug metabolism since its ability to react with 1-nitrohexane in the presence of sodium dithionite was demonstrated by the appearance of a characteristic Soret band at 411 nm. The high catalytic efficiency obtained in the case of the new garlic peroxidase (POX(1B)) is suitable for the monitoring of different analytes and biocatalysis.

[Social and economic impact of chicken pox vaccine at 15 months of age. Castile and Leon, Spain, 2004].

PubMed

Pérez-Rubio, A; Castrodeza Sanz, J J; Gil Costa, M; Luquero Alcalde, F J; Eiros Bouza, J; Ortiz de Lejarazu, R

2008-01-01

Chicken pox is a mainly childhood contagious disease caused by the Varicella Zoster Virus which gives rise to major healthcare and social costs. In 2005, Castile and Leon added chicken pox vaccine injections to its childhood vaccination schedule for eleven year-olds subject to coming down with this disease. This strategy does not modify the major mobility generated thereby at younger ages. This study is aimed at evaluating the profitability of systematic vaccination for chicken pox in infants 15 months of age in Castile and Leon. An economic cost-benefit evaluation has been set out by jeans of a decision-making tree. A fictitious cohort of 100,000 children in Castile and Leon having reached 15 months of age in 2004 is studied, to whom the chicken pox vaccine would be administered in conjunction with the mumps, measles, rubella vaccines. This study is approached from the social standpoint. The time horizon selected was that of up until the study cohort was to reach 15 years of age, applying a 3% discount rate. A sensitivity analysis was made for evaluating the uncertainty of some variables... The cost-benefit ratio of adding this vaccine to the childhood vaccination schedule amounts to 1.23. From the social standpoint, administering chicken pox vaccine in conjunction with the mumps, measles, rubella vaccines show itself to be profitable. The profitability is modified both if a second dose of vaccine is added as well as if only the direct healthcare costs are analyzed.

Auto immune hemolytic anemia in a child precipitated by chicken pox.

PubMed

Billoo, Samina Shamim; Jamalvi, Syed Waseem

2008-05-01

Auto Immune Hemolytic Anemia (AIHA) is a rare entity in children. We report a case of an adolescent girl with AIHA, which was precipitated by chicken pox. Clinical course over 3 years, till remission is described.

Detection, identification, and differentiation of sheep pox virus and goat pox virus from clinical cases in Giza Governorate, Egypt

PubMed Central

Mahmoud, M. A.; Khafagi, M. H.

2016-01-01

Aim: To isolate, identify, and differentiate Capripoxviruses (CaPV) (sheep pox virus and goat pox virus) infections by egg inoculation, transmission electron microscopy (TEM), and 30 kDa RNA polymerase subunit gene-based polymerase chain reaction (PCR) (RPO30) in clinically affected animals in Hawamdia township of Giza Governorate, Egypt. Materials and Methods: A total of 37 scab samples were collected from clinically suspected field cases of sheep pox and goat pox. These samples were collected during (2014-2015) during different outbreaks of sheep pox and goat pox from Hawamdia township of Giza Governorate, Egypt. The samples were subjected to egg inoculation, TEM, and (RPO30) gene-based PCR. By using the egg inoculation: Previously prepared 37 scab samples (n=23 sheep and n=14 goats) were inoculated on the chorioallantoic membrane of specific pathogen free (SPF) embryonated chicken eggs (12 days old age). In the presence of the suitable percentage of humidity and candling, the inoculated eggs were incubated at 37°C. By using the TEM: Samples showed positive pock lesions on the chorioallantoic membranes, were fixed in glutaraldehyde, then processed and sectioned for TEM. Using the (RPO30) gene-based PCR assay, 30 of positive samples after egg inoculation (n=19 sheep and n=11 goats) were screened. Results: Using the egg inoculation, a characteristic pock lesions for poxviruses were seen in 30/37 (n=19 sheep and n=11 goats) (81.08%). Using the TEM, examination of the positive samples after egg inoculation revealed positive result in 23/30 (n=15 sheep and n=8 goats) (76.66%). The positive results represented by the presence of negatively stained oval-shape virus particles. Using the (RPO30) gene-based PCR assay, out of 30 total of positive samples after egg inoculation (n=19 sheep and n=11 goats) were screened, 27 (90%) samples (n=17 sheep and n=10 goats) were positive. The given band sizes of sheep and goats were 172 and 152 bp, respectively. Conclusion: PCR assay depended on RPO30 gene can be used lonely for the detection, identification, and differentiation of CaPVs. RPO30 gene-based PCR assay in combination with gene sequencing helps in molecular epidemiological studies of CaPV infection. PMID:28096619

Detection, identification, and differentiation of sheep pox virus and goat pox virus from clinical cases in Giza Governorate, Egypt.

PubMed

Mahmoud, M A; Khafagi, M H

2016-12-01

To isolate, identify, and differentiate Capripoxviruses (CaPV) (sheep pox virus and goat pox virus) infections by egg inoculation, transmission electron microscopy (TEM), and 30 kDa RNA polymerase subunit gene-based polymerase chain reaction (PCR) (RPO30) in clinically affected animals in Hawamdia township of Giza Governorate, Egypt. A total of 37 scab samples were collected from clinically suspected field cases of sheep pox and goat pox. These samples were collected during (2014-2015) during different outbreaks of sheep pox and goat pox from Hawamdia township of Giza Governorate, Egypt. The samples were subjected to egg inoculation, TEM, and (RPO30) gene-based PCR. By using the egg inoculation: Previously prepared 37 scab samples (n=23 sheep and n=14 goats) were inoculated on the chorioallantoic membrane of specific pathogen free (SPF) embryonated chicken eggs (12 days old age). In the presence of the suitable percentage of humidity and candling, the inoculated eggs were incubated at 37°C. By using the TEM: Samples showed positive pock lesions on the chorioallantoic membranes, were fixed in glutaraldehyde, then processed and sectioned for TEM. Using the (RPO30) gene-based PCR assay, 30 of positive samples after egg inoculation (n=19 sheep and n=11 goats) were screened. Using the egg inoculation, a characteristic pock lesions for poxviruses were seen in 30/37 (n=19 sheep and n=11 goats) (81.08%). Using the TEM, examination of the positive samples after egg inoculation revealed positive result in 23/30 (n=15 sheep and n=8 goats) (76.66%). The positive results represented by the presence of negatively stained oval-shape virus particles. Using the (RPO30) gene-based PCR assay, out of 30 total of positive samples after egg inoculation (n=19 sheep and n=11 goats) were screened, 27 (90%) samples (n=17 sheep and n=10 goats) were positive. The given band sizes of sheep and goats were 172 and 152 bp, respectively. PCR assay depended on RPO30 gene can be used lonely for the detection, identification, and differentiation of CaPVs. RPO30 gene-based PCR assay in combination with gene sequencing helps in molecular epidemiological studies of CaPV infection.

Applications of Heider's p-o-x Balance Model to Classroom Situations

ERIC Educational Resources Information Center

Richey, Harold; Richey, Marjorie H.

1975-01-01

Some selected principles of Heider's balance theory are presented and the p-o-x model is explained as a theoretical framework for predicting responses to interpersonal situations in which the participants are in attitudinal agreement or disagreement. (Author)

Presetting ECG electrodes for earlier heart rate detection in the delivery room.

PubMed

Gulati, Rashmi; Zayek, Michael; Eyal, Fabien

2018-07-01

To determine whether heart rate (HR) could be detected earlier than by pulse oximeter (POX), using a novel method of application of electrocardiogram (ECG) electrodes during neonatal resuscitation in the delivery room. ECG electrodes were set before delivery to be applied to the back of infants' thorax. Time to detect HR was recorded as soon as a numerical HR along with a recognizable and persistent QRS complex was observed on ECG monitor (HRECG) and a plethysmographic waveform was seen on POX monitor (HRPOX). Out of 334 infants, 49 were <31 weeks of gestational age. Overall, the median (interquartile range, IQR) time to detect HRECG was significantly shorter [29 (5, 60) seconds] than time by POX [60 (45,120) seconds], (p < 0.001). Similarly, in <31-week infants, the median (IQR) time to detect HRECG was 10 (2, 40) seconds compared to 60 (30,120) seconds by POX, (p < 0.001). Failure to have HR detected by 1 minute occurred in 30%, 54% and 20% of infants by ECG, POX and either of the devices, respectively. In the delivery room, electrodes applied by the study method are more effective than pulse oximetry in providing the neonatal team with timely HR information that is necessary for proper resuscitative actions. Published by Elsevier B.V.

POX 52: A Dwarf Seyfert 1 Galaxy with an Intermediate-Mass Black Hole

NASA Astrophysics Data System (ADS)

Barth, Aaron J.; Ho, Luis C.; Rutledge, Robert E.; Sargent, Wallace L. W.

2004-05-01

We describe new optical images and spectra of POX 52, a dwarf galaxy with an active nucleus that was originally detected in the POX objective-prism survey. While POX 52 was originally thought to be a Seyfert 2 galaxy, the new data reveal an emission-line spectrum very similar to that of the dwarf Seyfert 1 galaxy NGC 4395, with broad components to the permitted line profiles, and we classify POX 52 as a Seyfert 1 galaxy. The host galaxy appears to be a dwarf elliptical, and its brightness profile is best fit by a Sérsic model with an index of 3.6+/-0.2 and a total magnitude of MV=-17.6. Applying mass-luminosity-line width scaling relations to estimate the black hole mass from the broad Hβ line width and nonstellar continuum luminosity, we find MBH~1.6×105Msolar. The stellar velocity dispersion in the host galaxy, measured from the Ca II λ8498, 8542 lines, is 36+/-5 km s-1, also suggestive of a black hole mass of order 105Msolar. Further searches for active nuclei in dwarf galaxies can provide unique constraints on the demographics of black holes in the mass range below 106Msolar.

Molecular epidemiology of goat pox viruses.

PubMed

Roy, P; Jaisree, S; Balakrishnan, S; Senthilkumar, K; Mahaprabhu, R; Mishra, A; Maity, B; Ghosh, T K; Karmakar, A P

2018-02-01

Goat pox disease outbreaks were observed in different places affecting Black Bengal Goats in West Bengal (WB) and Tellicherry, Vembur and non-descriptive breeds in Tamil Nadu (TN) causing severe lesions and mortality up to 30%. Clinical specimens from all the outbreaks were screened by polymerase chain reaction followed by restriction fragment length polymorphism (PCR-RFLP) and confirmed the diseases as Goat Pox. Virus isolation in Vero cell line was done with randomly selected ten samples, cytopathic effects (CPE) characterized by syncytia and intracytoplasmic inclusion bodies were observed after several blind passages. Nucleotide sequence of complete p32 gene using randomly selected two isolates and three clinical specimens revealed presence of Goat pox virus (GTPV)-specific signature residues in all the sequences. Phylogenetic analysis using the present five sequences along with GenBank data of GTPV complete p32 gene sequences showed all the GTPV sequences cluster together except Pellor strain (NC004003) and FZ Chinese strain (KC951854). The five sequences either from WB or TN cluster more closely with GTPV isolates of Maharashtra state that were responsible for cross species outbreak of pox disease in both sheep (KF468759) and goats (KF468762) in India during the year 2010. All the Indian goat pox viruses, including the Mukteswar strain, isolated in 1946 and sequence reported in 2004 clustered together with the GTPVs causing the recent outbreaks. It was observed that GTPVs caused similar clinical manifestation irrespective of their geographical locations and breed characteristics, no variation observed among the Indian isolates based on p32 gene over the period of seventy years and disease outbreaks could not be observed or reported in vaccinated goats. © 2017 Blackwell Verlag GmbH.

mi-siRNAs and plum pox virus resistance

USDA-ARS?s Scientific Manuscript database

The agricultural sector is expecting to derive tangible benefits from the investments that have been made in plant biotechnology. Although plant biotechnology research has been carried out for decades, only a few examples of biotech horticultural crops have reached the market. Plum pox virus (PPV)...

Effects of juglone and lawsone on oxidative stress in maize coleoptile cells treated with IAA.

PubMed

Kurtyka, Renata; Pokora, Wojciech; Tukaj, Zbigniew; Karcz, Waldemar

2016-01-01

Naphthoquinones are secondary metabolites widely distributed in nature and produced by bacteria, fungi and higher plants. Their biological activity may result from induction of oxidative stress, caused by redox cycling or direct interaction with cellular macromolecules, in which quinones act as electrophiles. The redox homeostasis is known as one of factors involved in auxin-mediated plant growth regulation. To date, however, little is known about the crosstalk between reactive oxygen species (ROS) produced by quinones and the plant growth hormone auxin (IAA). In this study, redox cycling properties of two naphthoquinones, juglone (5-hydroxy-1,4-naphthoquinone) and lawsone (2-hydroxy-1,4-naphthoquinone), were compared in experiments performed on maize coleoptile segments incubated with or without the addition of IAA. It was found that lawsone was much more effective than juglone in increasing both H 2 O 2 production and the activity of antioxidative enzymes (SOD, POX and CAT) in coleoptile cells, regardless of the presence of IAA. An increase in the activity of Cu/Zn-SOD isoenzymes induced by both naphthoquinones suggests that juglone- and lawsone-generated H 2 O 2 was primarily produced in the cytosolic and cell wall spaces. The cell potential to neutralize hydrogen peroxide, determined by POX and CAT activity, pointed to activity of catalase as the main enzymatic mechanism responsible for degradation of H 2 O 2 Therefore, we assumed that generation of H 2 O 2 , induced more efficiently by LW than JG, was the major factor accounting for differences in the toxicity of naphthoquinones in maize coleoptiles. The role of auxin in the process appeared negligible. Moreover, the results suggested that oxidative stress imposed by JG and LW was one of mechanisms of allelopathic action of the studied quinones in plants. © The Authors 2016. Published by Oxford University Press on behalf of the Annals of Botany Company.

Detection of reticuloendotheliosis virus as a contaminant of fowl pox vaccines.

PubMed

Awad, A M; Abd El-Hamid, H S; Abou Rawash, A A; Ibrahim, H H

2010-11-01

This study was designed to detect reticuloendotheliosis virus (REV) as a contaminant in fowl pox vaccines. A total of 30 fowl pox vaccine samples were examined for the presence of REV using both in vitro and in vivo methods. In in vitro testing, the fowl pox vaccine samples were inoculated into chicken embryo fibroblast cultures prepared from specific-pathogen-free embryonated chicken eggs, and the cultures were examined using PCR to detect REV. In in vivo testing, each fowl pox vaccine sample was inoculated into 5-d-old specific-pathogen-free chicks, which were kept under observation for up to 12 wk postinoculation; serum samples were collected at 15, 30, and 45 d postinoculation for the detection of REV-specific antibodies using ELISA. Tissue samples were collected at 8 and 12 wk postinoculation for histopathological examination. Of the tested vaccines, only one imported vaccine sample tested positive for REV using PCR. Serum samples collected from chicks infected with the PCR-positive vaccine batch also tested positive for REV-specific antibodies using ELISA. Histopathological examination of the liver, spleen, and bursa of Fabricius demonstrated the presence of tumor cells in these organs, confirming the results obtained using PCR and ELISA, and indicating that the sample was contaminated with REV. These data clearly indicate that the screening of all commercial poultry vaccines for viruses is an important factor in assuring the biosafety of animal vaccines.

77 FR 5381 - Plum Pox Compensation

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-03

... to provide for the payment of compensation to eligible owners of non-fruit-bearing ornamental tree... fruit orchards and fruit tree nurseries whose trees are required to be destroyed in order to prevent the... for treating trees or other plant material infected with plum pox, nor are there any known effective...

Development and deregulation of the plum pox virus resistant transgenic plum 'HoneySweet'

USDA-ARS?s Scientific Manuscript database

We have demonstrated that genetic engineering can be an important source of high level and durable resistance against Plum pox virus (PPV). We have shown, through a number of field studies, the environmental safety of this genetically engineered plum. Nevertheless, the utilization of this demonstr...

Post chicken pox neurological sequelae: Three distinct presentations.

PubMed

Paul, Rudrajit; Singhania, Pankaj; Hashmi, Ma; Bandyopadhyay, Ramtanu; Banerjee, Amit Kumar

2010-07-01

Varicella zoster infection is known to cause neurological involvement. The infection is usually self-limiting and resolves without sequelae. We present a series of three cases with neurological presentations following chicken pox infection. The first case is a case of meningitis, cerebellitis and polyradiculopathy, the second is a florid case of acute infective demyelinating polyradiculoneuropathy (Guillian-Barré syndrome) in a middle-aged female and the third case is a young man in whom we diagnosed acute transverse myelitis. All these cases presented with distinct neurological diagnoses and the etiology was established on the basis of history and serological tests confirmatory for chicken pox. The cases responded differently to treatment and the patients were left with minimum disability.

Sharka: how do plants respond to Plum pox virus infection?

PubMed

Clemente-Moreno, María J; Hernández, José A; Diaz-Vivancos, Pedro

2015-01-01

Plum pox virus (PPV), the causal agent of sharka disease, is one of the most studied plant viruses, and major advances in detection techniques, genome characterization and organization, gene expression, transmission, and the description of candidate genes involved in PPV resistance have been described. However, information concerning the plant response to PPV infection is very scarce. In this review, we provide an updated summary of the research carried out to date in order to elucidate how plants cope with PPV infection and their response at different levels, including the physiological, biochemical, proteomic, and genetic levels. Knowledge about how plants respond to PPV infection can contribute to the development of new strategies to cope with this disease. Due to the fact that PPV induces an oxidative stress in plants, the bio-fortification of the antioxidative defences, by classical or biotechnological approaches, would be a useful tool to cope with PPV infection. Nevertheless, there are still some gaps in knowledge related to PPV-plant interaction that remain to be filled, such as the effect of PPV on the hormonal profile of the plant or on the plant metabolome. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

HIGH EFFICIENCY SYNGAS GENERATION

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robert J. Copeland; Yevgenia Gershanovich; Brian Windecker

2005-02-01

This project investigated an efficient and low cost method of auto-thermally reforming natural gas to hydrogen and carbon monoxide. Reforming is the highest cost step in producing products such as methanol and Fisher Tropsch liquids (i.e., gas to liquids); and reducing the cost of reforming is the key to reducing the cost of these products. Steam reforming is expensive because of the high cost of the high nickel alloy reforming tubes (i.e., indirectly fired reforming tubes). Conventional auto-thermal or Partial Oxidation (POX) reforming minimizes the size and cost of the reformers and provides a near optimum mixture of CO andmore » hydrogen. However POX requires pure oxygen, which consumes power and significantly increases the cost to reforming. Our high efficiency process extracts oxygen from low-pressure air with novel oxygen sorbent and transfers the oxygen to a nickel-catalyzed reformer. The syngas is generated at process pressure (typically 20 to 40 bar) without nitrogen dilution and has a 1CO to 2H{sub 2} ratio that is near optimum for the subsequent production of Fisher-Tropsch liquid to liquids and other chemicals (i.e., Gas to Liquids, GTL). Our high process efficiency comes from the way we transfer the oxygen into the reformer. All of the components of the process, except for the oxygen sorbent, are commonly used in commercial practice. A process based on a longlived, regenerable, oxygen transfer sorbent could substantially reduce the cost of natural gas reforming to syngas. Lower cost syngas (CO + 2H{sub 2}) that is the feedstock for GTL would reduce the cost of GTL and for other commercial applications (e.g., methanol, other organic chemicals). The vast gas resources of Alaska's North Slope (ANS) offer more than 22 Tcf of gas and GTL production in this application alone, and could account for as much as 300,000 to 700,000 bpd for 20 to 30+ years. We developed a new sorbent, which is an essential part of the High Efficiency Oxygen Process (HOP). We tested the sorbent and observed that it has both a good oxygen capacity and operates as a highly effective reforming catalyst. We conducted a long duration tests of the sorbent (1,500 hours of continuous operation in the HOP cycle). Although the sorbent lost some oxygen capacity with cycling, the sorbent oxygen capacity stabilized after 1,000 hours and remained constant to the end of the test, 1,500 hour. The activity of the catalyst to reform methane to a hydrogen and carbon monoxide mixture was unchanged through the oxidation/reduction cycling. Our cost and performance analyses indicated a significant reduction in the cost of GTL production when using the HOP process integrated into a GTL plant.« less

Plum pox virus (PPV) genome expression in genetically engineered RNAi plants

USDA-ARS?s Scientific Manuscript database

An important approach to controlling sharka disease caused by Plum pox virus (PPV) is the development of PPV resistant plants using small interfering RNAs (siRNA) technology. In order to evaluate siRNA induced gene silencing, we studied, based on knowledge of the PPV genome sequence, virus genome t...

Plum orchards can remain Plum pox virus free for the life of the orchard

USDA-ARS?s Scientific Manuscript database

Plum pox virus (PPV), the cause of sharka disease, is a quarantine virus pathogen that can cause devastating losses mainly to plum. Estimated costs associated with sharka management worldwide in the last 30 years exceeded 10 billion Euros. To prevent the spread of PPV, we suggest three requirement...

ETIOLOGY OF WHITE POX, A LETHAL DISEASE OF THE CARIBBEAN ELKHORN CORAL, ACROPORA PALMATA.

EPA Science Inventory

Populations of the shallow-water Caribbean elkhorn coral, Acropora palmata, are being decimated by white pox disease, with losses in the Florida Keys typically in excess of 70%. Tissue loss is rapid, averaging 2.5 cm2 day-1. A bacterium isolated from diseased A. palmata was shown...

Avian Pox Discovered in the Critically Endangered Waved Albatross (Phoebastria irrorata) from the Galápagos Islands, Ecuador.

PubMed

Tompkins, Emily M; Anderson, David J; Pabilonia, Kristy L; Huyvaert, Kathryn P

2017-10-01

The Waved Albatross (Phoebastria irrorata) is a critically endangered seabird in a rapidly shrinking population in the Galápagos Islands, Ecuador. The introduction of novel pathogens and parasites poses a threat to population persistence. Monitoring disease prevalence and guarding against the spread of such agents in endemic taxa are conservation priorities for the Galápagos, where recent increases in the prevalence of avian pox may have contributed to population declines and range contractions in other bird species. During November 2013-January 2014, we identified 14 Waved Albatross nestlings at our study site on Española Island with avian pox-like lesions and clinical signs. Other seabirds, landbirds, and adult Waved Albatrosses were apparently unaffected. Histopathology of tissue samples from five infected nestlings revealed inclusion bodies in all samples, consistent with avipoxvirus infection. We documented higher mortality (6 of 14 nestlings) in affected nestlings than in unaffected young in this small outbreak of avian pox, the first report of its kind in the world's only tropical albatross.

Characterization of sheep pox virus vaccine for cattle against lumpy skin disease virus.

PubMed

Tuppurainen, Eeva S M; Pearson, Caroline R; Bachanek-Bankowska, Katarzyna; Knowles, Nick J; Amareen, Shadi; Frost, Lorraine; Henstock, Mark R; Lamien, Charles E; Diallo, Adama; Mertens, Peter P C

2014-09-01

Lumpy skin disease is of significant economic impact for the cattle industry in Africa. The disease is currently spreading aggressively in the Near East, posing a threat of incursion to Europe and Asia. Due to cross-protection within the Capripoxvirus genus, sheep pox virus (SPPV) vaccines have been widely used for cattle against lumpy skin disease virus (LSDV). In the Middle East and the Horn of Africa these vaccines have been associated with incomplete protection and adverse reactions in cattle post-vaccination. The present study confirms that the real identity of the commonly used Kenyan sheep and goat pox vaccine virus (KSGP) O-240 is not SPPV but is actually LSDV. The low level attenuation of this virus is likely to be not sufficient for safe use in cattle, causing clinical disease in vaccinated animals. In addition, Isiolo and Kedong goat pox strains, capable of infecting sheep, goats and cattle are identified for potential use as broad-spectrum vaccine candidates against all capripox diseases. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.

Constituents of Propolis: Chrysin, Caffeic Acid, p-Coumaric Acid, and Ferulic Acid Induce PRODH/POX-Dependent Apoptosis in Human Tongue Squamous Cell Carcinoma Cell (CAL-27).

PubMed

Celińska-Janowicz, Katarzyna; Zaręba, Ilona; Lazarek, Urszula; Teul, Joanna; Tomczyk, Michał; Pałka, Jerzy; Miltyk, Wojciech

2018-01-01

Propolis evokes several therapeutic properties, including anticancer activity. These activities are attributed to the action of polyphenols. Previously it has been demonstrated, that one of the most abundant polyphenolic compounds in ethanolic extracts of propolis are chrysin, caffeic acid, p -coumaric acid, and ferulic acid. Although their pro-apoptotic activity on human tongue squamous cell carcinoma cells (CAL-27) was established previously, the detailed mechanism of this process remains unclear. Considering the crucial role of proline metabolism and proline dehydrogenase/proline oxidase (PRODH/POX) in the regulation of cancer cell survival/apoptosis, we studied these processes in polyphenol-treated CAL-27 cells. All studied polyphenols evoked anti-proliferative activity, accompanied by increased PRODH/POX, P53, active caspases-3 and -9 expressions and decreased collagen biosynthesis, prolidase activity and proline concentration in CAL-27 cells. These data suggest that polyphenols of propolis induce PRODH/POX-dependent apoptosis through up-regulation of mitochondrial proline degradation and down-regulation of proline utilization for collagen biosynthesis.

Constituents of Propolis: Chrysin, Caffeic Acid, p-Coumaric Acid, and Ferulic Acid Induce PRODH/POX-Dependent Apoptosis in Human Tongue Squamous Cell Carcinoma Cell (CAL-27)

PubMed Central

Celińska-Janowicz, Katarzyna; Zaręba, Ilona; Lazarek, Urszula; Teul, Joanna; Tomczyk, Michał; Pałka, Jerzy; Miltyk, Wojciech

2018-01-01

Propolis evokes several therapeutic properties, including anticancer activity. These activities are attributed to the action of polyphenols. Previously it has been demonstrated, that one of the most abundant polyphenolic compounds in ethanolic extracts of propolis are chrysin, caffeic acid, p-coumaric acid, and ferulic acid. Although their pro-apoptotic activity on human tongue squamous cell carcinoma cells (CAL-27) was established previously, the detailed mechanism of this process remains unclear. Considering the crucial role of proline metabolism and proline dehydrogenase/proline oxidase (PRODH/POX) in the regulation of cancer cell survival/apoptosis, we studied these processes in polyphenol-treated CAL-27 cells. All studied polyphenols evoked anti-proliferative activity, accompanied by increased PRODH/POX, P53, active caspases-3 and -9 expressions and decreased collagen biosynthesis, prolidase activity and proline concentration in CAL-27 cells. These data suggest that polyphenols of propolis induce PRODH/POX-dependent apoptosis through up-regulation of mitochondrial proline degradation and down-regulation of proline utilization for collagen biosynthesis. PMID:29681859

A Multiwavelength Study of POX 52, a Dwarf Seyfert Galaxy with an Intermediate-Mass Black Hole

NASA Astrophysics Data System (ADS)

Barth, Aaron

2004-07-01

We propose a comprehensive optical, UV, and X-ray investigation of the unique galaxy POX 52. POX 52 is a Seyfert 1 galaxy with unprecedented properties: its host galaxy appears to be a dwarf elliptical, and its stellar velocity dispersion is only 36 km/s. The stellar velocity dispersion and the broad emission-line widths both suggest a black hole mass of order 10^5 solar masses, placing POX 52 in a region of AGN parameter space that is almost completely unexplored at present. We request ACS/HRC imaging to perform a definitive measurement of the host galaxy structure; STIS UV and optical spectroscopy to study the nonstellar continuum and the structure of the broad-line region; and Chandra ACS imaging to detect the X-ray emission from the nucleus and investigate its spectral and variability properties. The results of this program will give a detailed understanding of the host galaxy and accretion properties of one of the very few known black holes in the mass range around 10^5 solar masses.

[Direct costs of complicated chicken pox in a Colombian pediatric population].

PubMed

Alvis-Guzmán, Nelson; Paternina-Caicedo, Angel; Alvis-Estrada, Luis; De la Hoz-Restrepo, Fernando

2011-12-01

Estimating the cost of chicken pox in a Colombian pediatric population. This was a retrospective case study which searched for all diagnosed chicken pox cases in the Napoleón Franco Pareja children's hospital (Cartagena, Colombia), during 2005-2008. The hospital's records/perspective was used. Cost related to health personnel, lab, diagnostic images and drugs were searched. The micro-costing was made at Colombian peso prices for 2010. An adjustment was made for inflation. Mean hospital costs were $ 898,766 (Q1: $ 197,348; Q3: $ 1,195,262). Mean hospital cost per day was $ 221,777 (Q1: $ 97,027; Q3: $ 293,740). Mean cost <1 year-old patients was $ 980,742 (Q1: $ 905,708; Q3: $ 1,026,031). Mean cost was $ 105,833 in 5-12 year-old patients (Q1: $ 39,568; Q3: $ 891,824). The results were similar to those of previous studies (in Panama and some developed countries) highlighting relatively high illness costs in Colombia. These results increase the evidence in favor of vaccination and invite Colombian public health officials to consider introducing a chicken pox vaccine into Colombia.

Case report: Pox in the mourning dove in Maryland

USGS Publications Warehouse

Locke, L.N.; Herman, C.M.; King, E.S.

1960-01-01

Although trichomoniasis has received attention as a cause of death among mourning doves (Zenaidura macroura),  ittle work has been done on other diseases of this species. Kossack and Hanson2 reported the occurrence of pox lesions in mourning doves in Illinois. Rosen3 reported that "pigeon pox" had caused a severe mortality in a mourning dove flock near Yreka, Siskiyou County, California. A severe outbreak of pox that occurred in a captive flock of mourning doves at the Patuxent Research Refuge further emphasizes the need for more study of this disease as a cause of dove mortality. Twenty-two mourning doves were live trapped on the Agricultural Research Center, Beltsville, Maryland, in September, 1958. The doves were examined for presence of Trichomonas gallinae and, when found to be free of trichomonads, were made the nucleus of a captive dove colony. A mourning dove that had a small, pink nodule on the left eyelid was captured on the Agricultural Research Center on September 17, 1958. The nodule was excised and the cut surface was treated with tincture of merthiolate. The dove then was added to the dove colony.

Effect of Quorum Quenching Lactonase in Clinical Isolates of Pseudomonas aeruginosa and Comparison with Quorum Sensing Inhibitors

PubMed Central

Guendouze, Assia; Plener, Laure; Bzdrenga, Janek; Jacquet, Pauline; Rémy, Benjamin; Elias, Mikael; Lavigne, Jean-Philippe; Daudé, David; Chabrière, Eric

2017-01-01

Pseudomonas aeruginosa is a Gram negative pathogenic bacterium involved in many human infections including otitis, keratitis, pneumonia, and diabetic foot ulcers. P. aeruginosa uses a communication system, referred to as quorum sensing (QS), to adopt a group behavior by synchronizing the expression of certain genes. Among the regulated traits, secretion of proteases or siderophores, motility and biofilm formation are mainly involved in the pathogenicity. Many efforts have been dedicated to the development of quorum sensing inhibitors (QSI) and quorum quenching (QQ) agents to disrupt QS. QQ enzymes have been particularly considered as they may act in a catalytic way without entering the cell. Here we focus on the lactonase SsoPox which was previously investigated for its ability to degrade the signaling molecules, acyl-homoserine lactones, in particular on the engineered variant SsoPox-W263I. We highlight the potential of SsoPox-W263I to inhibit the virulence of 51 clinical P. aeruginosa isolates from diabetic foot ulcers by decreasing the secretion of two virulence factors, proteases and pyocyanin, as well as biofilm formation. We further compared the effect of SsoPox-W263I to the comprehensively described QSI, 5-fluorouracil and C-30. We found the lactonase SsoPox-W263I to be significantly more effective than the tested QSI at their respective concentration optimum and to retain its activity after immobilization steps, paving the way for future therapeutic applications. PMID:28261183

Sites and Regulation of Polyamine Catabolism in the Tobacco Plant. Correlations with Cell Division/Expansion, Cell Cycle Progression, and Vascular Development1

PubMed Central

Paschalidis, Konstantinos A.; Roubelakis-Angelakis, Kalliopi A.

2005-01-01

We previously gave a picture of the homeostatic characteristics of polyamine (PA) biosynthesis and conjugation in tobacco (Nicotiana tabacum) plant organs during development. In this work, we present the sites and regulation of PA catabolism related to cell division/expansion, cell cycle progression, and vascular development in the tobacco plant. Diamine oxidase (DAO), PA oxidase (PAO), peroxidases (POXs), and putrescine N-methyltransferase expressions follow temporally and spatially discrete patterns in shoot apical cells, leaves (apical, peripheral, and central regions), acropetal and basipetal petiole regions, internodes, and young and old roots in developing plants. DAO and PAO produce hydrogen peroxide, a plant signal molecule and substrate for POXs. Gene expression and immunohistochemistry analyses reveal that amine oxidases in developing tobacco tissues precede and overlap with nascent nuclear DNA and also with POXs and lignification. In mature and old tissues, flow cytometry indicates that amine oxidase and POX activities, as well as pao gene and PAO protein levels, coincide with G2 nuclear phase and endoreduplication. In young versus the older roots, amine oxidases and POX expression decrease with parallel inhibition of G2 advance and endoreduplication, whereas putrescine N-methyltransferase dramatically increases. In both hypergeous and hypogeous tissues, DAO and PAO expression occurs in cells destined to undergo lignification, suggesting a different in situ localization. DNA synthesis early in development and the advance in cell cycle/endocycle are temporally and spatially related to PA catabolism and vascular development. PMID:16040649

Cutaneous form of pox infection among captive peafowl (Pavo cristatus) chicks.

PubMed

Khan, Ahrar; Yousaf, Arfan; Khan, M Zargham; Siddique, Muhammad; Gul, S Tehseen; Mahmood, Fazal

2009-02-01

The present study was carried out to investigate the epidemiology and lesions of avian pox in captive peafowl chicks. Overall values of morbidity, mortality and case fatality were 45.2%, 27.1% and 60.0%, respectively. The chicks of 9 to 12 weeks of age showed a significantly (P<0.001) higher prevalence rate than other age groups. The morbidity and mortality due to avian pox in peafowl chicks was significantly (P<0.001) reduced when kept in mosquito-proof cages and hatched under broody chicken hens. Morbidity due to poxvirus infection on the peafowl farm was 82%, 26% and 12% in successive years. This reduction might have been the result of the introduction of mosquito-proof nets after year 1, although this was not the subject of a controlled experiment. All of the peafowl chicks suffering from dry pox showed pustular and nodular lesions on eye lids, beak, legs and toes. Distribution of lesions in different body parts varied significantly (P<0.023). Lesion diameters were less than 1 cm (59.73%), 1 to 2 cm (23.75%) and more than 2 cm (16.87%). Histopathological studies revealed extensive proliferation of subdermal connective tissue and infiltration of heterophils and macrophages. The keratinocytes showed degenerative changes in the form of cytoplasmic vacuolation, ballooning and hyper-chromatic nuclei. Eosinophilic intracytoplasmic inclusions (Bollinger bodies) in keratinocytes were consistently present. It was concluded that avian pox rendered high morbidity, mortality and case fatality in peafowl chicks.

Sero-prevalence, risk factors and distribution of sheep and goat pox in Amhara Region, Ethiopia.

PubMed

Fentie, Tsegaw; Fenta, Nigusie; Leta, Samson; Molla, Wassie; Ayele, Birhanu; Teshome, Yechale; Nigatu, Seleshe; Assefa, Ashenafi

2017-12-11

Sheep pox and goat pox are contagious viral diseases of sheep and goats, respectively. The diseases result in substantial economic losses due to decreased milk and meat production, damage to hides and wool, and possible trade restriction. A study was undertaken in Amhara region of Ethiopia. A cross-sectional study design was used to estimate the sero-prevalence and identify associated risk factors, while retrospective study design was used to assess the temporal and spatial distribution of the disease. A total of 672 serum samples were collected from 30 Kebeles and tested using virus neutralization test. From a total of 672 sera tested, 104 (15.5%) were positive for sheep and goat pox virus antibody; from which 56 (17%) were sheep and 48 (14%) were goats. The diseases were prevalent in all study zones, the highest sero-prevalence was observed in South Gondar (20.9%) and the lowest in North Gondar and West Gojjam zones (11.9% each). From the potential risk factors considered (species, sex, age, agro-ecology and location); only sex and age were significantly associated (p < 0.05) with the diseases in multivariable logistic regression. Female and young animals were at higher risk than their counterparts. From January 2010 to December 2014, a total of 366 outbreaks, 12,822 cases and 1480 deaths due to SP and 182 outbreaks, 10,066 cases and 997 deaths due to GP were recorded in Amhara National Regional State. Both the serological and the outbreak data revealed that sheep and goat pox is one of the most prevalent and widespread diseases of sheep and goats in the study area. Hence, annual mass vaccination program must be implemented for economic and viable control of sheep and goat pox diseases in the Amhara region in particular and at a national level in general.

Potential Military Chemical/Biological Agents and Compounds

DTIC Science & Technology

2005-01-01

synonym: fowl plague) Bluetongue virus Fungi Foot and mouth disease virus Colletorichum coffeanum var Goat pox virus Cochiliobolus...Swine vesicular disease virus) Virus Rinderpest virus (synonym: Cattle plague Barley Yellow Dwarf Virus Sheep pox virus Teschen disease virus...2) Occurrence. Infection has been documented throughout the US, in Canada, western and central Mexico , Panama, Costa Rica, Colombia, Argentina

Silencing in genetically engineered Prunus domestica provides durable and safe resistance to Plum pox virus (sharka disease)

USDA-ARS?s Scientific Manuscript database

Originally identified in Bulgaria in 1915, Plum pox virus (PPV) is the most damaging virus of stone fruit trees including apricot, plum, peach, and cherry. PPV steadily spread throughout Europe over the years since its discovery, and at the turn of the century (1999-2000), it reached North America ...

'HoneySweet' (C5), the first genetically engineered Plum pox virus-resistant plum (Prunus domestica L.) cultivar

USDA-ARS?s Scientific Manuscript database

‘HoneySweet’ plum was released by the U.S. Department of Agriculture, Agricultural Research Service, to provide U.S. growers and P. domestica plum breeders with a high fruit quality plum cultivar resistant to Plum pox virus (PPV). ‘HoneySweet’ was developed through genetic engineering utilizing the...

The Electrochemical Society, Inc. Meeting Program (181st), Held in St. Louis, Missouri on May 17-22, 1992. Including: State-of-the-Art Program on Compound Semiconductors XVI, Fullerenes: Chemistry, Physics, and New Directions, Quantum Confinement, Micromachining and Microstructures, Electronics/Dielectric Science and Technology Joint Recent News Papers

DTIC Science & Technology

1991-04-28

evening. After the boat has crusied for Division Executive Committee a while, you will be served a buffet-style dinner of baked ham. chicken a Is...you would like to discuss. a The Pox Theatre and St. Louis Science Center are spectacular sites member of the Society Headquarters Staff will be...be no larger than 8 In 1929 by William Pox of 20th Century Pon fame, as crown jewel of 1" i 11’. ie empire, It be earned the name "The Fabulous Pox

An Outbreak of Sheep Pox in Zabajkalskij kray of Russia.

PubMed

Maksyutov, R A; Gavrilova, E V; Agafonov, A P; Taranov, O S; Glotov, A G; Miheev, V N; Shchelkunov, S N; Sergeev, A N

2015-08-01

In this study, we investigated recent sheep pox outbreaks that occurred in Ononsky and Borzunsky regions of Zabajkalskij kray of Russia. The outbreaks involved in 2756 animals of which 112 were infected and 3 were slaughtered. Samples of injured skin of infected sheep were analysed by electron microscopy and CaPV-specific P32 gene amplification. Following sequence analysis of entire P32 gene showed that both specimens were identical to the sequence of several sheep poxvirus isolates from China and India. The close location of China to the last decade's Russian outbreaks suggest that possible future outbreaks in Russia could occur along the border regions with countries where sheep and goat pox are not controlled. © 2013 Blackwell Verlag GmbH.

In-line charge-trapping characterization of dielectrics for sub-0.5-um CMOS technologies

NASA Astrophysics Data System (ADS)

Roy, Pradip K.; Chacon, Carlos M.; Ma, Yi; Horner, Gregory

1997-09-01

The advent of ultra-large and giga-scale-integration (ULSI/GSI) has placed considerable emphasis on the development of new gate oxides and interlevel dielectrics capable of meeting strict performance and reliability requirements. The costs and demands associated with ULSI fabrication have in turn fueled the need for cost-effective, rapid and accurate in-line characterization techniques for evaluating dielectric quality. The use of non-contact surface photovoltage characterization techniques provides cost-effective rapid feedback on dielectric quality, reducing costs through the reutilization of control wafers and the elimination of processing time. This technology has been applied to characterize most of the relevant C-V parameters, including flatband voltage (Vfb), density of interface traps (Dit), mobile charge density (Qm), oxide thickness (Tox), oxide resistivity (pox) and total charge (Qtot) for gate and interlevel (ILO) oxides. A novel method of measuring tunneling voltage by this technique on various gate oxides is discussed. For ILO, PECVD and high density plasma dielectrics, surface voltage maps are also presented. Measurements of near-surface silicon quality are described, including minority carrier generation lifetime, and examples of their application in diagnosing manufacturing problems.

Partial oxidation power plant with reheating and method thereof

DOEpatents

Newby, Richard A.; Yang, Wen-Ching; Bannister, Ronald L.

1999-01-01

A system and method for generating power having an air compression/partial oxidation system, a turbine, and a primary combustion system. The air compression/partial oxidation system receives a first air stream and a fuel stream and produces a first partially oxidized fuel stream and a first compressed air stream therefrom. The turbine expands the first partially oxidized fuel stream while being cooled by the first compressed air stream to produce a heated air stream. The heated air stream is injected into the expanding first partially oxidized fuel stream, thereby reheating it in the turbine. A second partially oxidized fuel stream is emitted from the turbine. The primary combustion system receives said second partially oxidized fuel stream and a second air stream, combusts said second partially oxidized fuel stream, and produces rotating shaft power and an emission stream therefrom.

Role of L-alanine for redox self-sufficient amination of alcohols.

PubMed

Klatte, Stephanie; Wendisch, Volker F

2015-01-23

In white biotechnology biocatalysis represents a key technology for chemical functionalization of non-natural compounds. The plasmid-born overproduction of an alcohol dehydrogenase, an L-alanine-dependent transaminase and an alanine dehydrogenase allows for redox self-sufficient amination of alcohols in whole cell biotransformation. Here, conditions to optimize the whole cell biocatalyst presented in (Bioorg Med Chem 22:5578-5585, 2014), and the role of L-alanine for efficient amine functionalization of 1,10-decanediol to 1,10-diaminodecane were analyzed. The enzymes of the cascade for amine functionalization of alcohols were characterized in vitro to find optimal conditions for an efficient process. Transaminase from Chromobacterium violaceum, TaCv, showed three-fold higher catalytic efficiency than transaminase from Vibrio fluvialis, TaVf, and improved production at 37°C. At 42°C, TaCv was more active, which matched thermostable alcohol dehydrogenase and alanine dehydrogenase and improved the 1,10-diaminodecane production rate four-fold. To study the role of L-alanine in the whole cell biotransformation, the L-alanine concentration was varied and 1,10.diaminodecane formation tested with constant 10 mM 1,10- decanediol and 100 mM NH4Cl. Only 5.6% diamine product were observed without added L-alanine. L-alanine concentrations equimolar to that of the alcohol enabled for 94% product formation but higher L-alanine concentrations allowed for 100% product formation. L-alanine was consumed by the E. coli biocatalyst, presumably due to pyruvate catabolism since up to 16 mM acetate accumulated. Biotransformation employing E. coli strain YYC202/pTrc99a-ald-adh-ta Cv, which is unable to catabolize pyruvate, resulted in conversion with a selectivity of 42 mol-%. Biotransformation with E. coli strains only lacking pyruvate oxidase PoxB showed similar reduced amination of 1,10-decanediol indicating that oxidative decarboxylation of pyruvate to acetate by PoxB is primarily responsible for pyruvate catabolism during redox self-sufficient amination of alcohols using this whole cell biocatalyst. The replacement of the transaminase TaVf by TaCv, which showed higher activity at 42°C, in the artificial operon ald-adh-ta improved amination of alcohols in whole cell biotransformation. The addition of L-alanine, which was consumed by E. coli via pyruvate catabolism, was required for 100% product formation possibly by providing maintenance energy. Metabolic engineering revealed that pyruvate catabolism occurred primarily via oxidative decarboxylation to acetate by PoxB under the chosen biotranformation conditions.

Postchallenge Administration of Brincidofovir Protects Healthy and Immune-Deficient Mice Reconstituted with Limited Numbers of T Cells from Lethal Challenge with IHD-J-Luc Vaccinia Virus

PubMed Central

McCullough, Kevin Tyler; Cruz, Stephanie; Thomas, Antonia; Diaz, Claudia G.; Keilholz, Laurie; Grossi, Irma M.; Trost, Lawrence C.; Golding, Hana

2015-01-01

ABSTRACT Protection from lethality by postchallenge administration of brincidofovir (BCV, CMX001) was studied in normal and immune-deficient (nude, nu/nu) BALB/c mice infected with vaccinia virus (VACV). Whole-body bioluminescence imaging was used to record total fluxes in the nasal cavity, lungs, spleen, and liver and to enumerate pox lesions on tails of mice infected via the intranasal route with 105 PFU of recombinant IHD-J-Luc VACV expressing luciferase. Areas under the flux curve (AUCs) were calculated for individual mice to assess viral loads. A three-dose regimen of 20 mg/kg BCV administered every 48 h starting either on day 1 or day 2 postchallenge protected 100% of mice. Initiating BCV treatment earlier was more efficient in reducing viral loads and in providing protection from pox lesion development. All BCV-treated mice that survived challenge were also protected from rechallenge with IHD-J-Luc or WRvFire VACV without additional treatment. In immune-deficient mice, BCV protected animals from lethality and reduced viral loads while animals were on the drug. Viral recrudescence occurred within 4 to 9 days, and mice succumbed ∼10 to 20 days after treatment termination. Nude mice reconstituted with 105 T cells prior to challenge with 104 PFU of IHD-J-Luc and treated with BCV postchallenge survived the infection, cleared the virus from all organs, and survived rechallenge with 105 PFU of IHD-J-Luc VACV without additional BCV treatment. Together, these data suggest that BCV protects immunocompetent and partially T cell-reconstituted immune-deficient mice from lethality, reduces viral dissemination in organs, prevents pox lesion development, and permits generation of VACV-specific memory. IMPORTANCE Mass vaccination is the primary element of the public health response to a smallpox outbreak. In addition to vaccination, however, antiviral drugs are required for individuals with uncertain exposure status to smallpox or for whom vaccination is contraindicated. Whole-body bioluminescence imaging was used to study the effect of brincidofovir (BCV) in normal and immune-deficient (nu/nu) mice infected with vaccinia virus, a model of smallpox. Postchallenge administration of 20 mg/kg BCV rescued normal and immune-deficient mice partially reconstituted with T cells from lethality and significantly reduced viral loads in organs. All BCV-treated mice that survived infection were protected from rechallenge without additional treatment. In immune-deficient mice, BCV extended survival. The data show that BCV controls viral replication at the site of challenge and reduces viral dissemination to internal organs, thus providing a shield for the developing adaptive immunity that clears the host of virus and builds virus-specific immunological memory. PMID:25589648

Controversies in chicken-pox immunization.

PubMed

Bhave, Swati Y

2003-06-01

Chicken-pox is one more newer vaccine in our armamentarium against infectious diseases. Due to its extremely contagious nature, varicella is experienced by almost every child or young adult in the world. Each year from 1990 to 1994, prior to availability of varicella vaccine, about 4 million cases of varicella occurred in the United States. Of these cases approximately 10,000 required hospitalization and 100 died. Although varicella is not commonly perceived as an important public health problem, the socioeconomic consequences in industrialized countries of a disease that affects practically every child and causes the carrier absence from work should not be underestimated. The varicella vaccines available in the market are safe and effective. A recent cost-benefit analysis in USA showed that routine chicken-pox vaccination is likely to save five times the investment. Even when only direct costs were considered, benefits almost balanced the costs. At present similar studies from developing countries are not available. The public health impact of varicella and zoster may be increasing in regions with high endemic rates of HIV infection. Varicella vaccine may be used either at an individual level to protect susceptible adolescents and adults, or at a population level, to cover all children as part of a national immunization programme. Vaccination of adolescents and adults will protect at-risk individuals, but will not have a significant impact on the epidemiology of the disease on a population basis. On the other hand, extensive use as a routine vaccine in children will have a significant impact on the epidemiology of the disease. If sustained high coverage can be achieved, the disease may virtually disappear. If only partial coverage can be obtained, the epidemiology may shift, leading to an increase in the number of cases in older children and adults. Hence, routine childhood varicella immunization programmes should emphasize high, sustained coverage. At present, this vaccine will have a lower priority in the National Immunization Schedule that does not have MMR and typhoid, which have a greater socioeconomic impact. Hence, at the present time WHO does not recommend the inclusion of varicella vaccination into the routine immunization programmes of developing countries.

Protecting trees against virus diseases in the 21st century: genetic engineering of Plum pox virus resistance - from concept to product

USDA-ARS?s Scientific Manuscript database

Sharka disease, caused by Plum pox virus (PPV), was first recorded in Bulgaria during the early twentieth century. Since that first report, the disease has progressively spread throughout Europe where it has infected over 100 million stone fruit trees. From Europe, sharka disease spread to Asia, A...

75 FR 13672 - Implementation of Both the Understandings Reached at the 2009 Australia Group (AG) Plenary...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-23

... under the AG intersessional silent approval procedures) to remove ``white pox'' virus from the AG ``List... pox'' virus from the AG ``List of Biological Agents for Export Control.'' Consistent with this change, this rule renumbers and/or reorders certain viruses listed in ECCN 1C351.a to conform with the format...

World Epidemiology Review, Number 109.

DTIC Science & Technology

1978-10-11

Various sources, various dates) ..........j 0 Medical Tests Made Secretly Tests Indicate Chicken Pox Socioeconomic Ramifications of...Abating BURMA Briefs Campaign Against Diseases 12 CAMEROON Briefs Vaccination Campaign 13 EAST GERMANY Briefs Medical Care Shortages Ik...AMONG INDIANS IS REALLY CHICKEN POX Medical Tests Made Secretly Sao Paulo 0 ESTADO DE SAO PAULO in Portuguese 19 Aug 78 p 14 [Text] Nearly all the

Childhood Disintegrative Disorder as a Complication of Chicken Pox.

PubMed

Verma, Jitendra Kumar; Mohapatra, Satyakam

2016-01-01

Childhood disintegrative disorder (CDD) is characterized by late onset (>3 years of age) of developmental delays in language, social function and motor skills. Commonly there is no antecedent physical disorder leading to childhood disintegrative disorder. The present case report describes a child who developed childhood disintegrative disorder at the age of 6 years after an episode of chicken pox.

Partial oxidation power plant with reheating and method thereof

DOEpatents

Newby, R.A.; Yang, W.C.; Bannister, R.L.

1999-08-10

A system and method are disclosed for generating power having an air compression/partial oxidation system, a turbine, and a primary combustion system. The air compression/partial oxidation system receives a first air stream and a fuel stream and produces a first partially oxidized fuel stream and a first compressed air stream therefrom. The turbine expands the first partially oxidized fuel stream while being cooled by the first compressed air stream to produce a heated air stream. The heated air stream is injected into the expanding first partially oxidized fuel stream, thereby reheating it in the turbine. A second partially oxidized fuel stream is emitted from the turbine. The primary combustion system receives said second partially oxidized fuel stream and a second air stream, combusts said second partially oxidized fuel stream, and produces rotating shaft power and an emission stream therefrom. 2 figs.

The Great Pox and the Surgeon's Role in the Sixteenth Century.

PubMed

Allen Shotwell, R

2017-01-01

The sixteenth century saw a shift in perceptions of the scope of surgery. The medieval focus on elevating the status of surgery had been accompanied by a certain distancing of surgery from manual operations, but the medical humanism of the sixteenth century embraced manual skills as an important part of medicine, most noticeably in the case of anatomy. In the first part of this paper I use accounts of the treatment of ulcers as a way of exploring these changes in perceptions. Ulcers were a well-known surgical ailment in medieval medicine, but in the sixteenth century they were also associated with the Great Pox. This made their treatment an important test case for establishing the scope of surgery and ultimately led Gabriele Falloppio to claim that ulcers from the Pox were not a part of surgery at all. In the second half of the paper, I look at sixteenth-century descriptions of surgery found in works on surgery and anatomy and note how important the idea of the efficacy of surgical treatment was in them. I conclude by suggesting that the concern with efficacy was itself another aspect of the arrival of the Pox.

Avian pox in a red-tailed hawk (Buteo jamaicensis)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fitzner, R.E.; Miller, R.A. Pierce, C.A.; Rowe, S.E.

1985-07-01

Avian pox has been reported in at least 60 species of birds belonging to 20 different families. However, poxvirus infection in birds of prey is apparently uncommon. On 18 May 1981, an adult male red-tailed hawk was found on the US Department of Energy's Arid Land Ecology Reserve in Benton County, Washington. The bird was incapable of flight and was extremely thin. Nodular proliferations were noted on both feet and cutaneous scab-like lesions around the beak and eyes. The bird was killed in the field and submitted promptly to the diagnostic laboratory for necropsy. This report of pox infection inmore » a free-living adult red-tailed hawk represents one of the few such cases reported in the US. The potential for spread of the virus to other hawks may occur particularly during the nesting season when an infected adult could conceivably pass the virus to a mate and nestlings by direct contact or fomites. Little is known of the natural of avian pox infection in birds of prey. In other birds it is generally considered mild and self-limiting; however, eye lesions resulting in impaired vision may lead to starvation.« less

Reactivation of model cholinesterases by oximes and intermediate phosphyloximes: A computational study

PubMed Central

Vyas, Shubham; Hadad, Christopher M.

2008-01-01

Phosphyloximes (POX) are generated upon the reactivation of organophosphorus (OP) inhibited cholinesterases (ChEs) by pyridinium oximes. These POXs are known to be potent inhibitors of the ChEs following reactivation. However, they can also decompose to give an OP derivative and a cyano derivative of the oxime when a base abstracts the benzylic proton. Using density functional theory, thermodynamic properties were calculated for the reactivation and decomposition pathways of three different oximes (2-PAM, 3-PAM and 4-PAM) with six different OPs (cyclosarin, paraoxon, sarin, tabun, VR and VX). For reactivation purposes, 2-PAM is predicted to be more efficient than 3- and 4-PAM. Based on atomic charges and relative energies, 2-POXs were found to be more inclined towards the decomposition process. PMID:18582852

The Meaning of Signs:

PubMed Central

Stein, Claudia

2006-01-01

This article reconstructs the diagnostic act of the French pox in the French-disease hospital of sixteenth-century Augsburg. It focuses on how the participants in the clinical encounter imagined the configuration of the pox and its localization in the human body. Of central importance for answering this question is the early modern conception of physical signs. It has been argued that it was due to a specific understanding of bodily signs and their relationship to a disease and its causes, that disease definition and classification in the early modern period showed a high degree of flexibility and fluidity. This paper looks at how the sixteenth-century theoretical conception of physical signs not only shaped the diagnosis and treatment of the pox but also reflected the overall organization of institutions. PMID:17242549

World Epidemiology Review, Number 91

DTIC Science & Technology

1978-02-09

50 LIBYA 53 MALAYSIA 54 MEXICO 54 MOZAMBIQUE 55 NEW ZEALAND 57 NIGERIA. 58 a - [III - INT - 134] CONTENTS (Continued) Page...Editorial: "Mass Immunization"] [Text] Afghanistan was declared a small- pox free country at the begin- ning of this year after the assessment and...Afghanistan and inter- national organisations. For eradication of small- pox mass immunisation was a major weapon and the program was implemented in most

Problem Oriented Differential Diagnosis of Tropical Diseases

DTIC Science & Technology

1989-09-01

glomerulonephritis. 13. Varicella ( chicken pox ): rare complication. II. Nephrotic syndrome A distinctive lesion associated with nephrotic syndrome in West...hypersensitivity reactions, Stevens-Johnson syndrome, toxic nephrosis, and hypoglycemia. Studies in Mexico have shown that bismuth subsalicylate tablets are...typhus fever 7 14 Murine typhus 14 26 Q fever 10 21 Rickettsial pox 3 14 Rocky mountain spotted fever 6 21 Scrub typhus 2 10 Tick-borne rickettsioses

Multi-state analysis of the impacts of avian pox on a population of Serins (Serinus serinus): The importance of estimating recapture rates

USGS Publications Warehouse

Senar, J.C.; Conroy, M.J.

2004-01-01

Disease is one of the evolutionary forces shaping populations. Recent studies have shown that epidemics like avian pox, malaria, or mycoplasmosis have affected passerine population dynamics, being responsible for the decline of some populations or disproportionately killing males and larger individuals and thus selecting for specific morphotypes. However, few studies have estimated the effects of an epidemic by following individual birds using the capture-recapture approach. Because avian pox can be diagnosed by direct examination of the birds, we are here able to analyze, using multistate models, the development and consequences of an avian pox epidemic affecting in 1996, a population of Serins (Serinus serinus) in northeastern Spain. The epidemics lasted from June to the end of November of 1996, with a maximum apparent prevalence rate > 30% in October. However, recapture rate of sick birds was very high (0.81, range 0.37-0.93) compared to that of healthy birds (0.21, range 0.020-32), which highly inflated apparent prevalence rate. This was additionally supported by the low predicted transition from the state of being uninfected to the state of being infected (0.03, SE 0.03). Once infected, Serin avian pox was very virulent with (15-day) survival rate of infected birds being of only 0.46 (SE 0.17) compared to that of healthy ones (0.87, SE 0.03). Probability of recovery from disease, provided that the bird survived the first two weeks, however, was very high (0.65, SE 0.25). The use of these estimates together with a simple model, allowed us to predict an asymptotic increase to prevalence of about 4% by the end of the outbreak period, followed by a sharp decline, with the only remaining infestations being infected birds that had not yet recovered. This is in contrast to the apparent prevalence of pox and stresses the need to estimate recapture rates when estimating population dynamics parameters. ?? 2004 Museu de Cie??ncies Naturals.

Mistletoe (Viscum album) infestation in the Scots pine stimulates drought-dependent oxidative damage in summer.

PubMed

Mutlu, Salih; Ilhan, Veli; Turkoglu, Halil Ibrahim

2016-04-01

This study sought to contribute to the understanding of the detrimental effect of the mistletoe (Viscum albumL.), a hemiparasitic plant, on the mortality of the Scots pine (Pinus sylvestrisL.). Fieldwork was conducted in the town of Kelkit (Gumushane province, Turkey) from April to October in 2013. Pine needles of similar ages were removed from the branches of mistletoe-infested and noninfested Scots pine plants, then transported to the laboratory and used as research materials. The effects of the mistletoe on the Scots pine during infestation were evaluated by determining the levels of water, electrolyte leakage (EL), malondialdehyde (MDA, being a product of lipid peroxidation) and reactive oxygen species (ROS) such as superoxide anion (O2 (-•)), hydrogen peroxide (H2O2) and hydroxyl radical ((•)OH). In addition, the activities of antioxidative enzymes such as superoxide dismutase (SOD), catalase (CAT) and peroxidase (POX) were measured in the same samples. The highest level of drought stress was found in summer (especially in August) as a result of the lowest water content in the soil and the highest average temperature occurring in these months. The drought stress induced by mistletoe infestation caused a regular decrease in water content, while it increased the levels of EL, MDA and ROS (H2O2, O2 (-•)and(•)OH). The infestation also stimulated the activities of CAT and POX, with the exception of SOD. On the other hand, in August, when the drought conditions were the harshest, the levels of EL and MDA, which are two of the most important indicator parameters for oxidative stress, as well as the levels of H2O2and(•)OH, which are two of the ROS leading to oxidative stress, reached the highest values in both infested and noninfested needles, whereas the O2 (-•)level decreased. For the same period and needles, CAT activity increased, while SOD activity decreased. Peroxidase activity, however, did not exhibit a significant change. Our findings indicate that the increased mortality of the Scots pine may result from the mistletoe-induced very severe drought stress, and that the increase in the capacity of antioxidative enzyme system does not protect the plant against oxidative stress in dry summer seasons. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Diversity, origins and virulence of Avipoxviruses in Hawaiian Forest Birds

USGS Publications Warehouse

Jarvi, S.I.; Triglia, D.; Giannoulis, A.; Farias, M.; Bianchi, K.; Atkinson, C.T.

2008-01-01

We cultured avian pox (Avipoxvirus spp.) from lesions collected on Hawai'i, Maui, Moloka'i, and 'Oahu in the Hawaiian Islands from 15 native or non-native birds representing three avian orders. Phylogenetic analysis of a 538 bp fragment of the gene encoding the virus 4b core polypeptide revealed two distinct variant clusters, with sequences from chickens (fowlpox) forming a third distinct basal cluster. Pox isolates from one of these two clusters appear closely related to canarypox and other passerine pox viruses, while the second appears more specific to Hawai'i. There was no evidence that birds were infected simultaneously with multiple pox virus variants based on evaluation of multiples clones from four individuals. No obvious temporal or geographic associations were observed and strict host specificity was not apparent among the 4b-defined field isolates. We amplified a 116 bp 4b core protein gene fragment from an 'Elepaio (Chasiempis sandwichensis) collected in 1900 on Hawai'i Island that clustered closely with the second of the two variants, suggesting that this variant has been in Hawai'i for at least 100 years. The high variation detected between the three 4b clusters provides evidence for multiple, likely independent introductions, and does not support the hypothesis of infection of native species through introduction of infected fowl. Preliminary experimental infections in native Hawai'i 'Amakihi (Hemignathus virens) suggest that the 4b-defined variants may be biologically distinct, with one variant appearing more virulent. These pox viruses may interact with avian malaria (Plasmodium relictum), another introduced pathogen in Hawaiian forest bird populations, through modulation of host immune responses. ?? 2007 Springer Science+Business Media B.V.

Chicken pox associated thrombocytopenia in adults.

PubMed

Ali, Nadir; Anwar, Masood; Majeed, Irfan; Tariq, Waheed Uz Zaman

2006-04-01

To determine the frequency and magnitude of thrombocytopenia associated with chicken pox in adults. Observational descriptive study. Combined Military Hospital, Attock, from July 2003 to June 2004. All patients of age 15 years and above with history of fever, followed by appearance of the typical vesicular chicken pox rash, were inducted after informed consent. Two milliliters of whole blood was collected on day 1 of admission, and blood counts were performed. Patients were admitted and given 800 mg oral acyclovir, 5 times/day, for 7 days, in addition to symptomatic treatment. Patients were followed till 8 weeks. A total of 410 patients of chicken pox were received, out of which 270 were included. Age of patients ranged between 15 and 40 years with median age of 21 years. Platelet count on the day of admission ranged between 29 x 10(9)/L to 513 x 10(9)/L, mean platelet count 178 x 10(9)/L. Platelet count < 150 x 10(9)/L was detected in 80/270 (30%) patients. Platelet count in thrombocytopenia patients was from 29 x 10(9)/L to 149 x 10(9)/L with mean 121 x 10(9)/L. Thrombocytopenia recovered within 02 weeks in 78/80 (97%) patients. In 2 patients, thrombocytopenia recovered in 3 weeks. None of the patients developed purpuric spots, ecchymosis or bleeding manifestations. Thrombocytopenia in chicken pox is a common entity. Platelet count remains above 25 x 10(9) /L, which is usually not associated with bleeding manifestations. None of the patients in this series developed purpura. No specific pattern of total leukocyte counts was predictive of the progression or regression in platelet count.

Inhibiting effects of some oxadiazole derivatives on the corrosion of mild steel in perchloric acid solution

NASA Astrophysics Data System (ADS)

Lebrini, Mounim; Bentiss, Fouad; Vezin, Hervé; Lagrenée, Michel

2005-11-01

The efficiency of 3,5-bis( n-pyridyl)-1,3,4-oxadiazole ( n-POX, n = 1, 2, 3), as corrosion inhibitors for mild steel in 1 M perchloric acid (HClO 4) have been determined by weight loss measurements and electrochemical studies. The results show that these inhibitors revealed a good corrosion inhibition even at very low concentrations. Comparison of results among those obtained by the studied oxadiazoles shows that 3-POX was the best inhibitor. Polarisation curves indicate that n-pyridyl substituted-1,3,4-oxadiazoles are mixed type inhibitors in 1 M HClO 4. The adsorption of these inhibitors follows a Langmuir isotherm model. The electronic properties of n-POX, obtained using the AM1 semi-empirical quantum chemical approach, were correlated with their experimental efficiencies using the linear resistance model (LR).

[Retrobulbar optic nevritis and chicken pox: a case report in a child].

PubMed

Roelandt, V; Fayol, L; Hugonenq, C; Mancini, J; Chabrol, B

2005-03-01

We report here the case of a three-year-old boy presenting with an optic neuritis during the invasive phase of a chicken pox. This clinical, infrequent picture, can be directly due to the virus or be secondary to an auto-immune mechanism. The examination of the ocular fundus, the profile of the spinal fluid, the MRI and the measure of visual evoked potential allow to reach diagnosis and to identify the type of lesion. There is no consensus on the treatment of this optic neuritis and the current attitude is therapeutic abstention because of a rapid spontaneous improvement. Cerebellitis, meningitis can also be seen during chicken pox. Their evolution is quickly favorable, not requiring additional exam. Encephalitis can result from an auto-immune lesion of the white matter and require then the use of corticoids with antiviral drugs.

Compound Warfare: That Fatal Knot

DTIC Science & Technology

2002-08-01

this contact—the contact, incidentally, was a two-way street, with small pox , chicken pox , typhoid, measles, mumps, and other viral diseases killing...and Indian societies in Mexico and the Southwest quickly adopted the hardy and versatile animals into their local culture. By the end of the... Mexico and being admitted as the twenty-eighth state of the Union in 1845. Some of the great Indian heroes—Geronimo (born 1829) and Cochise (born ca

Field Manual of Wildlife Diseases. General Field Procedures and Diseases of Birds

DTIC Science & Technology

1999-01-01

The internal form of disease is referred to as wet pox and it is primarily a problem of young chickens and turkeys. This diphtheritic form...of Cranes 153 Chapter 18 Miscellaneous Herpesviruses of Birds 157 Chapter 19 Avian Pox 163 Chapter 20 Eastern Equine Encephalomyelitis 171...Raccoon Rats, mice, voles Muskrats, nutria Chipmunks Sea lions, fur seals Cottontail rabbits Chickens , turkeys Ducks, geese Pigeons Figure 7.4

JPRS Report, Epidemiology.

DTIC Science & Technology

1989-07-19

diagnoses as "endemic complacentitis." Chicken pox has persisted well past its seasonal limits. Since it is a non-notifiable disease, exact...Diseases comparative figures for the first four months of 1988 and 1989 show a worri- some graph. The hospital admitted 1,935 chicken pox patients last...PAULO, 20 Jun 89] 13 Leprosy Incidence Fourth Highest in World [Rio de Janiero O GLOBO, 3 May 89] 14 MEXICO African Bees Kill Farm Animals in

Seroprevalence of Capripoxvirus infection in sheep and goats among different agro-climatic zones of Odisha, India

PubMed Central

Hota, Abhishek; Biswal, Sangram; Sahoo, Niranjana; Venkatesan, Gnanavel; Arya, Sargam; Kumar, Amit; Ramakrishnan, Muthannan Andavar; Pandey, Awadh Bihari; Rout, Manoranjan

2018-01-01

Aim: The study was undertaken to assess the prevalence of antibodies to Capripoxviruses among small ruminants of Odisha, India. Materials and Methods: A total of 500 random serum samples collected from 214 sheep and 286 goats across 10 agro-climatic zones of Odisha, were screened using whole virus antigen-based indirect ELISA for antibodies against Capripoxviruses. Results were analyzed by suitable statistical methods. Results: Screening of 500 serum samples showed seropositivity of 8.88% and 31.47% in sheep and goats, respectively, for Capripoxviruses. The prevalence rate according to agro-climatic zone ranged from 0% (North Eastern coastal plain zone) to 48.57% (North central plateau zone) for goat pox, and 0% (Western undulating zone and North central plateau) to 22.22% (South Eastern ghat zone) for sheep pox. The difference in prevalence rates among the various agro-climatic zones was statistically significant (p<0.05) for goats, but not for sheep. Antibody prevalence rates among various districts were recorded to be the highest in Jagatsinghpur (30%) for sheep pox and Dhenkanal (80%) for goat pox. Conclusions: The study revealed serological evidence of Capripoxvirus infection in sheep and goat populations in the study area, in the absence of vaccination. Systematic investigation, monitoring, and reporting of outbreaks are necessary to devise control strategies. PMID:29479159

POX 4 and Tol 35: Two Peculiar Wolf-Rayet Dwarf Galaxies

NASA Astrophysics Data System (ADS)

Méndez, David I.; Esteban, César

1999-12-01

We present results of narrowband (Hα and adjacent continuum) and broadband (U, B, and V) optical CCD imaging together with high-resolution Hα spectroscopy of the blue compact Wolf-Rayet dwarf galaxies POX 4 and Tol 35. POX 4 has a fainter, irregular, and diffuse companion located 20.5" (4.7 kpc) along the minor axis of the galaxy, which is visible also in the Hα emission. The difference in recession velocity between the galaxy and the companion is about 130 km s-1. The observational results lead us to propose that POX 4 could be interpreted as a low-mass ring galaxy, produced by a head-on intrusion of the fainter companion. Regarding the other object, a spectrum taken along the major axis of Tol 35 shows the coexistence of systems of motion with a velocity difference of about 50 km s-1. Moreover, the deep continuum-subtracted Hα image of the galaxy shows very faint features that resemble the beginning of crossed tidal tails or gaseous filaments powered by the mechanical action of the young stellar population. In this sense, Tol 35 could be interpreted either as an object in an intermediate-stage merging process between two gas-rich dwarf galaxies or as an object suffering the effect of a galactic wind.

Epidemiology of the Emergent Disease Paridae pox in an Intensively Studied Wild Bird Population

PubMed Central

Lachish, Shelly; Lawson, Becki; Cunningham, Andrew A.; Sheldon, Ben C.

2012-01-01

Paridae pox, a novel avipoxvirus infection, has recently been identified as an emerging infectious disease affecting wild tit species in Great Britain. The incursion of Paridae pox to a long-term study site where populations of wild tits have been monitored in detail for several decades provided a unique opportunity to obtain information on the local-scale epidemiological characteristics of this novel infection during a disease outbreak. Using captures of >8000 individual birds, we show that, within two years of initial emergence, Paridae pox had become established within the population of great tits (Parus major) reaching relatively high peak prevalence (10%), but was far less prevalent (<1%) in sympatric populations of several other closely related, abundant Paridae species. Nonlinear smoothing models revealed that the temporal pattern of prevalence among great tits was characterised by within-year fluctuations indicative of seasonal forcing of infection rates, which was likely driven by multiple environmental and demographic factors. There was individual heterogeneity in the course of infection and, although recovery was possible, diseased individuals were far less likely to be recaptured than healthy individuals, suggesting a survival cost of infection. This study demonstrates the value of long-term monitoring for obtaining key epidemiological data necessary to understand disease dynamics, spread and persistence in natural populations. PMID:23185230

Black South African children's understanding of health and illness: colds, chicken pox, broken arms and AIDS.

PubMed

Peltzer, K; Promtussananon, S

2003-09-01

To examine the understanding of both health and illness (colds, broken arms, chicken pox, AIDS) in the same black South African children The sample included 60 children (30 were 5-year-olds and 30 were 9-year-olds) selected by simple random sampling from a rural primary school. They were interviewed, using a semi-structured interview schedule, about their understanding of health issues and their exposure to learning about health or sickness. Differences across age in children's expressed understanding of health and illnesses were found. The 9-year-olds were more likely to give objective signs of chicken pox and AIDS than the 5-year-olds. They also knew more about objective symptoms of colds, chicken pox and AIDS, and were more likely to mention non-observable signs of colds and broken arms. Although there were no differences between the two age groups regarding 'knowing' strategies for avoiding illnesses, the older children had a more accurate knowledge about preventive measures than the younger children. The understanding of AIDS followed the same developmental sequence reported for children's understanding of general physical illness. The results have implications for the creation of developmentally appropriate and effective health and AIDS education curricula for primary and elementary grades.

Strain-induced topological quantum phase transition in phosphorene oxide

NASA Astrophysics Data System (ADS)

Kang, Seoung-Hun; Park, Jejune; Woo, Sungjong; Kwon, Young-Kyun

Using ab initio density functional theory, we investigate the structural stability and electronic properties of phosphorene oxides (POx) with different oxygen compositions x. A variety of configurations are modeled and optimized geometrically to search for the equilibrium structure for each x value. Our electronic structure calculations on the equilibrium configuration obtained for each x reveal that the band gap tends to increase with the oxygen composition of x < 0.5, and then to decrease with x > 0.5. We further explore the strain effect on the electronic structure of the fully oxidized phosphorene, PO, with x = 1. At a particular strain without spin-orbit coupling (SOC) is observed a band gap closure near the Γ point in the k space. We further find the strain in tandem with SOC induces an interesting band inversion with a reopened very small band gap (5 meV), and thus gives rise to a topological quantum phase transition from a normal insulator to a topological insulator. Such a topological phase transition is confirmed by the wave function analysis and the band topology identified by the Z2 invariant calculation.

A Study of Waste Management within the COL Florence A. Blanchfield Army Community Hospital, Fort Campbell, Kentucky.

DTIC Science & Technology

1981-08-01

besnoiti Borna disease virus Bovine infectious petechial fever virus Camel pox virus Ephemeral fever virus Fowl plague virus Goat pox virus Hog...Varicella virus Vole rickettsia Yellow fever virus, 17D vaccine strain 69 Class 3 Alastrun, smallpox, monkeypox, and whitepox, when used in vitro Arbovirus...animal inoculation experiments Vesicular stomatitis virus Yellow fever virus - wild when used in vitro Class 4 Alastrun, smallpox, monkeypox, and

Hairpin plum pox virus coat protein (hpPPV-CP) structure in 'HoneySweet' C5 plum provides PPV resistance when genetically engineered into plum (Prunus domestica) seedlings

USDA-ARS?s Scientific Manuscript database

The genetically engineered plum 'HoneySweet' (aka C5) has proven to be highly resistant to Plum pox virus (PPV) for over 10 years in field trials. The original vector used for transformation to develop 'HoneySweet' carried a single sense sequence of the full length PPV coat protein (ppv-cp) gene, y...

[Psoas abscess as a chicken pox complication].

PubMed

Larcamon, Jorge E; Juanco, Gabriela; Alvarez, Lionel A; Pebe, Florián V

2010-06-01

Chicken pox is the most frequent exantematic illness; usually its course is self-limited and benign. Several bacterial complications are described due to the disruption of the skin as a defensive barrier because of the characteristics of the injuries and the associated inmunodepression. Psoas abscess is a rare illness and it's difficult to diagnose, with a general unspecified clinical presentation. We present the case of a 5-year-old girl, on her fifth day of chicken pox, who consults about a febrile convulsion, from which she recovers without any neurological symptoms, referring to functional impotence of her inferior left limb and pain in the lumbar and gluteal zone, which irradiates to the homolateral hip, making deambulation impossible. The definitive diagnosis was made with a CAT at hospital admission. The germ isolated was community-acquired methricillin-resistant Staphilococcus aureus. Treatment consisted in surgical drainage and endovenous antibiotics.

Comparative sequence analysis of B5R gene of zoonotic buffalo pox virus isolates with other orthopoxviruses.

PubMed

Chandranaik, B M; Singh, Raj Kumar; Hosamani, Mahusudan; Krishnappa, Giriappa; Harish, Balur R; Chethana, C S; Renukaprasad, C

2011-02-01

The present paper describes the isolation of buffalo pox virus from scab lesions and its molecular characterization through B5R gene sequencing. During our study, pustular pox lesions were observed on the teats and mammary parenchyma of cattle and buffaloes, and the disease was of significant zoonotic importance since similar lesions were produced on the hands, legs, and face of people in close contact with the affected animals. The collected scab materials were subjected for virus isolation in 9-11-day-old chicken embryos by the chorioallontoic membrane route and in the Vero cell line. The virus was confirmed by a sensitive and rapid diagnostic polymerase chain reaction using the primers that amplify "A type inclusion" gene, and further, B5R gene of the virus was sequenced and compared with the corresponding sequences of other orthopoxviruses. The results showed high sequence homology of our isolates with other orthopoxviruses.

Plum Pox Virus 6K1 Protein Is Required for Viral Replication and Targets the Viral Replication Complex at the Early Stage of Infection

PubMed Central

Cui, Hongguang

2016-01-01

ABSTRACT The potyviral RNA genome encodes two polyproteins that are proteolytically processed by three viral protease domains into 11 mature proteins. Extensive molecular studies have identified functions for the majority of the viral proteins. For example, 6K2, one of the two smallest potyviral proteins, is an integral membrane protein and induces the endoplasmic reticulum (ER)-originated replication vesicles that target the chloroplast for robust viral replication. However, the functional role of 6K1, the other smallest protein, remains uncharacterized. In this study, we developed a series of recombinant full-length viral cDNA clones derived from a Canadian Plum pox virus (PPV) isolate. We found that deletion of any of the short motifs of 6K1 (each of which ranged from 5 to 13 amino acids), most of the 6K1 sequence (but with the conserved sequence of the cleavage sites being retained), or all of the 6K1 sequence in the PPV infectious clone abolished viral replication. The trans expression of 6K1 or the cis expression of a dislocated 6K1 failed to rescue the loss-of-replication phenotype, suggesting the temporal and spatial requirement of 6K1 for viral replication. Disruption of the N- or C-terminal cleavage site of 6K1, which prevented the release of 6K1 from the polyprotein, either partially or completely inhibited viral replication, suggesting the functional importance of the mature 6K1. We further found that green fluorescent protein-tagged 6K1 formed punctate inclusions at the viral early infection stage and colocalized with chloroplast-bound viral replicase elements 6K2 and NIb. Taken together, our results suggest that 6K1 is required for viral replication and is an important viral element of the viral replication complex at the early infection stage. IMPORTANCE Potyviruses account for more than 30% of known plant viruses and consist of many agriculturally important viruses. The genomes of potyviruses encode two polyproteins that are proteolytically processed into 11 mature proteins, with the majority of them having been at least partially functionally characterized. However, the functional role of a small protein named 6K1 remains obscure. In this study, we showed that deletion of 6K1 or a short motif/region of 6K1 in the full-length cDNA clones of plum pox virus abolishes viral replication and that mutation of the N- or C-terminal cleavage sites of 6K1 to prevent its release from the polyprotein greatly attenuates or completely inhibits viral replication, suggesting its important role in potyviral infection. We report that 6K1 forms punctate structures and targets the replication vesicles in PPV-infected plant leaf cells at the early infection stage. Our data reveal that 6K1 is an important viral protein of the potyviral replication complex. PMID:26962227

UH-USA Agreement - A Telemedicine Research Proposal

DTIC Science & Technology

2004-11-01

hold and they were going to quarantine the entire airport. From his description, I explained that it probably was not smallpox but rather chicken pox ...but I still had to come over to examine the patient. I left my busy office, drove post haste to the airport, and confirmed that it was indeed chicken ... pox . No need for quarantine, and the planes resumed their schedules, although a bit late. I thought it would be so nice if the airport medical

Environmental Assessment for Kirtland Air Force Base Prairie Dog Management Program

DTIC Science & Technology

2003-11-01

such as chicken and small pox and is characterized by rashes, temperature at or above 99.3 degrees, chills and/or sweats, headache, backache...FINDING OF NO SIGNIFICANT IMPACT PRAIRIE DOG MANAGEMENT PROGRAM AT KIRTLAND AIR FORCE BASE, NEW MEXICO The 377th Air Base Wing of Air Force Materiel...of African rodents, prairie dogs, and certain other animals. We are taking this action to prevent the spread of monkey pox , a communicable disease, in

[Gigantic keloïds after chicken-pox. A case report].

PubMed

Gathse, A; Ibara, J R; Obengui; Moyen, G

2003-01-01

Keloïds are tumors which appear after a lesion or spontaneously. They are frequent on black skin. We report a gigantic keloïd case appeared after chicken-pox on a 29 year-old black girl who had viral infection when she was 6 years old. The tumors increased after chirurgical treatment and became very unaesthetic. This observation specific by its clinical presentation relates the treatment difficulties of these tumors in our area.

Epidemic pox and malaria in native forest birds

USGS Publications Warehouse

Atkinson, C. T.; Dusek, R. J.; Iko, W. M.

1993-01-01

Studies by Warner in the 1950’s and van Riper in the 1970’s identified disease as a potential limiting factor in the distribution and abundance of Hawaii’s native forest birds. Mosquito-transmitted protozoan and viral infections caused by malarial parasites and pox virus were especially significant. Both organisms were introduced to the islands after the arrival of Europeans and are thought to have affected avian communities the same way that measles devastated native Hawaiian peoples.

Digital epidemiology reveals global childhood disease seasonality and the effects of immunization

PubMed Central

2016-01-01

Public health surveillance systems are important for tracking disease dynamics. In recent years, social and real-time digital data sources have provided new means of studying disease transmission. Such affordable and accessible data have the potential to offer new insights into disease epidemiology at national and international scales. We used the extensive information repository Google Trends to examine the digital epidemiology of a common childhood disease, chicken pox, caused by varicella zoster virus (VZV), over an 11-y period. We (i) report robust seasonal information-seeking behavior for chicken pox using Google data from 36 countries, (ii) validate Google data using clinical chicken pox cases, (iii) demonstrate that Google data can be used to identify recurrent seasonal outbreaks and forecast their magnitude and seasonal timing, and (iv) reveal that VZV immunization significantly dampened seasonal cycles in information-seeking behavior. Our findings provide strong evidence that VZV transmission is seasonal and that seasonal peaks show remarkable latitudinal variation. We attribute the dampened seasonal cycles in chicken pox information-seeking behavior to VZV vaccine-induced reduction of seasonal transmission. These data and the methodological approaches provide a way to track the global burden of childhood disease and illustrate population-level effects of immunization. The global latitudinal patterns in outbreak seasonality could direct future studies of environmental and physiological drivers of disease transmission. PMID:27247405

Multiplex PCR for rapid diagnosis and differentiation of pox and pox-like diseases in dromedary Camels.

PubMed

Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M

2015-07-07

Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.

POX 186: A Dwarf Galaxy Under Construction?

NASA Astrophysics Data System (ADS)

Corbin, M. R.; Vacca, W. D.

2000-12-01

We have obtained deep images of the ultracompact ( ~ 3'') blue compact dwarf galaxy POX 186 in the F336W, F555W, and F814W filters of the Planetary Camera of the Hubble Space Telescope. We have additionally obtained a low-resolution near ultraviolet spectrum of the object with STIS and combine this with a ground-based spectrum covering the visible continuum and emission lines. Our images confirm this object to be highly compact, with a maximum projected size of only ~ 240 pc, making it one of the smallest galaxies known. We also confirm that the outer regions of the galaxy consist of an evolved stellar population, ruling out earlier speculations that POX 186 is a protogalaxy. However, the PC images reveal the galaxy to have a highly irregular morphology, with a pronounced tidal arm on its western side. This morphology is strongly suggestive of a recent collision between two smaller components which has in turn triggered the central starburst. The F336W image also shows that the material in this tidal stream is actively star forming. Given the very small ( ~ 100 pc) sizes of the colliding components, POX 186 may be a dwarf galaxy in the early stages of formation, which would be consistent with current ``downsizing'' models of galaxy formation in which the least massive objects are the last to form. This work is supported by NASA and the Space Telescope Science Institute.

Digital epidemiology reveals global childhood disease seasonality and the effects of immunization.

PubMed

Bakker, Kevin M; Martinez-Bakker, Micaela Elvira; Helm, Barbara; Stevenson, Tyler J

2016-06-14

Public health surveillance systems are important for tracking disease dynamics. In recent years, social and real-time digital data sources have provided new means of studying disease transmission. Such affordable and accessible data have the potential to offer new insights into disease epidemiology at national and international scales. We used the extensive information repository Google Trends to examine the digital epidemiology of a common childhood disease, chicken pox, caused by varicella zoster virus (VZV), over an 11-y period. We (i) report robust seasonal information-seeking behavior for chicken pox using Google data from 36 countries, (ii) validate Google data using clinical chicken pox cases, (iii) demonstrate that Google data can be used to identify recurrent seasonal outbreaks and forecast their magnitude and seasonal timing, and (iv) reveal that VZV immunization significantly dampened seasonal cycles in information-seeking behavior. Our findings provide strong evidence that VZV transmission is seasonal and that seasonal peaks show remarkable latitudinal variation. We attribute the dampened seasonal cycles in chicken pox information-seeking behavior to VZV vaccine-induced reduction of seasonal transmission. These data and the methodological approaches provide a way to track the global burden of childhood disease and illustrate population-level effects of immunization. The global latitudinal patterns in outbreak seasonality could direct future studies of environmental and physiological drivers of disease transmission.

Development of mixed-type autoimmune hemolytic anemia and Evans' syndrome following chicken pox infection in a case of low-titer cold agglutinin disease.

PubMed

Tanaka, Yumi; Masuya, Masahiro; Katayama, Naoyuki; Miyata, Eri; Sugimoto, Yuka; Shibasaki, Tetsunori; Yamamura, Kentaro; Ohishi, Kohshi; Minami, Nobuyuki; Shiku, Hiroshi; Nobori, Tsutomu

2006-10-01

We describe a patient with low-titer cold agglutinin disease (CAD) who developed mixed-type autoimmune hemolytic anemia (AIHA) and idiopathic thrombocytopenia following chicken pox infection. At least 1 year before admission to hospital, the patient had mild hemolytic anemia associated with low-titer cold agglutinins. A severe hemolytic crisis and thrombocytopenia (Evans' syndrome) occurred several days after infection with chicken pox, and the patient was referred to our hospital. Serological findings revealed the presence of both cold agglutinins and warm-reactive autoantibodies against erythrocytes, and the diagnosis was mixed-type AIHA. Following steroid therapy, the hemoglobin (Hb) level and platelet count improved. The patient was closely followed over a 10-year period with recurrent documented hemolysis after viral or bacterial infections. Warm-reactive autoantibodies have not been detected in the last 2 years, and only the immunoglobulin M anti-I cold agglutinins with a low titer and wide thermal amplitude have remained unchanged. Therefore, the patient has received at least 10 mg prednisolone daily to maintain a Hb level of 10 g/dL. To the best of our knowledge, no adult case of low-titer CAD that has evolved into mixed-type AIHA and Evans' syndrome after chicken pox infection has been previously reported in the literature.

International Symposium on Positive Strand RNA Viruses (2nd) Held in Vienna, Austria on June 26-30, 1989. Abstracts

DTIC Science & Technology

1989-07-01

DEAE dextran-treated chicken embryo Iosdr specific probe hybridised in -olont bluis to a fiibroblasts (CEF). VEE antigens were demonstrated in 1,1...P 13 P 14 MOLECULAR CLONING ANDOEXPRESSION OF ARNA-DEPENDENT MOLECULAR CLONING OF DEFECTIVE-LIKE RNA OF TWO RNA POLYMERASE OF PLUM POX VIRUS IN...Mokhosi PpO)TEINS. RNA STIMULATED ATyase ACffVITY OF PLUM Dept of Microbiologo, RihodvoJs sv POX POTYVIROS C1 PROTEIN. GRAHiAMSTOWN, South Af~ir . Sonia

Quality of Care Provided by Physician’s Extenders in Air Force Primary Medicine Clinics.

DTIC Science & Technology

1980-01-01

WITHOUT 214 ARRHYTHMIAS OR HEART BLOCK GASTROENTERITIS :634 HEART MURMUR [ 11 13. 15 MEASLES. MUMPS, CHICKEN POX 213. 215. 217 OTHER HEART DISEASES 01...mumps, chicken pox 8 11 7 16 Hepatitis or exposure to hepatitis 11 8 4 17 Infectious mononucleosis 1 15 2 *4 Gonorrhea (or exposure to gonorrhea) 17 28...Operation of the New Mexico Experimental Medical Care Review Organization," Medical Care 14 (Supplement 9), December 1976. Daniels, M., and S. A

Foot abnormalities of wild birds

USGS Publications Warehouse

Herman, C.M.; Locke, L.N.; Clark, G.M.

1962-01-01

The various foot abnormalities that occur in birds, including pox, scaly-leg, bumble-foot, ergotism and freezing are reviewed. In addition, our findings at the Patuxent Wildlife Research Center include pox from dove, mockingbird, cowbird, grackle and several species of sparrows. Scaly-leg has been particularly prevalent on icterids. Bumble foot has been observed in a whistling swan and in a group of captive woodcock. Ergotism is reported from a series of captive Canada geese from North Dakota. Several drug treatments recommended by others are presented.

Acute retinal necrosis complicating chicken pox in a healthy adult: a case report and review of literature.

PubMed

Tajunisah, Iqbal; Reddy, Sagili Chandrasekhara

2007-01-01

We report a case of unilateral acute retinal necrosis (ARN) with marked vitritis and retinal necrosis leading to retinal breaks following chicken pox successfully treated with intravenous acyclovir followed by oral acyclovir, orbital floor triamcinolone injections to contain the inflammation, and barrier laser therapy to secure the retinal breaks with good visual outcome. This case is unusual in its severity and the novel use orbital floor triamcinolone therapy to contain ARN inflammation.

Sharka: The Past, The Present and The Future

PubMed Central

Sochor, Jiri; Babula, Petr; Adam, Vojtech; Krska, Boris; Kizek, Rene

2012-01-01

Members the Potyviridae family belong to a group of plant viruses that are causing devastating plant diseases with a significant impact on agronomy and economics. Plum pox virus (PPV), as a causative agent of sharka disease, is widely discussed. The understanding of the molecular biology of potyviruses including PPV and the function of individual proteins as products of genome expression are quite necessary for the proposal the new antiviral strategies. This review brings to view the members of Potyviridae family with respect to plum pox virus. The genome of potyviruses is discussed with respect to protein products of its expression and their function. Plum pox virus distribution, genome organization, transmission and biochemical changes in infected plants are introduced. In addition, techniques used in PPV detection are accentuated and discussed, especially with respect to new modern techniques of nucleic acids isolation, based on the nanotechnological approach. Finally, perspectives on the future of possibilities for nanotechnology application in PPV determination/identification are outlined. PMID:23202508

Structural Analysis of the Phenol-Responsive Sensory Domain of the Transcription Activator PoxR.

PubMed

Patil, Vinod Vikas; Park, Kwang-Hyun; Lee, Seung-Goo; Woo, Euijeon

2016-04-05

Positive phenol-degradative gene regulator (PoxR) is a σ(54)-dependent AAA+ ATPase transcription activator that regulates the catabolism of phenols. The PoxR sensory domain detects phenols and relays signals for the activation of transcription. Here we report the first structure of the phenol sensory domain bound to phenol and five derivatives. It exists as a tightly intertwined homodimer with a phenol-binding pocket buried inside, placing two C termini on the same side of the dimer. His102 and Trp130 interact with the hydroxyl group of the phenol in a cavity surrounded by rigid hydrophobic residues on one side and a flexible region on the other. Each monomer has a V4R fold with a unique zinc-binding site. A shift at the C-terminal helix suggests that there is a possible conformational change upon ligand binding. The results provide a structural basis of chemical effector binding for transcriptional regulation with broad implications for protein engineering. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sharka: the past, the present and the future.

PubMed

Sochor, Jiri; Babula, Petr; Adam, Vojtech; Krska, Boris; Kizek, Rene

2012-11-07

Members the Potyviridae family belong to a group of plant viruses that are causing devastating plant diseases with a significant impact on agronomy and economics. Plum pox virus (PPV), as a causative agent of sharka disease, is widely discussed. The understanding of the molecular biology of potyviruses including PPV and the function of individual proteins as products of genome expression are quite necessary for the proposal the new antiviral strategies. This review brings to view the members of Potyviridae family with respect to plum pox virus. The genome of potyviruses is discussed with respect to protein products of its expression and their function. Plum pox virus distribution, genome organization, transmission and biochemical changes in infected plants are introduced. In addition, techniques used in PPV detection are accentuated and discussed, especially with respect to new modern techniques of nucleic acids isolation, based on the nanotechnological approach. Finally, perspectives on the future of possibilities for nanotechnology application in PPV determination/identification are outlined.

Cysteine-independent Catalase-like Activity of Vertebrate Peroxiredoxin 1 (Prx1)*

PubMed Central

Sun, Cen-Cen; Dong, Wei-Ren; Zhao, Jing; Nie, Li; Xiang, Li-Xin; Zhu, Guan; Shao, Jian-Zhong

2015-01-01

Peroxiredoxins (Prxs) are a ubiquitous family of antioxidant proteins that are known as thioredoxin peroxidases. Here we report that Prx1 proteins from Tetraodon nigroviridis and humans also possess a previously unknown catalase-like activity that is independent of Cys residues and reductants but dependent on iron. We identified that the GVL motif was essential to the catalase (CAT)-like activity of Prx1 but not to the Cys-dependent thioredoxin peroxidase (POX) activity, and we generated mutants lacking POX and/or CAT activities for individually delineating their functional features. We discovered that the TnPrx1 POX and CAT activities possessed different kinetic features in reducing H2O2. The overexpression of wild-type TnPrx1 and mutants differentially regulated the intracellular levels of reactive oxygen species and p38 phosphorylation in HEK-293T cells treated with H2O2. These observations suggest that the dual antioxidant activities of Prx1 may be crucial for organisms to mediate intracellular redox homeostasis. PMID:26088136

Theoretical study on the molecular structure and vibrational properties, NBO and HOMO-LUMO analysis of the POX3 (X = F, Cl, Br, I) series of molecules

NASA Astrophysics Data System (ADS)

Galván, Jorge E.; Gil, Diego M.; Lanús, Hernán E.; Altabef, Aida Ben

2015-02-01

The fourth member of the series of compounds of the type POX3 with X = I was synthesized and characterized by infrared spectroscopy. The geometrical parameters and vibrational properties of POX3 (X = F, Cl, Br, I) molecules were investigated theoretically by means DFT and ab initio methods. Available geometrical and vibrational data were used together with theoretical calculations in order to obtain a set of scaled force constants. The observed trends in geometrical parameters are analyzed and compared with those obtained in a previous work for the VOX3 (X = F, Cl, Br, I) series of compounds. NBO analysis was performed in order to know the hyper-conjugative interactions that favor one structure over another. The molecular properties such as ionization potential, electron affinity, electronegativity, chemical potential, chemical hardness, softness and global electrophilicity index have been deduced from HOMO-LUMO analysis.

An Intermediate-Mass Black Hole in the Dwarf Seyfert 1 Galaxy POX 52

NASA Astrophysics Data System (ADS)

Barth, A.; Ho, L.; Sargent, W.

2004-06-01

We describe new observations of POX 52, a previously known but nearly forgotten example of a dwarf galaxy with an active nucleus. While POX 52 was originally thought to be a Seyfert 2 galaxy, the new data reveal an emission-line spectrum very similar to that of the dwarf Seyfert 1 galaxy NGC 4395, with clear broad components to the permitted line profiles. The host galaxy appears to be a dwarf elliptical; this is the only known case of a Seyfert nucleus in a galaxy of this type. Applying scaling relations to estimate the black hole mass from the broad Hβ linewidth and continuum luminosity, we find MBH ≈ 1.6×105 M⊙. The stellar velocity dispersion in the host galaxy is 36 km s-1, also suggestive of a black hole mass of order 105 M⊙. Further searches for AGNs in dwarf galaxies can provide crucial constraints on the demographics of black holes in the mass range below 106 M⊙.

Recombinant Sheep Pox Virus Proteins Elicit Neutralizing Antibodies

PubMed Central

Chervyakova, Olga V.; Zaitsev, Valentin L.; Iskakov, Bulat K.; Tailakova, Elmira T.; Strochkov, Vitaliy M.; Sultankulova, Kulyaisan T.; Sandybayev, Nurlan T.; Stanbekova, Gulshan E.; Beisenov, Daniyar K.; Abduraimov, Yergali O.; Mambetaliyev, Muratbay; Sansyzbay, Abylay R.; Kovalskaya, Natalia Y.; Nemchinov, Lev. G.; Hammond, Rosemarie W.

2016-01-01

The aim of this work was to evaluate the immunogenicity and neutralizing activity of sheep pox virus (SPPV; genus Capripoxvirus, family Poxviridae) structural proteins as candidate subunit vaccines to control sheep pox disease. SPPV structural proteins were identified by sequence homology with proteins of vaccinia virus (VACV) strain Copenhagen. Four SPPV proteins (SPPV-ORF 060, SPPV-ORF 095, SPPV-ORF 117, and SPPV-ORF 122), orthologs of immunodominant L1, A4, A27, and A33 VACV proteins, respectively, were produced in Escherichia coli. Western blot analysis revealed the antigenic and immunogenic properties of SPPV-060, SPPV-095, SPPV-117 and SPPV-122 proteins when injected with adjuvant into experimental rabbits. Virus-neutralizing activity against SPPV in lamb kidney cell culture was detected for polyclonal antisera raised to SPPV-060, SPPV-117, and SPPV-122 proteins. To our knowledge, this is the first report demonstrating the virus-neutralizing activities of antisera raised to SPPV-060, SPPV-117, and SPPV-122 proteins. PMID:27338444

Recombinant Sheep Pox Virus Proteins Elicit Neutralizing Antibodies.

PubMed

Chervyakova, Olga V; Zaitsev, Valentin L; Iskakov, Bulat K; Tailakova, Elmira T; Strochkov, Vitaliy M; Sultankulova, Kulyaisan T; Sandybayev, Nurlan T; Stanbekova, Gulshan E; Beisenov, Daniyar K; Abduraimov, Yergali O; Mambetaliyev, Muratbay; Sansyzbay, Abylay R; Kovalskaya, Natalia Y; Nemchinov, Lev G; Hammond, Rosemarie W

2016-06-07

The aim of this work was to evaluate the immunogenicity and neutralizing activity of sheep pox virus (SPPV; genus Capripoxvirus, family Poxviridae) structural proteins as candidate subunit vaccines to control sheep pox disease. SPPV structural proteins were identified by sequence homology with proteins of vaccinia virus (VACV) strain Copenhagen. Four SPPV proteins (SPPV-ORF 060, SPPV-ORF 095, SPPV-ORF 117, and SPPV-ORF 122), orthologs of immunodominant L1, A4, A27, and A33 VACV proteins, respectively, were produced in Escherichia coli. Western blot analysis revealed the antigenic and immunogenic properties of SPPV-060, SPPV-095, SPPV-117 and SPPV-122 proteins when injected with adjuvant into experimental rabbits. Virus-neutralizing activity against SPPV in lamb kidney cell culture was detected for polyclonal antisera raised to SPPV-060, SPPV-117, and SPPV-122 proteins. To our knowledge, this is the first report demonstrating the virus-neutralizing activities of antisera raised to SPPV-060, SPPV-117, and SPPV-122 proteins.

Sheep pox in Tunisia: Current status and perspectives.

PubMed

Ben Chehida, F; Ayari-Fakhfakh, E; Caufour, P; Amdouni, J; Nasr, J; Messaoudi, L; Haj Ammar, H; Sghaier, S; Bernard, C; Ghram, A; Cêtre-Sossah, C

2018-02-01

Sheep pox, a well-known endemic capripox infection, has significant impacts on small ruminant populations in Tunisia. It is responsible for high economic losses throughout North Africa due to its enzootic nature and to the active animal transhumance existing in some governorates in Tunisia. The aim of this review was to analyse data gathered on annual vaccination campaigns designed to control its spread by reducing the level of endemicity and to describe diagnostic and management tools adapted to the Tunisian situation. Seasonal, temporal and spatial distributions of sheep pox outbreaks, as well as related clinical features, were found. It was concluded from this review that establishing strong herd immunization through individual animal immunization, creating adequate infrastructure, increasing awareness among breeders, setting up a field-based surveillance network and improving routine diagnostic methods need to be the major components of a programme to eradicate the disease. It was also felt that cost-benefit analyses of the surveillance and control strategies used would help in controlling its persistence. © 2017 Blackwell Verlag GmbH.

A search for HI in some peculiar faint dwarf galaxies

NASA Astrophysics Data System (ADS)

Begum, Ayesha; Chengalur, Jayaram N.

2005-09-01

We present a deep Giant Metrewave Radio Telescope (GMRT) search for HI 21-cm emission from three dwarf galaxies, viz. POX 186, SC 24 and KKR 25. Based, in part, on previous single-dish HI observations, these galaxies have been classified as a blue compact dwarf (BCD), a dwarf irregular and a transition galaxy, respectively. However, in conflict with previous single-dish detections, we do not detect HI in SC 24 or KKR 25. We suggest that the previous single-dish measurements were probably confused with the local Galactic emission. In the case of POX 186, we confirm the previous non-detection of HI but with substantially improved limits on its HI mass. Our derived upper limits on the HI mass of SC 24 and KKR 25 are similar to the typical HI mass limit for dwarf spheroidal (dSph) galaxies, whereas in the case of POX 186, we find that its gas content is somewhat smaller than is typical of BCD galaxies.

[Management of chicken pox purpura fulminans: a pediatric case report].

PubMed

Domergue, S; Rodiere, M; Bigorre, M; Guye, E; Captier, G

2006-06-01

The authors report a case of a 4 years old girl who had presented a chicken-pox purpura fulminans. Lesions appeared 5 days after chicken-pox start and were quickly evoluted in cutaneous and sub-cutaneous necrosis on external side of thighs and behind side of right calf. A medical management was done with fresh plasma, blood, antithrombine 3, and fibrin. Specifics treatments were done: heparin and activated C protein. Surgical treatment was realised 5 weeks later. It consisted of clean necrosis areas and put a thin skin graft witch was took on the scalp. The evolution was fast good. The follow-up is 3 years without big esthetic and functional consequences. Some cases of this pathology were described in literature with serious lesions. The management should be multidisciplinary. Surgical treatment should be realised when lesions are stabilized. Scalp is a donor site for skin graft very interesting because of big quantity of skin and not esthetic consequence.

Prevalence, distribution, and risk factor for sheep pox and goat pox (SPGP) in Algeria.

PubMed

Kardjadj, Moustafa

2017-03-01

A cross-sectional study using a tested questionnaire was carried out across Algeria between January and June 2014. Our investigation demonstrated that of the 150 flocks visited, 21 were positive for sheep pox and goat pox (SPGP) with an overall flock prevalence of 14% (95% CI 11.08-16.92%) suggesting that SPGP is endemic in Algeria. Our results showed also that the disease appears only in sheep and no case affecting goats has been reported. For the risk factor analysis, univariate analysis of variables followed by a multiple logistic regression identified steppe region (OR = 1.81, 95% CI 0.87-2.57; P = 0.037), large flocks (OR = 2. 19, 95% CI 1.02-3.36; P = 0.027), and transhumance (OR = 3.98, 95% CI 2.59-5.34; P = 0.021) as risk factors in the spread of the disease. Furthermore, our study revealed that the use of vaccination as preventive measures in the selected flocks decreased the odds for SPGP positivity by 5.78 (95% CI 2.22-9.34; P < 0.001) times compared to non vaccinated flocks. In conclusion, our findings documented an evidence of a widespread distribution and endemic establishment of the SPGP in Algerian sheep population despite the annual vaccination program. Consequently, the vaccination must cover all the Algerian sheep population to improve animal welfare and reduce economic losses associated with outbreak episodes.

Clinical and pathological findings of concurrent poxvirus lesions and aspergillosis infection in canaries.

PubMed

Reza, Kheirandish; Nasrin, Askari; Mahmoud, Salehi

2013-03-01

To investigate clinical, pathological and mycological findings in canaries, in which pox lesions and Aspergillus fumigatus (A. fumigatus) infection were observed simultaneously. This study was performed on a breeding colony (about 100 canaries) affected by fatal wasting disease. Necropsy was undertaken on 10 severely affected canaries, and gross lesions were recorded. Samples from internal organs displaying lesions were obtained for histopathological evaluation. Tracheal swap samples of internal organs of the all infected animals with lesions at necropsy were cultured in Sabouraud Dextrose Agar for mycological examination. At necropsy, caseous foci were determined in the lungs, on the air sacs, liver, spleen, heart. Swelling of the eyelids, diffuse hemorrhages in the subcutaneous tissue with small papular lesions of the skin were other typical necropsy findings. Histopathologically, pathognomonic eosinophilic intracytoplasmic inclusion bodies, which called Bollinger bodies, in both skin cells and vacuolated air way epithelial cells confirmed canary pox infection. Moreover, histopathological examination of the white-yellowish caseous foci revealed necrotic granulomatous reaction consisting of macrophages, heterophil leukocytes and giant cells encapsulated with a fibrous tissue. After the culture of the tissue samples, the formation of bluish green colonies confirmed A. fumigatus infection. Canary pox has been known as the disease that can result in high losses in a short time, as a re-emerging disease that has not been present during recent years in canary flocks in Iran. So, the current paper provides useful information to prevent misdiagnosed of canary pox disease which can cause secondary mycotic infection.

Peroxiredoxin 1 (Prx1) is a dual-function enzyme by possessing Cys-independent catalase-like activity

PubMed Central

Sun, Cen-Cen; Dong, Wei-Ren; Shao, Tong; Li, Jiang-Yuan; Zhao, Jing; Nie, Li

2017-01-01

Peroxiredoxin (Prx) was previously known as a Cys-dependent thioredoxin. However, we unexpectedly observed that Prx1 from the green spotted puffer fish Tetraodon nigroviridis (TnPrx1) was able to reduce H2O2 in a manner independent of Cys peroxidation and reductants. This study aimed to validate a novel function for Prx1, delineate the biochemical features and explore its antioxidant role in cells. We have confirmed that Prx1 from the puffer fish and humans truly possesses a catalase (CAT)-like activity that is independent of Cys residues and reductants, but dependent on iron. We have identified that the GVL motif was essential to the CAT-like activity of Prx1, but not to the Cys-dependent thioredoxin peroxidase (POX) activity, and generated mutants lacking POX and/or CAT-like activities for individual functional validation. We discovered that the TnPrx1 POX and CAT-like activities possessed different kinetic features in the reduction of H2O2. The overexpression of wild-type TnPrx1 and mutants differentially regulated the intracellular levels of reactive oxygen species (ROS) and the phosphorylation of p38 in HEK-293T cells treated with H2O2. Prx1 is a dual-function enzyme by acting as POX and CAT with varied affinities towards ROS. This study extends our knowledge on Prx1 and provides new opportunities to further study the biological roles of this family of antioxidants. PMID:28219939

Zinc oxide nanoparticles (ZnONPs) alleviate heavy metal-induced toxicity in Leucaena leucocephala seedlings: A physiochemical analysis.

PubMed

Venkatachalam, P; Jayaraj, M; Manikandan, R; Geetha, N; Rene, Eldon R; Sharma, N C; Sahi, S V

2017-01-01

The present study describes the role of zinc oxide nanoparticles (ZnONPs) in reversing oxidative stress symptoms induced by heavy metal (Cd and Pb) exposure in Leucaena leucocephala (Lam.) de Wit. Seedling growth was significantly enhanced with the augmentation of ZnONPs following Cd and Pb exposure. Heavy metal accumulations were recorded as 1253.1 mg Cd per kg DW and 1026.8 mg Pb per kg DW for the respective treatments. Results demonstrated that ZnONPs augmentation caused an increase in photosynthetic pigment and total soluble protein contents while a significant decrease in malondialdehyde (MDA-lipid peroxidation) content in leaves. Antioxidative enzymes such as superoxide dismutase (SOD), catalase (CAT) and peroxidase (POX) were, in turn, elevated in heavy metal-exposed leaves amended with ZnONPs. The ameliorating effect of ZnO nanoparticles on oxidative stress induced toxicity was also confirmed by the reduced MDA content and the elevated level of antioxidative enzyme activities in leaf tissues of L. leucocephala seedlings. Further, addition of ZnONPs in combination with Cd and Pb metals induced distinct genomic alterations such as presence of new DNA bands and/or absence of normal bands in the RAPD pattern of the exposed plants. This study uniquely suggests a potential role of zinc oxide nanoparticles in the remediation of heavy metal contaminated media. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Deciphering how LIP2 and POX2 promoters can optimally regulate recombinant protein production in the yeast Yarrowia lipolytica.

PubMed

Sassi, Hosni; Delvigne, Frank; Kar, Tambi; Nicaud, Jean-Marc; Coq, Anne-Marie Crutz-Le; Steels, Sebastien; Fickers, Patrick

2016-09-20

In recent years, the non-conventional model yeast species Yarrowia lipolytica has received much attention because it is a useful cell factory for producing recombinant proteins. In this species, expression vectors involving LIP2 and POX2 promoters have been developed and used successfully for protein production at yields similar to or even higher than those of other cell factories, such as Pichia pastoris. However, production processes involving these promoters can be difficult to manage, especially if carried out at large scales in fed-batch bioreactors, because they require hydrophobic inducers, such as oleic acid or methyl oleate. Thus, the challenge has become to reduce loads of hydrophobic substrates while simultaneously promoting recombinant protein production. One possible solution is to replace a portion of the inducer with a co-substrate that can serve as an alternative energy source. However, implementing such an approach would require detailed knowledge of how carbon sources impact promoter regulation, which is surprisingly still lacking for the LIP2 and POX2 promoters. This study's aim was thus to better characterize promoter regulation and cell metabolism in Y. lipolytica cultures grown in media supplemented with different carbon sources. pPOX2 induction could be detected when glucose or glycerol was used as sole carbon source, which meant these carbon source could not prevent promoter induction. In addition, when a mixture of glucose and oleic acid was used in complex medium, pPOX2 induction level was lower that that of pLIP2. In contrast, pLIP2 induction was absent when glucose was present in the culture medium, which meant that cell growth could occur without any recombinant gene expression. When a 40/60 mixture of glucose and oleic acid (w/w) was used, a tenfold increase in promoter induction, as compared to when an oleic-acid-only medium was observed. It was also clear that individual cells were adapting metabolically to use both glucose and oleic acid. Indeed, no distinct subpopulations that specialized on glucose versus oleic acid were observed; such an outcome would have led to producer and non-producer phenotypes. In medium containing both glucose and oleic acid, cells tended to directly metabolize oleic acid instead of storing it in lipid bodies. This study found that pLIP2 is a promoter of choice as compared to pPOX2 to drive gene expression for recombinant protein production by Y. lipolytica used as cell factory.

Enplanement and All Cargo Activity

DTIC Science & Technology

1991-01-01

ORLEANS NEW ORLEANS INTL/M MSY 3,255,817 $3.481.281 41 IL CHICAGO CHICAGO MIDWAY MDW 3,241,851 $3,472.203 42 OR PORTLAND PORTLAND INTL POX # 3,178,617...FNN 66.042 $473.418 NEW MEXICO TOTAL 2.560.292 $4.236.347 3601 COUNTY OF BROOME EDWIN A LINK FIELD-BRD 5GM 151.518 $783.947 3602 COUNTY OF CHAUTAUQUA...PENDLETON MUNI PDT 11,056 $400.000 4109 CITY OF REDMOND ROBERTS FtELD ROM 64.773 $486.820 4113 PORT OF PORTLAND PORTLAND INTL POX # 3.178,617 $1.715.551

Paroxysmal cold haemoglobinuria in an adult with chicken pox.

PubMed

Papalia, M A; Schwarer, A P

2000-05-01

Paroxysmal cold haemoglobinuria (PCH) is an autoimmune disorder characterized by intravascular haemolysis causing haemoglobinuria. It is due to a biphasic haemolysin known as the Donath-Landsteiner antibody, which binds specifically to the P antigen of red blood cells at low temperatures, leading to complement activation and red cell lysis at 37 degrees C. PCH is a rare disease which predominantly affects the paediatric population, occurring mostly during viral infections. We report on what is possibly the first case of PCH in an adult to be precipitated by chicken pox infection.

New respiratory virus (chicken pox, influenza and respiratory syncytial virus) vaccines: efficacy, necessity and policy for the tropical world at present.

PubMed

Wiwanitkit, Viroj

2009-09-01

Several respiratory viruses are documented in medicine. Several infectious diseases due to these viruses are current global public health problems. Prevention of respiratory viral infections becomes the focus of the public health ministries of many tropical countries. Presently, there are many new vaccines for respiratory viruses. These vaccines include chicken pox vaccine, influenza vaccine and respiratory syncytial virus vaccine. In this article, the author will briefly discuss on these quoted vaccines focusing on efficacy, necessity and policy for tropical world at present.

[Atypical course of chicken-pox complicated by hepatitis and endocarditis].

PubMed

Hryckiewicz, Katarzyna; Flieger, Jan; Juszczyk, Jacek

2004-01-01

A case of chicken-pox complicated by hepatitis and endocarditis in 21 years old man was described. Three weeks before admission to the Department of Infectious Diseases the patient stayed at the Neurological Department and was diagnosed as encephalitis. The spots on the skin and a very high level of aminotransferases were noticed in 19th day of hospitalization. The blood cultures were positive for Staphylococcus aureus MSSA. Bacterial endocarditis was diagnosed on the base of echocardiography. The patient was treated with antibiotics six weeks. He recovered completely.

Myocardial infarction in a 35-day-old infant with incomplete Kawasaki disease and chicken pox.

PubMed

Kossiva, Lydia; Papadopoulos, Marios; Lagona, Evangelia; Papadopoulos, George; Athanassaki, Corina

2010-10-01

Kawasaki disease is an acute febrile vasculitis of infancy and early childhood. It is uncommon in early infancy, because a significant proportion of these children do not meet the classical diagnostic criteria at this age. Infants younger than 6 months with persistent fever and some of the criteria of Kawasaki disease should always raise suspicion for Kawasaki disease early to avoid delayed diagnosis with severe cardiac complications. We present a 35-day-old infant with incomplete Kawasaki disease complicated with myocardial infarction during chicken pox.

Further characterization of a new recombinant group of Plum pox virus isolates, PPV-T, found in orchards in the Ankara province of Turkey.

PubMed

Serçe, Ciğdem Ulubaş; Candresse, Thierry; Svanella-Dumas, Laurence; Krizbai, Laszlo; Gazel, Mona; Cağlayan, Kadriye

2009-06-01

Sixteen Plum pox virus (PPV) isolates collected in the Ankara region of Turkey were analyzed using available serological and molecular typing assays. Surprisingly, despite the fact that all isolates except one, which was a mix infection, were typed as belonging to the PPV-M strain in four independent molecular assays, nine of them (60%) reacted with both PPV-M specific and PPV-D specific monoclonal antibodies. Partial 5' and 3' genomic sequence analysis on four isolates demonstrated that irrespective of their reactivity towards the PPV-D specific monoclonal antibody, they were all closely related to a recombinant PPV isolate from Turkey, Ab-Tk. All three isolates for which the relevant genomic sequence was obtained showed the same recombination event as Ab-Tk in the HC-Pro gene, around position 1566 of the genome. Complete genomic sequencing of Ab-Tk did not provide evidence for additional recombination events in its evolutionary history. Taken together, these results indicate that a group of closely related PPV isolates characterized by a unique recombination in the HC-Pro gene is prevalent under field conditions in the Ankara region of Turkey. Similar to the situation with the PPV-Rec strain, we propose that these isolates represent a novel strain of PPV, for which the name PPV-T (Turkey) is proposed. Given that PPV-T isolates cannot be identified by currently available typing techniques, it is possible that their presence has been overlooked in other situations. Further efforts should allow a precise description of their prevalence and of their geographical distribution in Turkey and, possibly, in other countries.

The Host Galaxy and Central Engine of the Dwarf Active Galactic Nucleus POX 52

NASA Astrophysics Data System (ADS)

Thornton, Carol E.; Barth, Aaron J.; Ho, Luis C.; Rutledge, Robert E.; Greene, Jenny E.

2008-10-01

We present new multiwavelength observations of the dwarf Seyfert 1 galaxy POX 52 in order to investigate the properties of the host galaxy and the active nucleus and to examine the mass of its black hole, previously estimated to be ~105 M⊙. HST ACS HRC images show that the host galaxy has a dwarf elliptical morphology (MI = - 18.4 mag, Sérsic index n = 4.3) with no detected disk component or spiral structure, confirming previous results from ground-based imaging. X-ray observations from both Chandra and XMM-Newton show strong (factor of 2) variability over timescales as short as 500 s, as well as a dramatic decrease in the absorbing column density over a 9 month period. We attribute this change to a partial covering absorber, with a 94% covering fraction and NH = 58+ 8.4-9.2 × 1021 cm -2, that moved out of the line of sight in between the XMM-Newton and Chandra observations. Combining these data with observations from the VLA, Spitzer, and archival data from 2MASS and GALEX, we examine the SED of the active nucleus. Its shape is broadly similar to typical radio-quiet quasar SEDs, despite the very low bolometric luminosity of Lbol = 1.3 × 1043 ergs s-1. Finally, we compare black hole mass estimators, including methods based on X-ray variability, and optical scaling relations using the broad Hβ line width and AGN continuum luminosity, finding a range of black hole mass from all methods to be MBH = (2.2-4.2) × 105 M⊙, with an Eddington ratio of Lbol/LEdd ≈ 0.2-0.5.

The Ontogeny and Brain Distribution Dynamics of the Appetite Regulators NPY, CART and pOX in Larval Atlantic Cod (Gadus morhua L.)

PubMed Central

Le, Hoang T. M. D.; Angotzi, Anna Rita; Ebbesson, Lars O. E.; Karlsen, Ørjan

2016-01-01

Similar to many marine teleost species, Atlantic cod undergo remarkable physiological changes during the early life stages with concurrent and profound changes in feeding biology and ecology. In contrast to the digestive system, very little is known about the ontogeny and the localization of the centers that control appetite and feed ingestion in the developing brain of fish. We examined the expression patterns of three appetite regulating factors (orexigenic: neuropeptide Y, NPY; prepro-orexin, pOX and anorexigenic: cocaine- and amphetamine-regulated transcript, CART) in discrete brain regions of developing Atlantic cod using chromogenic and double fluorescent in situ hybridization. Differential temporal and spatial expression patterns for each appetite regulator were found from first feeding (4 days post hatch; dph) to juvenile stage (76 dph). Neurons expressing NPY mRNA were detected in the telencephalon (highest expression), diencephalon, and optic tectum from 4 dph onward. CART mRNA expression had a wider distribution along the anterior-posterior brain axis, including both telencephalon and diencephalon from 4 dph. From 46 dph, CART transcripts were also detected in the olfactory bulb, region of the nucleus of medial longitudinal fascicle, optic tectum and midbrain tegmentum. At 4 and 20 dph, pOX mRNA expression was exclusively found in the preoptic region, but extended to the hypothalamus at 46 and 76 dph. Co-expression of both CART and pOX genes were also observed in several hypothalamic neurons throughout larval development. Our results show that both orexigenic and anorexigenic factors are present in the telencephalon, diencephalon and mesencephalon in cod larvae. The telencephalon mostly contains key factors of hunger control (NPY), while the diencephalon, and particularly the hypothalamus may have a more complex role in modulating the multifunctional control of appetite in this species. As the larvae develop, the overall progression in temporal and spatial complexity of NPY, CART and pOX mRNAs expression might be correlated to the maturation of appetite control regulation. These observations suggest that teleost larvae continue to develop the regulatory networks underlying appetite control after onset of exogenous feeding. PMID:27100086

The Ontogeny and Brain Distribution Dynamics of the Appetite Regulators NPY, CART and pOX in Larval Atlantic Cod (Gadus morhua L.).

PubMed

Le, Hoang T M D; Angotzi, Anna Rita; Ebbesson, Lars O E; Karlsen, Ørjan; Rønnestad, Ivar

2016-01-01

Similar to many marine teleost species, Atlantic cod undergo remarkable physiological changes during the early life stages with concurrent and profound changes in feeding biology and ecology. In contrast to the digestive system, very little is known about the ontogeny and the localization of the centers that control appetite and feed ingestion in the developing brain of fish. We examined the expression patterns of three appetite regulating factors (orexigenic: neuropeptide Y, NPY; prepro-orexin, pOX and anorexigenic: cocaine- and amphetamine-regulated transcript, CART) in discrete brain regions of developing Atlantic cod using chromogenic and double fluorescent in situ hybridization. Differential temporal and spatial expression patterns for each appetite regulator were found from first feeding (4 days post hatch; dph) to juvenile stage (76 dph). Neurons expressing NPY mRNA were detected in the telencephalon (highest expression), diencephalon, and optic tectum from 4 dph onward. CART mRNA expression had a wider distribution along the anterior-posterior brain axis, including both telencephalon and diencephalon from 4 dph. From 46 dph, CART transcripts were also detected in the olfactory bulb, region of the nucleus of medial longitudinal fascicle, optic tectum and midbrain tegmentum. At 4 and 20 dph, pOX mRNA expression was exclusively found in the preoptic region, but extended to the hypothalamus at 46 and 76 dph. Co-expression of both CART and pOX genes were also observed in several hypothalamic neurons throughout larval development. Our results show that both orexigenic and anorexigenic factors are present in the telencephalon, diencephalon and mesencephalon in cod larvae. The telencephalon mostly contains key factors of hunger control (NPY), while the diencephalon, and particularly the hypothalamus may have a more complex role in modulating the multifunctional control of appetite in this species. As the larvae develop, the overall progression in temporal and spatial complexity of NPY, CART and pOX mRNAs expression might be correlated to the maturation of appetite control regulation. These observations suggest that teleost larvae continue to develop the regulatory networks underlying appetite control after onset of exogenous feeding.

Low temperature InP /Si wafer bonding using boride treated surface

NASA Astrophysics Data System (ADS)

Huang, Hui; Ren, Xiaomin; Wang, Wenjuan; Song, Hailan; Wang, Qi; Cai, Shiwei; Huang, Yongqing

2007-04-01

An approach for InP /Si wafer bonding based on boride-solution treatment was presented. The bonding energy is higher than the InP fracture energy by annealing at 280°C. An In0.53Ga0.47As/InP multiple-quantum-well (MQW) structure grown on InP was transferred onto Si substrate via the bonding process. X-ray diffraction and photoluminescence reveal that crystal quality of the bonded MQW was preserved. A thin B2O3-POx-SiO2 oxide layer of about 28nm thick at the bonding interface was detected. X-ray photoelectron spectroscopy and Raman analyses indicate that the formation of oxygen bridging bonds by boride treatment is responsible for the strong fusion obtained at such low temperature.

Evaluating operating conditions for outcompeting nitrite oxidizers and maintaining partial nitrification in biofilm systems using biofilm modeling and Monte Carlo filtering.

PubMed

Brockmann, D; Morgenroth, E

2010-03-01

In practice, partial nitrification to nitrite in biofilms has been achieved with a range of different operating conditions, but mechanisms resulting in reliable partial nitrification in biofilms are not well understood. In this study, mathematical biofilm modeling combined with Monte Carlo filtering was used to evaluate operating conditions that (1) lead to outcompetition of nitrite oxidizers from the biofilm, and (2) allow to maintain partial nitrification during long-term operation. Competition for oxygen was found to be the main mechanism for displacing nitrite oxidizers from the biofilm, and preventing re-growth of nitrite oxidizers in the long-term. To maintain partial nitrification in the model, a larger oxygen affinity (i.e., smaller half saturation constant) for ammonium oxidizers compared to nitrite oxidizers was required, while the difference in maximum growth rate was not important for competition under steady state conditions. Thus, mechanisms for washout of nitrite oxidizing bacteria from biofilms are different from suspended cultures where the difference in maximum growth rate is a key mechanism. Inhibition of nitrite oxidizers by free ammonia was not required to outcompete nitrite oxidizers from the biofilm, and to maintain partial nitrification to nitrite. But inhibition by free ammonia resulted in faster washout of nitrite oxidizers. Copyright 2009 Elsevier Ltd. All rights reserved.

Plum Pox Virus 6K1 Protein Is Required for Viral Replication and Targets the Viral Replication Complex at the Early Stage of Infection.

PubMed

Cui, Hongguang; Wang, Aiming

2016-05-15

The potyviral RNA genome encodes two polyproteins that are proteolytically processed by three viral protease domains into 11 mature proteins. Extensive molecular studies have identified functions for the majority of the viral proteins. For example, 6K2, one of the two smallest potyviral proteins, is an integral membrane protein and induces the endoplasmic reticulum (ER)-originated replication vesicles that target the chloroplast for robust viral replication. However, the functional role of 6K1, the other smallest protein, remains uncharacterized. In this study, we developed a series of recombinant full-length viral cDNA clones derived from a Canadian Plum pox virus (PPV) isolate. We found that deletion of any of the short motifs of 6K1 (each of which ranged from 5 to 13 amino acids), most of the 6K1 sequence (but with the conserved sequence of the cleavage sites being retained), or all of the 6K1 sequence in the PPV infectious clone abolished viral replication. The trans expression of 6K1 or the cis expression of a dislocated 6K1 failed to rescue the loss-of-replication phenotype, suggesting the temporal and spatial requirement of 6K1 for viral replication. Disruption of the N- or C-terminal cleavage site of 6K1, which prevented the release of 6K1 from the polyprotein, either partially or completely inhibited viral replication, suggesting the functional importance of the mature 6K1. We further found that green fluorescent protein-tagged 6K1 formed punctate inclusions at the viral early infection stage and colocalized with chloroplast-bound viral replicase elements 6K2 and NIb. Taken together, our results suggest that 6K1 is required for viral replication and is an important viral element of the viral replication complex at the early infection stage. Potyviruses account for more than 30% of known plant viruses and consist of many agriculturally important viruses. The genomes of potyviruses encode two polyproteins that are proteolytically processed into 11 mature proteins, with the majority of them having been at least partially functionally characterized. However, the functional role of a small protein named 6K1 remains obscure. In this study, we showed that deletion of 6K1 or a short motif/region of 6K1 in the full-length cDNA clones of plum pox virus abolishes viral replication and that mutation of the N- or C-terminal cleavage sites of 6K1 to prevent its release from the polyprotein greatly attenuates or completely inhibits viral replication, suggesting its important role in potyviral infection. We report that 6K1 forms punctate structures and targets the replication vesicles in PPV-infected plant leaf cells at the early infection stage. Our data reveal that 6K1 is an important viral protein of the potyviral replication complex. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering.

PubMed

Karimova, Madina; Splith, Victoria; Karpinski, Janet; Pisabarro, M Teresa; Buchholz, Frank

2016-07-22

Precise genome engineering is instrumental for biomedical research and holds great promise for future therapeutic applications. Site-specific recombinases (SSRs) are valuable tools for genome engineering due to their exceptional ability to mediate precise excision, integration and inversion of genomic DNA in living systems. The ever-increasing complexity of genome manipulations and the desire to understand the DNA-binding specificity of these enzymes are driving efforts to identify novel SSR systems with unique properties. Here, we describe two novel tyrosine site-specific recombination systems designated Nigri/nox and Panto/pox. Nigri originates from Vibrio nigripulchritudo (plasmid VIBNI_pA) and recombines its target site nox with high efficiency and high target-site selectivity, without recombining target sites of the well established SSRs Cre, Dre, Vika and VCre. Panto, derived from Pantoea sp. aB, is less specific and in addition to its native target site, pox also recombines the target site for Dre recombinase, called rox. This relaxed specificity allowed the identification of residues that are involved in target site selectivity, thereby advancing our understanding of how SSRs recognize their respective DNA targets.

Method for improving catalyst function in auto-thermal and partial oxidation reformer-based processors

DOEpatents

Ahmed, Shabbir; Papadias, Dionissios D.; Lee, Sheldon H.D.; Ahluwalia, Rajesh K.

2014-08-26

The invention provides a method for reforming fuel, the method comprising contacting the fuel to an oxidation catalyst so as to partially oxidize the fuel and generate heat; warming incoming fuel with the heat while simultaneously warming a reforming catalyst with the heat; and reacting the partially oxidized fuel with steam using the reforming catalyst.

Review of Specifications for Zinc-Rich Paints,

DTIC Science & Technology

1979-09-01

inspected in 1976, the repair inorganic zinc was in very poor condition due to extensive " chicken pox " rusting. The original red lead alkyd and basic...Nebraska H-186 New Hampshire H-188 New Jersey H-189 /y’/9 7’ 𔃼 New Mexico H(-216.0 North Carolina H-217 North Dakota l1- 246 Ohio H-247 Oklahoma H-254...8217l.% 2. Olharfing I r A1 1 1e a £I )II d To be separately packaged in multiples of 0 54 pound of pox der per M . Cnpost vehicle. One 2.70 pound

Disrupted short chain specific β-oxidation and improved synthase expression increase synthesis of short chain fatty acids in Saccharomyces cerevisiae.

PubMed

Leber, Christopher; Choi, Jin Wook; Polson, Brian; Da Silva, Nancy A

2016-04-01

Biologically derived fatty acids have gained tremendous interest as an alternative to petroleum-derived fuels and chemical precursors. We previously demonstrated the synthesis of short chain fatty acids in Saccharomyces cerevisiae by introduction of the Homo sapiens fatty acid synthase (hFAS) with heterologous phosphopantetheine transferases and heterologous thioesterases. In this study, short chain fatty acid production was improved by combining a variety of novel enzyme and metabolic engineering strategies. The use of a H. sapiens-derived thioesterase and phosphopantetheine transferase were evaluated. In addition, strains were engineered to disrupt either the full β-oxidation (by deleting FAA2, PXA1, and POX1) or short chain-specific β-oxidation (by deleting FAA2, ANT1, and PEX11) pathways. Prohibiting full β-oxidation increased hexanoic and octanoic acid levels by 8- and 79-fold relative to the parent strain expressing hFAS. However, by targeting only short chain β-oxidation, hexanoic and octanoic acid levels increased further to 31- and 140-fold over the parent. In addition, an optimized hFAS gene increased hexanoic, octanoic, decanoic and total short chain fatty acid levels by 2.9-, 2.0-, 2.3-, and 2.2-fold, respectively, relative to the non-optimized counterpart. By combining these unique enzyme and metabolic engineering strategies, octanoic acid was increased more than 181-fold over the parent strain expressing hFAS. © 2015 Wiley Periodicals, Inc.

Low Cost High-H 2 Syngas Production for Power and Liquid Fuels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, S. James

2015-07-31

This report summarizes the technical progress made of the research project entitled “Low Cost High-H2 Syngas Production for Power and Liquid Fuels,” under DOE Contract No. DE-FE-0011958. The period of performance was October 1, 2013 through July 30, 2015. The overall objectives of this project was to determine the technical and economic feasibility of a systems approach for producing high hydrogen syngas from coal with the potential to reduce significantly the cost of producing power, chemical-grade hydrogen or liquid fuels, with carbon capture to reduce the environmental impact of gasification. The project encompasses several areas of study and the resultsmore » are summarized here. (1) Experimental work to determine the technical feasibility of a novel hybrid polymer/metal H2-membrane to recover pure H2 from a coal-derived syngas was done. This task was not successful. Membranes were synthesized and show impermeability of any gases at required conditions. The cause of this impermeability was most likely due to the densification of the porous polymer membrane support made from polybenzimidazole (PBI) at test temperatures above 250 °C. (2) Bench-scale experimental work was performed to extend GTI's current database on the University of California Sulfur Recovery Process-High Pressure (UCSRP-HP) and recently renamed Sulfur Removal and Recovery (SR2) process for syngas cleanup including removal of sulfur and other trace contaminants, such as, chlorides and ammonia. The SR2 process tests show >90% H2S conversion with outlet H2S concentrations less than 4 ppmv, and 80-90% ammonia and chloride removal with high mass transfer rates. (3) Techno-economic analyses (TEA) were done for the production of electric power, chemical-grade hydrogen and diesel fuels, from a mixture of coal- plus natural gas-derived syngas using the Aerojet Rocketdyne (AR) Advanced Compact coal gasifier and a natural gas partial oxidation reactor (POX) with SR2 technology. Due to the unsuccessful experimental results with the hybrid polymer/metal H2 membrane, a conventional CO2 capture (single-stage Selexol) and hydrogen purification (PSA) technologies were used in the appropriate cases. In all cases, the integrated system of Advanced Compact coal gasifier, non-catalytic natural gas partial oxidation, and SR2 multicontaminant removal with state-of-the-art auxiliary system provided a 5-25% cost advantage over the base line plants using GEE coal gasifier with conventional Selexol/Claus sulfur removal and recovery. These plants also produce 18-30% less CO2 than with the conventional coal gasification plants.« less

Pox 186: An ultracompact galaxy with dominant ionized gas emission

NASA Astrophysics Data System (ADS)

Guseva, N. G.; Papaderos, P.; Izotov, Y. I.; Noeske, K. G.; Fricke, K. J.

2004-07-01

We present a ground-based optical spectroscopic and HST U, V, I photometric study of the blue compact dwarf (BCD) galaxy Pox 186. It is found that the emission of the low-surface brightness (LSB) component in Pox 186 at radii ⪉3 arcsec (⪉270 pc in linear scale) is mainly gaseous in origin. We detect Hα emission out to radii as large as 6 arcsec. At radii ⪆3 arcsec the light of the LSB component is contaminated by the emission of background galaxies complicating the study of the outermost regions. The surface brightness distribution in the LSB component can be approximated by an exponential law with a scale length α ⪉ 120 pc. This places Pox 186 among the most compact dwarf galaxies known. The derived α is likely to be an upper limit to the scale length of the LSB component because of the strong contribution of the gaseous emission. The oxygen abundance in the bright H II region derived from the 4.5 m Multiple Mirror Telescope (MMT) and 3.6 m ESO telescope spectra are 12 + log (O/H) = 7.76 ± 0.02 and 7.74 ± 0.01 (˜Z⊙/15), respectively, in accordance with previous determinations. The helium mass fractions found in this region are Y = 0.248 ± 0.009 (MMT) and Y = 0.248 ± 0.004 (3.6 m) suggesting a high primordial helium abundance. The MMT Observatory is a joint facility of the Smithsonian Institution and the University of Arizona. Based on observations collected at the European Southern Observatory, Chile, ESO program 71.B-0032(A). 12+\\log(O/H)⊙ = 8.92 (Anders & Grevesse \\cite{Anders89}).

Prevalence and distribution of pox-like lesions, avian malaria, and mosquito vectors in Kipahulu valley, Haleakala National Park, Hawai'i, USA

USGS Publications Warehouse

Aruch, Samuel; Atkinson, Carter T.; Savage, Amy F.; LaPointe, Dennis

2007-01-01

We determined prevalence and altitudinal distribution of introduced avian malarial infections (Plasmodium relictum) and pox-like lesions (Avipoxvirus) in forest birds from Kīpahulu Valley, Haleakalā National Park, on the island of Maui, and we identified primary larval habitat for the mosquito vector of this disease. This intensively managed wilderness area and scientific reserve is one of the most pristine areas of native forest remaining in the state of Hawai‘i, and it will become increasingly important as a site for restoration and recovery of endangered forest birds. Overall prevalence of malarial infections in the valley was 8% (11/133) in native species and 4% (4/101) in nonnative passerines; prevalence was lower than reported for comparable elevations and habitats elsewhere in the state. Infections occurred primarily in ‘Apapane (Himatione sanguinea) and Hawai‘i ‘Amakihi (Hemignathus virens) at elevations below 1,400 m. Pox-like lesions were detected in only two Hawai‘i ‘Amakihi (2%; 2/94) at elevations below 950 m. We did not detect malaria or pox in birds caught at 1,400 m in upper reaches of the valley. Adult mosquitoes (Culex quinquefasciatus) were captured at four sites at elevations of 640, 760, 915, and 975 m, respectively. Culex quinquefasciatus larvae were found only in rock holes along intermittent tributaries of the two largest streams in the valley, but not in standing surface water, pig wallows, ground pools, tree cavities, and tree fern cavities. Mosquito populations in the valley are low, and they are probably influenced by periods of high rainfall that flush stream systems.

Autothermal and partial oxidation reformer-based fuel processor, method for improving catalyst function in autothermal and partial oxidation reformer-based processors

DOEpatents

Ahmed, Shabbir; Papadias, Dionissios D.; Lee, Sheldon H. D.; Ahluwalia, Rajesh K.

2013-01-08

The invention provides a fuel processor comprising a linear flow structure having an upstream portion and a downstream portion; a first catalyst supported at the upstream portion; and a second catalyst supported at the downstream portion, wherein the first catalyst is in fluid communication with the second catalyst. Also provided is a method for reforming fuel, the method comprising contacting the fuel to an oxidation catalyst so as to partially oxidize the fuel and generate heat; warming incoming fuel with the heat while simultaneously warming a reforming catalyst with the heat; and reacting the partially oxidized fuel with steam using the reforming catalyst.

'GETTING' THE POX: Reflections by an Historian on How to Write the History of Early Modern Disease.

PubMed

Stein, Claudia

This article reflects upon the recent return to linear history writing in medical history. It takes as its starting point a critique of the current return to constructivist ideas, suggesting the use of other methodological choices and interpretations to the surviving archival and textural sources of the sixteenth century pox. My investigation analyses the diagnostic act as an effort to bring together a study of medical semiotics. Medical semiotics considers how signs speak through the physical body, coached within a particular epistemology. There are no hidden meanings behind the visible sign or symptom - it is tranparent to the calculative and authoritative gaze and language of the doctor. It concerns how diseases came into being, the relationships they have constituted, the power they have secured and the actual knowledge/power they have eclipsed or are eclipsing. From such a perspective, "getting the pox" is not a bad thing. A methodological turn to medical semiotics reminds us that the history of disease should be an inquiry both into the grounds of our current knowledge and beliefs about disease and how they inspire our writing, as well as the analytical categories that establish their inevitability.

Next Generation Hemostatic Materials Based on NHS-Ester Functionalized Poly(2-oxazoline)s.

PubMed

Boerman, Marcel A; Roozen, Edwin; Sánchez-Fernández, María José; Keereweer, Abraham R; Félix Lanao, Rosa P; Bender, Johan C M E; Hoogenboom, Richard; Leeuwenburgh, Sander C; Jansen, John A; Van Goor, Harry; Van Hest, Jan C M

2017-08-14

In order to prevent hemorrhage during surgical procedures, a wide range of hemostatic agents have been developed. However, their efficacy is variable; hemostatic devices that use bioactive components to accelerate coagulation are dependent on natural sources, which limits reproducibility. Hybrid devices in which chain-end reactive poly(ethylene glycol) is employed as active component sometimes suffer from irregular cross-linking and dissolution of the polar PEG when blood flow is substantial. Herein, we describe a synthetic, nonbioactive hemostatic product by coating N-hydroxysuccinimide ester (NHS)-functional poly(2-oxazoline)s (POx-NHS) onto gelatin patches, which acts by formation of covalent cross-links between polymer, host blood proteins, gelatin and tissue to seal the wound site and prevent hemorrhage during surgery. We studied different process parameters (including polymer, carrier, and coating technique) in direct comparison with clinical products (Hemopatch and Tachosil) to obtain deeper understanding of this class of hemostatic products. In this work, we successfully prove the hemostatic efficacy of POx-NHS as polymer powders and coated patches both in vitro and in vivo against Hemopatch and Tachosil, demonstrating that POx-NHS are excellent candidate polymers for the development of next generation hemostatic patches.

Nanoarmored Enzymes for Organic Enzymology: Synthesis and Characterization of Poly(2-Alkyloxazoline)-Enzyme Conjugates.

PubMed

Leurs, Melanie; Tiller, Joerg C

2017-01-01

The properties of enzymes can be altered significantly by modification with polymers. Numerous different methods are known to obtain such polymer-enzyme conjugates (PECs). However, there is no universal method to render enzymes into PECs that are fully soluble in organic solvents. Here, we present a method, which achieves such high degree of modification of proteins that the majority of modified enzymes will be soluble in organic solvents. This is achieved by preparing poly(2-alkyloxazoline)s (POx) with an NH 2 end group and coupling this functional polymer via pyromellitic acid dianhydride onto the amino groups of the respective protein. The resulting PECs are capable of serving as surfactants for unmodified proteins, rendering the whole mixture organosoluble. Depending on the nature of the POx and the molecular weight and the nature of the enzyme, the PECs are soluble in chloroform or even toluene. Another advantage of this method is that the poly(2-alkyloxazoline) can be activated with the coupling agent and used for the enzyme conjugation without further purification. The POx-enzyme conjugates generated by this modification strategy show modulated catalytic activity in both, aqueous and organic, systems. © 2017 Elsevier Inc. All rights reserved.

Investigation of a Possible Link Between Vaccination and the 2010 Sheep Pox Epizootic in Morocco.

PubMed

Haegeman, A; Zro, K; Sammin, D; Vandenbussche, F; Ennaji, M M; De Clercq, K

2016-12-01

Sheep pox is endemic in most parts of Northern Africa and has the potential to cause severe economic problems. Live attenuated vaccines are used in Morocco, and in many other countries, to control the disease. Sheep pox virus (SPPV) re-appeared in 2010 causing a nodular clinical form previously not observed in Morocco. The severe clinical signs observed during the course of this outbreak and initial reports citing similarity in nucleotide sequence between the Moroccan vaccine strain and field isolates warranted a more in depth analysis of this epizootic. In this study, sequence analysis showed that isolates obtained from four provinces of eastern Morocco were identical, demonstrating that a single SPPV strain was responsible for the 2010 epizootic. In addition, the genome fragments sequenced and phylogenetic analyses undertaken as part of this study showed significant differences between field isolates and the Moroccan vaccine strain. New PCR methods were developed to differentiate between wild-type isolates and vaccine strains of SPPV. Using these methods, no trace of wild-type SPPV was found in the vaccine and no evidence was found to suggest that the vaccine strain was causing clinical disease. © 2015 Blackwell Verlag GmbH.

[Followup of chicken pox keratitis. Anatomic-clinical case report].

PubMed

D'hermies, F; Ellies, P; Meyer, A; Halhal, M; Morel, X; Behar-Cohen, F; Renard, G; Dighiero, P

2002-09-01

Chicken pox is a very common infectious disease in children. Its corneal involvement is less serious than with measles, which may lead to blindness in numerous developing countries. However, with occasional cases occur. A case of a 59-year-old male patient whose left cornea was involved during a chicken pox infection at the age of 7 is reported. More recently, the vision of the right eye was normal at 20/20 and reduced to visual perception in the affected left eye. Corneal sensitivity was maintained in the left eye, which, however exhibited a central epithelial defect. A central round opacity of the left corneal stroma was believed to be the scar resulting from a previous disciform keratitis. The left central cornea was thinned and there was neither an anterior chamber flare nor new corneal vessels. This corneal condition required a corneal allograft, performed quickly because of the potential risk of perforation. Histopathological study of the corneal button showed a central corneal thinning with an increase in epithelial thickness. The corneal stroma was disorganized, with irregular collagen bundles. No inflammatory cells could be observed, however. All the histopathological changes observed were those of a corneal scar.

Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering

PubMed Central

Karimova, Madina; Splith, Victoria; Karpinski, Janet; Pisabarro, M. Teresa; Buchholz, Frank

2016-01-01

Precise genome engineering is instrumental for biomedical research and holds great promise for future therapeutic applications. Site-specific recombinases (SSRs) are valuable tools for genome engineering due to their exceptional ability to mediate precise excision, integration and inversion of genomic DNA in living systems. The ever-increasing complexity of genome manipulations and the desire to understand the DNA-binding specificity of these enzymes are driving efforts to identify novel SSR systems with unique properties. Here, we describe two novel tyrosine site-specific recombination systems designated Nigri/nox and Panto/pox. Nigri originates from Vibrio nigripulchritudo (plasmid VIBNI_pA) and recombines its target site nox with high efficiency and high target-site selectivity, without recombining target sites of the well established SSRs Cre, Dre, Vika and VCre. Panto, derived from Pantoea sp. aB, is less specific and in addition to its native target site, pox also recombines the target site for Dre recombinase, called rox. This relaxed specificity allowed the identification of residues that are involved in target site selectivity, thereby advancing our understanding of how SSRs recognize their respective DNA targets. PMID:27444945

New insights into Escherichia coli metabolism: carbon scavenging, acetate metabolism and carbon recycling responses during growth on glycerol

PubMed Central

2012-01-01

Background Glycerol has enhanced its biotechnological importance since it is a byproduct of biodiesel synthesis. A study of Escherichia coli physiology during growth on glycerol was performed combining transcriptional-proteomic analysis as well as kinetic and stoichiometric evaluations in the strain JM101 and certain derivatives with important inactivated genes. Results Transcriptional and proteomic analysis of metabolic central genes of strain JM101 growing on glycerol, revealed important changes not only in the synthesis of MglB, LamB and MalE proteins, but also in the overexpression of carbon scavenging genes: lamB, malE, mglB, mglC, galP and glk and some members of the RpoS regulon (pfkA, pfkB, fbaA, fbaB, pgi, poxB, acs, actP and acnA). Inactivation of rpoS had an important effect on stoichiometric parameters and growth adaptation on glycerol. The observed overexpression of poxB, pta, acs genes, glyoxylate shunt genes (aceA, aceB, glcB and glcC) and actP, suggested a possible carbon flux deviation into the PoxB, Acs and glyoxylate shunt. In this scenario acetate synthesized from pyruvate with PoxB was apparently reutilized via Acs and the glyoxylate shunt enzymes. In agreement, no acetate was detected when growing on glycerol, this strain was also capable of glycerol and acetate coutilization when growing in mineral media and derivatives carrying inactivated poxB or pckA genes, accumulated acetate. Tryptophanase A (TnaA) was synthesized at high levels and indole was produced by this enzyme, in strain JM101 growing on glycerol. Additionally, in the isogenic derivative with the inactivated tnaA gene, no indole was detected and acetate and lactate were accumulated. A high efficiency aromatic compounds production capability was detected in JM101 carrying pJLBaroGfbrtktA, when growing on glycerol, as compared to glucose. Conclusions The overexpression of several carbon scavenging, acetate metabolism genes and the absence of acetate accumulation occurred in JM101 cultures growing on glycerol. To explain these results it is proposed that in addition to the glycolytic metabolism, a gluconeogenic carbon recycling process that involves acetate is occurring simultaneously in this strain when growing on glycerol. Carbon flux from glycerol can be efficiently redirected in JM101 strain into the aromatic pathway using appropriate tools. PMID:22513097

Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.).

PubMed

Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

2015-01-01

RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.

Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.)

PubMed Central

Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

2015-01-01

RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, “Rojo Pasión” and “Z506-7”, resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance. PMID:26658051

Oxidation Behavior of Carbon Fiber-Reinforced Composites

NASA Technical Reports Server (NTRS)

Sullivan, Roy M.

2008-01-01

OXIMAP is a numerical (FEA-based) solution tool capable of calculating the carbon fiber and fiber coating oxidation patterns within any arbitrarily shaped carbon silicon carbide composite structure as a function of time, temperature, and the environmental oxygen partial pressure. The mathematical formulation is derived from the mechanics of the flow of ideal gases through a chemically reacting, porous solid. The result of the formulation is a set of two coupled, non-linear differential equations written in terms of the oxidant and oxide partial pressures. The differential equations are solved simultaneously to obtain the partial vapor pressures of the oxidant and oxides as a function of the spatial location and time. The local rate of carbon oxidation is determined at each time step using the map of the local oxidant partial vapor pressure along with the Arrhenius rate equation. The non-linear differential equations are cast into matrix equations by applying the Bubnov-Galerkin weighted residual finite element method, allowing for the solution of the differential equations numerically.

Zirconia-molybdenum disilicide composites

DOEpatents

Petrovic, John J.; Honnell, Richard E.

1991-01-01

Compositions of matter comprised of molybdenum disilicide and zirconium oxide in one of three forms: pure, partially stabilized, or fully stabilized and methods of making the compositions. The stabilized zirconia is crystallographically stabilized by mixing it with yttrium oxide, calcium oxide, cerium oxide, or magnesium oxide and it may be partially stabilized or fully stabilized depending on the amount of stabilizing agent in the mixture.

Methanol partial oxidation reformer

DOEpatents

Ahmed, Shabbir; Kumar, Romesh; Krumpelt, Michael

1999-01-01

A partial oxidation reformer comprising a longitudinally extending chamber having a methanol, water and an air inlet and an outlet. An igniter mechanism is near the inlets for igniting a mixture of methanol and air, while a partial oxidation catalyst in the chamber is spaced from the inlets and converts methanol and oxygen to carbon dioxide and hydrogen. Controlling the oxygen to methanol mole ratio provides continuous slightly exothermic partial oxidation reactions of methanol and air producing hydrogen gas. The liquid is preferably injected in droplets having diameters less than 100 micrometers. The reformer is useful in a propulsion system for a vehicle which supplies a hydrogen-containing gas to the negative electrode of a fuel cell.

Methanol partial oxidation reformer

DOEpatents

Ahmed, S.; Kumar, R.; Krumpelt, M.

1999-08-17

A partial oxidation reformer is described comprising a longitudinally extending chamber having a methanol, water and an air inlet and an outlet. An igniter mechanism is near the inlets for igniting a mixture of methanol and air, while a partial oxidation catalyst in the chamber is spaced from the inlets and converts methanol and oxygen to carbon dioxide and hydrogen. Controlling the oxygen to methanol mole ratio provides continuous slightly exothermic partial oxidation reactions of methanol and air producing hydrogen gas. The liquid is preferably injected in droplets having diameters less than 100 micrometers. The reformer is useful in a propulsion system for a vehicle which supplies a hydrogen-containing gas to the negative electrode of a fuel cell. 7 figs.

Methanol partial oxidation reformer

DOEpatents

Ahmed, S.; Kumar, R.; Krumpelt, M.

1999-08-24

A partial oxidation reformer is described comprising a longitudinally extending chamber having a methanol, water and an air inlet and an outlet. An igniter mechanism is near the inlets for igniting a mixture of methanol and air, while a partial oxidation catalyst in the chamber is spaced from the inlets and converts methanol and oxygen to carbon dioxide and hydrogen. Controlling the oxygen to methanol mole ratio provides continuous slightly exothermic partial oxidation reactions of methanol and air producing hydrogen gas. The liquid is preferably injected in droplets having diameters less than 100 micrometers. The reformer is useful in a propulsion system for a vehicle which supplies a hydrogen-containing gas to the negative electrode of a fuel cell. 7 figs.

Methanol partial oxidation reformer

DOEpatents

Ahmed, Shabbir; Kumar, Romesh; Krumpelt, Michael

2001-01-01

A partial oxidation reformer comprising a longitudinally extending chamber having a methanol, water and an air inlet and an outlet. An igniter mechanism is near the inlets for igniting a mixture of methanol and air, while a partial oxidation catalyst in the chamber is spaced from the inlets and converts methanol and oxygen to carbon dioxide and hydrogen. Controlling the oxygen to methanol mole ratio provides continuous slightly exothermic partial oxidation reactions of methanol and air producing hydrogen gas. The liquid is preferably injected in droplets having diameters less than 100 micrometers. The reformer is useful in a propulsion system for a vehicle which supplies a hydrogen-containing gas to the negative electrode of a fuel cell.

Pox 186: A Nearby Protogalaxy?

NASA Astrophysics Data System (ADS)

Corbin, Michael

1999-07-01

Blue Compact Dwarf Galaxies {BCDGs} typically consist of clusters of early-type stars embedded in older, evolved stellar populations similar in size and shape to normal dwarf ellipticals. However, deep ground-based CCD images of one faint BCDG, Pox 186, reveal a very compact { 5" diameter} structure with no evidence of an underlying older population. Optical spectroscopy of this object also indicates that a large number of Wolf-Rayet stars are present, which implies that a burst of star formation must have occurred very recently {<=sssim 10^7 years ago}. It has thus been suggested that Pox 186 is a protogalaxy, forming its very first generation of stars. Further investigation of this possibility requires the high angular resolution and ultraviolet spectral coverage that only HST can provide. Using WFPC2, we propose to image the galaxy in the U, V, and I bands, in order to better test for the presence of an underlying evolved population and to reveal any substructure in its star-forming regions. Using STIS, we will obtain low-resolution ultraviolet spectra of the galaxy for combination with ground-based spectra covering the optical through near infrared. This will allow us to determine its spectral energy distribution, metallicity, and dust content, which will in turn constrain its age and star formation history.

Oxidation of C/SiC Composites at Reduced Oxygen Partial Pressures

NASA Technical Reports Server (NTRS)

Opila, E. J.; Serra, J. L.

2007-01-01

T-300 carbon fibers and T-300 carbon fiber reinforced silicon carbide composites (C/SiC) were oxidized in flowing reduced oxygen partial pressure environments at a total pressure of one atmosphere (0.5 atm O2, 0.05 atm O2 and 0.005 atm O2, balance argon). Experiments were conducted at four temperatures (816deg, 1149deg, 1343deg, and 1538 C). The oxidation kinetics were monitored using thermogravimetric analysis. T-300 fibers were oxidized to completion for times between 0.6 and 90 h. Results indicated that fiber oxidation kinetics were gas phase diffusion controlled. Oxidation rates had an oxygen partial pressure dependence with a power law exponent close to one. In addition, oxidation rates were only weakly dependent on temperature. The C/SiC coupon oxidation kinetics showed some variability, attributed to differences in the number and width of cracks in the SiC seal coat. In general, weight losses were observed indicating oxidation of the carbon fibers dominated the oxidation behavior. Low temperatures and high oxygen pressures resulted in the most rapid consumption of the carbon fibers. At higher temperatures, the lower oxidation rates were primarily attributed to crack closure due to SiC thermal expansion, rather than oxidation of SiC since these reduced rates were observed even at the lowest oxygen partial pressures where SiC oxidation is minimal.

Long Term Persistence of IgE Anti-Varicella Zoster Virus in Pediatric and Adult Serum Post Chicken Pox Infection and after Vaccination with Varicella Virus Vaccine.

PubMed

Smith-Norowitz, Tamar A; Josekutty, Joby; Silverberg, Jonathan I; Lev-Tov, Hadar; Norowitz, Yitzchok M; Kohlhoff, Stephan; Nowakowski, Maja; Durkin, Helen G; Bluth, Martin H

2009-12-01

The production of IgE specific to different viruses (HIV-1, Parvovirus B19, RSV), and the ability for IgE anti-HIV-1 to suppress HIV-1 production in vitro, strongly suggest an important role for IgE and/or anti viral specific IgE in viral pathogenesis. Previous studies in our laboratory were the first to report the presence of IgE anti-varicella zoster virus (VZV) in an adolescent patient with shingles. However, the presence and long term persistence of IgE anti VZV antibodies has not been studied in adults. The presence of serum IgE in addition to IgE and IgG anti-VZV antibody in sera were studied in children (N=12) (0-16 y/o) and adults (N=9) (32-76 y/o) with either a past history of (wild type) chicken pox (N=7 children, 9 adults) or 5 years after vaccination with varicella zoster (N=2 children) (Varicella virus vaccine live, Oka/Merck), as well as in non-infected subjects (N=3 children). Of the patients who had a positive history of chicken pox 13 of 16 (81%) contained IgE anti-VZV antibodies; they were both serum IgEHi (>100 IU/ml) and IgELo (<100 IU/ml). Of the patients who were vaccinated, IgE anti-VZV antibodies were undetected. In contrast, serum from the patients without a history of chicken pox or vaccination did not make either IgE or IgG anti-VZV antibodies. This is the first demonstration of the existence of IgE anti-VZV antibodies, and its long-term persistence in serum of previously infected subjects. Future studies regarding the functional role of anti-viral IgE and its relationship to VZV are warranted.

Genetic characterization of poxviruses in Camelus dromedarius in Ethiopia, 2011-2014.

PubMed

Gelaye, Esayas; Achenbach, Jenna Elizabeth; Ayelet, Gelagay; Jenberie, Shiferaw; Yami, Martha; Grabherr, Reingard; Loitsch, Angelika; Diallo, Adama; Lamien, Charles Euloge

2016-10-01

Camelpox and camel contagious ecthyma are infectious viral diseases of camelids caused by camelpox virus (CMLV) and camel contagious ecthyma virus (CCEV), respectively. Even though, in Ethiopia, pox disease has been creating significant economic losses in camel production, little is known on the responsible pathogens and their genetic diversity. Thus, the present study aimed at isolation, identification and genetic characterization of the causative viruses. Accordingly, clinical case observations, infectious virus isolation, and molecular and phylogenetic analysis of poxviruses infecting camels in three regions and six districts in the country, Afar (Chifra), Oromia (Arero, Miyu and Yabello) and Somali (Gursum and Jijiga) between 2011 and 2014 were undertaken. The full hemagglutinin (HA) and partial A-type inclusion protein (ATIP) genes of CMLV and full major envelope protein (B2L) gene of CCEV of Ethiopian isolates were sequenced, analyzed and compared among each other and to foreign isolates. The viral isolation confirmed the presence of infectious poxviruses. The preliminary screening by PCR showed 27 CMLVs and 20 CCEVs. The sequence analyses showed that the HA and ATIP gene sequences are highly conserved within the local isolates of CMLVs, and formed a single cluster together with isolates from Somalia and Syria. Unlike CMLVs, the B2L gene analysis of Ethiopian CCEV showed few genetic variations. The phylogenetic analysis revealed three clusters of CCEV in Ethiopia with the isolates clustering according to their geographical origins. To our knowledge, this is the first report indicating the existence of CCEV in Ethiopia where camel contagious ecthyma was misdiagnosed as camelpox. Additionally, this study has also disclosed the existence of co-infections with CMLV and CCEV. A comprehensive characterization of poxviruses affecting camels in Ethiopia and the full genome sequencing of representative isolates are recommended to better understand the dynamics of pox diseases of camels and to assist in the implementation of more efficient control measures. Copyright © 2016 Elsevier B.V. All rights reserved.

Oxygen partial pressure sensor

DOEpatents

Dees, D.W.

1994-09-06

A method for detecting oxygen partial pressure and an oxygen partial pressure sensor are provided. The method for measuring oxygen partial pressure includes contacting oxygen to a solid oxide electrolyte and measuring the subsequent change in electrical conductivity of the solid oxide electrolyte. A solid oxide electrolyte is utilized that contacts both a porous electrode and a nonporous electrode. The electrical conductivity of the solid oxide electrolyte is affected when oxygen from an exhaust stream permeates through the porous electrode to establish an equilibrium of oxygen anions in the electrolyte, thereby displacing electrons throughout the electrolyte to form an electron gradient. By adapting the two electrodes to sense a voltage potential between them, the change in electrolyte conductivity due to oxygen presence can be measured. 1 fig.

Oxygen partial pressure sensor

DOEpatents

Dees, Dennis W.

1994-01-01

A method for detecting oxygen partial pressure and an oxygen partial pressure sensor are provided. The method for measuring oxygen partial pressure includes contacting oxygen to a solid oxide electrolyte and measuring the subsequent change in electrical conductivity of the solid oxide electrolyte. A solid oxide electrolyte is utilized that contacts both a porous electrode and a nonporous electrode. The electrical conductivity of the solid oxide electrolyte is affected when oxygen from an exhaust stream permeates through the porous electrode to establish an equilibrium of oxygen anions in the electrolyte, thereby displacing electrons throughout the electrolyte to form an electron gradient. By adapting the two electrodes to sense a voltage potential between them, the change in electrolyte conductivity due to oxygen presence can be measured.

Designing and Creating a Synthetic Omega Oxidation Pathway in Saccharomyces cerevisiae Enables Production of Medium-Chain α, ω-Dicarboxylic Acids

PubMed Central

Han, Li; Peng, Yanfeng; Zhang, Yuangyuan; Chen, Wujiu; Lin, Yuping; Wang, Qinhong

2017-01-01

Medium-chain (C8–C14) α, ω-dicarboxylic acids (α, ω-DCAs), which have numerous applications as raw materials for producing various commodities and polymers in chemical industry, are mainly produced from chemical or microbial conversion of petroleum-derived alkanes or plant-derived fatty acids at present. Recently, significant attention has been gained to microbial production of medium-chain α, ω-DCAs from simple renewable sugars. Here, we designed and created a synthetic omega oxidation pathway in Saccharomyces cerevisiae to produce C10 and C12 α, ω-DCAs from renewable sugars and fatty acids by introducing a heterogeneous cytochrome P450 CYP94C1 and cytochrome reductase ATR1. Furthermore, the deletion of fatty acyl-CoA synthetase genes FAA1 and FAA4 increased the production of medium-chain α, ω-DCAs from 4.690 ± 0.088 mg/L to 12.177 ± 0.420 mg/L and enabled the production of C14 and C16 α, ω-DCAs at low percentage. But blocking β-oxidation pathway by deleting fatty-acyl coenzyme A oxidase gene POX1 and overexpressing different thioesterase genes had no significant impact on the production and the composition of α, ω-dicarboxylic acids. Overall, our study indicated the potential of microbial production of medium-chain α, ω-DCAs from renewable feedstocks using engineered yeast. PMID:29163455

Zinc-induced differential oxidative stress and antioxidant responses in Chlorella sorokiniana and Scenedesmus acuminatus.

PubMed

Hamed, Seham M; Zinta, Gaurav; Klöck, Gerd; Asard, Han; Selim, Samy; AbdElgawad, Hamada

2017-06-01

Algae are frequently exposed to toxic metals, and zinc (Zn) is one of the major toxicants present. We exposed two green microalgae, Chlorella sorokiniana and Scenedesmus acuminatus, to sub-lethal concentrations (1.0 and 0.6mM) of Zn for seven days. Algal responses were analysed at the level of growth, oxidative stress, and antioxidants. Growth parameters such as cell culture yield and pigment content were less affected by Zn in C. sorokiniana, despite the fact that this alga accumulated more zinc than S. acuminatus. Also, C. sorokiniana, but not S. acuminatus, was able to acclimatize during long-term exposure to toxic concentrations of the test metals (specific growth rate (µ) was 0.041/day and total chlorophyll was 14.6mg/mL). Although, Zn induced oxidative stress in both species, C. sorokiniana experienced less stress than S. acuminatus. This could be explained by a higher accumulation of antioxidants in C. sorokiniana, where flavonoids, polyphenols, tocopherols, glutathione (GSH) and ascorbate (ASC) content increased. Moreover, antioxidant enzymes glutathione S transferase (GST), glutathione reductase (GR), superoxide dismutase (SOD), peroxidase (POX) and ascorbate peroxidase (APX), showed increased activities in C. sorokiniana. In addition to, and probably also underlying, the higher Zn tolerance in C. sorokiniana, this alga also showed higher Zn biosorption capacity. Use of C. sorokiniana as a bio-remediator, could be considered. Copyright © 2017 Elsevier Inc. All rights reserved.

Isolation of poxvirus from debilitating cutaneous lesions on four immature grackles (Quiscalus sp.)

USGS Publications Warehouse

Docherty, D.E.; Long, R.I.; Flickinger, Edward L.; Locke, L.N.

1991-01-01

Poxvirus was isolated from nodules on four immature grackles (Quiscalus sp.) collected in two residential areas of Victoria, Texas. All of the birds were emaciated and had nodules on the eyelids, bill, legs, toes, and areas of the skin on the wings, neck, and ventral abdomen. These pox nodules were extensive and probably interfered with both sight and flight. The preliminary diagnosis was confirmed by virus isolation, histopathology, and electron microscopy. Poxvirus was isolated on the chorioallantoic membrane of embryonated hen's eggs and in Muscovy duck embryo fibroblast cell culture. Phaenicia calliphoridae (blowfly) larvae were found in one of the pox nodules, raising the possibility of mechanical transmission of the virus by contaminated adult blowflies.

Periorbital varicella gangrenosa: A rare complication of chicken pox.

PubMed

Jain, Jagriti; Thatte, Shreya; Singhai, Prakhar

2015-01-01

A previously healthy six year old male child presented in pediatrics ICU in state of shock with history of fever and rashes and later was diagnosed as chicken pox. He developed right sided periorbital varicella gangrenosa which is a form of necrotizing fasciitis secondary to skin infection. Patient was treated with intravenous acyclovir, antibiotics, amphotericin B, extensive debridement and later reconstruction of upper eyelid with skin grafting. Aggressive treatment helped preventing the eyeball and orbital involvement which would have necessitated orbital exenteration. However delayed presentation resulted in necrosis of orbicularis oculi and underlying tissue which resulted in graft retraction and lid dysfunction. Clinicians should be aware of this rare but fulminating condition to minimise the sight and life threatening complications associated with it.

Comparison of partial and full nitrification processes applied for treating high-strength nitrogen wastewaters: microbial ecology through nitrous oxide production.

PubMed

Ahn, Joon Ho; Kwan, Tiffany; Chandran, Kartik

2011-04-01

The goal of this study was to compare the microbial ecology, gene expression, biokinetics, and N2O emissions from a lab-scale bioreactor operated sequentially in full-nitrification and partial-nitrification modes. Based on sequencing of 16S rRNA and ammonia monooxygenase subunit A (amoA) genes, ammonia oxidizing bacteria (AOB) populations during full- and partial-nitrification modes were distinct from one another. The concentrations of AOB (XAOB) and their respiration rates during full- and partial-nitrification modes were statistically similar, whereas the concentrations of nitrite oxidizing bacteria (XNOB) and their respiration rates declined significantly after the switch from full- to partial-nitrification. The transition from full-nitrification to partial nitrification resulted in a protracted transient spike of nitrous oxide (N2O) and nitric oxide (NO) emissions, which later stabilized. The trends in N2O and NO emissions correlated well with trends in the expression of nirK and norB genes that code for the production of these gases in AOB. Both the transient and stabilized N2O and NO emissions during partial nitrification were statistically higher than those during steady-state full-nitrification. Based on these results, partial nitrification strategies for biological nitrogen removal, although attractive for their reduced operating costs and energy demand, may need to be optimized against the higher carbon foot-print attributed to their N2O emissions.

Oxidation of C/SiC Composites at Reduced Oxygen Partial Pressures

NASA Technical Reports Server (NTRS)

Opila, Elizabeth J.; Serra, Jessica

2009-01-01

Carbon-fiber reinforced SiC (C/SiC) composites are proposed for leading edge applications of hypersonic vehicles due to the superior strength of carbon fibers at high temperatures (greater than 1500 C). However, the vulnerability of the carbon fibers in C/SiC to oxidation over a wide range of temperatures remains a problem. Previous oxidation studies of C/SiC have mainly been conducted in air or oxygen, so that the oxidation behavior of C/SiC at reduced oxygen partial pressures of the hypersonic flight regime are less well understood. In this study, both carbon fibers and C/SiC composites were oxidized over a wide range of temperatures and oxygen partial pressures to facilitate the understanding and modeling of C/SiC oxidation kinetics for hypersonic flight conditions.

Magnesium Recycling of Partially Oxidized, Mixed Magnesium-Aluminum Scrap through Combined Refining and Solid Oxide Membrane Electrolysis Processes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiaofei Guan; Peter A. Zink; Uday B. Pal

2012-01-01

Pure magnesium (Mg) is recycled from 19g of partially oxidized 50.5wt.% Mg-Aluminum (Al) alloy. During the refining process, potentiodynamic scans (PDS) were performed to determine the electrorefining potential for magnesium. The PDS show that the electrorefining potential increases over time as the magnesium content inside the Mg-Al scrap decreases. Up to 100% percent of magnesium is refined from the Mg-Al scrap by a novel refining process of dissolving magnesium and its oxide into a flux followed by vapor phase removal of dissolved magnesium and subsequently condensing the magnesium vapor. The solid oxide membrane (SOM) electrolysis process is employed in themore » refining system to enable additional recycling of magnesium from magnesium oxide (MgO) in the partially oxidized Mg-Al scrap. The combination of the refining and SOM processes yields 7.4g of pure magnesium.« less

The prehistory of potyviruses: their initial radiation was during the dawn of agriculture.

PubMed

Gibbs, Adrian J; Ohshima, Kazusato; Phillips, Matthew J; Gibbs, Mark J

2008-06-25

Potyviruses are found world wide, are spread by probing aphids and cause considerable crop damage. Potyvirus is one of the two largest plant virus genera and contains about 15% of all named plant virus species. When and why did the potyviruses become so numerous? Here we answer the first question and discuss the other. We have inferred the phylogenies of the partial coat protein gene sequences of about 50 potyviruses, and studied in detail the phylogenies of some using various methods and evolutionary models. Their phylogenies have been calibrated using historical isolation and outbreak events: the plum pox virus epidemic which swept through Europe in the 20th century, incursions of potyviruses into Australia after agriculture was established by European colonists, the likely transport of cowpea aphid-borne mosaic virus in cowpea seed from Africa to the Americas with the 16th century slave trade and the similar transport of papaya ringspot virus from India to the Americas. Our studies indicate that the partial coat protein genes of potyviruses have an evolutionary rate of about 1.15x10(-4) nucleotide substitutions/site/year, and the initial radiation of the potyviruses occurred only about 6,600 years ago, and hence coincided with the dawn of agriculture. We discuss the ways in which agriculture may have triggered the prehistoric emergence of potyviruses and fostered their speciation.

The Prehistory of Potyviruses: Their Initial Radiation Was during the Dawn of Agriculture

PubMed Central

Gibbs, Adrian J.; Ohshima, Kazusato; Phillips, Matthew J.; Gibbs, Mark J.

2008-01-01

Background Potyviruses are found world wide, are spread by probing aphids and cause considerable crop damage. Potyvirus is one of the two largest plant virus genera and contains about 15% of all named plant virus species. When and why did the potyviruses become so numerous? Here we answer the first question and discuss the other. Methods and Findings We have inferred the phylogenies of the partial coat protein gene sequences of about 50 potyviruses, and studied in detail the phylogenies of some using various methods and evolutionary models. Their phylogenies have been calibrated using historical isolation and outbreak events: the plum pox virus epidemic which swept through Europe in the 20th century, incursions of potyviruses into Australia after agriculture was established by European colonists, the likely transport of cowpea aphid-borne mosaic virus in cowpea seed from Africa to the Americas with the 16th century slave trade and the similar transport of papaya ringspot virus from India to the Americas. Conclusions/Significance Our studies indicate that the partial coat protein genes of potyviruses have an evolutionary rate of about 1.15×10−4 nucleotide substitutions/site/year, and the initial radiation of the potyviruses occurred only about 6,600 years ago, and hence coincided with the dawn of agriculture. We discuss the ways in which agriculture may have triggered the prehistoric emergence of potyviruses and fostered their speciation. PMID:18575612

Analysis of the expression of putative heat-stress related genes in relation to thermotolerance of cork oak.

PubMed

Correia, Barbara; Rodriguez, José Luis; Valledor, Luis; Almeida, Tânia; Santos, Conceição; Cañal, Maria Jesús; Pinto, Glória

2014-03-15

Cork oak (Quercus suber L.) is a research priority in the Mediterranean area and because of cork oaks' distribution these stands are experiencing daily stress. Based on projections of intensifying climate change and considering the key role of exploring the recovery abilities, cork oak seedlings were subjected to a cumulative temperature increase from 25°C to 55°C and subsequent recovery. CO2 assimilation rate, chlorophyll fluorescence, anthocyanins, proline and lipid peroxidation were used to evaluate plant performance, while the relative abundance of seven genes encoding for proteins of cork oak with a putative role in thermal/stress regulation (POX1, POX2, HSP10.4, HSP17a.22, CHS, MTL and RBC) was analyzed by qPCR (quantitative Polymerase Chain Reaction). A temperature change to 35°C showed abundance alterations in the tested genes; at 45°C, the molecular changes were associated with an antioxidant response, possibly modulated by anthocyanins. At 55°C, HSP17a.22, MTL and proline accumulation were evident. After recovery, physiological balance was restored, whereas POX1, HSP10.4 and MTL abundances were suggested to be involved in increased thermotolerance. The data presented here are expected to pinpoint some pathways changes occurring during such stress and further recovery in this particular Mediterranean species. Copyright © 2013 Elsevier GmbH. All rights reserved.

Characterization of poxviruses from forest birds in Hawaii

USGS Publications Warehouse

Tripathy, Deoki N.; Schnitzlein, William M.; Morris, Patrick J.; Janssen, Don L.; Zuba, Jeffery K.; Massey, Greg; Atkinson, Carter T.

2000-01-01

Two strains of avian pox viruses were isolated from cutaneous lesions in Hawaiian crows (Corvus hawaiiensis) examined in 1994 and a third from a biopsy obtained in 1992 from an infected bird of the Apapane species (Himatione sanguinea) by inoculation of the chorioallantoic membranes (CAM) of developing chicken embryos. The resulting proliferative CAM lesions contained eosinophilic cytoplasmic inclusion bodies characteristic of pox virus infection. The pathogenicity of these three viruses in domestic chickens was mild as evidenced by the development of relatively minor lesions of short duration at the sites of inoculation. Their virulence in this host was similar to that of a fowlpox virus (FPV) vaccine strain and contrasted greatly with the ability of two field strains of FPV to produce extensive proliferative lesions. One of the Hawaiian crow pox virus isolates as well as the one originating from the Apapane species could be propagated in two secondary avian cell lines, QT-35 and LMH. A comparison of the restriction fragment length polymorphisms (RFLP) of the genomes of the two cell line-adapted viruses, generated by EcoRI digestion, revealed a limited degree of similarity. Moreover, neither profile was comparable to those of the two field isolates of FPV, which were almost indistinguishable from each other. Thus, based on the genetic distinctness of the two Hawaiian bird viruses, they appear to represent different strains of avipoxvirus.

Detection of plum pox virus infection in selection plum trees using spectral imaging

NASA Astrophysics Data System (ADS)

Angelova, Liliya; Stoev, Antoniy; Borisova, Ekaterina; Avramov, Latchezar

2016-01-01

Plum pox virus (PPV) is among the most studied viral diseases in the world in plants. It is considered to be one of the most devastating diseases of stone fruits in terms of agronomic impact and economic importance. Noninvasive, fast and reliable techniques are required for evaluation of the pathology in selection trees with economic impact. Such advanced tools for PPV detection could be optical techniques as light-induced fluorescence and diffuse reflectance spectroscopies. Specific regions in the electromagnetic spectra have been found to provide information about the physiological stress in plants, and consequently, diseased plants usually exhibit different spectral signature than non-stressed healthy plants in those specific ranges. In this study spectral reflectance and chlorophyll fluorescence were used for the identification of biotic stress caused by the pox virus on plum trees. The spectral responses of healthy and infected leaves from cultivars, which are widespread in Bulgaria were investigated. The two applied techniques revealed statistically significant differences between the spectral data of healthy plum leaves and those infected by PPV in the visible and near-infrared spectral ranges. Their application for biotic stress detection helps in monitoring diseases in plants using the different plant spectral properties in these spectral ranges. The strong relationship between the results indicates the applicability of diffuse reflectance and fluorescence techniques for conducting health condition assessments of vegetation and their importance for plant protection practices.

Low Impact of Avian Pox on Captive-Bred Houbara Bustard Breeding Performance.

PubMed

Le Loc'h, Guillaume; Souley, Mam-Noury Amadou; Bertagnoli, Stéphane; Paul, Mathilde C

2017-01-01

Avian pox, a disease caused by avipoxviruses, is a major cause of decline of some endangered bird species. While its impact has been assessed in several species in the wild, effects of the disease in conservation breeding have never been studied. Houbara bustard species ( Chlamydotis undulata and Chlamydotis macqueenii ), whose populations declined in the last decades, have been captive bred for conservation purposes for more than 20 years. While mortality and morbidity induced by avipoxviruses can be controlled by appropriate management, the disease might still affect bird breeding performance and jeopardize the production objectives of conservation programs. Impacts of the disease was studied during two outbreaks in captive-bred juvenile Houbara bustards in Morocco in 2009-2010 and 2010-2011, by modeling the effect of the disease on individual breeding performance (male display and female egg production) of 2,797 birds during their first breeding season. Results showed that the impact of avian pox on the ability of birds to reproduce and on the count of displays or eggs is low and mainly non-significant. The absence of strong impact compared to what could be observed in other species in the wild may be explained by the controlled conditions provided by captivity, especially the close veterinary monitoring of each bird. Those results emphasize the importance of individual management to prevent major disease emergence and their effects in captive breeding of endangered species.

Outbreaks of Pox Disease Due to Canarypox-Like and Fowlpox-Like Viruses in Large-Scale Houbara Bustard Captive-Breeding Programmes, in Morocco and the United Arab Emirates.

PubMed

Le Loc'h, G; Paul, M C; Camus-Bouclainville, C; Bertagnoli, S

2016-12-01

Infectious diseases can be serious threats for the success of reinforcement programmes of endangered species. Houbara Bustard species (Chlamydotis undulata and Chlamydotis macqueenii), whose populations declined in the last decades, have been captive-bred for conservation purposes for more than 15 years in North Africa and the Middle East. Field observations show that pox disease, caused by avipoxviruses (APV), regularly emerges in conservation projects of Houbara Bustard, despite a very strict implementation of both vaccination and biosecurity. Data collected from captive flocks of Houbara Bustard in Morocco from 2006 through 2013 and in the United Arab Emirates from 2011 through 2013 were analysed, and molecular investigations were carried out to define the virus strains involved. Pox cases (n = 2311) were observed during more than half of the year (88% of the months in Morocco, 54% in the United Arab Emirates). Monthly morbidity rates showed strong variations across the time periods considered, species and study sites: Four outbreaks were described during the study period on both sites. Molecular typing revealed that infections were mostly due to canarypox-like viruses in Morocco while fowlpox-like viruses were predominant in the United Arab Emirates. This study highlights that APV remain a major threat to consider in bird conservation initiatives. © 2015 Blackwell Verlag GmbH.

Early in vivo changes in calcium ions, oxidative stress markers, and ion channel immunoreactivity following partial injury to the optic nerve.

PubMed

Wells, Jonathan; Kilburn, Matthew R; Shaw, Jeremy A; Bartlett, Carole A; Harvey, Alan R; Dunlop, Sarah A; Fitzgerald, Melinda

2012-03-01

CNS injury is often localized but can be followed by more widespread secondary degenerative events that usually result in greater functional loss. Using a partial transection model in rat optic nerve (ON). we recently demonstrated in vivo increases in the oxidative stress-associated enzyme MnSOD 5 min after injury. However, mechanisms by which early oxidative stress spreads remain unclear. In the present study, we assessed ion distributions, additional oxidative stress indicators, and ion channel immunoreactivity in ON in the first 24 hr after partial transection. Using nanoscale secondary ion mass spectroscopy (NanoSIMS), we demonstrate changes in the distribution pattern of Ca ions following partial ON transection. Regions of elevated Ca ions in normal ON in vivo rapidly decrease following partial ON transection, but there is an increasingly punctate distribution at 5 min and 24 hr after injury. We also show rapid decreases in catalase activity and later increases in immunoreactivity of the advanced glycation end product carboxymethyl lysine in astrocytes. Increased oxidative stress in astrocytes is accompanied by significantly increased immunoreactivity of the AMPA receptor subunit GluR1 and aquaporin 4 (AQP4). Taken together, the results indicate that Ca ion changes and oxidative stress are early events following partial ON injury that are associated with changes in GluR1 AMPA receptor subunits and altered ionic balance resulting from increased AQP4. Copyright © 2011 Wiley Periodicals, Inc.

Sensitivity of two green microalgae to copper stress: Growth, oxidative and antioxidants analyses.

PubMed

Hamed, Seham M; Selim, Samy; Klöck, Gerd; AbdElgawad, Hamada

2017-10-01

Depending on species, heavy metals, including copper (Cu), differentially affect algal growth and metabolism. Here, we aim to evaluate the differential responses of two green microalgae, Chlorella sorokiniana and Scenedesmus acuminatus, exposed to sub-lethal doses of Cu (25 and 50µM, respectively) for 7 days. The changes in growth, oxidative damage markers, and antioxidants were analysed. We found that S. acuminatus could acclimatise during long-term exposure to Cu stress. S. acuminatus accumulated lower Cu content and showed a slight decrease in H 2 O 2 levels when compared to C. sorokiniana. Cu stress induced membrane damage in the two microalgae species, however, this increase was slightly lower in S. acuminatus. To mitigate Cu stress impact, C. sorkiniana markedly increased proline, polyphenols, flavonoids, tocopherols, glutathione levels, as well as the activities of GST, APX, GR and SOD enzymes, which could explain less-stress sensitivity. On the other hand, S. acuminatus exhibited significant increases in proline, polyphenol, and tocopherol contents. Activity levels of POX, APX, GR and SOD enzymes, were also increased. These results suggest that the two microalgae differentially induced the antioxidant defence system to neutralise the oxidative damage induced by Cu stress. This study also provided new data for Cu tolerance and Cu removal abilities of two microalgal species, which commonly exist in surface water bodies, where low Cu uptake and efficient antioxidant defence system protected S. acuminatus against oxidative stress induced by Cu stress. This makes it feasible for treatment of Cu contaminated waters. Copyright © 2017 Elsevier Inc. All rights reserved.

A Model for the Oxidation of Carbon Silicon Carbide Composite Structures

NASA Technical Reports Server (NTRS)

Sullivan, Roy M.

2004-01-01

A mathematical theory and an accompanying numerical scheme have been developed for predicting the oxidation behavior of carbon silicon carbide (C/SiC) composite structures. The theory is derived from the mechanics of the flow of ideal gases through a porous solid. The result of the theoretical formulation is a set of two coupled nonlinear differential equations written in terms of the oxidant and oxide partial pressures. The differential equations are solved simultaneously to obtain the partial vapor pressures of the oxidant and oxides as a function of the spatial location and time. The local rate of carbon oxidation is determined using the map of the local oxidant partial vapor pressure along with the Arrhenius rate equation. The nonlinear differential equations are cast into matrix equations by applying the Bubnov-Galerkin weighted residual method, allowing for the solution of the differential equations numerically. The numerical method is demonstrated by utilizing the method to model the carbon oxidation and weight loss behavior of C/SiC specimens during thermogravimetric experiments. The numerical method is used to study the physics of carbon oxidation in carbon silicon carbide composites.

Hydrogen generator, via catalytic partial oxidation of methane for fuel cells

NASA Astrophysics Data System (ADS)

Recupero, Vincenzo; Pino, Lidia; Di Leonardo, Raffaele; Lagana', Massimo; Maggio, Gaetano

It is well known that the most acknowledged process for generation of hydrogen for fuel cells is based upon the steam reforming of methane or natural gas. A valid alternative could be a process based on partial oxidation of methane, since the process is mildly exothermic and therefore not energy intensive. Consequently, great interest is expected from conversion of methane into syngas, if an autothermal, low energy intensive, compact and reliable process could be developed. This paper covers the activities, performed by the CNR Institute of Transformation and Storage of Energy (CNR-TAE), on theoretical and experimental studies for a compact hydrogen generator, via catalytic selective partial oxidation of methane, integrated with second generation fuel cells (EC-JOU2 contract). In particular, the project focuses the attention on methane partial oxidation via heterogeneous selective catalysts, in order to: demonstrate the basic catalytic selective partial oxidation of methane (CSPOM) technology in a subscale prototype, equivalent to a nominal output of 5 kWe; develop the CSPOM technology for its application in electric energy production by means of fuel cells; assess, by a balance of plant analysis, and a techno-economic evaluation, the potential benefits of the CSPOM for different categories of fuel cells.

9 CFR 121.3 - VS select agents and toxins.

Code of Federal Regulations, 2011 CFR

2011-01-01

... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS POSSESSION, USE, AND...-mouth disease virus; Goat pox virus; Japanese encephalitis virus; Lumpy skin disease virus; Malignant...

9 CFR 121.3 - VS select agents and toxins.

Code of Federal Regulations, 2012 CFR

2012-01-01

... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS POSSESSION, USE, AND...-mouth disease virus; Goat pox virus; Japanese encephalitis virus; Lumpy skin disease virus; Malignant...

Fifth Disease

MedlinePlus

... past. The others included measles, rubella (German measles), chicken pox, scarlet fever, and roseola. Fifth disease is ... The first signs of fifth disease are mild flu- or cold-like symptoms, including: low-grade fever ...

Remedial Investigation Report for Lake City Army Ammunition Plant. Volume 1

DTIC Science & Technology

1990-06-01

EXPLOSIVE COMPOUNDS 1 3-DNB ɘ 61 ɘ.61 ɘ.61 ɘ.61 ɘ.61 1 73 135-7N6 11 7 ɘ.56 ɘ.56 ɘ.56 ɘ.56 0.7 *J 3.24 ə 30 ə 30 ə,30 ə.30 ə.30 POX ɘ...COMPOUNDS * 5- TNB I37 ɘ.56 ɘ. 56 ɘ 56 ɘ. 56 ɘ,56 HMX 17 4 ə.,30 ə 30 < 1 340 ᝻,30 ə.30 POX IS0 1.67 ɘ.63 ɘ.63 ɘ.63 1 84 OTHERS (ALL NO OR...Torkelson and Rowe 1031 5-209 Evidence suggests that 1,1,2-TCA is embryo toxic to chicken eggs (Elovaara 1979). I,I,2-TCA was found to be weakly mutagenic

XMM-Newton Proposal 03024201

NASA Astrophysics Data System (ADS)

Barth, Aaron

2004-10-01

POX 52 is a Narrow-Line Seyfert 1 galaxy with extreme and unusual properties. Its black hole mass, estimated from the optical spectrum of the AGN, is only ~10^5 solar masses; its host galaxy is a dwarf elliptical with a velocity dispersion of only 36+/-5 km/s; and it is radiating at L/L_Edd ~ 1. POX 52 offers a unique opportunity to study black hole accretion at high accretion rates in a mass range that has barely been explored previously. We request 100 ksec of EPIC-pn observations of this unique AGN in order to characterize its X-ray spectrum and absorption, to search for Fe K line emission, to study its variability properties, and to search for quasi-periodic oscillations with the aim of better constraining the black hole mass.

The gas-phase on-line production of phosphoryl halides, POX 3 and their identification by infrared spectroscopy

NASA Astrophysics Data System (ADS)

Allaf, Abdul W.

1998-07-01

A new route has been devised, leading to the production of POX 3 molecules where X=F, Br and I by an on-line process using phosphoryl chloride, POCl 3 as a starting material passed over heated sodium fluoride, NaF, potassium bromide, KBr and potassium iodide, KI at 535, 690 and 480°C, respectively. The products have been characterised by the infrared (IR) spectra of their vapours. The low resolution gas-phase Fourier transform infrared spectra reported for the first time show strong bands centered at 1416.6, 1312.9, 1297.9 and 1285 cm -1, assigned to ν1(a 1), the OP stretching fundamental of POF 3, POCl 3, POBr 3 and POI 3, respectively.

Molecular epidemiology of Plum pox virus in Japan.

PubMed

Maejima, Kensaku; Himeno, Misako; Komatsu, Ken; Takinami, Yusuke; Hashimoto, Masayoshi; Takahashi, Shuichiro; Yamaji, Yasuyuki; Oshima, Kenro; Namba, Shigetou

2011-05-01

For a molecular epidemiological study based on complete genome sequences, 37 Plum pox virus (PPV) isolates were collected from the Kanto region in Japan. Pair-wise analyses revealed that all 37 Japanese isolates belong to the PPV-D strain, with low genetic diversity (less than 0.8%). In phylogenetic analysis of the PPV-D strain based on complete nucleotide sequences, the relationships of the PPV-D strain were reconstructed with high resolution: at the global level, the American, Canadian, and Japanese isolates formed their own distinct monophyletic clusters, suggesting that the routes of viral entry into these countries were independent; at the local level, the actual transmission histories of PPV were precisely reconstructed with high bootstrap support. This is the first description of the molecular epidemiology of PPV based on complete genome sequences.

[Acute illness following chicken pox: spleen infarction as a complication of varicella zoster infection].

PubMed

Teeninga, Nynke; Willemze, Annemieke J; Emonts, Marieke; Appel, Inge M

2011-01-01

Varicella zoster virus (VZV) infection can cause temporary acquired protein S or C deficiency via cross reacting antibodies and consequently inducing a hypercoagulable state. A 6-year-old girl with a history of congenital cardiac disease was seen at an Emergency Department with acute chest pain, dyspnoea and fever, seven days after developing chicken pox. Diagnostic tests revealed massive infarction of the spleen, and a protein S and C deficiency. In addition, blood cultures revealed a Lancefield group A β-haemolytic streptococcus (GABHS). The patient recovered fully after treatment with low molecular weight heparin and antibiotics. In this patient, septic emboli caused splenic infarction. Thromboembolic complications should be suspected in children with VZV who present with acute symptoms, in particular if bacterial superinfection is found.

Enhanced selectivity for the hydrolysis of block copoly(2-oxazoline)s in ethanol-water resulting in linear poly(ethylene imine) copolymers.

PubMed

van Kuringen, Huub P C; de la Rosa, Victor R; Fijten, Martin W M; Heuts, Johan P A; Hoogenboom, Richard

2012-05-14

The ability of merging the properties of poly(2-oxazoline)s and poly(ethylene imine) is of high interest for various biomedical applications, including gene delivery, biosensors, and switchable surfaces and nanoparticles. In the present research, a methodology for the controlled and selective hydrolysis of (co)poly(2-oxazoline)s is developed in an ethanol-water solvent mixture, opening the path toward a wide range of block poly(2-oxazoline-co-ethylene imine) (POx-PEI) copolymers with tunable properties. The unexpected influence of the selected ethanol-water binary solvent mixture on the hydrolysis kinetics and selectivity is highlighted in the pursue of well-defined POx-PEI block copolymers. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 121.3 - VS select agents and toxins.

Code of Federal Regulations, 2013 CFR

2013-01-01

... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS POSSESSION, USE, AND... fever virus; *Foot-and-mouth disease virus; Goat pox virus; Lumpy skin disease virus; Mycoplasma...

9 CFR 121.3 - VS select agents and toxins.

Code of Federal Regulations, 2014 CFR

2014-01-01

... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS POSSESSION, USE, AND... fever virus; *Foot-and-mouth disease virus; Goat pox virus; Lumpy skin disease virus; Mycoplasma...

Chickenpox

MedlinePlus

Varicella; Chicken pox ... Chickenpox is caused by the varicella-zoster virus. It is a member of the herpesvirus family. The same virus also causes shingles in adults. Chickenpox can be spread very easily to others from ...

IL-4 and IL-13 mediated down-regulation of CD8 expression levels can dampen anti-viral CD8⁺ T cell avidity following HIV-1 recombinant pox viral vaccination.

PubMed

Wijesundara, Danushka K; Jackson, Ronald J; Tscharke, David C; Ranasinghe, Charani

2013-09-23

We have shown that mucosal HIV-1 recombinant pox viral vaccination can induce high, avidity HIV-specific CD8(+) T cells with reduced interleukin (IL)-4 and IL-13 expression compared to, systemic vaccine delivery. In the current study how these cytokines act to regulate anti-viral CD8(+) T, cell avidity following HIV-1 recombinant pox viral prime-boost vaccination was investigated. Out of a panel of T cell avidity markers tested, only CD8 expression levels were found to be enhanced on, KdGag197-205 (HIV)-specific CD8(+) T cells obtained from IL-13(-/-), IL-4(-/-) and signal transducer and, activator of transcription of 6 (STAT6)(-/-) mice compared to wild-type (WT) controls following, vaccination. Elevated CD8 expression levels in this instance also correlated with polyfunctionality, (interferon (IFN)-γ, tumour necorsis factor (TNF)-α and IL-2 production) and the avidity of HIVspecific CD8(+) T cells. Furthermore, mucosal vaccination and vaccination with the novel adjuvanted IL-13 inhibitor (i.e. IL-13Rα2) vaccines significantly enhanced CD8 expression levels on HIV-specific CD8(+), T cells, which correlated with avidity. Using anti-CD8 antibodies that blocked CD8 availability on CD8(+), T cells, it was established that CD8 played an important role in increasing HIV-specific CD8(+) T cell avidity and polyfunctionality in IL-4(-/-), IL-13(-/-) and STAT6(-/-) mice compared to WT controls, following vaccination. Collectively, our data demonstrate that IL-4 and IL-13 dampen CD8 expression levels on anti-viral CD8(+) T cells, which can down-regulate anti-viral CD8(+) T cell avidity and, polyfunctionality following HIV-1 recombinant pox viral vaccination. These findings can be exploited to, design more efficacious vaccines not only against HIV-1, but many chronic infections where high, avidity CD8(+) T cells help protection. Copyright © 2013 Elsevier Ltd. All rights reserved.

THE EFFECT OF SULFUR ON METHANE PARTIAL OXIDATION AND REFORMING PROCESSES FOR LEAN NOX TRAP CATALYSIS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parks, II, James E; Ponnusamy, Senthil

2006-01-01

Lean NOx trap catalysis has demonstrated the ability to reduce NOx emissions from lean natural gas reciprocating engines by >90%. The technology operates in a cyclic fashion where NOx is trapped on the catalyst during lean operation and released and reduced to N2 under rich exhaust conditions; the rich cleansing operation of the cycle is referred to as "regeneration" since the catalyst is reactivated for more NOx trapping after NOx purge. Creating the rich exhaust conditions for regeneration can be accomplished by catalytic partial oxidation of methane in the exhaust system. Furthermore, catalytic reforming of partial oxidation exhaust can enablemore » increased quantities of H2 which is an excellent reductant for lean NOx trap regeneration. It is critical to maintain clean and efficient partial oxidation and reforming processes to keep the lean NOx trap functioning properly and to reduce extra fuel consumption from the regeneration process. Although most exhaust constituents do not impede partial oxidation and reforming, some exhaust constituents may negatively affect the catalysts and result in loss of catalytic efficiency. Of particular concern are common catalyst poisons sulfur, zinc, and phosphorous. These poisons form in the exhaust through combustion of fuel and oil, and although they are present at low concentrations, they can accumulate to significant levels over the life of an engine system. In the work presented here, the effects of sulfur on the partial oxidation and reforming catalytic processes were studied to determine any durability limitations on the production of reductants for lean NOx trap catalyst regeneration.« less

Magnesium Recycling of Partially Oxidized, Mixed Magnesium-Aluminum Scrap Through Combined Refining and Solid Oxide Membrane (SOM) Electrolysis Processes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guan, Xiaofei; Zink, Peter; Pal, Uday

2012-03-11

Pure magnesium (Mg) is recycled from 19g of partially oxidized 50.5wt.%Mg-Aluminum (Al) alloy. During the refining process, potentiodynamic scans (PDS) were performed to determine the electrorefining potential for magnesium. The PDS show that the electrorefining potential increases over time as the Mg content inside the Mg-Al scrap decreases. Up to 100% percent of magnesium is refined from the Mg-Al scrap by a novel refining process of dissolving magnesium and its oxide into a flux followed by vapor phase removal of dissolved magnesium and subsequently condensing the magnesium vapors in a separate condenser. The solid oxide membrane (SOM) electrolysis process ismore » employed in the refining system to enable additional recycling of magnesium from magnesium oxide (MgO) in the partially oxidized Mg-Al scrap. The combination of the refining and SOM processes yields 7.4g of pure magnesium; could not collect and weigh all of the magnesium recovered.« less

Antioxidative efficiency of Triticum aestivum L. exposed to chromium stress.

PubMed

Dey, Surjendu Kumar; Jena, Priyanka Priyadarshani; Kundu, Satyajit

2009-07-01

Wheat (Triticum aestivum L. cv Sonalika) seedlings were grown in presence of K2Cr2O7 (10, 50 and 100 ppm) for 7 days and growth, total chlorophyll, activities of antioxidative enzymes like superoxide dismutase (SOD; EC 1.15.1.1), catalase (CAT; EC 1.11.1.6) and guaiacol peroxidase (POX; EC 1.11.1.7) and lipid peroxidation were determined in root and shoot tissues. Growth of the seedlings was significantly (p < or = 0.05) depressed and at 100 ppm, root length was reduced by 63% and shoot length by 44% in comparison to the respective controls. Total chlorophyll loss in shoots was about 46% at 10 ppm of K2Cr2O7 which further increased to 80% at 100 ppm. Both in root and shoot tissues, activities of SOD and CAT declined with increase of metal in growth medium and it was significant (p < or = 0.05) even at lowest concentration of the metal tested. But POX activity showed a different trend. In root tissues it was decreased whereas in shoots, there was many fold increase in the activity (about 370% over control at 100 ppm). Malondialdehyde (MDA) content increased both in root and shoot tissues, but it reached significant (p < 0.05) level at 50 ppm in roots and at 100 ppm in shoot tissues. Even though antioxidative enzyme activities were not assayed in germinating embryos, inhibition in germination percentage (by 40% at 100 ppm) and increase in lipid peroxidation level (by 71% over control at 100 ppm) were observed in 2-day-old embryos, germinated in presence of K2Cr2O7 (10, 50 and 100 ppm). The results indicated the imposition of oxidative stress situations both during germination and early stages of seedling growth by Cr6 stress, which might be one of the probable reasons behind Cr toxicity in plants.

Effect of temperature modulations on TEMPO-mediated regioselective oxidation of unprotected carbohydrates and nucleosides.

PubMed

Yadav, Mahipal; Liotta, Charles L; Krishnamurthy, Ramanarayanan

2018-02-02

Regioselective oxidation of unprotected and partially protected oligosaccharides is a much sought-after goal. Herein, we report a notable improvement in the efficiency of TEMPO-catalyzed oxidation by modulating the temperature of the reaction. Mono-, di-, and tri-saccharides are oxidized regioselectively in yields of 75 to 92%. The present method is simple to implement and is also applicable for selective oxidations of other mono- and poly-hydroxy compounds including unprotected and partially protected nucleosides. Copyright © 2018 Elsevier Ltd. All rights reserved.

Kinetics of (reversible) internal reforming of methane in solid oxide fuel cells under stationary and APU conditions

NASA Astrophysics Data System (ADS)

Timmermann, H.; Sawady, W.; Reimert, R.; Ivers-Tiffée, E.

The internal reforming of methane in a solid oxide fuel cell (SOFC) is investigated and modeled for flow conditions relevant to operation. To this end, measurements are performed on anode-supported cells (ASC), thereby varying gas composition (y CO = 4-15%, yH2 = 5 - 17 % , yCO2 = 6 - 18 % , yH2O = 2 - 30 % , yCH4 = 0.1 - 20 %) and temperature (600-850 °C). In this way, operating conditions for both stationary applications (methane-rich pre-reformate) as well as for auxiliary power unit (APU) applications (diesel-POX reformate) are represented. The reforming reaction is monitored in five different positions alongside the anodic gas channel by means of gas chromatography. It is shown that methane is converted in the flow field for methane-rich gas compositions, whereas under operation with diesel reformate the direction of the reaction is reversed for temperatures below 675 °C, i.e. (exothermic) methanation occurs along the anode. Using a reaction model, a rate equation for reforming could be derived which is also valid in the case of methanation. By introducing this equation into the reaction model the methane conversion along a catalytically active Ni-YSZ cermet SOFC anode can be simulated for the operating conditions specified above.

Emission characteristics of a premix combustor fueled with a simulated partial-oxidation product gas

NASA Technical Reports Server (NTRS)

Clayton, R. M.

1979-01-01

A two-stage gas turbine combustor concept employing a very fuel-rich partial oxidation stage is being explored for broadening the combustion margin between ultralow emissions and the lean stability limit. Combustion and emission results are presented for a series of experiments where a simulated partial oxidation product gas was used in a premix combustor operated with inlet air state conditions typical of cruise power for high-performance aviation engines (12 atm and 850 F). Ultralow NOx, CO, and HC emissions and an extended lean burning limit were achieved simultaneously.

Poly(1,3,4-oxadiazoles) via aromatic nucleophilic displacement

NASA Technical Reports Server (NTRS)

Connell, John W. (Inventor); Hergenrother, Paul M. (Inventor); Wolf, Peter (Inventor)

1992-01-01

Poly(1,3,4-oxadiazoles) (POX) are prepared by the aromatic nucleophilic displacement reaction of di(hydroxyphenyl) 1,3,4-oxadiazole monomers with activated aromatic dihalides or activated aromatic dinitro compounds. The polymerizations are carried out in polar aprotic solvents such as sulfolane or diphenylsulfone using alkali metal bases such as potassium carbonate at elevated temperatures under nitrogen. The di(hydroxyphenyl) 1,3,4-oxadiazole monomers are synthesized by reacting 4-hydroxybenzoic hydrazide with phenyl 4-hydrobenzoate in the melt and also by reacting aromatic dihydrazides with two moles of phenyl 4-hydroxybenzoate in the melt. This synthetic route has provided high molecular weight POX of new chemical structure, is economically and synthetically more favorable than other routes, and allows for facile chemical structure variation due to the large variety of activated aromatic dihalides which are available.

THE INFLUENCE PRODUCED BY HIGH GAMMA-RAY DOSES ON SOME PROPERTIES OF THE VIRUSES (in Russian)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bektemirov, T.A.

1961-10-01

The effects produced by gamma rays on infectious, hemagglutinating, and antigenic properties common to the viruses of sneall-pox vaccine and those of infiuenze (grippe) and poliomyelitis were studied. All the viruses were grown on a monostratal culture of a renal epithelium taken from semians. Complete suppression of the vital activity appeared with a dose of 15 x 10/sup 5/ gm for the virus of influenza, 20 x 10/sup 5/ for the virus of small-pox, and 40 x 10/ sup 5/ for that of poliomyelitis. Hemagglutinins of the infiuenza and smallpox viruses became fulIy destroyed at a dose of 30 xmore » 10/sup 5/ gm. The irradiation caused the antigenic properties of the viruses under study to decline. (auth)« less

A Multiwavelength Study of POX 52, a Dwarf Seyfert Galaxy with an Intermediate Mass Black Hole

NASA Astrophysics Data System (ADS)

Barth, Aaron

2004-09-01

POX 52 is a Seyfert 1 galaxy with unprecedented properties: its host galaxy is a dwarf elliptical, and its stellar velocity dispersion is only 36 km/s. The stellar velocity dispersion and the broad emission-line widths both suggest a black hole mass of order 10^5 solar masses. We request HST ACS/HRC imaging to perform a definitive measurement of the host galaxy structure; STIS UV and optical spectroscopy to study the nonstellar continuum and the structure of the broad-line region; and Chandra ACIS imaging to investigate the spectral and variability properties of the X-ray emission. The results of this program will give a detailed understanding of the host galaxy and accretion properties of one of the very few known black holes in the mass range around 10^5 solar masses.

[Apical petrositis, osteomyelitis of the base of the skull bones and of the first cervical vertebra in a 5 year-old children following chicken pox].

PubMed

Bogomil'sky, M R; Polunin, M M; Zelikovich, E I; Soldatsky, Yu L; Burova, O V

2016-01-01

This publication was designed to describe a rare case of development of apicalpetrositis in a child presenting with acute otitis mediafollowing chicken pox experienced in the preceding period. We carried out the study with the use of computed tomography (CT) that demonstrated destruction of the temporal bone, bones of the base of the skull and of the first cervical vertebra. The treatment strategy chosen for the management of this condition that included antibiotic therapy and expectant observation proved justified and can be recommended as an algorithm of choice taking into consideration the difficulty of surgical approach to the apex of the petrous pyramid. However, this approach is associated with the high risk of disability arising from the potential injury to the craniocerebral nerves.

Cross-Dehydrogenative Coupling Reactions Between P(O)-H and X-H (X = S, N, O, P) Bonds.

PubMed

Hosseinian, Akram; Farshbaf, Sepideh; Fekri, Leila Zare; Nikpassand, Mohammad; Vessally, Esmail

2018-05-26

P(O)-X (X = S, N, O, P) bond-containing compounds have extensive application in medicinal chemistry, agrochemistry, and material chemistry. These useful organophosphorus compounds also have many applications in organic synthesis. In light of the importance of titled compounds, there is continuing interest in the development of synthetic methods for P(O)-X bonds construction. In the last 4 years, the direct coupling reaction of P(O)-H compounds with thiols, alcohols, and amines/amides has received much attention because of the atom-economic character. This review aims to give an overview of new developments in cross-dehydrogenative coupling reactions between P(O)-H and X-H (X = S, N, O, P) bonds, with special emphasis on the mechanistic aspects of the reactions.

Early plant growth and biochemical responses induced by Azospirillum brasilense Sp245 lipopolysaccharides in wheat (Triticum aestivum L.) seedlings are attenuated by procyanidin B2.

PubMed

Vallejo-Ochoa, Juan; López-Marmolejo, Mariel; Hernández-Esquivel, Alma Alejandra; Méndez-Gómez, Manuel; Suárez-Soria, Laura Nicolasa; Castro-Mercado, Elda; García-Pineda, Ernesto

2018-03-01

This study analyzes the effects of procyanidin B2 on early wheat plant growth and plant biochemical responses promoted by lipopolysaccharides (LPS) derived from the rhizobacteria Azospirillum brasilense Sp245. Measurements of leaf, root length, fresh weight, and dry weight showed in vitro plant growth stimulation 4 days after treatment with A. brasilense as well as LPS. Superoxide anion (O 2 ·- ) and hydrogen peroxide (H 2 O 2 ) levels increased in seedling roots treated with LPS (100 μg mL -1 ). The chlorophyll content in leaf decreased while the starch content increased 24 h after treatment in seedling roots. The LPS treatment induced a high increase in total peroxidase (POX) (EC 1.11.1.7) activity and ionically bound cell wall POX content in roots, when compared to respective controls. Early plant growth and biochemical responses observed in wheat seedlings treated with LPS were inhibited by the addition of procyanidin B2 (5 μg mL -1 ), a B type proanthocyanidin (PAC), plant-derived polyphenolic compound with binding properties of LPS. All results suggest first that the ionically bound cell wall POX enzymes could be a molecular target of A. brasilense LPS, and second that the recognition or association of LPS by plant cells is required to activate plant responses. This last event could play a critical role during plant growth regulation by A. brasilense LPS.

Effects of UV-B irradiation on isoforms of antioxidant enzymes and their activities in red alga Grateloupia filicina (Rhodophyta)

NASA Astrophysics Data System (ADS)

Zhao, Jiqiang; Li, Lixia

2014-11-01

Macroalgae in a littoral zone are inevitably exposed to UV-B irradiance. We analyzed the effects of UV-B on isoenzyme patterns and activities of superoxide dismutase (SOD), peroxidase (POX), catalase (CAT), and ascorbate peroxidase (APX) of red algae Grateloupia filicina (Lamour.) C. Agardh. The activities of SOD, CAT, and APX changed in response to UV-B in a time- and dose-dependent manner. POX activity increased significantly under all three UV-B treatments. The enzymatic assay showed three distinct bands of SODI (Mn-SOD), SODII (Fe-SOD), and SODIII (CuZn-SOD) under a low (Luv) and medium (Muv) dose of UV-B irradiation, while SODI and SODIII activities decreased significantly when exposed to a high dose of UV-B irradiation (Huv). The activity of POX isoenzymes increased significantly after exposure to UV-B, which is consistent with the total activity. In addition, a clear decrease in activity of CATIV was detected in response to all the three doses of UV treatments. Some bands of APX isoenzyme were also clearly influenced by UV-B irradiation. Correspondingly, the daily growth rate declined under all the three exposure doses, and was especially significant under Muv and Huv treatments. These data suggest that, although the protection mechanisms of antioxidant defense system are partly inducible by UV-B to prevent the damage, G. filicina has incomplete tolerance to higher UV-B irradiation stress.

Reforming of fuel inside fuel cell generator

DOEpatents

Grimble, Ralph E.

1988-01-01

Disclosed is an improved method of reforming a gaseous reformable fuel within a solid oxide fuel cell generator, wherein the solid oxide fuel cell generator has a plurality of individual fuel cells in a refractory container, the fuel cells generating a partially spent fuel stream and a partially spent oxidant stream. The partially spent fuel stream is divided into two streams, spent fuel stream I and spent fuel stream II. Spent fuel stream I is burned with the partially spent oxidant stream inside the refractory container to produce an exhaust stream. The exhaust stream is divided into two streams, exhaust stream I and exhaust stream II, and exhaust stream I is vented. Exhaust stream II is mixed with spent fuel stream II to form a recycle stream. The recycle stream is mixed with the gaseous reformable fuel within the refractory container to form a fuel stream which is supplied to the fuel cells. Also disclosed is an improved apparatus which permits the reforming of a reformable gaseous fuel within such a solid oxide fuel cell generator. The apparatus comprises a mixing chamber within the refractory container, means for diverting a portion of the partially spent fuel stream to the mixing chamber, means for diverting a portion of exhaust gas to the mixing chamber where it is mixed with the portion of the partially spent fuel stream to form a recycle stream, means for injecting the reformable gaseous fuel into the recycle stream, and means for circulating the recycle stream back to the fuel cells.

Reforming of fuel inside fuel cell generator

DOEpatents

Grimble, R.E.

1988-03-08

Disclosed is an improved method of reforming a gaseous reformable fuel within a solid oxide fuel cell generator, wherein the solid oxide fuel cell generator has a plurality of individual fuel cells in a refractory container, the fuel cells generating a partially spent fuel stream and a partially spent oxidant stream. The partially spent fuel stream is divided into two streams, spent fuel stream 1 and spent fuel stream 2. Spent fuel stream 1 is burned with the partially spent oxidant stream inside the refractory container to produce an exhaust stream. The exhaust stream is divided into two streams, exhaust stream 1 and exhaust stream 2, and exhaust stream 1 is vented. Exhaust stream 2 is mixed with spent fuel stream 2 to form a recycle stream. The recycle stream is mixed with the gaseous reformable fuel within the refractory container to form a fuel stream which is supplied to the fuel cells. Also disclosed is an improved apparatus which permits the reforming of a reformable gaseous fuel within such a solid oxide fuel cell generator. The apparatus comprises a mixing chamber within the refractory container, means for diverting a portion of the partially spent fuel stream to the mixing chamber, means for diverting a portion of exhaust gas to the mixing chamber where it is mixed with the portion of the partially spent fuel stream to form a recycle stream, means for injecting the reformable gaseous fuel into the recycle stream, and means for circulating the recycle stream back to the fuel cells. 1 fig.

Growth of Nucleation Sites on Pd-doped Bi_2Sr_2Ca1 Cu_2O_8+δ

NASA Astrophysics Data System (ADS)

Kouzoudis, D.; Finnemore, D. K.; Xu, Ming; Balachandran

1996-03-01

Enviromental Scanning Electron Microscope has shown evidence that during the growth of Bi_2Sr_2Ca_2Cu_3O_10+δ from mixed powders of Pb-doped Bi_2Sr_2Ca_1Cu_2O_8+δ and other oxides, a dense array of hillocks or mesas grow at the interface between an Ag overlay and Pb doped Bi_2Sr_2Ca_1Cu_2O_8+δ grains. These hillocks develop a texture that looks like ''chicken pox'' during the ramp up to the reaction temperature starting at about 700^circ C and they are about 500 to 1000 nm across and are spaced at about 500 to 1000 nm. If there is no Ag, this texture does not develop. Preliminary measurments indicate that the hillocks are re-crystallization of (Bi,Pb)_2Sr_2Ca_1Cu_2O_8+δ and are definetely not a Pb rich phase

Antioxidant enzymes activity and phenolic compounds content in red cabbage seedlings exposed to copper stress.

PubMed

Posmyk, M M; Kontek, R; Janas, K M

2009-02-01

The phenolics: anthocyanin (ATH), sinapoyl esters and activity of antioxidant enzymes: superoxide dismutase (SOD), catalase (CAT), guaiacol peroxidase (POX), ascorbate peroxidase (APX), glutathione peroxidase (GPX) and glutathione reductase (GR), in red cabbage seedlings subjected to Cu2+ stress were investigated. Cu2+ at low doses (0.5 mM), increased the levels of ATH and sinapoyl derivatives in red cabbage. High Cu2+ concentration (2.5 mM) provoked oxidative stress and enhanced thiobarbituric acid reactive substances (TBARS) content in tissues. A lower level of TBARS was correlated with high ATH content. It seems that synthesis of these isoflavonoids is an effective strategy against reactive oxygen species (ROS). The analysis of the antioxidant enzymes activity suggested that peroxidases were the most active enzymes in red cabbage seedlings exposed to Cu2+ stress. It could results from the fact that phenolic compounds (PhC), which could be also substrates for different peroxidases, were the first line of defence against metal stress.

Growth of nucleation sites on Pb-doped Bi2Sr2Ca1Cu2O8 + delta

NASA Astrophysics Data System (ADS)

Finnemore, D. K.; Xu, Ming; Kouzoudis, D.; Bloomer, T.; Kramer, M. J.; McKernan, Stuart; Balachandran, U.; Haldar, Pradeep

1996-01-01

In the growth of Bi2Sr2Ca2Cu3O10+δ from mixed powders of Pb-doped Bi2Sr2Ca1Cu2O8+δ and other oxides, it has been discovered that a dense array of hillocks or mesas grow at the interface between a Ag overlay and Pb-doped Bi2Sr2Ca1Cu2O8+δ grains during the ramp up to the reaction temperature. As viewed in an environmental scanning electron microscope, the Ag coated grains develop a texture that looks like ``chicken pox'' growing on the grains at about 700 °C. These hillocks are about 100 nm across and are spaced at about 500 to 1000 nm. If there is no Ag, this texture does not develop. Preliminary measurements indicate that the hillocks are a recrystallization of (Bi,Pb)2Sr2Ca1Cu2O8+δ, and are definitely not a Pb rich phase.

Oxygen permeation and stability of La 0.4Ca 0.6Fe 1-xCo xO 3-δ ( x = 0, 0.25, 0.5) membranes

NASA Astrophysics Data System (ADS)

Diethelm, S.; Van herle, J.; Middleton, P. H.; Favrat, D.

Three perovskite-type compounds of composition La 0.4Ca 0.6Fe 1- xCo xO 3- δ ( x=0, 0.25 and 0.5) were investigated for use as oxygen separation membranes for the partial oxidation (POX) of methane to syngas. Special attention was given to the question of their stability in real operating conditions. A permeation set-up was specially designed to measure oxygen fluxes through these materials when placed in a strong pO 2 gradient. It also facilitated testing the long-term stability of the specimen. Permeation measurements performed in an air/argon gradient between 800 and 1000 °C showed that the highest fluxes were obtained with the highest content of cobalt (La 0.4Ca 0.6Fe 0.5Co 0.5O 3- δ ≅ La 0.4Ca 0.6Fe 0.75Co 0.25O 3- δ > La 0.4Ca 0.6FeO 3- δ). In addition, comparison between the fluxes of samples of different thickness gave clear evidence of surface limitations in the oxygen transport. The long-term stability test showed opposite trends: only the two lowest Co containing compounds ( x=0 and 0.25) sustained an air/(Ar+H 2) gradient over more than 600 h. The other ( x=0.5) broke shortly after the introduction of H 2. In the presence of H 2, the oxygen flux was increased by a factor 10 compared to Ar and reached 0.83 μmol/cm 2 s for La 0.4Ca 0.6Fe 0.75Co 0.25O 3- δ at 900 °C. Post-operation SEM examination of the cross-section and both surfaces revealed that the surface exposed to H 2 had started to decompose resulting in the formation of a thin porous layer but the bulk of the material remained unchanged.

A light hydrocarbon fuel processor producing high-purity hydrogen

NASA Astrophysics Data System (ADS)

Löffler, Daniel G.; Taylor, Kyle; Mason, Dylan

This paper discusses the design process and presents performance data for a dual fuel (natural gas and LPG) fuel processor for PEM fuel cells delivering between 2 and 8 kW electric power in stationary applications. The fuel processor resulted from a series of design compromises made to address different design constraints. First, the product quality was selected; then, the unit operations needed to achieve that product quality were chosen from the pool of available technologies. Next, the specific equipment needed for each unit operation was selected. Finally, the unit operations were thermally integrated to achieve high thermal efficiency. Early in the design process, it was decided that the fuel processor would deliver high-purity hydrogen. Hydrogen can be separated from other gases by pressure-driven processes based on either selective adsorption or permeation. The pressure requirement made steam reforming (SR) the preferred reforming technology because it does not require compression of combustion air; therefore, steam reforming is more efficient in a high-pressure fuel processor than alternative technologies like autothermal reforming (ATR) or partial oxidation (POX), where the combustion occurs at the pressure of the process stream. A low-temperature pre-reformer reactor is needed upstream of a steam reformer to suppress coke formation; yet, low temperatures facilitate the formation of metal sulfides that deactivate the catalyst. For this reason, a desulfurization unit is needed upstream of the pre-reformer. Hydrogen separation was implemented using a palladium alloy membrane. Packed beds were chosen for the pre-reformer and reformer reactors primarily because of their low cost, relatively simple operation and low maintenance. Commercial, off-the-shelf balance of plant (BOP) components (pumps, valves, and heat exchangers) were used to integrate the unit operations. The fuel processor delivers up to 100 slm hydrogen >99.9% pure with <1 ppm CO, <3 ppm CO 2. The thermal efficiency is better than 67% operating at full load. This fuel processor has been integrated with a 5-kW fuel cell producing electricity and hot water.

Effect of oxygen partial pressure on oxidation of Mo-metal

NASA Astrophysics Data System (ADS)

Sharma, Rabindar Kumar; Kumar, Prabhat; Singh, Megha; Gopal, Pawar; Reddy, G. B.

2018-05-01

This report explains the effect of oxygen partial pressure (PO2 ) on oxidation of Mo-metal in oxygen plasma. XRD results indulge that oxide layers formed on Mo-surfaces at different oxygen partial pressures have two different oxide phases (i.e. orthorhombic MoO3 and monoclinic Mo8O23). Intense XRD peaks at high pressure (i.e. 2.0×10-1 Torr) points out the formation of thick oxide layer on Mo-surface due to presence of large oxygen species in chamber and less oxide volatilization. Whereas, at low PO2 (6.5×10-2 and 7.5×10-2 Torr.) the reduced peak strength is owing to high oxide volatilization rate. SEM micrographs and thickness measurements also support XRD results and confirm that the optimum -2value of PO2 to deposited thicker and uniform oxide film on glass substrate is 7.5×10-2 Torr through plasma assistedoxidation process. Further to study the compositional properties, EDX of the sample M2 (the best sample) is carried out, which confirms that the stoichiometric ratio is less than 3 (i.e. 2.88). Less stoichiometric ratio again confirms the presence of sub oxides in oxide layers on Mo metal as evidenced by XRD results. All the observed results are well in consonance with each other.

Stable, Ultra-Low Residence Time Partial Oxidation

DOEpatents

Schmidt, Lanny D.; Hickman, Daniel A.

1997-07-15

A process for the catalytic partial oxidation of methane in gas phase at very short residence time (800,000 to 12,000,000 hr.sup.-1) by contacting a gas stream containing methane and oxygen with a metal supported catalyst, such as platinum deposited on a ceramic monolith.

Partial oxidation of alkanes by dioxiranes formed in situ at low temperature.

PubMed

Yacob, Sara; Caulfield, Michael J; Barckholtz, Timothy A

2018-01-13

Partial oxidation catalysts capable of efficiently operating at low temperatures may limit the over-oxidation of alkane substrates and thereby improve selectivity. This work focuses on examining alkane oxidation using completely metal-free organocatalysts, dioxiranes. The dioxiranes employed here are synthesized by oxidation of a ketone using a terminal oxidant, such as hydrogen peroxide. Our work generates the dioxirane in situ , so that the process can be catalytic with respect to the ketone. To date, we have demonstrated selective partial oxidation of adamantane using ketone catalysts resulting in yields upwards of 60% towards 1-adamantanol with greater than 99% selectivity. Furthermore, we have demonstrated that changing the electrophilic character of the ketone R groups to contain more electron-donating ligands facilitates the dioxirane ring formation and improves overall oxidation yields. Isotopic labelling studies using H 2 18 O 2 show the preferential incorporation of an 18 O label into the parent ketone, providing evidence for a dioxirane intermediate formed in situ The isotopic labelling studies, along with solvent effect studies, suggest the formation of peracetic acid as a reactive intermediate.This article is part of a discussion meeting issue 'Providing sustainable catalytic solutions for a rapidly changing world'. © 2017 The Author(s).

Combined fuel and air staged power generation system

DOEpatents

Rabovitser, Iosif K; Pratapas, John M; Boulanov, Dmitri

2014-05-27

A method and apparatus for generation of electric power employing fuel and air staging in which a first stage gas turbine and a second stage partial oxidation gas turbine power operated in parallel. A first portion of fuel and oxidant are provided to the first stage gas turbine which generates a first portion of electric power and a hot oxidant. A second portion of fuel and oxidant are provided to the second stage partial oxidation gas turbine which generates a second portion of electric power and a hot syngas. The hot oxidant and the hot syngas are provided to a bottoming cycle employing a fuel-fired boiler by which a third portion of electric power is generated.

Proceedings of the International Pyrotechnics Seminar (6th) Held at Estes Park, Colorado, 17-21 July 1978

DTIC Science & Technology

1978-06-01

in metal form, and not as an oxide , as with conventional HC compositions. "That verified the fact that the aluminum did not take part in the chemical...the melting of the protective oxide layer on the aluminum particle with an attendant increase in surface reaction rate leading to ignition. Oxide ...detonation 5 aluminum BrF5 partial detonation 6 propylene oxide ClF3 partial detonation 621 041 IR! Each teat used about 5 kg of fuel, about 400 g

Ferromagnetic phase in partially oxidized FeMn films

NASA Astrophysics Data System (ADS)

Svalov, A. V.; Savin, P. A.; Lepalovskij, V. N.; Vas'kovskiy, V. O.; Larrañaga, A.; Kurlyandskaya, G. V.

2018-04-01

The structure, magnetic and magnetoresistive properties of ferromagnetic phase in partially oxidized FeMn films was studied. The oxidation was performed by annealing of the samples under atmospheric pressure in a gas mixture (nitrogen with 0.5% oxygen) at the temperature of 300 °C. The resulting ferromagnetic phase was isotropic in the film plane. The value of the anisotropic magnetoresistance was similar to the value of the anisotropic magnetoresistance usually observed in films of pure iron. The oxidation of antiferromagnetic FeMn films resulted in the appearance of an exchange bias.

Sugars and organic acids in plum fruit affected by Plum pox virus.

PubMed

Usenik, Valentina; Marn, Mojca Virscek

2017-05-01

Plum pox virus (PPV) causes severe economic losses in stone fruit production, but little is known about its effect on plum fruit composition. In this study, the influence of PPV on sugars and organic acids was evaluated in a susceptible plum (Prunus domestica L.) cultivar. PPV infection significantly affected the content and composition of sugars and organic acids. The composition of necrotic tissue was modified the most. A short-time infected tree yielded fruit with similar sugar composition to fruit from a healthy tree, but the decline of organic acids was faster. Prematurely ripened symptomatic fruit had reduced fruit weight and low sugar content. Infected trees of the studied cultivar produce fruit of inferior quality. Fruits are not suitable for processing, especially when most of them exhibit visual symptoms of PPV infection. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Multiwavelength Observations of the Dwarf Seyfert 1 Galaxy POX 52

NASA Astrophysics Data System (ADS)

Thornton, Carol E.; Barth, A. J.; Ho, L. C.; Rutledge, R. E.; Greene, J. E.

2006-12-01

POX 52 is an unusual narrow-line Seyfert 1 galaxy, having an estimated black hole mass of order 105 solar masses and a dwarf host galaxy with an absolute magnitude of only MV = -17.6, which gives us a unique opportunity to study black hole-bulge relations in the low-mass regime. We present new observations from a multiwavelength campaign to study its active nucleus and host galaxy. The data include observations from the Chandra and XMM-Newton Observatories, the Hubble Space Telescope, and the Very Large Array. Chandra data show a highly variable point source with a 2.0 10.0 keV luminosity of 0.7 * 1042 ergs/s. We will also describe the X-ray spectral shape, the structure of the host galaxy as determined from GALFIT modeling of the HST ACS/HRC images, and the spectral energy distribution of the active nucleus.

POX 186: the ultracompact blue compact dwarf galaxy reveals its nature

NASA Astrophysics Data System (ADS)

Doublier, V.; Kunth, D.; Courbin, F.; Magain, P.

2000-01-01

High resolution, ground based R and I band observations of the ultra compact dwarf galaxy POX 186 are presented. The data, obtained with the ESO New Technology Telescope (NTT), are analyzed using a new deconvolution algorithm which allows one to resolve the innermost regions of this stellar-like object into three Super-Star Clusters (SSC). Upper limits to both masses (M ~ 105 Msun) and physical sizes (<=60pc) of the SSCs are set. In addition, and maybe most importantly, extended light emission underlying the compact star-forming region is clearly detected in both bands. The R-I color rules out nebular Hα contamination and is consistent with an old stellar population. This casts doubt on the hypothesis that Blue Compact Dwarf Galaxies (BCDG) are young galaxies. based on observations carried out at NTT in La Silla, operated by the European Southern Observatory, during Director's Discretionary Time.

Synergistic Combinations of Multiple Chemotherapeutic Agents in High Capacity Poly(2-oxazoline) Micelles

PubMed Central

Han, Yingchao; He, Zhijian; Schulz, Anita; Bronich, Tatiana K.; Jordan, Rainer; Luxenhofer, Robert; Kabanov, Alexander V.

2012-01-01

Many effective drugs for cancer treatment are poorly water-soluble. In combination chemotherapy, needed excipients in additive formulations are often toxic and restrict their applications in clinical intervention. Here, we report on amphiphilic poly(2-oxazoline)s (POx) micelles as a promising high capacity delivery platform for multi-drug cancer chemotherapy. A variety of binary and ternary drugs combinations of paclitaxel (PTX), docetaxel (DTX), 17-allylamino-17-demethoxygeldanamycin (17-AAG), etoposide (ETO) and bortezomib (BTZ) were solubilized in defined polymeric micelles achieving unprecedented high total loading capacities of up to 50 wt.% drug per final formulation. Multi-drug loaded POx micelles showed enhanced stability in comparison to single-drug loaded micelles. Drug ratio dependent synergistic cytotoxicity of micellar ETO/17-AAG was observed in MCF-7 cancer cells and of micellar BTZ/17-AAG in MCF-7, PC3, MDA-MB-231 and HepG2 cells. PMID:22681126

How arbuscular mycorrhizal fungi influence the defense system of sunflower during different abiotic stresses.

PubMed

Mayer, Zoltán; Duc, Nguyen Hong; Sasvári, Zita; Posta, Katalin

2017-12-01

The association between terrestrial plants and arbuscular mycorrhizal (AM) fungi is one of the most common and widespread mutualistic plant-fungi interaction. AM fungi are of beneficial effects on the water and nutrient uptake of plants and increase plant defense mechanisms to alleviate different stresses. The aim of this study was to determine the level of polyphenol oxidase (PPO), guaiacol peroxidase (POX) and glutathione S-transferase (GST) enzyme activities and to track the expression of glutathione S-transferase (GST) gene in plant-arbuscular mycorrhizal system under temperature- and mechanical stress conditions. Our results suggest that induced tolerance of mycorrhizal sunflower to high temperature may be attributed to the induction of GST, POX and PPO enzyme activities as well as to the elevated expression of GST. However, the degree of tolerance of the plant is significantly influenced by the age which is probably justified by the energy considerations.

THE BEHAVIOR OF POX VIRUSES IN THE RESPIRATORY TRACT

PubMed Central

Nelson, John B.

1941-01-01

Fowl pox virus from active skin lesions was established in the upper respiratory tract of normal chickens by nasal instillation and maintained for 12 successive passages. The nasal infection was not communicable by direct contact but did afford protection, for at least 6 weeks, against subsequent development of the virus in the skin. Multiplication of the virus in the nasal passages was only irregularly attended by specific mucosal changes and was not accompanied by the vigorous counter-reaction engendered by the causal agents of roup. The same strain of virus on propagation in embryonated eggs also survived and multiplied in the nasal tract but with somewhat reduced activity, the 34th egg transfer failing to afford complete protection. Nasal instillation in mice was followed only by a reaction in the lung from which the virus was recoverable through the 7th day. PMID:19871128

Multicolor quantum dot-encoded microspheres for the fluoroimmunoassays of chicken newcastle disease and goat pox virus.

PubMed

Yuan, Pingfan; Ma, Qiang; Meng, Rizeng; Wang, Chao; Dou, Wenchao; Wang, Guannan; Su, Xingguang

2009-05-01

Semiconductor nanocrystals (or quantum dots, QDs) have the potential to overcome some of the limitations encountered by traditional fluorophores in fluorescence labeling applications. The unique spectroscopic properties of QDs make them hold immense promise as versatile labels for biological applications. In this work, we employ the layer-by-layer (LbL) method for the construction of bio-functional multicolor QD-encoded microspheres. Polystyrene microspheres with diameter of 3 microm were used as templates for the deposition of different sized CdTe QDs/polyelectrolyte multilayers. Two different antigens, Chicken newcastle disease (CND) antigen and goat pox virus (GPV) antigen, were conjugated to two kinds of biofunctional multicolor microspheres with different optical encoding. The multicolor microspheres can capture corresponding antibodies labeled with QDs, QDs-CND antibody and QDs-GPV antibody in the fluoroimmunoassays. The microspheres can be distinguished from each other based on their optical encoding.

Production of Lycopene in the Non-Carotenoid-Producing Yeast Yarrowia lipolytica

PubMed Central

Ketelhot, Markus; Gatter, Michael; Barth, Gerold

2014-01-01

The codon-optimized genes crtB and crtI of Pantoea ananatis were expressed in Yarrowia lipolytica under the control of the TEF1 promoter of Y. lipolytica. Additionally, the rate-limiting genes for isoprenoid biosynthesis in Y. lipolytica, GGS1 and HMG1, were overexpressed to increase the production of lycopene. All of the genes were also expressed in a Y. lipolytica strain with POX1 to POX6 and GUT2 deleted, which led to an increase in the size of lipid bodies and a further increase in lycopene production. Lycopene is located mainly within lipid bodies, and increased lipid body formation leads to an increase in the lycopene storage capacity of Y. lipolytica. Growth-limiting conditions increase the specific lycopene content. Finally, a yield of 16 mg g−1 (dry cell weight) was reached in fed-batch cultures, which is the highest value reported so far for a eukaryotic host. PMID:24375130

Plague, pox and the physician in Aberdeen, 1495-1516.

PubMed

Jillings, K

2010-03-01

This article discusses responses to disease in Aberdeen during a formative period in the provision of healthcare within the city. The foundation of King's College was followed, in 1497, by the establishment of the first royally endowed university Chair of Medicine in the British Isles, and its first incumbent, James Cumming, was employed by the local government as the first city doctor in 1503. His appointment had been preceded in 1497 by another legislative innovation in Aberdeen, when its council became the first civic body in the British Isles to implement regulations against the threat of the Great Pox (usually considered to be syphilis). It had subsequently to pass measures to prevent the spread of plague to the city, and these were typical of those already imposed elsewhere in Scotland and on the continent. Their apparent success in staving off plague lasted until 1514, when the city was struck by a severe outbreak which lasted two years.

SYNTHESIZING ALCOHOLS AND KETONES BY PHOTOINDUCED CATALYTIC PARTIAL-OXIDATION OF HYDROCARBONS IN TI02 FILM REACTORS PREPARED BY THREE DIFFERENT METHODS

EPA Science Inventory

The partial oxidation of cyclohexane to cyclohexanol and cyclohexanone on UV irradiated titanium dioxide films in the presence of molecular oxygen at ambient temperatures and pressures was studied. Three different coating methodologies (dip coating using titanium isopropoxide an...

Method of fabricating a monolithic solid oxide fuel cell

DOEpatents

Minh, N.Q.; Horne, C.R.

1994-03-01

In a two-step densifying process of making a monolithic solid oxide fuel cell, a limited number of anode-electrolyte-cathode cells separated by an interconnect layer are formed and partially densified. Subsequently, the partially densified cells are stacked and further densified to form a monolithic array. 10 figures.

Method of fabricating a monolithic solid oxide fuel cell

DOEpatents

Minh, Nguyen Q.; Horne, Craig R.

1994-01-01

In a two-step densifying process of making a monolithic solid oxide fuel cell, a limited number of anode-electrolyte-cathode cells separated by an interconnect layer are formed and partially densified. Subsequently, the partially densified cells are stacked and further densified to form a monolithic array.

Thermoresponsive Polymers for Nuclear Medicine: Which Polymer Is the Best?

PubMed

Sedláček, Ondřej; Černoch, Peter; Kučka, Jan; Konefal, Rafał; Štěpánek, Petr; Vetrík, Miroslav; Lodge, Timothy P; Hrubý, Martin

2016-06-21

Thermoresponsive polymers showing cloud point temperatures (CPT) in aqueous solutions are very promising for the construction of various systems in biomedical field. In many of these applications these polymers get in contact with ionizing radiation, e.g., if they are used as carriers for radiopharmaceuticals or during radiation sterilization. Despite this fact, radiosensitivity of these polymers is largely overlooked to date. In this work, we describe the effect of electron beam ionizing radiation on the physicochemical and phase separation properties of selected thermoresponsive polymers with CPT between room and body temperature. Stability of the polymers to radiation (doses 0-20 kGy) in aqueous solutions increased in the order poly(N-vinylcaprolactam) (PVCL, the least stable) ≪ poly[N-(2,2-difluoroethyl)acrylamide] (DFP) < poly(N-isopropylacrylamide) (PNIPAM) ≪ poly(2-isopropyl-2-oxazoline-co-2-n-butyl-2-oxazoline) (POX). Even low doses of β radiation (1 kGy), which are highly relevant to the storage of polymer radiotherapeutics and sterilization of biomedical systems, cause significant increase in molecular weight due to cross-linking (except for POX, where this effect is weak). In the case of PVCL irradiated with low doses, the increase in molecular weight induced an increase in the CPT of the polymer. For PNIPAM and DFP, there is strong chain hydrophilization leading to an increase in CPT. From this perspective, POX is the most suitable polymer for the construction of delivery systems that experience exposure to radiation, while PVCL is the least suitable and PNIPAM and DFP are suitable only for low radiation demands.

Molecular Smallpox Vaccine Delivered by Alphavirus Replicons Elicits Protective Immunity in Mice and Non-human Primates

PubMed Central

Hooper, Jay W.; Ferro, Anthony M.; Golden, Joseph W.; Silvera, Peter; Dudek, Jeanne; Alterson, Kim; Custer, Max; Rivers, Bryan; Morris, John; Owens, Gary; Smith, Jonathan F.; Kamrud, Kurt I.

2009-01-01

Naturally occurring smallpox was eradicated as a result of successful vaccination campaigns during the 1960s and 70s. Because of its highly contagious nature and high mortality rate, smallpox has significant potential as a biological weapon. Unfortunately, the current vaccine for orthopoxviruses is contraindicated for large portions of the population. Thus, there is a need for new, safe, and effective orthopoxvirus vaccines. Alphavirus replicon vectors, derived from strains of Venezuelan equine encephalitis virus, are being used to develop alternatives to the current smallpox vaccine. Here, we demonstrated that virus-like replicon particles (VRP) expressing the vaccinia virus A33R, B5R, A27L, and L1R genes elicited protective immunity in mice comparable to vaccination with live-vaccinia virus. Furthermore, cynomolgus macaques vaccinated with a combination of the four poxvirus VRPs (4pox-VRP) developed antibody responses to each antigen. These antibody responses were able to neutralize and inhibit the spread of both vaccinia virus and monkeypox virus. Macaques vaccinated with 4pox-VRP, flu HA VRP (negative control), or live-vaccinia virus (positive control) were challenged intravenously with 5 × 106 PFU of monkeypox virus 1 month after the second VRP vaccination. Four of the six negative control animals succumbed to monkeypox and the remaining two animals demonstrated either severe or grave disease. Importantly, all 10 macaques vaccinated with the 4pox-VRP vaccine survived without developing severe disease. These findings revealed that a single-boost VRP smallpox vaccine shows promise as a safe alternative to the currently licensed live-vaccinia virus smallpox vaccine. PMID:19833247

Follow-up of pregnant women exposed to chicken pox: an audit of relationship between level of antibody and development of chicken pox.

PubMed

Boxall, E H; Maple, P A C; Rathod, P; Smit, E

2011-10-01

The purpose of this study was to validate through natural exposure a cut-off level of varicella zoster IgG as protective against infection with varicella zoster virus (VZV). Laboratory testing to determine VZV immune status of pregnant women exposed to varicella is recommended. Quantitative assays are now available which are sensitive and specific. More than 200 consecutive requests for screening in pregnant patients with recent varicella contacts were followed-up by questionnaire. DiaSorin LIAISON and VZV time resolved fluorescence immuno assay (VZV TRFIA) were used to measure VZV antibody level. One hundred fifty out of 209 (72%) questionnaires were returned; 14 patients developed varicella, 129 did not and seven were not known. Patients who had been given VZIG and developed varicella on follow-up had a mean antibody level before VZIG of 28 mIU/ml and 62 mIU/ml, by LIAISON and TRFIA, respectively. The mean IgG level of those that did not develop varicella was 885 and 866 mIU/ml by LIAISON and TRFIA, respectively. Those with levels <100 mIU/ml were more likely to develop chicken pox than those with levels >100 mIU/ml (relative risk of 10.4 for LIAISON and 8.8 for TRFIA). On the basis of the relatively small numbers in this study, quantitative assays, using a 100mIU/ml cut-off, can differentiate between those who are susceptible and those who are protected against exposure, however follow-up studies should include sampling for VZV DNA and IgM.

Protective effect of metoclopramide against organophosphate-induced apoptosis in the murine skin fibroblast L929.

PubMed

Jaber, Basem M; Petroianu, Georg A; Rizvi, Syed A; Borai, Anwar; Saleh, Nada A; Hala, Sharif M; Saleh, Ayman M

2018-03-01

This study was performed to evaluate the protective efficacy of metoclopramide (MCP) against the organophosphates paraoxon (POX)- and malathion (MLT)-induced apoptosis in the murine L929 skin fibroblasts. L929 cells were exposed to either POX (10 nm) or 1.0 μm MLT in the absence and presence of increased concentrations of MCP. The protective effect of MCP on these organophosphate-stimulated apoptotic events was evaluated by flow cytometry analysis after staining with annexin-V/propidium iodide, processing and activation of the executioner caspase-3, cleavage of the poly-ADP ribose polymerase, fragmentation of the nucleosomal DNA and disruption of the mitochondrial membrane potential (Δψ). Our results showed that increased doses of MCP alone (≥10 μm) did not induce apoptosis or activation of caspase-3. Pretreatment of the cells with MCP attenuated all the apoptotic events triggered by the organophosphate compounds in a dose-dependent manner reaching ~70-80% protection when they were preincubated at 1 and 5 μm of the drug before the addition of POX and MLT, respectively. Interestingly, MCP did not offer a significant protective effect against the cytotoxicity of tumor necrosis factor-α, cisplatinum, etoposide or paclitaxel, which stimulate apoptosis by various mechanisms, suggesting that the anti-apoptotic effect of the drug is specific to organophosphates. The strong and specific anti-apoptotic activity of subclinical doses of MCP against the cytotoxicity of organophosphate compounds suggests its potential clinical application in treating their poisoning. Copyright © 2017 John Wiley & Sons, Ltd.

Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP(®) using reverse transcription-recombinase polymerase amplification.

PubMed

Zhang, Shulu; Ravelonandro, Michel; Russell, Paul; McOwen, Nathan; Briard, Pascal; Bohannon, Seven; Vrient, Albert

2014-10-01

Plum pox virus (PPV) causes the most destructive viral disease known as plum pox or Sharka disease in stone fruit trees. As an important regulated pathogen, detection of PPV is thus of critical importance to quarantine and eradication of the spreading disease. In this study, the innovative development of two AmplifyRP(®) tests is reported for a rapid isothermal detection of PPV using reverse transcription-recombinase polymerase amplification. In an AmplifyRP(®) test, all specific recombination and amplification reactions occur at a constant temperature without thermal cycling and the test results are either recorded in real-time with a portable fluorescence reader or displayed using a lateral flow strip contained inside an amplicon detection chamber. The major improvement of this assay is that the entire test from sample preparation to result can be completed in as little as 20min and can be performed easily both in laboratories and in the field. The results from this study demonstrated the ability of the AmplifyRP(®) technique to detect all nine PPV strains (An, C, CR, D, EA, M, Rec, T, or W). Among the economic benefits to pathogen surveys is the higher sensitivity of the AmplifyRP(®) to detect PPV when compared to the conventional ELISA and ImmunoStrip(®) assays. This is the first report describing the use of such an innovative technique to detect rapidly plant viruses affecting perennial crops. Copyright © 2014 Elsevier B.V. All rights reserved.

Pandemic Flu and Medical Biodefense Countermeasure Liability Limitation

DTIC Science & Technology

2010-02-12

covering countermeasures against other strains of influenza (including H1N1), anthrax, botulism , small pox, and acute radiation syndrome...Secretary of HHS has issued additional declarations covering various countermeasures against anthrax, botulism , acute radiation syndrome, smallpox, and

Export Controls: Controls Over the Export Licensing Process for Chemical and Biological Items

DTIC Science & Technology

2005-03-30

Akabane virus Bovine spongiform encephalopathy agent Camel pox virus Central European tick-borne encephalitis Cercopithecine herpesvirus 1...Herpes B virus) Coccidioides immitis Coccidioides posadasii Cowdria ruminantium (Heartwater) Far Eastern tick-borne encephalitis Liberobacter

Nanocrystalline films for gas-reactive applications

DOEpatents

Eastman, Jeffrey A.; Thompson, Loren J.

2004-02-17

A gas sensor for detection of oxidizing and reducing gases, including O.sub.2, CO.sub.2, CO, and H.sub.2, monitors the partial pressure of a gas to be detected by measuring the temperature rise of an oxide-thin-film-coated metallic line in response to an applied electrical current. For a fixed input power, the temperature rise of the metallic line is inversely proportional to the thermal conductivity of the oxide coating. The oxide coating contains multi-valent cation species that change their valence, and hence the oxygen stoichiometry of the coating, in response to changes in the partial pressure of the detected gas. Since the thermal conductivity of the coating is dependent on its oxygen stoichiometry, the temperature rise of the metallic line depends on the partial pressure of the detected gas. Nanocrystalline (<100 nm grain size) oxide coatings yield faster sensor response times than conventional larger-grained coatings due to faster oxygen diffusion along grain boundaries rather than through grain interiors.

Method and apparatus for converting hydrocarbon fuel into hydrogen gas and carbon dioxide

DOEpatents

Clawson, Lawrence G.; Mitchell, William L.; Bentley, Jeffrey M.; Thijssen, Johannes H.J.

2000-01-01

An apparatus and a method are disclosed for converting hydrocarbon fuel or an alcohol into hydrogen gas and carbon dioxide. The apparatus includes a first vessel having a partial oxidation reaction zone and a separate steam reforming reaction zone that is distinct from the partial oxidation reaction zone. The first vessel has a first vessel inlet at the partial oxidation reaction zone and a first vessel outlet at the steam reforming zone. The reformer also includes a helical tube extending about the first vessel. The helical tube has a first end connected to an oxygen-containing source and a second end connected to the first vessel at the partial oxidation reaction zone. Oxygen gas from an oxygen-containing source can be directed through the helical tube to the first vessel. A second vessel having a second vessel inlet and second vessel outlet is annularly disposed about the first vessel. The helical tube is disposed between the first vessel and the second vessel and gases from the first vessel can be directed through second vessel.

Method for generating hydrogen for fuel cells

DOEpatents

Ahmed, Shabbir; Lee, Sheldon H. D.; Carter, John David; Krumpelt, Michael

2004-03-30

A method of producing a H.sub.2 rich gas stream includes supplying an O.sub.2 rich gas, steam, and fuel to an inner reforming zone of a fuel processor that includes a partial oxidation catalyst and a steam reforming catalyst or a combined partial oxidation and stream reforming catalyst. The method also includes contacting the O.sub.2 rich gas, steam, and fuel with the partial oxidation catalyst and the steam reforming catalyst or the combined partial oxidation and stream reforming catalyst in the inner reforming zone to generate a hot reformate stream. The method still further includes cooling the hot reformate stream in a cooling zone to produce a cooled reformate stream. Additionally, the method includes removing sulfur-containing compounds from the cooled reformate stream by contacting the cooled reformate stream with a sulfur removal agent. The method still further includes contacting the cooled reformate stream with a catalyst that converts water and carbon monoxide to carbon dioxide and H.sub.2 in a water-gas-shift zone to produce a final reformate stream in the fuel processor.

Fuel processor and method for generating hydrogen for fuel cells

DOEpatents

Ahmed, Shabbir [Naperville, IL; Lee, Sheldon H. D. [Willowbrook, IL; Carter, John David [Bolingbrook, IL; Krumpelt, Michael [Naperville, IL; Myers, Deborah J [Lisle, IL

2009-07-21

A method of producing a H.sub.2 rich gas stream includes supplying an O.sub.2 rich gas, steam, and fuel to an inner reforming zone of a fuel processor that includes a partial oxidation catalyst and a steam reforming catalyst or a combined partial oxidation and stream reforming catalyst. The method also includes contacting the O.sub.2 rich gas, steam, and fuel with the partial oxidation catalyst and the steam reforming catalyst or the combined partial oxidation and stream reforming catalyst in the inner reforming zone to generate a hot reformate stream. The method still further includes cooling the hot reformate stream in a cooling zone to produce a cooled reformate stream. Additionally, the method includes removing sulfur-containing compounds from the cooled reformate stream by contacting the cooled reformate stream with a sulfur removal agent. The method still further includes contacting the cooled reformate stream with a catalyst that converts water and carbon monoxide to carbon dioxide and H.sub.2 in a water-gas-shift zone to produce a final reformate stream in the fuel processor.

Alcohol-free alkoxide process for containing nuclear waste

DOEpatents

Pope, James M.; Lahoda, Edward J.

1984-01-01

Disclosed is a method of containing nuclear waste. A composition is first prepared of about 25 to about 80%, calculated as SiO.sub.2, of a partially hydrolyzed silicon compound, up to about 30%, calculated as metal oxide, of a partially hydrolyzed aluminum or calcium compound, about 5 to about 20%, calculated as metal oxide, of a partially hydrolyzed boron or calcium compound, about 3 to about 25%, calculated as metal oxide, of a partially hydrolyzed sodium, potassium or lithium compound, an alcohol in a weight ratio to hydrolyzed alkoxide of about 1.5 to about 3% and sufficient water to remove at least 99% of the alcohol as an azeotrope. The azeotrope is boiled off and up to about 40%, based on solids in the product, of the nuclear waste, is mixed into the composition. The mixture is evaporated to about 25 to about 45% solids and is melted and cooled.

Thin film oxygen partial pressure sensor

NASA Technical Reports Server (NTRS)

Wortman, J. J.; Harrison, J. W.; Honbarrier, H. L.; Yen, J.

1972-01-01

The development is described of a laboratory model oxygen partial pressure sensor using a sputtered zinc oxide thin film. The film is operated at about 400 C through the use of a miniature silicon bar. Because of the unique resistance versus temperature relation of the silicon bar, control of the operational temperature is achieved by controlling the resistance. A circuit for accomplishing this is described. The response of sputtered zinc oxide films of various thicknesses to oxygen, nitrogen, argon, carbon dioxide, and water vapor caused a change in the film resistance. Over a large range, film conductance varied approximately as the square root of the oxygen partial pressure. The presence of water vapor in the gas stream caused a shift in the film conductance at a given oxygen partial pressure. A theoretical model is presented to explain the characteristic features of the zinc oxide response to oxygen.

A Comparison of Photocatalytic Oxidation Reactor Performance for Spacecraft Cabin Trace Contaminant Control Applications

NASA Technical Reports Server (NTRS)

Perry, Jay L.; Frederick, Kenneth R.; Scott, Joseph P.; Reinermann, Dana N.

2011-01-01

Photocatalytic oxidation (PCO) is a maturing process technology that shows potential for spacecraft life support system application. Incorporating PCO into a spacecraft cabin atmosphere revitalization system requires an understanding of basic performance, particularly with regard to partial oxidation product production. Four PCO reactor design concepts have been evaluated for their effectiveness for mineralizing key trace volatile organic com-pounds (VOC) typically observed in crewed spacecraft cabin atmospheres. Mineralization efficiency and selectivity for partial oxidation products are compared for the reactor design concepts. The role of PCO in a spacecraft s life support system architecture is discussed.

Fuel cell system for transportation applications

DOEpatents

Kumar, Romesh; Ahmed, Shabbir; Krumpelt, Michael; Myles, Kevin M.

1993-01-01

A propulsion system for a vehicle having pairs of front and rear wheels and a fuel tank. An electrically driven motor having an output shaft operatively connected to at least one of said pair of wheels is connected to a fuel cell having a positive electrode and a negative electrode separated by an electrolyte for producing dc power to operate the motor. A partial oxidation reformer is connected both to the fuel tank and to the fuel cell receives hydrogen-containing fuel from the fuel tank and water and air and for partially oxidizing and reforming the fuel with water and air in the presence of an oxidizing catalyst and a reforming catalyst to produce a hydrogen-containing gas. The hydrogen-containing gas is sent from the partial oxidation reformer to the fuel cell negative electrode while air is transported to the fuel cell positive electrode to produce dc power for operating the electric motor.

Fuel cell system for transportation applications

DOEpatents

Kumar, R.; Ahmed, S.; Krumpelt, M.; Myles, K.M.

1993-09-28

A propulsion system is described for a vehicle having pairs of front and rear wheels and a fuel tank. An electrically driven motor having an output shaft operatively connected to at least one of said pair of wheels is connected to a fuel cell having a positive electrode and a negative electrode separated by an electrolyte for producing dc power to operate the motor. A partial oxidation reformer is connected both to the fuel tank and to the fuel cell and receives hydrogen-containing fuel from the fuel tank and uses water and air for partially oxidizing and reforming the fuel in the presence of an oxidizing catalyst and a reforming catalyst to produce a hydrogen-containing gas. The hydrogen-containing gas is sent from the partial oxidation reformer to the fuel cell negative electrode while air is transported to the fuel cell positive electrode to produce dc power for operating the electric motor. 3 figures.

Enhanced plant growth promoting role of phycomolecules coated zinc oxide nanoparticles with P supplementation in cotton (Gossypium hirsutum L.).

PubMed

Venkatachalam, P; Priyanka, N; Manikandan, K; Ganeshbabu, I; Indiraarulselvi, P; Geetha, N; Muralikrishna, K; Bhattacharya, R C; Tiwari, M; Sharma, N; Sahi, S V

2017-01-01

This report focuses on application of zinc oxide nanoparticles (ZnONPs) carrying phycomolecule ligands as a novel plant growth promoter aimed at increasing the crop productivity. The present investigation examined the effect of ZnONPs on plant growth characteristics, and associated biochemical changes in cotton (Gossypium hirsutum L.) following growth in a range of concentrations (25-200 mg L -l ZnONPs) in combination with 100 mM P in a hydroponic system. Treated plants registered an increase in growth and total biomass by 130.6% and 131%, respectively, over control. Results demonstrated a significant increase in the level of chlorophyll a (141.6%), b (134.7%), carotenoids (138.6%), and total soluble protein contents (179.4%); at the same time, a significant reduction (68%) in the level of malondialdehyde (MDA) in leaves with respect to control. Interestingly, a significant increase in superoxide dismutase (SOD, 264.2%), and peroxidase (POX, 182.8%) enzyme activities followed by a decrease in the catalase (CAT) activity, in response to above treatments. These results suggest that bioengineered ZnONPs interact with meristematic cells triggering biochemical pathways conducive to an accumulation of biomass. Further investigations will map out the mode of action involved in growth promotion. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

A Model for the Oxidation of C/SiC Composite Structures

NASA Technical Reports Server (NTRS)

Sullivan, Roy M.

2003-01-01

A mathematical theory and an accompanying numerical scheme have been developed for predicting the oxidation behavior of C/SiC composite structures. The theory is derived from the mechanics of the flow of ideal gases through a porous solid. Within the mathematical formulation, two diffusion mechanisms are possible: (1) the relative diffusion of one species with respect to the mixture, which is concentration gradient driven and (2) the diffusion associated with the average velocity of the gas mixture, which is total gas pressure gradient driven. The result of the theoretical formulation is a set of two coupled nonlinear differential equations written in terms of the oxidant and oxide partial pressures. The differential equations must be solved simultaneously to obtain the partial vapor pressures of the oxidant and oxides as a function of space and time. The local rate of carbon oxidation is determined as a function of space and time using the map of the local oxidant partial vapor pressure along with the Arrhenius rate equation. The nonlinear differential equations are cast into matrix equations by applying the Bubnov-Galerkin weighted residual method, allowing for the solution of the differential equations numerically. The end result is a numerical scheme capable of determining the variation of the local carbon oxidation rates as a function of space and time for any arbitrary C/SiC composite structures.

Partial oxidation catalyst

DOEpatents

Krumpelt, Michael; Ahmed, Shabbir; Kumar, Romesh; Doshi, Rajiv

2000-01-01

A two-part catalyst comprising a dehydrogenation portion and an oxide-ion conducting portion. The dehydrogenation portion is a group VIII metal and the oxide-ion conducting portion is selected from a ceramic oxide crystallizing in the fluorite or perovskite structure. There is also disclosed a method of forming a hydrogen rich gas from a source of hydrocarbon fuel in which the hydrocarbon fuel contacts a two-part catalyst comprising a dehydrogenation portion and an oxide-ion conducting portion at a temperature not less than about 400.degree. C. for a time sufficient to generate the hydrogen rich gas while maintaining CO content less than about 5 volume percent. There is also disclosed a method of forming partially oxidized hydrocarbons from ethanes in which ethane gas contacts a two-part catalyst comprising a dehydrogenation portion and an oxide-ion conducting portion for a time and at a temperature sufficient to form an oxide.

Thin film devices used as oxygen partial pressure sensors

NASA Technical Reports Server (NTRS)

Canady, K. S.; Wortman, J. J.

1970-01-01

Electrical conductivity of zinc oxide films to be used in an oxygen partial pressure sensor is measured as a function of temperature, oxygen partial pressure, and other atmospheric constituents. Time response following partial pressure changes is studied as a function of temperature and environmental changes.

Nitrous oxide emissions from one-step partial nitritation/anammox processes.

PubMed

Yang, Jingjing; Trela, Jozef; Plaza, Elzbieta

2016-12-01

Measurements of nitrous oxide were made at pilot- and full-scale plants to evaluate greenhouse gas emissions from one-step partial nitritation/anammox processes applied in moving bed biofilm reactors treating reject water. It was found that 0.51-1.29% and 0.35-1.33% of the total nitrogen loads in the pilot- and full-scale reactor, respectively, were emitted as nitrous oxide. Between 80 and 90% of nitrous oxide emissions were in gaseous form and the rest amount was found in the reactor effluent; over 90% of nitrous oxide emissions occurred in the aerated period and less than 8% in the non-aerated period in the full-scale study. Nitrous oxide productions/consumptions were closely related to aeration and the nitrogen loads applied in the system.

Two stage catalytic combustor

NASA Technical Reports Server (NTRS)

Alvin, Mary Anne (Inventor); Bachovchin, Dennis (Inventor); Smeltzer, Eugene E. (Inventor); Lippert, Thomas E. (Inventor); Bruck, Gerald J. (Inventor)

2010-01-01

A catalytic combustor (14) includes a first catalytic stage (30), a second catalytic stage (40), and an oxidation completion stage (49). The first catalytic stage receives an oxidizer (e.g., 20) and a fuel (26) and discharges a partially oxidized fuel/oxidizer mixture (36). The second catalytic stage receives the partially oxidized fuel/oxidizer mixture and further oxidizes the mixture. The second catalytic stage may include a passageway (47) for conducting a bypass portion (46) of the mixture past a catalyst (e.g., 41) disposed therein. The second catalytic stage may have an outlet temperature elevated sufficiently to complete oxidation of the mixture without using a separate ignition source. The oxidation completion stage is disposed downstream of the second catalytic stage and may recombine the bypass portion with a catalyst exposed portion (48) of the mixture and complete oxidation of the mixture. The second catalytic stage may also include a reticulated foam support (50), a honeycomb support, a tube support or a plate support.

Analysis of effect of flameholder characteristics on lean, premixed, partially vaporized fuel-air mixtures quality and nitrogen oxides emissions

NASA Technical Reports Server (NTRS)

Cooper, L. P.

1981-01-01

An analysis was conducted of the effect of flameholding devices on the precombustion fuel-air characteristics and on oxides of nitrogen (NOx) emissions for combustion of premixed partially vaporized mixtures. The analysis includes the interrelationships of flameholder droplet collection efficiency, reatomization efficiency and blockage, and the initial droplet size distribution and accounts for the contribution of droplet combustion in partially vaporized mixtures to NOx emissions. Application of the analytical procedures is illustrated and parametric predictions of NOx emissions are presented.

Enzymatic and non-enzymatic comparison of two different industrial tomato (Solanum lycopersicum) varieties against drought stress.

PubMed

Çelik, Özge; Ayan, Alp; Atak, Çimen

2017-12-01

The aim of this study is to compare the tolerance mechanisms of two industrial tomato varieties (X5671R and 5MX12956) under drought stress. 14 days-old tomato seedlings were subjected to 7 days-long drought stress by withholding irrigation. The effects of stress were determined by enzymatic and non-enzymatic parameters. The physiological damages were evaluated via lipid peroxidation ratio, total protein content, relative water content, chlorophyll content and proline accumulation. Enzymatic responses were determined by biochemical analysis and electrophoresis of SOD, APX, POX and CAT enzymes. Relative water contents of X5671R and 5MX12956 varieties at 7th day of drought were decreased to 8.4 and 12.2%, respectively. Applied drought decreased all photosynthetic pigments of X5671R and 5MX12956 varieties during the treatment period significantly comparing to the Day 0 as the control. Total protein content, lipid peroxidation and proline accumulation presented increased values in both varieties in accordance with the increasing stress intensity. According to lipid peroxidation analysis, 5MX12956 tomato variety was found more drought sensitive than X5671R variety. Antioxidative enzyme activities showed increases in both varieties as a response to drought stress, although CAT and APX activities presented decrease on the 7th day of applied stress. 7 days long drought stress differentially altered POX, APX and SOD isozyme patterns. Same POX bands were observed in both varieties with different band intensities. However, main isozyme pattern differences were obtained for SOD and APX. APX1, Fe-SOD and Cu/Zn-SOD2 isozyme bands should be evaluated to define their main role in the tolerance mechanism of both tomato varieties.

Properties of Low-mass AGN as They Relate to Unification and Massive AGN

NASA Astrophysics Data System (ADS)

Hood, Carol E.

2011-01-01

Current unification models of AGN suggest the observational differences between Type 1 and Type 2 objects are solely due to the orientation angle of the object. Observations have proved consistent with predictions and continue to strengthen the case for unification, however, many are still searching for "true" Type 2 objects, including predictions of their formation due to low luminosity or low accretion rate. Low-mass (< 106solar masses) AGN provide interesting environments in which these unification models can be studied. We also aim to compare the properties of low-mass AGN with their more massive counterparts to look for structural similarities and differences over a more substantial range of luminosities and accretion rates than previously studied. We present an in-depth multi-wavelength study of one of the prototypical low-mass AGN, POX 52, investigating the properties of the central engine along with that of the host galaxy. This includes data from the VLA, Spitzer, 2MASS, HST, GALEX, XMM, and Chandra, providing us with one of the most comprehensive looks into low-mass AGN. Unlike the other prototypical low-mass AGN, NGC 4395, POX 52 resides in a dwarf elliptical galaxy, accreting at ≈ 0.35 the Eddington limit. Additionally, we examine a sample 41 Type 1 and Type 2 objects, including POX 52 and NGC 4395, with the Spitzer IRS and a sub-sample of those with XMM to study the absorption properties of low-mass AGN, to test the validity of unification models in the low-mass regime, and to investigate possible structural differences between objects with low and high mass black holes and accretion rates. We will discuss the IR spectral shape and present emission-line diagnostics for Type 1 and Type 2 AGNs at low masses.

Pock forming ability of fowl pox virus isolated from layer chicken and its adaptation in chicken embryo fibroblast cell culture

PubMed Central

Gilhare, Varsha Rani; Hirpurkar, S. D.; Kumar, Ashish; Naik, Surendra Kumar; Sahu, Tarini

2015-01-01

Aim: The objective of the present study was to examine pock forming ability of field strain and vaccine strain of fowl pox virus (FPV) in chorioallantoic membrane (CAM) of embryonated chicken eggs and its adaptation in chicken embryo fibroblast (CEF) cell culture. Materials and Methods: Dry scabs were collected from 25 affected birds in glycerin-saline and preserved at 4°C until processed. Virus was isolated in 10-day-old embryonated chicken eggs by dropped CAM method. The identity of the virus is confirmed by clinical findings of affected birds, pock morphology and histopathology of infected CAM. In addition one field isolate and vaccine strain of FPV was adapted to CEF cell culture. CEF cell culture was prepared from 9-day-old embryonated chicken eggs. Result: Clinical symptoms observed in affected birds include pox lesion on comb, wattle, eyelids and legs, no internal lesions were observed. All field isolates produced similar findings in CAM. Pocks produced by field isolates ranged from 3 mm to 5 mm at the third passage while initial passages edematous thickening and necrosis of CAM was observed. Pocks formed by lyophilized strain were ranges from 0.5 mm to 2.5 mm in diameter scattered all over the membrane at the first passage. Intra-cytoplasmic inclusion bodies are found on histopathology of CAM. At third passage level, the CEF inoculated with FPV showed characteristic cytopathic effect (CPE) included aggregation of cells, syncytia and plaque formation. Conclusion: FPV field isolates and vaccine strain produced distinct pock lesions on CAMs. Infected CAM showed intracytoplasmic inclusion bodies. The CEF inoculated with FPV field isolate as well as a vaccine strain showed characteristic CPE at third passage level. PMID:27047081

Pock forming ability of fowl pox virus isolated from layer chicken and its adaptation in chicken embryo fibroblast cell culture.

PubMed

Gilhare, Varsha Rani; Hirpurkar, S D; Kumar, Ashish; Naik, Surendra Kumar; Sahu, Tarini

2015-03-01

The objective of the present study was to examine pock forming ability of field strain and vaccine strain of fowl pox virus (FPV) in chorioallantoic membrane (CAM) of embryonated chicken eggs and its adaptation in chicken embryo fibroblast (CEF) cell culture. Dry scabs were collected from 25 affected birds in glycerin-saline and preserved at 4°C until processed. Virus was isolated in 10-day-old embryonated chicken eggs by dropped CAM method. The identity of the virus is confirmed by clinical findings of affected birds, pock morphology and histopathology of infected CAM. In addition one field isolate and vaccine strain of FPV was adapted to CEF cell culture. CEF cell culture was prepared from 9-day-old embryonated chicken eggs. Clinical symptoms observed in affected birds include pox lesion on comb, wattle, eyelids and legs, no internal lesions were observed. All field isolates produced similar findings in CAM. Pocks produced by field isolates ranged from 3 mm to 5 mm at the third passage while initial passages edematous thickening and necrosis of CAM was observed. Pocks formed by lyophilized strain were ranges from 0.5 mm to 2.5 mm in diameter scattered all over the membrane at the first passage. Intra-cytoplasmic inclusion bodies are found on histopathology of CAM. At third passage level, the CEF inoculated with FPV showed characteristic cytopathic effect (CPE) included aggregation of cells, syncytia and plaque formation. FPV field isolates and vaccine strain produced distinct pock lesions on CAMs. Infected CAM showed intracytoplasmic inclusion bodies. The CEF inoculated with FPV field isolate as well as a vaccine strain showed characteristic CPE at third passage level.

Assessment and comparison of the pathogenicity of Sheeppox Virus strains isolated in Morocco

PubMed Central

Hajjou, Saida; Khataby, Khadija; Amghar, Souad; El Fahime, Mustapha; El Harrak, Mehdi; Fakiri, Malika; Loutfi, Chafiqa

2017-01-01

Background and Objectives: Sheeppox virus causes systemic disease in sheep that is often associated with high morbidity and mortality. Protection against sheep pox is mainly based on medical prophylaxis, vaccination being the only way. In Morocco, and up to now, there is no available information about local challenge strain to use for controlling the efficiency of vaccines produced against sheep pox. Hence, the objective of the present study was to evaluate and compare the pathogenicity of seven Sheeppox virus (SPVs) isolates from 1993–1995 in Morocco. Materials and Methods: These seven SPV isolates have undergone various tests to evaluate their pathogenicity: Passages and titration on cell culture, Experimental inoculation on sheep, Virus-neutralization, In vivo titration and viral re-isolation by real-time PCR assay. Results: All infected lambs showed severe clinical signs, while most of them have been reproduced on 5 dpi and persisted until 21 dpi. The lambs infected by Oj1P4, Oj2P4 and BerP5 appeared lethargic, reluctant to move compared to those infected by other isolates. The results also revealed that all isolates were able to induce serological response. Virus isolation from infected organs and blood and amplification of the viral DNA by real-time PCR proved the presence of the virus in tissues and blood of infected lambs. These Moroccan SPVs demonstrated that the three isolates Oj1P4, Oj2P4 and BerP5 have a high pathogenicity; especially the BerP5 isolate which has an important infectious titer. Conclusion: These results demonstrate that the Berkane isolate is the most pathogenic of the tested isolates and it can be an excellent challenge strain for the control of the efficiency of vaccines against sheep pox produced in Morocco. PMID:29487736

Effects of Recurring Droughts on Extracellular Enzyme Activity in Mountain Grassland

NASA Astrophysics Data System (ADS)

Fuchslueger, L.; Bahn, M.; Kienzl, S.; Hofhansl, F.; Schnecker, J.; Richter, A.

2015-12-01

Water availability is a key factor for biogeochemical processes and determines microbial activity and functioning, and thereby organic matter decomposition in soils by affecting the osmotic potential, soil pore connectivity, substrate diffusion and nutrient availability. Low water availability during drought periods therefore directly affects microbial activity. Recurring drought periods likely induce shifts in microbial structure that might be reflected in altered responses of microbial turnover of organic matter by extracellular enzymes. To study this we measured a set of potential extracellular enzyme activity rates (cellobiohydrolase CBH; leucine-amino-peptidase LAP; phosphatase PHOS; phenoloxidase POX), in grassland soils that were exposed to extreme experimental droughts during the growing seasons of up to five subsequent years. During the first drought period after eight weeks of rain exclusion all measured potential enzyme activities were significantly decreased. In parallel, soil extractable organic carbon and nitrogen concentrations increased and microbial community structure, determined by phospholipid fatty acid analysis, changed. In soils that were exposed to two and three drought periods only PHOS decreased. After four years of drought again CBH, PHOS and POX decreased, while LAP was unaffected; after five years of drought PHOS and POX decreased and CBH and LAP remained stable. Thus, our results suggest that recurring extreme drought events can cause different responses of extracellular enzyme activities and that the responses change over time. We will discuss whether and to what degree these changes were related to shifts in microbial community composition. However, independent of whether a solitary or a recurrent drought was imposed, in cases when enzyme activity rates were altered during drought, they quickly recovered after rewetting. Overall, our data suggest that microbial functioning in mountain grassland is sensitive to drought, but highly resilient even after five years of drought.

Tuning the light emission of novel donor-acceptor phenoxazine dye-based materials towards the red spectral range

NASA Astrophysics Data System (ADS)

Damaceanu, Mariana-Dana; Constantin, Catalin-Paul

2018-04-01

A novel red fluorescent push-pull system able to generate an intramolecular charge-transfer (ICT) complex was synthesized. The novel dye (R-POX) combines some structural features which are rarely encountered in the design of other push-pull systems: hexyl-substituted phenoxazine as donor moiety, divinylketone as π-linker, and p-fluorobenzene as electron acceptor group. The relationship between the structural motif, photo-physical and electrochemical properties by UV-Vis absorption, photoluminescence and cyclic voltammetry was thoroughly investigated both as red dopant in poly(methylmethacrylate) (PMMA) or polyimide (PI) matrix, and non-doped host emitter. The molecular rigid cores of the synthesized dye formed supramolecular rod-like structures in condensed phase with a strong impact on the emissive centers. The aggregation was totally suppressed when the dye was used as dopant in an amorphous polymeric matrix, such as PMMA or PI. Electrochemical measurements revealed the dye ability for both hole and electron injection and transport. The fluorescence emission was found to be highly sensitive to solvent polarity, rendering blue-green, yellow, orange and red light emission in different organic solvents. The absolute fluorescence quantum yield reached 39.57% in solution, and dropped to 1.2% in solid state and to 14.01% when the dye was used as dopant in PMMA matrix. According to the available CIE 1931 standard, R-POX emitted pure and saturated red light of single wavelength with chromaticity coordinates very close to those of National Television System Committee (NTSC) standard red colour. The R-POX photo-optical features were compared to those of the commercial red emitter 6, 13-diphenylpentacene.

Enhanced Electro-Kinetics of C-C Bond-Splitting during Ethanol Oxidation Reaction using Pt/Rh/Sn Catalyst with a Partially Oxidized Pt and Rh Core and a SnO2 Shell

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, G.; Su, D.; Frenkel, A. I.

Direct ethanol fuel cell (DEFC) is a promising technology for generating electricity via the electro-oxidation of liquid ethanol. Its implementation requires the development of anode catalysts capable of producing CO 2 and yielding 12-electron transfer through breaking C-C bond of ethanol. Here we presented comprehensive studies of electro-kinetics of the CO 2 generation on Pt/Rh/Sn ternary catalysts. Our studies showed that, for the first time, the tri–phase PtRhOx- SnO 2 catalysts with a partially oxidized Pt and Rh core and a SnO 2 shell, validated by X-ray absorption analyses and scanning transmission electron microscope-electron energy loss spectroscopy line scan, coincidedmore » with a 2.5-fold increase in the CO 2 generation rate towards ethanol oxidation reaction, compared with the bi-phase PtRh-SnO 2 catalysts with a metallic PtRh alloy core and commercial Pt. These studies provided insight on the design of a new genre of electro-catalysts with a partially oxidized noble metal.« less

Oxidation of SiC Fiber-Reinforced SiC Matrix Composites with a BN Interphase

NASA Technical Reports Server (NTRS)

Opila, Elizabeth; Boyd, Meredith K.

2010-01-01

SiC-fiber reinforced SiC matrix composites with a BN interphase were oxidized in reduced oxygen partial pressures of oxygen to simulate the environment for hypersonic vehicle leading edge applications. The constituent fibers as well as composite coupons were oxidized in oxygen partial pressures ranging from 1000 ppm O2 to 5% O2 balance argon. Exposure temperatures ranged from 816 C to 1353 C (1500 F to 2450 F). The oxidation kinetics of the coated fibers were monitored by thermogravimetric analysis (TGA). An initial rapid transient weight gain was observed followed by parabolic kinetics. Possible mechanisms for the transient oxidation are discussed. One edge of the composite coupon seal coat was ground off to simulate damage to the composite which allowed oxygen ingress to the interior of the composite. Oxidation kinetics of the coupons were characterized by scanning electron microscopy since the weight changes were minimal. It was found that sealing of the coupon edge by silica formation occurred. Differences in the amount and morphology of the sealing silica as a function of time, temperature and oxygen partial pressure are discussed. Implications for use of these materials for hypersonic vehicle leading edge materials are summarized.

Enhanced Electro-Kinetics of C-C Bond-Splitting during Ethanol Oxidation Reaction using Pt/Rh/Sn Catalyst with a Partially Oxidized Pt and Rh Core and a SnO2 Shell

DOE PAGES

Yang, G.; Su, D.; Frenkel, A. I.; ...

2016-09-04

Direct ethanol fuel cell (DEFC) is a promising technology for generating electricity via the electro-oxidation of liquid ethanol. Its implementation requires the development of anode catalysts capable of producing CO 2 and yielding 12-electron transfer through breaking C-C bond of ethanol. Here we presented comprehensive studies of electro-kinetics of the CO 2 generation on Pt/Rh/Sn ternary catalysts. Our studies showed that, for the first time, the tri–phase PtRhOx- SnO 2 catalysts with a partially oxidized Pt and Rh core and a SnO 2 shell, validated by X-ray absorption analyses and scanning transmission electron microscope-electron energy loss spectroscopy line scan, coincidedmore » with a 2.5-fold increase in the CO 2 generation rate towards ethanol oxidation reaction, compared with the bi-phase PtRh-SnO 2 catalysts with a metallic PtRh alloy core and commercial Pt. These studies provided insight on the design of a new genre of electro-catalysts with a partially oxidized noble metal.« less

Transformations of C2-C4 alcohols on the surface of a copper catalyst

NASA Astrophysics Data System (ADS)

Magaeva, A. A.; Lyamina, G. V.; Sudakova, N. N.; Shilyaeva, L. P.; Vodyankina, O. V.

2007-10-01

The interaction of monoatomic alcohols C2-C4 with the surface of a copper catalyst preliminarily oxidized under various conditions was studied by the temperature-programmed reaction method to determine the detailed mechanism of partial oxidation. The conditions of oxygen preadsorption on the surface of copper for the preparation of the desired products were determined. The selective formation of carbonyl compounds was shown to occur at the boundary between reduced and oxidized copper surface regions. The role played by Cu2O was the deep oxidation of alcohols to CO2. Alcohols with branched hydrocarbon structures experienced parallel partial oxidation and dehydrogenation, which was related to the high stability of intermediate keto-type compounds.

Electrochemical components employing polysiloxane-derived binders

DOEpatents

Delnick, Frank M.

2013-06-11

A processed polysiloxane resin binder for use in electrochemical components and the method for fabricating components with the binder. The binder comprises processed polysiloxane resin that is partially oxidized and retains some of its methyl groups following partial oxidation. The binder is suitable for use in electrodes of various types, separators in electrochemical devices, primary lithium batteries, electrolytic capacitors, electrochemical capacitors, fuel cells and sensors.

Catalytic performance of V2O5-MoO3/γ-Al2O3 catalysts for partial oxidation of n-hexane1

NASA Astrophysics Data System (ADS)

Mahmoudian, R.; Khodadadi, Z.; Mahdavi, Vahid; Salehi, Mohammed

2016-01-01

In the current study, a series of V2O5-MoO3 catalyst supported on γ-Al2O3 with various V2O5 and MoO3 loadings was prepared by wet impregnation technique. The characterization of prepared catalysts includes BET surface area, powder X-ray diffraction (XRD), and oxygen chemisorptions. The partial oxidation of n-hexane by air over V2O5-MoO3/γ-Al2O3 catalysts was carried out under flow condition in a fixed bed glass reactor. The effect of V2O5 loading, temperature, MoO3 loading, and n-hexane LHSV on the n-hexane conversion and the product selectivity were investigated. The partial oxygenated products of n-hexane oxidation were ethanol, acetic anhydride, acetic acid, and acetaldehyde. The 10% V2O5-1%MoO3/γ-Al2O3 was found in most active and selective catalyst during partial oxidation of n-hexane. The results indicated that by increasing the temperature, the n-hexane conversion increases as well, although the selectivity of the products passes through a maximum by increasing the temperature.

Early diagenetic partial oxidation of organic matter and sulfides in the Middle Pennsylvanian (Desmoinesian) Excello Shale Member of the Fort Scott Limestone and equivalents, northern Midcontinent region, USA

USGS Publications Warehouse

Hatch, J.R.; Leventhal, M.S.

1997-01-01

A process of early diagenetic partial oxidation of organic matter and sulfides has altered the chemical composition of the Middle Pennsylvanian Excello Shale Member of the Fort Scott Limestone and equivalents in the northern Midcontinent region. This process was identified by comparison of organic carbon contents, Rock-Eval hydrogen indices, organic carbon ??13C and element compositions of core and surface mine samples of the Excello Shale Member with analyses of three other underlying and overlying organic-matter-rich marine shales (offshore shale lithofacies) from southern Iowa, northern Missouri, eastern Kansas and northeastern Oklahoma. The end product of the partial oxidation process is shale with relatively low contents of hydrogen-poor, C13-enriched organic matter, lower contents of sulfur and sulfide-forming elements, and relatively unchanged contents of phosphorus and many trace elements (e.g. Cr, Ni, and V). However, because of lower organic carbon contents, element/organic carbon ratios are greatly increased. The partial oxidation process apparently took place during subaerial exposure of the overlying marine carbonate member (Blackjack Creek Member of the Fort Scott Limestone) following a marine regression when meteoric waters percolated down to the level of the Excello muds allowing oxidation of organic matter and sulfides. This hypothesis is supported by earlier workers, who have identified meteoric carbonate cements within, and soil horizons at the top of the Blackjack Creek Member. The period of oxidation is constrained in that organic matter and sulfides in the Little Osage Shale Member of the Fort Scott Limestone and equivalents (immediately overlying the Blackjack Creek Member) appear unaltered. Similar alteration of other shales in the Middle and Upper Pennsylvanian sections may be local to regional in extent and would depend on the extent and duration of the marine regression and be influenced by local variations in permeability and topography. The partial oxidation process has likely led to a redistribution of sulfur and sulfide-forming elements into other organic-rich lithologies in the section. The altered/oxidized shales are nongenerative with respect to hydrocarbon generation.

Thesaurus of DDC Descriptors

DTIC Science & Technology

1966-06-01

BIRDS BLASTOMYCES BLATTIDAE BOVINES CANDIDA CANNABIS CARNIVORA CATS CEPHALOPODA CEREALS CETACEA CHICKENS CHILDREN CHIMPANZEES CHLORELLA...POLIOMYELITIS VIRUS POX VIRUSES PROTEUS PROTEUS VULGAR1S PROTOZOA PSEUOOMONADACEAE PSEUUOMONADALES PSEUDOMONAS PSEUDOMONAS AEROGINOSA RABIES VIRUS...ISLANUS MARYLAND MASSACHUSETTS MASSACHUSETTS BAY MEDITERRANEAN SEA MEDITERRANEAN SEA ISLANDS MELANESIA MEXICO MEXICO GULF MICHIGAN MICRONESIA

Grand Bay-Banks Lake Stewardship Partnership - Phase 2

DTIC Science & Technology

2006-11-01

including smallpox, measles, typhus, tuberculosis, chicken pox and influenza, any of which could prove fatal. When the southeastern Indians were hit...Gulf of Mexico coastal plain within southeast Mississippi, Alabama, and southwest Georgia where they are called "Grady Ponds" because of the Grady

21 CFR 866.3900 - Varicella-zoster virus serological reagents.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Varicella-zoster virus serological reagents. 866... Varicella-zoster virus serological reagents. (a) Identification. Varicella-zoster virus serological reagents... viruses and provides epidemiological information on these diseases. Varicella (chicken pox) is a mild...

21 CFR 866.3900 - Varicella-zoster virus serological reagents.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Varicella-zoster virus serological reagents. 866... Varicella-zoster virus serological reagents. (a) Identification. Varicella-zoster virus serological reagents... viruses and provides epidemiological information on these diseases. Varicella (chicken pox) is a mild...

21 CFR 866.3900 - Varicella-zoster virus serological reagents.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Varicella-zoster virus serological reagents. 866... Varicella-zoster virus serological reagents. (a) Identification. Varicella-zoster virus serological reagents... viruses and provides epidemiological information on these diseases. Varicella (chicken pox) is a mild...

21 CFR 866.3900 - Varicella-zoster virus serological reagents.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Varicella-zoster virus serological reagents. 866... Varicella-zoster virus serological reagents. (a) Identification. Varicella-zoster virus serological reagents... viruses and provides epidemiological information on these diseases. Varicella (chicken pox) is a mild...

21 CFR 866.3900 - Varicella-zoster virus serological reagents.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Varicella-zoster virus serological reagents. 866... Varicella-zoster virus serological reagents. (a) Identification. Varicella-zoster virus serological reagents... viruses and provides epidemiological information on these diseases. Varicella (chicken pox) is a mild...

7 CFR 301.74-1 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 5 2010-01-01 2010-01-01 false Definitions. 301.74-1 Section 301.74-1 Agriculture..., DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Plum Pox § 301.74-1 Definitions. The following definitions apply to this subpart. Administrator. The Administrator, Animal and Plant Health Inspection...

Concurrent Fowlpox and Candidiasis Diseases in Backyard Chickens with Unusual Pox Lesions in the Bursa of Fabricius.

PubMed

Ogasawara, Fusae; Yamamoto, Yu; Sato, Yasuo; Fukunari, Kazuhiro; Murata, Ken-Ichi; Yaegashi, Gakuji; Goto, Makiko; Murakami, Ryukoh

2016-09-01

Concurrent fowlpox and candidiasis diseases occurred in a backyard chicken flock. Four deceased chickens (one Nagoya breed and three white silkie chickens) were examined for diagnosis. At necropsy, white curd-like plaques were observed in the crop. Fungal elements that stained positive for Candida albicans with immunohistochemistry were distributed throughout the tongue, choanal mucosa, esophagus, and crop. Typical fowlpox lesions, composed of proliferating epithelial cells with ballooning degeneration and viral intracytoplasmic inclusions, were observed in the conjunctiva, nasal mucosa, and skin around the cloaca. Interestingly, hyperplastic interfollicular epithelium with rare virus inclusions was observed in the bursa of Fabricius (BF). Some bursal follicles were replaced by proliferating epithelial cells. These proliferating cells immunohistochemically stained positive for cytokeratin. PCR and subsequent genetic sequencing detected the C. albicans gene in the crop, and fowlpox virus genes in the BF. These results indicate that this outbreak was a rare presentation of fowlpox in spontaneously infected chickens, with unusual pox lesions in the BF.

Going Out on a Limb: Do Not Delay Diagnosis of Necrotizing Fasciitis in Varicella Infection.

PubMed

Sturgeon, Jonathan P; Segal, Laura; Verma, Anita

2015-07-01

Necrotizing fasciitis (NF) is a rare complication of varicella zoster (chicken pox) infection. Its diagnosis can be delayed or missed, which increases mortality and morbidity, because it initially presents similarly to cellulitis. We present the case of a 5-year-old boy who presented with a swollen leg, the difficulties in the diagnosis of NF, and a review of the literature. Necrotizing fasciitis complicating varicella zoster in children is associated with 3.4% mortality, although this rises to 13.6% in streptococcal toxic shock syndrome. Seventy-one percent of cases are confirmed as being caused by group A β-hemolytic Streptococcus. The association of NF with chicken pox is discussed along with the difficulties in diagnosis and treatment options. Necrotizing fasciitis is a surgical emergency and should be considered by all emergency department acute care practitioners in cases of varicella in which fever is enduring and swelling or pain is disproportionate. Because of the difficulty in diagnosis, senior opinion should be sought early.

Identification of Immunogenic Hot Spots within Plum Pox Potyvirus Capsid Protein for Efficient Antigen Presentation

PubMed Central

Fernández-Fernández, M. Rosario; Martínez-Torrecuadrada, Jorge L.; Roncal, Fernando; Domínguez, Elvira; García, Juan Antonio

2002-01-01

PEPSCAN analysis has been used to characterize the immunogenic regions of the capsid protein (CP) in virions of plum pox potyvirus (PPV). In addition to the well-known highly immunogenic N- and C-terminal domains of CP, regions within the core domain of the protein have also shown high immunogenicity. Moreover, the N terminus of CP is not homogeneously immunogenic, alternatively showing regions frequently recognized by antibodies and others that are not recognized at all. These results have helped us to design efficient antigen presentation vectors based on PPV. As predicted by PEPSCAN analysis, a small displacement of the insertion site in a previously constructed vector, PPV-γ, turned the derived chimeras into efficient immunogens. Vectors expressing foreign peptides at different positions within a highly immunogenic region (amino acids 43 to 52) in the N-terminal domain of CP were the most effective at inducing specific antibody responses against the foreign sequence. PMID:12438590

Differentially expressed genes in healthy and plum pox virus-infected Nicotiana benthamiana plants.

PubMed

Vozárová, Z; Žilová, M; Šubr, Z

2015-12-01

Viruses use both material and energy sources of their hosts and redirect the production of disposable compounds in order to make viral replication more efficient. Metabolism of infected organisms is modified by these enhanced requirements as well by their own defense response. Resulting complex story consists of many regulation events on various gene expression levels. Elucidating these processes may contribute to the knowledge on virus-host interactions and to evolving new antiviral strategies. In our work we applied a subtractive cloning technique to compare the transcriptomes of healthy and plum pox virus (PPV)-infected Nicotiana benthamiana plants. Several genes were found to be induced or repressed by the PPV infection. The induced genes were mainly related to general stress response or photosynthesis, several repressed genes could be connected with growth defects evoked by the infection. Interestingly, some genes usually up-regulated by fungal or bacterial infection were found repressed in PPV-infected plants. Potential involvement of particular differently expressed genes in the process of PPV infection is discussed.

An intermediate-mass black hole in the darf galaxy Pox 52

NASA Astrophysics Data System (ADS)

Barth, Aaron

2005-01-01

Do dwarf elliptical and dwarf spiral galaxies contain central black holes with masses below 106 solar masses? Beyond the Local Group dynamical searches for black holes in this mass range are very difficult but the detection of accretion-powered nuclear activity could be used to infer the presence of a black hole. The nearby dwarf spiral galaxy NGC 4395 hosts a faint Seyfert 1 nucleus with a likely black hole mass in the range 104-105 solar masses and for more than a decade it has been the only known example of a Seyfert 1 nucleus in a dwarf galaxy. I will present new Keck spectra of the dwarf galaxy POX 52 which demonstrate that it has a Seyfert 1 spectrum nearly identical to that of NGC 4395. Its velocity dispersion is 37 km/s suggesting a possible black hole mass of order 105 solar masses. I will discuss the prospects for systematic searches for nuclear activity in dwarf galaxies and the implications for black hole demographics.

New highly divergent Plum pox virus isolates infecting sour cherry in Russia.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna; Zakubanskiy, Alexander; Osipov, Gennady

2017-02-01

Unusual Plum pox virus (PPV) isolates (named Tat isolates) were discovered on sour cherry (Prunus cerasus) in Russia. They failed to be recognized by RT-PCR using commonly employed primers specific to the strains C or CR (the only ones that proved able to infect sour cherry) as well as to the strains M and W. Some of them can be detected by RT-PCR using the PPV-D-specific primers P1/PD or by TAS-ELISA with the PPV-C-specific monoclonal antibody AC. Phylogenetic analysis of the 3'-terminal genomic region assigned the Tat isolates into the cluster of cherry-adapted strains. However, they grouped separately from the C and CR strains and from each other as well. The sequence divergence of the Tat isolates is comparable to the differences between the known PPV strains. They may represent new group(s) of cherry-adapted isolates which do not seem to belong to any known strain of the virus. Copyright © 2016. Published by Elsevier Inc.

An Intermediate-Mass Black Hole in the Dwarf Galaxy Pox 52

NASA Astrophysics Data System (ADS)

Barth, Aaron

Do dwarf elliptical and dwarf spiral galaxies contain central black holes with masses below 106 solar masses? Beyond the Local Group dynamical searches for black holes in this mass range are very difficult but the detection of accretion-powered nuclear activity could be used to infer the presence of a black hole. The nearby dwarf spiral galaxy NGC 4395 hosts a faint Seyfert 1 nucleus with a likely black hole mass in the range 104-105 solar masses and for more than a decade it has been the only known example of a Seyfert 1 nucleus in a dwarf galaxy. I will present new Keck spectra of the dwarf galaxy POX 52 which demonstrate that it has a Seyfert 1 spectrum nearly identical to that of NGC 4395. Its velocity dispersion is 37 km/s suggesting a possible black hole mass of order 105 solar masses. I will discuss the prospects for systematic searches for nuclear activity in dwarf galaxies and the implications for black hole demographics.

Tracking the potyviral P1 protein in Nicotiana benthamiana plants during plum pox virus infection.

PubMed

Vozárová, Z; Glasa, M; Šubr, Z W

The P1 protein is derived from the N terminus of potyvirus-coded polyprotein. In addition to the proteolytic activity essential for its maturation, it probably participates in suppression of host defense and/or in virus replication. Clear validation of the P1 in vivo function(s), however, is not yet available. We applied an infectious cDNA clone of plum pox virus (PPV), where the P1 was N-fused with a hexahistidine tag, to trace this protein in Nicotiana benthamiana plants during the PPV infection. Immunoblot analysis with the anti-his antibody showed a diffuse band corresponding to the molecular weight about 70-80 kDa (about twice larger than expected) in the root samples from early stage of infection. This signal culminated on the sixth day post inoculation, later it rapidly disappeared. Sample denaturation by boiling in SDS before centrifugal clarification was essential, indicating strong affinity of P1-his to some plant compound sedimenting with the tissue and cell debris.

Revisiting Jenner's mysteries, the role of the Beaugency lymph in the evolutionary path of ancient smallpox vaccines.

PubMed

Damaso, Clarissa R

2018-02-01

In 1796, Edward Jenner developed the smallpox vaccine consisting of pustular material obtained from lesions on cows affected by so-called cow-pox. The disease, caused by cowpox virus, confers crossprotection against smallpox. However, historical evidence suggests that Jenner might have used vaccinia virus or even horsepox virus instead of cowpox virus. Mysteries surrounding the origin and nature of the smallpox vaccine persisted during the 19th century, a period of intense exchange of vaccine strains, including the Beaugency lymph. This lymph was obtained from spontaneous cases of cow-pox in France in 1866 and then distributed worldwide. A detailed Historical Review of the distribution of the Beaugency lymph supports recent genetic analyses of extant vaccine strains, suggesting the lymph was probably a vaccinia strain or a horsepox-like virus. This Review is a historical investigation that revisits the mysteries of the smallpox vaccine and reveals an intricate evolutionary relationship of extant vaccinia strains. Copyright © 2018 Elsevier Ltd. All rights reserved.

Characterization of avipoxviruses from wild birds in Norway

PubMed Central

2004-01-01

Abstract Avipoxviruses from different geographic regions of the world have been characterized to study their genetic and biological properties, but so far, no such work has been performed on Norwegian isolates. Lesions suggestive of avian pox, found on a Norwegian wild sparrow (Passer domesticus) and wood pigeon (Palumbus palumbus), were obtained in 1972 and 1996, respectively. Histologically, these lesions were demonstrated to be characteristic of poxvirus infections and the poxvirus was observed using an electron microscope. The resulting viruses were propagated in chicken embryo fibroblast cells. Restriction fragment length polymorphism of genomes from 2 Norwegian isolates and fowl pox vaccine strain, generated by BamHI, revealed a high degree of heterogeneity among the isolates. The profiles of avipoxviruses isolated from wild birds were clearly distinct from each other and also to the fowl poxvirus strain. Furthermore, chickens experimentally infected with pigeon poxvirus had higher antibody titers and extensive lesions compared to other isolates. This may suggest that pigeon poxvirus is more virulent than the other isolates. PMID:15188959

Partially Premixed Flame (PPF) Research for Fire Safety

NASA Technical Reports Server (NTRS)

Puri, Ishwar K.; Aggarwal, Suresh K.; Lock, Andrew J.; Hegde, Uday

2004-01-01

Incipient fires typically occur after the partial premixing of fuel and oxidizer. The mixing of product species into the fuel/oxidizer mixture influences flame stabilization and fire spread. Therefore, it is important to characterize the impact of different levels of fuel/oxidizer/product mixing on flame stabilization, liftoff and extinguishment under different gravity conditions. With regard to fire protection, the agent concentration required to achieve flame suppression is an important consideration. The initial stage of an unwanted fire in a microgravity environment will depend on the level of partial premixing and the local conditions such as air currents generated by the fire itself and any forced ventilation (that influence agent and product mixing into the fire). The motivation of our investigation is to characterize these impacts in a systematic and fundamental manner.

Sunlight Controls Water Column Processing of Carbon in Arctic Freshwaters

NASA Astrophysics Data System (ADS)

Cory, R. M.; Ward, C. P.; Crump, B. C.; Kling, G. W.

2014-12-01

Carbon (C) in thawing permafrost soils may have global impacts on climate change, yet controls on its processing and fate are poorly understood. The dominant fate of dissolved organic C (DOC) released from soils to inland waters is either complete oxidation to CO2 or partial oxidation and river export to oceans. Both processes are most often attributed to bacterial respiration, but we recently showed that photochemical oxidation exceeds rates of respiration and accounts for 70-95% of total DOC processed in the water column of arctic lakes and rivers. While the overall dominance of photochemical processing in streams and lakes remained, the fate of DOC varied consistently by water type. In small streams DOC was mainly mineralized by sunlight to CO2, while in lakes the main fate of DOC was partial photo-oxidation. Large rivers were intermediate between these end members, and photo-mineralization to CO2 was about equal to or less than partial photo-oxidation. We suggest this pattern is a result of light-exposure history, where DOC leached from soils into headwater streams has little prior light exposure and is labile to complete photo-oxidation, but as light exposure increases moving downstream and into lakes with longer residence times the DOC photo-lability declines. Thus as easily photo-mineralized moieties are removed, DOC fate shifts toward partial photo-oxidation and downstream export in rivers and lakes. At the basin scale, photochemical processing of DOC is about one third of the total CO2 released from surface waters, and is thus an important, newly measured component of the Arctic C budget. We also suggest that these photochemical transformations of DOC will occur in any shallow surface water, and could be important for better understanding inland water carbon cycling.

Effect of exercise therapy on lipid profile and oxidative stress indicators in patients with type 2 diabetes

PubMed Central

Gordon, Lorenzo A; Morrison, Errol Y; McGrowder, Donovan A; Young, Ronald; Fraser, Yeiny Terry Pena; Zamora, Eslaen Martorell; Alexander-Lindo, Ruby L; Irving, Rachael R

2008-01-01

Background Yoga has been shown to be a simple and economical therapeutic modality that may be considered as a beneficial adjuvant for type 2 diabetes mellitus. This study investigated the impact of Hatha yoga and conventional physical training (PT) exercise regimens on biochemical, oxidative stress indicators and oxidant status in patients with type 2 diabetes. Methods This prospective randomized study consisted of 77 type 2 diabetic patients in the Hatha yoga exercise group that were matched with a similar number of type 2 diabetic patients in the conventional PT exercise and control groups. Biochemical parameters such as fasting blood glucose (FBG), serum total cholesterol (TC), triglycerides, low-density lipoprotein (LDL), very low-density lipoproteins (VLDL) and high-density lipoprotein (HDL) were determined at baseline and at two consecutive three monthly intervals. The oxidative stress indicators (malondialdehyde – MDA, protein oxidation – POX, phospholipase A2 – PLA2 activity) and oxidative status [superoxide dismutase (SOD) and catalase activities] were measured. Results The concentrations of FBG in the Hatha yoga and conventional PT exercise groups after six months decreased by 29.48% and 27.43% respectively (P < 0.0001) and there was a significant reduction in serum TC in both groups (P < 0.0001). The concentrations of VLDL in the managed groups after six months differed significantly from baseline values (P = 0.036). Lipid peroxidation as indicated by MDA significantly decreased by 19.9% and 18.1% in the Hatha yoga and conventional PT exercise groups respectively (P < 0.0001); whilst the activity of SOD significantly increased by 24.08% and 20.18% respectively (P = 0.031). There was no significant difference in the baseline and 6 months activities of PLA2 and catalase after six months although the latter increased by 13.68% and 13.19% in the Hatha yoga and conventional PT exercise groups respectively (P = 0.144). Conclusion The study demonstrate the efficacy of Hatha yoga exercise on fasting blood glucose, lipid profile, oxidative stress markers and antioxidant status in patients with type 2 diabetes and suggest that Hatha yoga exercise and conventional PT exercise may have therapeutic preventative and protective effects on diabetes mellitus by decreasing oxidative stress and improving antioxidant status. Trial Registration Australian New Zealand Clinical Trials Registry (ANZCTR): ACTRN12608000217303 PMID:18477407

77 FR 58469 - Plum Pox Compensation

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-21

... owners of non-fruit-bearing ornamental tree nurseries and to increase the amount of compensation that may be paid to eligible owners of commercial stone fruit orchards and fruit tree nurseries whose trees... of regulated articles (e.g., trees, seedlings, root stock, budwood, branches, twigs, and leaves of...

Turning Bad Press into Prestige.

ERIC Educational Resources Information Center

Wassom, Julie

1995-01-01

Offers guidance to childcare directors on handling public and parent relations during crisis situations (e.g., an outbreak of chicken pox, a child's death, or teacher's dismissal for reasons that cannot be disclosed). Recommends keen observation, risk management, and good planning. Offers suggestions for handling the situation before, during, and…

POX 186: A Dwarf Galaxy in the Process of Formation?

NASA Astrophysics Data System (ADS)

Corbin, Michael R.; Vacca, William D.

2002-12-01

We present deep U-, V-, and I-band images of the ``ultracompact'' blue dwarf galaxy POX 186 obtained with the Planetary Camera 2 of the Hubble Space Telescope. We have also obtained a near-ultraviolet spectrum of the object with the Space Telescope Imaging Spectrograph and combine this with a new ground-based optical spectrum. The images confirm the galaxy to be extremely small, with a maximum extent of only 300 pc, a luminosity of ~10-4L*, and an estimated mass of ~107 Msolar. Its morphology is highly asymmetric, with a tail of material on its western side that may be tidal in origin. The U-band image shows this tail to be part of a stream of material in which stars have recently formed. Most of the star formation in the galaxy is, however, concentrated in a central, compact (d~10-15 pc) star cluster. We estimate this cluster to have a total mass of ~105 Msolar, to be forming stars at a rate of less than 0.05 yr-1, and to have a maximum age of a few million years. The outer regions of the galaxy are significantly redder than the cluster, with V-I colors consistent with a population dominated by K and M stars. From our analysis of the optical spectrum we find the galaxy to have a metallicity Z~=0.06 Zsolar and to contain a significant amount of internal dust [E(B-V)~=0.28] both values agree with previous estimates. While these results rule out earlier speculation that POX 186 is a protogalaxy, its morphology, mass, and active star formation suggest that it represents a recent (within ~108 yr) collision between two clumps of stars of subgalactic size (~100 pc). POX 186 may thus be a very small dwarf galaxy that, dynamically speaking, is still in the process of formation. This interpretation is supported by the fact that it resides in a void, so its morphology cannot be explained as the result of an encounter with a more massive galaxy. Clumps of stars this small may represent the building blocks required by hierarchical models of galaxy formation, and these results also support the recent ``downsizing'' picture of galaxy formation in which the least massive objects are the last to form. Based on observations with the NASA/ESA Hubble Space Telescope. The Hubble Space Telescope is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555 to the Space Telescope Science Institute.

[Pregnancy and vaccinoprevention].

PubMed

Galev, A; Nacheva, A

2014-01-01

Vaccinations protect woman and her fetus against different infectious diseases, but their application on pregnant should be extremely responsible. In this review I present information about some infectious diseases and vaccines during pregnancy. Women, planning to get pregnant should be advised to do serological tests in order to find out their immune status against some infections, leading to fetal congenital malformations (rubella, chicken pox, hepatitis B) and if necessary to get vaccinated at least a month before pregnancy. Despite the lack of vaccines against Cytomegalovirus (CMV), parvovirus 19 and Toxoplasma gondii it is good to know woman's immune status against these infections in order to clarify the clinical approach in case of future contact with sick or carriers. Parvovirus 19 could cause fetal death, while CMV could be transmitted to the child. Immune women wouldn't get sick and wouldn't transmit Toxoplasmagondii to the fetus during pregnancy. Recommended vaccines before pregnancy include vaccines against flu, human papilloma virus, MMR (morbilli, measles, rubella), Tdap (tetanus, diphtheria, whooping cough), chicken pox. CDC-Atlanta recommends during pregnancy two vaccines--against flu, in case it wasn't done before pregnancy, and Tdap during every pregnancy between 27-th and 36-th gestation week. Whooping cough is very dangerous for the baby during the first two months after birth, while it is not yet vaccinated. From this point of view it is of best interest of the mother to have strong immunity in order to transfer antibodies during breastfeeding, as well as for the father and the rest who will take care for the newborn child to be vaccinated against whooping cough. During pregnancy vaccinations against tuberculosis, morbilli, measles, rubella, meningococcal disease, typhoid fever and chicken pox are contraindicated. In case of contact vaccinations against rabies, anthrax, small pox, poliomyelitis and yellow fever should be taken into consideration. Immediately after birth, if the vaccination against whooping cough is missed young mother vaccination is recommended. The vaccination is one of the greatest achievements of the modern medicine, but it is still an object of vigorous attacks, concerning used products safety. One of the most spreading fears is about sterility after vaccination. Over a period of three years (2009-2012) 563 women were vaccinated by SACMEH against HPV. Forty two of them (13.40%) interrupt vaccination due to pregnancy (18 of them after the first shot and 24 after the second shot). Our observations show, that this vaccine is carried out good by the patients, tit is safe and does not cause sterility.

[A comparative study on Koii (public doctor) system and its effect on public health in colonial Taiwan and Korea].

PubMed

Moon, Myungki

2014-08-01

Koii(Public Doctor) System introduced into Taiwan in 1896 for the purpose of filling up medical vacuum of rural area and therefore spreading modern medical system all over Taiwan, was transplanted in 1913 into Colonial Korea for the same purpose. In terms of system itself Koii system in both areas were almost the same, but quite different in practices. First, Koiis in Taiwan was forced to write concrete medical report every month on the medical situation in the area under jurisdiction, whereas to those in Korea writing monthly report was not so compulsory. This difference resulted in some gaps in the quality of medical statistics of the two areas. Second, Unlike their counterparts in Korea, Koiis in Taiwan organized their own associations both locally and nationally and it helped to build up their own networks and share informations on medical situation including informations on infectious diseases. Third, Koiis in Taiwan formed more harmonious relationship between Taiwanese Police than their counterparts in Korea, which helped them to execute various medical activities in more comfortable environment. Taiwanese People went to medical institutions a lot more frequently than Korean People, and this difference was basically derived from the quite different density of Koii assignment in both areas. Korean People had to spend more time and money to utilize modern medical institutions than Taiwanese People did. The different density of Koii assignment also affected the results of prevention and eradication of infectious diseases; in Taiwan plague and small-pox has been successfully controled, whereas Chosun Government general was not so successful in controling infectious diseases including small-pox. Small-pox infected in Korea was about 6 times to Taiwan, and the number of death by small-pox was 9 times to Taiwan. One of the keys to this difference is the different role of Koiis. In Korea, Koiis could do little thing about infectious diseases mainly because of manpower shortage, thus shifting their duties like vaccination onto police officers who was inevitably inferior to doctors in medical terms, whereas vaccination was led by Koiis in Taiwan, with the help of police officers and traditional doctors. The difference between Korea and Taiwan in terms of Koii system and its effect implies that public health network in colonial Taiwan was better organized and more stable than that in colonial Korea, and therefore we should be careful about applying the concept of disciplinary power or modernization theory to colonial medical history of Korea.

Uranium and minor-element partitioning in Fe-Ti oxides and zircon from partially melted granodiorite, Crater Lake, Oregon

USGS Publications Warehouse

Tourrette, T.Z.L.; Burnett, D.S.; Bacon, C.R.

1991-01-01

Crystal-liquid partitioning in Fe-Ti oxides and zircon was studied in partially melted granodiorite blocks ejected during the climactic eruption of Mt. Mazama (Crater Lake), Oregon. The blocks, which contain up to 33% rhyolite glass (75 wt% SiO2), are interpreted to be portions of the magma chamber walls that were torn off during eruption. The glass is clear and well homogenized for all measured elements except Zr. Results for Fe-Ti oxides give DUoxide/liq ??? 0.1. Partitioning of Mg, Mn, Al, Si, V, and Cr in Fe-Ti oxides indicates that grains surrounded by glass are moderately well equilibrated with the melt for many of the minor elements, while those that are inclusions in relict plagioclase are not. Uranium and ytterbium inhomogeneities in zircons indicate that the zircons have only partially equilibrated with the melt and that uranium appears to have been diffusing out of the zircons faster than the zircons were dissolving. Minimum U, Y, and P concentrations in zircons give maximum DUzrc/liq = 13,DYzrc/liq = 23, and DPzrc/liq = 1, but these are considerably lower than reported by other workers for U and Y. Based on our measurements and given their low abundances in most rocks, Fe-Ti oxides probably do not play a major role in U-Th fractionation during partial melting. The partial melts were undersaturated with zircon and apatite, but both phases are present in our samples. This demonstrates an actual case of non-equilibrium source retention of accessory phases, which in general could be an important trace-element fractionation mechanism. Our results do not support the hypothesis that liquid structure is the dominant factor controlling trace-element partitioning in high-silica rhyolites. Rough calculations based on Zr gradients in the glass indicate that the samples could have been partially molten for 800 to 8000 years. ?? 1991.

A Theoretical Study of Methanol Oxidation on RuO 2(110): Bridging the Pressure Gap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Latimer, Allegra A.; Abild-Pedersen, Frank; Norskov, Jens K.

Partial oxidation catalysis is often fraught with selectivity problems, largely because there is a tendency of oxidation products to be more reactive than the starting material. One industrial process that has successfully overcome this problem is partial oxidation of methanol to formaldehyde. This process has become a global success, with an annual production of 30 million tons. Although ruthenium catalysts have not shown activity as high as the current molybdena or silver-based industrial standards, the study of ruthenium systems has the potential to elucidate which catalyst properties facilitate the desired partial oxidation reaction as opposed to deep combustion due tomore » a pressure-dependent selectivity “switch” that has been observed in ruthenium-based catalysts. In this work, we find that we are able to successfully rationalize this “pressure gap” using near-ab initio steady-state microkinetic modeling on RuO 2(110). We obtain molecular desorption prefactors from experiment and determine all other energetics using density functional theory. We show that, under ambient pressure conditions, formaldehyde production is favored on RuO 2(110), whereas under ultrahigh vacuum pressure conditions, full combustion to CO 2 takes place. We glean from our model several insights regarding how coverage effects, oxygen activity, and rate-determining steps influence selectivity and activity. As a result, we believe the understanding gained in this work might advise and inspire the greater partial oxidation community and be applied to other catalytic processes which have not yet found industrial success.« less

A Theoretical Study of Methanol Oxidation on RuO 2(110): Bridging the Pressure Gap

DOE PAGES

Latimer, Allegra A.; Abild-Pedersen, Frank; Norskov, Jens K.

2017-05-26

Partial oxidation catalysis is often fraught with selectivity problems, largely because there is a tendency of oxidation products to be more reactive than the starting material. One industrial process that has successfully overcome this problem is partial oxidation of methanol to formaldehyde. This process has become a global success, with an annual production of 30 million tons. Although ruthenium catalysts have not shown activity as high as the current molybdena or silver-based industrial standards, the study of ruthenium systems has the potential to elucidate which catalyst properties facilitate the desired partial oxidation reaction as opposed to deep combustion due tomore » a pressure-dependent selectivity “switch” that has been observed in ruthenium-based catalysts. In this work, we find that we are able to successfully rationalize this “pressure gap” using near-ab initio steady-state microkinetic modeling on RuO 2(110). We obtain molecular desorption prefactors from experiment and determine all other energetics using density functional theory. We show that, under ambient pressure conditions, formaldehyde production is favored on RuO 2(110), whereas under ultrahigh vacuum pressure conditions, full combustion to CO 2 takes place. We glean from our model several insights regarding how coverage effects, oxygen activity, and rate-determining steps influence selectivity and activity. As a result, we believe the understanding gained in this work might advise and inspire the greater partial oxidation community and be applied to other catalytic processes which have not yet found industrial success.« less

Catalytic oxidation of light alkanes in presence of a base

DOEpatents

Bhinde, Manoj V.; Bierl, Thomas W.

1998-01-01

The presence of a base in the reaction mixture in a metal-ligand catalyzed partial oxidation of alkanes results in sustained catalyst activity, and in greater percent conversion as compared with oxidation in the absence of base, while maintaining satisfactory selectivity for the desired oxidation, for example the oxidation of isobutane to isobutanol.

Sulfur control in ion-conducting membrane systems

DOEpatents

Stein, VanEric Edward; Richards, Robin Edward; Brengel, David Douglas; Carolan, Michael Francis

2003-08-05

A method for controlling the sulfur dioxide partial pressure in a pressurized, heated, oxygen-containing gas mixture which is contacted with an ion-conducting metallic oxide membrane which permeates oxygen ions. The sulfur dioxide partial pressure in the oxygen-depleted non-permeate gas from the membrane module is maintained below a critical sulfur dioxide partial pressure, p.sub.SO2 *, to protect the membrane material from reacting with sulfur dioxide and reducing the oxygen flux of the membrane. Each ion-conducting metallic oxide material has a characteristic critical sulfur dioxide partial pressure which is useful in determining the required level of sulfur removal from the feed gas and/or from the fuel gas used in a direct-fired feed gas heater.

Selective Oxidation and Reactive Wetting during Galvanizing of a CMnAl TRIP-Assisted Steel

NASA Astrophysics Data System (ADS)

Bellhouse, E. M.; McDermid, J. R.

2011-09-01

A transformation induced plasticity (TRIP)-assisted steel with 0.2 pct C, 1.5 pct Mn, and 1.5 pct Al was successfully galvanized using a thermal cycle previously shown to produce an excellent combination of strength and ductility. The steel surface chemistry and oxide morphology were determined as a function of process atmosphere oxygen partial pressure. For the 220 K (-53 °C) dew point (dp) + 20 pct H2 atmosphere, the oxide morphology was a mixture of films and nodules. For the 243 K (-30 °C) dp + 5 pct H2 atmosphere, nodules of MnO were found primarily at grain boundaries. For the 278 K (+5 °C) dp + 5 pct H2 atmosphere, nodules of metallic Fe were found on the surface as a result of alloy element internal oxidation. The steel surface chemistry and oxide morphology were then related to the reactive wetting behavior during continuous hot dip galvanizing. Good wetting was obtained using the two lower oxygen partial pressure process atmospheres [220 K dp and 243 K dp (-53 °C dp and -30 °C dp)]. An increase in the number of bare spots was observed when using the higher oxygen partial pressure process atmosphere (+5 °C dp) due to the increased thickness of localized oxide films.

78 FR 48644 - Notice of Request for Extension of Approval of an Information Collection; Plum Pox Compensation

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-09

... compensation to owners of commercial stone fruit orchards and fruit tree nurseries whose trees or nursery stock... known effective methods for treating trees or other plant material infected with PPV, nor are there any... spread of the disease is [[Page 48645

7 CFR 301.74-5 - Compensation.

Code of Federal Regulations, 2010 CFR

2010-01-01

... compensation for losses associated with the destruction of trees in order to control plum pox pursuant to an... only in accordance with paragraph (b)(1)(ii) of this section. (2) Owners of fruit tree nurseries. The owner of a fruit tree nursery will be eligible to receive compensation for net revenue losses associated...

ERCMExpress. Volume 2, Issue 7

ERIC Educational Resources Information Center

US Department of Education, 2006

2006-01-01

This issue of ERCMExpress presents the topic "Schools Respond to Infectious Disease." Every year, schools confront a range of infectious diseases such as chicken pox, lice, ringworm and seasonal influenza. In response, faculty and staff work together to control the outbreak, quell fears and dispel rumors. For example, school administrators may…

7 CFR 301.74-2 - Regulated articles.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 5 2010-01-01 2010-01-01 false Regulated articles. 301.74-2 Section 301.74-2... SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Plum Pox § 301.74-2 Regulated articles. The following are regulated articles: (a) All plant material and plant parts of Prunus (stone fruit) species...

7 CFR 301.74-2 - Regulated articles.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 5 2013-01-01 2013-01-01 false Regulated articles. 301.74-2 Section 301.74-2... SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Plum Pox § 301.74-2 Regulated articles. The following are regulated articles: (a) All plant material and plant parts of Prunus (stone fruit) species...

7 CFR 301.74-2 - Regulated articles.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 5 2014-01-01 2014-01-01 false Regulated articles. 301.74-2 Section 301.74-2... SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Plum Pox § 301.74-2 Regulated articles. The following are regulated articles: (a) All plant material and plant parts of Prunus (stone fruit) species...

7 CFR 301.74-2 - Regulated articles.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 5 2012-01-01 2012-01-01 false Regulated articles. 301.74-2 Section 301.74-2... SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Plum Pox § 301.74-2 Regulated articles. The following are regulated articles: (a) All plant material and plant parts of Prunus (stone fruit) species...

7 CFR 301.74-2 - Regulated articles.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 5 2011-01-01 2011-01-01 false Regulated articles. 301.74-2 Section 301.74-2... SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Plum Pox § 301.74-2 Regulated articles. The following are regulated articles: (a) All plant material and plant parts of Prunus (stone fruit) species...

Cyclic lipopeptides from Bacillus subtilis ABS-S14 elicit defense-related gene expression in citrus fruit

USDA-ARS?s Scientific Manuscript database

Effects of cyclic lipopeptides obtained from B. subtilis ABS-S14 on eliciting defense-related gene transcription and activity of defense-related enzymes glucanase (GLU), chitinase (CHI), peroxidase (POX) and lipoxygenase (LOX) in Citrus sinensis cv. Valencia fruit were determined. The maximum level ...

Sharka epidemiology and worldwide management strategies: learning lessons to optimize disease control in perennial plants

USDA-ARS?s Scientific Manuscript database

Many plant epidemics that cause major economic losses cannot be controlled with pesticides. Among them, sharka epidemics severely affect prunus trees worldwide. Its causal agent, Plum pox virus (PPV;, genus Potyvirus), has been classified as a quarantine pathogen in numerous countries. As a result, ...

Synthesis and Biological Evaluation of Brain-Specific Anti-RNA Viral Agents

DTIC Science & Technology

1989-06-30

disease or ultimately death. DNA viruses are subdivided into five families and include the pathogens responsible for labial and genital herpes, chicken ... pox , shingles and mononucleosis. RNA viruses are present in more numerous forms and are subdivided into ten families. These viruses are unusual in

Participation of chitin-binding peroxidase isoforms in the wilt pathogenesis of cotton

USDA-ARS?s Scientific Manuscript database

Specific chitin-binding isozymes of peroxidase (POX) play an important role in pathogenesis of plant diseases caused with fungi. We studied the dynamics of peroxidase activity in two varieties of cotton (Gossypium hirsutum L.); one was a susceptible and the other resistant to the plant pathogen Vert...

Inheritance of plum pox virus resistance in transgenic plums

USDA-ARS?s Scientific Manuscript database

We have studied the heritability of the virus transgene engineered in 'HoneySweet' plum through different cross-hybridization with two commercial cultivars of Prunus domestica (Prunier d’Ente 303 and Quetsche 2906) and one wild species, P. spinosa 2862, rootstock using 'HoneySweet' plum as the polle...

Complete and Partial Photo-oxidation of Dissolved Organic Matter Draining Permafrost Soils.

PubMed

Ward, Collin P; Cory, Rose M

2016-04-05

Photochemical degradation of dissolved organic matter (DOM) to carbon dioxide (CO2) and partially oxidized compounds is an important component of the carbon cycle in the Arctic. Thawing permafrost soils will change the chemical composition of DOM exported to arctic surface waters, but the molecular controls on DOM photodegradation remain poorly understood, making it difficult to predict how inputs of thawing permafrost DOM may alter its photodegradation. To address this knowledge gap, we quantified the susceptibility of DOM draining the shallow organic mat and the deeper permafrost layer of arctic soils to complete and partial photo-oxidation and investigated changes in the chemical composition of each DOM source following sunlight exposure. Permafrost and organic mat DOM had similar lability to photomineralization despite substantial differences in initial chemical composition. Concurrent losses of carboxyl moieties and shifts in chemical composition during photodegradation indicated that photodecarboxylation could account for 40-90% of DOM photomineralized to CO2. Permafrost DOM had a higher susceptibility to partial photo-oxidation compared to organic mat DOM, potentially due to a lower abundance of phenolic moieties with antioxidant properties. These results suggest that photodegradation will likely continue to be an important control on DOM fate in arctic freshwaters as the climate warms and permafrost soils thaw.

Effects of inoculum type and bulk dissolved oxygen concentration on achieving partial nitrification by entrapped-cell-based reactors.

PubMed

Rongsayamanont, Chaiwat; Limpiyakorn, Tawan; Khan, Eakalak

2014-07-01

An entrapment of nitrifiers into gel matrix is employed as a tool to fulfill partial nitrification under non-limiting dissolved oxygen (DO) concentrations in bulk solutions. This study aims to clarify which of these two attributes, inoculum type and DO concentration in bulk solutions, is the decisive factor for partial nitrification in an entrapped-cell based system. Four polyvinyl alcohol entrapped inocula were prepared to have different proportions of nitrite-oxidizing bacteria (NOB) and nitrite-oxidizing activity. At a DO concentration of 3 mg l(-1), the number of active NOB cells in an inoculum was the decisive factor for partial nitrification enhancement. However, when the DO concentration was reduced to 2 mg l(-1), all entrapped cell inocula showed similar degrees of partial nitrification. The results suggested that with the lower bulk DO concentration, the preparation of entrapped cell inocula is not useful as the DO level becomes the decisive factor for achieving partial nitrification. Copyright © 2014 Elsevier Ltd. All rights reserved.

Effect of PEEP and inhaled nitric oxide on pulmonary gas exchange during gaseous and partial liquid ventilation with small volumes of perfluorocarbon.

PubMed

Max, M; Kuhlen, R; Falter, F; Reyle-Hahn, M; Dembinski, R; Rossaint, R

2000-04-01

Partial liquid ventilation, positive end-expiratory pressure (PEEP) and inhaled nitric oxide (NO) can improve ventilation/perfusion mismatch in acute lung injury (ALI). The aim of the present study was to compare gas exchange and hemodynamics in experimental ALI during gaseous and partial liquid ventilation at two different levels of PEEP, with and without the inhalation of nitric oxide. Seven pigs (24+/-2 kg BW) were surfactant-depleted by repeated lung lavage with saline. Gas exchange and hemodynamic parameters were assessed in all animals during gaseous and subsequent partial liquid ventilation at two levels of PEEP (5 and 15 cmH2O) and intermittent inhalation of 10 ppm NO. Arterial oxygenation increased significantly with a simultaneous decrease in cardiac output when PEEP 15 cmH2O was applied during gaseous and partial liquid ventilation. All other hemodynamic parameters revealed no relevant changes. Inhalation of NO and instillation of perfluorocarbon had no additive effects on pulmonary gas exchange when compared to PEEP 15 cmH2O alone. In experimental lung injury, improvements in gas exchange are most distinct during mechanical ventilation with PEEP 15 cmH2O without significantly impairing hemodynamics. Partial liquid ventilation and inhaled NO did not cause an additive increase of PaO2.

Catalytic oxidation of light alkanes in presence of a base

DOEpatents

Bhinde, M.V.; Bierl, T.W.

1998-03-03

The presence of a base in the reaction mixture in a metal-ligand catalyzed partial oxidation of alkanes results in sustained catalyst activity, and in greater percent conversion as compared with oxidation in the absence of base, while maintaining satisfactory selectivity for the desired oxidation, for example the oxidation of isobutane to isobutanol. 1 fig.

Three-Dimensional Normal Human Neural Progenitor Tissue-Like Assemblies: A Model for Persistent Varicell-Zoster Virus Infection and Platform to Study Viral Infectivity and Oxidative Stress and Damage

NASA Technical Reports Server (NTRS)

Goodwin, T. J.; McCarthy, M.; Osterrieder, N.; Cohrs, R. J.; Kaufer, B. B.

2014-01-01

The environment of space results in a multitude of challenges to the human physiology that present barriers to extended habitation and exploration. Over 40 years of investigation to define countermeasures to address space flight adaptation has left gaps in our knowledge regarding mitigation strategies partly due to the lack of investigative tools, monitoring strategies, and real time diagnostics to understand the central causative agent(s) responsible for physiologic adaptation and maintaining homeostasis. Spaceflight-adaptation syndrome is the combination of space environmental conditions and the synergistic reaction of the human physiology. Our work addresses the role of oxidative stress and damage (OSaD) as a negative and contributing Risk Factor (RF) in the following areas of combined spaceflight related dysregulation: i) radiation induced cellular damage [1], [2] ii) immune impacts and the inflammatory response [3], [4] and iii) varicella zoster virus (VZV) reactivation [5]. Varicella-zoster (VZV)/Chicken Pox virus is a neurotropic human alphaherpesvirus resulting in varicella upon primary infection, suppressed by the immune system becomes latent in ganglionic neurons, and reactivates under stress events to re-express in zoster and possibly shingles. Our laboratory has developed a complex threedimensional (3D) normal human neural tissue model that emulates several characteristics of the human trigeminal ganglia (TG) and allows the study of combinatorial experimentation which addresses, simultaneously, OSaD associated with Spaceflight adaptation and habitation [6].

Bismuth Oxide Nanoparticles Partially Substituted with EuIII, MnIV, and SiIV: Structural, Spectroscopic, and Optical Findings.

PubMed

Ortiz-Quiñonez, José-Luis; Zumeta-Dubé, Inti; Díaz, David; Nava-Etzana, Noel; Cruz-Zaragoza, Epifanio; Santiago-Jacinto, Patricia

2017-03-20

Interest in nanostructured partially substituted bismuth oxides has been increasing over the last years. Research on new synthesis methods, properties, and possible uses for these oxides is needed. The objective of this paper is to synthesize β-Bi 2 O 3 , β-Bi 2 O 3 :Eu 3+ , β-Bi 2 O 3 :Mn 4+ , Bi 12 Bi 0.8 O 19.2 , Bi 12 Bi 0.8 O 19.2 /Li + , Bi 12 MnO 20 , and Bi 12 SiO 20 nanoparticles and to investigate their structural, spectroscopic, and optical changes. Some of the causes that generated their properties are also discussed. These materials are important because the doping or partial substitution of bismuth oxide with these cations (Eu 3+ , Mn 4+ , and Si 4+ ) modifies some properties such as optical absorption, reactivity toward CO 2 , among others. X-ray diffraction (in powders), high-resolution transmission electron microscopy, Fourier transform infrared (FTIR), resonance Raman scattering, diffuse reflectance, and solid-state magic-angle-spinning 29 Si NMR were used for the characterization of the synthesized materials. We found that partial substitution of yellow Bi 12 Bi 0.8 O 19.2 with Mn 4+ and Si 4+ changed the color to green and whitish, respectively. New bands in the Raman scattering and FTIR spectra of these oxides are deeply discussed. Raman scattering spectroscopy was a valuable and reliable technique to detect the Eu 3+ and Mn 4+ cations as dopants in the bismuth oxides. The 29 Si chemical shift (δ) in Bi 12 SiO 20 was -78.16 ppm, whereas in SiO 2 , it was around -110 ppm. This considerable shift in Bi 12 SiO 20 occurred because of an increased shielding of the Si nucleus in the Si(O) 4 tetrahedron. This shielding was provided by the low-electronegativity and highly polarizable Bi cations. The isovalent doping of β-Bi 2 O 3 nanoparticles with Eu 3+ enhanced their thermal stability over 400 °C. Variation in the optical absorption and reactivity toward the acidic CO 2 molecule of the partially substituted bismuth oxides was explained on the basis of the optical basicity and ionic-covalent parameter concepts. Some possible uses for the synthesized oxides are suggested.

Autothermal hydrogen storage and delivery systems

DOEpatents

Pez, Guido Peter [Allentown, PA; Cooper, Alan Charles [Macungie, PA; Scott, Aaron Raymond [Allentown, PA

2011-08-23

Processes are provided for the storage and release of hydrogen by means of dehydrogenation of hydrogen carrier compositions where at least part of the heat of dehydrogenation is provided by a hydrogen-reversible selective oxidation of the carrier. Autothermal generation of hydrogen is achieved wherein sufficient heat is provided to sustain the at least partial endothermic dehydrogenation of the carrier at reaction temperature. The at least partially dehydrogenated and at least partially selectively oxidized liquid carrier is regenerated in a catalytic hydrogenation process where apart from an incidental employment of process heat, gaseous hydrogen is the primary source of reversibly contained hydrogen and the necessary reaction energy.

Hydrogen rich gas generator

NASA Technical Reports Server (NTRS)

Houseman, J. (Inventor)

1976-01-01

A process and apparatus is described for producing a hydrogen rich gas by introducing a liquid hydrocarbon fuel in the form of a spray into a partial oxidation region and mixing with a mixture of steam and air that is preheated by indirect heat exchange with the formed hydrogen rich gas, igniting the hydrocarbon fuel spray mixed with the preheated mixture of steam and air within the partial oxidation region to form a hydrogen rich gas.

Methanol partial oxidation on Ag(111) from first principles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aljama, Hassan; Yoo, Jong Suk; Nørskov, Jens K.

In this work, we examine the thermochemistry and kinetics of the partial oxidation of methanol to formaldehyde on silver surfaces. Periodic density functional theory calculations employing the BEEF-vdW functional are used to identify the most stable phases of the silver surface under relevant reaction conditions and the reaction energetics are obtained on these surfaces. The calculated binding energies and transition state energies are used as input in a mean-field microkinetic model providing the reaction kinetics on silver surfaces under different reaction conditions. Our results show that, under conditions pertaining to methanol partial oxidation, oxygen is present at low concentrations andmore » it plays a critical role in the catalytic reaction. Surface oxygen promotes the reaction by activating the OH bond in methanol, thus forming a methoxy intermediate, which can react further to form formaldehyde. Finally, the dissociation of molecular oxygen is identified as the most critical step.« less

Methanol partial oxidation on Ag(111) from first principles

DOE PAGES

Aljama, Hassan; Yoo, Jong Suk; Nørskov, Jens K.; ...

2016-10-26

In this work, we examine the thermochemistry and kinetics of the partial oxidation of methanol to formaldehyde on silver surfaces. Periodic density functional theory calculations employing the BEEF-vdW functional are used to identify the most stable phases of the silver surface under relevant reaction conditions and the reaction energetics are obtained on these surfaces. The calculated binding energies and transition state energies are used as input in a mean-field microkinetic model providing the reaction kinetics on silver surfaces under different reaction conditions. Our results show that, under conditions pertaining to methanol partial oxidation, oxygen is present at low concentrations andmore » it plays a critical role in the catalytic reaction. Surface oxygen promotes the reaction by activating the OH bond in methanol, thus forming a methoxy intermediate, which can react further to form formaldehyde. Finally, the dissociation of molecular oxygen is identified as the most critical step.« less

Magnetic properties of partially oxidized Fe films

NASA Astrophysics Data System (ADS)

Garcia, Miguel Angel; Lopez-Dominguez, Victor; Hernando, Antonio

Hybrid magnetic nanostructures exhibit appealing properties due to interface and proximity effects. A simple and interesting system of hybrid magnetic nanomaterials are partially oxidized ferromagnetic films. We have fabricated Fe films by thermal evaporation and performed a partial oxidation to magnetite (Fe3O4) by annealing in air at different times and temperatures. The magnetic properties of the films evolve from those of pure metallic iron to pure magnetite, showing intermediate states where the proximity effects control the magnetic behavior. At some stages, the magnetization curves obtained by SQUID and MOKE magnetometry exhibit important differences due to the dissimilar contribution of both phases to the magneto-optical response of the system This work has been supported by the Ministerio Español de Economia y Competitividad (MINECO) MAT2013-48009-C4-1. V.L.D and M.A.G. acknowledges financial support from BBVA foundation.

The change of steel surface chemistry regarding oxygen partial pressure and dew point

NASA Astrophysics Data System (ADS)

Norden, Martin; Blumenau, Marc; Wuttke, Thiemo; Peters, Klaus-Josef

2013-04-01

By investigating the surface state of a Ti-IF, TiNb-IF and a MnCr-DP after several series of intercritical annealing, the impact of the annealing gas composition on the selective oxidation process is discussed. On behalf of the presented results, it can be concluded that not the general oxygen partial pressure in the annealing furnace, which is a result of the equilibrium reaction of water and hydrogen, is the main driving force for the selective oxidation process. It is shown that the amounts of adsorbed gases at the strip surface and the effective oxygen partial pressure resulting from the adsorbed gases, which is mainly dependent on the water content of the annealing furnace, is driving the selective oxidation processes occurring during intercritical annealing. Thus it is concluded, that for industrial applications the dew point must be the key parameter value for process control.

Bactericidal activity of partially oxidized nanodiamonds.

PubMed

Wehling, Julia; Dringen, Ralf; Zare, Richard N; Maas, Michael; Rezwan, Kurosch

2014-06-24

Nanodiamonds are a class of carbon-based nanoparticles that are rapidly gaining attention, particularly for biomedical applications, i.e., as drug carriers, for bioimaging, or as implant coatings. Nanodiamonds have generally been considered biocompatible with a broad variety of eukaryotic cells. We show that, depending on their surface composition, nanodiamonds kill Gram-positive and -negative bacteria rapidly and efficiently. We investigated six different types of nanodiamonds exhibiting diverse oxygen-containing surface groups that were created using standard pretreatment methods for forming nanodiamond dispersions. Our experiments suggest that the antibacterial activity of nanodiamond is linked to the presence of partially oxidized and negatively charged surfaces, specifically those containing acid anhydride groups. Furthermore, proteins were found to control the bactericidal properties of nanodiamonds by covering these surface groups, which explains the previously reported biocompatibility of nanodiamonds. Our findings describe the discovery of an exciting property of partially oxidized nanodiamonds as a potent antibacterial agent.

The chemical energy unit partial oxidation reactor operation simulation modeling

NASA Astrophysics Data System (ADS)

Mrakin, A. N.; Selivanov, A. A.; Batrakov, P. A.; Sotnikov, D. G.

2018-01-01

The chemical energy unit scheme for synthesis gas, electric and heat energy production which is possible to be used both for the chemical industry on-site facilities and under field conditions is represented in the paper. The partial oxidation reactor gasification process mathematical model is described and reaction products composition and temperature determining algorithm flow diagram is shown. The developed software product verification showed good convergence of the experimental values and calculations according to the other programmes: the temperature determining relative discrepancy amounted from 4 to 5 %, while the absolute composition discrepancy ranged from 1 to 3%. The synthesis gas composition was found out practically not to depend on the supplied into the partial oxidation reactor (POR) water vapour enthalpy and compressor air pressure increase ratio. Moreover, air consumption coefficient α increase from 0.7 to 0.9 was found out to decrease synthesis gas target components (carbon and hydrogen oxides) specific yield by nearly 2 times and synthesis gas target components required ratio was revealed to be seen in the water vapour specific consumption area (from 5 to 6 kg/kg of fuel).

Oxide nucleation on thin films of copper during in situ oxidation in an electron microscope

NASA Technical Reports Server (NTRS)

Heinemann, K.; Rao, D. B.; Douglass, D. L.

1975-01-01

Single-crystal copper thin films were oxidized at an isothermal temperature of 425 C and at an oxygen partial pressure of 0.005 torr. Specimens were prepared by epitaxial vapor deposition onto polished faces of rocksalt and were mounted in a hot stage inside the ultrahigh-vacuum chamber of a high-resolution electron microscope. An induction period of roughly 30 min was established which was independent of the film thickness but depended strongly on the oxygen partial pressure and to exposure to oxygen prior to oxidation. Neither stacking faults nor dislocations were found to be associated with the Cu2O nucleation sites. The experimental data, including results from oxygen dissolution experiments and from repetitive oxidation-reduction-oxidation sequences, fit well into the framework of an oxidation process involving the formation of a surface charge layer, oxygen saturation of the metal with formation of a supersaturated zone near the surface, and nucleation followed by surface diffusion of oxygen and bulk diffusion of copper for lateral and vertical oxide growth, respectively.

[Amnesic effect of nitrous oxide in gradual general anesthesia].

PubMed

Mouquet, W; Milhaud, A; Berlemont, D; Bachelet, Y

1989-05-01

The amnesic effect of nitrous oxide was studied in 50 women undergoing induced abortions under general anesthesia at a hospital in France. The request for general anesthesia was made by the practitioner, by psychologists working with the women, or by the women themselves. Patient ages ranged from 13-39 years and averaged 24. All patients were given 1 mg of dextromoramide. During the procedure a mixture of 50% nitrous oxide and 50% oxygen was delivered. The patient was asked to count to 200 and remember a list of 5 words, and questions were posed. The nitrous oxide was terminated at completion of the aspiration. Awakening occurred in under 5 minutes with nitrous oxide and oxygen and at around 10 minutes when halothane was added. 30 minutes after awakening the patient was questioned about the surgery and the preoperative talk and questions. None of the patients recalled insertion of the speculum. In 46 of the 50 cases a total or partial amnesia occurred. Among 20 patients given the nitrous oxide-oxygen mixture only, 15 experienced total, 4 partial, and 1 no amnesia. Among the 30 patients given the same gas mixture and halothane, 25 experienced total, 2 partial, and 3 no amnesia. Nitrous oxide has no effect on longterm memory and probably inhibits the 1st phase of memorization. There are several components of its mode of action: classic analgesia, a potentializing effect with morphinomimetics and other general anesthesias, and an amnesia of painful and disagreeable interventions.

Training of the American Soldier During World War I and World War II.

DTIC Science & Technology

1987-06-05

smallpox, chicken pox , meningitis, typhoid, diptheria and other diseases resulted in the deaths of between 17,000 to 19,000 men during the course of...lessons of previous wars in both periods. The Spanish-American War and the United States’ incursion into Mexico provided valuable experience in

Full-Genome Sequence of a Novel Varicella-Zoster Virus Clade Isolated in Mexico

PubMed Central

Rodríguez-Castillo, Araceli; Ortiz-Alcántara, Joanna María; Gonzalez-Durán, Elizabeth; Segura-Candelas, José Miguel; Pérez-Agüeros, Sandra Ivette; Escobar-Escamilla, Noé; Méndez-Tenorio, Alfonso; Diaz-Quiñonez, José Alberto

2015-01-01

Varicella-zoster virus (VZV) is a member of the Herpesviridae family, which causes varicella (chicken pox) and herpes zoster (shingles) in humans. Here, we report the complete genome sequence of varicella-zoster virus, isolated from a vesicular fluid sample, revealing the circulation of VZV clade VIII in Mexico. PMID:26159533

Association of Human Q Fever with Animal Husbandry, Taiwan, 2004-2012.

PubMed

Lai, Chung-Hsu; Chang, Lin-Li; Lin, Jiun-Nong; Liao, Ming-Huei; Liu, Shyh-Shyan; Lee, Hsu-Hsun; Lin, Hsi-Hsun; Chen, Yen-Hsu

2015-12-01

In Taiwan, Q fever cases in humans began increasing in 2004 and peaked in 2007 but dramatically declined in 2008 and 2011. Cases were significantly correlated with the number of goats. The decline might be associated with the collateral effects of measures to control goat pox in 2008 and 2010.

Genomic analysis reveals candidate genes for PPV resistance in apricot (Prunus armeniaca L.)

USDA-ARS?s Scientific Manuscript database

Sharka disease, caused by Plum pox virus (PPV), is the most important disease affecting Prunus species. A major PPV resistance locus (PPVres) was previously mapped to the upper part of apricot (Prunus armeniaca) linkage group 1. In this study, a physical map of the PPVres locus in the PPV resistan...

'HoneySweet' plum - a valuable genetically engineered fruit-tree cultivar and germplasm resource

USDA-ARS?s Scientific Manuscript database

‘HoneySweet’ is a plum variety developed through genetic engineering to be highly resistant to plum pox potyvirus (PPV), the causal agent of sharka disease, that threatens stone-fruit industries world-wide and most specifically, in Europe. Field testing for over 15 years in Europe has demonstrated ...

A Masterpiece of Counterguerrilla Warfare: BG J. Franklin Bell in the Philippines, 1901-1902

DTIC Science & Technology

2007-01-01

their movable food supplies, including rice, palay, chickens , live stock, etc., to within the limits of the zone established at their own or nearest...epidemic of small- pox break out in any protected zone. Therefore the importance of prompt completion of this compulsory vaccination should be impressed

World Epidemiology Review No. 99

DTIC Science & Technology

1978-08-02

by microbes Brucellosis, bacterial anthrax, symptomatic anthrax, aviary cholera, sheep pox, farcy in cattle, aphthous fever, bluetongue , heartwater...equine epizootic lymphangitis, Teschen’s disease, hemorrhagic septicemia, tuberculosis, rabies, equine and bovine plague, swine salmonellosis... bovine peripneumonia. 57 Some of these diseases, whose list is far from exhaustive, are infectious. Others are contagious, and finally, a certain number

THE SCHOOL HEALTH AND SAFETY PROGRAM.

ERIC Educational Resources Information Center

1963

INVOLVING INDIVIDUALS AS WELL AS ORGANIZATIONS, THE PROGRAM AIMED AT THE OPTIMUM HEALTH OF ALL CHILDREN, AND IMPROVEMENT OF HEALTH AND SAFETY STANDARDS WITHIN THE COMMUNITY. EACH OF THE CHILDREN WAS URGED TO HAVE A SUCCESSFUL VACCINATION FOR SMALL POX, THE DPT SERIES AND BOOSTER, THE POLIO SERIES, AND CORRECTIONS OF ALL DENTAL DEFECTS AND…

Robust Research and Rapid Response: The Plum Pox Virus Story

ERIC Educational Resources Information Center

Alter, Theodore R.; Bridger, Jeffrey C.; Travis, James W.

2004-01-01

Universities are frequently criticized for being unresponsive to the needs of their stakeholders. In response to this perception, many institutions of higher learning have taken steps to become more productively engaged with the people, organizations, and communities they serve. In this article, we analyze the process of engagement by focusing on…

‘GETTING’ THE POX

PubMed Central

Stein, Claudia

2015-01-01

This article reflects upon the recent return to linear history writing in medical history. It takes as its starting point a critique of the current return to constructivist ideas, suggesting the use of other methodological choices and interpretations to the surviving archival and textural sources of the sixteenth century pox. My investigation analyses the diagnostic act as an effort to bring together a study of medical semiotics. Medical semiotics considers how signs speak through the physical body, coached within a particular epistemology. There are no hidden meanings behind the visible sign or symptom - it is tranparent to the calculative and authoritative gaze and language of the doctor. It concerns how diseases came into being, the relationships they have constituted, the power they have secured and the actual knowledge/power they have eclipsed or are eclipsing. From such a perspective, “getting the pox” is not a bad thing. A methodological turn to medical semiotics reminds us that the history of disease should be an inquiry both into the grounds of our current knowledge and beliefs about disease and how they inspire our writing, as well as the analytical categories that establish their inevitability. PMID:26345376