Detection of Hepatozoon felis in Ticks Collected from Free-Ranging Amur Tigers ( Panthera tigris altaica), Russian Far East, 2002-12.

PubMed

Thomas, Lindsay H; Seryodkin, Ivan V; Goodrich, John M; Miquelle, Dale G; Birtles, Richard J; Lewis, John C M

2016-07-01

We collected 69 ticks from nine, free-ranging Amur tigers ( Panthera tigris altaica) between 2002 and 2011 and investigated them for tick-borne pathogens. DNA was extracted using alkaline digestion and PCR was performed to detect apicomplexan organisms. Partial 18S rDNA amplification products were obtained from 14 ticks from four tigers, of which 13 yielded unambiguous nucleotide sequence data. Comparative sequence analysis revealed all 13 partial 18S rDNA sequences were most similar to those belonging to strains of Hepatozoon felis (>564/572 base-pair identity, >99% sequence similarity). Although this tick-borne protozoon pathogen has been detected in wild felids from many parts of the world, this is the first record from the Russian Far East.

Genome-wide comparisons of phylogenetic similarities between partial genomic regions and the full-length genome in Hepatitis E virus genotyping.

PubMed

Wang, Shuai; Wei, Wei; Luo, Xuenong; Cai, Xuepeng

2014-01-01

Besides the complete genome, different partial genomic sequences of Hepatitis E virus (HEV) have been used in genotyping studies, making it difficult to compare the results based on them. No commonly agreed partial region for HEV genotyping has been determined. In this study, we used a statistical method to evaluate the phylogenetic performance of each partial genomic sequence from a genome wide, by comparisons of evolutionary distances between genomic regions and the full-length genomes of 101 HEV isolates to identify short genomic regions that can reproduce HEV genotype assignments based on full-length genomes. Several genomic regions, especially one genomic region at the 3'-terminal of the papain-like cysteine protease domain, were detected to have relatively high phylogenetic correlations with the full-length genome. Phylogenetic analyses confirmed the identical performances between these regions and the full-length genome in genotyping, in which the HEV isolates involved could be divided into reasonable genotypes. This analysis may be of value in developing a partial sequence-based consensus classification of HEV species.

Characterization of perch rhabdovirus (PRV) in farmed grayling Thymallus thymallus.

PubMed

Gadd, Tuija; Viljamaa-Dirks, Satu; Holopainen, Riikka; Koski, Perttu; Jakava-Viljanen, Miia

2013-10-11

Two Finnish fish farms experienced elevated mortality rates in farmed grayling Thymallus thymallus fry during the summer months, most typically in July. The mortalities occurred during several years and were connected with a few neurological disorders and peritonitis. Virological investigation detected an infection with an unknown rhabdovirus. Based on the entire glycoprotein (G) and partial RNA polymerase (L) gene sequences, the virus was classified as a perch rhabdovirus (PRV). Pairwise comparisons of the G and L gene regions of grayling isolates revealed that all isolates were very closely related, with 99 to 100% nucleotide identity, which suggests the same origin of infection. Phylogenetic analysis demonstrated that they were closely related to the strain isolated from perch Perca fluviatilis and sea trout Salmo trutta trutta caught from the Baltic Sea. The entire G gene sequences revealed that all Finnish grayling isolates, and both the perch and sea trout isolates, were most closely related to a PRV isolated in France in 2004. According to the partial L gene sequences, all of the Finnish grayling isolates were most closely related to the Danish isolate DK5533 from pike. The genetic analysis of entire G gene and partial L gene sequences showed that the Finnish brown trout isolate ka907_87 shared only approximately 67 and 78% identity, respectively, with our grayling isolates. The grayling isolates were also analysed by an immunofluorescence antibody test. This is the first report of a PRV causing disease in grayling in Finland.

Characterizing partial AZFc deletions of the Y chromosome with amplicon-specific sequence markers

PubMed Central

Navarro-Costa, Paulo; Pereira, Luísa; Alves, Cíntia; Gusmão, Leonor; Proença, Carmen; Marques-Vidal, Pedro; Rocha, Tiago; Correia, Sónia C; Jorge, Sónia; Neves, António; Soares, Ana P; Nunes, Joaquim; Calhaz-Jorge, Carlos; Amorim, António; Plancha, Carlos E; Gonçalves, João

2007-01-01

Background The AZFc region of the human Y chromosome is a highly recombinogenic locus containing multi-copy male fertility genes located in repeated DNA blocks (amplicons). These AZFc gene families exhibit slight sequence variations between copies which are considered to have functional relevance. Yet, partial AZFc deletions yield phenotypes ranging from normospermia to azoospermia, thwarting definite conclusions on their real impact on fertility. Results The amplicon content of partial AZFc deletion products was characterized with novel amplicon-specific sequence markers. Data indicate that partial AZFc deletions are a male infertility risk [odds ratio: 5.6 (95% CI: 1.6–30.1)] and although high diversity of partial deletion products and sequence conversion profiles were recorded, the AZFc marker profiles detected in fertile men were also observed in infertile men. Additionally, the assessment of rearrangement recurrence by Y-lineage analysis indicated that while partial AZFc deletions occurred in highly diverse samples, haplotype diversity was minimal in fertile men sharing identical marker profiles. Conclusion Although partial AZFc deletion products are highly heterogeneous in terms of amplicon content, this plasticity is not sufficient to account for the observed phenotypical variance. The lack of causative association between the deletion of specific gene copies and infertility suggests that AZFc gene content might be part of a multifactorial network, with Y-lineage evolution emerging as a possible phenotype modulator. PMID:17903263

Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

PubMed

Zhao, Ya-E; Wu, Li-Ping

2012-09-01

To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

PubMed

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Enterocin T, a novel class IIa bacteriocin produced by Enterococcus sp. 812.

PubMed

Chen, Yi-Sheng; Yu, Chi-Rong; Ji, Si-Hua; Liou, Min-Shiuan; Leong, Kun-Hon; Pan, Shwu-Fen; Wu, Hui-Chung; Lin, Yu-Hsuan; Yu, Bi; Yanagida, Fujitoshi

2013-09-01

Enterococcus sp. 812, isolated from fresh broccoli, was previously found to produce a bacteriocin active against a number of Gram-positive bacteria, including Listeria monocytogenes. Bacteriocin activity decreased slightly after autoclaving (121 °C for 15 min), but was inactivated by protease K. Mass spectrometry analysis revealed the bacteriocin mass to be approximately 4,521.34 Da. N-terminal amino acid sequencing yielded a partial sequence, NH2-ATYYGNGVYXDKKKXWVEWGQA, by Edman degradation, which contained the consensus class IIa bacteriocin motif YGNGV in the N-terminal region. The obtained partial sequence showed high homology with some enterococcal bacteriocins; however, no identical peptide or protein was found. This peptide was therefore considered to be a novel bacteriocin produced by Enterococcus sp. 812 and was termed enterocin T.

New Ehrlichia Species Closely Related to Ehrlichia chaffeensis Isolated from Ixodes ovatus Ticks in Japan

PubMed Central

Shibata, Shin-ichiro; Kawahara, Makoto; Rikihisa, Yasuko; Fujita, Hiromi; Watanabe, Yuriko; Suto, Chiharu; Ito, Tadahiko

2000-01-01

Seven Ehrlichia strains (six HF strains and one Anan strain) that were obtained from laboratory mice by intraperitoneally inoculating homogenates of adult Ixodes ovatus collected in Japan were characterized. 16S rRNA sequences of all six HF strains were identical, and the sequences were 99.7, 98.2, and 97.7% identical to those of Anan strain, Ehrlichia chaffeensis (human monocytic ehrlichiosis agent), and E. muris, respectively. Partial GroEL amino acid sequencing also revealed that the six HF strains had identical sequences, which were 99.0, 98.5, and 97.3% identical to those of E. chaffeensis, the Anan strain, and E. canis, respectively. All HF strains were lethal to mice at higher dosages and intraperitoneal inoculation, whereas the Anan or E. muris strain induced only mild clinical signs. Light and electron microscopy of moribund mice inoculated with one of the HF strains revealed severe liver necrosis and the presence of numerous ehrlichial inclusions (morulae) in various organs. The study revealed that members of E. canis genogroup are naturally present in Ixodes ticks. HF strains that can cause severe illness in immunocompetent laboratory mice would be valuable in studying the pathogenesis and the roles of both cellular and humoral immune responses in ehrlichiosis caused by E. canis genogroup. PMID:10747103

Isolation and characterisation of a pod dehiscence zone-specific polygalacturonase from Brassica napus.

PubMed

Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B

1996-06-01

Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.

In vitro isolation and molecular characterization of an Ehrlichia canis strain from São Paulo, Brazil

PubMed Central

Aguiar, Daniel M.; Hagiwara, Mitika K.; Labruna, Marcelo B.

2008-01-01

An Ehrlichia canis isolate was obtained from an naturally infected dog exhibiting clinical signs of ehrlichiosis in São Paulo Municipality, state of São Paulo, Brazil. The isolate was characterized by PCR and DNA sequencing of portions of the ehrlichial genes dsb, 16SrRNA, and p28. Partial dsb and 16S rRNA sequences were identical to three and five other E. canis strains, respectively, from different countries and continents (including North America, Africa, Asia and Europe). Conversely, the p28 partial sequence for this E. canis (São Paulo) differed by 1, 2, and 2 nucleotides from the corresponding sequences of the E. canis strains Jake (from USA), Oklahoma (USA), and VHE (Venezuela), respectively. The results in this study indicate that E. canis is the only recognized Ehrlichia species infecting dogs in Brazil. PMID:24031251

A Systematic Approach for Discovering Novel, Clinically Relevant Bacteria

PubMed Central

Simmon, Keith E.; Fisher, Mark A.

2012-01-01

Sequencing of the 16S rRNA gene (16S) is a reference method for bacterial identification. Its expanded use has led to increased recognition of novel bacterial species. In most clinical laboratories, novel species are infrequently encountered, and their pathogenic potential is often difficult to assess. We reviewed partial 16S sequences from >26,000 clinical isolates, analyzed during February 2006–June 2010, and identified 673 that have <99% sequence identity with valid reference sequences and are thus possibly novel species. Of these 673 isolates, 111 may represent novel genera (<95% identity). Isolates from 95 novel taxa were recovered from multiple patients, indicating possible clinical relevance. Most repeatedly encountered novel taxa belonged to the genera Nocardia (14 novel taxa, 42 isolates) and Actinomyces (12 novel taxa, 52 isolates). This systematic approach for recognition of novel species with potential diagnostic or therapeutic relevance provides a basis for epidemiologic surveys and improvement of sequence databases and may lead to identification of new clinical entities. PMID:22377371

A systematic approach for discovering novel, clinically relevant bacteria.

PubMed

Schlaberg, Robert; Simmon, Keith E; Fisher, Mark A

2012-03-01

Sequencing of the 16S rRNA gene (16S) is a reference method for bacterial identification. Its expanded use has led to increased recognition of novel bacterial species. In most clinical laboratories, novel species are infrequently encountered, and their pathogenic potential is often difficult to assess. We reviewed partial 16S sequences from >26,000 clinical isolates, analyzed during February 2006-June 2010, and identified 673 that have <99% sequence identity with valid reference sequences and are thus possibly novel species. Of these 673 isolates, 111 may represent novel genera (<95% identity). Isolates from 95 novel taxa were recovered from multiple patients, indicating possible clinical relevance. Most repeatedly encountered novel taxa belonged to the genera Nocardia (14 novel taxa, 42 isolates) and Actinomyces (12 novel taxa, 52 isolates). This systematic approach for recognition of novel species with potential diagnostic or therapeutic relevance provides a basis for epidemiologic surveys and improvement of sequence databases and may lead to identification of new clinical entities.

The complete mitochondrial genome of the Japanese ornamental koi carp (Cyprinus carpio) and its implication for the history of koi.

PubMed

Mabuchi, Kohji; Song, Hayeun

2014-02-01

Complete mitochondrial genome (mitogenome) sequences were determined for two individuals of Japanese ornamental koi carp. Interestingly, the obtained mitogenomes (16,581 bp) were both completely identical to the recently reported mitogenome of Oujiang color carp from China. Control region (CR) sequences in DNA database demonstrated that more than half (65%) of the koi carp individuals so far reported had partial or complete CR sequences identical to those from Oujiang color carp. These results might suggest that the Japanese koi carp has been originated from Chinese Oujiang color carp, contrary to the belief in Japan that the koi carps have been developed directly from carp stocks in Japan. In any case, the present results emphasize the importance of analyzing Oujiang color carp when studying the origin of koi carp.

Prevalence of Ehrlichia canis, Anaplasma platys, Babesia canis vogeli, Hepatozoon canis, Bartonella vinsonii berkhoffii, and Rickettsia spp. in dogs from Grenada.

PubMed

Yabsley, Michael J; McKibben, John; Macpherson, Calum N; Cattan, Peggy F; Cherry, Natalie A; Hegarty, Barbara C; Breitschwerdt, Edward B; O'Connor, Tom; Chandrashekar, Ramaswamy; Paterson, Tara; Perea, Marta Lanza; Ball, Geoffrey; Friesen, Stanley; Goedde, Jill; Henderson, Brooke; Sylvester, Wayne

2008-02-14

To identify the tick-borne pathogens in dogs from Grenada, we conducted a serologic survey for Ehrlichia canis in 2004 (104 dogs) and a comprehensive serologic and molecular survey for a variety of tick-borne pathogens in 2006 (73 dogs). In 2004 and 2006, 44 and 32 dogs (42.3% and 43.8%) were seropositive for E. canis, respectively. In 2006, several tick-borne pathogens were identified by serology and PCR. DNA of E. canis, Anaplasma platys, Babesia canis vogeli, Hepatozoon canis, and Bartonella sp. were identified in 18 (24.7%), 14 (19.2%), 5 (7%), 5 (7%), and 1 (1.4%) dogs, respectively. Six (8.2%) dogs were seropositive for Bartonella vinsonii subsp. berkhoffii. All dogs were seronegative and PCR-negative for Rickettsia spp. Coinfection with two or three pathogens was observed in eight dogs. Partial 16S rRNA E. canis and A. platys sequences were identical to sequences in GenBank. Partial 18S rRNA gene sequences from the Grenadian H. canis were identical to each other and had one possible mismatch (ambiguous base) from H. canis detected from Spain and Brazil. Grenadian B. c. vogeli sequences were identical to B. c. vogeli from Brazil and Japan. All of the detected pathogens are transmitted, or suspected to be transmitted, by Rhipicephalus sanguineus. Results of this study indicate that dogs from Grenada are infected with multiple tick-borne pathogens; therefore, tick-borne diseases should be included as differentials for dogs exhibiting thrombocytopenia, leukopenia, fever, or lethargy. One pathogen, E. canis, is also of potential public health significance.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

PubMed

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-12-31

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

PubMed Central

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-01-01

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215

A novel flavivirus detected in two Aedes spp. collected near the demilitarized zone of the Republic of Korea.

PubMed

Korkusol, Achareeya; Takhampunya, Ratree; Hang, Jun; Jarman, Richard G; Tippayachai, Bousaraporn; Kim, Heung-Chul; Chong, Sung-Tae; Davidson, Silas A; Klein, Terry A

2017-05-01

Flaviviruses comprise a large and diverse group of positive-stranded RNA viruses, including tick-, mosquito- and unknown-vector-borne flaviviruses. A novel flavivirus was detected in pools of Aedes vexans nipponii (n=1) and Aedes esoensis (n=3) collected in 2012 and 2013 near the demilitarized zone (DMZ), Republic of Korea (ROK). Phylogenetic analyses of the NS5, E gene and complete polyprotein coding sequence (CDS) showed that the novel virus fell within the Aedes-borne flaviviruses (ABFVs), with nucleotide identity ranging from 57.8-75.1 %, 46.1-74.2 % and 51.1-76.2 %, respectively. While the novel ABFV was distant from other flaviviruses within the group, it formed a clade with Ilomantsi virus (ILOV). Sequence alignments of the partial NS5 gene, full-length E gene and polyprotein CDS between the novel virus and ILOV showed approximately 76.2 % nucleotide identity and 90 % amino acid identity, respectively. The ABFV identified in Aedes mosquitoes from the ROK is a novel ABFV based on the sequence analyses and is designated as Panmunjeom flavivirus (PANFV).

Identification of largemouth bass virus in the introduced Northern Snakehead inhabiting the Chesapeake Bay watershed.

PubMed

Iwanowicz, L; Densmore, C; Hahn, C; McAllister, P; Odenkirk, J

2013-09-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Identification of largemouth bass virus in the introduced Northern snakehead inhabiting the Cheasapeake Bay watershed

USGS Publications Warehouse

Iwanowicz, Luke R.; Densmore, Christine L.; Hahn, Cassidy M.; McAllister, Phillip; Odenkirk, John

2013-01-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Characterization of gonadotrophin-releasing hormone precursor cDNA in the Old World mole-rat Cryptomys hottentotus pretoriae: high degree of identity with the New World guinea pig sequence.

PubMed

Kalamatianos, T; du Toit, L; Hrabovszky, E; Kalló, I; Marsh, P J; Bennett, N C; Coen, C W

2005-05-01

Regulation of pituitary gonadotrophins by the decapeptide gonadotrophin-releasing hormone 1 (GnRH1) is crucial for the development and maintenance of reproductive functions. A common amino acid sequence for this decapeptide, designated as 'mammalian' GnRH, has been identified in all mammals thus far investigated with the exception of the guinea pig, in which there are two amino acid substitutions. Among hystricognath rodents, the members of the family Bathyergidae regulate reproduction in response to diverse cues. Thus, highveld mole-rats (Cryptomys hottentotus pretoriae) are social bathyergids in which breeding is restricted to a particular season in the dominant female, but continuously suppressed in subordinate colony members. Elucidation of reproductive control in these animals will be facilitated by characterization of their GnRH1 gene. A partial sequence of GnRH1 precursor cDNA was isolated and characterized. Comparative analysis revealed the highest degree of identity (86%) to guinea pig GnRH1 precursor mRNA. Nevertheless, the deduced amino acid sequence of the mole-rat decapeptide is identical to the 'mammalian' sequence rather than that of guinea pigs. Successful detection of GnRH1-synthesizing neurones using either a guinea pig GnRH1 riboprobe or an antibody against the 'mammalian' decapeptide is consistent with the guinea pig-like sequence for the precursor and the classic 'mammalian' form for the decapeptide. The high degree of identity in the GnRH1 precursor sequence between this Old World mole-rat and the New World guinea pig is consistent with the theory that caviomorphs and phiomorphs originated from a common ancestral line in the Palaeocene to mid Eocene, some 63-45 million years ago.

Prevalence and genetic characterization of eimeriid coccidia from feces of black-necked cranes, Grus nigricollis.

PubMed

Liang, Yu; Zhao, ZiJiao; Hu, JunJie; Esch, Gerald W; Peng, MingChun; Liu, Qiong; Chen, JinQing

2018-03-01

Disseminated visceral coccidiosis (DVC) is a widely distributed intestinal and extraintestinal disease of cranes caused by eimeriid coccidia and has lethal pathogenicity to several crane species. Here, feces of 164 black-necked cranes collected in Dashanbao Black-necked Crane National Nature Reserve, China, were examined to determine the prevalence of coccidial oocysts. Of the 164 fecal samples, 76 (46.3%) were positive for oocysts of Eimeria, including E. gruis in 59 (35.9%), E. reichenowi in 52 (31.7%), and E. bosquei in 47 (28.7%) by microscopic observation. Sixty-eight (89.5%) of these positive samples included two or more morphologically identifiable species of Eimeria. The nearly full length 18S rRNA gene (18S rRNA; about 1.8 kb) and partial mitochondrial cytochrome c oxidase I gene (COX1; about 1.3 kb) from oocysts of each morphologically distinct species of Eimeria were amplified, sequenced, and analyzed. BLAST searches using these new 18S rRNA sequences for E. gruis, E. reichenowi, or E. bosquei showed the most similar sequences were those of E. gruis (98.7-99.7% identity), E. reichenowi (97.9-100% identity), or E. gruis (98.6-99.6% identity) isolated from different species of Grus. BLAST searches using the new COX1 sequences for the three species of Eimeria showed that no nucleotide sequences of Eimeria and Isospora coccidia in GenBank have more than 83.0% identity with these species. Identities among the new COX1 sequences were 91.8% for E. gruis and E. reichenowi, 94.5% for E. gruis and E. bosquei, and 91.3% for E. reichenowi and E. bosquei. Phylogenetic analysis based on 18S rRNA or COX1 sequences indicated that Eimeria spp. in black-necked cranes were clustered together with other previously identified Eimeria species from different cranes.

Molecular characterization of Calocedrus rupestris Aver., H.T. Nguyen & L.K. Phan, 2008 (Cupressaceae) based on ITS1 partial sequence.

PubMed

Long, P K; Trang, N T P; Averyanov, L V; Loc, P K

2011-11-21

Calocedrus rupestris Aver., H.T. Nguyen & L.K. Phan was described in 2008 based on some morphological characters that were not sufficiently significant to discriminate it as a species distinct from C. macrolepis Kurz. We applied a new approach to resolve these conflicting views by using sequence data from DNA (ITS) to elucidate phylogenetic relationships between the two species. Analyses of a partial ITS1 sequence in 5 individuals of 2 subpopulations of C. macrolepis and 18 individuals of 8 subpopulations of C. rupestris collected in Vietnam were done. Molecular characterization of the two species showed its low divergence with the lack of autapomorphic characters. In addition, the ITS1 partial sequences of some C. rupestris individuals were identical with C. macrolepis. Due to the less distinctive morphology between C. rupestris and C. macrolepis, the divergence between them does not exceed the interspecific levels, and therefore, C. rupestris could not be regarded as an independent species in relation to C. macrolepis but only as one of its varieties, C. macrolepis var. rupestris (Aver., H.T. Nguyen & L.K. Phan) L.K. Phan, Long K. Phan & Aver.

Sequence diversity of wheat mosaic virus isolates.

PubMed

Stewart, Lucy R

2016-02-02

Wheat mosaic virus (WMoV), transmitted by eriophyid wheat curl mites (Aceria tosichella) is the causal agent of High Plains disease in wheat and maize. WMoV and other members of the genus Emaravirus evaded thorough molecular characterization for many years due to the experimental challenges of mite transmission and manipulating multisegmented negative sense RNA genomes. Recently, the complete genome sequence of a Nebraska isolate of WMoV revealed eight segments, plus a variant sequence of the nucleocapsid protein-encoding segment. Here, near-complete and partial consensus sequences of five more WMoV isolates are reported and compared to the Nebraska isolate: an Ohio maize isolate (GG1), a Kansas barley isolate (KS7), and three Ohio wheat isolates (H1, K1, W1). Results show two distinct groups of WMoV isolates: Ohio wheat isolate RNA segments had 84% or lower nucleotide sequence identity to the NE isolate, whereas GG1 and KS7 had 98% or higher nucleotide sequence identity to the NE isolate. Knowledge of the sequence variability of WMoV isolates is a step toward understanding virus biology, and potentially explaining observed biological variation. Published by Elsevier B.V.

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

PubMed

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

PubMed Central

Chang, Wei Shan

2014-01-01

Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria.

PubMed

Oluwayelu, D O; Todd, D; Olaleye, O D

2008-12-01

This work reports the first molecular analysis study of chicken anaemia virus (CAV) in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6% and 4% nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2% amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/CI-8 and NGR/CI-9) were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

Analysis of 16S-23S intergenic spacer regions of the rRNA operons in Edwardsiella ictaluri and Edwardsiella tarda isolates from fish.

PubMed

Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H

2005-01-01

To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.

Molecular characterization of trichomonads from feces of dogs with diarrhea.

PubMed

Gookin, Jody L; Birkenheuer, Adam J; St John, Victoria; Spector, Michelle; Levy, Michael G

2005-08-01

Trichomonads are occasionally observed in the feces of dogs with diarrhea. On the basis of superficial morphological appearance, these infections have been attributed to opportunistic overgrowth of the commensal, Pentatrichomonas hominis. However, molecular characterization of canine trichomonads has never been reported. This study was performed to determine, by means of rRNA gene sequence analysis, the identity of trichomonads observed in feces from dogs with diarrhea. Total DNA was isolated from fecal samples obtained from a 3-mo-old mixed breed dog and litter of German Shepherd puppies having profuse liquid diarrhea containing numerous trichomonads. Total DNA was subject to PCR amplification of partial 18S rRNA gene or 5.8S, ITS1, ITS2, and partial 18S and 28S rRNA genes using species-specific and universal primers, respectively. Products of 642 and 1864 base-pair length were amplified and cloned. On the basis of rRNA gene sequence, the trichomonads observed in the single dog and the litter of puppies shared 100% identity with Tritrichomonas foetus and P. hominis, respectively. The present study is the first to establish the molecular identity of trichomonads infecting dogs with diarrhea. These studies validate the longstanding assumption that canine trichomoniasis may be attributed to P. hominis. Importantly, these studies additionally recognize that canine trichomoniasis may also be caused by infection with T. foetus.

Molecular homogeneity of heat-stable enterotoxins produced by bovine enterotoxigenic Escherichia coli.

PubMed Central

Saeed, A M; Magnuson, N S; Sriranganathan, N; Burger, D; Cosand, W

1984-01-01

Heat-stable enterotoxins (STs) from four strains of bovine enterotoxigenic Escherichia coli representing four serogroups were purified to homogeneity by utilizing previously published purification schemata. Biochemical characterization of the purified STs showed that they met the basic criteria for the heat-stable enterotoxins of E. coli. Amino acid analysis of the purified STs revealed that they were peptides of identical amino acid composition. This composition consisted of 18 residues of 10 different amino acids, 6 of which were cysteine. The amino acid composition of the four ST peptides was identical to that reported for the STs of human and porcine E. coli. In addition, complete sequence analysis of two of the ST peptides and partial sequencing of several others revealed strong homology to the sequences of STs from human and porcine E. coli and to the sequence predicted from the last 18 codons of the transposon Tn1681. There was also substantial homology to the sequence predicted from the ST-coding genetic element of human E. coli, which may indicate the existence of identical bioactive configuration among ST peptides of E. coli strains of various host origins. These data support the hypothesis that STs produced by human, bovine, and porcine E. coli are coded by a closely related genetic element which may have originated from a single, widely disseminated transposon. Images PMID:6376355

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

Morphologic and Molecular Characterization of a Demodex (Acari: Demodicidae) Species from White-Tailed Deer (Odocoileus virginianus)

PubMed Central

Yabsley, Michael J.; Clay, Sarah E.; Gibbs, Samantha E. J.; Cunningham, Mark W.; Austel, Michaela G.

2013-01-01

Demodex mites, although usually nonpathogenic, can cause a wide range of dermatological lesions ranging from mild skin irritation and alopecia to severe furunculosis. Recently, a case of demodicosis from a white-tailed deer (Odocoileus virginianus) revealed a Demodex species morphologically distinct from Demodex odocoilei. All life cycle stages were considerably larger than D. odocoilei and although similar in size to D. kutzeri and D. acutipes from European cervids, numerous morphometrics distinguished the four species. Adult males and females were 209.1 ± 13.1 and 225.5 ± 13.4 μm in length, respectively. Ova, larva, and nymphs measured 65.1 ± 4.1, 124.9 ± 11.6, and 205.1 ± 19.4 μm in length, respectively. For phylogenetic analyses, a portion of the 18S rRNA gene was amplified and sequenced from samples of the WTD Demodex sp., two Demodex samples from domestic dogs, and Demodex ursi from a black bear. Phylogenetic analyses indicated that the WTD Demodex was most similar to D. musculi from laboratory mice. A partial sequence from D. ursi was identical to the WTD Demodex sequence; however, these two species can be differentiated morphologically. This paper describes a second Demodex species from white-tailed deer and indicates that 18S rRNA is useful for phylogenetic analysis of most Demodex species, but two morphologically distinct species had identical partial sequences. Additional gene targets should be investigated for phylogenetic and parasite-host association studies. PMID:27335854

Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

PubMed

El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

2013-07-01

Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

Primary structure of Lep d I, the main Lepidoglyphus destructor allergen.

PubMed

Varela, J; Ventas, P; Carreira, J; Barbas, J A; Gimenez-Gallego, G; Polo, F

1994-10-01

The most relevant allergen of the storage mite Lepidoglyphus destructor (Lep d I) has been characterized. Lep d I is a monomer protein of 13273 Da. The primary structure of Lep d I was determined by N-terminal Edman degradation and partially confirmed by cDNA sequencing. Sequence polymorphism was observed at six positions, with non-conservative substitutions in three of them. No potential N-glycosylation site was revealed by peptide sequencing. The 125-residue sequence of Lep d I shows approximately 40% identity (including the six cysteines) with the overlapping regions of group II allergens from the genus Dermatophagoides, which, however, do not share common allergenic epitopes with Lep d I.

A New Zamilon-like Virophage Partial Genome Assembled from a Bioreactor Metagenome

PubMed Central

Bekliz, Meriem; Verneau, Jonathan; Benamar, Samia; Raoult, Didier; La Scola, Bernard; Colson, Philippe

2015-01-01

Virophages replicate within viral factories inside the Acanthamoeba cytoplasm, and decrease the infectivity and replication of their associated giant viruses. Culture isolation and metagenome analyses have suggested that they are common in our environment. By screening metagenomic databases in search of amoebal viruses, we detected virophage-related sequences among sequences generated from the same non-aerated bioreactor metagenome as recently screened by another team for virophage capsid-encoding genes. We describe here the assembled partial genome of a virophage closely related to Zamilon, which infects Acanthamoeba with mimiviruses of lineages B and C but not A. Searches for sequences related to amoebal giant viruses, other Megavirales representatives and virophages were conducted using BLAST against this bioreactor metagenome (PRJNA73603). Comparative genomic and phylogenetic analyses were performed using sequences from previously identified virophages. A total of 72 metagenome contigs generated from the bioreactor were identified as best matching with sequences from Megavirales representatives, mostly Pithovirus sibericum, pandoraviruses and amoebal mimiviruses from three lineages A–C, as well as from virophages. In addition, a partial genome from a Zamilon-like virophage, we named Zamilon 2, was assembled. This genome has a size of 6716 base pairs, corresponding to 39% of the Zamilon genome, and comprises partial or full-length homologs for 15 Zamilon predicted open reading frames (ORFs). Mean nucleotide and amino acid identities for these 15 Zamilon 2 ORFs with their Zamilon counterparts were 89% (range, 81–96%) and 91% (range, 78–99%), respectively. Notably, these ORFs included two encoding a capsid protein and a packaging ATPase. Comparative genomics and phylogenetic analyses indicated that the partial genome was that of a new Zamilon-like virophage. Further studies are needed to gain better knowledge of the tropism and prevalence of virophages in our biosphere and in humans. PMID:26640459

Molecular characterization of Atractolytocestus sagittatus (Cestoda: Caryophyllidea), monozoic parasite of common carp, and its differentiation from the invasive species Atractolytocestus huronensis.

PubMed

Bazsalovicsová, Eva; Králová-Hromadová, Ivica; Stefka, Jan; Scholz, Tomáš

2012-05-01

Sequence structure of complete internal transcribed spacer 1 and 2 (ITS1 and ITS2) of the ribosomal DNA region and partial mitochondrial cytochrome c oxidase subunit I (cox1) gene sequences were studied in the monozoic tapeworm Atractolytocestus sagittatus (Kulakovskaya et Akhmerov, 1965) (Cestoda: Caryophyllidea), a parasite of common carp (Cyprinus carpio carpio L.). Intraindividual sequence diversity was observed in both ribosomal spacers. In ITS1, a total number of 19 recombinant clones yielded eight different sequence types (pairwise sequence identity, 99.7-100%) which, however, did not resemble the structure typical for divergent intragenomic ITS copies (paralogues). Polymorphism was displayed by several single nucleotide mutations present exclusively in single clones, but variation in the number of short repetitive motifs was not observed. In ITS2, a total of 21 recombinant clones yielded ten different sequence types (pairwise sequence identity, 97.5-100%). They were mostly characterized by a varying number of (TCGT)(n) repeats resulting in assortment of ITS2 sequences into two sequence variants, which reflected the structure specific for ITS paralogues. The third DNA region analysed, mitochondrial cox1 gene (669 bp) was detected to be 100% identical in all studied A. sagittatus individuals. Comparison of molecular data on A. sagittatus with those on Atractolytocestus huronensis Anthony, 1958, an invasive parasite of common carp, has shown that interspecific differences significantly exceeded intraspecific variation in both ribosomal spacers (81.4-82.5% in ITS1, 74.4-75.2% in ITS2) as well as in mitochondrial cox1, which confirms validity of both congeneric tapeworms parasitic in the same fish host.

The tapeworm Atractolytocestus tenuicollis (Cestoda: Caryophyllidea)--a sister species or ancestor of an invasive A. huronensis?

PubMed

Králová-Hromadová, Ivica; Štefka, Jan; Bazsalovicsová, Eva; Bokorová, Silvia; Oros, Mikuláš

2013-10-01

Atractolytocestus tenuicollis (Li, 1964) Xi, Wang, Wu, Gao et Nie, 2009 is a monozoic, non-segmented tapeworm of the order Caryophyllidea, parasitizing exclusively common carp (Cyprinus carpio L.). In the current work, the first molecular data, in particular complete ribosomal internal transcribed spacer 2 (ITS2) and partial mitochondrial cytochrome c oxidase subunit I (cox1) on A. tenuicollis from Niushan Lake, Wuhan, China, are provided. In order to evaluate molecular interrelationships within Atractolytocestus, the data on A. tenuicollis were compared with relevant data on two other congeners, Atractolytocestus huronensis and Atractolytocestus sagittatus. Divergent intragenomic copies (ITS2 paralogues) were detected in the ITS2 ribosomal spacer of A. tenuicollis; the same phenomenon has previously been observed also in two other congeners. ITS2 structure of A. tenuicollis was very similar to that of A. huronensis from Slovakia, USA and UK; overall pairwise sequence identity was 91.7-95.2%. On the other hand, values of sequence identity between A. tenuicollis and A. sagittatus were lower, 69.7-70.9%. Cox1 sequence, analysed in five A. tenuicollis individuals, were 100 % identical and no intraspecific variation was observed. Comparison of A. tenuicollis cox1 with respective sequences of two other Atractolytocestus species showed that the mitochondrial haplotype found in Chinese A. tenuicollis is structurally specific (haplotype 4; Ha4) and differs from all so far determined Atractolytocestus haplotypes (Ha1 and Ha2 for A. huronensis; Ha3 for A. sagittatus). Pairwise sequence identity between A. tenuicollis cox1 haplotype and remaining three haplotypes followed the same pattern as in ITS2. The nucleotide and amino acide (aa) sequence comparison with A. huronensis Ha1 and Ha2 revealed higher sequence identity, 90.3-90.8% (96.9% in aa), while lower values were achieved between A. tenuicollis haplotype and Ha3 of Japanese A. sagittatus-75.2 % (81.9 % in aa). The phylogenetic analyses using cox1, ITS2 and combined cox1 + ITS2 sequences revealed close genetic interrelationship between A. tenuicollis and A. huronensis. Independently of a type of analysis and DNA region used, the topology of obtained trees was always identical; A. tenuicollis formed separate clade with A. huronensis forming a closely related sister group.

Molecular phylogeny of some avian species using Cytochrome b gene sequence analysis

PubMed Central

Awad, A; Khalil, S. R; Abd-Elhakim, Y. M

2015-01-01

Veritable identification and differentiation of avian species is a vital step in conservative, taxonomic, forensic, legal and other ornithological interventions. Therefore, this study involved the application of molecular approach to identify some avian species i.e. Chicken (Gallus gallus), Muskovy duck (Cairina moschata), Japanese quail (Coturnix japonica), Laughing dove (Streptopelia senegalensis), and Rock pigeon (Columba livia). Genomic DNA was extracted from blood samples and partial sequence of the mitochondrial cytochrome b gene (358 bp) was amplified and sequenced using universal primers. Sequences alignment and phylogenetic analyses were performed by CLC main workbench program. The obtained five sequences were deposited in GenBank and compared with those previously registered in GenBank. The similarity percentage was 88.60% between Gallus gallus and Coturnix japonica and 80.46% between Gallus gallus and Columba livia. The percentage of identity between the studied species and GenBank species ranged from 77.20% (Columba oenas and Anas platyrhynchos) to 100% (Gallus gallus and Gallus sonneratii, Coturnix coturnix and Coturnix japonica, Meleagris gallopavo and Columba livia). Amplification of the partial sequence of mitochondrial cytochrome b gene proved to be practical for identification of an avian species unambiguously. PMID:27175180

Random Amplification and Pyrosequencing for Identification of Novel Viral Genome Sequences

PubMed Central

Hang, Jun; Forshey, Brett M.; Kochel, Tadeusz J.; Li, Tao; Solórzano, Víctor Fiestas; Halsey, Eric S.; Kuschner, Robert A.

2012-01-01

ssRNA viruses have high levels of genomic divergence, which can lead to difficulty in genomic characterization of new viruses using traditional PCR amplification and sequencing methods. In this study, random reverse transcription, anchored random PCR amplification, and high-throughput pyrosequencing were used to identify orthobunyavirus sequences from total RNA extracted from viral cultures of acute febrile illness specimens. Draft genome sequence for the orthobunyavirus L segment was assembled and sequentially extended using de novo assembly contigs from pyrosequencing reads and orthobunyavirus sequences in GenBank as guidance. Accuracy and continuous coverage were achieved by mapping all reads to the L segment draft sequence. Subsequently, RT-PCR and Sanger sequencing were used to complete the genome sequence. The complete L segment was found to be 6936 bases in length, encoding a 2248-aa putative RNA polymerase. The identified L segment was distinct from previously published South American orthobunyaviruses, sharing 63% and 54% identity at the nucleotide and amino acid level, respectively, with the complete Oropouche virus L segment and 73% and 81% identity at the nucleotide and amino acid level, respectively, with a partial Caraparu virus L segment. The result demonstrated the effectiveness of a sequence-independent amplification and next-generation sequencing approach for obtaining complete viral genomes from total nucleic acid extracts and its use in pathogen discovery. PMID:22468136

Cloning of novel cellulases from cellulolytic fungi: heterologous expression of a family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris.

PubMed

Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana

2011-12-10

Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.

PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.

PubMed

Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q

2007-01-01

Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.

Diversity of partial RNA-dependent RNA polymerase gene sequences of soybean blotchy mosaic virus isolates from different host-, geographical- and temporal origins.

PubMed

Strydom, Elrea; Pietersen, Gerhard

2018-05-01

Infection of soybean by the plant cytorhabdovirus soybean blotchy mosaic virus (SbBMV) results in significant yield losses in the temperate, lower-lying soybean production regions of South Africa. A 277 bp portion of the RNA-dependent RNA polymerase gene of 66 SbBMV isolates from different: hosts, geographical locations in South Africa, and times of collection (spanning 16 years) were amplified by RT-PCR and sequenced to investigate the genetic diversity of isolates. Phylogenetic reconstruction revealed three main lineages, designated Groups A, B and C, with isolates grouping primarily according to geographic origin. Pairwise nucleotide identities ranged between 85.7% and 100% among all isolates, with isolates in Group A exhibiting the highest degree of sequence identity, and isolates of Groups A and B being more closely related to each other than to those in Group C. This is the first study investigating the genetic diversity of SbBMV.

Identification of a novel aviadenovirus, designated pigeon adenovirus 2 in domestic pigeons (Columba livia).

PubMed

Teske, L; Rubbenstroth, D; Meixner, M; Liere, K; Bartels, H; Rautenschlein, S

2017-01-02

The young pigeon disease syndrome (YPDS) affects mainly young pigeons of less than one year of age and leads to crop stasis, vomitus, diarrhea, anorexia and occasionally death. This disease is internationally a major health problem because of its seasonal appearance during competitions such as homing pigeon races or exhibitions of ornamental birds. While the etiology of YPDS is still unclear, adenoviruses are frequently discussed as potential causative agents. Electron microscopy of feces from a YPDS outbreak revealed massive shedding of adenovirus-like particles. Whole genome sequencing of this sample identified a novel adenovirus tentatively named pigeon adenovirus 2 (PiAdV-2). Phylogenetic and comparative genome analysis suggest PiAdV-2 to belong to a new species within the genus Aviadenovirus, for which we propose the name Pigeon aviadenovirus B. The PiAdV-2 genome shares 54.9% nucleotide sequence identity with pigeon adenovirus 1 (PiAdV-1). In a screening of further YPDS-affected flocks two variants of PiAdV-2 (variant A and B) were detected which shared 97.6% nucleotide identity of partial polymerase sequences, but only 79.7% nucleotide identity of partial hexon sequences. The distribution of both PiAdV-2 variants was further investigated in fecal samples collected between 2008 and 2015 from healthy or YPDS-affected racing pigeons of different lofts. Independent of their health status, approximately 20% of young and 13% of adult pigeon flocks harbored PiAdV-2 variants. Birds were free of PiAdV-1 or other aviadenoviruses as determined by PCRs targeting the aviadenovirus polymerase or the PiAdV-1 fiber gene, respectively. In conclusion, there is no indication of a correlation between YPDS outbreaks and the presence of PiAdV-2 or other aviadenoviruses, arguing against an causative role in this disease complex. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of a third feline Demodex species through partial sequencing of the 16S rDNA and frequency of Demodex species in 74 cats using a PCR assay.

PubMed

Ferreira, Diana; Sastre, Natalia; Ravera, Iván; Altet, Laura; Francino, Olga; Bardagí, Mar; Ferrer, Lluís

2015-08-01

Demodex cati and Demodex gatoi are considered the two Demodex species of cats. However, several reports have identified Demodex mites morphologically different from these two species. The differentiation of Demodex mites is usually based on morphology, but within the same species different morphologies can occur. DNA amplification/sequencing has been used effectively to identify and differentiate Demodex mites in humans, dogs and cats. The aim was to develop a PCR technique to identify feline Demodex mites and use this technique to investigate the frequency of Demodex in cats. Demodex cati, D. gatoi and Demodex mites classified morphologically as the third unnamed feline species were obtained. Hair samples were taken from 74 cats. DNA was extracted; a 330 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of D. cati and D. gatoi shared >98% identity with those published on GenBank. The sequence of the third unnamed species showed 98% identity with a recently published feline Demodex sequence and only 75.2 and 70.9% identity with D. gatoi and D. cati sequences, respectively. Demodex DNA was detected in 19 of 74 cats tested; 11 DNA sequences corresponded to Demodex canis, five to Demodex folliculorum, three to D. cati and two to Demodex brevis. Three Demodex species can be found in cats, because the third unnamed Demodex species is likely to be a distinct species. Apart from D. cati and D. gatoi, DNA from D. canis, D. folliculorum and D. brevis was found on feline skin. © 2015 ESVD and ACVD.

Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus.

PubMed

Kim, Byoung-Jun; Kim, Ga-Na; Kim, Bo-Ram; Shim, Tae-Sun; Kook, Yoon-Hoh; Kim, Bum-Joon

2017-01-01

Recent multi locus sequence typing (MLST) and genome based studies indicate that lateral gene transfer (LGT) events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas), we applied rpoB typing (711 bp) to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp). The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60) genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46), showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41) PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated.

Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus

PubMed Central

Kim, Byoung-Jun; Kim, Ga-Na; Kim, Bo-Ram; Shim, Tae-Sun; Kook, Yoon-Hoh

2017-01-01

Recent multi locus sequence typing (MLST) and genome based studies indicate that lateral gene transfer (LGT) events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas), we applied rpoB typing (711 bp) to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp). The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60) genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46), showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41) PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated. PMID:28604829

Spatial capture–recapture with partial identity: An application to camera traps

USGS Publications Warehouse

Augustine, Ben C.; Royle, J. Andrew; Kelly, Marcella J.; Satter, Christopher B.; Alonso, Robert S.; Boydston, Erin E.; Crooks, Kevin R.

2018-01-01

Camera trapping surveys frequently capture individuals whose identity is only known from a single flank. The most widely used methods for incorporating these partial identity individuals into density analyses discard some of the partial identity capture histories, reducing precision, and, while not previously recognized, introducing bias. Here, we present the spatial partial identity model (SPIM), which uses the spatial location where partial identity samples are captured to probabilistically resolve their complete identities, allowing all partial identity samples to be used in the analysis. We show that the SPIM outperforms other analytical alternatives. We then apply the SPIM to an ocelot data set collected on a trapping array with double-camera stations and a bobcat data set collected on a trapping array with single-camera stations. The SPIM improves inference in both cases and, in the ocelot example, individual sex is determined from photographs used to further resolve partial identities—one of which is resolved to near certainty. The SPIM opens the door for the investigation of trapping designs that deviate from the standard two camera design, the combination of other data types between which identities cannot be deterministically linked, and can be extended to the problem of partial genotypes.

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov.

PubMed Central

Doroghazi, J. R.; Ju, K.-S.; Metcalf, W. W.

2014-01-01

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with five other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these other species, including Streptomyces almquistii NRRL B-1685T, Streptomyces flocculus NRRL B-2465T, Streptomyces gibsonii NRRL B-1335T and Streptomyces rangoonensis NRRL B-12378T are quite similar. This cluster is of particular taxonomic interest because Streptomyces albus is the type species of the genus Streptomyces. The related strains were subjected to multilocus sequence analysis (MLSA) utilizing partial sequences of the housekeeping genes atpD, gyrB, recA, rpoB and trpB and confirmation of previously reported phenotypic characteristics. The five strains formed a coherent cluster supported by a 100 % bootstrap value in phylogenetic trees generated from sequence alignments prepared by concatenating the sequences of the housekeeping genes, and identical tree topology was observed using various different tree-making algorithms. Moreover, all but one strain, S. flocculus NRRL B-2465T, exhibited identical sequences for all of the five housekeeping gene loci sequenced, but NRRL B-2465T still exhibited an MLSA evolutionary distance of 0.005 from the other strains, a value that is lower than the 0.007 MLSA evolutionary distance threshold proposed for species-level relatedness. These data support a proposal to reclassify S. almquistii, S. flocculus, S. gibsonii and S. rangoonensis as later heterotypic synonyms of S. albus with NRRL B-1811T as the type strain. The MLSA sequence database also demonstrated utility for quickly and conclusively confirming that numerous strains within the ARS Culture Collection had been previously misidentified as subspecies of S. albus and that Streptomyces albus subsp. pathocidicus should be redescribed as a novel species, Streptomyces pathocidini sp. nov., with the type strain NRRL B-24287T. PMID:24277863

Molecular characterisation of Sarcocystis lutrae n. sp. and Toxoplasma gondii from the musculature of two Eurasian otters (Lutra lutra) in Norway.

PubMed

Gjerde, Bjørn; Josefsen, Terje D

2015-03-01

Sarcocysts were detected in routinely processed histological sections of skeletal muscle, but not cardiac muscle, of two adult male otters (Lutra lutra; Mustelidae) from northern Norway following their post-mortem examination in 1999 and 2000. The sarcocysts were slender, spindle-shaped, up to 970 μm long and 35-70 μm in greatest diameter. The sarcocyst wall was thin (∼ 0.5 μm) and smooth with no visible protrusions. Portions of unfixed diaphragm of both animals were collected at the autopsies and kept frozen for about 14 years pending further examination. When the study was resumed in 2013, the thawed muscle samples were examined for sarcocysts under a stereo microscope, but none could be found. Genomic DNA was therefore extracted from a total of 36 small pieces of the diaphragm from both otters, and samples found to contain Sarcocystidae DNA were used selectively for PCR amplification and sequencing of the nuclear 18S and 28S ribosomal (r) RNA genes and internal transcribed spacer 1 (ITS1) region, as well as the mitochondrial cytochrome b (cytb) and cytochrome c oxidase subunit 1 (cox1) genes. Sequence comparisons revealed that both otters were infected by the same Sarcocystis sp. and that there was no genetic variation (100 % identity) among sequenced isolates at the 18S and 28S rRNA genes (six identical isolates at both loci) or at cox1 (13 identical isolates). PCR products comprising the ITS1 region, on the other hand, had to be cloned before sequencing due to intraspecific sequence variation. A total of 33 clones were sequenced, and the identities between them were 97.9-99.9 %. These sequences were most similar (93.7-96.0 % identity) to a sequence of Sarcocystis kalvikus from the wolverine in Canada, but the phylogenetic analyses placed all of them as a monophyletic sister group to S. kalvikus. Hence, they were considered to represent a novel species, which was named Sarcocystis lutrae. Sequence comparisons and phylogenetic analyses based on sequences of the 18S and 28S rRNA genes and cox1, for which little or no sequence data were available for S. kalvikus, revealed that S. lutrae otherwise was most closely related to various Sarcocystis spp. using birds or carnivores as intermediate hosts. The cox1 sequences of S. lutrae from the otters were identical to two sequences from an arctic fox, which in a previous study had been assigned to Sarcocystis arctica due to a high identity (99.4 %) with the latter species at this gene and a complete identity with S. arctica at three other loci when using the same DNA samples as templates for PCR reactions. Additional PCR amplifications and sequencing of cox1 (ten sequences) and the ITS1 region (four sequences) using four DNA samples from this fox as templates again generated cox1 sequences exclusively of S. lutrae, but ITS1 sequences of S. arctica, and thus confirmed that this arctic fox had acted as intermediate host for both S. arctica and S. lutrae. Based on the phylogenetic placement of S. lutrae, the geographical location of infected animals (otters, arctic fox) and the distribution of carnivores/raptors which may have interacted with them, the white-tailed eagle (Haliaeetus albicilla) seems to be a possible definitive host of S. lutrae. Some of the muscle samples from both otters were shown to harbour stages of Toxoplasma gondii through PCR amplification and sequencing of the entire ITS1 region (five isolates) and/or the partial cytb (eight isolates) and cox1 (one isolate). These sequences were identical to several previous sequences of T. gondii in GenBank. Thus, both otters had a dual infection with S. lutrae and T. gondii.

Epidemic Keratoconjunctivitis Due to the Novel Hexon-Chimeric-Intermediate 22,37/H8 Human Adenovirus ▿

PubMed Central

Aoki, Koki; Ishiko, Hiroaki; Konno, Tsunetada; Shimada, Yasushi; Hayashi, Akio; Kaneko, Hisatoshi; Ohguchi, Takeshi; Tagawa, Yoshitsugu; Ohno, Shigeaki; Yamazaki, Shudo

2008-01-01

In a 2-month period in 2003, we encountered an outbreak of epidemic keratoconjunctivitis (EKC) in Japan. We detected 67 human adenoviruses (HAdVs) by PCR from eye swabs of patients with EKC at five eye clinics in different parts of Japan. Forty-one of the 67 HAdV DNAs from the swabs were identified as HAdV-37 by phylogenetic analysis using a partial hexon gene sequence. When the restriction patterns of these viral genomes were compared with that of the HAdV-37 prototype strain, one isolate showed a never-before-seen restriction pattern. Within 1 year, we encountered three more EKC cases caused by a genetically identical virus: two nosocomial infections at two different university hospitals and a sporadic infection at an eye clinic. We determined the nucleotide sequences of the full-length hexon and fiber genes of these isolates and compared them to those of the 51 prototype strains. Surprisingly, the sequence of the hexon (ɛ determinant) loop-1 and -2 regions showed the highest nucleotide identity with HAdV-22, a rare EKC isolate. However, the nucleotide sequence of the fiber gene was identical to that of the HAdV-8 prototype strain. 22 We propose that this virus is a new hexon-chimeric intermediate HAdV-22,37/H8, and may be an etiological agent of EKC. PMID:18701656

Partial sequencing analysis of the NS5B region confirmed the predominance of hepatitis C virus genotype 1 infection in Jeddah, Saudi Arabia.

PubMed

El Hadad, Sahar; Al-Hamdan, Hesa; Linjawi, Sabah

2017-01-01

Chronic hepatitis C virus (HCV) infection and its progression are major health problems that many countries including Saudi Arabia are facing. Determination of HCV genotypes and subgenotypes is critical for epidemiological and clinical analysis and aids in the determination of the ideal treatment strategy that needs to be followed and the expected therapy response. Although HCV infection has been identified as the second most predominant type of hepatitis in Saudi Arabia, little is known about the molecular epidemiology and genetic variability of HCV circulating in the Jeddah province of Saudi Arabia. The aim of this study was to determine the dominance of various HCV genotypes and subgenotypes circulating in Jeddah using partial sequencing of the NS5B region. To the best of our knowledge, this is the first study of its kind in Saudi Arabia. To characterize HCV genotypes and subgenotypes, serum samples from 56 patients with chronic HCV infection were collected and subjected to partial NS5B gene amplification and sequence analysis. Phylogenetic analysis of the NS5B partial sequences revealed that HCV/1 was the predominant genotype (73%), followed by HCV/4 (24.49%) and HCV/3 (2.04%). Moreover, pairwise analysis also confirmed these results based on the average specific nucleotide distance identity: ±0.112, ±0.112, and ±0.179 for HCV/1, HCV/4, and HCV/3, respectively, without any interference between genotypes. Notably, the phylogenetic tree of the HCV/1 subgenotypes revealed that all the isolates (100%) from the present study belonged to the HCV/1a subgenotype. Our findings also revealed similarities in the nucleotide sequences between HCV circulating in Saudi Arabia and those circulating in countries such as Morocco, Egypt, Canada, India, Pakistan, and France. These results indicated that determination of HCV genotypes and subgenotypes based on partial sequence analysis of the NS5B region is accurate and reliable for HCV subtype determination.

Molecular characterization of the ribosomal DNA unit of Sarcocystis singaporensis, Sarcocystis zamani and Sarcocystis zuoi from rodents in Thailand

PubMed Central

WATTHANAKAIWAN, Vichan; SUKMAK, Manakorn; HAMARIT, Kriengsak; KAOLIM, Nongnid; WAJJWALKU, Worawidh; MUANGKRAM, Yuttamol

2017-01-01

Sarcocystis species are heteroxenous cyst-forming coccidian protozoan parasites with a wide host range, including rodents. In this study, Sarcocystis spp. samples were isolated from Bandicota indica, Rattus argentiventer, R. tiomanicus and R. norvegicus across five provinces of Thailand. Two major groups of Sarcocystis cysts were determined in this study: large and small cysts. By sequence comparisons and phylogenetic analyses based on the partial sequences of 28S ribosomal DNA, the large cysts showed the highest identity value (99%) with the S. zamani in GenBank database. While the small cysts could be divided into 2 groups of Sarcocystis: S. singaporensis and presupposed S. zuoi. The further analysis on 18S rDNA supported that the 2 isolates (S2 and B6 no.2) were as identified as S. singaporensis shared a high sequence identity with the S. singaporensis in GenBank database and the unidentified Sarcocystis (4 isolates, i.e., B6 no.10, B6 no.12, B10 no.4 and B10 no.7) showed 96.3–99.5% identity to S. zuoi as well as high distinct identity from others Sarcocystis spp. (≤93%). The result indicated that these four samples should be S. zuoi. In this study, we provided complete sequence of internal transcribed spacer 1 (ITS1), 5.8S rDNA and internal transcribed spacer 2 (ITS2) of these three Sarcocystis species and our new primer set could be useful to study the evolution of Sarcocystis. PMID:28701623

Molecular characterization of the ribosomal DNA unit of Sarcocystis singaporensis, Sarcocystis zamani and Sarcocystis zuoi from rodents in Thailand.

PubMed

Watthanakaiwan, Vichan; Sukmak, Manakorn; Hamarit, Kriengsak; Kaolim, Nongnid; Wajjwalku, Worawidh; Muangkram, Yuttamol

2017-08-18

Sarcocystis species are heteroxenous cyst-forming coccidian protozoan parasites with a wide host range, including rodents. In this study, Sarcocystis spp. samples were isolated from Bandicota indica, Rattus argentiventer, R. tiomanicus and R. norvegicus across five provinces of Thailand. Two major groups of Sarcocystis cysts were determined in this study: large and small cysts. By sequence comparisons and phylogenetic analyses based on the partial sequences of 28S ribosomal DNA, the large cysts showed the highest identity value (99%) with the S. zamani in GenBank database. While the small cysts could be divided into 2 groups of Sarcocystis: S. singaporensis and presupposed S. zuoi. The further analysis on 18S rDNA supported that the 2 isolates (S2 and B6 no.2) were as identified as S. singaporensis shared a high sequence identity with the S. singaporensis in GenBank database and the unidentified Sarcocystis (4 isolates, i.e., B6 no.10, B6 no.12, B10 no.4 and B10 no.7) showed 96.3-99.5% identity to S. zuoi as well as high distinct identity from others Sarcocystis spp. (≤93%). The result indicated that these four samples should be S. zuoi. In this study, we provided complete sequence of internal transcribed spacer 1 (ITS1), 5.8S rDNA and internal transcribed spacer 2 (ITS2) of these three Sarcocystis species and our new primer set could be useful to study the evolution of Sarcocystis.

Distribution and molecular diversity of three cucurbit-infecting poleroviruses in China.

PubMed

Shang, Qiao-xia; Xiang, Hai-ying; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

2009-11-01

Cucurbit aphid-borne yellows virus (CABYV) and Melon aphid-borne yellows virus (MABYV) have been found to be associated with cucurbit yellowing disease in China. Our report identifies for the first time a third distinct polerovirus, tentatively named Suakwa aphid-borne yellows virus (SABYV), infecting Suakwa vegetable sponge. To better understand the distribution and molecular diversity of these three poleroviruses infecting cucurbits, a total of 214 cucurbitaceous crop samples were collected from 25 provinces in China, and were investigated by RT-PCR and sequencing. Of these, 108 samples tested positive for CABYV, while 40 samples from five provinces were positive for MABYV, and SABYV was detected in only 4 samples which were collected in the southern part of China. Forty-one PCR-amplified fragments containing a portion of the RdRp gene, intergenic NCR and CP gene were cloned and sequenced. Sequence comparisons showed that CABYV isolates shared 78.0-79.2% nucleotide sequence identity with MABYV isolates, and 69.7-70.8% with SABYV. Sequence identity between MABYV and SABYV was 73.3-76.5%. In contrast, the nucleotide identities within each species were 93.2-98.7% (CABYV), 98.1-99.9% (MABYV), and 96.1-98.6% (SABYV). Phylogenetic analyses revealed that the polerovirus isolates fit into three distinct groups, corresponding to the three species. The CABYV group could be further divided into two subgroups: the Asia subgroup and the Mediterranean subgroup, based on CP gene and partial RdRp gene sequences. Recombination analysis suggested that MABYV may be a recombinant virus.

Shark complement: an assessment.

PubMed

Smith, S L

1998-12-01

The classical (CCP) and alternative (ACP) pathways of complement activation have been established for the nurse shark (Ginglymostoma cirratum). The isolation of a cDNA clone encoding a mannan-binding protein-associated serine protease (MASP)-1-like protein from the Japanese dogfish (Triakis scyllia) suggests the presence of a lectin pathway. The CCP consists of six functionally distinct components: C1n, C2n, C3n, C4n, C8n and C9n, and is activated by immune complexes in the presence of Ca++ and Mg++ ions. The ACP is antibody independent, requiring Mg++ ions and a heat-labile 90 kDa factor B-like protein for activity. Proteins considered homologues of C1q, C3 and C4 (C2n) of the mammalian complement system have been isolated from nurse shark serum. Shark C1q is composed of at least two chain types each showing 50% identity to human C1q chains A and B. Partial sequence of the globular domain of one of the chains shows it to be C1q-like rather than like mannan-binding protein. N-terminal amino acid sequences of the alpha and beta chain of shark C3 and C4 molecules show significant identity with corresponding human C3 and C4 chains. A sequence representing shark C4 gamma chain, shows little similarity to human C4 gamma chain. The terminal shark components C8n and C9n are functional analogues of mammalian C8 and C9. Anaphylatoxin activity has been demonstrated in activated shark serum, and porcine C5a desArg induces shark leucocyte chemotaxis. The deduced amino acid sequence of a partial C3 cDNA clone from the nurse shark shows 50%, 30% and 24% homology with the corresponding region of mammalian C3, C4 and alpha 2-macroglobulin. Deduced amino acid sequence data from partial Bf/C2 cDNA clones, two from the nurse shark and one from the Japanese dogfish, suggest that at least one species of elasmobranch has two distinct Bf/C2 genes.

Detection and partial molecular characterization of atypical plum pox virus isolates from naturally infected sour cherry.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna

2013-06-01

Atypical isolates of plum pox virus (PPV) were discovered in naturally infected sour cherry in urban ornamental plantings in Moscow, Russia. The isolates were detected by polyclonal double antibody sandwich ELISA and RT-PCR using universal primers specific for the 3'-non-coding and coat protein (CP) regions of the genome but failed to be recognized by triple antibody sandwich ELISA with the universal monoclonal antibody 5B and by RT-PCR using primers specific to for PPV strains D, M, C and W. Sequence analysis of the CP genes of nine isolates revealed 99.2-100 % within-group identity and 62-85 % identity to conventional PPV strains. Phylogenetic analysis showed that the atypical isolates represent a group that is distinct from the known PPV strains. Alignment of the N-terminal amino acid sequences of CP demonstrated their close similarity to those of a new tentative PPV strain, CR.

Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil

PubMed Central

Oliveira, L.P.; Cardozo, G.P.; Santos, E.V.; Mansur, M.A.B.; Donini, I.A.N.; Zissou, V.G.; Roberto, P.G.; Marins, M.

2009-01-01

The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto. PMID:24031351

New record of Ascaridia nymphii (Secernentea: Ascaridiidae) from macaw parrot, Ara chloroptera, in China.

PubMed

Yang, Fang; Zhang, Pan; Shi, Xianli; Li, Kangxin; Wang, Minwei; Fu, Yeqi; Yan, Xinxin; Hang, Jianxiong; Li, Guoqing

2018-06-01

Present study was performed to identify the species of ascarids from macaw parrot, Ara chloroptera, in China. Total 6 ascarids (3 males and 3 females) were collected in the feces of 3 macaws at Guangzhou Zoo in Guangdong Province, China. Their morphological characteristics with dimensions were observed under a light microscope, and their genetic characters were analyzed with the partial 18S rDNA, ITS rDNA and nad4 gene sequences, respectively. Results showed that all worms have no interlabia but male worms have two alate spicules, well-developed precloacal sucker and a tail with ventrolateral caudal alae and 11 pairs of papillae. The partial 18S rDNA, ITS rDNA and nad4 sequences were 831bp, 1015bp and 394bp in length, respectively. They showed the highest similarity of 99.8% (18S rDNA) with Ascaridia nymphii, 93.8% identities (ITS rDNA) with A. columbae and 98.5% to 99.5% identities (nad4) with Ascaridia sp. from infected parrot. All Ascaridia nematodes from the macaws were clustered into one clade and formed monophyletic group of Ascaridia with A. columbae and A. galli in two phylogenetic trees. It is observed that the combining morphological and sequencing data from three loci, the present Ascaridia species was identified as Ascaridia nymphii, which is the first record of A. nymphii from macaw parrot in China. Copyright © 2018 Elsevier B.V. All rights reserved.

Nucleotide sequences of Japanese isolates of citrus vein enation virus.

PubMed

Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru

2017-03-01

The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.

Molecular characterization and phylogenetic analysis of Sugarcane yellow leaf virus isolates from China.

PubMed

Gao, San-Ji; Lin, Yi-Hua; Pan, Yong-Bao; Damaj, Mona B; Wang, Qin-Nan; Mirkov, T Erik; Chen, Ru-Kai

2012-10-01

Sugarcane yellow leaf virus (SCYLV) (genus Polerovirus, family Luteoviridae), the causal agent of sugarcane yellow leaf disease (YLD), was first detected in China in 2006. To assess the distribution of SCYLV in the major sugarcane-growing Chinese provinces, leaf samples from 22 sugarcane clones (Saccharum spp. hybrid) showing YLD symptoms were collected and analyzed for infection by the virus using reverse transcription PCR (RT-PCR), quantitative RT-PCR, and immunological assays. A complete genomic sequence (5,879 nt) of the Chinese SCYLV isolate CHN-FJ1 and partial genomic sequences (2,915 nt) of 13 other Chinese SCYLV isolates from this study were amplified, cloned, and sequenced. The genomic sequence of the CHN-FJ1 isolate was found to share a high identity (98.4-99.1 %) with those of the Brazilian (BRA) genotype isolates and a low identity (86.5-86.9 %) with those of the CHN1 and Cuban (CUB) genotype isolates. The genetic diversity of these 14 Chinese SCYLV isolates was assessed along with that of 29 SCYLV isolates of worldwide origin reported in the GenBank database, based on the full or partial genomic sequence. Phylogenetic analysis demonstrated that all the 14 Chinese SCYLV isolates clustered into one large group with the BRA genotype and 12 other reported SCYLV isolates. In addition, five reported Chinese SCYLV isolates were grouped with the Peruvian (PER), CHN1 and CUB genotypes. We therefore speculated that at least four SCYLV genotypes, BRA, PER, CHN1, and CUB, are associated with YLD in China. Interestingly, a 39-nt deletion was detected in the sequence of the CHN-GD3 isolate, in the middle of the ORF1 region adjacent to the overlap between ORF1 and ORF2. This location is known to be one of the recombination breakpoints in the Luteoviridae family.

How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

PubMed

Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

2018-03-15

The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA gene sequences at some threshold of nucleotide identity, typically 97% or 98.5%. Here, we explore how well this strategy reflects the more accurate whole-genome-based proxies and determine the frequency with which the high conservation of 16S rRNA sequences masks substantial species-level diversity. Copyright © 2018 American Society for Microbiology.

Molecular epidemiology of the rabies virus in Slovenia 1994-2010.

PubMed

Rihtarič, D; Hostnik, P; Grom, J; Toplak, I

2011-08-26

A molecular epidemiology study was performed on a selection of 30 rabies-positive brain samples collected between 1994 and 2010 in Slovenia and originating from the red fox (n=19), badger (n=3), cattle (n=3), dog (n=2), cat (n=1), marten (n=1) and horse (n=1). Based on the comparison of 1092 and 672 nucleotide sequences of nucleoprotein (N) and partial glycoprotein (G) gene regions, a low genetic diversity of the circulating strains was detected, but both phylogenetic trees were consistent with the topology where partial nucleoprotein or glycoprotein genes were used. A high sequence identity in the N and G gene to rabies virus isolates from neighbouring countries was found. The Slovenian strains were clearly different from the vaccine strains SAD B19 and SAD Bern, which have been used in Slovenia since 1988. Copyright © 2011 Elsevier B.V. All rights reserved.

Characterization of a novel variant of Mycobacterium chimaera.

PubMed

van Ingen, J; Hoefsloot, W; Buijtels, P C A M; Tortoli, E; Supply, P; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

2012-09-01

In this study, nonchromogenic mycobacteria were isolated from pulmonary samples of three patients in the Netherlands. All isolates had identical, unique 16S rRNA gene and 16S-23S ITS sequences, which were closely related to those of Mycobacterium chimaera and Mycobacterium marseillense. The biochemical features of the isolates differed slightly from those of M. chimaera, suggesting that the isolates may represent a possible separate species within the Mycobacterium avium complex (MAC). However, the cell-wall mycolic acid pattern, analysed by HPLC, and the partial sequences of the hsp65 and rpoB genes were identical to those of M. chimaera. We concluded that the isolates represent a novel variant of M. chimaera. The results of this analysis have led us to question the currently used methods of species definition for members of the genus Mycobacterium, which are based largely on 16S rRNA or rpoB gene sequencing. Definitions based on a single genetic target are likely to be insufficient. Genetic divergence, especially in the MAC, yields strains that cannot be confidently assigned to a specific species based on the analysis of a single genetic target.

Cloning and sequencing of the cDNA species for mammalian dimeric dihydrodiol dehydrogenases.

PubMed Central

Arimitsu, E; Aoki, S; Ishikura, S; Nakanishi, K; Matsuura, K; Hara, A

1999-01-01

Cynomolgus and Japanese monkey kidneys, dog and pig livers and rabbit lens contain dimeric dihydrodiol dehydrogenase (EC 1.3.1.20) associated with high carbonyl reductase activity. Here we have isolated cDNA species for the dimeric enzymes by reverse transcriptase-PCR from human intestine in addition to the above five animal tissues. The amino acid sequences deduced from the monkey, pig and dog cDNA species perfectly matched the partial sequences of peptides digested from the respective enzymes of these animal tissues, and active recombinant proteins were expressed in a bacterial system from the monkey and human cDNA species. Northern blot analysis revealed the existence of a single 1.3 kb mRNA species for the enzyme in these animal tissues. The human enzyme shared 94%, 85%, 84% and 82% amino acid identity with the enzymes of the two monkey strains (their sequences were identical), the dog, the pig and the rabbit respectively. The sequences of the primate enzymes consisted of 335 amino acid residues and lacked one amino acid compared with the other animal enzymes. In contrast with previous reports that other types of dihydrodiol dehydrogenase, carbonyl reductases and enzymes with either activity belong to the aldo-keto reductase family or the short-chain dehydrogenase/reductase family, dimeric dihydrodiol dehydrogenase showed no sequence similarity with the members of the two protein families. The dimeric enzyme aligned with low degrees of identity (14-25%) with several prokaryotic proteins, in which 47 residues are strictly or highly conserved. Thus dimeric dihydrodiol dehydrogenase has a primary structure distinct from the previously known mammalian enzymes and is suggested to constitute a novel protein family with the prokaryotic proteins. PMID:10477285

Cloning and Characterization of the Lactococcal Plasmid-Encoded Type II Restriction/Modification System, LlaDII

PubMed Central

Madsen, Annette; Josephsen, Jytte

1998-01-01

The LlaDII restriction/modification (R/M) system was found on the naturally occurring 8.9-kb plasmid pHW393 in Lactococcus lactis subsp. cremoris W39. A 2.4-kb PstI-EcoRI fragment inserted into the Escherichia coli-L. lactis shuttle vector pCI3340 conferred to L. lactis LM2301 and L. lactis SMQ86 resistance against representatives of the three most common lactococcal phage species: 936, P335, and c2. The LlaDII endonuclease was partially purified and found to recognize and cleave the sequence 5′-GC↓NGC-3′, where the arrow indicates the cleavage site. It is thus an isoschizomer of the commercially available restriction endonuclease Fnu4HI. Sequencing of the 2.4-kb PstI-EcoRI fragment revealed two open reading frames arranged tandemly and separated by a 105-bp intergenic region. The endonuclease gene of 543 bp preceded the methylase gene of 954 bp. The deduced amino acid sequence of the LlaDII R/M system showed high homology to that of its only sequenced isoschizomer, Bsp6I from Bacillus sp. strain RFL6, with 41% identity between the endonucleases and 60% identity between the methylases. The genetic organizations of the LlaDII and Bsp6I R/M systems are identical. Both methylases have two recognition sites (5′-GCGGC-3′ and 5′-GCCGC-3′) forming a putative stem-loop structure spanning part of the presumed −35 sequence and part of the intervening region between the −35 and −10 sequences. Alignment of the LlaDII and Bsp6I methylases with other m5C methylases showed that the protein primary structures possessed the same organization. PMID:9647810

The human homolog of S. cerevisiae CDC27, CDC27 Hs, is encoded by a highly conserved intronless gene present in multiple copies in the human genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Devor, E.J.; Dill-Devor, R.M.

1994-09-01

We have obtained a number of unique sequences via PCR amplification of human genomic DNA using degenerate primers under low stringency (42{degrees}C). One of these, an 853 bp product, has been identified as a partial genomic sequence of the human homolog of the S. cerevisiae CDC27 gene, CDC27Hs (GenBank No. U00001). This gene, reported by Turgendreich et al. is also designated EST00556 from Adams et al. We have undertaken a more detailed examination of our sequence, MCP34N, and have found that: 1. the genomic sequence is nearly identical to CDC27Hs over its entire 853 bp length; 2. an MCP34N-specific PCRmore » assay of several non-human primate species reveals amplification products in chimpanzee and gorilla genomes having greater than 90% sequence identity with CDC27Hs; and 3. an MCP34N-specific PCR assay of the BIOS hybrid cell line panel gives a discordancy pattern suggesting multiple loci. Based upon these data, we present the following initial characterization: 1. the complete MCP34N sequence identity with CDC27Hs indicates that the latter is encoded by an intronless gene; 2. CDC27Hs is highly conserved among higher primates; and 3. CDC27Hs is present in multiple copies in the human genome. These characteristics, taken together with those initially reported for CDC27Hs, suggest that this is an old gene that carries out an important but, as yet, unknown function in the human brain.« less

A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

PubMed

Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

2017-11-01

Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

The morphological and molecular identity of Longidorus piceicola Lišková, Robbins & Brown, 1997 from Romania (Nematoda, Dorylaimida)

PubMed Central

Groza, Mariana; Lazarova, Stela; Luca, Francesca De; Fanelli, Elena; Milka Elshishka; Radoslavov, Georgi; Hristov, Peter; Coman, Mihaela; Peneva, Vlada

2017-01-01

Abstract Longidorus piceicola, a new geographical and host record from Romania, was described and illustrated on the basis of two populations originating from a coniferous and a deciduous forest. The main morphological characters of specimens from Romania correspond very well with the type material collected from the soil around Picea abies L. (Slovakia) except for the shorter body and tail. The D2-D3 fragment of 28S rDNA from both populations was amplified and sequenced, and the sequences were identical to L. piceicola sequence from Slovakia. The partial 18S-ITS1-5.8S-ITS2 rDNA regions from one of the populations were sequenced for the first time. The evolutionary relationships between L. piceicola and the closest species L. intermedius based on D2-D3 sequence divergence and single-nucleotide polymorphisms are discussed. Although having very low sequence dissimilarity (0.3–0.9 %) both species have distinct morphology and biology. Longidorus piceicola differs from L. intermedius in having a much longer odontostyle, body, distance anterior end - guide ring, a wider lip region, more ventromedian supplements (11 vs 5–7) in the male, and develops through four rather than three juvenile stages. Furthermore, L. piceicola occurs more frequently in association with conifers, while L. intermedius is found mainly in oak forests. PMID:28769632

Molecular identification and partial sequence analysis of an aryl hydrocarbon receptor from beluga (Delphinapterus leucas)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jensen, B.A.; Hahn, M.E.

1995-12-31

The aryl hydrocarbon receptor (AhR) mediates the effects of many common and potentially toxic organic hydrocarbons, including some polychlorinated biphenyls and dioxins. Since small cetaceans often inhabit industrially polluted coastal waters, comparison of the molecular structure and function of this protein in cetaeans with other marine and mammalian species is important for evaluating the sensitivity of cetaceans to these pollutants. An AhR protein has been identified in beluga liver by photoaffinity labeling. In the present study, the authors sought to clone and sequence an AhR cDNA from beluga as a prelude to studying its structure and function, using reverse-transcription polymerasemore » chain reaction (RT-PCR) and degenerate primers, a 515 base pair fragment was amplified, cloned and sequenced, revealing homology to the PAS domain (ligand binding and dimerization region) of AhRs from terrestrial mammals. This portion of the putative beluga AhR has 82% amino acid and 81% nucleotide sequence identity to the mouse AhR, and 63% amino acid and 64% nucleotide sequence identity to an AhR from the marine fish Fundulus heteroclitus. A beluga cDNA library was synthesized and is currently being screened with the PCR-generated fragment to obtain the complete coding sequence. This is the first molecular evidence of AhR presence in cetaceans.« less

A new variant of antimetabolic protein, arcelin from an Indian bean, Lablab purpureus (Linn.) and its effect on the stored product pest, Callosobruchus maculatus.

PubMed

Janarthanan, Sundaram; Sakthivelkumar, Shanmugavel; Veeramani, Velayutham; Radhika, Dixit; Muthukrishanan, Subbaratnam

2012-12-15

The anti-metabolic or insecticidal gene, arcelin (Arl) was isolated, cloned and sequenced using sequence specific degenerate primers from the seeds of Lablab purpureus collected from the Western Ghats, Tamil Nadu, India. The L. purpureus arcelin nucleotide sequence was homologous to Arl-3 and Arl-4 alleles from Phaseolus spp. The protein it encodes has 70% amino acid identity with the amino acid sequences of Arl-3I, Arl-3III, Arl-4 precursor, Arl-4 and Arl-4I. The partially purified arcelin from the seeds of L. purpureus using an artificial diet confirmed the complete retardation of development of the stored product pest Callosobruchus maculatus at 0.2% w/w arcelin-incorporated artificial seeds. Copyright © 2012 Elsevier Ltd. All rights reserved.

Tick-borne bacteria in free-living jaguars (Panthera onca) in Pantanal, Brazil.

PubMed

Widmer, Cynthia E; Azevedo, Fernando C C; Almeida, Aliny P; Ferreira, Fernando; Labruna, Marcelo B

2011-08-01

Tick-borne bacteria were investigated in 10 free-living jaguars and their ticks in the Pantanal biome, Brazil. Jaguar sera were tested by indirect fluorescent antibody assays using Rickettsia rickettsii, Rickettsia parkeri, Rickettsia amblyommii, Rickettsia rhipicephali, Rickettsia felis, Rickettsia bellii, Ehrlichia canis, and Coxiella burnetii as crude antigens. All 10 jaguar sera reacted (titer ≥ 64) to at least one Rickettsia species; 4 and 3 sera reacted with E. canis and C. burnetii, respectively. One jaguar presented antibody titer to R. parkeri at least fourfold higher than those to any of the other five Rickettsia antigens, suggesting that this animal was infected by R. parkeri. Ticks collected from jaguars included the species Amblyomma cajennense, Amblyomma triste, and Rhipicephalus (Boophilus) microplus. No Rickettsia DNA was detected in jaguar blood samples, but an A. triste specimen collected on a jaguar was shown by PCR to be infected by R. parkeri. The blood of two jaguars and samples of A. triste, A. cajennense, and Amblyomma sp. yielded Ehrlichia DNA by PCR targeting the ehrlichial genes 16S rRNA and dsb. Partial DNA sequences obtained from PCR products resulted in a new ehrlichial strain, here designated as Ehrlichia sp. strain Jaguar. A partial DNA sequence of the 16S rRNA gene of this novel strain showed to be closest (99.0%) to uncultured strains of Ehrlichia sp. from Japan and Russia and 98.7% identical to different strains of Ehrlichia ruminantium. The ehrlichial dsb partial sequence of strain jaguar showed to be at most 80.7% identical to any Ehrlichia species or genotype available in GenBank. Through phylogenetic analysis, Ehrlichia sp. strain jaguar grouped in a cluster, albeit distantly, with different genotypes of E. ruminantium. Results highlight risks for human and animal health, considering that cattle ranching and ecotourism are major economic activities in the Pantanal region of Brazil.

Molecular characterization of Echinococcus granulosus isolates from Bulgarian human cystic echinococcosis patients.

PubMed

Marinova, Irina; Spiliotis, Markus; Wang, Junhua; Muhtarov, Marin; Chaligiannis, Ilias; Sotiraki, Smaro; Rainova, Iskra; Gottstein, Bruno; Boubaker, Ghalia

2017-03-01

Although cystic echinococcosis (CE) is highly endemic in Bulgaria, there is still scarce information about species and/or genotypes of the Echinococcus granulosus complex that infect humans. Our study tackled the genetic diversity of E. granulosus complex in a cohort of 30 Bulgarian CE patients. Ten animal E. granulosus isolates from neighboring Greece were additionally included. Specimens were comparatively analyzed for partial sequences of five mitochondrial (mt) (cox I, nad I, rrnS, rrnL, and atp6) and three nuclear (nc) genes (act II, hbx 2, and ef-1α) using a PCR-sequencing approach. All 30 Bulgarian isolates were identified as E. granulosus sensu stricto (s.s.) and were showing identical sequences for each of the three examined partial nc gene markers. Based upon concatenated sequences from partial mtDNA markers, we detected 10 haplotypes: 6 haplotypes (H1-H6) clustering with E. granulosus s.s. (G1) and 4 haplotypes (H9-H13) grouping with E. granulosus s.s. (G3), with H1 and H10 being the most frequent in Bulgarian patients. The haplotypes H1, H4, and H11 were also present in Greek hydatid cyst samples of animal origin. In conclusion, E. granulosus s.s. (G1 and G3 genotypes) is the only causative agent found so far to cause human CE in Bulgaria. However, further studies including larger sample sizes and other additional geographic regions in Bulgaria will have to be performed to confirm our results.

Donkey Orchid Symptomless Virus: A Viral ‘Platypus’ from Australian Terrestrial Orchids

PubMed Central

Wylie, Stephen J.; Li, Hua; Jones, Michael G. K.

2013-01-01

Complete and partial genome sequences of two isolates of an unusual new plant virus, designated Donkey orchid symptomless virus (DOSV) were identified using a high-throughput sequencing approach. The virus was identified from asymptomatic plants of Australian terrestrial orchid Diuris longifolia (Common donkey orchid) growing in a remnant forest patch near Perth, western Australia. DOSV was identified from two D. longifolia plants of 264 tested, and from at least one plant of 129 Caladenia latifolia (pink fairy orchid) plants tested. Phylogenetic analysis of the genome revealed open reading frames (ORF) encoding seven putative proteins of apparently disparate origins. A 69-kDa protein (ORF1) that overlapped the replicase shared low identity with MPs of plant tymoviruses (Tymoviridae). A 157-kDa replicase (ORF2) and 22-kDa coat protein (ORF4) shared 32% and 40% amino acid identity, respectively, with homologous proteins encoded by members of the plant virus family Alphaflexiviridae. A 44-kDa protein (ORF3) shared low identity with myosin and an autophagy protein from Squirrelpox virus. A 27-kDa protein (ORF5) shared no identity with described proteins. A 14-kDa protein (ORF6) shared limited sequence identity (26%) over a limited region of the envelope glycoprotein precursor of mammal-infecting Crimea-Congo hemorrhagic fever virus (Bunyaviridae). The putative 25-kDa movement protein (MP) (ORF7) shared limited (27%) identity with 3A-like MPs of members of the plant-infecting Tombusviridae and Virgaviridae. Transmissibility was shown when DOSV systemically infected Nicotiana benthamiana plants. Structure and organization of the domains within the putative replicase of DOSV suggests a common evolutionary origin with ‘potexvirus-like’ replicases of viruses within the Alphaflexiviridae and Tymoviridae, and the CP appears to be ancestral to CPs of allexiviruses (Alphaflexiviridae). The MP shares an evolutionary history with MPs of dianthoviruses, but the other putative proteins are distant from plant viruses. DOSV is not readily classified in current lower order virus taxa. PMID:24223974

Parallels between UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in Arabidopsis and Antirrhinum.

PubMed

Ingram, G C; Goodrich, J; Wilkinson, M D; Simon, R; Haughn, G W; Coen, E S

1995-09-01

The unusual floral organs (ufo) mutant of Arabidopsis has flowers with variable homeotic organ transformations and inflorescence-like characteristics. To determine the relationship between UFO and previously characterized meristem and organ identity genes, we cloned UFO and determined its expression pattern. The UFO gene shows extensive homology with FIMBRIATA (FIM), a gene mediating between meristem and organ identity genes in Antirrhinum. All three UFO mutant alleles that we sequenced are predicted to produce truncated proteins. UFO transcripts were first detected in early floral meristems, before organ identity genes had been activated. At later developmental stages, UFO expression is restricted to the junction between sepal and petal primordia. Phenotypic, genetic, and expression pattern comparisons between UFO and FIM suggest that they are cognate homologs and play a similar role in mediating between meristem and organ identity genes. However, some differences in the functions and genetic interactions of UFO and FIM were apparent, indicating that changes in partially redundant pathways have occurred during the evolutionary divergence of Arabidopsis and Antirrhinum.

Occurrence and Partial Characterization of Lettuce big vein associated virus and Mirafiori lettuce big vein virus in Lettuce in Iran.

PubMed

Alemzadeh, E; Izadpanah, K

2012-12-01

Mirafiori lettuce big vein virus (MiLBVV) and lettuce big vein associated virus (LBVaV) were found in association with big vein disease of lettuce in Iran. Analysis of part of the coat protein (CP) gene of Iranian isolates of LBVaV showed 97.1-100 % nucleotide sequence identity with other LBVaV isolates. Iranian isolates of MiLBVV belonged to subgroup A and showed 88.6-98.8 % nucleotide sequence identity with other isolates of this virus when amplified by PCR primer pair MiLV VP. The occurrence of both viruses in lettuce crop was associated with the presence of resting spores and zoosporangia of the fungus Olpidium brassicae in lettuce roots under field and greenhouse conditions. Two months after sowing lettuce seed in soil collected from a lettuce field with big vein affected plants, all seedlings were positive for LBVaV and MiLBVV, indicating soil transmission of both viruses.

Genetic diversity in Trypanosoma theileri from Sri Lankan cattle and water buffaloes.

PubMed

Yokoyama, Naoaki; Sivakumar, Thillaiampalam; Fukushi, Shintaro; Tattiyapong, Muncharee; Tuvshintulga, Bumduuren; Kothalawala, Hemal; Silva, Seekkuge Susil Priyantha; Igarashi, Ikuo; Inoue, Noboru

2015-01-30

Trypanosoma theileri is a hemoprotozoan parasite that infects various ruminant species. We investigated the epidemiology of this parasite among cattle and water buffalo populations bred in Sri Lanka, using a diagnostic PCR assay based on the cathepsin L-like protein (CATL) gene. Blood DNA samples sourced from cattle (n=316) and water buffaloes (n=320) bred in different geographical areas of Sri Lanka were PCR screened for T. theileri. Parasite DNA was detected in cattle and water buffaloes alike in all the sampling locations. The overall T. theileri-positive rate was higher in water buffaloes (15.9%) than in cattle (7.6%). Subsequently, PCR amplicons were sequenced and the partial CATL sequences were phylogenetically analyzed. The identity values for the CATL gene were 89.6-99.7% among the cattle-derived sequences, compared with values of 90.7-100% for the buffalo-derived sequences. However, the cattle-derived sequences shared 88.2-100% identity values with those from buffaloes. In the phylogenetic tree, the Sri Lankan CATL gene sequences fell into two major clades (TthI and TthII), both of which contain CATL sequences from several other countries. Although most of the CATL sequences from Sri Lankan cattle and buffaloes clustered independently, two buffalo-derived sequences were observed to be closely related to those of the Sri Lankan cattle. Furthermore, a Sri Lankan buffalo sequence clustered with CATL gene sequences from Brazilian buffalo and Thai cattle. In addition to reporting the first PCR-based survey of T. theileri among Sri Lankan-bred cattle and water buffaloes, the present study found that some of the CATL gene fragments sourced from water buffaloes shared similarity with those determined from cattle in this country. Copyright © 2014 Elsevier B.V. All rights reserved.

The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

PubMed

Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

2018-05-17

Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

PubMed Central

Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

2006-01-01

Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

PubMed

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

Lactobacillus Strain Diversity Based on Partial hsp60 Gene Sequences and Design of PCR-Restriction Fragment Length Polymorphism Assays for Species Identification and Differentiation▿ †

PubMed Central

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages. PMID:17993558

The Complete Sequence of a Human Parainfluenzavirus 4 Genome

PubMed Central

Yea, Carmen; Cheung, Rose; Collins, Carol; Adachi, Dena; Nishikawa, John; Tellier, Raymond

2009-01-01

Although the human parainfluenza virus 4 (HPIV4) has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada). The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97%) with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized. PMID:21994536

Diversity and three-dimensional structures of the alpha Mcr of the methanogenic Archaea from the anoxic region of Tucuruí Lake, in Eastern Brazilian Amazonia

PubMed Central

Santana, Priscila Bessa; Junior, Rubens Ghilardi; Alves, Claudio Nahum; Silva, Jeronimo Lameira; McCulloch, John Anthony; Schneider, Maria Paula Cruz; da Costa da Silva, Artur

2012-01-01

Methanogenic archaeans are organisms of considerable ecological and biotechnological interest that produce methane through a restricted metabolic pathway, which culminates in the reaction catalyzed by the Methyl-coenzyme M reductase (Mcr) enzyme, and results in the release of methane. Using a metagenomic approach, the gene of the α subunit of mcr (mcrα) was isolated from sediment sample from an anoxic zone, rich in decomposing organic material, obtained from the Tucuruí hydroelectric dam reservoir in eastern Brazilian Amazonia. The partial nucleotide sequences obtained were 83 to 95% similar to those available in databases, indicating a low diversity of archaeans in the reservoir. Two orders were identified - the Methanomicrobiales, and a unique Operational Taxonomic Unit (OTU) forming a clade with the Methanosarcinales according to low bootstrap values. Homology modeling was used to determine the three-dimensional (3D) structures, for this the partial nucleotide sequence of the mcrα were isolated and translated on their partial amino acid sequences. The 3D structures of the archaean Mcrα observed in the present study varied little, and presented approximately 70% identity in comparison with the Mcrα of Methanopyrus klanderi. The results demonstrated that the community of methanogenic archaeans of the anoxic C1 region of the Tucurui reservoir is relatively homogeneous. PMID:22481885

Molecular characterization of Hepatozoon sp. in cats from São Luís Island, Maranhão, Northeastern Brazil.

PubMed

de Bortoli, Caroline P; André, Marcos R; Braga, Maria do Socorro C; Machado, Rosangela Zacarias

2011-10-01

Few molecular studies have been done concerning the molecular characterization of Hepatozoon species among domestic and wild felids. The present work aimed to characterize molecularly the presence of Hepatozoon sp. DNA in cat blood samples from São Luís Island, Maranhão state, Northeastern Brazil. EDTA-whole blood samples were collected from 200 domestic cats with outdoor and wood areas access from São Luís, Maranhão, Brazil. Each sample of extracted DNA was used as a template in PCR reactions aiming to amplify a partial sequence of 18S rRNA of Hepatozoon spp. We also performed sequence alignment to establish the identity of the parasite species infecting these animals using DNA sequences based on 18S rRNA. From 200 sampled cats, Hepatozoon DNA was only found in one animal (0.5%). The found Hepatozoon DNA showed 97% of identity with Hemobartonella felis isolates 1 and 2 from Spain. When analyzing the phylogenetic tree, the found Hepatozoon DNA was in the same clade than H. felis isolates. Our findings suggest that more than one species of Hepatozoon could infect felids in Brazil.

Isolation and Molecular Characterization of Novel Infectious Bronchitis Virus Variants from Vaccinated Broiler Flocks in Egypt.

PubMed

Abdel-Sabour, Mohammed A; Al-Ebshahy, Emad M; Khaliel, Samy A; Abdel-Wanis, Nabil A; Yanai, Tokuma

2017-09-01

The present study aimed to determine the molecular characteristics of circulating infectious bronchitis virus (IBV) strains in vaccinated broiler flocks in the Giza and Fayoum governorates. Thirty-four isolates were collected, and egg propagation revealed their ability to induce typical IBV lesions after three to five successive passages. Three selected isolates were identified as IBV using a real-time reverse transcriptase-PCR assay targeted the nucleocapsid (N) gene and further characterized by partial spike (S) gene sequence analysis. Phylogenetic analysis revealed their clustering into two variant groups. Group I consisted of one variant (VSVRI_F3), which had 99.1% nucleotide sequence identity to the Q1 reference strain. Group II consisted of variants VSVRI_G4 and VSVRI_G9, which showed 92.8%-94.3% nucleotide identity with the Egyptian variants Eg/12120S/2012, Eg/12197B/2012, and Eg/1265B/2012. Regarding the deduced amino acid sequence, the three variants had 77.1%-85.2% similarity with the vaccine strains currently used in Egypt. These findings highlight the importance of monitoring the prevalence of IBV variants in vaccinated broiler flocks as well as adopting an appropriate vaccination strategy.

The leukocyte common antigen (CD45): a putative receptor-linked protein tyrosine phosphatase.

PubMed Central

Charbonneau, H; Tonks, N K; Walsh, K A; Fischer, E H

1988-01-01

A major protein tyrosine phosphatase (PTPase 1B) has been isolated in essentially homogeneous form from the soluble and particulate fractions of human placenta. Unexpectedly, partial amino acid sequences displayed no homology with the primary structures of the protein Ser/Thr phosphatases deduced from cDNA clones. However, the sequence is strikingly similar to the tandem C-terminal homologous domains of the leukocyte common antigen (CD45). A 157-residue segment of PTPase 1B displayed 40% and 33% sequence identity with corresponding regions from cytoplasmic domains I and II of human CD45. Similar degrees of identity have been observed among the catalytic domains of families of regulatory proteins such as protein kinases and cyclic nucleotide phosphodiesterases. On this basis, it is proposed that the CD45 family has protein tyrosine phosphatase activity and may represent a set of cell-surface receptors involved in signal transduction. This suggests that the repertoire of signal transduction mechanisms may include the direct control of an intracellular protein tyrosine phosphatase, offering the possibility of a regulatory balance with those protein tyrosine kinases that act at the internal surface of the membrane. Images PMID:2845400

Comparison of growth on mannitol salt agar, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, VITEK® 2 with partial sequencing of 16S rRNA gene for identification of coagulase-negative staphylococci.

PubMed

Ayeni, Funmilola A; Andersen, Camilla; Nørskov-Lauritsen, Niels

2017-04-01

Mannitol salt agar (MSA) is often used in resources' limited laboratories for identification of S. aureus however, coagulase-negative staphylococci (CoNS) grows and ferments mannitol on MSA. 171 strains of CoNS which have been previously misidentified as S. aureus due to growth on MSA were collected from different locations in Nigeria and two methods for identification of CoNS were compared i.e. ViTEK 2 and MALDI-TOF MS with partial 16S rRNA gene sequencing as gold standard. Partial tuf gene sequencing was used for contradicting identification. All 171 strains (13 species) grew on MSA and ferments mannitol. All tested strains of S. epidermidis, S. haemolyticus, S. nepalensis, S. pasteuri, S. sciuri,, S. warneri, S. xylosus, S. capitis were correctly identified by MALDI-TOF while variable identification were observed in S. saprophyticus and S. cohnii (90%, 81%). There was low identification of S. arlettae (14%) while all strains of S. kloosii and S. gallinarum were misidentified. There is absence of S. gallinarum in the MALDI-TOF database at the period of this study. All tested strains of S. epidermidis, S. gallinarum, S. haemolyticus, S. sciuri,, S. warneri, S. xylosus and S. capitis were correctly identified by ViTEK while variable identification were observed in S. saprophyticus, S. arlettae, S. cohnii, S. kloosii, (84%, 86%, 75%, 60%) and misidentification of S. nepalensis, S. pasteuri. Partial sequencing of 16S rRNA gene was used as gold standard for most strains except S. capitis and S. xylosus where the two species were misidentified by partial sequencing of 16S rRNA contrary to MALDI-TOF and ViTEK identification. Tuf gene sequencing was used for correct identification. Characteristic growth on MSA for CoNS is also identical to S. aureus growth on the media and therefore, MSA could not differentiate between S. aureus and CoNS. The percentage accuracy of ViTEK was better than MALDI-TOF in identification of CoNS. Although partial sequencing of 16S rRNA gene was used as gold standard in this study, it could not correctly identify S. capitis and S. xylosus. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dobrava Virus Carried by the Yellow-Necked Field Mouse Apodemus flavicollis, Causing Hemorrhagic Fever with Renal Syndrome in Romania

PubMed Central

Panculescu-Gatej, Raluca Ioana; Sirbu, Anca; Dinu, Sorin; Waldstrom, Maria; Heyman, Paul; Murariu, Dimitru; Petrescu, Angela; Szmal, Camelia; Oprisan, Gabriela; Lundkvist, Åke

2014-01-01

Abstract Hemorrhagic fever with renal syndrome (HFRS) has been confirmed by serological methods during recent years in Romania. In the present study, focus-reduction neutralization tests (FRNT) confirmed Dobrava hantavirus (DOBV) as the causative agent in some HFRS cases, but could not distinguish between DOBV and Saaremaa virus (SAAV) infections in other cases. DOBV was detected by a DOBV-specific TaqMan assay in sera of nine patients out of 22 tested. Partial sequences of the M genomic segment of DOBV were obtained from sera of three patients and revealed the circulation of two DOBV lineages in Romania. Investigation of rodents trapped in Romania found three DOBV-positive Apodemus flavicollis out of 83 rodents tested. Two different DOBV lineages were also detected in A. flavicollis as determined from partial sequences of the M and S genomic segments. Sequences of DOBV in A. flavicollis were either identical or closely related to the sequences obtained from the HFRS patients. The DOBV strains circulating in Romania clustered in two monophyletic groups, together with strains from Slovenia and the north of Greece. This is the first evidence for the circulation of DOBV in wild rodents and for a DOBV etiology of HFRS in Romania. PMID:24746107

Dobrava virus carried by the yellow-necked field mouse Apodemus flavicollis, causing hemorrhagic fever with renal syndrome in Romania.

PubMed

Panculescu-Gatej, Raluca Ioana; Sirbu, Anca; Dinu, Sorin; Waldstrom, Maria; Heyman, Paul; Murariu, Dimitru; Petrescu, Angela; Szmal, Camelia; Oprisan, Gabriela; Lundkvist, Ake; Ceianu, Cornelia S

2014-05-01

Hemorrhagic fever with renal syndrome (HFRS) has been confirmed by serological methods during recent years in Romania. In the present study, focus-reduction neutralization tests (FRNT) confirmed Dobrava hantavirus (DOBV) as the causative agent in some HFRS cases, but could not distinguish between DOBV and Saaremaa virus (SAAV) infections in other cases. DOBV was detected by a DOBV-specific TaqMan assay in sera of nine patients out of 22 tested. Partial sequences of the M genomic segment of DOBV were obtained from sera of three patients and revealed the circulation of two DOBV lineages in Romania. Investigation of rodents trapped in Romania found three DOBV-positive Apodemus flavicollis out of 83 rodents tested. Two different DOBV lineages were also detected in A. flavicollis as determined from partial sequences of the M and S genomic segments. Sequences of DOBV in A. flavicollis were either identical or closely related to the sequences obtained from the HFRS patients. The DOBV strains circulating in Romania clustered in two monophyletic groups, together with strains from Slovenia and the north of Greece. This is the first evidence for the circulation of DOBV in wild rodents and for a DOBV etiology of HFRS in Romania.

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius)

PubMed Central

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-01-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus. Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research (FSHR and LHR) as well as reproduction-linked polymorphisms and breeding programs. PMID:27844002

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius).

PubMed

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-06-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus . Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research ( FSHR and LHR ) as well as reproduction-linked polymorphisms and breeding programs.

Genome sequence analysis of predicted polyprenol reductase gene from mangrove plant kandelia obovata

NASA Astrophysics Data System (ADS)

Basyuni, M.; Sagami, H.; Baba, S.; Oku, H.

2018-03-01

It has been previously reported that dolichols but not polyprenols were predominated in mangrove leaves and roots. Therefore, the occurrence of larger amounts of dolichol in leaves of mangrove plants implies that polyprenol reductase is responsible for the conversion of polyprenol to dolichol may be active in mangrove leaves. Here we report the early assessment of probably polyprenol reductase gene from genome sequence of mangrove plant Kandelia obovata. The functional assignment of the gene was based on a homology search of the sequences against the non-redundant (nr) peptide database of NCBI using Blastx. The degree of sequence identity between DNA sequence and known polyprenol reductase was confirmed using the Blastx probability E-value, total score, and identity. The genome sequence data resulted in three partial sequences, termed c23157 (700 bp), c23901 (960 bp), and c24171 (531 bp). The c23157 gene showed the highest similarity (61%) to predicted polyprenol reductase 2- like from Gossypium raimondii with E-value 2e-100. The second gene was c23901 to exhibit high similarity (78%) to the steroid 5-alpha-reductase Det2 from J. curcas with E-value 2e-140. Furthermore, the c24171 gene depicted highest similarity (79%) to the polyprenol reductase 2 isoform X1 from Jatropha curcas with E- value 7e-21.The present study suggested that the c23157, c23901, and c24171, genes may encode predicted polyprenol reductase. The c23157, c23901, c24171 are therefore the new type of predicted polyprenol reductase from K. obovata.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

Development of phylogenetic markers for Sebacina (Sebacinaceae) mycorrhizal fungi associated with Australian orchids.

PubMed

Ruibal, Monica P; Peakall, Rod; Foret, Sylvain; Linde, Celeste C

2014-06-01

To investigate fungal species identity and diversity in mycorrhizal fungi of order Sebacinales, we developed phylogenetic markers. These new markers will enable future studies investigating species delineation and phylogenetic relationships of the fungal symbionts and facilitate investigations into evolutionary interactions among Sebacina species and their orchid hosts. • We generated partial genome sequences for a Sebacina symbiont originating from Caladenia huegelii with 454 genome sequencing and from three symbionts from Eriochilus dilatatus and one from E. pulchellus using Illumina sequencing. Six nuclear and two mitochondrial loci showed high variability (10-31% parsimony informative sites) for Sebacinales mycorrhizal fungi across four genera of Australian orchids (Caladenia, Eriochilus, Elythranthera, and Glossodia). • We obtained highly informative DNA markers that will allow investigation of mycorrhizal diversity of Sebacinaceae fungi associated with terrestrial orchids in Australia and worldwide.

Involvement of two genetic lineages of Sarcoptes scabiei mites in a local mange epizootic of wild mammals in Japan.

PubMed

Makouloutou, Patrice; Suzuki, Kazuo; Yokoyama, Mayumi; Takeuchi, Masahiko; Yanagida, Tetsuya; Sato, Hiroshi

2015-01-01

Similar to wild mammals on the continents, mange caused by the mange mite, Sarcoptes scabiei (Acari: Sarcoptidae) is spreading in wild mammals in most of Japan. We collected crusted or alopetic skin from 120 raccoon dogs (Nyctereutes procyonoides viverrinus), three raccoons (Procyon lotor), six Japanese badgers (Meles anakuma), one Japanese marten (Martes melampus), one stray dog (Canis lupus familiaris), four wild boars (Sus scrofa leucomystax), and one Japanese serow (Capricornis crispus), mainly in an area where mangy wild animals have been increasingly noted in the past 4 yr. The second internal transcribed spacer (ITS2) region of the ribosomal RNA gene and the partial 16S and cytochrome c oxidase subunit I (cox-1) genes of mitochondrial DNA (mtDNA) were characterized in these skin samples. The ITS2 sequencing (404 base pairs [bp]) identified the causative mite for mangy skin lesions of 128 animals as S. scabiei, regardless of host origin. The cat mite (Notoedres cati) was the cause in one raccoon dog and one raccoon. Most mites had almost identical ITS2 nucleotide sequences to those recorded in a variety of mammals worldwide. Partial 16S and cox-1 fragments of mtDNA amplified and sequenced successfully (331 bp and 410 bp, respectively) showed an identical nucleotide sequence except for one site (C vs. T) for the former and four sites (G, C, C, C vs. A, T, T, T, respectively) for the latter fragment. These substitutions were always synchronized, with the two mitochondrial DNA haplotypes (i.e., C/GCCC and T/ATTT) appearing to separately colonize in geographic units. The T/ATTT haplotype fell into a clade where animal-derived mites worldwide dominated, whereas the C/GCCC haplotype formed a geographic branch unique to Japanese isolates. These results suggest that heterologous populations of monospecific S. scabiei are expanding their populations and distributions regardless of host species in an apparently local mange epizootic of wild mammals in Japan.

Discrepancy between species borders at morphological and molecular levels in the genus Cochliopodium (Amoebozoa, Himatismenida), with the description of Cochliopodium plurinucleolum n. sp.

PubMed

Geisen, Stefan; Kudryavtsev, Alexander; Bonkowski, Michael; Smirnov, Alexey

2014-05-01

Amoebae of the genus Cochliopodium are characterized by a tectum that is a layer of scales covering the dorsal surface of the cell. A combination of scale structure, morphological features and, nowadays, molecular information allows species discrimination. Here we describe a soil species Cochliopodium plurinucleolum n. sp. that besides strong genetic divergence from all currently described species of Cochliopodium differs morphologically by the presence of several peripheral nucleoli in the nucleus. Further, we unambiguously show that the Golgi attachment associated with a dictyosome in Cochliopodium is a cytoplasmic microtubule organizing center (MTOC). Last, we provide detailed morphological and molecular information on the sister clade of C. plurinucleolum, containing C. minus, C. minutoidum, C. pentatrifurcatum and C. megatetrastylus. These species share nearly identical sequences of both, small subunit ribosomal RNA and partial Cox1 genes, and nearly identical structure of the scales. Scales of C. pentatrifurcatum differ, however, strongly from scales of the others while sequences of C. pentatrifurcatum and C. minus are nearly identical. These discrepancies urge for future sampling efforts to disentangle species characteristics within Cochliopdium and to investigate morphological and molecular patterns that allow reliable species differentiation. Copyright © 2014 Elsevier GmbH. All rights reserved.

Genetic analysis of H9N2 avian influenza viruses circulated in broiler flocks: a case study in Iraq in 2014-2015.

PubMed

Kraidi, Qayssar Ali; Madadgar, Omid; Ghalyanchi Langeroudi, Arash; Karimi, Vahid

2017-04-01

H9N2 avian influenza viruses (AIVs) have been recorded in Eurasian for several years. Since 2004-2005, the disease has become endemic in Iraq, causing serious economic losses in the poultry industry. The hemagglutinin (HA) and neuraminidase (NA), two out of eight protein-coding genes, play an important role during the early stage of infection and hinder virus assembling. Little is known about the genetic information of the H9N2 viruses currently circulating in Iraq; thus, gene sequences of six AIVS of the H9N2 subtype have been detected and analyzed in the period of 2014-2015 from different outbreaks of broiler flocks in five provinces situated in the middle and southern parts of Iraq. Genetic comparison of the partial sequences of HA gene indicated that all Iraqi viruses are related to each other and could be divided into two subgroups. Viruses of the first and the second subgroups demonstrated a high similar identity with Pakistani and Iranian viruses, respectively. The nucleotide sequences of the NA protein of the all studied Iraqi viruses were very similar (95.2-100% identity), and shared high nucleotide sequence identity with Iranian, Pakistani, and Lebanese strains. All six recent viruses possessed histidine, alanine, and leucine at positions 183, 190, and 226, respectively, which are the key residues in receptor-binding sites. The Iraqi viruses were closely related to viruses of G1-like lineage isolated from poultry flocks of Iran and Pakistan, suggesting that possible epidemiological links could be derived from a common origin. Further investigations are required and should include the viral isolation and full-length molecular characterization of H9N2 AIVs in this area.

Molecular cloning, characterization, and immunolocalization of two lactate dehydrogenase homologous genes from Taenia solium.

PubMed

Du, Wuying; Hu, Fengyu; Yang, Yabo; Hu, Dong; Hu, Xuchu; Yu, Xinbing; Xu, Jin; Dai, Jialin; Liao, Xinjiang; Huang, Jiang

2011-09-01

Two novel genes encoding lactate dehydrogenase A (LDHA) and B (LDHB) homologues, respectively, were identified from the cDNA libraries of adult Taenia solium (T. solium). The two deduced amino acid sequences both show more than 50% identity to the homologues for Danio rerio, Xenopus laevis, Schistosoma japonicum, Sus scrofa, Homo sapiens, et al. The identity of the amino acid sequence between TsLDHA and TsLDHB is 57.4%, and that of the nucleotide sequence is 61.5%. Recombinant TsLDHA homologue (rTsLDHA) and TsLDHB homologue (rTsLDHB) were expressed in Escherichia coli BL21/DE3 and purified. Though there were some differences in the sequence, the two LDH isozyme homologues show similarity in the conserved LDH domain, topological structure, primary immunological traits, localization on the tegument of T. solium adult, and partial physicochemical properties. The linear B-cell epitope analysis of TsLDHA and TsLDHB discovered a TsLDHA specific epitope. The purified rTsLDHA and rTsLDHB could be recognized by rat immuno-sera, serum from swine, or a patient infected with T. solium, respectively, but Western blot analysis showed cross-reactions, not only between these two LDH members but also with other common human tapeworms or helminths. The results suggested that the two LDH homologues are similar in the characteristics of LDH family, and they are not specific antigens for immunodiagnosis.

The Detection of a Low Pathogenicity Avian Influenza Virus Subtype H9 Infection in a Turkey Breeder Flock in the United Kingdom.

PubMed

Reid, Scott M; Banks, Jill; Ceeraz, Vanessa; Seekings, Amanda; Howard, Wendy A; Puranik, Anita; Collins, Susan; Manvell, Ruth; Irvine, Richard M; Brown, Ian H

2016-05-01

In April 2013, an H9N2 low pathogenicity avian influenza (LPAI) virus was isolated in a turkey breeder farm in Eastern England comprising 4966 birds. Point-of-lay turkey breeding birds had been moved from a rearing site and within 5 days had shown rapid onset of clinical signs of dullness, coughing, and anorexia. Three houses were involved, two contained a total of 4727 turkey hens, and the third housed 239 male turkeys. Around 50% of the hens were affected, whereas the male turkeys demonstrated milder clinical signs. Bird morbidity rose from 10% to 90%, with an increase in mortality in both houses of turkey hens to 17 dead birds in one house and 27 birds in the second house by day 6. The birds were treated with an antibiotic but were not responsive. Postmortem investigation revealed air sacculitis but no infraorbital sinus swellings or sinusitis. Standard samples were collected, and influenza A was detected. H9 virus infection was confirmed in all three houses by detection and subtyping of hemagglutinating agents in embryonated specific-pathogen-free fowls' eggs, which were shown to be viruses of H9N2 subtype using neuraminidase inhibition tests and a suite of real-time reverse transcription PCR assays. LPAI virus pathotype was suggested by cleavage site sequencing, and an intravenous pathogenicity index of 0.00 confirmed that the virus was of low pathogenicity. Therefore, no official disease control measures were required, and despite the high morbidity, birds recovered and were kept in production. Neuraminidase sequence analysis revealed a deletion of 78 nucleotides in the stalk region, suggesting an adaptation of the virus to poultry. Hemagglutinin gene sequences of two of the isolates clustered with a group of H9 viruses containing other contemporary European H9 strains in the Y439/Korean-like group. The closest matches to the two isolates were A/turkey/Netherlands/11015452/11 (H9N2; 97.9-98% nucleotide identity) and A/mallard/Finland/Li13384/10 (H9N2; 97% nucleotide identity). Both PB2 partial sequences were a 100% nucleotide identity with A/mallard/France/090360/09, indicating a European origin of the causative virus. Furthermore, partial sequencing analysis of the remaining genes revealed the virus to be genotypically of European avian origin and therefore of lower risk to public health compared with contemporary viruses in Central and Eastern Asia. Occupational health risks were assessed, and preventative measures were taken.

Isolation of a variant Porphyromonas sp. from polymicrobial infections in central bearded dragons (Pogona vitticeps).

PubMed

Bemis, David A; Greenacre, Cheryl B; Bryant, Mary Jean; Jones, Rebekah D; Kania, Stephen A

2011-01-01

Isolates of gram-negative anaerobic bacteria from reptiles have only occasionally been identified to the genus and species level in the veterinary medical literature. In particular, reports identifying Porphyromonas spp. from infections in reptiles are scarce. The present report describes unique Porphyromonas isolates obtained from necrosuppurative infections in central bearded dragons (Pogona vitticeps). The isolates grew in the presence of oxygen, were strongly hemolytic, and did not produce detectable black, iron porphyrin pigment. Biochemical identification kit numeric biocodes gave high but unreliable probabilities (>99.9%) for identification as Porphyromonas gingivalis. Partial 16S ribosomal RNA gene sequences of the isolates were identical to each other and shared 91% identity with those of Porphyromonas gulae. The isolates may represent a new reptile-associated Porphyromonas species.

Why barcode? High-throughput multiplex sequencing of mitochondrial genomes for molecular systematics.

PubMed

Timmermans, M J T N; Dodsworth, S; Culverwell, C L; Bocak, L; Ahrens, D; Littlewood, D T J; Pons, J; Vogler, A P

2010-11-01

Mitochondrial genome sequences are important markers for phylogenetics but taxon sampling remains sporadic because of the great effort and cost required to acquire full-length sequences. Here, we demonstrate a simple, cost-effective way to sequence the full complement of protein coding mitochondrial genes from pooled samples using the 454/Roche platform. Multiplexing was achieved without the need for expensive indexing tags ('barcodes'). The method was trialled with a set of long-range polymerase chain reaction (PCR) fragments from 30 species of Coleoptera (beetles) sequenced in a 1/16th sector of a sequencing plate. Long contigs were produced from the pooled sequences with sequencing depths ranging from ∼10 to 100× per contig. Species identity of individual contigs was established via three 'bait' sequences matching disparate parts of the mitochondrial genome obtained by conventional PCR and Sanger sequencing. This proved that assembly of contigs from the sequencing pool was correct. Our study produced sequences for 21 nearly complete and seven partial sets of protein coding mitochondrial genes. Combined with existing sequences for 25 taxa, an improved estimate of basal relationships in Coleoptera was obtained. The procedure could be employed routinely for mitochondrial genome sequencing at the species level, to provide improved species 'barcodes' that currently use the cox1 gene only.

Partial sequencing of sodA gene and its application to identification of Streptococcus dysgalactiae subsp. dysgalactiae isolated from farmed fish.

PubMed

Nomoto, R; Kagawa, H; Yoshida, T

2008-01-01

To investigate the difference between Lancefield group C Streptococcus dysgalactiae (GCSD) strains isolated from diseased fish and animals by sequencing and phylogenetic analysis of the sodA gene. The sodA gene of Strep. dysgalactiae strains isolated from fish and animals were amplified and its nucleotide sequences were determined. Although 100% sequence identity was observed among fish GCSD strains, the determined sequences from animal isolates showed variations against fish isolate sequences. Thus, all fish GCSD strains were clearly separated from the GCSD strains of other origin by using phylogenetic tree analysis. In addition, the original primer set was designed based on the determined sequences for specifically amplify the sodA gene of fish GCSD strains. The primer set yield amplification products from only fish GCSD strains. By sequencing analysis of the sodA gene, the genetic divergence between Strep. dysgalactiae strains isolated from fish and mammals was demonstrated. Moreover, an original oligonucletide primer set, which could simply detect the genotype of fish GCSD strains was designed. This study shows that Strep. dysgalactiae isolated from diseased fish could be distinguished from conventional GCSD strains by the difference in the sequence of the sodA gene.

Fowl Adenoviruses D and E Cause Inclusion Body Hepatitis Outbreaks in Broiler and Broiler Breeder Pullet Flocks.

PubMed

Morshed, Rima; Hosseini, Hossein; Langeroudi, Arash Ghalyanchi; Fard, Mohammad Hassan Bozorgmehri; Charkhkar, Saeid

2017-06-01

Twenty-four fowl adenoviruses (FAdVs) were isolated from broiler and broiler breeder pullet flocks in Iran during 2013-2016 and were identified and characterized. All FAdVs were from inclusion body hepatitis (IBH) cases, showing an enlarged and pale yellow liver with multiple petechial hemorrhages. Phylogenetic analyses of partial hexon gene sequences are an adequate and quick method for differentiation and genotyping. The isolates were subjected to PCR to amplify a 590-bp fragment from the hexon gene. Sequence analysis revealed the presence of two species D and E. Eighty FAdV isolates were genetically related to the strain EU979378 of FAdV-11 (96.5% to 97.6% identity), and six isolates were related to the strain EU979375 of FAdV-8b (97% identity). The results indicated that two FAdV serotypes (11 and 8b) are high prevalence serotypes of FAdVs in Iran and are pathogenic enough to cause IBH in young chicks. Therefore, preventive measures against FAdV infection on poultry farms should be implemented.

Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

PubMed

He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

2004-09-01

Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.

Life in the dark: metagenomic evidence that a microbial slime community is driven by inorganic nitrogen metabolism.

PubMed

Tetu, Sasha G; Breakwell, Katy; Elbourne, Liam D H; Holmes, Andrew J; Gillings, Michael R; Paulsen, Ian T

2013-06-01

Beneath Australia's large, dry Nullarbor Plain lies an extensive underwater cave system, where dense microbial communities known as 'slime curtains' are found. These communities exist in isolation from photosynthetically derived carbon and are presumed to be chemoautotrophic. Earlier work found high levels of nitrite and nitrate in the cave waters and a high relative abundance of Nitrospirae in bacterial 16S rRNA clone libraries. This suggested that these communities may be supported by nitrite oxidation, however, details of the inorganic nitrogen cycling in these communities remained unclear. Here we report analysis of 16S rRNA amplicon and metagenomic sequence data from the Weebubbie cave slime curtain community. The microbial community is comprised of a diverse assortment of bacterial and archaeal genera, including an abundant population of Thaumarchaeota. Sufficient thaumarchaeotal sequence was recovered to enable a partial genome sequence to be assembled, which showed considerable synteny with the corresponding regions in the genome of the autotrophic ammonia oxidiser Nitrosopumilus maritimus SCM1. This partial genome sequence, contained regions with high sequence identity to the ammonia mono-oxygenase operon and carbon fixing 3-hydroxypropionate/4-hydroxybutyrate cycle genes of N. maritimus SCM1. Additionally, the community, as a whole, included genes encoding key enzymes for inorganic nitrogen transformations, including nitrification and denitrification. We propose that the Weebubbie slime curtain community represents a distinctive microbial ecosystem, in which primary productivity is due to the combined activity of archaeal ammonia-oxidisers and bacterial nitrite oxidisers.

DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

PubMed Central

Comer, Jeffrey

2016-01-01

Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

Molecular characterization of a new species in the genus Alphacoronavirus associated with mink epizootic catarrhal gastroenteritis

PubMed Central

Vlasova, Anastasia N.; Halpin, Rebecca; Wang, Shiliang; Ghedin, Elodie; Spiro, David J.

2011-01-01

A coronavirus (CoV) previously shown to be associated with catarrhal gastroenteritis in mink (Mustela vison) was identified by electron microscopy in mink faeces from two fur farms in Wisconsin and Minnesota in 1998. A pan-coronavirus and a genus-specific RT-PCR assay were used initially to demonstrate that the newly discovered mink CoVs (MCoVs) were members of the genus Alphacoronavirus. Subsequently, using a random RT-PCR approach, full-genomic sequences were generated that further confirmed that, phylogenetically, the MCoVs belonged to the genus Alphacoronavirus, with closest relatedness to the recently identified but only partially sequenced (fragments of the polymerase, and full-length spike, 3c, envelope, nucleoprotein, membrane, 3x and 7b genes) ferret enteric coronavirus (FRECV) and ferret systemic coronavirus (FRSCV). The molecular data presented in this study provide the first genetic evidence for a new coronavirus associated with epizootic catarrhal gastroenteritis outbreaks in mink and demonstrate that MCoVs possess high genomic variability and relatively low overall nucleotide sequence identities (91.7 %) between contemporary strains. Additionally, the new MCoVs appeared to be phylogenetically distant from human (229E and NL63) and other alphacoronaviruses and did not belong to the species Alphacoronavirus 1. It is proposed that, together with the partially sequenced FRECV and FRSCV, they comprise a new species within the genus Alphacoronavirus. PMID:21346029

Veillonella infantium sp. nov., an anaerobic, Gram-stain-negative coccus isolated from tongue biofilm of a Thai child.

PubMed

Mashima, Izumi; Liao, Yu-Chieh; Miyakawa, Hiroshi; Theodorea, Citra F; Thawboon, Boonyanit; Thaweboon, Sroisiri; Scannapieco, Frank A; Nakazawa, Futoshi

2018-04-01

A strain of a novel anaerobic, Gram-stain-negative coccus was isolated from the tongue biofilm of a Thai child. This strain was shown, at the phenotypic level and based on 16S rRNA gene sequencing, to be a member of the genus Veillonella. Comparative analysis of the 16S rRNA, dnaK and rpoB gene sequences indicated that phylogenetically the strain comprised a distinct novel branch within the genus Veillonella. The novel strain showed 99.8, 95.1 and 95.9 % similarity to partial 16S rRNA, dnaK and rpoB gene sequences, respectively, to the type strains of the two most closely related species, Veillonelladispar ATCC 17748 T and Veillonellatobetsuensis ATCC BAA-2400 T . The novel strain could be discriminated from previously reported species of the genus Veillonella based on partial dnaK and rpoB gene sequencing and average nucleotide identity values. The major acid end-product produced by this strain was acetic acid under anaerobic conditions in trypticase-yeast extract-haemin with 1 % (w/v) glucose or fructose medium. Lactate was fermented to acetic acid and propionic acid. Based on these observations, this strain represents a novel species, for which the name Veillonella infantium sp. nov. is proposed. The type strain is T11011-4 T (=JCM 31738 T =TSD-88 T ).

Partial characterization of the lettuce infectious yellows virus genomic RNAs, identification of the coat protein gene and comparison of its amino acid sequence with those of other filamentous RNA plant viruses.

PubMed

Klaassen, V A; Boeshore, M; Dolja, V V; Falk, B W

1994-07-01

Purified virions of lettuce infectious yellows virus (LIYV), a tentative member of the closterovirus group, contained two RNAs of approximately 8500 and 7300 nucleotides (RNAs 1 and 2 respectively) and a single coat protein species with M(r) of approximately 28,000. LIYV-infected plants contained multiple dsRNAs. The two largest were the correct size for the replicative forms of LIYV virion RNAs 1 and 2. To assess the relationships between LIYV RNAs 1 and 2, cDNAs corresponding to the virion RNAs were cloned. Northern blot hybridization analysis showed no detectable sequence homology between these RNAs. A partial amino acid sequence obtained from purified LIYV coat protein was found to align in the most upstream of four complete open reading frames (ORFs) identified in a LIYV RNA 2 cDNA clone. The identity of this ORF was confirmed as the LIYV coat protein gene by immunological analysis of the gene product expressed in vitro and in Escherichia coli. Computer analysis of the LIYV coat protein amino acid sequence indicated that it belongs to a large family of proteins forming filamentous capsids of RNA plant viruses. The LIYV coat protein appears to be most closely related to the coat proteins of two closteroviruses, beet yellows virus and citrus tristeza virus.

Expression of the Caulobacter heat shock gene dnaK is developmentally controlled during growth at normal temperatures.

PubMed Central

Gomes, S L; Gober, J W; Shapiro, L

1990-01-01

Caulobacter crescentus has a single dnaK gene that is highly homologous to the hsp70 family of heat shock genes. Analysis of the cloned and sequenced dnaK gene has shown that the deduced amino acid sequence could encode a protein of 67.6 kilodaltons that is 68% identical to the DnaK protein of Escherichia coli and 49% identical to the Drosophila and human hsp70 protein family. A partial open reading frame 165 base pairs 3' to the end of dnaK encodes a peptide of 190 amino acids that is 59% identical to DnaJ of E. coli. Northern blot analysis revealed a single 4.0-kilobase mRNA homologous to the cloned fragment. Since the dnaK coding region is 1.89 kilobases, dnaK and dnaJ may be transcribed as a polycistronic message. S1 mapping and primer extension experiments showed that transcription initiated at two sites 5' to the dnaK coding sequence. A single start site of transcription was identified during heat shock at 42 degrees C, and the predicted promoter sequence conformed to the consensus heat shock promoters of E. coli. At normal growth temperature (30 degrees C), a different start site was identified 3' to the heat shock start site that conformed to the E. coli sigma 70 promoter consensus sequence. S1 protection assays and analysis of expression of the dnaK gene fused to the lux transcription reporter gene showed that expression of dnaK is temporally controlled under normal physiological conditions and that transcription occurs just before the initiation of DNA replication. Thus, in both human cells (I. K. L. Milarski and R. I. Morimoto, Proc. Natl. Acad. Sci. USA 83:9517-9521, 1986) and in a simple bacterium, the transcription of a hsp70 gene is temporally controlled as a function of the cell cycle under normal growth conditions. Images PMID:2345134

Identification of a Linked Set of Genes in Serpulina hyodysenteriae (B204) Predicted To Encode Closely Related 39-Kilodalton Extracytoplasmic Proteins

PubMed Central

Gabe, Jeffrey D.; Dragon, Elizabeth; Chang, Ray-Jen; McCaman, Michael T.

1998-01-01

A tandem pair of nearly identical genes from Serpulina hyodysenteriae (B204) were cloned and sequenced. The full open reading frame of one gene and the partial open reading frame of the neighboring gene appear to encode secreted proteins which are homologous to, yet distinct from, the 39-kDa extracytoplasmic protein purified from the membrane fraction of S. hyodysenteriae. We have designated these newly identified genes vspA and vspB (for variable surface protein). PMID:9440540

Evidence of enzootic circulation of West Nile virus (Nea Santa-Greece-2010, lineage 2), Greece, May to July 2011.

PubMed

Chaskopoulou, A; Dovas, Ci; Chaintoutis, Sc; Bouzalas, I; Ara, G; Papanastassopoulou, M

2011-08-04

A West Nile virus (WNV) surveillance network including sentinel chickens was deployed in Thessaloniki county, Greece, from May to July 2011. For the first time in summer 2011, a chicken WNV isolate from 6 July was molecularly identified. The partial NS3 sequence was identical to that of the Nea Santa-Greece-2010 WNV lineage 2, detected in central Macedonia in 2010. This suggests that WNV is actively circulating in central Macedonia and that it may have overwintered in northern Greece.

A new species of Drepanocephalus Dietz, 1909 (Digenea: Echinostomatidae) from the double-crested cormorant Phalacrocorax auritus (Lesson) (Aves: Phalacrocoracidae) in North America.

PubMed

Kudlai, Olena; Kostadinova, Aneta; Pulis, Eric E; Tkach, Vasyl V

2015-03-01

Drepanocephalus auritus n. sp. is described based on specimens from the double-crested cormorant Phalacrocorax auritus (Lesson) in North America. The new species differs from its congeners in its very narrow, elongate body, long uterine field and widely separated testes. Sequences of the nuclear rRNA gene cluster, spanning the 3' end of the nuclear ribosomal 18S rRNA gene, internal transcribed spacer region (ITS1+5.8S gene+ITS2) and partial 28S gene (2,345 bp), were identical in specimens collected from North Dakota, Minnesota and Mississippi, USA. Sequences of the 651 bp long fragment of the mitochondrial cox1 gene exhibited very low intraspecific variability (< 1%). Comparisons of the newly-generated sequences with those available in the GenBank indicate that the sequences from North America published under the name D. spathans Dietz, 1909 in fact represent D. auritus n. sp.

Novel, non-symbiotic isolates of Neorhizobium from a dryland agricultural soil.

PubMed

Soenens, Amalia; Imperial, Juan

2018-01-01

Semi-selective enrichment, followed by PCR screening, resulted in the successful direct isolation of fast-growing Rhizobia from a dryland agricultural soil. Over 50% of these isolates belong to the genus Neorhizobium , as concluded from partial rpoB and near-complete 16S rDNA sequence analysis. Further genotypic and genomic analysis of five representative isolates confirmed that they form a coherent group within Neorhizobium , closer to N. galegae than to the remaining Neorhizobium species, but clearly differentiated from the former, and constituting at least one new genomospecies within Neorhizobium. All the isolates lacked nod and nif symbiotic genes but contained a repABC replication/maintenance region, characteristic of rhizobial plasmids, within large contigs from their draft genome sequences. These repABC sequences were related, but not identical, to repABC sequences found in symbiotic plasmids from N. galegae , suggesting that the non-symbiotic isolates have the potential to harbor symbiotic plasmids. This is the first report of non-symbiotic members of Neorhizobium from soil.

Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus).

PubMed

Pawar, Rahul Mohanchandra; Poornachandar, Anantula; Arun, Attur Shanmugam; Manikandan, Santhanam; Shivaji, Sisinthy

2011-12-15

Hepatozoon species are parasites that infect a wide variety of domestic and wild animals. The objective of the study was to detect the occurrence of Hepatozoon ursi in Indian sloth bears and to characterize the parasite based on phylogenetic analysis of the partial 18S rRNA gene sequence. Hepatozoon infection could be detected in 38 (70%) out of fifty-four blood samples of Indian sloth bears (captive and wild), suggestive of high prevalence of Hepatozoon infection in Indian sloth bears. Sequencing of partial 18S rRNA gene of the positive samples and BLAST analysis indicated that the nearest phylogenetic neighbour was H. ursi with which they exhibited 99-100% similarity. Additionally, Hepatozoon sp. isolated from wild sloth bears of India were identical to those in captive sloth bears and phylogenetically related to H. ursi reported from Japanese black bears from Japan. To our knowledge, this is the first report on the molecular characterization of H. ursi infection in Indian sloth bears. Copyright © 2011 Elsevier B.V. All rights reserved.

Partial Treatment Requests and Underlying Motives of Applicants for Gender Affirming Interventions.

PubMed

Beek, Titia F; Kreukels, Baudewijntje P C; Cohen-Kettenis, Peggy T; Steensma, Thomas D

2015-11-01

Historically, only individuals with a cross-gender identity who wanted to receive a full treatment, were eligible for "complete sex reassignment" consisting of feminizing/masculinizing hormone treatment and several surgical interventions including genital surgery (full treatment). Currently, it is unclear what motives underlie a request for hormones only or surgery only or a combination of hormones and surgery (e.g., a mastectomy), but no genital surgery (partial treatment). The aims of this study were (i) to describe treatment requests of applicants at a specialized gender identity clinic in the Netherlands; and (ii) to explore the motives underlying a partial treatment request, including the role of (non-binary) gender identity. Information was collected on all 386 adults who applied for treatment at the Center of Expertise on Gender Dysphoria of the VU University Medical Center in Amsterdam, the Netherlands, in the year 2013. Treatment requests were available for 360 individuals: 233 natal men (64.7%) and 127 natal women (35.3%). Treatment requests were systematically collected during assessment. Individuals were classified as either desiring a full or partial treatment. The motives behind a partial treatment request were collected and categorized as well. The majority of applicants at our gender identity clinic requested full treatment. Among those who requested partial treatment, the most reported underlying motive was surgical risks/outcomes. Only a small number of applicants requested partial treatment to bring their body into alignment with their non-binary gender identity. It becomes clear that partial treatment is requested by a substantial number of applicants. This emphasizes the need for gender identity clinics to provide information about the medical possibilities and limitations, and careful introduction and evaluation of non-standard treatment options. © 2015 International Society for Sexual Medicine.

Computer aided identification of a Hevein-like antimicrobial peptide of bell pepper leaves for biotechnological use.

PubMed

Games, Patrícia Dias; daSilva, Elói Quintas Gonçalves; Barbosa, Meire de Oliveira; Almeida-Souza, Hebréia Oliveira; Fontes, Patrícia Pereira; deMagalhães, Marcos Jorge; Pereira, Paulo Roberto Gomes; Prates, Maura Vianna; Franco, Gloria Regina; Faria-Campos, Alessandra; Campos, Sérgio Vale Aguiar; Baracat-Pereira, Maria Cristina

2016-12-15

Antimicrobial peptides from plants present mechanisms of action that are different from those of conventional defense agents. They are under-explored but have a potential as commercial antimicrobials. Bell pepper leaves ('Magali R') are discarded after harvesting the fruit and are sources of bioactive peptides. This work reports the isolation by peptidomics tools, and the identification and partially characterization by computational tools of an antimicrobial peptide from bell pepper leaves, and evidences the usefulness of records and the in silico analysis for the study of plant peptides aiming biotechnological uses. Aqueous extracts from leaves were enriched in peptide by salt fractionation and ultrafiltration. An antimicrobial peptide was isolated by tandem chromatographic procedures. Mass spectrometry, automated peptide sequencing and bioinformatics tools were used alternately for identification and partial characterization of the Hevein-like peptide, named HEV-CANN. The computational tools that assisted to the identification of the peptide included BlastP, PSI-Blast, ClustalOmega, PeptideCutter, and ProtParam; conventional protein databases (DB) as Mascot, Protein-DB, GenBank-DB, RefSeq, Swiss-Prot, and UniProtKB; specific for peptides DB as Amper, APD2, CAMP, LAMPs, and PhytAMP; other tools included in ExPASy for Proteomics; The Bioactive Peptide Databases, and The Pepper Genome Database. The HEV-CANN sequence presented 40 amino acid residues, 4258.8 Da, theoretical pI-value of 8.78, and four disulfide bonds. It was stable, and it has inhibited the growth of phytopathogenic bacteria and a fungus. HEV-CANN presented a chitin-binding domain in their sequence. There was a high identity and a positive alignment of HEV-CANN sequence in various databases, but there was not a complete identity, suggesting that HEV-CANN may be produced by ribosomal synthesis, which is in accordance with its constitutive nature. Computational tools for proteomics and databases are not adjusted for short sequences, which hampered HEV-CANN identification. The adjustment of statistical tests in large databases for proteins is an alternative to promote the significant identification of peptides. The development of specific DB for plant antimicrobial peptides, with information about peptide sequences, functional genomic data, structural motifs and domains of molecules, functional domains, and peptide-biomolecule interactions are valuable and necessary.

Primary structure of stanniocalcin in two basal Actinopterygii.

PubMed

Amemiya, Yutaka; Youson, John H

2004-01-15

The primary structure of stanniocalcin (STC), the principal product of the corpuscles of Stannius (CS) in ray-finned fishes, was deduced from STC cDNA clones for two species of holostean, the gar, Lepisosteus osseus and the bowfin, Amia calva. Overlapping partial cDNA clones were amplified by polymerase chain reaction (PCR) from single-strand cDNA of the CS. Excluding the poly(A) tail, the cDNAs of 1863 base pairs [bp] (gar) and 914 bp (bowfin) contained the 5' untranslated region followed by the coding region and the 3' untranslated region. Both the gar and bowfin STC cDNA encode a prehormone of 252 amino acids (aa) with a signal peptide of 32 aa and a mature protein of 220 aa. The deduced aa sequence of gar STC shows 87% identity with bowfin STC, 60-72% identity with most vertebrate STCs and 26% identity with mouse STC2. Phylogenetic analysis of the sequences support a view that the gar and bowfin form a monophyletic holostean clade. RT-PCR revealed in the gar and bowfin that, just as in mammals and rainbow trout, the expression of STC mRNA is widely spread in many tissues and organs. Since the gar and bowfin are representatives of the most ancient fishes known to possess CS, the corpuscular-derived STC molecule in fish has had a conserved evolution.

Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)

NASA Technical Reports Server (NTRS)

Shibata, K.; Abe, S.; Davies, E.

2001-01-01

Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.

Mitochondrial cytochrome b DNA sequence variations: an approach to fish species identification in processed fish products.

PubMed

Pepe, Tiziana; Trotta, Michele; di Marco, Isolina; Cennamo, Paola; Anastasio, Aniello; Cortesi, Maria Luisa

2005-02-01

The identification of fish species in food products is problematic because morphological features of the fish are partially or completely lost during processing. It is important to determine fish origin because of the increasing international seafood trade and because European Community Regulation 104/2000 requires that the products be labeled correctly. Sequence analysis of PCR products from a conserved region of the cytochrome b gene was used to identity fish species belonging to the families Gadidae and Merluccidae in 18 different processed fish products. This method allowed the identification of fish species in all samples. Fish in all of the examined products belonged to these two families, with the exception of one sample of smoked baccalà (salt cod), which was not included in the Gadidae cluster.

An outbreak of food-borne gastroenteritis due to sapovirus among junior high school students.

PubMed

Usuku, Shuzo; Kumazaki, Makoto; Kitamura, Katsuhiko; Tochikubo, Osamu; Noguchi, Yuzo

2008-11-01

The human sapovirus (SaV) causes acute gastroenteritis mainly in infants and young children. A food-borne outbreak of gastroenteritis associated with SaV occurred among junior high school students in Yokohama, Japan, during and after a study trip. The nucleotide sequences of the partial capsid gene derived from the students exhibited 98% homology to a SaV genogroup IV strain, Hu/Angelholm/SW278/2004/SE, which was isolated from an adult with gastroenteritis in Solna, Sweden. An identical nucleotide sequence was detected from a food handler at the hotel restaurant, suggesting that the causative agent of the outbreak was transmitted from the food handler. This is the first description of a food-borne outbreak associated with the SaV genogroup IV strain in Japan.

N-terminus conservation in the terminal pigment of phycobilisomes from a prokaryotic and eukaryotic alga. [Porphyridium cruentum; Nostoc

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gantt, E.; Cunningham, F.X. Jr.; Lipschultz, C.A.

1988-04-01

High molecular weight polypeptides from phycobilisomes, believed to be involved in facilitating the energy flow from phycobilisomes to thylakoids, are conserved in the prokaryote Nostoc sp. and the eukaryote Porphyridium cruentum. Partial N-terminal sequence analysis of the phycobilisome-polypeptides of Nostoc (94 kilodalton) and Porphyridium (92 kilodalton) revealed 55% identity in the first 20 residues, but no significant homology with sequences of other phycobiliproteins or phycobilisome-linkers. Polypeptides (94 and 92 kilodalton) from Nostoc thylakoids free of phycobilisomes, previously presumed to be involved in the phycobilisome-thylakoid linkage exhibit the same immunocrossreactivity but are different from the 94 kilodalton-phycobilisome polypeptide by having blockedmore » N-termini and a different amino acid composition.« less

Phosphodiesterase from Daboia russelli russelli venom: purification, partial characterization and inhibition of platelet aggregation.

PubMed

Mitra, Jyotirmoy; Bhattacharyya, Debasish

2014-09-01

Phosphodiesterases (PDEs) belong to a super-family of enzymes that have multiple roles in the metabolism of extracellular nucleotides and regulation of nucleotide-based intercellular signalling. A PDE from Russell's viper (Daboia russelli russelli) venom (DR-PDE) was purified by gel filtration, ion exchange and affinity chromatographies. Homogeneity of the preparation was verified by SDS-PAGE, SE-HPLC and mass spectrometry. It was free from 5'-nucleotidase, alkaline phosphatase and protease activities. Identity of the enzyme was ensured from partial sequence homology with other PDEs. DR-PDE was inactivated by polyvalent anti-venom serum and metal chelators. The enzyme was partially inhibited by the root extracts of four medicinal plants but remained unaffected by inhibitors of intracellular PDEs. DR-PDE hydrolyses ADP and thus, strongly inhibits ADP-induced platelet aggregation in human platelet rich plasma. This study leads to better understanding of a component of Russell's viper venom that affects homoeostatic system of the victim. Copyright © 2014 Elsevier Ltd. All rights reserved.

Genomics in Cardiovascular Disease

PubMed Central

Roberts, Robert; Marian, A.J.; Dandona, Sonny; Stewart, Alexandre F.R.

2013-01-01

A paradigm shift towards biology occurred in the 1990’s subsequently catalyzed by the sequencing of the human genome in 2000. The cost of DNA sequencing has gone from millions to thousands of dollars with sequencing of one’s entire genome costing only $1,000. Rapid DNA sequencing is being embraced for single gene disorders, particularly for sporadic cases and those from small families. Transmission of lethal genes such as associated with Huntington’s disease can, through in-vitro fertilization, avoid passing it on to one’s offspring. DNA sequencing will meet the challenge of elucidating the genetic predisposition for common polygenic diseases, especially in determining the function of the novel common genetic risk variants and identifying the rare variants, which may also partially ascertain the source of the missing heritability. The challenge for DNA sequencing remains great, despite human genome sequences being 99.5% identical, the 3 million single nucleotide polymorphisms (SNPs) responsible for most of the unique features add up to 60 new mutations per person which, for 7 billion people, is 420 billion mutations. It is claimed that DNA sequencing has increased 10,000 fold while information storage and retrieval only 16 fold. The physician and health user will be challenged by the convergence of two major trends, whole genome sequencing and the storage/retrieval and integration of the data. PMID:23524054

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

Genotypic and phenotypic diversity of Alicyclobacillus acidocaldarius isolates.

PubMed

Félix-Valenzuela, L; Guardiola-Avila, I; Burgara-Estrella, A; Ibarra-Zavala, M; Mata-Haro, V

2015-10-01

The fruit juice industry recognizes Alicyclobacillus as a major quality control target micro-organism. In this study, we analysed 19 bacterial isolates to identify Alicyclobacillus species by polymerase chain reaction (PCR) and sequencing analyses. Phenotypic and genomic diversity among isolates were investigated by API 50CHB system and ERIC-PCR (enterobacterial repetitive intergenic consensus-PCR) respectively. All bacterial isolates were identified as Alicyclobacillus acidocaldarius, and almost all showed identical DNA sequences according to their 16S rRNA (rDNA) gene partial sequences. Only few carbohydrates were fermented by A. acidocaldarius isolates, and there was little variability in the biochemical profile. Genotypic fingerprinting of the A. acidocaldarius isolates showed high diversity, and clusters by ERIC-PCR were distinct to those obtained from the 16S rRNA gene phylogenetic tree. There was no correlation between phenotypic and genotypic variability in the A. acidocaldarius isolates analysed in this study. Detection of Alicyclobacillus strains is imperative in fruit concentrates and juices due to the production of guaiacol. Identification of the genera originates rejection of the product by processing industry. However, not all the Alicyclobacillus species are deteriorative and hence the importance to differentiate among them. In this study, partial 16S ribosomal RNA sequence alignment allowed the differentiation of species. In addition, ERIC-PCR was introduced for the genotypic characterization of Alicyclobacillus, as an alternative for differentiation among isolates from the same species. © 2015 The Society for Applied Microbiology.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

PubMed

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Molecular Characterization and Phylogenetic Analysis of Anaplasma spp. and Ehrlichia spp. Isolated from Various Ticks in Southeastern and Northwestern Regions of Iran.

PubMed

Jafar Bekloo, Ahmad; Ramzgouyan, Maryam Roya; Shirian, Sadegh; Faghihi, Faezeh; Bakhshi, Hassan; Naseri, Fatemeh; Sedaghat, Mehdi; Telmadarraiy, Zakkyeh

2018-05-01

Anaplasma/Ehrlichia species are tick-transmitted pathogens that cause infections in humans and numerous domestic and wild animal species. There is no information available on the molecular characteristics and phylogenetic position of Anaplasma/Ehrlichia spp. isolated from tick species from different geographic locations in Iran. The aim of this study was to determine the prevalence, molecular characteristics, and phylogenetic relationship of both Anaplasma spp. and Ehrlichia spp. in tick species isolated from different domestic animals from two different geographical locations of Iran. A total of 930 ticks were collected from 93 cattle, 250 sheep, and 587 goats inhabiting the study areas. The collected ticks were then investigated for the presence of Anaplasma/Ehrlichia spp. using nested PCR based on the 16S rRNA gene, followed by sequencing. Sequence analysis was done based on the data published in the GenBank on Anaplasma/Ehrlichia spp. isolates using bioinformatic tools such as the standard nucleotide BLAST. Genome of Anaplasma or Ehrlichia spp. was detected in 14 ticks collected in Heris, including 5 Dermacentor marginatus, 1 Haemaphysalis erinacei, 3 Hyalomma anatolicum, and 4 Rhipicephalus sanguineus, also in 29 ticks collected in Chabahar, including 14 R. sanguineus, 8 D. marginatus, 3 Hyalomma Anatolicum, and 4 Hyalomma dromedarii. Partial analysis of the 16S rRNA gene sequence of positive samples collected from goats and sheep showed that they were infected with Anaplasma/Ehrlichia spp. that were 94-98% identical to ovine Anaplasma and 91-96% identical to Neoehrlichia and Ehrlichia spp. The various ticks identified in this study suggest the possible emergence of tick-borne diseases in animals and humans in these regions. R. sanguineus and D. marginatus seem to be predominant vectors responsible for anaplasmosis in these regions. Partial sequence analysis of the 16S rRNA gene showed that A. ovis is genetically polymorphic in these regions. Furthermore, an association between the genetic heterogeneity of this microorganism and the geographical regions of Anaplasma strains was found. This study also showed that those ticks that were collected from the same geographical origin were infected with closely related strains of Anaplasma.

The arbuscular mycorrhizal fungal protein glomalin is a putative homolog of heat shock protein 60.

PubMed

Gadkar, Vijay; Rillig, Matthias C

2006-10-01

Work on glomalin-related soil protein produced by arbuscular mycorrhizal (AM) fungi (AMF) has been limited because of the unknown identity of the protein. A protein band cross-reactive with the glomalin-specific antibody MAb32B11 from the AM fungus Glomus intraradices was partially sequenced using tandem liquid chromatography-mass spectrometry. A 17 amino acid sequence showing similarity to heat shock protein 60 (hsp 60) was obtained. Based on degenerate PCR, a full-length cDNA of 1773 bp length encoding the hsp 60 gene was isolated from a G. intraradices cDNA library. The ORF was predicted to encode a protein of 590 amino acids. The protein sequence had three N-terminal glycosylation sites and a string of GGM motifs at the C-terminal end. The GiHsp 60 ORF had three introns of 67, 76 and 131 bp length. The GiHsp 60 was expressed using an in vitro translation system, and the protein was purified using the 6xHis-tag system. A dot-blot assay on the purified protein showed that it was highly cross-reactive with the glomalin-specific antibody MAb32B11. The present work provides the first evidence for the identity of the glomalin protein in the model AMF G. intraradices, thus facilitating further characterization of this protein, which is of great interest in soil ecology.

Subtype Distribution of Blastocystis Isolates in Sebha, Libya

PubMed Central

Abdulsalam, Awatif M.; Ithoi, Init; Al-Mekhlafi, Hesham M.; Al-Mekhlafi, Abdulsalam M.; Ahmed, Abdulhamid; Surin, Johari

2013-01-01

Background Blastocystis is a genetically diverse and a common intestinal parasite of humans with a controversial pathogenic potential. This study was carried out to identify the Blastocystis subtypes and their association with demographic and socioeconomic factors among outpatients living in Sebha city, Libya. Methods/Findings Blastocystis in stool samples were cultured followed by isolation, PCR amplification of a partial SSU rDNA gene, cloning, and sequencing. The DNA sequences of isolated clones showed 98.3% to 100% identity with the reference Blastocystis isolates from the Genbank. Multiple sequence alignment showed polymorphism from one to seven base substitution and/or insertion/deletion in several groups of non-identical nucleotides clones. Phylogenetic analysis revealed three assemblage subtypes (ST) with ST1 as the most prevalent (51.1%) followed by ST2 (24.4%), ST3 (17.8%) and mixed infections of two concurrent subtypes (6.7%). Blastocystis ST1 infection was significantly associated with female (P = 0.009) and low educational level (P = 0.034). ST2 was also significantly associated with low educational level (P= 0.008) and ST3 with diarrhoea (P = 0.008). Conclusion Phylogenetic analysis of Libyan Blastocystis isolates identified three different subtypes; with ST1 being the predominant subtype and its infection was significantly associated with female gender and low educational level. More extensive studies are needed in order to relate each Blastocystis subtype with clinical symptoms and potential transmission sources in this community. PMID:24376805

Subtype distribution of Blastocystis isolates in Sebha, Libya.

PubMed

Abdulsalam, Awatif M; Ithoi, Init; Al-Mekhlafi, Hesham M; Al-Mekhlafi, Abdulsalam M; Ahmed, Abdulhamid; Surin, Johari

2013-01-01

Blastocystis is a genetically diverse and a common intestinal parasite of humans with a controversial pathogenic potential. This study was carried out to identify the Blastocystis subtypes and their association with demographic and socioeconomic factors among outpatients living in Sebha city, Libya. Blastocystis in stool samples were cultured followed by isolation, PCR amplification of a partial SSU rDNA gene, cloning, and sequencing. The DNA sequences of isolated clones showed 98.3% to 100% identity with the reference Blastocystis isolates from the Genbank. Multiple sequence alignment showed polymorphism from one to seven base substitution and/or insertion/deletion in several groups of non-identical nucleotides clones. Phylogenetic analysis revealed three assemblage subtypes (ST) with ST1 as the most prevalent (51.1%) followed by ST2 (24.4%), ST3 (17.8%) and mixed infections of two concurrent subtypes (6.7%). ST1 infection was significantly associated with female (P = 0.009) and low educational level (P = 0.034). ST2 was also significantly associated with low educational level (P= 0.008) and ST3 with diarrhoea (P = 0.008). Phylogenetic analysis of Libyan Blastocystis isolates identified three different subtypes; with ST1 being the predominant subtype and its infection was significantly associated with female gender and low educational level. More extensive studies are needed in order to relate each Blastocystis subtype with clinical symptoms and potential transmission sources in this community.

Triple infection with agamid adenovirus 1, Encephaliton cuniculi-like microsporidium and enteric coccidia in a bearded dragon (Pogona vitticeps).

PubMed

Schilliger, Lionel; Mentré, Véronique; Marschang, Rachel E; Nicolier, Alexandra; Richter, Barbara

2016-10-12

A 2-month-old juvenile central bearded dragon was presented for anorexia and cachexia. Another specimen from the same cage had died suddenly 2 weeks prior. Fecal analysis revealed a high quantity of Isospora amphiboluri and a few pinworm eggs. Other examinations were not performed and the animal died a few days later despite supportive care. A third individual from the same cage presented with anorexia and a distended cœlom and was euthanized. In this third dragon, histological examination revealed intestinal coccidiosis, basophilic intranuclear inclusions compatible with adenovirus infection, acute hepatic necrosis with intrahepatocytic and intraenteritic organisms typical of microsporidia and renal gout. A PCR confirmed the diagnosis of adenovirosis. Sequencing showed that the PCR product was 100% identical to the corresponding portion of the agamid adenovirus 1 genome. A PCR for the detection of Encephalitozoon (E.) cuniculi was positive. Partial sequencing revealed 100% identity to an E. cuniculi-like organism previously found in bearded dragons. In cases where environmental factors such as poor hygiene or stress can be excluded, the presence of opportunistic pathogens in high numbers can be due to a systemic (viral) infection with temporary immunosuppression.

Zonadhesin D3-Polypeptides Vary among Species but Are Similar in Equus Species Capable of Interbreeding1

PubMed Central

Tardif, Steve; Brady, Heidi A.; Breazeale, Kelly R.; Bi, Ming; Thompson, Leslie D.; Bruemmer, Jason E.; Bailey, Laura B.; Hardy, Daniel M.

2009-01-01

Zonadhesin is a rapidly evolving protein in the sperm acrosome that confers species specificity to sperm-zona pellucida adhesion. Though structural variation in zonadhesin likely contributes to its species-specific function, the protein has not previously been characterized in organisms capable of interbreeding. Here we compared properties of zonadhesin in several animals, including the horse (Equus caballus), donkey (E. asinus), and Grevy's zebra (E. grevyi) to determine if variation in zonadhesin correlates with ability of gametes to cross-fertilize. Zonadhesin localized to the apical acrosomes of spermatozoa from all three Equus species, similar to its localization in other animals. Likewise, in horse and donkey testis, zonadhesin was detected only in germ cells, first in the acrosomal granule of round spermatids and then in the developing acrosomes of elongating spermatids. Among non-Equus species, D3-domain polypeptides of mature, processed zonadhesin varied markedly in size and detergent solubility. However, zonadhesin D3-domain polypeptides in horse, donkey, and zebra spermatozoa exhibited identical electrophoretic mobility and detergent solubility. Equus zonadhesin D3-polypeptides (p110/p80 doublet) were most similar in size to porcine and bovine zonadhesin D3-polypeptides (p105). Sequence comparisons revealed that the horse zonadhesin precursor's domain content and arrangement are similar to those of zonadhesin from other large animals. Partial sequences of horse and donkey zonadhesin were much more similar to each other (>99% identity) than they were to orthologous sequences of human, pig, rabbit, and mouse zonadhesin (52%–72% identity). We conclude that conservation of zonadhesin D3-polypeptide properties correlates with ability of Equus species to interbreed. PMID:19794156

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

Unprecedented genomic diversity of AhR1 and AhR2 genes in Atlantic salmon (Salmo salar L.).

PubMed

Hansson, Maria C; Wittzell, Håkan; Persson, Kerstin; von Schantz, Torbjörn

2004-06-24

Aryl hydrocarbon receptor (AhR) genes encode proteins involved in mediating the toxic responses induced by several environmental pollutants. Here, we describe the identification of the first two AhR1 (alpha and beta) genes and two additional AhR2 (alpha and beta) genes in the tetraploid species Atlantic salmon (Salmo salar L.) from a cosmid library screening. Cosmid clones containing genomic salmon AhR sequences were isolated using a cDNA clone containing the coding region of the Atlantic salmon AhR2gamma as a probe. Screening revealed 14 positive clones, from which four were chosen for further analyses. One of the cosmids contained genomic AhR sequences that were highly similar to the rainbow trout (Oncorhynchus mykiss) AhR2alpha and beta genes. SMART RACE amplified two complete, highly similar but not identical AhR type 2 sequences from salmon cDNA, which from phylogenetic analyses were determined as the rainbow trout AhR2alpha and beta orthologs. The salmon AhR2alpha and beta encode proteins of 1071 and 1058 residues, respectively, and encompass characteristic AhR sequence elements like a basic-helix-loop-helix (bHLH) and two PER-ARNT-SIM (PAS) domains. Both genes are transcribed in liver, spleen and muscle tissues of adult salmon. A second cosmid contained partial sequences, which were identical to the previously characterized AhR2gamma gene. The last two cosmids contained partial genomic AhR sequences, which were more similar to other AhR type 1 fish genes than the four characterized salmon AhR2 genes. However, attempts to amplify the corresponding complete cDNA sequences of the inserts proved very difficult, suggesting that these genes are non-functional or very weakly transcribed in the examined tissues. Phylogenetic analyses of the conserved regions did, however, clearly indicate that these two AhRs belong to the AhR type 1 clade and have been assigned as the Atlantic salmon AhR1alpha and AhR1beta genes. Taken together, these findings demonstrate that multiple AhR genes are present in Atlantic salmon genome, which likely is a consequence of previous genome duplications in the evolutionary past of salmonids. Plausible explanations for the high incidence of AhR genes in fish and more specifically in salmonids, like rapid divergences in specialized functions, are discussed.

Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

PubMed Central

2018-01-01

Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424

Sequence analysis of Jembrana disease virus strains reveals a genetically stable lentivirus.

PubMed

Desport, Moira; Stewart, Meredith E; Mikosza, Andrew S; Sheridan, Carol A; Peterson, Shane E; Chavand, Olivier; Hartaningsih, Nining; Wilcox, Graham E

2007-06-01

Jembrana disease virus (JDV) is a lentivirus associated with an acute disease syndrome with a 20% case fatality rate in Bos javanicus (Bali cattle) in Indonesia, occurring after a short incubation period and with no recurrence of the disease after recovery. Partial regions of gag and pol and the entire env were examined for sequence variation in DNA samples from cases of Jembrana disease obtained from Bali, Sumatra and South Kalimantan in Indonesian Borneo. A high level of nucleotide conservation (97-100%) was observed in gag sequences from samples taken in Bali and Sumatra, indicating that the source of JDV in Sumatra was most likely to have originated from Bali. The pol sequences and, unexpectedly, the env sequences from Bali samples were also well conserved with low nucleotide (96-99%) and amino acid substitutions (95-99%). However, the sample from South Kalimantan (JDV(KAL/01)) contained more divergent sequences, particularly in env (88% identity). Phylogenetic analysis revealed that the JDV(KAL/01)env sequences clustered with the sequence from the Pulukan sample (Bali) from 2001. JDV appears to be remarkably stable genetically and has undergone minor genetic changes over a period of nearly 20 years in Bali despite becoming endemic in the cattle population of the island.

Diagnostics of Neisseriaceae and Moraxellaceae by Ribosomal DNA Sequencing: Ribosomal Differentiation of Medical Microorganisms

PubMed Central

Harmsen, Dag; Singer, Christian; Rothgänger, Jörg; Tønjum, Tone; Sybren de Hoog, Gerrit; Shah, Haroun; Albert, Jürgen; Frosch, Matthias

2001-01-01

Fast and reliable identification of microbial isolates is a fundamental goal of clinical microbiology. However, in the case of some fastidious gram-negative bacterial species, classical phenotype identification based on either metabolic, enzymatic, or serological methods is difficult, time-consuming, and/or inadequate. 16S or 23S ribosomal DNA (rDNA) bacterial sequencing will most often result in accurate speciation of isolates. Therefore, the objective of this study was to find a hypervariable rDNA stretch, flanked by strongly conserved regions, which is suitable for molecular species identification of members of the Neisseriaceae and Moraxellaceae. The inter- and intrageneric relationships were investigated using comparative sequence analysis of PCR-amplified partial 16S and 23S rDNAs from a total of 94 strains. When compared to the type species of the genera Acinetobacter, Moraxella, and Neisseria, an average of 30 polymorphic positions was observed within the partial 16S rDNA investigated (corresponding to Escherichia coli positions 54 to 510) for each species and an average of 11 polymorphic positions was observed within the 202 nucleotides of the 23S rDNA gene (positions 1400 to 1600). Neisseria macacae and Neisseria mucosa subsp. mucosa (ATCC 19696) had identical 16S and 23S rDNA sequences. Species clusters were heterogeneous in both genes in the case of Acinetobacter lwoffii, Moraxella lacunata, and N. mucosa. Neisseria meningitidis isolates failed to cluster only in the 23S rDNA subset. Our data showed that the 16S rDNA region is more suitable than the partial 23S rDNA for the molecular diagnosis of Neisseriaceae and Moraxellaceae and that a reference database should include more than one strain of each species. All sequence chromatograms and taxonomic and disease-related information are available as part of our ribosomal differentiation of medical microorganisms (RIDOM) web-based service (http://www.ridom.hygiene.uni-wuerzburg.de/). Users can submit a sequence and conduct a similarity search against the RIDOM reference database for microbial identification purposes. PMID:11230407

On a New Trigonometric Identity

ERIC Educational Resources Information Center

Chen, Hongwei

2002-01-01

A new trigonometric identity derived from factorizations and partial fractions is given. This identity is used to evaluate the Poisson integral via Riemann sum and to establish some trigonometric summation identities.

A novel spotted fever group Rickettsia infecting Amblyomma parvitarsum (Acari: Ixodidae) in highlands of Argentina and Chile.

PubMed

Ogrzewalska, Maria; Nieri-Bastos, Fernanda A; Marcili, Arlei; Nava, Santiago; González-Acuña, Daniel; Muñoz-Leal, Sebastián; Ruiz-Arrondo, Ignacio; Venzal, José M; Mangold, Atilio; Labruna, Marcelo B

2016-04-01

The tick Amblyomma parvitarsum (Acari: Ixodidae) has established populations in Andean and Patagonic environments of South America. For the present study, adults of A. parvitarsum were collected in highland areas (elevation >3500 m) of Argentina and Chile during 2009-2013, and tested by PCR for rickettsial infection in the laboratory, and isolation of rickettsiae in Vero cell culture by the shell vial technique. Overall, 51 (62.2%) out of 82 A. parvitarsum adult ticks were infected by spotted fever group (SFG) rickettsiae, which generated DNA sequences 100% identical to each other, and when submitted to BLAST analysis, they were 99.3% identical to corresponding sequence of the ompA gene of Rickettsia sp. strain Atlantic rainforest. Rickettsiae were successfully isolated in Vero cell culture from two ticks, one from Argentina and one from Chile. DNA extracted from the third passage of the isolates of Argentina and Chile were processed by PCR, resulting in partial sequences for three rickettsial genes (gltA, ompB, ompA). These sequences were concatenated and aligned with rickettsial corresponding sequences available in GenBank. Phylogenetic analysis revealed that the A. pavitarsum rickettsial agent grouped under high bootstrap support in a clade composed by the SFG pathogens R. sibirica, R. africae, R. parkeri, Rickettsia sp. strain Atlantic rainforest, and two unnamed SFG agents of unknown pathogenicty, Rickettsia sp. strain NOD, and Rickettsia sp. strain ApPR. The pathogenic role of this A. parvitarsum rickettsia cannot be discarded, since several species of tick-borne rickettsiae that were considered nonpathogenic for decades are now associated with human infections. Copyright © 2016. Published by Elsevier GmbH.

Diversity in VP3, NSP3, and NSP4 of rotavirus B detected from Japanese cattle.

PubMed

Hayashi-Miyamoto, Michiko; Murakami, Toshiaki; Minami-Fukuda, Fujiko; Tsuchiaka, Shinobu; Kishimoto, Mai; Sano, Kaori; Naoi, Yuki; Asano, Keigo; Ichimaru, Toru; Haga, Kei; Omatsu, Tsutomu; Katayama, Yukie; Oba, Mami; Aoki, Hiroshi; Shirai, Junsuke; Ishida, Motohiko; Katayama, Kazuhiko; Mizutani, Tetsuya; Nagai, Makoto

2017-04-01

Bovine rotavirus B (RVB) is an etiological agent of diarrhea mostly in adult cattle. Currently, a few sequences of viral protein (VP)1, 2, 4, 6, and 7 and nonstructural protein (NSP)1, 2, and 5 of bovine RVB are available in the DDBJ/EMBL/GenBank databases, and none have been reported for VP3, NSP3, and NSP4. In order to fill this gap in the genetic characterization of bovine RVB strains, we used a metagenomics approach and sequenced and analyzed the complete coding sequences (CDS) of VP3, NSP3, and NSP4 genes, as well as the partial or complete CDS of other genes of RVBs detected from Japanese cattle. VP3, NSP3, and NSP4 of bovine RVBs shared low nucleotide sequence identities (63.3-64.9% for VP3, 65.9-68.2% for NSP3, and 52.6-56.2% for NSP4) with those of murine, human, and porcine RVBs, suggesting that bovine RVBs belong to a novel genotype. Furthermore, significantly low amino acid sequence identities were observed for NSP4 (36.1-39.3%) between bovine RVBs and the RVBs of other species. In contrast, hydrophobic plot analysis of NSP4 revealed profiles similar to those of RVBs of other species and rotavirus A (RVA) strains. Phylogenetic analyses of all gene segments revealed that bovine RVB strains formed a cluster that branched distantly from other RVBs. These results suggest that bovine RVBs have evolved independently from other RVBs but in a similar manner to other rotaviruses. These findings provide insights into the evolution and diversity of RVB strains. Copyright © 2017 Elsevier B.V. All rights reserved.

The central domain of bovine submaxillary mucin consists of over 50 tandem repeats of 329 amino acids. Chromosomal localization of the BSM1 gene and relations to ovine and porcine counterparts.

PubMed

Jiang, W; Gupta, D; Gallagher, D; Davis, S; Bhavanandan, V P

2000-04-01

We previously elucidated five distinct protein domains (I-V) for bovine submaxillary mucin, which is encoded by two genes, BSM1 and BSM2. Using Southern blot analysis, genomic cloning and sequencing of the BSM1 gene, we now show that the central domain (V) consists of approximately 55 tandem repeats of 329 amino acids and that domains III-V are encoded by a 58.4-kb exon, the largest exon known for all genes to date. The BSM1 gene was mapped by fluorescence in situ hybridization to the proximal half of chromosome 5 at bands q2. 2-q2.3. The amino-acid sequence of six tandem repeats (two full and four partial) were found to have only 92-94% identities. We propose that the variability in the amino-acid sequences of the mucin tandem repeat is important for generating the combinatorial library of saccharides that are necessary for the protective function of mucins. The deduced peptide sequences of the central domain match those determined from the purified bovine submaxillary mucin and also show 68-94% identity to published peptide sequences of ovine submaxillary mucin. This indicates that the core protein of ovine submaxillary mucin is closely related to that of bovine submaxillary mucin and contains similar tandem repeats in the central domain. In contrast, the central domain of porcine submaxillary mucin is reported to consist of 81-amino-acid tandem repeats. However, both bovine submaxillary mucin and porcine submaxillary mucin contain similar N-terminal and C-terminal domains and the corresponding genes are in the conserved linkage regions of the respective genomes.

Identification and Characterization of Citrus tristeza virus Isolates Breaking Resistance in Trifoliate Orange in California.

PubMed

Yokomi, Raymond K; Selvaraj, Vijayanandraj; Maheshwari, Yogita; Saponari, Maria; Giampetruzzi, Annalisa; Chiumenti, Michela; Hajeri, Subhas

2017-07-01

Most Citrus tristeza virus (CTV) isolates in California are biologically mild and symptomless in commercial cultivars on CTV tolerant rootstocks. However, to better define California CTV isolates showing divergent serological and genetic profiles, selected isolates were subjected to deep sequencing of small RNAs. Full-length sequences were assembled, annotated and trifoliate orange resistance-breaking (RB) isolates of CTV were identified. Phylogenetic relationships based on their full genomes placed three isolates in the RB clade: CA-RB-115, CA-RB-AT25, and CA-RB-AT35. The latter two isolates were obtained by aphid transmission from Murcott and Dekopon trees, respectively, containing CTV mixtures. The California RB isolates were further distinguished into two subclades. Group I included CA-RB-115 and CA-RB-AT25 with 99% nucleotide sequence identity with RB type strain NZRB-G90; and group II included CA-RB-AT35 with 99 and 96% sequence identity with Taiwan Pumelo/SP/T1 and HA18-9, respectively. The RB phenotype was confirmed by detecting CTV replication in graft-inoculated Poncirus trifoliata and transmission from P. trifoliata to sweet orange. The California RB isolates induced mild symptoms compared with severe isolates in greenhouse indexing tests. Further examination of 570 CTV accessions, acquired from approximately 1960 and maintained in planta at the Central California Tristeza Eradication Agency, revealed 16 RB positive isolates based on partial p65 sequences. Six isolates collected from 1992 to 2011 from Tulare and Kern counties were CA-RB-115-like; and 10 isolates collected from 1968 to 2010 from Riverside, Fresno, and Kern counties were CA-RB-AT35-like. The presence of the RB genotype is relevant because P. trifoliata and its hybrids are the most popular rootstocks in California.

The nucleotide sequence of Watermelon mosaic virus (WMV, Potyvirus) reveals interspecific recombination between two related potyviruses in the 5' part of the genome.

PubMed

Desbiez, C; Lecoq, H

2004-08-01

Watermelon mosaic virus (WMV, Potyvirus) is a potyvirus with a worldwide distribution, mostly in temperate and mediterranean regions. According to the partial sequences that were available, WMV appeared to share high sequence similarity with Soybean mosaic virus (SMV), and it was almost considered as a strain of SMV in spite of its different and much broader host range. Like SMV, it was also related to legume-infecting potyviruses belonging to the " Bean common mosaic virus (BCMV) subgroup". In this paper we obtained the full-length sequence of WMV, and we confirmed that this virus is very closely related to SMV in most of its genome; however, there is evidence for an interspecific recombination in the P1 protein, as the P1 of WMV was 135 amino-acids longer than that of SMV, and the N-terminal half of the P1 showed no relation to SMV but was 85% identical to BCMV. This suggests that WMV has emerged through an ancestral recombination event, and supports the distinction of WMV and SMV as separate taxonomic units.

Taxonomic evaluation of putative Streptomyces scabiei strains held in the ARS Culture Collection (NRRL) using multi-locus sequence analysis.

PubMed

Labeda, David P

2016-03-01

Multi-locus sequence analysis has been demonstrated to be a useful tool for identification of Streptomyces species and was previously applied to phylogenetically differentiate the type strains of species pathogenic on potatoes (Solanum tuberosum L.). The ARS Culture Collection (NRRL) contains 43 strains identified as Streptomyces scabiei deposited at various times since the 1950s and these were subjected to multi-locus sequence analysis utilising partial sequences of the house-keeping genes atpD, gyrB, recA, rpoB and trpB. Phylogenetic analyses confirmed the identity of 17 of these strains as Streptomyces scabiei, 9 of the strains as the potato-pathogenic species Streptomyces europaeiscabiei and 6 strains as potentially new phytopathogenic species. Of the 16 other strains, 12 were identified as members of previously described non-pathogenic Streptomyces species while the remaining 4 strains may represent heretofore unrecognised non-pathogenic species. This study demonstrated the value of this technique for the relatively rapid, simple and sensitive molecular identification of Streptomyces strains held in culture collections.

PCR detection of Anaplasma phagocytophilum in goat flocks in an area endemic for tick-borne fever in Switzerland.

PubMed

Silaghi, C; Scheuerle, M C; Friche Passos, L M; Thiel, C; Pfister, K

2011-02-01

Central Switzerland is a highly endemic region for tick-borne fever (TBF) in cattle, however, little is known about A. phagocytophilum in goats. In the present study, 72 animals from six goat flocks (373 EDTA blood-samples) in Central Switzerland were analysed for A. phagocytophilum DNA. A real-time PCR targeting the msp2 gene of A. phagocytophilum was performed and in positive samples the partial 165 rRNA, groEL and msp4 gene were amplified for sequence analysis. Four DNA extracts were positive. Different sequence types on basis of the amplified genes were found. For comparison, sequences of A. phagocytophilum from 12 cattle (originating from Switzerland and Southern Germany) were analysed. The 165 rRNA gene sequences from cattle were all identical amongst each other, but the groEL and msp4 gene differed depending on the origin of the cattle samples and differed from the variants from goats. This study clearly provides molecular evidence for the presence of different types of A. phagocytophilum in goat flocks in Switzerland, a fact which deserves more thorough attention in clinical studies.

Occurrence of dsRNA Mycovirus (LeV-FMRI0339) in the Edible Mushroom Lentinula edodes and Meiotic Stability of LeV-FMRI0339 among Monokaryotic Progeny

PubMed Central

Kim, Jung-Mi; Yun, Suk-Hyun; Park, Seung-Moon; Ko, Han-Gyu; Kim, Dae-Hyuk

2013-01-01

dsRNA was found in malformed cultures of Lentinula edodes strain FMRI0339, one of the three most popular sawdust cultivated commercial strains of shiitake, and was also found in healthy-looking fruiting bodies and actively growing mycelia. Cloning of the partial genome of the dsRNA revealed the presence of the RdRp sequence of a novel L. edodes mycovirus (LeV), and sequence comparison of the cloned amplicon showed identical sequences sequence to known RNA-dependent RNA polymerase genes of LeV found in strain HKA. The meiotic stability of dsRNA was examined by measuring the ratio of the presence of dsRNA among sexual monokaryotic progeny. More than 40% of the monokaryotic progeny still contained the dsRNA, indicating the persistence of dsRNA during sexual reproduction. Comparing the mycelia growth of monokaryotic progeny suggested that there appeared to be a tendency toward a lower frequency of virus incidence in actively growing progeny. PMID:25288977

The bean. alpha. -amylase inhibitor is encoded by a lectin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moreno, J.; Altabella, T.; Chrispeels, M.J.

The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has themore » same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.« less

Toxicity and Molecular Identification of Green Toadfish Lagocephalus lunaris Collected from Kyushu Coast, Japan

PubMed Central

Nagashima, Yuji; Matsumoto, Takuya; Kadoyama, Keisuke; Ishizaki, Shoichiro; Terayama, Makoto

2011-01-01

Green toadfish Lagocephalus lunaris inhabits tropical and subtropical seas and contains high tetrodotoxin (TTX) levels in the muscle as well as liver and gonad. In 2008 to 2009, food poisoning due to ingesting L. lunais occurred in Western Japan. Five specimens of green toadfish caught in Kyushu coast, Japan, were analyzed for toxicity, toxins, and species identification. All five specimens were toxic by bioassay. Comparing the maximum toxicity in tissues, ovary contained the most toxin (1810 mouse unit [MU]/g), followed by liver (341 MU/g), muscle (135 MU/g), skin (79 MU/g), and intestine (72 MU/g). Liquid chromatography/mass spectrometry analysis revealed that TTX was the major toxin. Nucleotide sequence analysis of the 16S rRNA gene fragment of muscle mitochondrial DNA indicated that partial sequences of PCR products of four specimens were identical with that of L. lunaris. The sequence of one specimen was indistinguishable from that of the brown-backed toadfish Lagocephalus wheeleri, a nontoxic species. PMID:22028709

Role of chicken astrovirus as a causative agent of gout in commercial broilers in India.

PubMed

Bulbule, N R; Mandakhalikar, K D; Kapgate, S S; Deshmukh, V V; Schat, K A; Chawak, M M

2013-01-01

Several outbreaks of gout were reported in commercial broilers in India during 2011 and 2012, causing up to 40% mortality in the birds. Gross and histopathological observations confirmed gout. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) analysis from kidney samples of gout-affected birds indicated the presence of chicken astrovirus (CAstV) in 41.7% of cases and a mixed infection of CAstV and avian nephritis virus (ANV) in 36.4% of cases. CAstV isolated from gout-affected kidneys by inoculating embryonated specific pathogen free (SPF) eggs showed dwarfing in embryos and a cytopathic effect in chicken embryo kidney cells. Inoculation of 1-day-old SPF and broiler chicks with CAstVs caused gout and mortality between 4 and 10 days post inoculation. Virus isolation and qRT-PCR analysis showed the presence of only CAstV in inoculated chicks. Sequence analysis of capsid genes indicated a major group of Indian CAstVs that displayed 92.0 to 99.2% intergroup amino acid identity and 83.9 to 90.4% identity with subgroup Bi CAstVs of UK origin. We designated this group Indian Bi. Analysis of the partial polymerase amino acid sequences of our isolates indicated two groups of CAstVs (Indian 1 and 2) that displayed 90.2 to 95.5% amino acid identity between them. We thus report for the first time that, in addition to infectious bronchitis virus and ANV, CAstVs are a causative agent of gout.

Novel magnetite-producing magnetotactic bacteria belonging to the Gammaproteobacteria.

PubMed

Lefèvre, Christopher T; Viloria, Nathan; Schmidt, Marian L; Pósfai, Mihály; Frankel, Richard B; Bazylinski, Dennis A

2012-02-01

Two novel magnetotactic bacteria (MTB) were isolated from sediment and water collected from the Badwater Basin, Death Valley National Park and southeastern shore of the Salton Sea, respectively, and were designated as strains BW-2 and SS-5, respectively. Both organisms are rod-shaped, biomineralize magnetite, and are motile by means of flagella. The strains grow chemolithoautotrophically oxidizing thiosulfate and sulfide microaerobically as electron donors, with thiosulfate oxidized stoichiometrically to sulfate. They appear to utilize the Calvin-Benson-Bassham cycle for autotrophy based on ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) activity and the presence of partial sequences of RubisCO genes. Strains BW-2 and SS-5 biomineralize chains of octahedral magnetite crystals, although the crystals of SS-5 are elongated. Based on 16S rRNA gene sequences, both strains are phylogenetically affiliated with the Gammaproteobacteria class. Strain SS-5 belongs to the order Chromatiales; the cultured bacterium with the highest 16S rRNA gene sequence identity to SS-5 is Thiohalocapsa marina (93.0%). Strain BW-2 clearly belongs to the Thiotrichales; interestingly, the organism with the highest 16S rRNA gene sequence identity to this strain is Thiohalospira alkaliphila (90.2%), which belongs to the Chromatiales. Each strain represents a new genus. This is the first report of magnetite-producing MTB phylogenetically associated with the Gammaproteobacteria. This finding is important in that it significantly expands the phylogenetic diversity of the MTB. Physiology of these strains is similar to other MTB and continues to demonstrate their potential in nitrogen, iron, carbon and sulfur cycling in natural environments.

The gene for stinging nettle lectin (Urtica dioica agglutinin) encodes both a lectin and a chitinase.

PubMed

Lerner, D R; Raikhel, N V

1992-06-05

Chitin-binding proteins are present in a wide range of plant species, including both monocots and dicots, even though these plants contain no chitin. To investigate the relationship between in vitro antifungal and insecticidal activities of chitin-binding proteins and their unknown endogenous functions, the stinging nettle lectin (Urtica dioica agglutinin, UDA) cDNA was cloned using a synthetic gene as the probe. The nettle lectin cDNA clone contained an open reading frame encoding 374 amino acids. Analysis of the deduced amino acid sequence revealed a 21-amino acid putative signal sequence and the 86 amino acids encoding the two chitin-binding domains of nettle lectin. These domains were fused to a 19-amino acid "spacer" domain and a 244-amino acid carboxyl extension with partial identity to a chitinase catalytic domain. The authenticity of the cDNA clone was confirmed by deduced amino acid sequence identity with sequence data obtained from tryptic digests, RNA gel blot, and polymerase chain reaction analyses. RNA gel blot analysis also showed the nettle lectin message was present primarily in rhizomes and inflorescence (with immature seeds) but not in leaves or stems. Chitinase enzymatic activity was found when the chitinase-like domain alone or the chitinase-like domain with the chitin-binding domains were expressed in Escherichia coli. This is the first example of a chitin-binding protein with both a duplication of the 43-amino acid chitin-binding domain and a fusion of the chitin-binding domains to a structurally unrelated domain, the chitinase domain.

The Nerium oleander aphid Aphis nerii is tolerant to a local isolate of Aphid lethal paralysis virus (ALPV).

PubMed

Dombrovsky, Aviv; Luria, Neta

2013-04-01

In a survey that was conducted during the year 2011, a local strain of Aphid lethal paralysis virus (ALPV) was identified and isolated from a wild population of Aphis nerii aphids living on Nerium oleander plants located in northern Israel. The new strain was tentatively named (ALPV-An). RNA extracted from the viral particles allowed the amplification and determination of the complete genome sequence. The virus genome is comprised of 9835 nucleotides. In a BLAST search analysis, the ALPV-An sequence showed 89 % nucleotide sequence identity with the whole genome of a South African ALPV and 96 and 94 % amino acid sequence identity with the ORF1 and ORF2 of that strain, respectively. In preliminary experiments, spray-applied, purified ALPV virions were highly pathogenic to the green peach aphid Myzus persicae; 95 % mortality was recorded 4 days post-infection. These preliminary results demonstrate the potential of ALPV for use as a biologic agent for some aphid control. Surprisingly, no visible ALPV pathogenic effects, such as morphological changes or paralysis, were observed in the A. nerii aphids infected with ALPV-An. The absence of clear ALPV symptoms in A. nerii led to the formulation of two hypotheses, which were partially examined in this study. The first hypothesis suggest that A. nerii is resistant or tolerant of ALPV, while the second hypothesis propose that ALPV-An may be a mild strain of ALPV. Currently, our results is in favor with the first hypothesis since ALPV-An is cryptic in A. nerii aphids and can be lethal for M. persicae aphids.

Genetic analysis of the porcine group B rotavirus NSP2 gene from wild-type Brazilian strains.

PubMed

Médici, K C; Barry, A F; Alfieri, A F; Alfieri, A A

2010-01-01

Group B rotaviruses (RV-B) were first identified in piglet feces, being later associated with diarrhea in humans, cattle, lambs, and rats. In human beings, the virus was only described in China, India, and Bangladesh, especially infecting adults. Only a few studies concerning molecular analysis of the RV-B NSP2 gene have been conducted, and porcine RV-B has not been characterized. In the present study, three porcine wild-type RV-B strains from piglet stool samples collected from Brazilian pig herds were used for analysis. PAGE results were inconclusive for those samples, but specific amplicons of the RV-B NSP2 gene (segment 8) were obtained in a semi-nested PCR assay. The three porcine RV-B strains showed the highest nucleotide identity with the human WH1 strain and the alignments with other published sequences resulted in three groups of strains divided according to host species. The group of human strains showed 92.4 to 99.7% nucleotide identity while the porcine strains of the Brazilian RV-B group showed 90.4 to 91.8% identity to each other. The identity of the Brazilian porcine RV-B strains with outer sequences consisting of group A and C rotaviruses was only 35.3 to 38.8%. A dendrogram was also constructed to group the strains into clusters according to host species: human, rat, and a distinct third cluster consisting exclusively of the Brazilian porcine RV-B strains. This is the first study of the porcine RV-B NSP2 gene that contributes to the partial characterization of this virus and demonstrates the relationship among RV-B strains from different host species.

TLA-1: a New Plasmid-Mediated Extended-Spectrum β-Lactamase from Escherichia coli

PubMed Central

Silva, J.; Aguilar, C.; Ayala, G.; Estrada, M. A.; Garza-Ramos, U.; Lara-Lemus, R.; Ledezma, L.

2000-01-01

Escherichia coli R170, isolated from the urine of an infected patient, was resistant to expanded-spectrum cephalosporins, aztreonam, ciprofloxacin, and ofloxacin but was susceptible to amikacin, cefotetan, and imipenem. This particular strain contained three different plasmids that encoded two β-lactamases with pIs of 7.0 and 9.0. Resistance to cefotaxime, ceftazidime, aztreonam, trimethoprim, and sulfamethoxazole was transferred by conjugation from E. coli R170 to E. coli J53-2. The transferred plasmid, RZA92, which encoded a single β-lactamase, was 150 kb in length. The cefotaxime resistance gene that encodes the TLA-1 β-lactamase (pI 9.0) was cloned from the transconjugant by transformation to E. coli DH5α. Sequencing of the blaTLA-1 gene revealed an open reading frame of 906 bp, which corresponded to 301 amino acid residues, including motifs common to class A β-lactamases: 70SXXK, 130SDN, and 234KTG. The amino acid sequence of TLA-1 shared 50% identity with the CME-1 chromosomal class A β-lactamase from Chryseobacterium (Flavobacterium) meningosepticum; 48.8% identity with the VEB-1 class A β-lactamase from E. coli; 40 to 42% identity with CblA of Bacteroides uniformis, PER-1 of Pseudomonas aeruginosa, and PER-2 of Salmonella typhimurium; and 39% identity with CepA of Bacteroides fragilis. The partially purified TLA-1 β-lactamase had a molecular mass of 31.4 kDa and a pI of 9.0 and preferentially hydrolyzed cephaloridine, cefotaxime, cephalothin, benzylpenicillin, and ceftazidime. The enzyme was markedly inhibited by sulbactam, tazobactam, and clavulanic acid. TLA-1 is a new extended-spectrum β-lactamase of Ambler class A. PMID:10722503

TLA-1: a new plasmid-mediated extended-spectrum beta-lactamase from Escherichia coli.

PubMed

Silva, J; Aguilar, C; Ayala, G; Estrada, M A; Garza-Ramos, U; Lara-Lemus, R; Ledezma, L

2000-04-01

Escherichia coli R170, isolated from the urine of an infected patient, was resistant to expanded-spectrum cephalosporins, aztreonam, ciprofloxacin, and ofloxacin but was susceptible to amikacin, cefotetan, and imipenem. This particular strain contained three different plasmids that encoded two beta-lactamases with pIs of 7.0 and 9.0. Resistance to cefotaxime, ceftazidime, aztreonam, trimethoprim, and sulfamethoxazole was transferred by conjugation from E. coli R170 to E. coli J53-2. The transferred plasmid, RZA92, which encoded a single beta-lactamase, was 150 kb in length. The cefotaxime resistance gene that encodes the TLA-1 beta-lactamase (pI 9.0) was cloned from the transconjugant by transformation to E. coli DH5alpha. Sequencing of the bla(TLA-1) gene revealed an open reading frame of 906 bp, which corresponded to 301 amino acid residues, including motifs common to class A beta-lactamases: (70)SXXK, (130)SDN, and (234)KTG. The amino acid sequence of TLA-1 shared 50% identity with the CME-1 chromosomal class A beta-lactamase from Chryseobacterium (Flavobacterium) meningosepticum; 48.8% identity with the VEB-1 class A beta-lactamase from E. coli; 40 to 42% identity with CblA of Bacteroides uniformis, PER-1 of Pseudomonas aeruginosa, and PER-2 of Salmonella typhimurium; and 39% identity with CepA of Bacteroides fragilis. The partially purified TLA-1 beta-lactamase had a molecular mass of 31.4 kDa and a pI of 9.0 and preferentially hydrolyzed cephaloridine, cefotaxime, cephalothin, benzylpenicillin, and ceftazidime. The enzyme was markedly inhibited by sulbactam, tazobactam, and clavulanic acid. TLA-1 is a new extended-spectrum beta-lactamase of Ambler class A.

Multiple copies of a bile acid-inducible gene in Eubacterium sp. strain VPI 12708.

PubMed Central

Gopal-Srivastava, R; Mallonee, D H; White, W B; Hylemon, P B

1990-01-01

Eubacterium sp. strain VPI 12708 is an anaerobic intestinal bacterium which possesses inducible bile acid 7-dehydroxylation activity. Several new polypeptides are produced in this strain following induction with cholic acid. Genes coding for two copies of a bile acid-inducible 27,000-dalton polypeptide (baiA1 and baiA2) have been previously cloned and sequenced. We now report on a gene coding for a third copy of this 27,000-dalton polypeptide (baiA3). The baiA3 gene has been cloned in lambda DASH on an 11.2-kilobase DNA fragment from a partial Sau3A digest of the Eubacterium DNA. DNA sequence analysis of the baiA3 gene revealed 100% homology with the baiA1 gene within the coding region of the 27,000-dalton polypeptides. The baiA2 gene shares 81% sequence identity with the other two genes at the nucleotide level. The flanking nucleotide sequences associated with the baiA1 and baiA3 genes are identical for 930 bases in the 5' direction from the initiation codon and for at least 325 bases in the 3' direction from the stop codon, including the putative promoter regions for the genes. An additional open reading frame (occupying from 621 to 648 bases, depending on the correct start codon) was found in the identical 5' regions associated with the baiA1 and baiA3 clones. The 5' sequence 930 bases upstream from the baiA1 and baiA3 genes was totally divergent. The baiA2 gene, which is part of a large bile acid-inducible operon, showed no homology with the other two genes either in the 5' or 3' direction from the polypeptide coding region, except for a 15-base-pair presumed ribosome-binding site in the 5' region. These studies strongly suggest that a gene duplication (baiA1 and baiA3) has occurred and is stably maintained in this bacterium. Images PMID:2376563

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Description of a new soft tick species (Acari: Argasidae: Ornithodoros) associated with stream-breeding frogs (Anura: Cycloramphidae: Cycloramphus) in Brazil.

PubMed

Muñoz-Leal, Sebastián; Toledo, Luís Felipe; Venzal, José M; Marcili, Arlei; Martins, Thiago F; Acosta, Igor C L; Pinter, Adriano; Labruna, Marcelo B

2017-08-01

In this study, we present a morphological description of immature and adult specimens of Ornithodoros saraivai n. sp., a tick associated with the frog Cycloramphus boraceiensis (Cycloramphidae) at São Sebastião island, located in the São Paulo state seaboard, Brazil. While larvae of O. saraivai are ecologically related to Ornithodoros faccinii, another soft tick associated with cycloramphids, the combination of 7 sternal pairs, 16 dorsal pairs, a pyriform dorsal plate and a partially toothed hypostome constitute unique characters of the O. saraivai larvae. One undetermined nymphal instar and adults of O. saraivai are similar to mature specimens of the Ornithodoros talaje species group; however, the O. saraivai specimens can be recognized by the presence of a robust bean-shaped spiracle with a large spiracular plate and more than two long seta in palpal article I. Identical partial sequences of the mitochondrial 16S rDNA gene confirmed the identity for all collected stages and for two cohorts of laboratory-reared larvae of O. saraivai. A Bayesian and Maximum Parsimony inferred phylogenetic trees support the position of O. saraivai in a clade with O. faccinii, suggesting the existence of an Ornithodoros lineage that evolved in association with amphibians. Copyright © 2017 Elsevier GmbH. All rights reserved.

Down-Regulation of TM29, a Tomato SEPALLATA Homolog, Causes Parthenocarpic Fruit Development and Floral Reversion1

PubMed Central

Ampomah-Dwamena, Charles; Morris, Bret A.; Sutherland, Paul; Veit, Bruce; Yao, Jia-Long

2002-01-01

We have characterized the tomato (Lycopersicon esculentum Mill.) MADS box gene TM29 that shared a high amino acid sequence homology to the Arabidopsis SEP1, 2, and 3 (SEPALLATA1, 2, and 3) genes. TM29 showed similar expression profiles to SEP1, with accumulation of mRNA in the primordia of all four whorls of floral organs. In addition, TM29 mRNA was detected in inflorescence and vegetative meristems. To understand TM29 function, we produced transgenic tomato plants in which TM29 expression was down-regulated by either cosuppression or antisense techniques. These transgenic plants produced aberrant flowers with morphogenetic alterations in the organs of the inner three whorls. Petals and stamens were green rather than yellow, suggesting a partial conversion to a sepalloid identity. Stamens and ovaries were infertile, with the later developing into parthenocarpic fruit. Ectopic shoots with partially developed leaves and secondary flowers emerged from the fruit. These shoots resembled the primary transgenic flowers and continued to produce parthenocarpic fruit and additional ectopic shoots. Based on the temporal and spatial expression pattern and transgenic phenotypes, we propose that TM29 functions in floral organ development, fruit development, and maintenance of floral meristem identity in tomato. PMID:12376628

In-depth characterization of breast cancer tumor-promoting cell transcriptome by RNA sequencing and microarrays

PubMed Central

Soldà, Giulia; Merlino, Giuseppe; Fina, Emanuela; Brini, Elena; Moles, Anna; Cappelletti, Vera; Daidone, Maria Grazia

2016-01-01

Numerous studies have reported the existence of tumor-promoting cells (TPC) with self-renewal potential and a relevant role in drug resistance. However, pathways and modifications involved in the maintenance of such tumor subpopulations are still only partially understood. Sequencing-based approaches offer the opportunity for a detailed study of TPC including their transcriptome modulation. Using microarrays and RNA sequencing approaches, we compared the transcriptional profiles of parental MCF7 breast cancer cells with MCF7-derived TPC (i.e. MCFS). Data were explored using different bioinformatic approaches, and major findings were experimentally validated. The different analytical pipelines (Lifescope and Cufflinks based) yielded similar although not identical results. RNA sequencing data partially overlapped microarray results and displayed a higher dynamic range, although overall the two approaches concordantly predicted pathway modifications. Several biological functions were altered in TPC, ranging from production of inflammatory cytokines (i.e., IL-8 and MCP-1) to proliferation and response to steroid hormones. More than 300 non-coding RNAs were defined as differentially expressed, and 2,471 potential splicing events were identified. A consensus signature of genes up-regulated in TPC was derived and was found to be significantly associated with insensitivity to fulvestrant in a public breast cancer patient dataset. Overall, we obtained a detailed portrait of the transcriptome of a breast cancer TPC line, highlighted the role of non-coding RNAs and differential splicing, and identified a gene signature with a potential as a context-specific biomarker in patients receiving endocrine treatment. PMID:26556871

Superoxide activates a GDP-sensitive proton conductance in skeletal muscle mitochondria from king penguin (Aptenodytes patagonicus).

PubMed

Talbot, Darren A; Hanuise, Nicolas; Rey, Benjamin; Rouanet, Jean-Louis; Duchamp, Claude; Brand, Martin D

2003-12-26

We present the partial nucleotide sequence of the avian uncoupling protein (avUCP) gene from king penguin (Aptenodytes patagonicus), showing that the protein is 88-92% identical to chicken (Gallus gallus), turkey (Meleagris gallopavo), and hummingbird (Eupetomena macroura). We show that superoxide activates the proton conductance of mitochondria isolated from king penguin skeletal muscle. GDP abolishes the superoxide-activated proton conductance, indicating that it is mediated via avUCP. In the absence of superoxide there is no GDP-sensitive component of the proton conductance from penguin muscle mitochondria demonstrating that avUCP plays no role in the basal proton leak.

Molecular basis of the polydispersity of mucins: implications for the generation of saccharide diversity.

PubMed

Bhavanandan, V P; Gupta, D; Woitach, J; Guo, X; Jiang, W

1999-06-01

Secreted epithelial mucins are large macromolecules which exhibit extreme polydispersity, the molecular basis of which is not fully understood. We have obtained partial sequences of two genes (BSM1 and BSM2) coding for two distinct molecules. This is the first time that such closely-related genes have been identified for any mucin from an animal. We propose that a combination of multiple homologous genes, alternative splicing, differential glycosylation, and additional post-translational processing all contribute to the extreme polydispersity of mucins. The multiple domain structure and non-identical tandem repeats are also very important for the generation of the saccharide diversities of mucins.

Identification of a Novel Renal Coccidian (Apicomplexa: Eimeriidae) from the Great-Horned Owl ( Bubo virginianus ), USA.

PubMed

Jankovsky, Jennie M; Brand, Mabre; Gerhold, Richard W

2017-04-01

We diagnosed renal coccidiosis in two of five Great-horned Owls ( Bubo virginianus ) examined in eastern Tennessee, US, 2007-13. Histopathologic examination of the kidneys revealed multifocal mild-to-moderate dilation and epithelial hyperplasia of collecting ducts. Renal collecting duct epithelial cells contained intracytoplasmic microgametocytes, macrogametocytes, and sporulating and sporulated oocysts. Renal coccidiosis in affected birds did not result in significant inflammation. Sequence analysis of the amplified partial 18S short subunit ribosomal RNA coding region from examination of formalin fixed tissue by using PCR disclosed a 93% identity to Eimeria reichenowi in GenBank, suggesting a novel Eimeria sp.

Analysis of CHRNA7 rare variants in autism spectrum disorder susceptibility.

PubMed

Bacchelli, Elena; Battaglia, Agatino; Cameli, Cinzia; Lomartire, Silvia; Tancredi, Raffaella; Thomson, Susanne; Sutcliffe, James S; Maestrini, Elena

2015-04-01

Chromosome 15q13.3 recurrent microdeletions are causally associated with a wide range of phenotypes, including autism spectrum disorder (ASD), seizures, intellectual disability, and other psychiatric conditions. Whether the reciprocal microduplication is pathogenic is less certain. CHRNA7, encoding for the alpha7 subunit of the neuronal nicotinic acetylcholine receptor, is considered the likely culprit gene in mediating neurological phenotypes in 15q13.3 deletion cases. To assess if CHRNA7 rare variants confer risk to ASD, we performed copy number variant analysis and Sanger sequencing of the CHRNA7 coding sequence in a sample of 135 ASD cases. Sequence variation in this gene remains largely unexplored, given the existence of a fusion gene, CHRFAM7A, which includes a nearly identical partial duplication of CHRNA7. Hence, attempts to sequence coding exons must distinguish between CHRNA7 and CHRFAM7A, making next-generation sequencing approaches unreliable for this purpose. A CHRNA7 microduplication was detected in a patient with autism and moderate cognitive impairment; while no rare damaging variants were identified in the coding region, we detected rare variants in the promoter region, previously described to functionally reduce transcription. This study represents the first sequence variant analysis of CHRNA7 in a sample of idiopathic autism. © 2015 Wiley Periodicals, Inc.

Full-length genome characterization and genetic relatedness analysis of hepatitis A virus outbreak strains associated with acute liver failure among children.

PubMed

Vaughan, Gilberto; Forbi, Joseph C; Xia, Guo-Liang; Fonseca-Ford, Maureen; Vazquez, Roberto; Khudyakov, Yury E; Montiel, Sonia; Waterman, Steve; Alpuche, Celia; Gonçalves Rossi, Livia Maria; Luna, Norma

2014-02-01

Clinical infection by hepatitis A virus (HAV) is generally self-limited but in some cases can progress to liver failure. Here, an HAV outbreak investigation among children with acute liver failure in a highly endemic country is presented. In addition, a sensitive method for HAV whole genome amplification and sequencing suitable for analysis of clinical samples is described. In this setting, two fatal cases attributed to acute liver failure and two asymptomatic cases living in the same household were identified. In a second household, one HAV case was observed with jaundice which resolved spontaneously. Partial molecular characterization showed that both households were infected by HAV subtype IA; however, the infecting strains in the two households were different. The HAV outbreak strains recovered from all cases grouped together within cluster IA1, which contains closely related HAV strains from the United States commonly associated with international travelers. Full-genome HAV sequences obtained from the household with the acute liver failure cases were related (genetic distances ranging from 0.01% to 0.04%), indicating a common-source infection. Interestingly, the strain recovered from the asymptomatic household contact was nearly identical to the strain causing acute liver failure. The whole genome sequence from the case in the second household was distinctly different from the strains associated with acute liver failure. Thus, infection with almost identical HAV strains resulted in drastically different clinical outcomes. © 2013 Wiley Periodicals, Inc.

Genetic variability in Melipona quinquefasciata (Hymenoptera, Apidae, Meliponini) from northeastern Brazil determined using the first internal transcribed spacer (ITS1).

PubMed

Pereira, J O P; Freitas, B M; Jorge, D M M; Torres, D C; Soares, C E A; Grangeiro, T B

2009-01-01

Melipona quinquefasciata is a ground-nesting South American stingless bee whose geographic distribution was believed to comprise only the central and southern states of Brazil. We obtained partial sequences (about 500-570 bp) of first internal transcribed spacer (ITS1) nuclear ribosomal DNA from Melipona specimens putatively identified as M. quinquefasciata collected from different localities in northeastern Brazil. To confirm the taxonomic identity of the northeastern samples, specimens from the state of Goiás (Central region of Brazil) were included for comparison. All sequences were deposited in GenBank (accession numbers EU073751-EU073759). The mean nucleotide divergence (excluding sites with insertions/deletions) in the ITS1 sequences was only 1.4%, ranging from 0 to 4.1%. When the sites with insertions/deletions were also taken into account, sequence divergences varied from 0 to 5.3%. In all pairwise comparisons, the ITS1 sequence from the specimens collected in Goiás was most divergent compared to the ITS1 sequences of the bees from the other locations. However, neighbor-joining phylogenetic analysis showed that all ITS1 sequences from northeastern specimens along with the sample of Goiás were resolved in a single clade with a bootstrap support of 100%. The ITS1 sequencing data thus support the occurrence of M. quinquefasciata in northeast Brazil.

Bird ticks in Hungary reflect western, southern, eastern flyway connections and two genetic lineages of Ixodes frontalis and Haemaphysalis concinna.

PubMed

Hornok, S; Flaisz, B; Takács, N; Kontschán, J; Csörgő, T; Csipak, Á; Jaksa, B R; Kováts, D

2016-02-24

Birds play an important role in short- and long-distance transportation of ticks and tick-borne pathogens. The aim of the present study was to provide comprehensive information on the species and genetic diversity of ixodid ticks transported by migratory and non-migratory bird species in Central Europe, and to evaluate relevant data in a geographical, as well as in an ecological context. During a three year period (2012-2014), altogether 3339 ixodid ticks were collected from 1167 passerine birds (representatives of 47 species) at ringing stations in Hungary. These ticks were identified, and the tick-infestations of bird species were compared according to various traits. In addition, PCR and sequencing of part of the cytochrome oxidase subunit-I (COI) and 16S rDNA genes were performed from representatives of five tick species. The most abundant tick species found were Ixodes ricinus and Haemaphysalis concinna (with 2296 and 989 immature stages, respectively). In addition, 48 I. frontalis (all stages), three Hyalomma rufipes nymphs, one I. lividus and two I. festai females were collected. The majority of I. ricinus and I. frontalis specimens occurred on ground-feeding bird species, as contrasted to Ha. concinna. Hy. rufipes showed the highest degree of sequence identity to an Ethiopian hybrid of the same tick species. Based on both COI and 16S rDNA gene analyses, two genetic lineages of I. frontalis were recognized (with only 91.4 % identity in their partial COI gene). These were highly similar to South-Western European isolates of the same tick species. Phylogenetic analysis of Ha. concinna specimens collected from birds in Hungary also revealed two genetic lineages, one of which showed high (≥99 %) degree of 16S rDNA sequence identity to conspecific East Asian isolates. Two genetic lineages of I. frontalis and Ha. concinna are transported by birds in Central Europe, which reflect a high degree of sequence identity to South-Western European and East Asian isolates of the same tick species, respectively. In addition, I. festai was collected for the first time in Hungary. These findings highlight the importance of western and eastern migratory connections by birds (in addition to the southern direction), which are also relevant to the epidemiology of tick-borne diseases.

Variable-Number Tandem Repeats That Are Useful in Genotyping Isolates of Salmonella enterica subsp. enterica Serovars Typhimurium and Newport▿

PubMed Central

Witonski, D. ; Stefanova, R.; Ranganathan, A.; Schutze, G. E.; Eisenach, K. D.; Cave, M. D.

2006-01-01

The genome of Salmonella enterica subsp. enterica serovar Typhimurium strain LT2 was analyzed for direct repeats, and 54 sequences containing variable-number tandem repeat loci were identified. Ten primer pairs that anneal upstream and downstream of each selected locus were designed and used to amplify PCR targets in isolates of S. enterica serovars Typhimurium and Newport. Four of the 10 loci did not show polymorphism in the length of products. Six loci were selected for analysis. Isolates of S. enterica serovars Typhimurium and Newport that were related to specific outbreaks and showed identical pulsed-field gel electrophoresis patterns were indistinguishable by the length of the six variable-number tandem repeats. Isolates that differed in their pulsed-field gel electrophoresis patterns showed polymorphism in variable-number tandem repeat profiles. Length of the products was confirmed by DNA sequence analysis. Only 2 of the 10 loci contained exact integers of the direct repeat. Eight loci contained partial copies. The partial copies were maintained at the ends of the variable-number tandem repeat loci in all isolates. In spite of having partial copies that were maintained in all isolates, the number of direct repeats at a locus was polymorphic. Six variable-number tandem repeat loci were useful in distinguishing isolates of S. enterica serovars Typhimurium and Newport that had different pulsed-field gel electrophoresis patterns and in identifying outbreak-associated cases that shared a common pulsed-field gel pattern. PMID:16943354

First Report and Characterization of Pestalotiopsis ellipsospora Causing Canker on Acanthopanax divaricatus

PubMed Central

Yun, Yeo Hong; Ahn, Geum Ran

2015-01-01

Acanthopanax divaricatus, a member of the Araliaceae family, has been used as an invigorant in traditional Korean medicine. During disease monitoring, a stem with small, irregular, brown lesions was sampled at a farm in Cheonan in 2011. The symptoms seen were sunken cankers and reddish-brown needles on the infected twig. The isolated fungal colonies were whitish, having crenated edges and aerial mycelium on the surface, and with black gregarious fruiting bodies. The reverse plate was creamy white. Conidia were 17~22 × 3.5~4.2 µm, fusiform, 4-septate, and straight to slightly curved. The nucleotide sequence of the partial translation elongation factor 1 alpha gene of the fungal isolate, shares 99% sequence identity with that of known Pestalotiopsis ellipsospora. Based on the results of the morphological and molecular analyses, the fungal isolate was identified as P. ellipsospora. In Korea, this is the first report of canker on A. divaricatus. PMID:26539058

First Report and Characterization of Pestalotiopsis ellipsospora Causing Canker on Acanthopanax divaricatus.

PubMed

Yun, Yeo Hong; Ahn, Geum Ran; Kim, Seong Hwan

2015-09-01

Acanthopanax divaricatus, a member of the Araliaceae family, has been used as an invigorant in traditional Korean medicine. During disease monitoring, a stem with small, irregular, brown lesions was sampled at a farm in Cheonan in 2011. The symptoms seen were sunken cankers and reddish-brown needles on the infected twig. The isolated fungal colonies were whitish, having crenated edges and aerial mycelium on the surface, and with black gregarious fruiting bodies. The reverse plate was creamy white. Conidia were 17~22 × 3.5~4.2 µm, fusiform, 4-septate, and straight to slightly curved. The nucleotide sequence of the partial translation elongation factor 1 alpha gene of the fungal isolate, shares 99% sequence identity with that of known Pestalotiopsis ellipsospora. Based on the results of the morphological and molecular analyses, the fungal isolate was identified as P. ellipsospora. In Korea, this is the first report of canker on A. divaricatus.

Characterization of isolates of meloidogyne from rice-wheat production fields in Nepal.

PubMed

Pokharel, Ramesh R; Abawi, George S; Zhang, Ning; Duxbury, John M; Smart, Christine D

2007-09-01

Thirty-three isolates of root-knot nematode were recovered from soil samples from rice-wheat fields in Nepal and maintained on rice cv. BR 11. The isolates were characterized using morphology, host range and DNA sequence analyses in order to ascertain their identity. Results indicated phenotypic similarity (juvenile measurements, perennial pattern, host range and gall shape) of the Nepalese isolates with Meloidogyne graminicola, with minor variations. The rice varieties LA 110 and Labelle were susceptible to all of the Nepalese isolates, but differences in the aggressiveness of the isolates were observed. Phylogenetic analyses based on the sequences of partial internal transcribed spacer (ITS) of the rRNA genes indicated that all Nepalese isolates formed a distinct clade with known isolates of M. graminicola with high bootstrap support. Furthermore, two groups were identified within the M. graminicola clade. No correlation between ITS haplotype and aggressiveness or host range was found among the tested isolates.

Verification of natural infection of peridomestic rodents by PCV2 on commercial swine farms.

PubMed

Pinheiro, Albanno Leonard Braz Campos; Bulos, Luiz Henrique Silva; Onofre, Thiago Souza; de Paula Gabardo, Michelle; de Carvalho, Otávio Valério; Fausto, Mariana Costa; Guedes, Roberto Maurício Carvalho; de Almeida, Márcia Rogéria; Silva Júnior, Abelardo

2013-06-01

The porcine circovirus-2 (PCV2) is the main agent responsible for porcine circovirus associated diseases (PCVAD). Few studies have been done regarding PCV2 infection in other species. The purpose of this study was to investigate the occurrence of PCV2 infection in the peridomestic rodent species Mus musculus and Rattus rattus on commercial pig farms in Brazil. Immunohistochemistry assay demonstrated PCV2 in the spleen, lung and kidney. Viral DNA was detected in tissues by nested PCR assay. Partial sequences of PCV2 genomes detected in the rodents had strong identity with gene sequences of PCV2 isolates from pigs. These results show that the studied peridomestic rodent species can be naturally infected by PCV2. However, further studies are needed to confirm PCV2 transmission from rodents to pigs. Copyright © 2012 Elsevier Ltd. All rights reserved.

SARS-CoV Infection in a Restaurant from Palm Civet

PubMed Central

Wang, Ming; Yan, Meiying; Xu, Huifang; Liang, Weili; Kan, Biao; Zheng, Bojian; Chen, Honglin; Zheng, Han; Xu, Yanmei; Zhang, Enmin; Wang, Hongxia; Ye, Jingrong; Li, Guichang; Li, Machao; Cui, Zhigang; Liu, Yu-Fei; Guo, Rong-Tong; Liu, Xiao-Ning; Zhan, Liu-Hua; Zhou, Duan-Hua; Zhao, Ailan; Hai, Rong; Yu, Dongzhen; Guan, Yi

2005-01-01

Epidemiologic investigations showed that 2 of 4 patients with severe acute respiratory syndrome (SARS) identified in the winter of 2003–2004 were a waitress at a restaurant in Guangzhou, China, that served palm civets as food and a customer who ate in the restaurant a short distance from animal cages. All 6 palm civets at the restaurant were positive for SARS-associated coronavirus (SARS-CoV). Partial spike (S) gene sequences of SARS-CoV from the 2 patients were identical to 4 of 5 S gene viral sequences from palm civets. Phylogenetic analysis showed that SARS-CoV from palm civets in the restaurant was most closely related to animal isolates. SARS cases at the restaurant were the result of recent interspecies transfer from the putative palm civet reservoir, and not the result of continued circulation of SARS-CoV in the human population. PMID:16485471

SARS-CoV infection in a restaurant from palm civet.

PubMed

Wang, Ming; Yan, Meiying; Xu, Huifang; Liang, Weili; Kan, Biao; Zheng, Bojian; Chen, Honglin; Zheng, Han; Xu, Yanmei; Zhang, Enmin; Wang, Hongxia; Ye, Jingrong; Li, Guichang; Li, Machao; Cui, Zhigang; Liu, Yu-Fei; Guo, Rong-Tong; Liu, Xiao-Ning; Zhan, Liu-Hua; Zhou, Duan-Hua; Zhao, Ailan; Hai, Rong; Yu, Dongzhen; Guan, Yi; Xu, Jianguo

2005-12-01

Epidemiologic investigations showed that 2 of 4 patients with severe acute respiratory syndrome (SARS) identified in the winter of 2003-2004 were a waitresss at a restaurant in Guangzhou, China, that served palm civets as food and a customer who ate in the restaurant ashort distance from animal cages. All 6 palm civets at the restaurant were positive for SARS-associated coronavirus (SARS-CoV). Partial spike (S) gene sequences of SARS-CoV from the 2 patients were identical to 4 of 5 Sgene viral sequences from palm civets. Phylogenetic analysis showed that SARS-CoV from palm civets in the restaurant was most closely related to animal isolates. SARS cases at the restaurant were the result of recent interspecies transfer from the putative palm civet reservoir, and not the result of continued circulation of SARS-CoV in the human population.

Phylogenetic and microsatellite markers for Tulasnella (Tulasnellaceae) mycorrhizal fungi associated with Australian orchids.

PubMed

Ruibal, Monica P; Peakall, Rod; Smith, Leon M; Linde, Celeste C

2013-03-01

Phylogenetic and microsatellite markers were developed for Tulasnella mycorrhizal fungi to investigate fungal species identity and diversity. These markers will be useful in future studies investigating the phylogenetic relationship of the fungal symbionts, specificity of orchid-mycorrhizal associations, and the role of mycorrhizae in orchid speciation within several orchid genera. • We generated partial genome sequences of two Tulasnella symbionts originating from Chiloglottis and Drakaea orchid species with 454 genome sequencing. Cross-genus transferability across mycorrhizal symbionts associated with multiple genera of Australian orchids (Arthrochilus, Chiloglottis, Drakaea, and Paracaleana) was found for seven phylogenetic loci. Five loci showed cross-transferability to Tulasnella from other orchid genera, and two to Sebacina. Furthermore, 11 polymorphic microsatellite loci were developed for Tulasnella from Chiloglottis. • Highly informative markers were obtained, allowing investigation of mycorrhizal diversity of Tulasnellaceae associated with a wide variety of terrestrial orchids in Australia and potentially worldwide.

First complete genome sequence of infectious laryngotracheitis virus

PubMed Central

2011-01-01

Background Infectious laryngotracheitis virus (ILTV) is an alphaherpesvirus that causes acute respiratory disease in chickens worldwide. To date, only one complete genomic sequence of ILTV has been reported. This sequence was generated by concatenating partial sequences from six different ILTV strains. Thus, the full genomic sequence of a single (individual) strain of ILTV has not been determined previously. This study aimed to use high throughput sequencing technology to determine the complete genomic sequence of a live attenuated vaccine strain of ILTV. Results The complete genomic sequence of the Serva vaccine strain of ILTV was determined, annotated and compared to the concatenated ILTV reference sequence. The genome size of the Serva strain was 152,628 bp, with a G + C content of 48%. A total of 80 predicted open reading frames were identified. The Serva strain had 96.5% DNA sequence identity with the concatenated ILTV sequence. Notably, the concatenated ILTV sequence was found to lack four large regions of sequence, including 528 bp and 594 bp of sequence in the UL29 and UL36 genes, respectively, and two copies of a 1,563 bp sequence in the repeat regions. Considerable differences in the size of the predicted translation products of 4 other genes (UL54, UL30, UL37 and UL38) were also identified. More than 530 single-nucleotide polymorphisms (SNPs) were identified. Most SNPs were located within three genomic regions, corresponding to sequence from the SA-2 ILTV vaccine strain in the concatenated ILTV sequence. Conclusions This is the first complete genomic sequence of an individual ILTV strain. This sequence will facilitate future comparative genomic studies of ILTV by providing an appropriate reference sequence for the sequence analysis of other ILTV strains. PMID:21501528

Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

USGS Publications Warehouse

Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

2011-01-01

Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

Sequence determination and analysis of the NSs genes of two tospoviruses.

PubMed

Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

2012-03-01

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

The Pea light-independent photomorphogenesis1 Mutant Results from Partial Duplication of COP1 Generating an Internal Promoter and Producing Two Distinct Transcripts

PubMed Central

Sullivan, James A.; Gray, John C.

2000-01-01

The pea lip1 (light-independent photomorphogenesis1) mutant shows many of the characteristics of light-grown development when grown in continuous darkness. To investigate the identity of LIP1, cDNAs encoding the pea homolog of COP1, a repressor of photomorphogenesis identified in Arabidopsis, were isolated from wild-type and lip1 pea seedlings. lip1 seedlings contained a wild-type COP1 transcript as well as a larger COP1′ transcript that contained an internal in-frame duplication of 894 bp. The COP1′ transcript segregated with the lip1 phenotype in F2 seedlings and could be translated in vitro to produce a protein of ∼100 kD. The COP1 gene in lip1 peas contained a 7.5-kb duplication, consisting of exons 1 to 7 of the wild-type sequence, located 2.5 kb upstream of a region of genomic DNA identical to the wild-type COP1 DNA sequence. Transcription and splicing of the mutant COP1 gene was predicted to produce the COP1′ transcript, whereas transcription from an internal promoter in the 2.5-kb region of DNA located between the duplicated regions of COP1 would produce the wild-type COP1 transcript. The presence of small quantities of wild-type COP1 transcripts may reduce the severity of the phenotype produced by the mutated COP1′ protein. The genomic DNA sequences of the COP1 gene from wild-type and lip1 peas and the cDNA sequences of COP1 and COP1′ transcripts have been submitted to the EMBL database under the EMBL accession numbers AJ276591, AJ276592, AJ289773, and AJ289774, respectively. PMID:11041887

Isolated populations of Ixodes lividus ticks in the Czech Republic and Belgium host genetically homogeneous Rickettsia vini.

PubMed

Nováková, Markéta; Heneberg, Petr; Heylen, Dieter J A; Medvecký, Matej; Muñoz-Leal, Sebastián; Šmajs, David; Literák, Ivan

2018-03-01

In the last two decades, the advent of molecular methods has revealed a remarkable diversity of rickettsiae (Rickettsiales: Rickettsiaceae) in invertebrates. Several species of these obligate intracellular bacteria are known to cause human infections, hence more attention has been directed towards human-biting ectoparasites. A spotted fever group Rickettsia sp. was previously detected in Ixodes lividus ticks (Ixodidae) associated with sand martins (Hirundinidae: Riparia riparia). In order to identify whether this rickettsia varies among isolated tick populations, a total of 1758 I. lividus ticks and five Ixodes ricinus ticks (Ixodidae) were collected in the Czech Republic and 148 I. lividus ticks were collected in Belgium, from nests of sand martins, European bee-eaters (Meropidae: Merops apiaster), Eurasian tree sparrows (Passeridae: Passer montanus), and from captured sand martins. We screened 165 and 78 I. lividus ticks (from the Czech Republic and Belgium, respectively) and all five I. ricinus ticks for the presence of rickettsial DNA. Only I. lividus samples were positive for Rickettsia vini, a spotted fever group rickettsia that commonly infects the tree-hole tick Ixodes arboricola (Ixodidae). Maximum likelihood analysis of the rickettsial sequences showed that the most closely related organism to R. vini corresponds to an uncharacterized rickettsia detected in Argas lagenoplastis (Argasidae), a nidicolous soft tick of the fairy martin (Hirundinidae: Petrochelidon ariel) in Australia. The observed variability of R. vini sequences from isolated tick populations was low; all 85 sequenced samples were identical to each other in five out of six partial rickettsial genes, except for the sca4 sequence (99.9% identity, 808/809 nt) that differed in I. lividus ticks from two sampling sites in the Czech Republic. Copyright © 2018 Elsevier GmbH. All rights reserved.

Characterization of Clostridium perfringens iota-toxin genes and expression in Escherichia coli.

PubMed

Perelle, S; Gibert, M; Boquet, P; Popoff, M R

1993-12-01

The iota toxin which is produced by Clostridium perfringens type E, is a binary toxin consisting of two independent polypeptides: Ia, which is an ADP-ribosyltransferase, and Ib, which is involved in the binding and internalization of the toxin into the cell. Two degenerate oligonucleotide probes deduced from partial amino acid sequence of each component of C. spiroforme toxin, which is closely related to the iota toxin, were used to clone three overlapping DNA fragments containing the iota-toxin genes from C. perfringens type E plasmid DNA. Two genes, in the same orientation, coding for Ia (387 amino acids) and Ib (875 amino acids) and separated by 243 noncoding nucleotides were identified. A predicted signal peptide was found for each component, and the secreted Ib displays two domains, the propeptide (172 amino acids) and the mature protein (664 amino acids). The Ia gene has been expressed in Escherichia coli and C. perfringens, under the control of its own promoter. The recombinant polypeptide obtained was recognized by Ia antibodies and ADP-ribosylated actin. The expression of the Ib gene was obtained in E. coli harboring a recombinant plasmid encompassing the putative promoter upstream of the Ia gene and the Ia and Ib genes. Two residues which have been found to be involved in the NAD+ binding site of diphtheria and pseudomonas toxins are conserved in the predicted Ia sequence (Glu-14 and Trp-19). The predicted amino acid Ib sequence shows 33.9% identity with and 54.4% similarity to the protective antigen of the anthrax toxin complex. In particular, the central region of Ib, which contains a predicted transmembrane segment (Leu-292 to Ser-308), presents 45% identity with the corresponding protective antigen sequence which is involved in the translocation of the toxin across the cell membrane.

Prevalence of Theileria and Babesia species in Tunisian sheep.

PubMed

Rjeibi, Mohamed R; Darghouth, Mohamed A; Gharbi, Mohamed

2016-05-24

In this study, the prevalence of Theileria and Babesia species in sheep was assessed with Giemsastained blood smear examination and polymerase chain reaction to identify the different piroplasms in 270 sheep from three Tunisian bioclimatic zones (north, centre, and south). The overall infection prevalence by Babesia spp. and Theileria spp. in Giemsa-stained blood smears was 2.9% (8/270) and 4.8% (13/270) respectively. The molecular results showed that sheep were more often infected by Theileria ovis than Babesia ovis with an overall prevalence of 16.3% (44/270) and 7.8% (21/270) respectively (p = 0.01). The molecular prevalence by Babesia ovis was significantly higher in females than in males (p < 0.05). According to localities B. ovis was found exclusively in sheep from the centre of Tunisia (Kairouan) whereas Theileria ovis was found in all regions. Infections with T. ovis and B. ovis were confirmed by sequencing. The sequence of T. ovis in this study (accession numbers KM924442) falls into the same clade as T. ovis deposited in GenBank. The T. ovis amplicons (KM924442) showed 99%-100% identities with GenBank sequences. Moreover, comparison of the partial sequences of 18S rRNA gene of B. ovis described in this study (KP670199) revealed 99.4% similarity with B. ovis recently reported in northern Tunisia from sheep and goats. Three nucleotides were different at positions 73 (A/T), 417 (A/T), and 420 (G/T). It also had 99% identity with B. ovis from Spain, Turkey and Iraq. The results suggest a high T. ovis prevalence in Tunisia with a decreasing north-south gradient. This could be correlated to the vector tick distribution.

Genetic diversity of ORF3 and spike genes of porcine epidemic diarrhea virus in Thailand.

PubMed

Temeeyasen, Gun; Srijangwad, Anchalee; Tripipat, Thitima; Tipsombatboon, Pavita; Piriyapongsa, Jittima; Phoolcharoen, Waranyoo; Chuanasa, Taksina; Tantituvanont, Angkana; Nilubol, Dachrit

2014-01-01

Porcine epidemic diarrhea virus (PEDV) has become endemic in the Thai swine industry, causing economic losses and repeated outbreaks since its first emergence in 2007. In the present study, 69 Thai PEDV isolates were obtained from 50 swine herds across Thailand during the period 2008-2012. Both partial and complete nucleotide sequences of the spike (S) glycoprotein and the nucleotide sequences of ORF3 genes were determined to investigate the genetic diversity and molecular epidemiology of Thai PEDV. Based on the analysis of the partial S glycoprotein genes, the Thai PEDV isolates were clustered into 2 groups related to Korean and Chinese field isolates. The results for the complete spike genes, however, demonstrated that both groups were grouped in the same cluster. Interestingly, both groups of Thai PEDV isolates had a 4-aa (GENQ) insertion between positions 55 and 56, a 1-aa insertion between positions 135 and 136, and a 2-aa deletion between positions 155 and 156, making them identical to the Korean KNU series and isolates responsible for outbreaks in China in recent years. In addition to the complete S sequences, the ORF3 gene analyses suggested that the isolates responsible for outbreaks in Thailand are not vaccine related. The results of this study suggest that the PEDV isolates responsible for outbreaks in Thailand since its emergence represent a variant of PEDV that was previously reported in China and Korea. Copyright © 2013 Elsevier B.V. All rights reserved.

Biochemical Characterization, Thermal Stability, and Partial Sequence of a Novel Exo-Polygalacturonase from the Thermophilic Fungus Rhizomucor pusillus A13.36 Obtained by Submerged Cultivation.

PubMed

Trindade, Lucas Vinícius; Desagiacomo, Carla; Polizeli, Maria de Lourdes Teixeira de Moraes; Damasio, André Ricardo de Lima; Lima, Aline Margarete Furuyama; Gomes, Eleni; Bonilla-Rodriguez, Gustavo Orlando

2016-01-01

This work reports the production of an exo-polygalacturonase (exo-PG) by Rhizomucor pusillus A13.36 in submerged cultivation (SmC) in a shaker at 45°C for 96 h. A single pectinase was found and purified in order to analyze its thermal stability, by salt precipitation and hydrophobic interaction chromatography. The pectinase has an estimated Mw of approximately 43.5-47 kDa and optimum pH of 4.0 but is stable in pH ranging from 3.5 to 9.5 and has an optimum temperature of 61°C. It presents thermal stability between 30 and 60°C, has 70% activation in the presence of Ca 2+ , and was tested using citrus pectin with a degree of methyl esterification (DE) of 26%. E a ( d ) for irreversible denaturation was 125.5 kJ/mol with positive variations of entropy and enthalpy for that and Δ G ( d ) values were around 50 kJ/mol. The hydrolysis of polygalacturonate was analyzed by capillary electrophoresis which displayed a pattern of sequential hydrolysis (exo). The partial identification of the primary sequence was done by MS MALDI-TOF and a comparison with data banks showed the highest identity of the sequenced fragments of exo-PG from R. pusillus with an exo-pectinase from Aspergillus fumigatus . Pectin hydrolysis showed a sigmoidal curve for the Michaelis-Menten plot.

Biochemical Characterization, Thermal Stability, and Partial Sequence of a Novel Exo-Polygalacturonase from the Thermophilic Fungus Rhizomucor pusillus A13.36 Obtained by Submerged Cultivation

PubMed Central

Trindade, Lucas Vinícius; Desagiacomo, Carla; Damasio, André Ricardo de Lima; Lima, Aline Margarete Furuyama; Gomes, Eleni

2016-01-01

This work reports the production of an exo-polygalacturonase (exo-PG) by Rhizomucor pusillus A13.36 in submerged cultivation (SmC) in a shaker at 45°C for 96 h. A single pectinase was found and purified in order to analyze its thermal stability, by salt precipitation and hydrophobic interaction chromatography. The pectinase has an estimated Mw of approximately 43.5–47 kDa and optimum pH of 4.0 but is stable in pH ranging from 3.5 to 9.5 and has an optimum temperature of 61°C. It presents thermal stability between 30 and 60°C, has 70% activation in the presence of Ca2+, and was tested using citrus pectin with a degree of methyl esterification (DE) of 26%. E a(d) for irreversible denaturation was 125.5 kJ/mol with positive variations of entropy and enthalpy for that and ΔG (d) values were around 50 kJ/mol. The hydrolysis of polygalacturonate was analyzed by capillary electrophoresis which displayed a pattern of sequential hydrolysis (exo). The partial identification of the primary sequence was done by MS MALDI-TOF and a comparison with data banks showed the highest identity of the sequenced fragments of exo-PG from R. pusillus with an exo-pectinase from Aspergillus fumigatus. Pectin hydrolysis showed a sigmoidal curve for the Michaelis-Menten plot. PMID:28025649

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

NASA Astrophysics Data System (ADS)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Whole genome sequencing identifies influenza A H3N2 transmission and offers superior resolution to classical typing methods.

PubMed

Meinel, Dominik M; Heinzinger, Susanne; Eberle, Ute; Ackermann, Nikolaus; Schönberger, Katharina; Sing, Andreas

2018-02-01

Influenza with its annual epidemic waves is a major cause of morbidity and mortality worldwide. However, only little whole genome data are available regarding the molecular epidemiology promoting our understanding of viral spread in human populations. We implemented a RT-PCR strategy starting from patient material to generate influenza A whole genome sequences for molecular epidemiological surveillance. Samples were obtained within the Bavarian Influenza Sentinel. The complete influenza virus genome was amplified by a one-tube multiplex RT-PCR and sequenced on an Illumina MiSeq. We report whole genomic sequences for 50 influenza A H3N2 viruses, which was the predominating virus in the season 2014/15, directly from patient specimens. The dataset included random samples from Bavaria (Germany) throughout the influenza season and samples from three suspected transmission clusters. We identified the outbreak samples based on sequence identity. Whole genome sequencing (WGS) was superior in resolution compared to analysis of single segments or partial segment analysis. Additionally, we detected manifestation of substantial amounts of viral quasispecies in several patients, carrying mutations varying from the dominant virus in each patient. Our rapid whole genome sequencing approach for influenza A virus shows that WGS can effectively be used to detect and understand outbreaks in large communities. Additionally, the genomic data provide in-depth details about the circulating virus within one season.

Genome sequencing identifies Listeria fleischmannii subsp. coloradonensis subsp. nov., isolated from a ranch.

PubMed

den Bakker, Henk C; Manuel, Clyde S; Fortes, Esther D; Wiedmann, Martin; Nightingale, Kendra K

2013-09-01

Twenty Listeria-like isolates were obtained from environmental samples collected on a cattle ranch in northern Colorado; all of these isolates were found to share an identical partial sigB sequence, suggesting close relatedness. The isolates were similar to members of the genus Listeria in that they were Gram-stain-positive, short rods, oxidase-negative and catalase-positive; the isolates were similar to Listeria fleischmannii because they were non-motile at 25 °C. 16S rRNA gene sequencing for representative isolates and whole genome sequencing for one isolate was performed. The genome of the type strain of Listeria fleischmannii (strain LU2006-1(T)) was also sequenced. The draft genomes were very similar in size and the average MUMmer nucleotide identity across 91% of the genomes was 95.16%. Genome sequence data were used to design primers for a six-gene multi-locus sequence analysis (MLSA) scheme. Phylogenies based on (i) the near-complete 16S rRNA gene, (ii) 31 core genes and (iii) six housekeeping genes illustrated the close relationship of these Listeria-like isolates to Listeria fleischmannii LU2006-1(T). Sufficient genetic divergence of the Listeria-like isolates from the type strain of Listeria fleischmannii and differing phenotypic characteristics warrant these isolates to be classified as members of a distinct infraspecific taxon, for which the name Listeria fleischmannii subsp. coloradonensis subsp. nov. is proposed. The type strain is TTU M1-001(T) ( =BAA-2414(T) =DSM 25391(T)). The isolates of Listeria fleischmannii subsp. coloradonensis subsp. nov. differ from the nominate subspecies by the inability to utilize melezitose, turanose and sucrose, and the ability to utilize inositol. The results also demonstrate the utility of whole genome sequencing to facilitate identification of novel taxa within a well-described genus. The genomes of both subspecies of Listeria fleischmannii contained putative enhancin genes; the Listeria fleischmannii subsp. coloradonensis subsp. nov. genome also encoded a putative mosquitocidal toxin. The presence of these genes suggests possible adaptation to an insect host, and further studies are needed to probe niche adaptation of Listeria fleischmannii.

Biosynthetic Investigations of Lactonamycin and Lactonamycin Z: Cloning of the Biosynthetic Gene Clusters and Discovery of an Unusual Starter Unit▿ †

PubMed Central

Zhang, Xiujun; Alemany, Lawrence B.; Fiedler, Hans-Peter; Goodfellow, Michael; Parry, Ronald J.

2008-01-01

The antibiotics lactonamycin and lactonamycin Z provide attractive leads for antibacterial drug development. Both antibiotics contain a novel aglycone core called lactonamycinone. To gain insight into lactonamycinone biosynthesis, cloning and precursor incorporation experiments were undertaken. The lactonamycin gene cluster was initially cloned from Streptomyces rishiriensis. Sequencing of ca. 61 kb of S. rishiriensis DNA revealed the presence of 57 open reading frames. These included genes coding for the biosynthesis of l-rhodinose, the sugar found in lactonamycin, and genes similar to those in the tetracenomycin biosynthetic gene cluster. Since lactonamycin production by S. rishiriensis could not be sustained, additional proof for the identity of the S. rishiriensis cluster was obtained by cloning the lactonamycin Z gene cluster from Streptomyces sanglieri. Partial sequencing of the S. sanglieri cluster revealed 15 genes that exhibited a very high degree of similarity to genes within the lactonamycin cluster, as well as an identical organization. Double-crossover disruption of one gene in the S. sanglieri cluster abolished lactonamycin Z production, and production was restored by complementation. These results confirm the identity of the genetic locus cloned from S. sanglieri and indicate that the highly similar locus in S. rishiriensis encodes lactonamycin biosynthetic genes. Precursor incorporation experiments with S. sanglieri revealed that lactonamycinone is biosynthesized in an unusual manner whereby glycine or a glycine derivative serves as a starter unit that is extended by nine acetate units. Analysis of the gene clusters and of the precursor incorporation data suggested a hypothetical scheme for lactonamycinone biosynthesis. PMID:18070976

Adenovirus and mycoplasma infection in an ornate box turtle (Terrapene ornata ornata) in Hungary.

PubMed

Farkas, Szilvia L; Gál, János

2009-07-02

A female, adult ornate box turtle (Terrapene ornata ornata) with fatty liver was submitted for virologic examination in Hungary. Signs of an adenovirus infection including degeneration of the liver cells, enlarged nuclei and intranuclear inclusion bodies were detected by light microscopic examination. The presence of an adenovirus was later confirmed by obtaining partial sequence data from the adenoviral DNA-dependent DNA-polymerase. Phylogenetic analyses revealed that this novel chelonian adenovirus was distinct from previously described reptilian adenoviruses, not belonging to any of the recognized genera of the family Adenoviridae. As a part of the routine diagnostic procedure for chelonians the detection of herpes-, rana- and iridoviruses together with Mycoplasma spp. was attempted. Amplicons were generated by a general mycoplasma polymerase chain reaction (PCR) targeting the 16S/23S ribosomal RNA (rRNA) intergenic spacer region, as well as, a specific Mycoplasma agassizii PCR targeting the 16S rRNA gene. Based on the analyses of partial sequences of the 16S rRNA gene, the Mycoplasma sp. of the ornate box turtle seemed to be identical with the recently described eastern box turtle (Terrapene carolina carolina) Mycoplasma sp. This is the first report of a novel chelonian adenovirus and a mycoplasma infection in an ornate box turtle (T. ornata ornata) in Europe.

Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L.

PubMed

Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

2017-07-01

The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

[Sequence analysis of LEAFY homologous gene from Dendrobium moniliforme and application for identification of medicinal Dendrobium].

PubMed

Xing, Wen-Rui; Hou, Bei-Wei; Guan, Jing-Jiao; Luo, Jing; Ding, Xiao-Yu

2013-04-01

The LEAFY (LFY) homologous gene of Dendrobium moniliforme (L.) Sw. was cloned by new primers which were designed based on the conservative region of known sequences of orchid LEAFY gene. Partial LFY homologous gene was cloned by common PCR, then we got the complete LFY homologous gene Den LFY by Tail-PCR. The complete sequence of DenLFY gene was 3 575 bp which contained three exons and two introns. Using BLAST method, comparison analysis among the exon of LFY homologous gene indicted that the DenLFY gene had high identity with orchids LFY homologous, including the related fragment of PhalLFY (84%) in Phalaenopsis hybrid cultivar, LFY homologous gene in Oncidium (90%) and in other orchid (over 80%). Using MP analysis, Dendrobium is found to be the sister to Oncidium and Phalaenopsis. Homologous analysis demonstrated that the C-terminal amino acids were highly conserved. When the exons and introns were separately considered, exons and the sequence of amino acid were good markers for the function research of DenLFY gene. The second intron can be used in authentication research of Dendrobium based on the length polymorphism between Dendrobium moniliforme and Dendrobium officinale.

The production of Multiple Small Peptaibol Families by Single 14-Module Peptide Synthetases in Trichoderma/Hypocrea

DOE Office of Scientific and Technical Information (OSTI.GOV)

Degenkolb, Thomas; Aghchehb, Razieh Karimi; Dieckmann, Ralf

2012-03-01

The most common peptaibibiotic structures are 11-residue peptaibols found widely distributed in the genus Trichoderma/Hypocrea. Frequently associated are 14-residue peptaibols sharing partial sequence identity. Genome sequencing projects of 3 Trichoderma strains of the major clades reveal the presence of up to 3 types of nonribosomal peptide synthetases with 7, 14, or 18-20 amino acid adding modules. We here provide evidence that the 14-module NRPS type found in T. virens, T. reesei (teleomorph Hypocrea jecorina) and T. atroviride produces both 11- and 14- residue peptaibols based on the disruption of the respective NRPS gene of T. reesei, and bioinformatic analysis ofmore » their amino acid activating domains and modules. The structures of these peptides may be predicted from the gene structures and have been confirmed by analysis of families of 11- and 14-residue peptaibols from the strain 618, termed hypojecorins A (23 sequences determined, 4 new) and B (3 new sequences), and the recently established trichovirins A from T. virens. The distribution of 11- and 14-residue products is strain-specific and depends on growth conditions as well. Possible mechanisms of module skipping are discussed.« less

The Saccharomyces cerevisiae YPR184w gene encodes the glycogen debranching enzyme.

PubMed

Teste, M A; Enjalbert, B; Parrou, J L; François, J M

2000-12-01

The YPR184w gene encodes a 1536-amino acid protein that is 34-39% identical to the mammal, Drosophila melanogaster and Caenorhabditis elegans glycogen debranching enzyme. The N-terminal part of the protein possesses the four conserved sequences of the alpha-amylase superfamily, while the C-terminal part displays 50% similarity with the C-terminal of other eukaryotic glycogen debranching enzymes. Reliable measurement of alpha-1,4-glucanotransferase and alpha-1, 6-glucosidase activity of the yeast debranching enzyme was determined in strains overexpressing YPR184w. The alpha-1, 4-glucanotransferase activity of a partially purified preparation of debranching enzyme preferentially transferred maltosyl units than maltotriosyl. Deletion of YPR184w prevents glycogen degradation, whereas overexpression had no effect on the rate of glycogen breakdown. In response to stress and growth conditions, the transcriptional control of YPR184w gene, renamed GDB1 (for Glycogen DeBranching gene), is strictly identical to that of other genes involved in glycogen metabolism.

First detection and molecular characterization of Echinococcus equinus in a mule in Turkey.

PubMed

Simsek, Sami; Cevik, Aydin

2014-10-01

Cystic echinococcosis is a zoonotic disease with a cosmopolital distribution. It is caused by the larval stages (metacestodes) of the parasite Echinococcus granulosus which infects different animal species. In this report, we present a case of E. granulosus infection in a mule and molecular characterization of the cyst. For this purpose parasite material was collected from the liver of a necropsied mule. DNA was isolated and PCR amplification of mitochondrial 12S rRNA as well as partial sequencing of mitochondrial cytochrome c oxidase subunit 1 (mt-CO1) genes were performed. Six unilocular cysts, filled with clear fluid were found in the liver and spleen. All cysts were found to be fertile. The 12S rRNA-PCR did not yield any band while mt-CO1-PCR yielded a 446 bp sized amplification product. Sequence corresponding to mt-CO1 gene was identical to a sequence reported for E. equinus (formerly G4) (Genbank accession number: KC953029). This is the first record of E. equinus as a cause of cystic echinococcosis in a mule in Turkey.

Quantitation of normal CFTR mRNA in CF patients with splice-site mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Z.; Olsen, J.C.; Silverman, L.M.

Previously we identified two mutations in introns of the CFTR gene associated with partially active splice sites and unusual clinical phenotypes. One mutation in intron 19 (3849+10 kb C to T) is common in CF patients with normal sweat chloride values; an 84 bp sequence from intron 19, which contains a stop codon, is inserted between exon 19 and exon 20 in most nasal CFTR transcripts. The other mutation in intron 14B (2789+5 G to A) is associated with elevated sweat chloride levels, but mild pulmonary disease; exon 14B (38 bp) is spliced out of most nasal CFTR transcipts. Themore » remaining CFTR cDNA sequences, other than the 84 bp insertion of exon 14B deletion, are identical to the published sequence. To correlate genotype and phenotype, we used quantitative RT-PCR to determine the levels of normally-spliced CFTR mRNA in nasal epithelia from these patients. CFTR cDNA was amplified (25 cycles) by using primers specific for normally-spliced species, {gamma}-actin cDNA was amplified as a standard.« less

Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation.

PubMed

Bhat, P V; Labrecque, J; Boutin, J M; Lacroix, A; Yoshida, A

1995-12-12

Retinoic acid (RA), an important regulator of cell differentiation, is biosynthesized from retinol via retinal by a two-step oxidation process. We previously reported the purification and partial amino acid (aa) sequence of a rat kidney aldehyde dehydrogenase (ALDH) isozyme that catalyzed the oxidation of 9-cis and all-trans retinal to corresponding RA with high efficiency [Labrecque et al. Biochem. J. 305 (1995) 681-684]. A rat kidney cDNA library was screened using a 291-bp PCR product generated from total kidney RNA using a pair of oligodeoxyribonucleotide primers matched with the aa sequence. The full-length rat kidney ALDH cDNA contains a 2315-bp (501 aa) open reading frame (ORF). The aa sequence of rat kidney ALDH is 89, 96 and 87% identical to that of the rat cytosolic ALDH, the mouse cytosolic ALDH and human cytosolic ALDH, respectively. Northern blot and RT-PCR-mediated analysis demonstrated that rat kidney ALDH is strongly expressed in kidney, lung, testis, intestine, stomach and trachea, but weakly in the liver.

Incorporation of unique molecular identifiers in TruSeq adapters improves the accuracy of quantitative sequencing.

PubMed

Hong, Jungeui; Gresham, David

2017-11-01

Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.

Electrophysiological evidence for parts and wholes in visual face memory.

PubMed

Towler, John; Eimer, Martin

2016-10-01

It is often assumed that upright faces are represented in a holistic fashion, while representations of inverted faces are essentially part-based. To assess this hypothesis, we recorded event-related potentials (ERPs) during a sequential face identity matching task where successively presented pairs of upright or inverted faces were either identical or differed with respect to their internal features, their external features, or both. Participants' task was to report on each trial whether the face pair was identical or different. To track the activation of visual face memory representations, we measured N250r components that emerge over posterior face-selective regions during the activation of visual face memory representations by a successful identity match. N250r components to full identity repetitions were smaller and emerged later for inverted as compared to upright faces, demonstrating that image inversion impairs face identity matching processes. For upright faces, N250r components were also elicited by partial repetitions of external or internal features, which suggest that the underlying identity matching processes are not exclusively based on non-decomposable holistic representations. However, the N250r to full identity repetitions was super-additive (i.e., larger than the sum of the two N250r components to partial repetitions of external or internal features) for upright faces, demonstrating that holistic representations were involved in identity matching processes. For inverted faces, N250r components to full and partial identity repetitions were strictly additive, indicating that the identity matching of external and internal features operated in an entirely part-based fashion. These results provide new electrophysiological evidence for qualitative differences between representations of upright and inverted faces in the occipital-temporal face processing system. Copyright © 2016 Elsevier Ltd. All rights reserved.

Facilitated sequence counting and assembly by template mutagenesis

PubMed Central

Levy, Dan; Wigler, Michael

2014-01-01

Presently, inferring the long-range structure of the DNA templates is limited by short read lengths. Accurate template counts suffer from distortions occurring during PCR amplification. We explore the utility of introducing random mutations in identical or nearly identical templates to create distinguishable patterns that are inherited during subsequent copying. We simulate the applications of this process under assumptions of error-free sequencing and perfect mapping, using cytosine deamination as a model for mutation. The simulations demonstrate that within readily achievable conditions of nucleotide conversion and sequence coverage, we can accurately count the number of otherwise identical molecules as well as connect variants separated by long spans of identical sequence. We discuss many potential applications, such as transcript profiling, isoform assembly, haplotype phasing, and de novo genome assembly. PMID:25313059

The pig X and Y Chromosomes: structure, sequence, and evolution

PubMed Central

Skinner, Benjamin M.; Sargent, Carole A.; Churcher, Carol; Hunt, Toby; Herrero, Javier; Loveland, Jane E.; Dunn, Matt; Louzada, Sandra; Fu, Beiyuan; Chow, William; Gilbert, James; Austin-Guest, Siobhan; Beal, Kathryn; Carvalho-Silva, Denise; Cheng, William; Gordon, Daria; Grafham, Darren; Hardy, Matt; Harley, Jo; Hauser, Heidi; Howden, Philip; Howe, Kerstin; Lachani, Kim; Ellis, Peter J.I.; Kelly, Daniel; Kerry, Giselle; Kerwin, James; Ng, Bee Ling; Threadgold, Glen; Wileman, Thomas; Wood, Jonathan M.D.; Yang, Fengtang; Harrow, Jen; Affara, Nabeel A.; Tyler-Smith, Chris

2016-01-01

We have generated an improved assembly and gene annotation of the pig X Chromosome, and a first draft assembly of the pig Y Chromosome, by sequencing BAC and fosmid clones from Duroc animals and incorporating information from optical mapping and fiber-FISH. The X Chromosome carries 1033 annotated genes, 690 of which are protein coding. Gene order closely matches that found in primates (including humans) and carnivores (including cats and dogs), which is inferred to be ancestral. Nevertheless, several protein-coding genes present on the human X Chromosome were absent from the pig, and 38 pig-specific X-chromosomal genes were annotated, 22 of which were olfactory receptors. The pig Y-specific Chromosome sequence generated here comprises 30 megabases (Mb). A 15-Mb subset of this sequence was assembled, revealing two clusters of male-specific low copy number genes, separated by an ampliconic region including the HSFY gene family, which together make up most of the short arm. Both clusters contain palindromes with high sequence identity, presumably maintained by gene conversion. Many of the ancestral X-related genes previously reported in at least one mammalian Y Chromosome are represented either as active genes or partial sequences. This sequencing project has allowed us to identify genes—both single copy and amplified—on the pig Y Chromosome, to compare the pig X and Y Chromosomes for homologous sequences, and thereby to reveal mechanisms underlying pig X and Y Chromosome evolution. PMID:26560630

Queer English Language Teacher Identity: A Narrative Exploration in Colombia

ERIC Educational Resources Information Center

Lander, Roderick

2018-01-01

This article presents partial results of research exploring links between language teacher identity and queer identity in English language teachers working in Colombia. Three gay male teachers participated in a narrative research project framed within a poststructural perspective on identity. I conducted and recorded semi-structured interviews…

Cloning and characterization of newly isolated lipase from Enterobacter sp. Bn12.

PubMed

Farrokh, Parisa; Yakhchali, Bagher; Karkhane, Ali Asghar

2014-01-01

A mesophilic Enterobacter sp. Bn12 producing an alkaline thermostable lipase was isolated from soil in Tehran, Iran. The lipase gene (ELBn12) was identified from a genomic library. Sequence analysis of the DNA fragment revealed an open reading frame of 879 bp encoding a lipase with a molecular mass of 31.3 kDa. The deduced amino acid sequence showed 96% identity with a lipase of Enterobacter sp. Ag1 and the identity of their DNA sequences was 88.9%. ELBn12 belongs to the lipase subfamily I.1 and its catalytic triad consists of Ser82, Asp237 and His259. The lipase was expressed in Escherichia coli (BL21) pLysS and partially purified by anion exchange chromatography. The maximum activity of ELBn12 was obtained at temperature of 60 °C and pH 8.0 towards tricaprylin (C8) and its specific activity was around 2900 U/mg. ELBn12 was stable within a broad pH range from 6.0 to 11.0. The enzyme showed high stability in both polar and nonpolar organic solvents at 50% (v/v). The lipase activity was enhanced in the presence of 10 mM of Ca(2+), Mg(2+) and K(+), while heavy metals (Fe(3+) and Zn(2+)) had strong inhibitory effect. ELBn12 showed high activity in the presence of 1% (w/v) nonionic surfactants, however ionic surfactants inhibited the lipolytic activity. ELBn12 characteristics show that it has a potential to be used in various industrial processes.

Cloning and characterization of newly isolated lipase from Enterobacter sp. Bn12

PubMed Central

Farrokh, Parisa; Yakhchali, Bagher; Karkhane, Ali Asghar

2014-01-01

A mesophilic Enterobacter sp. Bn12 producing an alkaline thermostable lipase was isolated from soil in Tehran, Iran. The lipase gene (ELBn12) was identified from a genomic library. Sequence analysis of the DNA fragment revealed an open reading frame of 879 bp encoding a lipase with a molecular mass of 31.3 kDa. The deduced amino acid sequence showed 96% identity with a lipase of Enterobacter sp. Ag1 and the identity of their DNA sequences was 88.9%. ELBn12 belongs to the lipase subfamily I.1 and its catalytic triad consists of Ser82, Asp237 and His259. The lipase was expressed in Escherichia coli (BL21) pLysS and partially purified by anion exchange chromatography. The maximum activity of ELBn12 was obtained at temperature of 60 °C and pH 8.0 towards tricaprylin (C8) and its specific activity was around 2900 U/mg. ELBn12 was stable within a broad pH range from 6.0 to 11.0. The enzyme showed high stability in both polar and nonpolar organic solvents at 50% (v/v). The lipase activity was enhanced in the presence of 10 mM of Ca2+, Mg2+ and K+, while heavy metals (Fe3+ and Zn2+) had strong inhibitory effect. ELBn12 showed high activity in the presence of 1% (w/v) nonionic surfactants, however ionic surfactants inhibited the lipolytic activity. ELBn12 characteristics show that it has a potential to be used in various industrial processes. PMID:25242958

The influence of sequence context and length on the kinetics of DNA duplex formation from complementary hairpins possessing (CNG) repeats.

PubMed

Paiva, Anthony M; Sheardy, Richard D

2005-04-20

The formation of unusual structures during DNA replication has been invoked for gene expansion in genomes possessing triplet repeat sequences, CNG, where N = A, C, G, or T. In particular, it has been suggested that the daughter strand of the leading strand partially dissociates from the parent strand and forms a hairpin. The equilibrium between the fully duplexed parent:daugter species and the parent:hairpin species is dependent upon their relative stabilities and the rates of reannealing of the daughter strand back to the parent. These stabilities and rates are ultimately influenced by the sequence context of the DNA and its length. Previous work has demonstrated that longer strands are more stable than shorter strands and that the identity of N also influences the thermal stability [Paiva, A. M.; Sheardy, R. D. Biochemistry 2004, 43, 14218-14227]. Here, we show that the rate of duplex formation from complementary hairpins is also sequence context and length dependent. In particular, longer duplexes have higher activation energies than shorter duplexes of the same sequence context. Further, [(CCG):(GGC)] duplexes have lower activation energies than corresponding [(CAG):(GTC)] duplexes of the same length. Hence, hairpins formed from long CNG sequences are more thermodynamically stable and have slower kinetics for reannealing to their complement than shorter analogues. Gene expansion can now be explained in terms of thermodynamics and kinetics.

Characterization of Apricot pseudo-chlorotic leaf spot virus, A Novel Trichovirus Isolated from Stone Fruit Trees.

PubMed

Liberti, D; Marais, A; Svanella-Dumas, L; Dulucq, M J; Alioto, D; Ragozzino, A; Rodoni, B; Candresse, T

2005-04-01

ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

Holding a manual response sequence in memory can disrupt vocal responses that share semantic features with the manual response.

PubMed

Fournier, Lisa Renee; Wiediger, Matthew D; McMeans, Ryan; Mattson, Paul S; Kirkwood, Joy; Herzog, Theibot

2010-07-01

Holding an action plan in memory for later execution can delay execution of another action if the actions share a similar (compatible) feature. This compatibility interference (CI) occurs for actions that share the same response modality (e.g., manual response). We investigated whether CI can generalize to actions that utilize different response modalities (manual and vocal). In three experiments, participants planned and withheld a sequence of key-presses with the left- or right-hand based on the visual identity of the first stimulus, and then immediately executed a speeded, vocal response ('left' or 'right') to a second visual stimulus. The vocal response was based on discriminating stimulus color (Experiment 1), reading a written word (Experiment 2), or reporting the antonym of a written word (Experiment 3). Results showed that CI occurred when the manual response hand (e.g., left) was compatible with the identity of the vocal response (e.g., 'left') in Experiment 1 and 3, but not in Experiment 2. This suggests that partial overlap of semantic codes is sufficient to obtain CI unless the intervening action can be accessed automatically (Experiment 2). These findings are consistent with the code occupation hypothesis and the general framework of the theory of event coding (Behav Brain Sci 24:849-878, 2001a; Behav Brain Sci 24:910-937, 2001b).

Pairagon: a highly accurate, HMM-based cDNA-to-genome aligner.

PubMed

Lu, David V; Brown, Randall H; Arumugam, Manimozhiyan; Brent, Michael R

2009-07-01

The most accurate way to determine the intron-exon structures in a genome is to align spliced cDNA sequences to the genome. Thus, cDNA-to-genome alignment programs are a key component of most annotation pipelines. The scoring system used to choose the best alignment is a primary determinant of alignment accuracy, while heuristics that prevent consideration of certain alignments are a primary determinant of runtime and memory usage. Both accuracy and speed are important considerations in choosing an alignment algorithm, but scoring systems have received much less attention than heuristics. We present Pairagon, a pair hidden Markov model based cDNA-to-genome alignment program, as the most accurate aligner for sequences with high- and low-identity levels. We conducted a series of experiments testing alignment accuracy with varying sequence identity. We first created 'perfect' simulated cDNA sequences by splicing the sequences of exons in the reference genome sequences of fly and human. The complete reference genome sequences were then mutated to various degrees using a realistic mutation simulator and the perfect cDNAs were aligned to them using Pairagon and 12 other aligners. To validate these results with natural sequences, we performed cross-species alignment using orthologous transcripts from human, mouse and rat. We found that aligner accuracy is heavily dependent on sequence identity. For sequences with 100% identity, Pairagon achieved accuracy levels of >99.6%, with one quarter of the errors of any other aligner. Furthermore, for human/mouse alignments, which are only 85% identical, Pairagon achieved 87% accuracy, higher than any other aligner. Pairagon source and executables are freely available at http://mblab.wustl.edu/software/pairagon/

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T formed a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these ot...

Prevalence and genetic heterogeneity of porcine group C rotaviruses in nursing and weaned piglets in Ohio, USA and identification of a potential new VP4 genotype.

PubMed

Amimo, J O; Vlasova, A N; Saif, L J

2013-05-31

Swine fecal samples collected from seven farms were screened for group C rotaviruses (RVCs) using a reverse transcription-polymerase chain reaction assay. A total of 380 samples were tested and 19.5% were positive. Of the 128 samples collected in 2012, 23.5% from nursing piglets and 8.5% from weaned piglets were RVC positive, with a higher RVC frequency in diarrheic (28.4%) than in non-diarrheic (6.6%) piglets. Two strains (RVC/Pig-wt/USA/RV0104/2011/G3PX and RVC/Pig-wt/USA/RV0143/2012/G6Px) from two different farms were characterized genetically to gain information on virus diversity based on full length sequences of the inner capsid VP6, enterotoxin NSP4 and the outer capsid VP7 and VP4 (partial for RV0104) genes. The VP6 gene of the two strains showed high (99%) nucleotide identity to one another, 84-91% identity to other porcine RVCstrains and 81-82% identity to human and bovine RVC strains. The NSP4 gene analysis revealed that RVC/Pig-wt/USA/RV0104/2011/G3PX and RVC/Pig-wt/USA/RV0143/2012/G6Px strains were not closely related to each other (87% identity), but shared higher identity with prototype RVC/Pig-wt/USA/Cowden/1980/G1Px strain (93% and 89%, respectively) and were more distantly related to human strains (72-76% identity). The VP7 gene analysis indicated that the two strains were distantly related to one another (72% identity). RVC/Pig-wt/USA/RV0143/2012/G6Px was most closely related to porcine RVC G6 strains (82-86% identity), whereas RVC/Pig-wt/USA/RV0104/2011/G3PX was most closely related to porcine HF (G3) strain (94% identity). Analysis of the full length nucleotide sequence of the VP4 gene revealed that RVC/Pig-wt/USA/RV0143/2012/G6Px was distantly related to porcine (75%), bovine (74%) and human (70%) strains. The deduced amino acid identities (69.5-75.6%) of VP4 between RVC/Pig-wt/USA/RV0143/2012/G6Px and other RVCs were low; hence, we propose that this strain comprises a new VP4 genotype. Our results indicate high genetic heterogeneity in RVCs genes and the concurrent co-circulation of different genotypes at the same time. Our findings are useful for the development of more accurate diagnostic tools, for basic research to understand gene function and to provide information for RVC diversity germane to vaccine development. Copyright © 2013 Elsevier B.V. All rights reserved.

Estimation and Testing of Partial Covariances, Correlations, and Regression Weights Using Maximum Likelihood Factor Analysis.

ERIC Educational Resources Information Center

And Others; Werts, Charles E.

1979-01-01

It is shown how partial covariance, part and partial correlation, and regression weights can be estimated and tested for significance by means of a factor analytic model. Comparable partial covariance, correlations, and regression weights have identical significance tests. (Author)

Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

PubMed

Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

2014-04-01

The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens).

PubMed

Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei

2016-08-01

Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin.

MetaSeq: privacy preserving meta-analysis of sequencing-based association studies.

PubMed

Singh, Angad Pal; Zafer, Samreen; Pe'er, Itsik

2013-01-01

Human genetics recently transitioned from GWAS to studies based on NGS data. For GWAS, small effects dictated large sample sizes, typically made possible through meta-analysis by exchanging summary statistics across consortia. NGS studies groupwise-test for association of multiple potentially-causal alleles along each gene. They are subject to similar power constraints and therefore likely to resort to meta-analysis as well. The problem arises when considering privacy of the genetic information during the data-exchange process. Many scoring schemes for NGS association rely on the frequency of each variant thus requiring the exchange of identity of the sequenced variant. As such variants are often rare, potentially revealing the identity of their carriers and jeopardizing privacy. We have thus developed MetaSeq, a protocol for meta-analysis of genome-wide sequencing data by multiple collaborating parties, scoring association for rare variants pooled per gene across all parties. We tackle the challenge of tallying frequency counts of rare, sequenced alleles, for metaanalysis of sequencing data without disclosing the allele identity and counts, thereby protecting sample identity. This apparent paradoxical exchange of information is achieved through cryptographic means. The key idea is that parties encrypt identity of genes and variants. When they transfer information about frequency counts in cases and controls, the exchanged data does not convey the identity of a mutation and therefore does not expose carrier identity. The exchange relies on a 3rd party, trusted to follow the protocol although not trusted to learn about the raw data. We show applicability of this method to publicly available exome-sequencing data from multiple studies, simulating phenotypic information for powerful meta-analysis. The MetaSeq software is publicly available as open source.

Characterisation of Potential Antimicrobial Targets in Bacillus spp. I. Aminotransferases and Methionine Regeneration in Bacillus subtilis

DTIC Science & Technology

2002-07-01

DAAT and 45% identical to the Staphylococcus haemolyticus DAAT. The ybgE and ywaA sequences were found in the Illa subfamily, and were 59% identical to...halodurans BH1060 gene product. The two sequences also had a respective 40% and 37% identity to the Staphylococcus aureuts SAV2560 gene product. The 6

Phylogenetic and microsatellite markers for Tulasnella (Tulasnellaceae) mycorrhizal fungi associated with Australian orchids1

PubMed Central

Ruibal, Monica P.; Peakall, Rod; Smith, Leon M.; Linde, Celeste C.

2013-01-01

• Premise of the study: Phylogenetic and microsatellite markers were developed for Tulasnella mycorrhizal fungi to investigate fungal species identity and diversity. These markers will be useful in future studies investigating the phylogenetic relationship of the fungal symbionts, specificity of orchid–mycorrhizal associations, and the role of mycorrhizae in orchid speciation within several orchid genera. • Methods and Results: We generated partial genome sequences of two Tulasnella symbionts originating from Chiloglottis and Drakaea orchid species with 454 genome sequencing. Cross-genus transferability across mycorrhizal symbionts associated with multiple genera of Australian orchids (Arthrochilus, Chiloglottis, Drakaea, and Paracaleana) was found for seven phylogenetic loci. Five loci showed cross-transferability to Tulasnella from other orchid genera, and two to Sebacina. Furthermore, 11 polymorphic microsatellite loci were developed for Tulasnella from Chiloglottis. • Conclusions: Highly informative markers were obtained, allowing investigation of mycorrhizal diversity of Tulasnellaceae associated with a wide variety of terrestrial orchids in Australia and potentially worldwide. PMID:25202528

Hierarchical assembly of viral nanotemplates with encoded microparticles via nucleic acid hybridization.

PubMed

Tan, Wui Siew; Lewis, Christina L; Horelik, Nicholas E; Pregibon, Daniel C; Doyle, Patrick S; Yi, Hyunmin

2008-11-04

We demonstrate hierarchical assembly of tobacco mosaic virus (TMV)-based nanotemplates with hydrogel-based encoded microparticles via nucleic acid hybridization. TMV nanotemplates possess a highly defined structure and a genetically engineered high density thiol functionality. The encoded microparticles are produced in a high throughput microfluidic device via stop-flow lithography (SFL) and consist of spatially discrete regions containing encoded identity information, an internal control, and capture DNAs. For the hybridization-based assembly, partially disassembled TMVs were programmed with linker DNAs that contain sequences complementary to both the virus 5' end and a selected capture DNA. Fluorescence microscopy, atomic force microscopy (AFM), and confocal microscopy results clearly indicate facile assembly of TMV nanotemplates onto microparticles with high spatial and sequence selectivity. We anticipate that our hybridization-based assembly strategy could be employed to create multifunctional viral-synthetic hybrid materials in a rapid and high-throughput manner. Additionally, we believe that these viral-synthetic hybrid microparticles may find broad applications in high capacity, multiplexed target sensing.

Ependymin, a gene involved in regeneration and neuroplasticity in vertebrates, is overexpressed during regeneration in the echinoderm Holothuria glaberrima.

PubMed

Suárez-Castillo, Edna C; Medina-Ortíz, Wanda E; Roig-López, José L; García-Arrarás, José E

2004-06-09

We report the characterization of an ependymin-related gene (EpenHg) from a regenerating intestine cDNA library of the sea cucumber Holothuria glaberrima. This finding is remarkable because no ependymin sequence has ever been reported from invertebrates. Database comparisons of the conceptual translation of the EpenHg gene reveal 63% similarity (47% identity) with mammalian ependymin-related proteins (MERPs) and close relationship with the frog and piscine ependymins. We also report the partial sequences of ependymin representatives from another species of sea cucumber and from a sea urchin species. Conventional and real-time reverse transcriptase polymerase chain reaction (RT-PCRs) show that the gene is expressed in several echinoderm tissues, including esophagus, mesenteries, gonads, respiratory trees, hemal system, tentacles and body wall. Moreover, the ependymin product in the intestine is overexpressed during sea cucumber intestinal regeneration. The discovery of ependymins in echinoderms, a group well known for their regenerative capacities, can give us an insight on the evolution and roles of ependymin molecules.

First isolation and molecular characterization of Ehrlichia canis in Costa Rica, Central America.

PubMed

Romero, L E; Meneses, A I; Salazar, L; Jiménez, M; Romero, J J; Aguiar, D M; Labruna, M B; Dolz, G

2011-08-01

The present study investigated Ehrlichia species in blood samples from dogs suspected of clinical ehrlichiosis, using molecular and isolation techniques in cell culture. From a total of 310 canine blood samples analyzed by 16S rRNA nested PCR, 148 (47.7%) were positive for Ehrlichia canis. DNA from Ehrlichia chaffeensis or Ehrlichia ewingii was not detected in any sample using species-specific primers in separated reactions. Leukocytes from five PCR-positive dogs were inoculated into DH82 cells; successful isolation of E. canis was obtained in four samples. Partial sequence of the dsb gene of eight canine blood samples (including the five samples for in vitro isolation) was obtained by PCR and their analyses through BLAST showed 100% of identity with the corresponding sequence of E. canis in GenBank. This study represents the first molecular diagnosis, isolation, and molecular characterization of E. canis in dogs from Costa Rica. Copyright © 2010 Elsevier Ltd. All rights reserved.

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

ExprAlign - the identification of ESTs in non-model species by alignment of cDNA microarray expression profiles

PubMed Central

2009-01-01

Background Sequence identification of ESTs from non-model species offers distinct challenges particularly when these species have duplicated genomes and when they are phylogenetically distant from sequenced model organisms. For the common carp, an environmental model of aquacultural interest, large numbers of ESTs remained unidentified using BLAST sequence alignment. We have used the expression profiles from large-scale microarray experiments to suggest gene identities. Results Expression profiles from ~700 cDNA microarrays describing responses of 7 major tissues to multiple environmental stressors were used to define a co-expression landscape. This was based on the Pearsons correlation coefficient relating each gene with all other genes, from which a network description provided clusters of highly correlated genes as 'mountains'. We show that these contain genes with known identities and genes with unknown identities, and that the correlation constitutes evidence of identity in the latter. This procedure has suggested identities to 522 of 2701 unknown carp ESTs sequences. We also discriminate several common carp genes and gene isoforms that were not discriminated by BLAST sequence alignment alone. Precision in identification was substantially improved by use of data from multiple tissues and treatments. Conclusion The detailed analysis of co-expression landscapes is a sensitive technique for suggesting an identity for the large number of BLAST unidentified cDNAs generated in EST projects. It is capable of detecting even subtle changes in expression profiles, and thereby of distinguishing genes with a common BLAST identity into different identities. It benefits from the use of multiple treatments or contrasts, and from the large-scale microarray data. PMID:19939286

Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

PubMed

Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

2008-01-01

The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

TIA: algorithms for development of identity-linked SNP islands for analysis by massively parallel DNA sequencing.

PubMed

Farris, M Heath; Scott, Andrew R; Texter, Pamela A; Bartlett, Marta; Coleman, Patricia; Masters, David

2018-04-11

Single nucleotide polymorphisms (SNPs) located within the human genome have been shown to have utility as markers of identity in the differentiation of DNA from individual contributors. Massively parallel DNA sequencing (MPS) technologies and human genome SNP databases allow for the design of suites of identity-linked target regions, amenable to sequencing in a multiplexed and massively parallel manner. Therefore, tools are needed for leveraging the genotypic information found within SNP databases for the discovery of genomic targets that can be evaluated on MPS platforms. The SNP island target identification algorithm (TIA) was developed as a user-tunable system to leverage SNP information within databases. Using data within the 1000 Genomes Project SNP database, human genome regions were identified that contain globally ubiquitous identity-linked SNPs and that were responsive to targeted resequencing on MPS platforms. Algorithmic filters were used to exclude target regions that did not conform to user-tunable SNP island target characteristics. To validate the accuracy of TIA for discovering these identity-linked SNP islands within the human genome, SNP island target regions were amplified from 70 contributor genomic DNA samples using the polymerase chain reaction. Multiplexed amplicons were sequenced using the Illumina MiSeq platform, and the resulting sequences were analyzed for SNP variations. 166 putative identity-linked SNPs were targeted in the identified genomic regions. Of the 309 SNPs that provided discerning power across individual SNP profiles, 74 previously undefined SNPs were identified during evaluation of targets from individual genomes. Overall, DNA samples of 70 individuals were uniquely identified using a subset of the suite of identity-linked SNP islands. TIA offers a tunable genome search tool for the discovery of targeted genomic regions that are scalable in the population frequency and numbers of SNPs contained within the SNP island regions. It also allows the definition of sequence length and sequence variability of the target region as well as the less variable flanking regions for tailoring to MPS platforms. As shown in this study, TIA can be used to discover identity-linked SNP islands within the human genome, useful for differentiating individuals by targeted resequencing on MPS technologies.

The convergence of the order sequence and the solution function sequence on fractional partial differential equation

NASA Astrophysics Data System (ADS)

Rusyaman, E.; Parmikanti, K.; Chaerani, D.; Asefan; Irianingsih, I.

2018-03-01

One of the application of fractional ordinary differential equation is related to the viscoelasticity, i.e., a correlation between the viscosity of fluids and the elasticity of solids. If the solution function develops into function with two or more variables, then its differential equation must be changed into fractional partial differential equation. As the preliminary study for two variables viscoelasticity problem, this paper discusses about convergence analysis of function sequence which is the solution of the homogenous fractional partial differential equation. The method used to solve the problem is Homotopy Analysis Method. The results show that if given two real number sequences (αn) and (βn) which converge to α and β respectively, then the solution function sequences of fractional partial differential equation with order (αn, βn) will also converge to the solution function of fractional partial differential equation with order (α, β).

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Changes in Gene Expression of Arabidopsis Thaliana Cell Cultures Upon Exposure to Real and Simulated Partial- g Forces

NASA Astrophysics Data System (ADS)

Fengler, Svenja; Spirer, Ina; Neef, Maren; Ecke, Margret; Hauslage, Jens; Hampp, Rüdiger

2016-06-01

Cell cultures of the plant model organism Arabidopsis thaliana were exposed to partial- g forces during parabolic flight and clinostat experiments (0.16 g, 0.38 g and 0.5 g were tested). In order to investigate gravity-dependent alterations in gene expression, samples were metabolically quenched by the fixative RNA later Ⓡ to stabilize nucleic acids and used for whole-genome microarray analysis. An attempt to identify the potential threshold acceleration for the gravity-dependent response showed that the smaller the experienced g-force, the greater was the susceptibility of the cell cultures. Compared to short-term μ g during a parabolic flight, the number of differentially expressed genes under partial- g was lower. In addition, the effect on the alteration of amounts of transcripts decreased during partial- g parabolic flight due to the sequence of the different parabolas (0.38 g, 0.16 g and μ g). A time-dependent analysis under simulated 0.5 g indicates that adaptation occurs within minutes. Differentially expressed genes (at least 2-fold up- or down-regulated in expression) under real flight conditions were to some extent identical with those affected by clinorotation. The highest number of homologuous genes was detected within seconds of exposure to 0.38 g (both flight and clinorotation). To a considerable part, these genes deal with cell wall properties. Additionally, responses specific for clinorotation were observed.

The genomic and biological characterization of Citrullus lanatus cryptic virus infecting watermelon in China.

PubMed

Xin, Min; Cao, Mengji; Liu, Wenwen; Ren, Yingdang; Lu, Chuantao; Wang, Xifeng

2017-03-15

A dsRNA virus was detected in the watermelon (Citrullus lanatus) samples collected from Kaifeng, Henan province, China through the use of next generation sequencing of small RNAs. The complete genome of this virus is comprised of dsRNA-1 (1603nt) and dsRNA-2 (1466nt), both of which are single open reading frames and potentially encode a 54.2kDa RNA-dependent RNA polymerase (RdRp) and a 45.9kDa coat protein (CP), respectively. The RdRp and CP share the highest amino acid identities 85.3% and 75.4% with a previously reported Israeli strain Citrullus lanatus cryptic virus (CiLCV), respectively. Genome comparisons indicate that this virus is the same species with CiLCV, whereas the reported sequences of the Israeli strain of CiLCV are partial, and our newly identified sequences can represent the complete genome of CiLCV. Futhermore, phylogenetic tree analyses based on the RdRp sequences suggest that CiLCV is one member in the genus Deltapartitivirus, family Partitiviridae. In addition, field investigation and seed-borne bioassays show that CiLCV commonly occurs in many varieties and is transmitted though seeds at a very high rate. Copyright © 2017 Elsevier B.V. All rights reserved.

Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1

PubMed Central

Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.

2000-01-01

Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440

Biochemical and Molecular Phylogenetic Study of Agriculturally Useful Association of a Nitrogen-Fixing Cyanobacterium and Nodule Sinorhizobium with Medicago sativa L.

PubMed Central

Karaushu, E. V.; Kravzova, T. R.; Vorobey, N. A.; Kiriziy, D. A.; Olkhovich, O. P.; Taran, N. Yu.; Kots, S. Ya.; Omarova, E.

2015-01-01

Seed inoculation with bacterial consortium was found to increase legume yield, providing a higher growth than the standard nitrogen treatment methods. Alfalfa plants were inoculated by mono- and binary compositions of nitrogen-fixing microorganisms. Their physiological and biochemical properties were estimated. Inoculation by microbial consortium of Sinorhizobium meliloti T17 together with a new cyanobacterial isolate Nostoc PTV was more efficient than the single-rhizobium strain inoculation. This treatment provides an intensification of the processes of biological nitrogen fixation by rhizobia bacteria in the root nodules and an intensification of plant photosynthesis. Inoculation by bacterial consortium stimulates growth of plant mass and rhizogenesis and leads to increased productivity of alfalfa and to improving the amino acid composition of plant leaves. The full nucleotide sequence of the rRNA gene cluster and partial sequence of the dinitrogenase reductase (nifH) gene of Nostoc PTV were deposited to GenBank (JQ259185.1, JQ259186.1). Comparison of these gene sequences of Nostoc PTV with all sequences present at the GenBank shows that this cyanobacterial strain does not have 100% identity with any organisms investigated previously. Phylogenetic analysis showed that this cyanobacterium clustered with high credibility values with Nostoc muscorum. PMID:26114100

Biochemical and Molecular Phylogenetic Study of Agriculturally Useful Association of a Nitrogen-Fixing Cyanobacterium and Nodule Sinorhizobium with Medicago sativa L.

PubMed

Karaushu, E V; Lazebnaya, I V; Kravzova, T R; Vorobey, N A; Lazebny, O E; Kiriziy, D A; Olkhovich, O P; Taran, N Yu; Kots, S Ya; Popova, A A; Omarova, E; Koksharova, O A

2015-01-01

Seed inoculation with bacterial consortium was found to increase legume yield, providing a higher growth than the standard nitrogen treatment methods. Alfalfa plants were inoculated by mono- and binary compositions of nitrogen-fixing microorganisms. Their physiological and biochemical properties were estimated. Inoculation by microbial consortium of Sinorhizobium meliloti T17 together with a new cyanobacterial isolate Nostoc PTV was more efficient than the single-rhizobium strain inoculation. This treatment provides an intensification of the processes of biological nitrogen fixation by rhizobia bacteria in the root nodules and an intensification of plant photosynthesis. Inoculation by bacterial consortium stimulates growth of plant mass and rhizogenesis and leads to increased productivity of alfalfa and to improving the amino acid composition of plant leaves. The full nucleotide sequence of the rRNA gene cluster and partial sequence of the dinitrogenase reductase (nifH) gene of Nostoc PTV were deposited to GenBank (JQ259185.1, JQ259186.1). Comparison of these gene sequences of Nostoc PTV with all sequences present at the GenBank shows that this cyanobacterial strain does not have 100% identity with any organisms investigated previously. Phylogenetic analysis showed that this cyanobacterium clustered with high credibility values with Nostoc muscorum.

Terminal region sequence variations in variola virus DNA.

PubMed

Massung, R F; Loparev, V N; Knight, J C; Totmenin, A V; Chizhikov, V E; Parsons, J M; Safronov, P F; Gutorov, V V; Shchelkunov, S N; Esposito, J J

1996-07-15

Genome DNA terminal region sequences were determined for a Brazilian alastrim variola minor virus strain Garcia-1966 that was associated with an 0.8% case-fatality rate and African smallpox strains Congo-1970 and Somalia-1977 associated with variola major (9.6%) and minor (0.4%) mortality rates, respectively. A base sequence identity of > or = 98.8% was determined after aligning 30 kb of the left- or right-end region sequences with cognate sequences previously determined for Asian variola major strains India-1967 (31% death rate) and Bangladesh-1975 (18.5% death rate). The deduced amino acid sequences of putative proteins of > or = 65 amino acids also showed relatively high identity, although the Asian and African viruses were clearly more related to each other than to alastrim virus. Alastrim virus contained only 10 of 70 proteins that were 100% identical to homologs in Asian strains, and 7 alastrim-specific proteins were noted.

Effects of learning with explicit elaboration on implicit transfer of visuomotor sequence learning.

PubMed

Tanaka, Kanji; Watanabe, Katsumi

2013-08-01

Intervals between stimuli and/or responses have significant influences on sequential learning. In the present study, we investigated whether transfer would occur even when the intervals and the visual configurations in a sequence were drastically changed so that participants did not notice that the required sequences of responses were identical. In the experiment, two (or three) sequential button presses comprised a "set," and nine (or six) consecutive sets comprised a "hyperset." In the first session, participants learned either a 2 × 9 or 3 × 6 hyperset by trial and error until they completed it 20 times without error. In the second block, the 2 × 9 (3 × 6) hyperset was changed into the 3 × 6 (2 × 9) hyperset, resulting in different visual configurations and intervals between stimuli and responses. Participants were assigned into two groups: the Identical and Random groups. In the Identical group, the sequence (i.e., the buttons to be pressed) in the second block was identical to that in the first block. In the Random group, a new hyperset was learned. Even in the Identical group, no participants noticed that the sequences were identical. Nevertheless, a significant transfer of performance occurred. However, in the subsequent experiment that did not require explicit trial-and-error learning in the first session, implicit transfer in the second session did not occur. These results indicate that learning with explicit elaboration strengthens the implicit representation of the sequence order as a whole; this might occur independently of the intervals between elements and enable implicit transfer.

Sequence and structural implications of a bovine corneal keratan sulfate proteoglycan core protein. Protein 37B represents bovine lumican and proteins 37A and 25 are unique

NASA Technical Reports Server (NTRS)

Funderburgh, J. L.; Funderburgh, M. L.; Brown, S. J.; Vergnes, J. P.; Hassell, J. R.; Mann, M. M.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

1993-01-01

Amino acid sequence from tryptic peptides of three different bovine corneal keratan sulfate proteoglycan (KSPG) core proteins (designated 37A, 37B, and 25) showed similarities to the sequence of a chicken KSPG core protein lumican. Bovine lumican cDNA was isolated from a bovine corneal expression library by screening with chicken lumican cDNA. The bovine cDNA codes for a 342-amino acid protein, M(r) 38,712, containing amino acid sequences identified in the 37B KSPG core protein. The bovine lumican is 68% identical to chicken lumican, with an 83% identity excluding the N-terminal 40 amino acids. Location of 6 cysteine and 4 consensus N-glycosylation sites in the bovine sequence were identical to those in chicken lumican. Bovine lumican had about 50% identity to bovine fibromodulin and 20% identity to bovine decorin and biglycan. About two-thirds of the lumican protein consists of a series of 10 amino acid leucine-rich repeats that occur in regions of calculated high beta-hydrophobic moment, suggesting that the leucine-rich repeats contribute to beta-sheet formation in these proteins. Sequences obtained from 37A and 25 core proteins were absent in bovine lumican, thus predicting a unique primary structure and separate mRNA for each of the three bovine KSPG core proteins.

The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

PubMed

Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

2016-08-01

The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

Natural infection of Cryptosporidium muris (Apicomplexa: Cryptosporiidae) in Siberian chipmunks.

PubMed

Hůrková, Lada; Hajdusek, Ondrej; Modrý, David

2003-04-01

Coprologic examination of nine Siberian chipmunks (Eutamias sibiricus) imported from Southeast Asia revealed infection with Cryptosporidium sp. Experimental inoculation of BALB/c mice proved their susceptibility to the infection. Infected mice shed oocysts 14-35 days postinfection. Oocyst morphology was similar to that reported for C. muris in previous studies, oocysts were 8.1 (7.0-9.0) x 5.9 (5.0-6.5) microns. Clinical signs were absent in naturally infected chipmunks and experimental mice. Histologic examinations of mice revealed numerous developmental stages of C. muris in the glandular stomach. Analysis of partial small subunit rRNA gene sequences confirmed identity of these isolates as C. muris. Our results represent the first report of C. muris in members of the family Sciuridae.

Comparison of the canine and human acid {beta}-galactosidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.

Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less

Phylogenetic analysis of phenotypically characterized Cryptococcus laurentii isolates reveals high frequency of cryptic species.

PubMed

Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

2014-01-01

Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99-100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode.

Mosaic Graphs and Comparative Genomics in Phage Communities

PubMed Central

Belcaid, Mahdi; Bergeron, Anne

2010-01-01

Abstract Comparing the genomes of two closely related viruses often produces mosaics where nearly identical sequences alternate with sequences that are unique to each genome. When several closely related genomes are compared, the unique sequences are likely to be shared with third genomes, leading to virus mosaic communities. Here we present comparative analysis of sets of Staphylococcus aureus phages that share large identical sequences with up to three other genomes, and with different partners along their genomes. We introduce mosaic graphs to represent these complex recombination events, and use them to illustrate the breath and depth of sequence sharing: some genomes are almost completely made up of shared sequences, while genomes that share very large identical sequences can adopt alternate functional modules. Mosaic graphs also allow us to identify breakpoints that could eventually be used for the construction of recombination networks. These findings have several implications on phage metagenomics assembly, on the horizontal gene transfer paradigm, and more generally on the understanding of the composition and evolutionary dynamics of virus communities. PMID:20874413

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

Erwinia teleogrylli sp. nov., a Bacterial Isolate Associated with a Chinese Cricket

PubMed Central

Liu, Bo; Luo, Jin; Li, Wei; Long, Xiu-Feng; Zhang, Yu-Qin; Zeng, Zhi-Gang; Tian, Yong-Qiang

2016-01-01

A bacterial isolate (SCU-B244T) was obtained in China from crickets (Teleogryllus occipitalis) living in cropland deserted for approximately 10 years. The isolated bacteria were Gram-negative, facultatively anaerobic, oxidase-negative rods. A preliminary analysis of the 16S rRNA gene sequence indicated that the strain belongs to either the genus Erwinia or Pantoea. Analysis of multilocus sequence typing based on concatenated partial atpD, gyrB and infB gene sequences and physiological and biochemical characteristics indicated that the strain belonged to the genus Erwinia, as member of a new species as it was distinct from other known Erwinia species. Further analysis of the 16S rRNA gene showed SCU-B244T to have 94.71% identity to the closest species of that genus, Erwinia oleae (DSM 23398T), which is below the threshold of 97% used to discriminate bacterial species. DNA-DNA hybridization results (5.78±2.52%) between SCU-B244T and Erwinia oleae (DSM 23398T) confirmed that SCU-B244T and Erwinia oleae (DSM 23398T) represent different species combined with average nucleotide identity values which range from 72.42% to 74.41. The DNA G+C content of SCU-B244T was 55.32 mol%, which also differs from that of Erwinia oleae (54.7 to 54.9 mol%). The polyphasic taxonomic approach used here confirmed that the strain belongs to the Erwinia group and represents a novel species. The name Erwinia teleogrylli sp. nov. is proposed for this novel taxon, for which the type strain is SCU-B244T (= CGMCC 1.12772T = DSM 28222T = KCTC 42022T). PMID:26800121

DNA barcoding for identification of consumer-relevant mushrooms: A partial solution for product certification?

PubMed

Raja, Huzefa A; Baker, Timothy R; Little, Jason G; Oberlies, Nicholas H

2017-01-01

One challenge in the dietary supplement industry is confirmation of species identity for processed raw materials, i.e. those modified by milling, drying, or extraction, which move through a multilevel supply chain before reaching the finished product. This is particularly difficult for samples containing fungal mycelia, where processing removes morphological characteristics, such that they do not present sufficient variation to differentiate species by traditional techniques. To address this issue, we have demonstrated the utility of DNA barcoding to verify the taxonomic identity of fungi found commonly in the food and dietary supplement industry; such data are critical for protecting consumer health, by assuring both safety and quality. By using DNA barcoding of nuclear ribosomal internal transcribed spacer (ITS) of the rRNA gene with fungal specific ITS primers, ITS barcodes were generated for 33 representative fungal samples, all of which could be used by consumers for food and/or dietary supplement purposes. In the majority of cases, we were able to sequence the ITS region from powdered mycelium samples, grocery store mushrooms, and capsules from commercial dietary supplements. After generating ITS barcodes utilizing standard procedures accepted by the Consortium for the Barcode of Life, we tested their utility by performing a BLAST search against authenticate published ITS sequences in GenBank. In some cases, we also downloaded published, homologous sequences of the ITS region of fungi inspected in this study and examined the phylogenetic relationships of barcoded fungal species in light of modern taxonomic and phylogenetic studies. We anticipate that these data will motivate discussions on DNA barcoding based species identification as applied to the verification/certification of mushroom-containing dietary supplements. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Genetic and molecular characterization of a gene encoding a wide specificity purine permease of Aspergillus nidulans reveals a novel family of transporters conserved in prokaryotes and eukaryotes.

PubMed

Diallinas, G; Gorfinkiel, L; Arst, H N; Cecchetto, G; Scazzocchio, C

1995-04-14

In Aspergillus nidulans, loss-of-function mutations in the uapA and azgA genes, encoding the major uric acid-xanthine and hypoxanthine-adenine-guanine permeases, respectively, result in impaired utilization of these purines as sole nitrogen sources. The residual growth of the mutant strains is due to the activity of a broad specificity purine permease. We have identified uapC, the gene coding for this third permease through the isolation of both gain-of-function and loss-of-function mutations. Uptake studies with wild-type and mutant strains confirmed the genetic analysis and showed that the UapC protein contributes 30% and 8-10% to uric acid and hypoxanthine transport rates, respectively. The uapC gene was cloned, its expression studied, its sequence and transcript map established, and the sequence of its putative product analyzed. uapC message accumulation is: (i) weakly induced by 2-thiouric acid; (ii) repressed by ammonium; (iii) dependent on functional uaY and areA regulatory gene products (mediating uric acid induction and nitrogen metabolite repression, respectively); (iv) increased by uapC gain-of-function mutations which specifically, but partially, suppress a leucine to valine mutation in the zinc finger of the protein coded by the areA gene. The putative uapC gene product is a highly hydrophobic protein of 580 amino acids (M(r) = 61,251) including 12-14 putative transmembrane segments. The UapC protein is highly similar (58% identity) to the UapA permease and significantly similar (23-34% identity) to a number of bacterial transporters. Comparisons of the sequences and hydropathy profiles of members of this novel family of transporters yield insights into their structure, functionally important residues, and possible evolutionary relationships.

Assessment of the microbial diversity of Brazilian kefir grains by PCR-DGGE and pyrosequencing analysis.

PubMed

Leite, A M O; Mayo, B; Rachid, C T C C; Peixoto, R S; Silva, J T; Paschoalin, V M F; Delgado, S

2012-09-01

The microbial diversity and community structure of three different kefir grains from different parts of Brazil were examined via the combination of two culture-independent methods: PCR-denaturing gradient gel electrophoresis (PCR-DGGE) and pyrosequencing. PCR-DGGE showed Lactobacillus kefiranofaciens and Lactobacillus kefiri to be the major bacterial populations in all three grains. The yeast community was dominated by Saccharomyces cerevisiae. Pyrosequencing produced a total of 14,314 partial 16S rDNA sequence reads from the three grains. Sequence analysis grouped the reads into three phyla, of which Firmicutes was dominant. Members of the genus Lactobacillus were the most abundant operational taxonomic units (OTUs) in all samples, accounting for up to 96% of the sequences. OTUs belonging to other lactic and acetic acid bacteria genera, such as Lactococcus, Leuconostoc, Streptococcus and Acetobacter, were also identified at low levels. Two of the grains showed identical DGGE profiles and a similar number of OTUs, while the third sample showed the highest diversity by both techniques. Pyrosequencing allowed the identification of bacteria that were present in small numbers and rarely associated with the microbial community of this complex ecosystem. Copyright © 2012 Elsevier Ltd. All rights reserved.

First report of carp oedema virus infection of koi (Cyprinus carpio haematopterus) in the Republic of Korea.

PubMed

Kim, S W; Jun, J W; Giri, S S; Chi, C; Yun, S; Kim, H J; Kim, S G; Kang, J W; Park, S C

2018-04-01

Twenty-five koi (Cyprinus carpio haematopterus) bought from a wholesale fish market in Korea, showed lethargic behaviour and 100% mortality within 20 days. Carp oedema virus (CEV) was detected by PCR in all 25 koi. Results of detailed histopathological and clinical examinations of 17 koi indicated loss of body balance, severe infiltration of inflammatory cells into the inter-lamellar spaces of the gills and vacuolization and inclusion bodies in gill epithelial cells. Sequence analysis of PCR products of these koi showed up to 99% identity to the previously reported sequences, suggesting that the observed mass mortality resulted from koi sleepy disease (KSD) due to CEV infection. To the best of our knowledge, this study is the first report of KSD in the Republic of Korea. Partial sequences of 4a protein from the virus indicated that the present CEV detected in koi from Korea is more closely related to that from the UK and Poland than from Japan. The present findings indicate that the prevalence and spread of KSD must be closely monitored in both European and Asian countries to avoid potential economic losses to the global koi industry. © 2017 Blackwell Verlag GmbH.

Cyprinid herpesvirus 2 infection emerged in cultured gibel carp, Carassius auratus gibelio in China.

PubMed

Xu, Jin; Zeng, Lingbing; Zhang, Hui; Zhou, Yong; Ma, Jie; Fan, Yuding

2013-09-27

An epizootic with severe mortality has emerged in cultured gibel carp, Carassius auratus gibelio, in China since 2009, and caused huge economic loss. The signs and epidemiology background of the disease were investigated. Parasite examination, bacteria and virus isolation were carried out for pathogen isolation. The causative pathogen was obtained and identified as Cyprinid herpesvirus 2 (CyHV-2) by experimental infection, electron microscopy, cell culture, PCR assay and sequence alignment, designated as CyHV-2-JSSY. Experimental infection proved the high virulence of CyHV-2-JSSY to healthy gibel carp. Electron microscopy revealed that the viral nucleocapsid was hexagonal in shape measuring 110-120 nm in diameter with a 170-200 nm envelope. The virus caused significant CPE in Koi-Fin cells at the early passages, but not beyond the fifth passages. Sequence alignment of the partial viral helicase gene (JX566884) showed that it shared 99-100% identity to the published sequences of other CyHV-2 isolates. This study represented the first isolation and identification of CyHV-2 in cultured gibel carp in China and laid a foundation for the further studies of the disease. Copyright © 2013 Elsevier B.V. All rights reserved.

Detection and phylogenetic analysis of a new adenoviral polymerase gene in reptiles in Korea.

PubMed

Bak, Eun-Jung; Jho, Yeonsook; Woo, Gye-Hyeong

2018-06-01

Over a period of 7 years (2004-2011), samples from 34 diseased reptiles provided by local governments, zoos, and pet shops were tested for viral infection. Animals were diagnosed based on clinical signs, including loss of appetite, diarrhea, rhinorrhea, and unexpected sudden death. Most of the exotic animals had gastrointestinal problems, such as mucosal redness and ulcers, while the native animals had no clinical symptoms. Viral sequences were found in seven animals. Retroviral genes were amplified from samples from five Burmese pythons (Python molurus bivittatus), an adenovirus was detected in a panther chameleon (Furcifer pardalis), and an adenovirus and a paramyxovirus were detected in a tropical girdled lizard (Cordylus tropidosternum). Phylogenetic analysis of retroviruses and paramyxoviruses showed the highest sequence identity to both a Python molurus endogenous retrovirus and a Python curtus endogenous retrovirus and to a lizard isolate, respectively. Partial sequencing of an adenoviral DNA polymerase gene from the lizard isolate suggested that the corresponding virus was a novel isolate different from the reference strain (accession no. AY576677.1). The virus was not isolated but was detected, using molecular genetic techniques, in a lizard raised in a pet shop. This animal was also coinfected with a paramyxovirus.

Genetic and molecular characterization of the maize rp3 rust resistance locus.

PubMed Central

Webb, Craig A; Richter, Todd E; Collins, Nicholas C; Nicolas, Marie; Trick, Harold N; Pryor, Tony; Hulbert, Scot H

2002-01-01

In maize, the Rp3 gene confers resistance to common rust caused by Puccinia sorghi. Flanking marker analysis of rust-susceptible rp3 variants suggested that most of them arose via unequal crossing over, indicating that rp3 is a complex locus like rp1. The PIC13 probe identifies a nucleotide binding site-leucine-rich repeat (NBS-LRR) gene family that maps to the complex. Rp3 variants show losses of PIC13 family members relative to the resistant parents when probed with PIC13, indicating that the Rp3 gene is a member of this family. Gel blots and sequence analysis suggest that at least 9 family members are at the locus in most Rp3-carrying lines and that at least 5 of these are transcribed in the Rp3-A haplotype. The coding regions of 14 family members, isolated from three different Rp3-carrying haplotypes, had DNA sequence identities from 93 to 99%. Partial sequencing of clones of a BAC contig spanning the rp3 locus in the maize inbred line B73 identified five different PIC13 paralogues in a region of approximately 140 kb. PMID:12242248

The Retirement process: Making the Person and Cultural Meanings malleable

PubMed Central

Luborsky, Mark R.

2012-01-01

In research on life-course transitions, the dynamics of reorganizing meanings and lives were examined in interviews with 32 retiring workers in the United States. New retirees engaged in reorganization of self and social identity by work in special projects involving physical labor to demolish and rebuild backyards and household interiors. Findings indicate that the work in these projects conjoins the reshaping of subjective experience and social life. The projects express a behavioral narrative of the transition in that the spatial sequence of activities (moving from households to the community) parallels the temporal order of reorganization (from self to social identity). Individuals invent and recapitulate partially formed symbols (i.e., dirt, birth, and death) and prior life events to develop new self-images and social lives. These metaphors and processes of separation and death foster creativity and reintegration and must be viewed as integral to transition rather than interpreted as phenomena to be avoided as they are in gerontology and medical practice. Transitions need to be understood as situated within individual histories and cultural contexts. PMID:23308033

Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand.

PubMed

Pohuang, Tawatchai; Chansiripornchai, Niwat; Tawatsin, Achara; Sasipreeyajan, Jiroj

2009-09-01

Thirteen field isolates of infectious bronchitis virus (IBV) were isolated from broiler flocks in Thailand between January and June 2008. The 878-bp of the S1 gene covering a hypervariable region was amplified and sequenced. Phylogenetic analysis based on that region revealed that these viruses were separated into two groups (I and II). IBV isolates in group I were not related to other IBV strains published in the GenBank database. Group 1 nucleotide sequence identities were less than 85% and amino acid sequence identities less than 84% in common with IBVs published in the GenBank database. This group likely represents the strains indigenous to Thailand. The isolates in group II showed a close relationship with Chinese IBVs. They had nucleotide sequence identities of 97-98% and amino acid sequence identities 96-98% in common with Chinese IBVs (strain A2, SH and QXIBV). This finding indicated that the recent Thai IBVs evolved separately and at least two groups of viruses are circulating in Thailand.

Infective Endocarditis: Identification of Catalase-Negative, Gram-Positive Cocci from Blood Cultures by Partial 16S rRNA Gene Analysis and by Vitek 2 Examination.

PubMed

Abdul-Redha, Rawaa Jalil; Kemp, Michael; Bangsborg, Jette M; Arpi, Magnus; Christensen, Jens Jørgen

2010-01-01

Streptococci, enterococci and Streptococcus-like bacteria are frequent etiologic agents of infective endocarditis and correct species identification can be a laboratory challenge. Viridans streptococci (VS) not seldomly cause contamination of blood cultures. Vitek 2 and partial sequencing of the 16S rRNA gene were applied in order to compare the results of both methods. STRAINS ORIGINATED FROM TWO GROUPS OF PATIENTS: 149 strains from patients with infective endocarditis and 181 strains assessed as blood culture contaminants. Of the 330 strains, based on partial 16S rRNA gene sequencing results, 251 (76%) were VS strains, 10 (3%) were pyogenic streptococcal strains, 54 (16%) were E. faecalis strains and 15 (5%) strains belonged to a group of miscellaneous catalase-negative, Gram-positive cocci. Among VS strains, respectively, 220 (87,6%) and 31 (12,3%) obtained agreeing and non-agreeing identifications with the two methods with respect to allocation to the same VS group. Non-agreeing species identification mostly occurred among strains in the contaminant group, while for endocarditis strains notably fewer disagreeing results were observed.Only 67 of 150 strains in the mitis group strains obtained identical species identifications by the two methods. Most VS strains belonging to the groups of salivarius, anginosus, and mutans obtained agreeing species identifications with the two methods, while this only was the case for 13 of the 21 bovis strains. Pyogenic strains (n=10), Enterococcus faecalis strains (n=54) and a miscellaneous group of catalase-negative, Gram-positive cocci (n=15) seemed well identified by both methods, except that disagreements in identifications in the miscellaneous group of strains occurred for 6 of 15 strains.

Primary structures and partial toxicological characterization of two phospholipases A2 from Micrurus mipartitus and Micrurus dumerilii coral snake venoms.

PubMed

Rey-Suárez, Paola; Núñez, Vitelbina; Saldarriaga-Córdoba, Mónica; Lomonte, Bruno

2017-06-01

Snake venom phospholipases A 2 (PLA 2 ) share high sequence identities and a conserved structural scaffold, but show important functional differences. Only a few PLA 2 s have been purified and characterized from coral snake (Micrurus spp.) venoms, and their role in envenomation remains largely unknown. In this report, we describe the isolation, sequencing and partial functional characterization of two Micrurus PLA 2 s: MmipPLA 2 from Micrurus mipartitus and MdumPLA 2 from Micrurus dumerilii, two species of clinical importance in Colombia. MmipPLA 2 consisted of 119 amino acid residues with a predicted pI of 8.4, whereas MdumPLA 2 consisted of 117 residues with a pI of 5.6. Both PLA 2 s showed the conserved 'group I' cysteine pattern and were enzymatically active, although MdumPLA 2 had higher activity. The two enzymes differed notably in their toxicity, with MmipPLA 2 being highly lethal to mice and mildly myotoxic, whereas MdumPLA 2 was not lethal (up to 3 μg/g body weight) but strongly myotoxic. MdumPLA 2 displayed higher anticoagulant activity than MmipPLA 2 in vitro and caused more sustained edema in the mouse footpad assay. Neither of these enzymes was cytolytic to cultured skeletal muscle C2C12 myotubes. Based on their structural differences, the two enzymes were placed in separate lineages in a partial phylogeny of Micrurus venom PLA 2 s and this classification agreed with their divergent biological activities. Overall, these findings highlight the structural and functional diversity of Micrurus venom PLA 2 s. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Interuser Interference Analysis for Direct-Sequence Spread-Spectrum Systems Part I: Partial-Period Cross-Correlation

NASA Technical Reports Server (NTRS)

Ni, Jianjun (David)

2012-01-01

This presentation discusses an analysis approach to evaluate the interuser interference for Direct-Sequence Spread-Spectrum (DSSS) Systems for Space Network (SN) Users. Part I of this analysis shows that the correlation property of pseudo noise (PN) sequences is the critical factor which determines the interuser interference performance of the DSSS system. For non-standard DSSS systems in which PN sequence s period is much larger than one data symbol duration, it is the partial-period cross-correlation that determines the system performance. This study reveals through an example that a well-designed PN sequence set (e.g. Gold Sequence, in which the cross-correlation for a whole-period is well controlled) may have non-controlled partial-period cross-correlation which could cause severe interuser interference for a DSSS system. Since the analytical derivation of performance metric (bit error rate or signal-to-noise ratio) based on partial-period cross-correlation is prohibitive, the performance degradation due to partial-period cross-correlation will be evaluated using simulation in Part II of this analysis in the future.

Characterization of Clostridium perfringens iota-toxin genes and expression in Escherichia coli.

PubMed Central

Perelle, S; Gibert, M; Boquet, P; Popoff, M R

1993-01-01

The iota toxin which is produced by Clostridium perfringens type E, is a binary toxin consisting of two independent polypeptides: Ia, which is an ADP-ribosyltransferase, and Ib, which is involved in the binding and internalization of the toxin into the cell. Two degenerate oligonucleotide probes deduced from partial amino acid sequence of each component of C. spiroforme toxin, which is closely related to the iota toxin, were used to clone three overlapping DNA fragments containing the iota-toxin genes from C. perfringens type E plasmid DNA. Two genes, in the same orientation, coding for Ia (387 amino acids) and Ib (875 amino acids) and separated by 243 noncoding nucleotides were identified. A predicted signal peptide was found for each component, and the secreted Ib displays two domains, the propeptide (172 amino acids) and the mature protein (664 amino acids). The Ia gene has been expressed in Escherichia coli and C. perfringens, under the control of its own promoter. The recombinant polypeptide obtained was recognized by Ia antibodies and ADP-ribosylated actin. The expression of the Ib gene was obtained in E. coli harboring a recombinant plasmid encompassing the putative promoter upstream of the Ia gene and the Ia and Ib genes. Two residues which have been found to be involved in the NAD+ binding site of diphtheria and pseudomonas toxins are conserved in the predicted Ia sequence (Glu-14 and Trp-19). The predicted amino acid Ib sequence shows 33.9% identity with and 54.4% similarity to the protective antigen of the anthrax toxin complex. In particular, the central region of Ib, which contains a predicted transmembrane segment (Leu-292 to Ser-308), presents 45% identity with the corresponding protective antigen sequence which is involved in the translocation of the toxin across the cell membrane. Images PMID:8225592

Further insight into genetic variation and haplotype diversity of Cherry virus A from China

PubMed Central

Candresse, Thierry; He, Zhen; Li, Shifang; Ma, Yuxin

2017-01-01

Cherry virus A (CVA) infection appears to be prevalent in cherry plantations worldwide. In this study, the diversity of CVA isolates from 31 cherry samples collected from different orchards around Bohai Bay in northeastern China was analyzed. The complete genome of one of these isolates, ChYT52, was found to be 7,434 nt in length excluding the poly (A) tail. It shares between 79.9–98.7% identity with CVA genome sequences in GenBank, while its RdRp core is more divergent (79.1–90.7% nt identity), likely as a consequence of a recombination event. Phylogenetic analysis of ChYT52 genome with CVA genomes in Genbank resulted in at least 7 major clusters plus additional 5 isolates alone at the end of long branches suggesting the existence of further phylogroups diversity in CVA. The genetic diversity of Chinese CVA isolates from 31 samples and GenBank sequences were analyzed in three genomic regions that correspond to the coat protein, the RNA-dependent RNA polymerase core region, and the movement protein genes. With few exceptions likely representing further recombination impact, the trees various trees are largely congruent, indicating that each region provides valuable phylogenetic information. In all cases, the majority of the Chinese CVA isolates clustering in phylogroup I, together with the X82547 reference sequence from Germany. Statistically significant negative values were obtained for Tajima’s D in the three genes for phylogroup I, suggesting that it may be undergoing a period of expansion. There was considerable haplotype diversity in the individual samples and more than half samples contained genetically diverse haplotypes belonging to different phylogroups. In addition, a number of statistically significant recombination events were detected in CVA genomes or in the partial genomic sequences indicating an important contribution of recombination to CVA evolution. This work provides a foundation for elucidation of the epidemiological characteristics and evolutionary history of CVA populations. PMID:29020049

A Novel Partial Sequence Alignment Tool for Finding Large Deletions

PubMed Central

Aruk, Taner; Ustek, Duran; Kursun, Olcay

2012-01-01

Finding large deletions in genome sequences has become increasingly more useful in bioinformatics, such as in clinical research and diagnosis. Although there are a number of publically available next generation sequencing mapping and sequence alignment programs, these software packages do not correctly align fragments containing deletions larger than one kb. We present a fast alignment software package, BinaryPartialAlign, that can be used by wet lab scientists to find long structural variations in their experiments. For BinaryPartialAlign, we make use of the Smith-Waterman (SW) algorithm with a binary-search-based approach for alignment with large gaps that we called partial alignment. BinaryPartialAlign implementation is compared with other straight-forward applications of SW. Simulation results on mtDNA fragments demonstrate the effectiveness (runtime and accuracy) of the proposed method. PMID:22566777

Isolation, Characterization and Bioactivities of an Extracellular Polysaccharide Produced from Streptomyces sp. MOE6.

PubMed

Elnahas, Marwa O; Amin, Magdy A; Hussein, Mohamed M D; Shanbhag, Vinit C; Ali, Amal E; Wall, Judy D

2017-08-24

A Streptomyces strain was isolated from soil and the sequence of 1471 nucleotides of its 16S rDNA showed 99% identity to Streptomyces sp. HV10. This newly isolated Streptomyces strain produced an extracellular polysaccharide (EPS) composed mainly of glucose and mannose in a ratio of 1:4.1, as was characterized by Fourier transform infrared spectroscopy (FTIR), HPLC and ¹H-NMR. The antioxidant activities of the partially purified MOE6-EPS were determined by measuring the hydroxyl free radical scavenging activity and the scavenging of 2,2-diphenyl-2-picryl-hydrazyl (DPPH) radicals. In addition, the partially purified MOE6-EPS showed high ferrous ion (Fe 2+ ) chelation activity which is another antioxidant activity. Interestingly, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays that were colorimetric assays for NAD(P)H-dependent cellular oxidoreductases and a proxy of the number of viable cells, showed that the partially purified MOE6-EPS inhibited the proliferation of the human breast cancer cells (MDA-MB-231). The scratch wound assay showed that MOE6-EPS reduced the migration of mouse breast cancer cells (4T1). This study reports the production of EPS from Streptomyces species with promising antioxidant, metal chelating and mammalian cell inhibitory activities.

Sequence of a second gene encoding bovine submaxillary mucin: implication for mucin heterogeneity and cloning.

PubMed

Jiang, W; Woitach, J T; Gupta, D; Bhavanandan, V P

1998-10-20

Secreted epithelial mucins are extremely large and heterogeneous glycoproteins. We report the 5 kilobase DNA sequence of a second gene, BSM2, which encodes bovine submaxillary mucin. The determined nucleotide and deduced amino acid sequences of BSM2 are 95.2% and 92. 2% identical, respectively, to those of the previously described BSM1 gene isolated from the same cow. Further, the five predicted protein domains of the two genes are 100%, 94%, 93%, 77%, and 88% identical. Based on the above results, we propose that expression of multiple homologous core proteins from a single animal is a factor in generating diversity of saccharides in mucins and in providing resistance of the molecules to proteolysis. In addition, this work raises several important issues in mucin cloning such as assembling sequences from seemingly overlapping clones and deducing consensus sequences for nearly identical tandem repeats. Copyright 1998 Academic Press.

Identification of a new Apscaviroid from Japanese persimmon.

PubMed

Nakaune, Ryoji; Nakano, Masaaki

2008-01-01

Three viroid-like sequences were detected from Japanese persimmon (Diospyrus kaki Thunb.) by RT-PCR using primers specific for members of the genus Apscaviroid. Based on the sequences, we determined the complete genomic sequences. Two had 92.1-94.3% sequence identity with citrus viroid OS (CVd-OS) and 91.4-96.3% identity with apple fruit crinkle viroid (AFCVd), respectively. Another one, tentatively named persimmon viroid (PVd), had 396 nucleotides and less than 70% sequence identity with known viroids. The secondary structure of PVd is proposed to be rod-like with extensive base pairing and contains the terminal conserved region and the central conserved region characteristic of the genus Apscaviroid. Moreover, we confirmed that the viroids, including PVd, are graft transmissible from persimmon to persimmon and that persimmon is a natural host of these viroids. According to its molecular and biological properties, PVd should be considered a member of a new species in the genus Apscaviroid.

Molecular cloning and expression of two heat-shock protein genes (HSC70/HSP70) from Prenant's schizothoracin (Schizothorax prenanti).

PubMed

Li, Jiuxuan; Zhang, Haibin; Zhang, Xiuyue; Yang, Shiyong; Yan, Taiming; Song, Zhaobin

2015-04-01

Through the RT-PCR and rapid amplification of cDNA ends, two complementary deoxyribonucleic acid (cDNA) clones encoding heat-shock cognate 70 (HSC70, designated Sp-HSC70) and inducible heat-shock protein 70 (HSP70, designated Sp-HSP70) were isolated from the liver of Prenant's schizothoracin (Schizothorax prenanti). The cDNAs were 2344- and 2292-bp in length and contained 1950- and 1932-bp open reading frames, encoded proteins of 649 and 643 amino acids, respectively. Amino acid sequence analysis indicated that both Sp-HSC70 and Sp-HSP70 contained three signature sequences of HSP70 family, two partial overlapping bipartite nuclear localization signal sequences (an ATP-binding site motif, a bipartite nuclear targeting signal), and a cytoplasmic characteristic motif EEVD. Homology analysis revealed that Sp-HSC70 and Sp-HSP70 shared 77.5% identity and Sp-HSC70 shared more than 81.1% identity with the known HSC70s of other vertebrates, while Sp-HSP70 shared more than 77.5 % identity with the known HSP70s of other vertebrates. Fluorescent real-time quantitative RT-PCR showed that Sp-HSC70 and Sp-HSP70 mRNAs were found in all tested tissues, including blood, brain, heart, liver, spleen, head kidney, white muscle, skin, gonad, hypophysis, red muscle, and gill. The Sp-HSC70 and Sp-HSP70 mRNA expression level in blood and head kidney displayed a significant increase in vibrio-challenged group with the bacterium Aeromonas hydrophila at 24 h post-infection compared to a control group. Temporally, there was a clear time-dependent expression pattern of Sp-HSC70 or Sp-HSP70 gene after bacterial challenge, and the expression of Sp-HSC70 and Sp-HSP70 mRNAs reached a maximum level at 12 and 6 h post-challenge, respectively. Both returned to control level after 7 × 24 h. The results suggest that Sp-HSC70 and Sp-HSP70 genes may play important roles in mediating the immune responses of A. hydrophila-related diseases in the Prenant's schizothoracin.

Zuotin, a putative Z-DNA binding protein in Saccharomyces cerevisiae

NASA Technical Reports Server (NTRS)

Zhang, S.; Lockshin, C.; Herbert, A.; Winter, E.; Rich, A.

1992-01-01

A putative Z-DNA binding protein, named zuotin, was purified from a yeast nuclear extract by means of a Z-DNA binding assay using [32P]poly(dG-m5dC) and [32P]oligo(dG-Br5dC)22 in the presence of B-DNA competitor. Poly(dG-Br5dC) in the Z-form competed well for the binding of a zuotin containing fraction, but salmon sperm DNA, poly(dG-dC) and poly(dA-dT) were not effective. Negatively supercoiled plasmid pUC19 did not compete, whereas an otherwise identical plasmid pUC19(CG), which contained a (dG-dC)7 segment in the Z-form was an excellent competitor. A Southwestern blot using [32P]poly(dG-m5dC) as a probe in the presence of MgCl2 identified a protein having a molecular weight of 51 kDa. The 51 kDa zuotin was partially sequenced at the N-terminal and the gene, ZUO1, was cloned, sequenced and expressed in Escherichia coli; the expressed zuotin showed similar Z-DNA binding activity, but with lower affinity than zuotin that had been partially purified from yeast. Zuotin was deduced to have a number of potential phosphorylation sites including two CDC28 (homologous to the human and Schizosaccharomyces pombe cdc2) phosphorylation sites. The hexapeptide motif KYHPDK was found in zuotin as well as in several yeast proteins, DnaJ of E.coli, csp29 and csp32 proteins of Drosophila and the small t and large T antigens of the polyoma virus. A 60 amino acid segment of zuotin has similarity to several histone H1 sequences. Disruption of ZUO1 in yeast resulted in a slow growth phenotype.

Characterization of sour cherry isolates of plum pox virus from the Volga Basin in Russia reveals a new cherry strain of the virus.

PubMed

Glasa, Miroslav; Prikhodko, Yuri; Predajňa, Lukáš; Nagyová, Alžbeta; Shneyder, Yuri; Zhivaeva, Tatiana; Subr, Zdeno; Cambra, Mariano; Candresse, Thierry

2013-09-01

Plum pox virus (PPV) is the causal agent of sharka, the most detrimental virus disease of stone fruit trees worldwide. PPV isolates have been assigned into seven distinct strains, of which PPV-C regroups the genetically distinct isolates detected in several European countries on cherry hosts. Here, three complete and several partial genomic sequences of PPV isolates from sour cherry trees in the Volga River basin of Russia have been determined. The comparison of complete genome sequences has shown that the nucleotide identity values with other PPV isolates reached only 77.5 to 83.5%. Phylogenetic analyses clearly assigned the RU-17sc, RU-18sc, and RU-30sc isolates from cherry to a distinct cluster, most closely related to PPV-C and, to a lesser extent, PPV-W. Based on their natural infection of sour cherry trees and genomic characterization, the PPV isolates reported here represent a new strain of PPV, for which the name PPV-CR (Cherry Russia) is proposed. The unique amino acids conserved among PPV-CR and PPV-C cherry-infecting isolates (75 in total) are mostly distributed within the central part of P1, NIa, and the N terminus of the coat protein (CP), making them potential candidates for genetic determinants of the ability to infect cherry species or of adaptation to these hosts. The variability observed within 14 PPV-CR isolates analyzed in this study (0 to 2.6% nucleotide divergence in partial CP sequences) and the identification of these isolates in different localities and cultivation conditions suggest the efficient establishment and competitiveness of the PPV-CR in the environment. A specific primer pair has been developed, allowing the specific reverse-transcription polymerase chain reaction detection of PPV-CR isolates.

Immunological and molecular polymorphisms of OspC, an immunodominant major outer surface protein of Borrelia burgdorferi.

PubMed Central

Wilske, B; Preac-Mursic, V; Jauris, S; Hofmann, A; Pradel, I; Soutschek, E; Schwab, E; Will, G; Wanner, G

1993-01-01

The gene of the immunodominant major protein pC of Borrelia burgdorferi was previously cloned and sequenced (R. Fuchs, S. Jauris, F. Lottspeich, V. Preac-Mursic, B. Wilske, and E. Soutschek, Mol. Microbiol. 6:503-509, 1992). pC is abundantly expressed on the outer surface of B. burgdorferi, as demonstrated by immunoelectron microscopy with monoclonal antibody L22 1F8. Accordingly, pC is renamed OspC, by analogy to the outer surface proteins OspA and OspB. Western immunoblot analysis of 45 B. burgdorferi isolates with monoclonal antibodies revealed that OspC is immunologically heterogeneous. Partial sequence analysis of the ospC gene confirmed the protein heterogeneity at the genetic level. We found that the degree of identity between the ospC partial sequences of five strains representing different OspA serotypes was only 63.3 to 85.4%. Immunological heterogeneity was also observed among representatives of the three newly designated genospecies of B. burgdorferi sensu lato, B. burgdorferi sensu stricto, B. garinii, and group VS461. Heterogeneity was confirmed for B. garinii at the genetic level. The ospC gene was also cloned from strains that did not express OspC, and antibody-reactive OspC was expressed in Escherichia coli. In addition, OspC-expressing variants were obtained from a nonexpressing strain by plating single colonies on solid medium. These findings confirm that the ospC gene is also present in nonexpressing strains. Because OspC is an immunodominant protein for the early immune response in Lyme borreliosis and was effective as a vaccine in an animal model, the immunological and molecular polymorphisms of ospC and OspC have important implications for the development of diagnostic reagents and vaccines. Images PMID:8478108

Identification and characterization of the nickel uptake system for urease biogenesis in Streptococcus salivarius 57.I.

PubMed

Chen, Yi-Ywan M; Burne, Robert A

2003-12-01

Ureases are multisubunit enzymes requiring Ni(2+) for activity. The low pH-inducible urease gene cluster in Streptococcus salivarius 57.I is organized as an operon, beginning with ureI, followed by ureABC (structural genes), and ureEFGD (accessory genes). Urease biogenesis also requires a high-affinity Ni(2+) uptake system. By searching the partial genome sequence of a closely related organism, Streptococcus thermophilus LMG18311, three open reading frame (ORFs) homologous to those encoding proteins involved in cobalamin biosynthesis and cobalt transport (cbiMQO) were identified immediately 3' to the ure operon. To determine whether these genes were involved in urease biogenesis by catalyzing Ni(2+) uptake in S. salivarius, regions 3' to ureD were amplified by PCRs from S. salivarius by using primers identical to the S. thermophilus sequences. Sequence analysis of the products revealed three ORFs. Reverse transcriptase PCR was used to demonstrate that the ORFs are transcribed as part of the ure operon. Insertional inactivation of ORF1 with a polar kanamycin marker completely abolished urease activity and the ability to accumulate (63)Ni(2+) during growth. Supplementation of the growth medium with NiCl(2) at concentrations as low as 2.5 micro M partially restored urease activity in the mutant. Both wild-type and mutant strains showed enhanced urease activity when exogenous Ni(2+) was provided at neutral pH. Enhancement of urease activity by adding nickel was regulated at the posttranslational level. Thus, ORF1, ORF2, and ORF3 are part of the ure operon, and these genes, designated ureM, ureQ, and ureO, respectively, likely encode a Ni(2+)-specific ATP-binding cassette transporter.

Complete genome analysis of porcine kobuviruses from the feces of pigs in Japan.

PubMed

Akagami, Masataka; Ito, Mika; Niira, Kazutaka; Kuroda, Moegi; Masuda, Tsuneyuki; Haga, Kei; Tsuchiaka, Shinobu; Naoi, Yuki; Kishimoto, Mai; Sano, Kaori; Omatsu, Tsutomu; Aoki, Hiroshi; Katayama, Yukie; Oba, Mami; Oka, Tomoichiro; Ichimaru, Toru; Yamasato, Hiroshi; Ouchi, Yoshinao; Shirai, Junsuke; Katayama, Kazuhiko; Mizutani, Tetsuya; Nagai, Makoto

2017-08-01

Porcine kobuviruses (PoKoVs) are ubiquitously distributed in pig populations worldwide and are thought to be enteric viruses in swine. Although PoKoVs have been detected in pigs in Japan, no complete genome data for Japanese PoKoVs are available. In the present study, 24 nearly complete or complete sequences of the PoKoV genome obtained from 10 diarrheic feces and 14 non-diarrheic feces of Japanese pigs were analyzed using a metagenomics approach. Japanese PoKoVs shared 85.2-100% identity with the complete coding nucleotide (nt) sequences and the closest relationship of 85.1-98.3% with PoKoVs from other countries. Twenty of 24 Japanese PoKoVs carried a deletion of 90 nt in the 2B coding region. Phylogenetic tree analyses revealed that PoKoVs were not grouped according to their geographical region of origin and the phylogenetic trees of the L, P1, P2, and P3 genetic regions showed topologies different from each other. Similarity plot analysis using strains from a single farm revealed partially different similarity patterns among strains from identical farm origins, suggesting that recombination events had occurred. These results indicate that various PoKoV strains are prevalent and not restricted geographically on pig farms worldwide and the coexistence of multiple strains leads to recombination events of PoKoVs and contributes to the genetic diversity and evolution of PoKoVs.

Differential expression of a novel gene during seed triacylglycerol accumulation in lupin species ( Lupinus angustifolius L. and L. mutabilis L.).

PubMed

Francki, Michael G; Whitaker, Peta; Smith, Penelope M; Atkins, Craig A

2002-11-01

Seed triacylglycerols (TAGs) are stored as energy reserves and extracted for various end-product uses. In lupins, seed oil content varies from 16% in Lupinus mutabilisto 8% in L. angustifolius. We have shown that TAGs rapidly accumulate during mid-stages of seed development in L. mutabilis compared to the lower seed oil species, L. angustifolius. In this study, we have targeted the key enzymes of the lipid biosynthetic pathway, acetyl-CoA carboxylase (ACCase) and diacylglycerol acyltransferase (DAGAT), to determine factors regulating TAG accumulation between two lupin species. A twofold increase in ACCase activity was observed in L. mutabilis relative to L. angustifolius and correlated with rapid TAG accumulation. No difference in DAGAT activity was detected. We have identified, cloned and partially characterised a novel gene differentially expressed during TAG accumulation between L. angustifolius and L. mutabilis. The gene has some identity to the glucose dehydrogenase family previously described in barley and bacteria and the significance of its expression levels during seed development in relation to TAG accumulation is discussed. DNA sequence analysis of the promoter in both L. angustifolius and L. mutabilis identified putative matrix attachment regions and recognition sequences for transcription binding sites similar to those found in the Adh1 gene from Arabidopsis. The identical promoter regions between species indicate that differential gene expression is controlled by alternative transcription factors, accessibility to binding sites or a combination of both.

The 2.1-kb inverted repeat DNA sequences flank the mat2,3 silent region in two species of Schizosaccharomyces and are involved in epigenetic silencing in Schizosaccharomyces pombe.

PubMed Central

Singh, Gurjeet; Klar, Amar J S

2002-01-01

The mat2,3 region of the fission yeast Schizosaccharomyces pombe exhibits a phenomenon of transcriptional silencing. This region is flanked by two identical DNA sequence elements, 2.1 kb in length, present in inverted orientation: IRL on the left and IRR on the right of the silent region. The repeats do not encode any ORF. The inverted repeat DNA region is also present in a newly identified related species, which we named S. kambucha. Interestingly, the left and right repeats share perfect identity within a species, but show approximately 2% bases interspecies variation. Deletion of IRL results in variegated expression of markers inserted in the silent region, while deletion of the IRR causes their derepression. When deletions of these repeats were genetically combined with mutations in different trans-acting genes previously shown to cause a partial defect in silencing, only mutations in clr1 and clr3 showed additive defects in silencing with the deletion of IRL. The rate of mat1 switching is also affected by deletion of repeats. The IRL or IRR deletion did not cause significant derepression of the mat2 or mat3 loci. These results implicate repeats for maintaining full repression of the mat2,3 region, for efficient mat1 switching, and further support the notion that multiple pathways cooperate to silence the mat2,3 domain. PMID:12399374

Vig r 6, the cytokinin-specific binding protein from mung bean (Vigna radiata) sprouts, cross-reacts with Bet v 1-related allergens and binds IgE from birch pollen allergic patients’ sera

PubMed Central

Guhsl, Eva Elisabeth; Hofstetter, Gerlinde; Hemmer, Wolfgang; Ebner, Christof; Vieths, Stefan; Vogel, Lothar; Breiteneder, Heimo; Radauer, Christian

2014-01-01

Scope Birch pollen associated allergy to mung bean sprouts is caused by cross-reactivity between the birch pollen allergen Bet v 1 and the mung bean allergen Vig r 1. We aimed to determine the allergenicity of the cytokinin-specific binding protein from mung bean (Vig r 6), another allergen related to Bet v 1 with only 31% sequence identity. Methods and results Bet v 1, Gly m 4, Vig r 1, and Vig r 6 were produced in Escherichia coli. In an ELISA, 73 and 32% of Bet v 1-sensitized birch-allergic patients’ sera (n = 60) showed IgE binding to Vig r 1 and Vig r 6, respectively. Of 19 patients who reported allergic reactions or had positive prick-to-prick tests to mung bean sprouts, 79% showed IgE binding to Vig r 1 and 63% showed IgE binding to Vig r 6. Bet v 1 completely inhibited IgE binding to both mung bean allergens. Vig r 6 showed partial cross-reactivity with Vig r 1 and activated basophils sensitized with mung bean allergic patients’ sera. Conclusion We demonstrated IgE cross-reactivity despite low sequence identity between Vig r 6 and other Bet v 1-related allergens. Thus, IgE binding to Vig r 6 may contribute to birch pollinosis-associated mung bean sprout allergy. PMID:23996905

Sequence Analysis and Initial Characterization of Two Isozymes of Hydroxylaminobenzene Mutase from Pseudomonas pseudoalcaligenes JS45

PubMed Central

Davis, John K.; Paoli, George C.; He, Zhongqi; Nadeau, Lloyd J.; Somerville, Charles C.; Spain, Jim C.

2000-01-01

Pseudomonas pseudoalcaligenes JS45 grows on nitrobenzene by a partially reductive pathway in which the intermediate hydroxylaminobenzene is enzymatically rearranged to 2-aminophenol by hydroxylaminobenzene mutase (HAB mutase). The properties of the enzyme, the reaction mechanism, and the evolutionary origin of the gene(s) encoding the enzyme are unknown. In this study, two open reading frames (habA and habB), each encoding an HAB mutase enzyme, were cloned from a P. pseudoalcaligenes JS45 genomic library and sequenced. The open reading frames encoding HabA and HabB are separated by 2.5 kb and are divergently transcribed. The deduced amino acid sequences of HabA and HabB are 44% identical. The HAB mutase specific activities in crude extracts of Escherichia coli clones synthesizing either HabA or HabB were similar to the specific activities of extracts of strain JS45 grown on nitrobenzene. HAB mutase activity in E. coli extracts containing HabB withstood heating at 85°C for 10 min, but extracts containing HabA were inactivated when they were heated at temperatures above 60°C. HAB mutase activity in extracts of P. pseudoalcaligenes JS45 grown on nitrobenzene exhibited intermediate temperature stability. Although both the habA gene and the habB gene conferred HAB mutase activity when they were separately cloned and expressed in E. coli, reverse transcriptase PCR analysis indicated that only habA is transcribed in P. pseudoalcaligenes JS45. A mutant strain derived from strain JS45 in which the habA gene was disrupted was unable to grow on nitrobenzene, which provided physiological evidence that HabA is involved in the degradation of nitrobenzene. A strain in which habB was disrupted grew on nitrobenzene. Gene Rv3078 of Mycobacterium tuberculosis H37Rv encodes a protein whose deduced amino acid sequence is 52% identical to the HabB amino acid sequence. E. coli containing M. tuberculosis gene Rv3078 cloned into pUC18 exhibited low levels of HAB mutase activity. Sequences that exhibit similarity to transposable element sequences are present between habA and habB, as well as downstream of habB, which suggests that horizontal gene transfer resulted in acquisition of one or both of the hab genes. PMID:10877793

Institutional Identity and Self-Esteem among African American Males in College

ERIC Educational Resources Information Center

Thomas, Dominique L.; Smith, Chauncey D.; Marks, Bryant T.; Crosby, Brandon

2012-01-01

Social identity theory maintains that one's self-concept is partially determined by the social groups to which the individual belongs. Using this as a theoretical framework, this study examined the relationship between multiple dimensions of institutional identity and self-esteem in 411 Black male college freshmen. It was hypothesized that…

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these oth...

Characterization of acid-tolerant H/CO-utilizing methanogenic enrichment cultures from an acidic peat bog in New York State.

PubMed

Bräuer, Suzanna L; Yashiro, Erika; Ueno, Norikiyo G; Yavitt, Joseph B; Zinder, Stephen H

2006-08-01

Two methanogenic cultures were enriched from acidic peat soil using a growth medium buffered to c. pH 5. One culture, 6A, was obtained from peat after incubation with H(2)/CO(2), whereas culture NTA was derived from a 10(-4) dilution of untreated peat into a modified medium. 16S rRNA gene clone libraries from each culture contained one methanogen and two bacterial sequences. The methanogen 16S rRNA gene sequences were 99% identical with each other and belonged to the novel "R-10/Fen cluster" family of the Methanomicrobiales, whereas their mcrA sequences were 96% identical. One bacterial 16S rRNA gene sequence from culture 6A belonged to the Bacteroidetes and showed 99% identity with sequences from methanogenic enrichments from German and Russian bogs. The other sequence belonged to the Firmicutes and was identical to a thick rod-shaped citrate-utilizing organism isolated from culture 6A, the numbers of which decreased when the Ti (III) chelator was switched from citrate to nitrilotriacetate. Bacterial clones from the NTA culture clustered in the Delta- and Betaproteobacteria. Both cultures contained thin rods, presumably the methanogens, as the predominant morphotype, and represent a significant advance in characterization of the novel acidiphilic R-10 family methanogens.

Unique and redundant functional domains of APETALA1 and CAULIFLOWER, two recently duplicated Arabidopsis thaliana floral MADS-box genes.

PubMed

Alvarez-Buylla, Elena R; García-Ponce, Berenice; Garay-Arroyo, Adriana

2006-01-01

APETALA1 (AP1) and CAULIFLOWER (CAL) are closely related MADS box genes that are partially redundant during Arabidopsis thaliana floral meristem determination. AP1 is able to fully substitute for CAL functions, but not vice versa, and AP1 has unique sepal and petal identity specification functions. In this study, the unique and redundant functions of these two genes has been mapped to the four protein domains that characterize type-II MADS-domain proteins by expressing all 15 chimeric combinations of AP1 and CAL cDNA regions under control of the AP1 promoter in ap1-1 loss-of-function plants. The "in vivo" function of these chimeric genes was analysed in Arabidopsis plants by expressing the chimeras. Rescue of flower meristem and sepal/petal identities was scored in single and multiple insert homozygous transgenic lines. Using these chimeric lines, it was found that distinct residues of the AP1 K domain not shared by the same CAL domain are necessary and sufficient for complete recovery of floral meristem identity, in the context of the CAL protein sequence, while both AP1 COOH and K domains are indispensable for complete rescue of sepal identity. By contrast, either one of these two AP1 domains is necessary and sufficient for complete petal identity recovery. It was also found that there were positive and negative synergies among protein domains and their combinations, and that multiple-insert lines showed relatively better rescue than equivalent single-insert lines. Finally, several lines had flowers with extra sepals and petals suggesting that chimeric proteins yield abnormal transcriptional complexes that may alter the expression or regulation of genes that control floral organ number under normal conditions.

Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.

PubMed

Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly

2016-11-01

Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

Remarkable sequence conservation of the last intron in the PKD1 gene.

PubMed

Rodova, Marianna; Islam, M Rafiq; Peterson, Kenneth R; Calvet, James P

2003-10-01

The last intron of the PKD1 gene (intron 45) was found to have exceptionally high sequence conservation across four mammalian species: human, mouse, rat, and dog. This conservation did not extend to the comparable intron in pufferfish. Pairwise comparisons for intron 45 showed 91% identity (human vs. dog) to 100% identity (mouse vs. rat) for an average for all four species of 94% identity. In contrast, introns 43 and 44 of the PKD1 gene had average pairwise identities of 57% and 54%, and exons 43, 44, and 45 and the coding region of exon 46 had average pairwise identities of 80%, 84%, 82%, and 80%. Intron 45 is 90 to 95 bp in length, with the major region of sequence divergence being in a central 4-bp to 9-bp variable region. RNA secondary structure analysis of intron 45 predicts a branching stem-loop structure in which the central variable region lies in one loop and the putative branch point sequence lies in another loop, suggesting that the intron adopts a specific stem-loop structure that may be important for its removal. Although intron 45 appears to conform to the class of small, G-triplet-containing introns that are spliced by a mechanism utilizing intron definition, its high sequence conservation may be a reflection of constraints imposed by a unique mechanism that coordinates splicing of this last PKD1 intron with polyadenylation.

tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.

PubMed

Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi

2014-01-01

The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

Anticancer property of sediment actinomycetes against MCF-7 and MDA-MB-231 cell lines.

PubMed

Ravikumar, S; Fredimoses, M; Gnanadesigan, M

2012-02-01

To investigate the anticancer property of marine sediment actinomycetes against two different breast cancer cell lines. In vitro anticancer activity was carried out against breast (MCF-7 and MDA-MB-231) cancer cell lines. Partial sequences of the 16s rRNA gene, phylogenetic tree construction, multiple sequence analysis and secondary structure analysis were also carried out with the actinomycetes isolates. Of the selected five actinomycete isolates, ACT01 and ACT02 showed the IC50 value with (10.13±0.92) and (22.34±5.82) µg/mL concentrations, respectively for MCF-7 cell line at 48 h, but ACT01 showed the minimum (18.54±2.49 µg/mL) level of IC50 value with MDA-MB-231 cell line. Further, the 16s rRNA partial sequences of ACT01, ACT02, ACT03, ACT04 and ACT05 isolates were also deposited in NCBI data bank with the accession numbers of GQ478246, GQ478247, GQ478248, GQ478249 and GQ478250, respectively. The phylogenetic tree analysis showed that, the isolates of ACT02 and ACT03 were represented in group I and III, respectively, but ACT01 and ACT02 were represented in group II. The multiple sequence alignment of the actinomycete isolates showed that, the maximum identical conserved regions were identified with the nucleotide regions of 125 to 221st base pairs, 65 to 119th base pairs and 55, 48 and 31st base pairs. Secondary structure prediction of the 16s rRNA showed that, the maximum free energy was consumed with ACT03 isolate (-45.4 kkal/mol) and the minimum free energy was consumed with ACT04 isolate (-57.6 kkal/mol). The actinomycete isolates of ACT01 and ACT02 (GQ478246 and GQ478247) which are isolated from sediment sample can be further used as anticancer agents against breast cancer cell lines.

Identification and phylogenetic relationship of Iranian strains of various Leishmania species isolated from cutaneous and visceral cases of leishmaniasis based on N-acetylglucosamine-1-phosphate transferase gene.

PubMed

Hajjaran, Homa; Mohebali, Mehdi; Teimouri, Aref; Oshaghi, Mohammad Ali; Mirjalali, Hamed; Kazemi-Rad, Elham; Shiee, Mohammad Reza; Naddaf, Saied Reza

2014-08-01

The identity of Iranian Leishmania species has been resolved to some extent by some genetic markers. In this study, based on N-acetylglucosamine-1-phosphate transferase (nagt) gene, we further elucidated the identity and phylogeny of the prevalent species in this country. DNAs of 121 isolates belonging to cutaneous leishmaniasis (CL) patients, canine visceral leishmaniasis (CVL) cases, and Rhombomys opimus rodents were amplified by targeting a partial sequence of nagt gene. All the amplicons were analyzed with restriction fragment length polymorphism (RFLP) using Acc1 enzyme, and 49 amplicons representing different reservoir hosts were sequenced and aligned with similar sequences from GenBank database. The RFLP analysis revealed that 41 CL patients were infected Leishmania tropica and 36 with Leishmania major. Among 10 CVL isolates, 6 were identified as Leishmania infantum and 4 as L. tropica. Amongst 34 rodents' isolates, 11 and 23 isolates exhibited patterns similar to those of L. major, and L. tropica/Leishmania turanica, respectively. The sequencing results from all CL patients, CVL cases, and 4 reservoir rodents were in agreement with RFLP analysis and showed 99-100% homologies with the registered species of L. major, L. tropica, and L. infantum from Turkey, Tunisia, Iraq and Israel. Of the 7 rodent isolates exhibiting RFLP patterns similar to L. tropica/L. turanica, 3 exhibited the highest homologies (99-100%) with L. turanica and 4 with Leishmania gerbilli. The 49 nagt DNA sequences were grouped into five clusters representing L. major, L. tropica, L. infantum, L. turanica and L. gerbilli species, encompassing 19 haplotypes. No correlation was observed between intraspecies divergence and geographic distribution of haplotypes. The L. tropica haplotypes exhibited more homologies with those of L. infantum than L. major (97.2% vs. 96.9%), a probable indication to the potential ability of L. tropica to visceralize. Characterization of Iranian Leishmania isolates using nagt gene allowed unambiguous identification of five prevalent species with a high-resolution phylogeny. Copyright © 2014 Elsevier B.V. All rights reserved.

Brucella papionis sp. nov., isolated from baboons (Papio spp.)

PubMed Central

Davison, Nicholas; Cloeckaert, Axel; Al Dahouk, Sascha; Zygmunt, Michel S.; Brew, Simon D.; Perrett, Lorraine L.; Koylass, Mark S.; Vergnaud, Gilles; Quance, Christine; Scholz, Holger C.; Dick, Edward J.; Hubbard, Gene; Schlabritz-Loutsevitch, Natalia E.

2014-01-01

Two Gram-negative, non-motile, non-spore-forming coccoid bacteria (strains F8/08-60T and F8/08-61) isolated from clinical specimens obtained from baboons (Papio spp.) that had delivered stillborn offspring were subjected to a polyphasic taxonomic study. On the basis of 16S rRNA gene sequence similarities, both strains, which possessed identical sequences, were assigned to the genus Brucella. This placement was confirmed by extended multilocus sequence analysis (MLSA), where both strains possessed identical sequences, and whole-genome sequencing of a representative isolate. All of the above analyses suggested that the two strains represent a novel lineage within the genus Brucella. The strains also possessed a unique profile when subjected to the phenotyping approach classically used to separate species of the genus Brucella, reacting only with Brucella A monospecific antiserum, being sensitive to the dyes thionin and fuchsin, being lysed by bacteriophage Wb, Bk2 and Fi phage at routine test dilution (RTD) but only partially sensitive to bacteriophage Tb, and with no requirement for CO2 and no production of H2S but strong urease activity. Biochemical profiling revealed a pattern of enzyme activity and metabolic capabilities distinct from existing species of the genus Brucella. Molecular analysis of the omp2 locus genes showed that both strains had a novel combination of two highly similar omp2b gene copies. The two strains shared a unique fingerprint profile of the multiple-copy Brucella-specific element IS711. Like MLSA, a multilocus variable number of tandem repeat analysis (MLVA) showed that the isolates clustered together very closely, but represent a distinct group within the genus Brucella. Isolates F8/08-60T and F8/08-61 could be distinguished clearly from all known species of the genus Brucellaand their biovars by both phenotypic and molecular properties. Therefore, by applying the species concept for the genus Brucellasuggested by the ICSP Subcommittee on the Taxonomy of Brucella, they represent a novel species within the genus Brucella, for which the name Brucella papionis sp. nov. is proposed, with the type strain F8/08-60T ( = NCTC 13660T = CIRMBP 0958T). PMID:25242540

Second-generation sequencing of entire mitochondrial coding-regions (∼15.4 kb) holds promise for study of the phylogeny and taxonomy of human body lice and head lice.

PubMed

Xiong, H; Campelo, D; Pollack, R J; Raoult, D; Shao, R; Alem, M; Ali, J; Bilcha, K; Barker, S C

2014-08-01

The Illumina Hiseq platform was used to sequence the entire mitochondrial coding-regions of 20 body lice, Pediculus humanus Linnaeus, and head lice, P. capitis De Geer (Phthiraptera: Pediculidae), from eight towns and cities in five countries: Ethiopia, France, China, Australia and the U.S.A. These data (∼310 kb) were used to see how much more informative entire mitochondrial coding-region sequences were than partial mitochondrial coding-region sequences, and thus to guide the design of future studies of the phylogeny, origin, evolution and taxonomy of body lice and head lice. Phylogenies were compared from entire coding-region sequences (∼15.4 kb), entire cox1 (∼1.5 kb), partial cox1 (∼700 bp) and partial cytb (∼600 bp) sequences. On the one hand, phylogenies from entire mitochondrial coding-region sequences (∼15.4 kb) were much more informative than phylogenies from entire cox1 sequences (∼1.5 kb) and partial gene sequences (∼600 to ∼700 bp). For example, 19 branches had > 95% bootstrap support in our maximum likelihood tree from the entire mitochondrial coding-regions (∼15.4 kb) whereas the tree from 700 bp cox1 had only two branches with bootstrap support > 95%. Yet, by contrast, partial cytb (∼600 bp) and partial cox1 (∼486 bp) sequences were sufficient to genotype lice to Clade A, B or C. The sequences of the mitochondrial genomes of the P. humanus, P. capitis and P. schaeffi Fahrenholz studied are in NCBI GenBank under the accession numbers KC660761-800, KC685631-6330, KC241882-97, EU219988-95, HM241895-8 and JX080388-407. © 2014 The Royal Entomological Society.

Molecular characterization of a distinct monopartite begomovirus associated with betasatellites and alphasatellites infecting Pisum sativum in Nepal.

PubMed

Shahid, M S; Pudashini, B J; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2017-04-01

Pea (Pisum sativum) plants exhibiting leaf distortion, yellowing, stunted growth and reduction in leaf size from Rampur, Nepal were shown to be infected by a begomovirus in association with betasatellites and alphasatellites. The begomovirus associated with the disease showed only low levels of nucleotide sequence identity (<91%) to previously characterized begomoviruses. This finding indicates that the pea samples were infected with an as yet undescribed begomovirus for which the name Pea leaf distortion virus (PLDV) is proposed. Two species of betasatellite were identified in association with PLDV. One group of sequences had high (>78%) nucleotide sequence identity to isolates of Ludwigia leaf distortion betasatellite (LuLDB), and the second group had less than 78% to all other betasatellite sequences. This showed PLDV to be associated with either LuLDB or a previously undescribed betasatellite for which the name Pea leaf distortion betasatellite is proposed. Two types of alphasatellites were identified in the PLDV-infected pea plants. The first type showed high levels of sequence identity to Ageratum yellow vein alphasatellite, and the second type showed high levels of identity to isolates of Sida yellow vein China alphasatellite. These are the first begomovirus, betasatellites and alphasatellites isolated from pea.

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Phylogenetic Analysis of Phenotypically Characterized Cryptococcus laurentii Isolates Reveals High Frequency of Cryptic Species

PubMed Central

Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J.; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

2014-01-01

Background Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. Methods In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. Results BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99–100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Conclusions Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode. PMID:25251413

Cluster synchronization in networks of identical oscillators with α-function pulse coupling.

PubMed

Chen, Bolun; Engelbrecht, Jan R; Mirollo, Renato

2017-02-01

We study a network of N identical leaky integrate-and-fire model neurons coupled by α-function pulses, weighted by a coupling parameter K. Studies of the dynamics of this system have mostly focused on the stability of the fully synchronized and the fully asynchronous splay states, which naturally depends on the sign of K, i.e., excitation vs inhibition. We find that there is also a rich set of attractors consisting of clusters of fully synchronized oscillators, such as fixed (N-1,1) states, which have synchronized clusters of sizes N-1 and 1, as well as splay states of clusters with equal sizes greater than 1. Additionally, we find limit cycles that clarify the stability of previously observed quasiperiodic behavior. Our framework exploits the neutrality of the dynamics for K=0 which allows us to implement a dimensional reduction strategy that simplifies the dynamics to a continuous flow on a codimension 3 subspace with the sign of K determining the flow direction. This reduction framework naturally incorporates a hierarchy of partially synchronized subspaces in which the new attracting states lie. Using high-precision numerical simulations, we describe completely the sequence of bifurcations and the stability of all fixed points and limit cycles for N=2-4. The set of possible attracting states can be used to distinguish different classes of neuron models. For instance from our previous work [Chaos 24, 013114 (2014)CHAOEH1054-150010.1063/1.4858458] we know that of the types of partially synchronized states discussed here, only the (N-1,1) states can be stable in systems of identical coupled sinusoidal (i.e., Kuramoto type) oscillators, such as θ-neuron models. Upon introducing a small variation in individual neuron parameters, the attracting fixed points we discuss here generalize to equivalent fixed points in which neurons need not fire coincidently.

Cluster synchronization in networks of identical oscillators with α -function pulse coupling

NASA Astrophysics Data System (ADS)

Chen, Bolun; Engelbrecht, Jan R.; Mirollo, Renato

2017-02-01

We study a network of N identical leaky integrate-and-fire model neurons coupled by α -function pulses, weighted by a coupling parameter K . Studies of the dynamics of this system have mostly focused on the stability of the fully synchronized and the fully asynchronous splay states, which naturally depends on the sign of K , i.e., excitation vs inhibition. We find that there is also a rich set of attractors consisting of clusters of fully synchronized oscillators, such as fixed (N -1 ,1 ) states, which have synchronized clusters of sizes N -1 and 1, as well as splay states of clusters with equal sizes greater than 1. Additionally, we find limit cycles that clarify the stability of previously observed quasiperiodic behavior. Our framework exploits the neutrality of the dynamics for K =0 which allows us to implement a dimensional reduction strategy that simplifies the dynamics to a continuous flow on a codimension 3 subspace with the sign of K determining the flow direction. This reduction framework naturally incorporates a hierarchy of partially synchronized subspaces in which the new attracting states lie. Using high-precision numerical simulations, we describe completely the sequence of bifurcations and the stability of all fixed points and limit cycles for N =2 -4 . The set of possible attracting states can be used to distinguish different classes of neuron models. For instance from our previous work [Chaos 24, 013114 (2014), 10.1063/1.4858458] we know that of the types of partially synchronized states discussed here, only the (N -1 ,1 ) states can be stable in systems of identical coupled sinusoidal (i.e., Kuramoto type) oscillators, such as θ -neuron models. Upon introducing a small variation in individual neuron parameters, the attracting fixed points we discuss here generalize to equivalent fixed points in which neurons need not fire coincidently.

Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

PubMed

Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

2013-11-01

Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.

Isolation and characterization of adrenoleukodystrophy protein (ALDP) related sequences in the human genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geraghty, M.T.; Stetten, G.; Kearns, W.

1994-09-01

X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less

Tomato bushy stunt virus (TBSV) infecting Lycopersicon esculentum.

PubMed

Hafez, El Sayed E; Saber, Ghada A; Fattouh, Faiza A

2010-01-01

Tomato bushy stunt virus (TBSV) was detected in tomato crop (Lycopersicon esculentum) in Egypt with characteristic mosaic leaf deformation, stunting, and bushy growth symptoms. TBSV infection was confirmed serologically by ELISA and calculated incidence was 25.5%. Basic physicochemical properties of a purified TBSV Egh isolate were identical to known properties of tombusviruses of isometric 30-nm diameter particles, 41-kDa coat protein and the genome of approximately 4800 nt. This is the first TBSV isolate reported in Egypt. Cloning and partial sequencing of the isolate showed that it is more closely related to TBSV-P and TBSV-Ch than TBSV-Nf and TBSV-S strains of the virus. However, it is distinct from the above strains and could be a new strain of the virus which further confirms the genetic diversity of tombusviruses.

RECOVIR Software for Identifying Viruses

NASA Technical Reports Server (NTRS)

Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

2013-01-01

Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

Identification of Clinical Isolates of Actinomyces Species by Amplified 16S Ribosomal DNA Restriction Analysis

PubMed Central

Hall, Val; Talbot, P. R.; Stubbs, S. L.; Duerden, B. I.

2001-01-01

Amplified 16S ribosomal DNA (rDNA) restriction analysis (ARDRA), using enzymes HaeIII and HpaII, was applied to 176 fresh and 299 stored clinical isolates of putative Actinomyces spp. referred to the Anaerobe Reference Unit of the Public Health Laboratory Service for confirmation of identity. Results were compared with ARDRA results obtained previously for reference strains and with conventional phenotypic reactions. Identities of some strains were confirmed by analysis of partial 16S rDNA sequences. Of the 475 isolates, 331 (70%) were clearly assigned to recognized Actinomyces species, including 94 isolates assigned to six recently described species. A further 52 isolates in 12 ARDRA profiles were designated as apparently resembling recognized species, and 44 isolates, in 18 novel profiles, were confirmed as members of genera other than Actinomyces. The identities of 48 isolates in nine profiles remain uncertain, and they may represent novel species of Actinomyces. For the majority of species, phenotypic results, published reactions for the species, and ARDRA profiles concurred. However, of 113 stored isolates originally identified as A. meyeri or resembling A. meyeri by phenotypic tests, only 21 were confirmed as A. meyeri by ARDRA; 63 were reassigned as A. turicensis, 7 as other recognized species, and 22 as unidentified actinomycetes. Analyses of incidence and clinical associations of Actinomyces spp. add to the currently sparse knowledge of some recently described species. PMID:11574572

Communities of arbuscular mycorrhizal fungi in Pyrus pyrifolia var. culta (Japanese pear) and an understory herbaceous plant Plantago asiatica.

PubMed

Yoshimura, Yuko; Ido, Akifumi; Matsumoto, Teruyuki; Yamato, Masahide

2013-01-01

We investigated communities of arbuscular mycorrhizal fungi (AMF) in the fine roots of Pyrus pyrifolia var. culta, and Plantago asiatica to consider the relationship between orchard trees and herbaceous plants in AMF symbioses. The AMF communities were analyzed on the basis of the partial fungal DNA sequences of the nuclear small subunit ribosomal RNA gene (SSU rDNA), which were amplified using the AMF-specific primers AML1 and AML2. Phylogenetic analysis showed that the obtained AMF sequences were divided into 23 phylotypes. Among them, 12 phylotypes included AMF from both host plants, and most of the obtained sequences (689/811) were affiliated to them. Canonical correspondence analysis showed that the host plant species did not have a significant effect on the distribution of AMF phylotypes, whereas the effects of sampling site, soil total C, soil total N and soil-available P were significant. It was also found that the mean observed overlaps of AMF phylotypes between the paired host plants in the same soil cores (27.1% of phylotypes shared) were significantly higher than the mean 1,000 simulated overlaps (14.2%). Furthermore, the same AMF sequences (100% sequence identity) were detected from both host plants in 8/12 soil cores having both roots. Accordingly, we concluded that Py. pyrifolia and Pl. asiatica examined shared some AMF communities, which suggested that understory herbaceous plants may function as AMF inoculum sources for orchard trees.

Communities of Arbuscular Mycorrhizal Fungi in Pyrus pyrifolia var. culta (Japanese pear) and an Understory Herbaceous Plant Plantago asiatica

PubMed Central

Yoshimura, Yuko; Ido, Akifumi; Matsumoto, Teruyuki; Yamato, Masahide

2013-01-01

We investigated communities of arbuscular mycorrhizal fungi (AMF) in the fine roots of Pyrus pyrifolia var. culta, and Plantago asiatica to consider the relationship between orchard trees and herbaceous plants in AMF symbioses. The AMF communities were analyzed on the basis of the partial fungal DNA sequences of the nuclear small subunit ribosomal RNA gene (SSU rDNA), which were amplified using the AMF-specific primers AML1 and AML2. Phylogenetic analysis showed that the obtained AMF sequences were divided into 23 phylotypes. Among them, 12 phylotypes included AMF from both host plants, and most of the obtained sequences (689/811) were affiliated to them. Canonical correspondence analysis showed that the host plant species did not have a significant effect on the distribution of AMF phylotypes, whereas the effects of sampling site, soil total C, soil total N and soil-available P were significant. It was also found that the mean observed overlaps of AMF phylotypes between the paired host plants in the same soil cores (27.1% of phylotypes shared) were significantly higher than the mean 1,000 simulated overlaps (14.2%). Furthermore, the same AMF sequences (100% sequence identity) were detected from both host plants in 8/12 soil cores having both roots. Accordingly, we concluded that Py. pyrifolia and Pl. asiatica examined shared some AMF communities, which suggested that understory herbaceous plants may function as AMF inoculum sources for orchard trees. PMID:23614902

Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

PubMed Central

Kyöstiö, S R; Cramer, C L; Lacy, G H

1991-01-01

The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

Homology of aspartyl- and lysyl-tRNA synthetases.

PubMed Central

Gampel, A; Tzagoloff, A

1989-01-01

The yeast nuclear gene MSD1 coding for mitochondrial aspartyl-tRNA synthetase has been cloned and sequenced. The identity of the gene is confirmed by the following evidence. (i) The primary structure of the protein derived from the gene sequence is similar to that of the yeast cytoplasmic aspartyl-tRNA synthetase. (ii) In situ disruption of MSD1 in a respiratory-competent haploid strain of yeast induces a pleiotropic phenotype consistent with a lesion in mitochondrial protein synthesis. (iii) Mitochondria from a mutant with a disrupted chromosomal copy of MSD1 are unable to acylate mitochondrial aspartyl-tRNA. The primary structures of the cytoplasmic and mitochondrial aspartyl-tRNA synthetases are similar to the yeast cytoplasmic lysyl-tRNA synthetase, suggesting that the two types of synthetases may have a common evolutionary origin. Searches of the current protein banks also have revealed a high degree of sequence similarity of the lysyl-tRNA synthetase to the product of the Escherichia coli herC gene and to the partial sequence of a protein encoded by an unidentified reading frame located adjacent to the E. coli frdA gene. Based on the sequence similarities and the map positions of the herC and frdA loci, we propose herC to be the structural gene of the constitutively expressed lysyl-tRNA synthetase of E. coli and the unidentified reading frame to be the structural gene of the heat-inducible lysyl-tRNA synthetase. Images PMID:2668951

Purification, characterization and molecular cloning of chymotrypsin inhibitor peptides from the venom of Burmese Daboia russelii siamensis.

PubMed

Guo, Chun-Teng; McClean, Stephen; Shaw, Chris; Rao, Ping-Fan; Ye, Ming-Yu; Bjourson, Anthony J

2013-05-01

One novel Kunitz BPTI-like peptide designated as BBPTI-1, with chymotrypsin inhibitory activity was identified from the venom of Burmese Daboia russelii siamensis. It was purified by three steps of chromatography including gel filtration, cation exchange and reversed phase. A partial N-terminal sequence of BBPTI-1, HDRPKFCYLPADPGECLAHMRSF was obtained by automated Edman degradation and a Ki value of 4.77nM determined. Cloning of BBPTI-1 including the open reading frame and 3' untranslated region was achieved from cDNA libraries derived from lyophilized venom using a 3' RACE strategy. In addition a cDNA sequence, designated as BBPTI-5, was also obtained. Alignment of cDNA sequences showed that BBPTI-5 exhibited an identical sequence to BBPTI-1 cDNA except for an eight nucleotide deletion in the open reading frame. Gene variations that represented deletions in the BBPTI-5 cDNA resulted in a novel protease inhibitor analog. Amino acid sequence alignment revealed that deduced peptides derived from cloning of their respective precursor cDNAs from libraries showed high similarity and homology with other Kunitz BPTI proteinase inhibitors. BBPTI-1 and BBPTI-5 consist of 60 and 66 amino acid residues respectively, including six conserved cysteine residues. As these peptides have been reported to have influence on the processes of coagulation, fibrinolysis and inflammation, their potential application in biomedical contexts warrants further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.

Issues of Motivation and Identity Positioning: Two Teachers' Motivational Practices for Engaging Immigrant Children in Learning Heritage Languages

ERIC Educational Resources Information Center

Kim, Jung-In

2017-01-01

This study investigates two Korean heritage language teachers' motivational practices in relation to their identity positioning as heritage language (HL) teachers. Constant-comparative analyses of teachers' interviews and classroom practices showed that the two teachers' identity positioning as HL teachers was partially shaped by their earlier…

Building a model: developing genomic resources for common milkweed (Asclepias syriaca) with low coverage genome sequencing

PubMed Central

2011-01-01

Background Milkweeds (Asclepias L.) have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L.) could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. Results A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp) and 5S rDNA (120 bp) sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp), with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae) unigenes (median coverage of 0.29×) and 66% of single copy orthologs (COSII) in asterids (median coverage of 0.14×). From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites) and phylogenetics (low-copy nuclear genes) studies were developed. Conclusions The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species and its relatives. This study represents a first step in the development of a community resource for further study of plant-insect co-evolution, anti-herbivore defense, floral developmental genetics, reproductive biology, chemical evolution, population genetics, and comparative genomics using milkweeds, and A. syriaca in particular, as ecological and evolutionary models. PMID:21542930

Building a model: developing genomic resources for common milkweed (Asclepias syriaca) with low coverage genome sequencing.

PubMed

Straub, Shannon C K; Fishbein, Mark; Livshultz, Tatyana; Foster, Zachary; Parks, Matthew; Weitemier, Kevin; Cronn, Richard C; Liston, Aaron

2011-05-04

Milkweeds (Asclepias L.) have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L.) could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp) and 5S rDNA (120 bp) sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp), with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae) unigenes (median coverage of 0.29×) and 66% of single copy orthologs (COSII) in asterids (median coverage of 0.14×). From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites) and phylogenetics (low-copy nuclear genes) studies were developed. The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species and its relatives. This study represents a first step in the development of a community resource for further study of plant-insect co-evolution, anti-herbivore defense, floral developmental genetics, reproductive biology, chemical evolution, population genetics, and comparative genomics using milkweeds, and A. syriaca in particular, as ecological and evolutionary models.

Relapsing fever causative agent in Southern Iran is a closely related species to East African borreliae.

PubMed

Naddaf, Saied Reza; Ghazinezhad, Behnaz; Kazemirad, Elham; Cutler, Sally Jane

2017-10-01

We obtained two blood samples from relapsing fever patients residing in Jask County, Hormozgan Province, southern Iran in 2013. Sequencing of a partial fragment of glpQ from two samples, and further characterization of one of them by analyzing flaB gene, and 16S-23S spacer (IGS) revealed the greatest sequence identity with East African borreliae, Borrelia recurrentis, and Borrelia duttonii, and Borrelia microti from Iran. Phylogenetic analyses of glpQ, flaB, and concatenated sequences (glpQ, flab, and IGS) clustered these sequences amongst East African Relapsing fever borreliae and B. microti from Iran. However, the more discriminatory IGS disclosed a unique 8-bp signature (CAGCCTAA) separating these from B. microti and indeed other relapsing fever borreliae. In southern Iran, relapsing fever cases are mostly from localities in which O. erraticus ticks, the notorious vector of B. microti, prevail. There are chances that this argasid tick serves as a host and vector of several closely related species or ecotypes including the one we identified in the present study. The distribution of this Borrelia species remains to be elucidated, but it is assumed to be endemic to lowland areas of the Hormozgan Province, as well as Sistan va Baluchistan in the southeast and South Khorasan (in Persian: Khorasan-e Jonobi) in the east of Iran. Copyright © 2017 Elsevier GmbH. All rights reserved.

The Microbial Genomes Atlas (MiGA) webserver: taxonomic and gene diversity analysis of Archaea and Bacteria at the whole genome level.

PubMed

Rodriguez-R, Luis M; Gunturu, Santosh; Harvey, William T; Rosselló-Mora, Ramon; Tiedje, James M; Cole, James R; Konstantinidis, Konstantinos T

2018-06-14

The small subunit ribosomal RNA gene (16S rRNA) has been successfully used to catalogue and study the diversity of prokaryotic species and communities but it offers limited resolution at the species and finer levels, and cannot represent the whole-genome diversity and fluidity. To overcome these limitations, we introduced the Microbial Genomes Atlas (MiGA), a webserver that allows the classification of an unknown query genomic sequence, complete or partial, against all taxonomically classified taxa with available genome sequences, as well as comparisons to other related genomes including uncultivated ones, based on the genome-aggregate Average Nucleotide and Amino Acid Identity (ANI/AAI) concepts. MiGA integrates best practices in sequence quality trimming and assembly and allows input to be raw reads or assemblies from isolate genomes, single-cell sequences, and metagenome-assembled genomes (MAGs). Further, MiGA can take as input hundreds of closely related genomes of the same or closely related species (a so-called 'Clade Project') to assess their gene content diversity and evolutionary relationships, and calculate important clade properties such as the pangenome and core gene sets. Therefore, MiGA is expected to facilitate a range of genome-based taxonomic and diversity studies, and quality assessment across environmental and clinical settings. MiGA is available at http://microbial-genomes.org/.

Detection of Low-Level Cardinium and Wolbachia Infections in Culicoides

PubMed Central

Mee, Peter T.; Weeks, Andrew R.; Walker, Peter J.; Hoffmann, Ary A.

2015-01-01

Bacterial endosymbionts have been identified as potentially useful biological control agents for a range of invertebrate vectors of disease. Previous studies of Culicoides (Diptera: Ceratopogonidae) species using conventional PCR assays have provided evidence of Wolbachia (1/33) and Cardinium (8/33) infections. Here, we screened 20 species of Culicoides for Wolbachia and Cardinium, utilizing a combination of conventional PCR and more sensitive quantitative PCR (qPCR) assays. Low levels of Cardinium DNA were detected in females of all but one of the Culicoides species screened, and low levels of Wolbachia were detected in females of 9 of the 20 Culicoides species. Sequence analysis based on partial 16S rRNA gene and gyrB sequences identified “Candidatus Cardinium hertigii” from group C, which has previously been identified in Culicoides from Japan, Israel, and the United Kingdom. Wolbachia strains detected in this study showed 98 to 99% sequence identity to Wolbachia previously detected from Culicoides based on the 16S rRNA gene, whereas a strain with a novel wsp sequence was identified in Culicoides narrabeenensis. Cardinium isolates grouped to geographical regions independent of the host Culicoides species, suggesting possible geographical barriers to Cardinium movement. Screening also identified Asaia bacteria in Culicoides. These findings point to a diversity of low-level endosymbiont infections in Culicoides, providing candidates for further characterization and highlighting the widespread occurrence of these endosymbionts in this insect group. PMID:26150447

Co-circulation of genetically distinct groups of avian paramyxovirus type 1 in pigeon Newcastle disease in Iran.

PubMed

Rezaei Far, A; Peighambari, S M; Pourbakhsh, S A; Ashtari, A; Soltani, M

2017-02-01

Pigeons are considered as one of the major natural reservoirs in the epidemiology of Newcastle disease (ND). In this study, the partial sequence of fusion protein gene of 17 pigeon-origin ND viruses (NDVs) isolated during 2012-2013 in Iran was analysed. Since the studied isolates showed F0 protein cleavage sites compatible with velogenic NDVs, all were considered as virulent NDVs. Two isolates carried 112RRQKRF117 as the cleavage site motif, whereas the rest demonstrated 112KRQKRF117 motif which just recently has been reported among Iranian virulent NDVs. Phylogenetic analysis divided all these diverse isolates in two distinct clusters within class II genotype VI. Based on the partial fusion protein gene sequence, 15 out of 17 isolates showed the highest genetic identity to subgenotype VIb/2 and the other two isolates were placed in a distinct genetic group of genotype VI. Based on recent findings, at least two different sublineages of genotype VI are causing the ND outbreaks in the pigeon population and are circulating simultaneously along with virulent NDVs of genotype VII in various species in Iran. The continuing circulation of a diverse group of virulent NDVs as an enzootic in widespread species such as pigeon can cause outbreaks in commercial poultry flocks and also failure in controlling programmes. Therefore, the constant monitoring and awareness of the virus characteristics should be considered in controlling programmes against ND in Iran.

Genetic characterization of Rhipicephalus sanguineus (sensu lato) ticks from dogs in Portugal.

PubMed

Dantas-Torres, Filipe; Maia, Carla; Latrofa, Maria Stefania; Annoscia, Giada; Cardoso, Luís; Otranto, Domenico

2017-03-13

The taxonomic status of the brown dog tick Rhipicephalus sanguineus (sensu stricto) is a subject of on-going debate; there is a consensus that populations of this tick species should be referred to as R. sanguineus (sensu lato) until its taxonomic status is resolved. Recent genetic studies revealed the existence of more than one lineage of R. sanguineus (s.l.) in temperate countries. In this study, we assessed the genetic identity of ticks collected from rural dogs living in several areas located in all major geographical regions of Portugal. A total of 347 ticks were collected from rural dogs living in different regions of Portugal. These ticks were morphologically identified and partial mitochondrial 16S rRNA gene sequences (~300 bp) were obtained from representative specimens. The ticks were morphologically identified as Ixodes ricinus (seven males and 27 females), Rhipicephalus bursa (one male), Rhipicephalus pusillus (one female) and R. sanguineus (s.l.) (two larvae, 101 nymphs, 108 males and 100 females). Partial mitochondrial 16S rRNA gene sequences were obtained from 58 R. sanguineus (s.l.) specimens, and all of them were genetically identified as belonging to the so-called temperate lineage of R. sanguineus (s.l.) CONCLUSIONS: These results strongly suggest that the temperate species of R. sanguineus (s.l.) is the only representative of this tick group found on dogs in Portugal. It also adds weight to the hypothesis that Rhipicephalus turanicus is not present in this country, although further investigations are necessary to confirm this.

Isolation and Expression Profile of the Ca2+-Activated Chloride Channel-like Membrane Protein 6 Gene in Xenopus laevis

PubMed Central

Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh

2011-01-01

To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170

A novel beta-glucosidase from the cell wall of maize (Zea mays L.): rapid purification and partial characterization

NASA Technical Reports Server (NTRS)

Nematollahi, W. P.; Roux, S. J.

1999-01-01

Plants have a variety of glycosidic conjugates of hormones, defense compounds, and other molecules that are hydrolyzed by beta-glucosidases (beta-D-glucoside glucohydrolases, E.C. 3.2.1.21). Workers have reported several beta-glucosidases from maize (Zea mays L.; Poaceae), but have localized them mostly by indirect means. We have purified and partly characterized a 58-Ku beta-glucosidase from maize, which we conclude from a partial sequence analysis, from kinetic data, and from its localization is not identical to any of those already reported. A monoclonal antibody, mWP 19, binds this enzyme, and localizes it in the cell walls of maize coleoptiles. An earlier report showed that mWP19 inhibits peroxidase activity in crude cell wall extracts and can immunoprecipitate peroxidase activity from these extracts, yet purified preparations of the 58 Ku protein had little or no peroxidase activity. The level of sequence similarity between beta-glucosidases and peroxidases makes it unlikely that these enzymes share epitopes in common. Contrary to a previous conclusion, these results suggest that the enzyme recognized by mWP19 is not a peroxidase, but there is a wall peroxidase closely associated with the 58 Ku beta-glucosidase in crude preparations. Other workers also have co-purified distinct proteins with beta-glucosidases. We found no significant charge in the level of immunodetectable beta-glucosidase in mesocotyls or coleoptiles that precedes the red light-induced changes in the growth rate of these tissues.

Novel Partial Reductive Pathway for 4-Chloronitrobenzene and Nitrobenzene Degradation in Comamonas sp. Strain CNB-1

PubMed Central

Wu, Jian-feng; Jiang, Cheng-ying; Wang, Bao-jun; Ma, Ying-fei; Liu, Zhi-pei; Liu, Shuang-jiang

2006-01-01

Comamonas sp. strain CNB-1 grows on 4-chloronitrobenzene (4-CNB) and nitrobenzene as sole carbon and nitrogen sources. In this study, two genetic segments, cnbB-orf2-cnbA and cnbR-orf1-cnbCaCbDEFGHI, located on a newly isolated plasmid, pCNB1 (ca. 89 kb), and involved in 4-CNB/nitrobenzene degradation, were characterized. Seven genes (cnbA, cnbB, cnbCa, cnbCb, cnbD, cnbG, and cnbH) were cloned and functionally expressed in recombinant Escherichia coli, and they were identified as encoding 4-CNB nitroreductase (CnbA), 1-hydroxylaminobenzene mutase (CnbB), 2-aminophenol 1,6-dioxygenase (CnbCab), 2-amino-5-chloromuconic semialdehyde dehydrogenase (CnbD), 2-hydroxy-5-chloromuconic acid (2H5CM) tautomerase, and 2-amino-5-chloromuconic acid (2A5CM) deaminase (CnbH). In particular, the 2A5CM deaminase showed significant identities (31 to 38%) to subunit A of Asp-tRNAAsn/Glu-tRNAGln amidotransferase and not to the previously identified deaminases for nitroaromatic compound degradation. Genetic cloning and expression of cnbH in Escherichia coli revealed that CnbH catalyzed the conversion of 2A5CM into 2H5CM and ammonium. Four other genes (cnbR, cnbE, cnbF, and cnbI) were tentatively identified according to their high sequence identities to other functionally identified genes. It was proposed that CnbH might represent a novel type of deaminase and be involved in a novel partial reductive pathway for chloronitrobenzene or nitrobenzene degradation. PMID:16517619

Implication of the cause of differences in 3D structures of proteins with high sequence identity based on analyses of amino acid sequences and 3D structures.

PubMed

Matsuoka, Masanari; Sugita, Masatake; Kikuchi, Takeshi

2014-09-18

Proteins that share a high sequence homology while exhibiting drastically different 3D structures are investigated in this study. Recently, artificial proteins related to the sequences of the GA and IgG binding GB domains of human serum albumin have been designed. These artificial proteins, referred to as GA and GB, share 98% amino acid sequence identity but exhibit different 3D structures, namely, a 3α bundle versus a 4β + α structure. Discriminating between their 3D structures based on their amino acid sequences is a very difficult problem. In the present work, in addition to using bioinformatics techniques, an analysis based on inter-residue average distance statistics is used to address this problem. It was hard to distinguish which structure a given sequence would take only with the results of ordinary analyses like BLAST and conservation analyses. However, in addition to these analyses, with the analysis based on the inter-residue average distance statistics and our sequence tendency analysis, we could infer which part would play an important role in its structural formation. The results suggest possible determinants of the different 3D structures for sequences with high sequence identity. The possibility of discriminating between the 3D structures based on the given sequences is also discussed.

Identification of a novel bovine enterovirus possessing highly divergent amino acid sequences in capsid protein.

PubMed

Tsuchiaka, Shinobu; Rahpaya, Sayed Samim; Otomaru, Konosuke; Aoki, Hiroshi; Kishimoto, Mai; Naoi, Yuki; Omatsu, Tsutomu; Sano, Kaori; Okazaki-Terashima, Sachiko; Katayama, Yukie; Oba, Mami; Nagai, Makoto; Mizutani, Tetsuya

2017-01-17

Bovine enterovirus (BEV) belongs to the species Enterovirus E or F, genus Enterovirus and family Picornaviridae. Although numerous studies have identified BEVs in the feces of cattle with diarrhea, the pathogenicity of BEVs remains unclear. Previously, we reported the detection of novel kobu-like virus in calf feces, by metagenomics analysis. In the present study, we identified a novel BEV in diarrheal feces collected for that survey. Complete genome sequences were determined by deep sequencing in feces. Secondary RNA structure analysis of the 5' untranslated region (UTR), phylogenetic tree construction and pairwise identity analysis were conducted. The complete genome sequences of BEV were genetically distant from other EVs and the VP1 coding region contained novel and unique amino acid sequences. We named this strain as BEV AN12/Bos taurus/JPN/2014 (referred to as BEV-AN12). According to genome analysis, the genome length of this virus is 7414 nucleotides excluding the poly (A) tail and its genome consists of a 5'UTR, open reading frame encoding a single polyprotein, and 3'UTR. The results of secondary RNA structure analysis showed that in the 5'UTR, BEV-AN12 had an additional clover leaf structure and small stem loop structure, similarly to other BEVs. In pairwise identity analysis, BEV-AN12 showed high amino acid (aa) identities to Enterovirus F in the polyprotein, P2 and P3 regions (aa identity ≥82.4%). Therefore, BEV-AN12 is closely related to Enterovirus F. However, aa sequences in the capsid protein regions, particularly the VP1 encoding region, showed significantly low aa identity to other viruses in genus Enterovirus (VP1 aa identity ≤58.6%). In addition, BEV-AN12 branched separately from Enterovirus E and F in phylogenetic trees based on the aa sequences of P1 and VP1, although it clustered with Enterovirus F in trees based on sequences in the P2 and P3 genome region. We identified novel BEV possessing highly divergent aa sequences in the VP1 coding region in Japan. According to species definition, we proposed naming this strain as "Enterovirus K", which is a novel species within genus Enterovirus. Further genomic studies are needed to understand the pathogenicity of BEVs.

Molecular identification of a new begomovirus infecting yellow passion fruit (Passiflora edulis) in Colombia.

PubMed

Vaca-Vaca, Juan Carlos; Carrasco-Lozano, Emerson Clovis; López-López, Karina

2017-02-01

The complete genome sequence of a bipartite begomovirus (genus Begomovirus, family Geminiviridae) infecting yellow passion fruit (Passiflora edulis) in the state of Valle del Cauca (Colombia) has been determined. The complete DNA-A and DNA-B components were determined to be 2600 and 2572 nt in length, respectively. The DNA-A showed the highest nucleotide sequence identity (87.2 %) to bean dwarf mosaic virus (M88179), a begomovirus found in common bean crops in Colombia, and only 77.4 % identity to passion fruit severe leaf distortion virus (FJ972767), a begomovirus identified infecting passion fruit in Brazil. Based on its sequence identity to all other begomoviruses known to date and in accordance with the ICTV species demarcation criterion for the genus Begomovirus (≥91 % sequence identity for the complete DNA-A), the name passion fruit leaf distortion virus is proposed for this new begomovirus. To our knowledge, this is the first report of a bipartite begomovirus affecting passion fruit in Colombia and the second report of a geminivirus affecting this crop worldwide.

Sequence identity and antigenic cross-reactivity of white face hornet venom allergen, also a hyaluronidase, with other proteins.

PubMed

Lu, G; Kochoumian, L; King, T P

1995-03-03

White face hornet (Dolichovespula maculata) venom has three known protein allergens which induce IgE response in susceptible people. They are antigen 5, phospholipase A1, and hyaluronidase, also known as Dol m 5, 1, and 2, respectively. We have cloned Dol m 2, a protein of 331 residues. When expressed in bacteria, a mixture of recombinant Dol m 2 and its fragments was obtained. The fragments were apparently generated by proteolysis of a Met-Met bond at residue 122, as they were not observed for a Dol m 2 mutant with a Leu-Met bond. Dol m 2 has 56% sequence identity with the honey bee venom allergen hyaluronidase and 27% identity with PH-20, a human sperm protein with hyaluronidase activity. A common feature of hornet venom allergens is their sequence identity with other proteins in our environment. We showed previously the sequence identity of Dol m 5 with a plant protein and a mammalian testis protein and of Dol m 1 with mammalian lipases. In BALB/c mice, Dol m 2 and bee hyaluronidase showed cross-reactivity at both antibody and T cell levels. These findings are relevant to some patients' multiple sensitivity to hornet and bee stings.

Optimization of identity operation in NMR spectroscopy via genetic algorithm: Application to the TEDOR experiment

NASA Astrophysics Data System (ADS)

Manu, V. S.; Veglia, Gianluigi

2016-12-01

Identity operation in the form of π pulses is widely used in NMR spectroscopy. For an isolated single spin system, a sequence of even number of π pulses performs an identity operation, leaving the spin state essentially unaltered. For multi-spin systems, trains of π pulses with appropriate phases and time delays modulate the spin Hamiltonian to perform operations such as decoupling and recoupling. However, experimental imperfections often jeopardize the outcome, leading to severe losses in sensitivity. Here, we demonstrate that a newly designed Genetic Algorithm (GA) is able to optimize a train of π pulses, resulting in a robust identity operation. As proof-of-concept, we optimized the recoupling sequence in the transferred-echo double-resonance (TEDOR) pulse sequence, a key experiment in biological magic angle spinning (MAS) solid-state NMR for measuring multiple carbon-nitrogen distances. The GA modified TEDOR (GMO-TEDOR) experiment with improved recoupling efficiency results in a net gain of sensitivity up to 28% as tested on a uniformly 13C, 15N labeled microcrystalline ubiquitin sample. The robust identity operation achieved via GA paves the way for the optimization of several other pulse sequences used for both solid- and liquid-state NMR used for decoupling, recoupling, and relaxation experiments.

Detection and molecular characterization of feline hemoplasmas in wild felid species in Iran in the Middle East.

PubMed

Ghazisaeedi, Fereshteh; Atyabi, Nahid; Zahraei Salehi, Taghi; Tabatabaei, Saeid; Ashrafi Tamai, Iraj; Memarian, Iman; Tasker, Séverine

2017-10-01

Three feline hemoplasma species exist in felids: Mycoplasma haemofelis, 'Candidatus Mycoplasma haemominutum', and 'Candidatus Mycoplasma turicensis'. The aims of the study were to determine the presence of, and molecularly characterize, any hemoplasmas in wild felids, including the endangered Persian leopard in Iran, the Middle East. Blood samples were collected from 19 wild felids, including three Persian leopards. Using species-specific hemoplasma PCRs and ELISA serological testing for feline leukaemia virus and feline immunodeficiency virus (FIV), two Persian leopards were found to be infected with 'Ca. M. haemominutum' and were seropositive for FIV. Partial 16S rRNA gene sequences were generated for these 'Ca. M. haemominutum' species and subsequent phylogenetic analysis revealed 97.70% to 99.45% sequence identity with those found in domestic cats from Iran and other countries. This study confirms the presence of 'Ca. M. haemominutum' and concurrent FIV antibody in wild felids in Iran. This represents the first report of hemoplasma in wild felids in the Middle East as well as the first report of infection in Persian leopards. Copyright © 2017 Elsevier Ltd. All rights reserved.

Simian hepatitis A virus derived from a captive rhesus monkey in India is similar to the strain isolated from wild African green monkeys in Kenya.

PubMed

Arankalle, V A; Ramakrishnan, J

2009-03-01

A simian hepatitis A virus (HAV) was identified retrospectively in a faecal sample from a rhesus monkey in India, inoculated in 1995 with a faecal suspension from a suspected patient of non-A to E hepatitis. The monkey was in captivity for 2 years in one of the experimental primate facilities in western India before being moved to the National Institute of Virology, Pune for experimentation. Phylogenetic analysis based on a partial sequence of the 5' noncoding region placed this virus in genotype V, the only other member being the AGM-27 strain recovered in 1986 from African green monkeys in Kenya. The source of infection of the monkey remains unclear. The full genome was amplified in nine fragments and sequenced. The genome of the Indian simian HAV (IND-SHAV) is 7425 nucleotides long including the poly-A tail of 14 nucleotides at the 3' end. At the nucleotide and amino acid levels, IND-SHAV was 99.8 and 100% identical with AGM27, respectively.

Functional expression of an ajmaline pathway-specific esterase from Rauvolfia in a novel plant-virus expression system.

PubMed

Ruppert, Martin; Woll, Jörn; Giritch, Anatoli; Genady, Ezzat; Ma, Xueyan; Stöckigt, Joachim

2005-11-01

Acetylajmalan esterase (AAE) plays an essential role in the late stage of ajmaline biosynthesis. Based on the partial peptide sequences of AAE isolated and purified from Rauvolfia cell suspensions, a full-length AAE cDNA clone was isolated. The amino acid sequence of AAE has the highest level of identity of 40% to putative lipases known from the Arabidopsis thaliana genome project. Based on the primary structure AAE is a new member of the GDSL lipase superfamily. The expression in Escherichia coli failed although a wide range of conditions were tested. With a novel virus-based plant expression system, it was possible to express AAE functionally in leaves of Nicotiana benthamiana Domin. An extraordinarily high enzyme activity was detected in the Nicotiana tissue, which exceeded that in Rauvolfia serpentina (L.) Benth. ex Kurz cell suspension cultures about 20-fold. This expression allowed molecular analysis of AAE for the first time and increased the number of functionally expressed alkaloid genes from Rauvolfia now to eight, and the number of ajmaline pathway-specific cDNAs to a total of six.

Reassortant group A rotavirus from straw-colored fruit bat (Eidolon helvum).

PubMed

Esona, Mathew D; Mijatovic-Rustempasic, Slavica; Conrardy, Christina; Tong, Suxiang; Kuzmin, Ivan V; Agwanda, Bernard; Breiman, Robert F; Banyai, Krisztian; Niezgoda, Michael; Rupprecht, Charles E; Gentsch, Jon R; Bowen, Michael D

2010-12-01

Bats are known reservoirs of viral zoonoses. We report genetic characterization of a bat rotavirus (Bat/KE4852/07) detected in the feces of a straw-colored fruit bat (Eidolon helvum). Six bat rotavirus genes (viral protein [VP] 2, VP6, VP7, nonstructural protein [NSP] 2, NSP3, and NSP5) shared ancestry with other mammalian rotaviruses but were distantly related. The VP4 gene was nearly identical to that of human P[6] rotavirus strains, and the NSP4 gene was closely related to those of previously described mammalian rotaviruses, including human strains. Analysis of partial sequence of the VP1 gene indicated that it was distinct from cognate genes of other rotaviruses. No sequences were obtained for the VP3 and NSP1 genes of the bat rotavirus. This rotavirus was designated G25-P[6]-I15-R8(provisional)-C8-Mx-Ax-N8-T11-E2-H10. Results suggest that several reassortment events have occurred between human, animal, and bat rotaviruses. Several additional rotavirus strains were detected in bats.

Reassortant Group A Rotavirus from Straw-colored Fruit Bat (Eidolon helvum)

PubMed Central

Esona, Mathew D.; Mijatovic-Rustempasic, Slavica; Conrardy, Christina; Tong, Suxiang; Kuzmin, Ivan V.; Agwanda, Bernard; Breiman, Robert F.; Banyai, Krisztian; Niezgoda, Michael; Rupprecht, Charles E.; Gentsch, Jon R.

2010-01-01

Bats are known reservoirs of viral zoonoses. We report genetic characterization of a bat rotavirus (Bat/KE4852/07) detected in the feces of a straw-colored fruit bat (Eidolon helvum). Six bat rotavirus genes (viral protein [VP] 2, VP6, VP7, nonstructural protein [NSP] 2, NSP3, and NSP5) shared ancestry with other mammalian rotaviruses but were distantly related. The VP4 gene was nearly identical to that of human P[6] rotavirus strains, and the NSP4 gene was closely related to those of previously described mammalian rotaviruses, including human strains. Analysis of partial sequence of the VP1 gene indicated that it was distinct from cognate genes of other rotaviruses. No sequences were obtained for the VP3 and NSP1 genes of the bat rotavirus. This rotavirus was designated G25-P[6]-I15-R8(provisional)-C8-Mx-Ax-N8-T11-E2-H10. Results suggest that several reassortment events have occurred between human, animal, and bat rotaviruses. Several additional rotavirus strains were detected in bats. PMID:21122212

Functional and genetic screening of acute myeloid leukemia associated with mediastinal germ cell tumor identifies MEK inhibitor as an active clinical agent.

PubMed

Leonard, Jessica T; Raess, Philipp W; Dunlap, Jennifer; Hayes-Lattin, Brandon; Tyner, Jeffrey W; Traer, Elie

2016-03-31

Hematologic malignancies arising in the setting of established germ cell tumors have been previously described and have a dismal prognosis. Identification of targetable mutations and pathway dysregulation through massively parallel sequencing and functional assays provides new approaches to disease management. Herein, we report the case of a 23-year-old male who was diagnosed with a mediastinal germ cell tumor and subsequent acute myeloid leukemia. A shared clonal origin was demonstrated through identification of identical NRAS and TP53 somatic mutations in both malignancies. The patient's leukemia was refractory to standard therapies with short interval relapse. Functional assays demonstrated the patient's blasts to be sensitive to the mitogen-activated protein kinase kinase (MEK) inhibitor trametinib, correlating with the activating NRAS mutation. The patient experienced a sustained partial remission while on trametinib therapy but ultimately suffered relapse of the germ cell tumor. The leukemic clone remained stable and sensitive to trametinib at that time. This case highlights the potential power of combining genetic sequencing and in vitro functional assays with targeted therapies in the treatment of rare diseases.

Screening of Lactobacillus isolates from gastrointestinal tract of guinea fowl for probiotic qualities using in vitro tests to select species-specific probiotic candidates.

PubMed

Vineetha, P G; Tomar, S; Saxena, V K; Susan, C; Sandeep, S; Adil, K; Mukesh, K

2016-08-01

A total of 32 Lactobacillus isolates, 8 each from the crop (LGFCP1-LGFCP8), proventriculus (LGFP9-LGFP16), ileum (LGFI17-LGFI24) and caeca (LGFCM25-LGFCM32) were isolated from 25 adult guinea fowl (Pearl variety), 22-28 weeks of age, and characterised morphologically, physiologically, biochemically and by molecular methods. Isolates were screened for their probiotic quality using range of in vitro tests: aggregation test, cell surface hydrophobicity, resistance to bile salts and acidic conditions, enzymatic tests and coaggregation and antagonistic test. Based on in vitro test results and a novel scoring method, the two best isolates were selected and partial 16S rRNA sequencing was done. BLAST (Basic Local Alignment Search Tool) analysis of sequence of isolate LGFCP4 showed 99% genetic identity with Lactobacillus plantarum and LGFP16 with Lactobacillus reuteri. The study shows that these two microbial agents may be suitable as potential probiotic candidates in guinea fowl, as well as in a feed supplement for other poultry species.

Polypeptide having or assisting in carbohydrate material degrading activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Los, Alrik Pieter

2016-02-16

The invention relates to a polypeptide which comprises the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 76% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 76% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having beta-glucosidase activity and uses thereof

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoonneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; De Jong, Rene Marcel

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well asmore » the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.« less

Polypeptide having swollenin activity and uses thereof

DOEpatents

Schoonneveld-Bergmans, Margot Elizabeth Francoise; Heijne, Wilbert Herman Marie; Vlasie, Monica D; Damveld, Robbertus Antonius

2015-11-04

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having beta-glucosidase activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; De Jong, Rene Marcel; Damveld, Robbertus Antonius

2015-09-01

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 70% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 70% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having cellobiohydrolase activity and uses thereof

DOEpatents

Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Roubos, Johannes Andries; Los, Alrik Pieter

2015-09-15

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 93% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 93% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having acetyl xylan esterase activity and uses thereof

DOEpatents

Schoonneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Los, Alrik Pieter

2015-10-20

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 82% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 82% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having carbohydrate degrading activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Vlasie, Monica Diana; Damveld, Robbertus Antonius

2015-08-18

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

On the Role of Aggregation Prone Regions in Protein Evolution, Stability, and Enzymatic Catalysis: Insights from Diverse Analyses

PubMed Central

Buck, Patrick M.; Kumar, Sandeep; Singh, Satish K.

2013-01-01

The various roles that aggregation prone regions (APRs) are capable of playing in proteins are investigated here via comprehensive analyses of multiple non-redundant datasets containing randomly generated amino acid sequences, monomeric proteins, intrinsically disordered proteins (IDPs) and catalytic residues. Results from this study indicate that the aggregation propensities of monomeric protein sequences have been minimized compared to random sequences with uniform and natural amino acid compositions, as observed by a lower average aggregation propensity and fewer APRs that are shorter in length and more often punctuated by gate-keeper residues. However, evidence for evolutionary selective pressure to disrupt these sequence regions among homologous proteins is inconsistent. APRs are less conserved than average sequence identity among closely related homologues (≥80% sequence identity with a parent) but APRs are more conserved than average sequence identity among homologues that have at least 50% sequence identity with a parent. Structural analyses of APRs indicate that APRs are three times more likely to contain ordered versus disordered residues and that APRs frequently contribute more towards stabilizing proteins than equal length segments from the same protein. Catalytic residues and APRs were also found to be in structural contact significantly more often than expected by random chance. Our findings suggest that proteins have evolved by optimizing their risk of aggregation for cellular environments by both minimizing aggregation prone regions and by conserving those that are important for folding and function. In many cases, these sequence optimizations are insufficient to develop recombinant proteins into commercial products. Rational design strategies aimed at improving protein solubility for biotechnological purposes should carefully evaluate the contributions made by candidate APRs, targeted for disruption, towards protein structure and activity. PMID:24146608

Sequence Similarity Presenter: a tool for the graphic display of similarities of long sequences for use in presentations.

PubMed

Fröhlich, K U

1994-04-01

A new method for the presentation of alignments of long sequences is described. The degree of identity for the aligned sequences is averaged for sections of a fixed number of residues. The resulting values are converted to shades of gray, with white corresponding to lack of identity and black corresponding to perfect identity. A sequence alignment is represented as a bar filled with varying shades of gray. The display is compact and allows for a fast and intuitive recognition of the distribution of regions with a high similarity. It is well suited for the presentation of alignments of long sequences, e.g. of protein superfamilies, in plenary lectures. The method is implemented as a HyperCard stack for Apple Macintosh computers. Several options for the modification of the output are available (e.g. background reduction, size of the summation window, consideration of amino acid similarity, inclusion of graphic markers to indicate specific domains). The output is a PostScript file which can be printed, imported as EPS or processed further with Adobe Illustrator.

Isolation of prolactin and growth hormone from the pituitary of the holostean fish Amia calva.

PubMed

Dores, R M; Noso, T; Rand-Weaver, M; Kawauchi, H

1993-06-01

Pituitaries from adult male and female Amia calva (Order Holostei) were acid extracted and fractionated by gel filtration column chromatography and reversed-phase high performance liquid chromatography. This two-step isolation procedure yielded homogeneous pools of Amia prolaction (PRL) and growth hormone (GH). The amino acid composition of both purified polypeptides was determined. Primary sequence analysis of the first 22 positions at the N-terminal of Amia PRL revealed that this region has 63% sequence identity with eel PRL-1. The N-terminal region of Amia PRL lacks the disulfide bridge which is characteristic of tetrapod PRLs. Primary sequence analysis of the first 24 positions at the N-terminal of Amia GH revealed that this region has 62% sequence identity with eel GH and 54% sequence identity with both blue shark GH and sea turtle GH. Based on N-terminal analysis, it appears that Amia PRL and GH are more closely related to teleost PRLs and GHs than they are to tetrapod PRLs and GHs.

Complete mitochondrial genome of the larch hawk moth, Sphinx morio (Lepidoptera: Sphingidae).

PubMed

Kim, Min Jee; Choi, Sei-Woong; Kim, Iksoo

2013-12-01

The larch hawk moth, Sphinx morio, belongs to the lepidopteran family Sphingidae that has long been studied as a family of model insects in a diverse field. In this study, we describe the complete mitochondrial genome (mitogenome) sequences of the species in terms of general genomic features and characteristic short repetitive sequences found in the A + T-rich region. The 15,299-bp-long genome consisted of a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes) and one major non-coding A + T-rich region, with the typical arrangement found in Lepidoptera. The 316-bp-long A + T-rich region located between srRNA and tRNA(Met) harbored the conserved sequence blocks that are typically found in lepidopteran insects. Additionally, the A + T-rich region of S. morio contained three characteristic repeat sequences that are rarely found in Lepidoptera: two identical 12-bp repeat, three identical 5-bp-long tandem repeat, and six nearly identical 5-6 bp long repeat sequences.

ITS rDNA sequences of Pomphorhynchus laevis (Zoega in Müller, 1776) and P. lucyi Williams and Rogers, 1984 (Acanthocephala: Palaeacanthocephala).

PubMed

Král'ová-Hromadová, Iva; Tietz, David F; Shinn, Andrew P; Spakulová, Marta

2003-10-01

The internal transcribed spacers (ITS-1 and ITS-2) of the ribosomal RNA gene of Pomphorhynchus laevis (Zoega in Müller, 1776) (Acanthocephala) isolated from various fish species across Central and Southern Europe were compared with those of P. lucyi Williams and Rogers, 1984 collected from the largemouth bass Micropterus salmonoides Boulenger from the USA. The nucleotide sequences of ITS regions of P. laevis from minnows Phoxinus phoxinus (L.) and chub Leuciscus cephalus (L.) from two distant localities in the Slovak Republic were found to be 100% identical. The ITS-1 and ITS-2 of P. laevis from chub from the Czech Republic and Italy were also mutually identical, but significantly different from Slovak worms (88.7% identity for ITS-1, 91.3% identity for ITS-2). A fifth sample collected from Barbus tyberinus Bonaparte from Italy was very similar to the sympatric Italian isolate from chub, possessing four nucleotide substitutions in ITS-1 (98.4% identity). The ITS rDNA sequences of P. lucyi differed significantly from those of P. laevis; the values of identity were 51.8-56.1% for ITS-1 and 63.1-65.3% for ITS-2, and were significantly higher than the range of P. laevis within-species variability. The results based on the ITS sequences confirmed the occurrence of strains in P. laevis from Continental Europe which are well defined by molecules but reveal only slight differences in their morphology.

Spatial and identity negative priming in audition: evidence of feature binding in auditory spatial memory.

PubMed

Mayr, Susanne; Buchner, Axel; Möller, Malte; Hauke, Robert

2011-08-01

Two experiments are reported with identical auditory stimulation in three-dimensional space but with different instructions. Participants localized a cued sound (Experiment 1) or identified a sound at a cued location (Experiment 2). A distractor sound at another location had to be ignored. The prime distractor and the probe target sound were manipulated with respect to sound identity (repeated vs. changed) and location (repeated vs. changed). The localization task revealed a symmetric pattern of partial repetition costs: Participants were impaired on trials with identity-location mismatches between the prime distractor and probe target-that is, when either the sound was repeated but not the location or vice versa. The identification task revealed an asymmetric pattern of partial repetition costs: Responding was slowed down when the prime distractor sound was repeated as the probe target, but at another location; identity changes at the same location were not impaired. Additionally, there was evidence of retrieval of incompatible prime responses in the identification task. It is concluded that feature binding of auditory prime distractor information takes place regardless of whether the task is to identify or locate a sound. Instructions determine the kind of identity-location mismatch that is detected. Identity information predominates over location information in auditory memory.

Serine protease activity in m-1 cortical collecting duct cells.

PubMed

Liu, Lian; Hering-Smith, Kathleen S; Schiro, Faith R; Hamm, L Lee

2002-04-01

An apical serine protease, channel-activating protease 1 (CAP1), augments sodium transport in A6 cells. Prostasin, a novel serine protease originally purified from seminal fluid, has been proposed to be the mammalian ortholog of CAP1. We have recently found functional evidence for a similar protease activity in the M-1 cortical collecting duct cell line. The purposes of the present studies were to determine whether prostasin (or CAP1) is present in collecting duct cells by use of mouse M-1 cells, to sequence mouse prostasin, and to further characterize the identity of the serine protease activity and additional functional features in M-1 cells. Using mouse expressed sequence tag sequences that are highly homologous to the published human prostasin sequence as templates, reverse transcription-polymerase chain reaction and RACE (rapid amplification of cDNA ends) were used to sequence mouse prostasin mRNA, which shows 99% identical to published mouse CAP1 sequence. A single 1800-bp transcript was found by Northern analysis, and this was not altered by aldosterone. Equivalent short-circuit current (I(eq)), which represents sodium transport in these cells, dropped to 59+/-3% of control value within 1 hour of incubation with aprotinin, a serine protease inhibitor. Trypsin increased the I(eq) in aprotinin-treated cells to the value of the control group within 5 minutes. Application of aprotinin not only inhibited amiloride sensitive I(eq) but also reduced transepithelial resistance (R(te)) to 43+/-2%, an effect not expected with simple inhibition of sodium channels. Trypsin partially reversed the effect of aprotinin on R(te). Another serine protease inhibitor, soybean trypsin inhibitor (STI), decreased I(eq) in M-1 cells. STI inhibited I(eq) gradually over 6 hours, and the inhibition of I(eq) by 2 inhibitors was additive. STI decreased transepithelial resistance much less than did aprotinin. Neither aldosterone nor dexamethasone significantly augmented protease activity or prostasin mRNA levels, and in fact, dexamethasone decreased prostasin mRNA expression. In conclusion, although prostasin is present in M-1 cells and probably augments sodium transport in these cells, serine proteases probably have other effects (eg, resistance) in the collecting duct in addition to effects on sodium channels. Steroids do not alter these effects in M-1 cells. Additional proteases are likely also present in mouse collecting duct cells.

Reptilian transferrins: evolution of disulphide bridges and conservation of iron-binding center.

PubMed

Ciuraszkiewicz, Justyna; Biczycki, Marian; Maluta, Aleksandra; Martin, Samuel; Watorek, Wiesław; Olczak, Mariusz

2007-07-01

Transferrins, found in invertebrates and vertebrates, form a physiologically important family of proteins playing a major role in iron acquisition and transport, defense against microbial pathogens, growth and differentiation. These proteins are bilobal in structure and each lobe is composed of two domains divided by a cleft harboring an iron atom. Vertebrate transferrins comprise of serotransferrins, lactoferrins and ovotransferrins. In mammals serotransferrins transport iron in physiological fluids and deliver it to cells, while lactoferrins scavenge iron, limiting its availability to invading microbes. In oviparous vertebrates there is only one transferrin gene, expressed either in the liver to be delivered to physiological fluids as serotransferrin, or in the oviduct with a final localization in egg white as ovotransferrin. Being products of one gene sero- and ovotransferrin are identical at the amino-acid sequence level but with different, cell specific glycosylation patterns. Our knowledge of the mechanisms of transferrin iron binding and release is based on sequence and structural data obtained for human serotransferrin and hen and duck ovotransferrins. No sequence information about other ovotransferrins was available until our recent publication of turkey, ostrich, and red-eared turtle (TtrF) ovotransferrin mRNA sequences [Ciuraszkiewicz, J., Olczak, M., Watorek, W., 2006. Isolation, cloning and sequencing of transferrins from red-eared turtle, African ostrich and turkey. Comp. Biochem. Physiol. 143 B, 301-310]. In the present paper, ten new reptilian mRNA transferrin sequences obtained from the Nile crocodile (NtrF), bearded dragon (BtrF), Cuban brown anole (AtrF), veiled and Mediterranean chameleons (VtrF and KtrF), sand lizard (StrF), leopard gecko (LtrF), Burmese python (PtrF), African house snake (HtrF), and grass snake (GtrF) are presented and analyzed. Nile crocodile and red-eared turtle transferrins have a disulphide bridge pattern identical to known bird homologues. A partially different disulphide bridge pattern was found in the Squamata (snakes and lizards). The possibility of a unique interdomain disulphide bridge was predicted for LtrF. Differences were found in iron-binding centers from those of previously known transferrins. Substitutions were found in the iron-chelating residues of StrF and TtrF and in the synergistic anion-binding residues of NtrF. In snakes, the transferrin (PtrF, HtrF and GtrF) N-lobe "dilysine trigger" occurring in all other known transferrins was not found, which indicates a different mechanism of iron release.

Genetic variation and origin of parthenogenesis in the Aspidoscelis cozumela complex: evidence from mitochondrial genes.

PubMed

Manríquez-Morán, Norma L; Cruz, Fausto R Méndez-de la; Murphy, Robert W

2014-01-01

Parthenogenesis is a form of clonal reproduction. Eggs develop in the absence of sperm and offspring are genetically identical to their mother. Although common in invertebrates, it occurs in only a few species of squamate reptiles. Parthenogenetic reptiles have their origin in interspecific hybridization, and their populations are exclusively female. Because of its high mutation rate and maternal inheritance, mitochondrial DNA sequence data can evaluate the origin and evolution of all-female vertebrates. Partial sequences from two mitochondrial genes, Cytb and ND4, were analyzed to investigate questions about the origin of parthenogenesis in the Aspidoscelis cozumela complex, which includes A. cozumela, A. maslini and A. rodecki. Low levels of divergence were detected among parthenogenetic species, and between them and A. angusticeps, confirming it as the maternal species of the parthenoforms. A gene tree was constructed using sequences from three populations of A. angusticeps and nine of its unisexual daughter species. The phylogeny suggests that two independent hybridization events between A. angusticeps and A. deppii formed three unisexual species. One hybridization resulted in A. rodecki and the other formed A. maslini and A. cozumela. Although A. cozumela has the haplotype characteristic of A. maslini from Puerto Morelos, it is considered to be a different species based on karyological and morphological characteristics and its geographical isolation.

Host specificity and basic ecology of Mammomonogamus (Nematoda, Syngamidae) from lowland gorillas and forest elephants in Central African Republic.

PubMed

Červená, Barbora; Vallo, Peter; Pafčo, Barbora; Jirků, Kateřina; Jirků, Miloslav; Petrželková, Klára Judita; Todd, Angelique; Turkalo, Andrea K; Modrý, David

2017-07-01

Syngamid strongylids of the genus Mammomonogamus undoubtedly belong among the least known nematodes with apparent zoonotic potential and the real diversity of the genus remains hard to evaluate without extensive molecular data. Eggs of Mammomonogamus sp. are frequently found in feces of African forest elephants (Loxodonta cyclotis) and western lowland gorillas (Gorilla gorilla gorilla) in Dzanga-Sangha Protected Areas. Using sedimentation-based coproscopic techniques, we found the eggs of Mammomonogamus in 19·7% elephant and 54·1% gorilla fecal samples with 8-55 and 1-24 eggs per gram of fecal sediment for elephants and gorillas, respectively. We used a combination of light microscopy, scanning electron microscopy and analysis of cytochrome c oxidase subunit I (cox1) and a partial sequence of 18S rDNA isolated from single eggs to test the hypothesis of possible Mammomonogamus conspecificity in gorillas and elephants. Whereas 18S rDNA sequences were identical in both gorillas and elephants, we distinguished seven different haplotypes within the cox1. Two haplotypes were found in both gorillas and elephants suggesting sharing of Mammomonogamus. Assignment of the parasite to M. loxodontis is proposed. Provided sequences represent the first genomic data on Mammomonogamus spp.

Isolation of nine gene sequences induced by silica in murine macrophages

DOE Office of Scientific and Technical Information (OSTI.GOV)

Segade, F.; Claudio, E.; Wrobel, K.

1995-03-01

Macrophage activation by silica is the initial step in the development of silicosis. To identify genes that might be involved in silica-mediated activation, RAW 264.7 mouse macrophages were treated with silica for 48 h, and a subtracted cDNA library enriched for silica-induced genes (SIG) was constructed and differently screened. Nine cDNA clones (designated SIG-12, -14, -20, -41, -61, -81, -91, and -111) were partially sequenced and compared with sequences in GenBank/EMBL databases. SIG-12, -14, and -20 corresponded to the genes for ribosomal proteins L13A, L32, and L26, respectively. SIG-61 is the mouse homologue of p21 RhoC. SIG-91 is identical tomore » the 67-kDa high-affinity laminin receptor. Four genes were not identified and are novel. All of the mRNAs corresponding to the nine cloned cDNAs were inducible by silica. Steady-state levels of mRNAs in RAW 264.7 cells treated with various macrophage activators and inducers of signal transduction pathways were determined. A complex pattern of induction and repression was found, indicating that upon phagocytosis of silica particles, many regulatory mechanisms of genes expression are simultaneously triggered. 55 refs., 4 figs., 1 tab.« less

HIP1 propagates in cyanobacterial DNA via nucleotide substitutions but promotes excision at similar frequencies in Escherichia coli and Synechococcus PCC 7942.

PubMed

Robinson, P J; Cranenburgh, R M; Head, I M; Robinson, N J

1997-04-01

The sequence 5'-GCGATCGC-3', designated HIP1, for highly iterated palindrome, was first identified at the borders of a gene-deletion event and subsequently shown to constitute up to 2.5% of the DNA in some cyanobacteria. It is now reported that HIP1 is polyphyletic, occurring in several distinct cyanobacterial lineages and not defining a clade. HIP1 does not introduce gaps into sequence alignments. It aligns with partial HIP1 sites in related sequences showing that it propagates by nucleotide substitutions rather than insertion. Constructs have been created to determine the frequencies at which deletion events occur between palindromes located within the selectable marker neo. Deletion between HIP1 sites was more frequent in Synechococcus PCC 7942 than deletion between control palindromes, 5'-CCGATCGG-3', designated PAL0. However, this is not due to a recombinase that recognises HIP1 and is peculiar to cyanobacteria because similar deletion frequencies were detected in Escherichia coli. Furthermore, the frequency of deletion of DNA flanked asymmetrically by one HIP1 site and one PAL0 site was less than the frequency of deletion of DNA flanked asymmetrically by identical copies of either palindrome. This is consistent with deletion by copy-choice.

Effects of a Non-Conservative Sequence on the Properties of β-glucuronidase from Aspergillus terreus Li-20

PubMed Central

Liu, Yanli; Huangfu, Jie; Qi, Feng; Kaleem, Imdad; E, Wenwen; Li, Chun

2012-01-01

We cloned the β-glucuronidase gene (AtGUS) from Aspergillus terreus Li-20 encoding 657 amino acids (aa), which can transform glycyrrhizin into glycyrrhetinic acid monoglucuronide (GAMG) and glycyrrhetinic acid (GA). Based on sequence alignment, the C-terminal non-conservative sequence showed low identity with those of other species; thus, the partial sequence AtGUS(-3t) (1–592 aa) was amplified to determine the effects of the non-conservative sequence on the enzymatic properties. AtGUS and AtGUS(-3t) were expressed in E. coli BL21, producing AtGUS-E and AtGUS(-3t)-E, respectively. At the similar optimum temperature (55°C) and pH (AtGUS-E, 6.6; AtGUS(-3t)-E, 7.0) conditions, the thermal stability of AtGUS(-3t)-E was enhanced at 65°C, and the metal ions Co2+, Ca2+ and Ni2+ showed opposite effects on AtGUS-E and AtGUS(-3t)-E, respectively. Furthermore, Km of AtGUS(-3t)-E (1.95 mM) was just nearly one-seventh that of AtGUS-E (12.9 mM), whereas the catalytic efficiency of AtGUS(-3t)-E was 3.2 fold higher than that of AtGUS-E (7.16 vs. 2.24 mM s−1), revealing that the truncation of non-conservative sequence can significantly improve the catalytic efficiency of AtGUS. Conformational analysis illustrated significant difference in the secondary structure between AtGUS-E and AtGUS(-3t)-E by circular dichroism (CD). The results showed that the truncation of the non-conservative sequence could preferably alter and influence the stability and catalytic efficiency of enzyme. PMID:22347419

An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

PubMed

Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

2004-01-21

We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

First Report on Circulation of Echinococcus ortleppi in the one Humped Camel (Camelus dromedaries), Sudan

PubMed Central

2013-01-01

Background Echinococcus granulosus (EG) complex, the cause of cystic echinococcosis (CE), infects humans and several other animal species worldwide and hence the disease is of public health importance. Ten genetic variants, or genotypes designated as (G1-G10), are distributed worldwide based on genetic diversity. The objective of this study was to provide some sequence data and phylogeny of EG isolates recovered from the Sudanese one-humped camel (Camelus dromedaries). Fifty samples of hydatid cysts were collected from the one- humped camels (Camelus dromedaries) at Taboul slaughter house, central Sudan. DNAs were extracted from protoscolices and/or associated germinal layers of hydatid cysts using a commercial kit. The mitochondrial NADH dehydrogenase subunit 1 (NADH1) gene and the cytochrome C oxidase subunit 1 (cox1) gene were used as targets for polymerase chain reaction (PCR) amplification. The PCR products were purified and partial sequences were generated. Sequences were further examined by sequence analysis and subsequent phylogeny to compare these sequences to those from known strains of EG circulating globally. Results The identity of the PCR products were confirmed as NADH1 and cox1 nucleotide sequences using the Basic Local Alignment Search Tool (BLAST) of NCBI (National Center for Biotechnology Information, Bethesda, MD). The phylogenetic analysis showed that 98% (n = 49) of the isolates clustered with Echinococcus canadensis genotype 6 (G6), whereas only one isolate (2%) clustered with Echinococcus ortleppi (G5). Conclusions This investigation expands on the existing sequence data generated from EG isolates recovered from camel in the Sudan. The circulation of the cattle genotype (G5) in the one-humped camel is reported here for the first time. PMID:23800362

First report on circulation of Echinococcus ortleppi in the one humped camel (Camelus dromedaries), Sudan.

PubMed

Ahmed, Mohamed E; Eltom, Kamal H; Musa, Nasreen O; Ali, Ibtisam A; Elamin, Fatima M; Grobusch, Martin P; Aradaib, Imadeldin E

2013-06-25

Echinococcus granulosus (EG) complex, the cause of cystic echinococcosis (CE), infects humans and several other animal species worldwide and hence the disease is of public health importance. Ten genetic variants, or genotypes designated as (G1-G10), are distributed worldwide based on genetic diversity. The objective of this study was to provide some sequence data and phylogeny of EG isolates recovered from the Sudanese one-humped camel (Camelus dromedaries). Fifty samples of hydatid cysts were collected from the one- humped camels (Camelus dromedaries) at Taboul slaughter house, central Sudan. DNAs were extracted from protoscolices and/or associated germinal layers of hydatid cysts using a commercial kit. The mitochondrial NADH dehydrogenase subunit 1 (NADH1) gene and the cytochrome C oxidase subunit 1 (cox1) gene were used as targets for polymerase chain reaction (PCR) amplification. The PCR products were purified and partial sequences were generated. Sequences were further examined by sequence analysis and subsequent phylogeny to compare these sequences to those from known strains of EG circulating globally. The identity of the PCR products were confirmed as NADH1 and cox1 nucleotide sequences using the Basic Local Alignment Search Tool (BLAST) of NCBI (National Center for Biotechnology Information, Bethesda, MD). The phylogenetic analysis showed that 98% (n = 49) of the isolates clustered with Echinococcus canadensis genotype 6 (G6), whereas only one isolate (2%) clustered with Echinococcus ortleppi (G5). This investigation expands on the existing sequence data generated from EG isolates recovered from camel in the Sudan. The circulation of the cattle genotype (G5) in the one-humped camel is reported here for the first time.

Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

PubMed

Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

2011-09-01

Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

Structures of two Arabidopsis thaliana major latex proteins represent novel helix-grip folds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lytle, Betsy L.; Song, Jikui; de la Cruz, Norberto B.

2009-06-02

Here we report the first structures of two major latex proteins (MLPs) which display unique structural differences from the canonical Bet v 1 fold described earlier. MLP28 (SwissProt/TrEMBL ID Q9SSK9), the product of gene At1g70830.1, and the At1g24000.1 gene product (Swiss- Prot/TrEMBL ID P0C0B0), proteins which share 32% sequence identity, were independently selected as foldspace targets by the Center for Eukaryotic Structural Genomics. The structure of a single domain (residues 17-173) of MLP28 was solved by NMR spectroscopy, while the full-length At1g24000.1 structure was determined by X-ray crystallography. MLP28 displays greater than 30% sequence identity to at least eight MLPsmore » from other species. For example, the MLP28 sequence shares 64% identity to peach Pp-MLP119 and 55% identity to cucumber Csf2.20 In contrast, the At1g24000.1 sequence is highly divergent (see Fig. 1), containing a gap of 33 amino acids when compared with all other known MLPs. Even when the gap is excluded, the sequence identity with MLPs from other species is less than 30%. Unlike some of the MLPs from other species, none of the A. thaliana MLPs have been characterized biochemically. We show by NMR chemical shift mapping that At1g24000.1 binds progesterone, demonstrating that despite its sequence dissimilarity, the hydrophobic binding pocket is conserved and, therefore, may play a role in its biological function and that of the MLP family in general.« less

First isolation of Rickettsia monacensis from a patient in South Korea.

PubMed

Kim, Yeon-Sook; Choi, Yeon-Joo; Lee, Kyung-Min; Ahn, Kyu-Joong; Kim, Heung-Chul; Klein, Terry; Jiang, Ju; Richards, Allen; Park, Kyung-Hee; Jang, Won-Jong

2017-07-01

A Rickettsia sp. was isolated from the blood of a patient with an acute febrile illness using the shell vial technique; the isolate was named CN45Kr and was identified by molecular assay as Rickettsia monacensis, which was first recognized as a pathogen in Spain. Sequencing analysis showed that the gltA sequence of the isolate was identical to that of Rickettsia sp. IRS3. The ompA-5mp fragment sequence showed 100% identity to those of R. monacensis and Rickettsia sp. In56 and ompA-3pA In56 and 100% identity to that of Rickettsia sp. IRS3. The ompB sequence was found to have 99.9% similarity to that of R. monacensis IrR/Munich. This study confirms the pathogenicity of this agent and provides additional information about its geographic distribution. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

NGSCheckMate: software for validating sample identity in next-generation sequencing studies within and across data types.

PubMed

Lee, Sejoon; Lee, Soohyun; Ouellette, Scott; Park, Woong-Yang; Lee, Eunjung A; Park, Peter J

2017-06-20

In many next-generation sequencing (NGS) studies, multiple samples or data types are profiled for each individual. An important quality control (QC) step in these studies is to ensure that datasets from the same subject are properly paired. Given the heterogeneity of data types, file types and sequencing depths in a multi-dimensional study, a robust program that provides a standardized metric for genotype comparisons would be useful. Here, we describe NGSCheckMate, a user-friendly software package for verifying sample identities from FASTQ, BAM or VCF files. This tool uses a model-based method to compare allele read fractions at known single-nucleotide polymorphisms, considering depth-dependent behavior of similarity metrics for identical and unrelated samples. Our evaluation shows that NGSCheckMate is effective for a variety of data types, including exome sequencing, whole-genome sequencing, RNA-seq, ChIP-seq, targeted sequencing and single-cell whole-genome sequencing, with a minimal requirement for sequencing depth (>0.5X). An alignment-free module can be run directly on FASTQ files for a quick initial check. We recommend using this software as a QC step in NGS studies. https://github.com/parklab/NGSCheckMate. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Process signatures in glatiramer acetate synthesis: structural and functional relationships.

PubMed

Campos-García, Víctor R; Herrera-Fernández, Daniel; Espinosa-de la Garza, Carlos E; González, German; Vallejo-Castillo, Luis; Avila, Sandra; Muñoz-García, Leslie; Medina-Rivero, Emilio; Pérez, Néstor O; Gracia-Mora, Isabel; Pérez-Tapia, Sonia Mayra; Salazar-Ceballos, Rodolfo; Pavón, Lenin; Flores-Ortiz, Luis F

2017-09-21

Glatiramer Acetate (GA) is an immunomodulatory medicine approved for the treatment of multiple sclerosis, whose mechanisms of action are yet to be fully elucidated. GA is comprised of a complex mixture of polypeptides with different amino acid sequences and structures. The lack of sensible information about physicochemical characteristics of GA has contributed to its comprehensiveness complexity. Consequently, an unambiguous determination of distinctive attributes that define GA is of highest relevance towards dissecting its identity. Herein we conducted a study of characteristic GA heterogeneities throughout its manufacturing process (process signatures), revealing a strong impact of critical process parameters (CPPs) on the reactivity of amino acid precursors; reaction initiation and polymerization velocities; and peptide solubility, susceptibility to hydrolysis, and size-exclusion properties. Further, distinctive GA heterogeneities were correlated to defined immunological and toxicological profiles, revealing that GA possesses a unique repertoire of active constituents (epitopes) responsible of its immunological responses, whose modification lead to altered profiles. This novel approach established CPPs influence on intact GA peptide mixture, whose physicochemical identity cannot longer rely on reduced properties (based on complete or partial GA degradation), providing advanced knowledge on GA structural and functional relationships to ensure a consistent manufacturing of safe and effective products.

Incidence of three Kudoa spp., K. neothunni, K. hexapunctata, and K. thunni (Myxosporea: Multivalvulida), in Thunnus tunas distributed in the western Pacific Ocean.

PubMed

Kasai, Akihiro; Tsuduki, Hideaki; Jimenez, Lea Angsinco; Li, Ying-Chun; Tanaka, Shuhei; Sato, Hiroshi

2017-04-01

A variety of tunas of the genus Thunnus are consumed daily in Japan as sliced raw fish (sashimi and sushi). The consumption of fresh sliced raw fish, i.e., unfrozen or uncooked, can sometimes cause food poisoning that is manifested by transient diarrhea and vomiting for a single day. One of the causes of this type of food poisoning has been identified as live Kudoa septempunctata (Myxosporea: Multivalvulida) in the olive flounder (Paralichthys olivaceus). Furthermore, raw slices of fresh tunas are highly suspected to be a possible causative fish of similar food poisoning in Japan. In the present study, we conducted a survey of kudoid infections in tunas (the yellowfin tuna Thunnus albacares, the Pacific bluefin tuna Thunnus orientalis, and the longtail tuna Thunnus tonggol) fished in the western Pacific Ocean off Japan and several East Asian countries and characterized morphologically and genetically the kudoid myxospores in pseudocysts or cysts dispersed in the trunk muscles. Pseudocysts of solely Kudoa hexapunctata were identified in the Pacific bluefin tuna (four isolates), whereas in the yellowfin tuna (21 isolates) pseudocysts of Kudoa neothunni and K. hexapunctata were detected at a ratio of 15:6, respectively, in addition to cyst-forming Kudoa thunni in five yellowfin tunas. In the trunk muscles of six longtail tunas examined, pseudocysts of K. neothunni (all six fish) and K. hexapunctata (two fish) were densely dispersed. The myxospores of K. neothunni found in these longtail tunas had seven shell valves and polar capsules (SV/PC) instead of the more common six SV/PC arranged symmetrically. Nucleotide sequences of the 18S and 28S ribosomal RNA gene (rDNA), some with the internal transcribed spacer regions as well, of K. hexapunctata and K. neothunni from the three Thunnus spp., including the seven-SV/PC morphotype, were very similar to previously characterized nucleotide sequences of each species, whereas the 18S and 28S rDNA of four isolates of K. thunni from yellowfin tunas showed a range of nucleotide variations of 99.0-99.9% identity over 1752-1763-bp long partial 18S rDNA and 97.4-99.9% identity over 797-802-bp long partial 28S rDNA. Therefore, this rather high variation of the rDNA nucleotide sequences of K. thunni proved to be contrary to the few variations of K. neothunni and K. hexapunctata rDNA nucleotide sequences. The present study provides a new host record of the longtail tuna for K. neothunni and K. hexapunctata and reveals a high prevalence of the seven-SV/PC myxospore morphotype of K. neothunni in this tuna host.

GRIL: genome rearrangement and inversion locator.

PubMed

Darling, Aaron E; Mau, Bob; Blattner, Frederick R; Perna, Nicole T

2004-01-01

GRIL is a tool to automatically identify collinear regions in a set of bacterial-size genome sequences. GRIL uses three basic steps. First, regions of high sequence identity are located. Second, some of these regions are filtered based on user-specified criteria. Finally, the remaining regions of sequence identity are used to define significant collinear regions among the sequences. By locating collinear regions of sequence, GRIL provides a basis for multiple genome alignment using current alignment systems. GRIL also provides a basis for using current inversion distance tools to infer phylogeny. GRIL is implemented in C++ and runs on any x86-based Linux or Windows platform. It is available from http://asap.ahabs.wisc.edu/gril

A broad-spectrum antimicrobial activity of Bacillus subtilis RLID 12.1.

PubMed

Ramachandran, Ramya; Chalasani, Ajay Ghosh; Lal, Ram; Roy, Utpal

2014-01-01

In the present study, an attempt was made to biochemically characterize the antimicrobial substance from the soil isolate designated as RLID 12.1 and explore its potential applications in biocontrol of drug-resistant pathogens. The antimicrobial potential of the wild-type isolate belonging to the genus Bacillus was determined by the cut-well agar assay. The production of antimicrobial compound was recorded maximum at late exponential growth phase. The ultrafiltered concentrate was insensitive to organic solvents, metal salts, surfactants, and proteolytic and nonproteolytic enzymes. The concentrate was highly heat stable and active over a wide range of pH values. Partial purification, zymogram analysis, and TLC were performed to determine the preliminary biochemical nature. The molecular weight of the antimicrobial peptide was determined to be less than 2.5 kDa in 15% SDS-PAGE and in zymogram analysis against Streptococcus pyogenes. The N-terminal amino acid sequence by Edman degradation was partially determined to be T-P-P-Q-S-X-L-X-X-G, which shows very insignificant identity to other antimicrobial peptides from bacteria. The minimum inhibitory concentrations of dialysed and partially purified ion exchange fractions were determined against some selected gram-positive and gram-negative bacteria and some pathogenic yeasts. The presence of three important antimicrobial peptide biosynthesis genes ituc, fend, and bmyb was determined by PCR.

The earliest maize from San Marcos Tehuacán is a partial domesticate with genomic evidence of inbreeding

PubMed Central

Vallebueno-Estrada, Miguel; Rodríguez-Arévalo, Isaac; Rougon-Cardoso, Alejandra; Martínez González, Javier; García Cook, Angel; Vielle-Calzada, Jean-Philippe

2016-01-01

Pioneering archaeological expeditions lead by Richard MacNeish in the 1960s identified the valley of Tehuacán as an important center of early Mesoamerican agriculture, providing by far the widest collection of ancient crop remains, including maize. In 2012, a new exploration of San Marcos cave (Tehuacán, Mexico) yielded nonmanipulated maize specimens dating at a similar age of 5,300–4,970 calibrated y B.P. On the basis of shotgun sequencing and genomic comparisons to Balsas teosinte and modern maize, we show herein that the earliest maize from San Marcos cave was a partial domesticate diverging from the landraces and containing ancestral allelic variants that are absent from extant maize populations. Whereas some domestication loci, such as teosinte branched1 (tb1) and brittle endosperm2 (bt2), had already lost most of the nucleotide variability present in Balsas teosinte, others, such as teosinte glume architecture1 (tga1) and sugary1 (su1), conserved partial levels of nucleotide variability that are absent from extant maize. Genetic comparisons among three temporally convergent samples revealed that they were homozygous and identical by descent across their genome. Our results indicate that the earliest maize from San Marcos was already inbred, opening the possibility for Tehuacán maize cultivation evolving from reduced founder populations of isolated and perhaps self-pollinated individuals. PMID:27872313

The earliest maize from San Marcos Tehuacán is a partial domesticate with genomic evidence of inbreeding.

PubMed

Vallebueno-Estrada, Miguel; Rodríguez-Arévalo, Isaac; Rougon-Cardoso, Alejandra; Martínez González, Javier; García Cook, Angel; Montiel, Rafael; Vielle-Calzada, Jean-Philippe

2016-12-06

Pioneering archaeological expeditions lead by Richard MacNeish in the 1960s identified the valley of Tehuacán as an important center of early Mesoamerican agriculture, providing by far the widest collection of ancient crop remains, including maize. In 2012, a new exploration of San Marcos cave (Tehuacán, Mexico) yielded nonmanipulated maize specimens dating at a similar age of 5,300-4,970 calibrated y B.P. On the basis of shotgun sequencing and genomic comparisons to Balsas teosinte and modern maize, we show herein that the earliest maize from San Marcos cave was a partial domesticate diverging from the landraces and containing ancestral allelic variants that are absent from extant maize populations. Whereas some domestication loci, such as teosinte branched1 (tb1) and brittle endosperm2 (bt2), had already lost most of the nucleotide variability present in Balsas teosinte, others, such as teosinte glume architecture1 (tga1) and sugary1 (su1), conserved partial levels of nucleotide variability that are absent from extant maize. Genetic comparisons among three temporally convergent samples revealed that they were homozygous and identical by descent across their genome. Our results indicate that the earliest maize from San Marcos was already inbred, opening the possibility for Tehuacán maize cultivation evolving from reduced founder populations of isolated and perhaps self-pollinated individuals.

High levels of p19/nm23 protein in neuroblastoma are associated with advanced stage disease and with N-myc gene amplification.

PubMed Central

Hailat, N; Keim, D R; Melhem, R F; Zhu, X X; Eckerskorn, C; Brodeur, G M; Reynolds, C P; Seeger, R C; Lottspeich, F; Strahler, J R

1991-01-01

The gene encoding a novel protein designated nm23-H1, which was recently identified as identical to the A subunit of nucleotide diphosphate kinase from human erythrocytes, has been proposed to play a role in tumor metastasis suppression. We report that untreated neuroblastoma tumors contain a cellular polypeptide (Mr = 19,000) designated p19, identified in two-dimensional electrophoretic gels, which occurs at significantly higher levels (P = 0.0001) in primary tumors containing amplified N-myc gene. The partial amino acid sequence obtained for p19 is identical to the sequence of the human nm23-H1 protein. An antibody to the A subunit of erythrocyte nucleotide diphosphate kinase reacted exclusively with p19. In this study, significantly higher levels of p19/nm23 occurred in primary neuroblastoma tumors from patients with advanced stages (III and IV) relative to tumors from patients with limited stages (I and II) of the disease. Even among patients with a single copy of the N-myc gene, tumors from patients with stages III and IV had statistically significantly higher levels of p19/nm23 than tumors from patients with stages I and II. Our findings indicate that, in contrast to a proposed role for nm23-H1 as a tumor metastasis suppressor, increased p19/nm23 protein in neuroblastoma is correlated with features of the disease that are associated with aggressive tumors. Therefore, nm23-H1 may have distinct if not opposite roles in different tumors. Images PMID:2056128

Vig r 6, the cytokinin-specific binding protein from mung bean (Vigna radiata) sprouts, cross-reacts with Bet v 1-related allergens and binds IgE from birch pollen allergic patients' sera.

PubMed

Guhsl, Eva Elisabeth; Hofstetter, Gerlinde; Hemmer, Wolfgang; Ebner, Christof; Vieths, Stefan; Vogel, Lothar; Breiteneder, Heimo; Radauer, Christian

2014-03-01

Birch pollen associated allergy to mung bean sprouts is caused by cross-reactivity between the birch pollen allergen Bet v 1 and the mung bean allergen Vig r 1. We aimed to determine the allergenicity of the cytokinin-specific binding protein from mung bean (Vig r 6), another allergen related to Bet v 1 with only 31% sequence identity. Bet v 1, Gly m 4, Vig r 1, and Vig r 6 were produced in Escherichia coli. In an ELISA, 73 and 32% of Bet v 1-sensitized birch-allergic patients' sera (n = 60) showed IgE binding to Vig r 1 and Vig r 6, respectively. Of 19 patients who reported allergic reactions or had positive prick-to-prick tests to mung bean sprouts, 79% showed IgE binding to Vig r 1 and 63% showed IgE binding to Vig r 6. Bet v 1 completely inhibited IgE binding to both mung bean allergens. Vig r 6 showed partial cross-reactivity with Vig r 1 and activated basophils sensitized with mung bean allergic patients' sera. We demonstrated IgE cross-reactivity despite low sequence identity between Vig r 6 and other Bet v 1-related allergens. Thus, IgE binding to Vig r 6 may contribute to birch pollinosis-associated mung bean sprout allergy. © 2013 The Authors. Molecular Nutrition & Food Research published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Persistence of Mycoplasma hyopneumoniae sequence types in spite of a control program for enzootic pneumonia in pigs.

PubMed

Overesch, Gudrun; Kuhnert, Peter

2017-09-15

Enzootic pneumonia (EP) in pigs caused by Mycoplasma (M.) hyopneumoniae has successfully been combatted in Switzerland. A control program was fully implemented in 2004 which is based on total depopulation strategies of affected fattening farms as well as partial depopulation on breeding farms. Thereby, the number of cases has dropped drastically from more than 200 in 2003 to two cases in 2013. Currently monitoring is done based on clinical observation and subsequent diagnostic of coughing pigs. Moreover, in case of more than 10% gross pathological lesions per slaughter batch laboratory confirmation for EP is compulsory. Despite these strict measures it was not possible to eliminate M. hyopneumoniae from Swiss pig production. In fact, during the last few years the number of EP cases has slightly increased. Therefore, genotyping of the involved M. hyopneumoniae strains was conducted in order to elucidate possible sources and routes of infection. All available and typeable samples from totally 22 cases during the period 2014-2016 were investigated by extended multilocus sequence typing (MLST). A total of 16 cases, including eight from 2014, five from 2015 and three from 2016 could thereby be included in the study. MLST revealed that the majority of cases in 2014/2015 were due to two major spread scenarios, i.e. two M. hyopneumoniae sequence types, each scenario involving six individual production farms in five to six different Cantons (states), respectively. Moreover, by comparison of archived sequences some sequence types were observed over ten years demonstrating their persistence over a long time and the possible partial failure of elimination measures in Switzerland. Insufficient sanitation on affected farms and subsequent animal transport of symptomless infected pigs could lead to recurrent cases. Wild boar harbor identical strains found with EP but solid data are missing to assign a role as reservoir to this wild animal. Implementing a monitoring scheme for M. hyopneumoniae in wild boar in combination with genotyping of all available samples from domestic pigs could direct responsible authorities to possible gaps and deficiencies of control measures taken for combating enzootic pneumonia. With the newly installed PubMLST database sequence types for M. hyopneumoniae are now available and allow tracing back strains on the international level. Copyright © 2017 Elsevier B.V. All rights reserved.

The Pinus taeda genome is characterized by diverse and highly diverged repetitive sequences

PubMed Central

2010-01-01

Background In today's age of genomic discovery, no attempt has been made to comprehensively sequence a gymnosperm genome. The largest genus in the coniferous family Pinaceae is Pinus, whose 110-120 species have extremely large genomes (c. 20-40 Gb, 2N = 24). The size and complexity of these genomes have prompted much speculation as to the feasibility of completing a conifer genome sequence. Conifer genomes are reputed to be highly repetitive, but there is little information available on the nature and identity of repetitive units in gymnosperms. The pines have extensive genetic resources, with approximately 329000 ESTs from eleven species and genetic maps in eight species, including a dense genetic map of the twelve linkage groups in Pinus taeda. Results We present here the Sanger sequence and annotation of ten P. taeda BAC clones and Genome Analyzer II whole genome shotgun (WGS) sequences representing 7.5% of the genome. Computational annotation of ten BACs predicts three putative protein-coding genes and at least fifteen likely pseudogenes in nearly one megabase of sequence. We found three conifer-specific LTR retroelements in the BACs, and tentatively identified at least 15 others based on evidence from the distantly related angiosperms. Alignment of WGS sequences to the BACs indicates that 80% of BAC sequences have similar copies (≥ 75% nucleotide identity) elsewhere in the genome, but only 23% have identical copies (99% identity). The three most common repetitive elements in the genome were identified and, when combined, represent less than 5% of the genome. Conclusions This study indicates that the majority of repeats in the P. taeda genome are 'novel' and will therefore require additional BAC or genomic sequencing for accurate characterization. The pine genome contains a very large number of diverged and probably defunct repetitive elements. This study also provides new evidence that sequencing a pine genome using a WGS approach is a feasible goal. PMID:20609256

Genetic characterization of canine parvovirus from dogs in Pakistan.

PubMed

Shabbir, M Z; Sohail, M U; Chaudhary, U N; Yaqub, W; Rashid, I; Saleem, M H; Munir, M

Canine parvoviruses (CPV) exist as antigenic variants with varying frequencies and genetic variabilities across the globe. Given the endemicity and high prevalence in Pakistan, we characterized the CPVs originating from dogs-population to elucidate viral diversity and evolution. Fecal samples from clinically diseased pups (n = 17) of different breeds and age (2-6 months) were processed for hemagglutination assay (HA), and later for partial amplification of VP2 gene sequence and amino acid analysis. A total of 11 samples (64.71%) were found positive both in hemagglutination and PCR assays. Phylogenetic and evolutionary analysis demonstrated higher genetic heterogeneity in studied strains and constituted seven clusters within the CPV-2a group, however, they shared high level of identity with Chinese strains. Further studies are necessary to elucidate genetic analysis and epidemiology of CPV variants across a wide geographical area of the country.

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

PubMed

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

Detection of a new bat gammaherpesvirus in the Philippines.

PubMed

Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

2009-08-01

A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

High-speed optical phase-shifting apparatus

DOEpatents

Zortman, William A.

2016-11-08

An optical phase shifter includes an optical waveguide, a plurality of partial phase shifting elements arranged sequentially, and control circuitry electrically coupled to the partial phase shifting elements. The control circuitry is adapted to provide an activating signal to each of the N partial phase shifting elements such that the signal is delayed by a clock cycle between adjacent partial phase shifting elements in the sequence. The transit time for a guided optical pulse train between the input edges of consecutive partial phase shifting elements in the sequence is arranged to be equal to a clock cycle, thereby enabling pipelined processing of the optical pulses.

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

PubMed

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were <90%. This suggests that it is a new member of the genus Polerovirus, and the name pea mild chlorosis virus is proposed.

PSS-3D1D: an improved 3D1D profile method of protein fold recognition for the annotation of twilight zone sequences.

PubMed

Ganesan, K; Parthasarathy, S

2011-12-01

Annotation of any newly determined protein sequence depends on the pairwise sequence identity with known sequences. However, for the twilight zone sequences which have only 15-25% identity, the pair-wise comparison methods are inadequate and the annotation becomes a challenging task. Such sequences can be annotated by using methods that recognize their fold. Bowie et al. described a 3D1D profile method in which the amino acid sequences that fold into a known 3D structure are identified by their compatibility to that known 3D structure. We have improved the above method by using the predicted secondary structure information and employ it for fold recognition from the twilight zone sequences. In our Protein Secondary Structure 3D1D (PSS-3D1D) method, a score (w) for the predicted secondary structure of the query sequence is included in finding the compatibility of the query sequence to the known fold 3D structures. In the benchmarks, the PSS-3D1D method shows a maximum of 21% improvement in predicting correctly the α + β class of folds from the sequences with twilight zone level of identity, when compared with the 3D1D profile method. Hence, the PSS-3D1D method could offer more clues than the 3D1D method for the annotation of twilight zone sequences. The web based PSS-3D1D method is freely available in the PredictFold server at http://bioinfo.bdu.ac.in/servers/ .

Carbohydrate degrading polypeptide and uses thereof

DOEpatents

Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Roubos, Johannes Andries; Los, Alrik Pieter

2015-10-20

The invention relates to a polypeptide having carbohydrate material degrading activity which comprises the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 4, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional protein and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Identification of four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, from an East African population by high-resolution sequence-based typing.

PubMed

Luo, M; Mao, X; Plummer, F A

2005-02-01

We report here four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, identified from an East African population during sequence-based HLA-B typing. The novel alleles were confirmed by sequencing two separate polymerase chain reaction products, and by molecular cloning and sequencing multiple clones. B*1590 is identical to B*1510 at exon 2 and exon 3, except for a difference (GCCGTC) at codon 158. Sequence differences at codon 152 (GAGGTG) and codon 167 (TGGTCG) differentiate B*1591 from B*1503 at exon 3. B*2726 is identical to B*2708 at exon 2 and exon 3, except for a difference (AAGCAG) at codon 70. B*4705 was identified in three Kenyan women. The allele is identical to B*47010101/02 at exon 2 and exon 3, except for differences at codon 97 (AGGAAT) and codon 99 (TTTTAT). These new alleles have been named by the WHO Nomenclature Committee. Identification of these novel HLA-B alleles reflects the genetic diversity of this East African population.

Prevalence and genotypic characterization of bovine Echinococcus granulosus isolates by using cytochrome oxidase 1 (Co1) gene in Hyderabad, Pakistan.

PubMed

Ehsan, Muhammad; Akhter, Nasreen; Bhutto, Bachal; Arijo, Abdullah; Ali Gadahi, Javaid

2017-05-30

Cystic echinococcosis is an important zoonotic disease; it has serious impacts on animals as well as human health throughout the world. Genotypic characterization of Echinocossus granulosus (E. granulosus) in buffaloes has not been addressed in Pakistan. Therefore, the present study was conducted to evaluate the incidence and genotypic characterization of bovine E. granulosus. Out of 832 buffaloes examined, 112 (13.46%) were found infected. The favorable site for hydatid cyst development was liver (8.65%) followed by lungs (4.80%). The rate of cystic echinococcosis was found higher in females 14.43% than males 9.77%. The females above seven years aged were more infected as compared to the young ones. The partial sequence of mitochondrial cytochrome oxidase 1 (CO1) gene was used for identification and molecular analysis of buffalo's E. granulosus isolates. The alignment of redundant sequences were compared with already identified 10 genotypes available at National Centre for Biotechnology Information (NCBI) GenBank. The sequencing and phylogenetic analysis of all randomly selected buffalo isolates were belong to the G1- G3 complex (E. granulosus sensu stricto). All sequences were diverse from the reference sequence. No one showed complete identity to the buffalo strain (G3), representing substantial microsequence variability in G1, G2 and G3 genotypes. We evaluated the echinococcal infectivity and first time identification of genotypes in buffaloes in Sindh, Pakistan. This study will lead to determine accurate source of this zoonotic disease to humans in Pakistan. Copyright © 2017 Elsevier B.V. All rights reserved.

Mutant swarms of a totivirus-like entities are present in the red macroalga Chondrus crispus and have been partially transferred to the nuclear genome.

PubMed

Rousvoal, Sylvie; Bouyer, Betty; López-Cristoffanini, Camilo; Boyen, Catherine; Collén, Jonas

2016-08-01

Chondrus crispus Stackhouse (Gigartinales) is a red seaweed found on North Atlantic rocky shores. Electrophoresis of RNA extracts showed a prominent band with a size of around 6,000 bp. Sequencing of the band revealed several sequences with similarity to totiviruses, double-stranded RNA viruses that normally infect fungi. This virus-like entity was named C. crispus virus (CcV). It should probably be regarded as an extreme viral quasispecies or a mutant swarm since low identity (<65%) was found between sequences. Totiviruses typically code for two genes: one capsid gene (gag) and one RNA-dependent RNA polymerase gene (pol) with a pseudoknot structure between the genes. Both the genes and the intergenic structures were found in the CcV sequences. A nonidentical gag gene was also found in the nuclear genome of C. crispus, with associated expressed sequence tags (EST) and upstream regulatory features. The gene was presumably horizontally transferred from the virus to the alga. Similar dsRNA bands were seen in extracts from different life cycle stages of C. crispus and from all geographic locations tested. In addition, similar bands were also observed in RNA extractions from other red algae; however, the significance of this apparently widespread phenomenon is unknown. Neither phenotype caused by the infection nor any virus particles or capsid proteins were identified; thus, the presence of viral particles has not been validated. These findings increase the known host range of totiviruses to include marine red algae. © 2016 Phycological Society of America.

Sequencing, bioinformatic characterization and expression pattern of a putative amino acid transporter from the parasitic cestode Echinococcus granulosus.

PubMed

Camicia, Federico; Paredes, Rodolfo; Chalar, Cora; Galanti, Norbel; Kamenetzky, Laura; Gutierrez, Ariana; Rosenzvit, Mara C

2008-03-31

We have sequenced and partially characterized an Echinococcus granulosus cDNA, termed egat1, from a protoscolex signal sequence trap (SST) cDNA library. The isolated 1627 bp long cDNA contains an ORF of 489 amino acids and shows an amino acid identity of 30% with neutral and excitatory amino acid transporters members of the Dicarboxylate/Amino Acid Na+ and/or H+ Cation Symporter family (DAACS) (TC 2.A.23). Additional bioinformatics analysis of EgAT1, confirmed the results obtained by similarity searches and showed the presence of 9 to 10 transmembrane domains, consensus sequences for N-glycosylation between the third and fourth transmembrane domain, a highly similar hydropathy profile with ASCT1 (a known member of DAACS family), high score with SDF (Sodium Dicarboxilate Family) and similar motifs with EDTRANSPORT, a fingerprint of excitatory amino acid transporters. The localization of the putative amino acid transporter was analyzed by in situ hybridization and immunofluorescence in protoscoleces and associated germinal layer. The in situ hybridization labelling indicates the distribution of egat1 mRNA throughout the tegument. EgAT1 protein, which showed in Western blots a molecular mass of approximately 60 kD, is localized in the subtegumental region of the metacestode, particularly around suckers and rostellum of protoscoleces and layers from brood capsules. The sequence and expression analyses of EgAT1 pave the way for functional analysis of amino acids transporters of E. granulosus and its evaluation as new drug targets against cystic echinococcosis.

Discrimination between Demodex folliculorum (Acari: Demodicidae) isolates from China and Spain based on mitochondrial cox1 sequences*

PubMed Central

Zhao, Ya-e; Ma, Jun-xian; Hu, Li; Wu, Li-ping; De Rojas, Manuel

2013-01-01

For a long time, classification of Demodex mites has been based mainly on their hosts and phenotypic characteristics. A new subspecies of Demodex folliculorum has been proposed, but not confirmed. Here, cox1 partial sequences of nine isolates of three Demodex species from two geographical sources (China and Spain) were studied to conduct molecular identification of D. folliculorum. Sequencing showed that the mitochondrial cox1 fragments of five D. folliculorum isolates from the facial skin of Chinese individuals were 429 bp long and that their sequence identity was 97.4%. The average sequence divergence was 1.24% among the five Chinese isolates, 0.94% between the two geographical isolate groups (China (5) and Spain (1)), and 2.15% between the two facial tissue sources (facial skin (6) and eyelids (1)). The genetic distance and rate of third-position nucleotide transition/transversion were 0.0125, 2.7 (3/1) among the five Chinese isolates, 0.0094, 3.1 (3/1) between the two geographical isolate groups, and 0.0217, 4.4 (3/1) between the two facial tissue sources. Phylogenetic trees showed that D. folliculorum from the two geographical isolate groups did not form sister clades, while those from different facial tissue sources did. According to the molecular characteristics, it appears that subspecies differentiation might not have occurred and that D. folliculorum isolates from the two geographical sources are of the same population. However, population differentiation might be occurring between isolates from facial skin and eyelids. PMID:24009203

Lelliottia aquatilis sp. nov., isolated from drinking water.

PubMed

Kämpfer, Peter; Glaeser, Stefanie P; Packroff, Gabriele; Behringer, Katja; Exner, Martin; Chakraborty, Trinad; Schmithausen, Ricarda M; Doijad, Swapnil

2018-06-22

Five beige-pigmented, oxidase-negative bacterial isolates, 6331-17 T , 6332-17, 6333-17, 6334-17 and 9827-07, isolated either from a drinking water storage reservoir or drinking water in 2006 and 2017 in Germany, were examined in detail applying by a polyphasic taxonomic approach. Cells of the isolates were rod-shaped and Gram-stain-negative. Comparison of the 16S rRNA gene sequences of these five isolates showed highest sequence similarities to Lelliottia amnigena (99.98 %) and Lelliottia nimipressuralis (99.99 %). Multilocus sequence analyses based on concatenated partial rpoB, gyrB, infB and atpD sequences confirmed the clustering of these isolates with Lelliottia species, but also revealed a clear distinction to the closest related type strains. Analysis of the genome sequences of these isolates indicated >70 % in silico DNA-DNA hybridization and high average nucleotide identities between strains. Nevertheless, they showed only <70 and <95 % similarity to the type strains of these two Lelliottia species. The fatty acid profiles of these isolates were very similar and consisted of the major fatty acids C16:0, C17 : 0cyclo, C15 : 0iso 2-OH/C16 : 1ω7c and C18 : 1ω7c. In addition, physiological/biochemical tests revealed high phenotypic similarity to each other. These cumulative data indicate that these isolates represent a novel Lelliottia species, for which the name Lelliottia aquatilis sp. nov. is proposed, with strain 6331-17 T (=CCM 8846 T =CIP 111609 T =LMG 30560 T ) as the type strain.

Molecular characterization of Echinococcus granulosus isolated from sheep in Palestine.

PubMed

Adwan, Ghaleb; Adwan, Kamel; Bdir, Sami; Abuseir, Sameh

2013-06-01

A total of twenty-three Echinococcus granulosus hydatid cysts were collected from infected sheep slaughtered in Nablus abattoir, Nablus - Palestine. Protoscoleces or germinal membranes were used for DNA extraction followed by PCR amplification. Amplified products were analyzed the presence of a fragment of 444bp of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene followed by nucleotide sequencing. Overall, 21 hydatid cysts were positive compared to a negative control. The partial sequences of cox1 gene of E. granulosus strains indicated that the sheep in Palestine were infected with genotype 1 (G1), genotype 2 (G2) and genotype 3 (G3). The prevalence of these genotypes was (14/21) 66.7%, (4/21) 19.0% and (3/21) 14.3% for G1, G2 and G3, respectively. Our results showed that twelve strains of G1 belonged to the common haplotype EG01 which is the major haplotype in all the geographic populations. Phylogenetic analysis also showed that two sequences of G1 genotype which have GenBank accession No. KC109657 and KC109659 were corresponding to G1.4 micro-variants. Only the sequence of GenBank accession No. KC109652 identified in our study as G2 was found to have complete identity to the original sequence described for the cox1 gene (GenBank accession No. M84662). It is concluded that G1 genotype is the predominant genotype in sheep in Palestine. Therefore, these findings should be taken into consideration in developing prevention strategies and control programs for hydatidosis in Palestine. Copyright © 2013 Elsevier Inc. All rights reserved.

Flavivirus and Filovirus EvoPrinters: New alignment tools for the comparative analysis of viral evolution.

PubMed

Brody, Thomas; Yavatkar, Amarendra S; Park, Dong Sun; Kuzin, Alexander; Ross, Jermaine; Odenwald, Ward F

2017-06-01

Flavivirus and Filovirus infections are serious epidemic threats to human populations. Multi-genome comparative analysis of these evolving pathogens affords a view of their essential, conserved sequence elements as well as progressive evolutionary changes. While phylogenetic analysis has yielded important insights, the growing number of available genomic sequences makes comparisons between hundreds of viral strains challenging. We report here a new approach for the comparative analysis of these hemorrhagic fever viruses that can superimpose an unlimited number of one-on-one alignments to identify important features within genomes of interest. We have adapted EvoPrinter alignment algorithms for the rapid comparative analysis of Flavivirus or Filovirus sequences including Zika and Ebola strains. The user can input a full genome or partial viral sequence and then view either individual comparisons or generate color-coded readouts that superimpose hundreds of one-on-one alignments to identify unique or shared identity SNPs that reveal ancestral relationships between strains. The user can also opt to select a database genome in order to access a library of pre-aligned genomes of either 1,094 Flaviviruses or 460 Filoviruses for rapid comparative analysis with all database entries or a select subset. Using EvoPrinter search and alignment programs, we show the following: 1) superimposing alignment data from many related strains identifies lineage identity SNPs, which enable the assessment of sublineage complexity within viral outbreaks; 2) whole-genome SNP profile screens uncover novel Dengue2 and Zika recombinant strains and their parental lineages; 3) differential SNP profiling identifies host cell A-to-I hyper-editing within Ebola and Marburg viruses, and 4) hundreds of superimposed one-on-one Ebola genome alignments highlight ultra-conserved regulatory sequences, invariant amino acid codons and evolutionarily variable protein-encoding domains within a single genome. EvoPrinter allows for the assessment of lineage complexity within Flavivirus or Filovirus outbreaks, identification of recombinant strains, highlights sequences that have undergone host cell A-to-I editing, and identifies unique input and database SNPs within highly conserved sequences. EvoPrinter's ability to superimpose alignment data from hundreds of strains onto a single genome has allowed us to identify unique Zika virus sublineages that are currently spreading in South, Central and North America, the Caribbean, and in China. This new set of integrated alignment programs should serve as a useful addition to existing tools for the comparative analysis of these viruses.

G to A substitution in 5{prime} donor splice site of introns 18 and 48 of COL1A1 gene of type I collagen results in different splicing alternatives in osteogenesis imperfecta type I cell strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.; Deschenes, S.

We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exonmore » 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.« less

Redescription and phylogenetic position of Myxobolus aeglefini and Myxobolus platessae n. comb. (Myxosporea), parasites in the cartilage of some North Atlantic marine fishes, with notes on the phylogeny and classification of the Platysporina.

PubMed

Karlsbakk, Egil; Kristmundsson, Árni; Albano, Marco; Brown, Paul; Freeman, Mark A

2017-02-01

Myxobolus 'aeglefini' Auerbach, 1906 was originally described from cranial cartilage of North sea haddock (Melanogrammus aeglefinus), but has subsequently been recorded from cartilaginous tissues of a range of other gadoid hosts, from pleuronectids and from lumpsucker (Cyclopterus lumpus) in the North Atlantic and from a zoarcid fish in the Japan Sea (Pacific). We obtained partial small-subunit rDNA sequences of Myxobolus 'aeglefini' from gadoids and pleuronectids from Norway and Iceland. The sequences from gadoids and pleuronectids represented two different genotypes, showing 98.2% identity. Morphometric studies on the spores from selected gadids and pleuronectids revealed slight but statistically significant differences in spore dimensions associated with the genotypes, the spores from pleuronectids were thicker and with larger polar capsules. We identify the morpho- and genotype from gadoids with Myxobolus 'aeglefini' sensu Auerbach, and the one from pleuronectids with Sphaerospora platessae Woodcock, 1904 as Myxobolus platessae n. comb. The latter species was originally described from Irish Sea plaice (Pleuronectes platessa). Myxobolus albi Picon et al., 2009 described from the common goby Pomatoschistus microps in Scotland is a synonym of M. 'aeglefini'. The Pacific Myxobolus 'aeglefini' represents a separate species, showing only 97.4-97.6% identity to the Atlantic species. In phylogenetic analyses based on SSU rDNA sequences, these and some related marine chondrotropic Myxobolus spp. form a distinct well supported group. This clusters with freshwater and marine myxobolids and Triangula and Cardimyxobolus species, in a basal clade in the phylogeny of the Platysporina. Members of family Myxobilatidae, Ortholinea spp. (currently Ortholineidae) and sequences of some other urinary system infecting myxosporeans form a well supported clade among members of the suborder Platysporina. Based on phylogenetic analyses, we propose the following changes to the classification of Myxosporea: i) Ortholineidae is dismantled and Ortholinea spp. transferred to Myxobilatidae, and ii) Myxobilatidae is transferred from suborder Variisporina to Platysporina. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Rabbit haemorrhagic disease virus 2 (RHDV2) outbreak in Azores: Disclosure of common genetic markers and phylogenetic segregation within the European strains.

PubMed

Duarte, Margarida; Carvalho, Carina; Bernardo, Susana; Barros, Sílvia Vanessa; Benevides, Sandra; Flor, Lídia; Monteiro, Madalena; Marques, Isabel; Henriques, Margarida; Barros, Sílvia C; Fagulha, Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel

2015-10-01

Rabbit haemorrhagic disease virus 2 (RHDV2) is widespread in several countries of Western Europe, but it has not been introduced to other continents. However, between late 2014 and early 2015, the presence of RHDV2 was confirmed outside of the European continent, in the Azores, initially in the islands of Graciosa, Flores, S. Jorge and Terceira. In this study we report the subsequent detection of RHDV2 in wild rabbits from the islands of Faial, St. Maria and S. Miguel, and display the necropsy and microscopic examination data obtained, which showed lesions similar to those induced by classical strains of RHDV, with severe affection of lungs and liver. We also disclose the result of a genetic investigation carried out with RHDV2 positive samples from wild rabbits found dead in the seven islands. Partial vp60 sequences were amplified from 27 tissue samples. Nucleotide analysis showed that the Azorean strains are closely related to each other, sharing a high genetic identity (>99.15%). None of the obtained sequences were identical to any RHDV2 sequence publically known, hampering a clue for the source of the outbreaks. However, Bayesian and maximum likelihood phylogenetic analyses disclosed that Azorean strains are more closely related to a few strains from Southern Portugal than with any others presently known. In the analysed region comprising the terminal 942 nucleotides of the vp60 gene, four new single nucleotide polymorphisms (SNP) were identified. Based on the present data, these four SNPs, which are unique in the strains from Azores, may constitute putative molecular geographic markers for Azorean RHDV2 strains, if they persist in the future. One of these variations is a non-synonymous substitution that involves the replacement of one amino acid in a hypervariable region of the capsid protein. Copyright © 2015 Elsevier B.V. All rights reserved.

The Protein Identifier Cross-Referencing (PICR) service: reconciling protein identifiers across multiple source databases.

PubMed

Côté, Richard G; Jones, Philip; Martens, Lennart; Kerrien, Samuel; Reisinger, Florian; Lin, Quan; Leinonen, Rasko; Apweiler, Rolf; Hermjakob, Henning

2007-10-18

Each major protein database uses its own conventions when assigning protein identifiers. Resolving the various, potentially unstable, identifiers that refer to identical proteins is a major challenge. This is a common problem when attempting to unify datasets that have been annotated with proteins from multiple data sources or querying data providers with one flavour of protein identifiers when the source database uses another. Partial solutions for protein identifier mapping exist but they are limited to specific species or techniques and to a very small number of databases. As a result, we have not found a solution that is generic enough and broad enough in mapping scope to suit our needs. We have created the Protein Identifier Cross-Reference (PICR) service, a web application that provides interactive and programmatic (SOAP and REST) access to a mapping algorithm that uses the UniProt Archive (UniParc) as a data warehouse to offer protein cross-references based on 100% sequence identity to proteins from over 70 distinct source databases loaded into UniParc. Mappings can be limited by source database, taxonomic ID and activity status in the source database. Users can copy/paste or upload files containing protein identifiers or sequences in FASTA format to obtain mappings using the interactive interface. Search results can be viewed in simple or detailed HTML tables or downloaded as comma-separated values (CSV) or Microsoft Excel (XLS) files suitable for use in a local database or a spreadsheet. Alternatively, a SOAP interface is available to integrate PICR functionality in other applications, as is a lightweight REST interface. We offer a publicly available service that can interactively map protein identifiers and protein sequences to the majority of commonly used protein databases. Programmatic access is available through a standards-compliant SOAP interface or a lightweight REST interface. The PICR interface, documentation and code examples are available at http://www.ebi.ac.uk/Tools/picr.

The Protein Identifier Cross-Referencing (PICR) service: reconciling protein identifiers across multiple source databases

PubMed Central

Côté, Richard G; Jones, Philip; Martens, Lennart; Kerrien, Samuel; Reisinger, Florian; Lin, Quan; Leinonen, Rasko; Apweiler, Rolf; Hermjakob, Henning

2007-01-01

Background Each major protein database uses its own conventions when assigning protein identifiers. Resolving the various, potentially unstable, identifiers that refer to identical proteins is a major challenge. This is a common problem when attempting to unify datasets that have been annotated with proteins from multiple data sources or querying data providers with one flavour of protein identifiers when the source database uses another. Partial solutions for protein identifier mapping exist but they are limited to specific species or techniques and to a very small number of databases. As a result, we have not found a solution that is generic enough and broad enough in mapping scope to suit our needs. Results We have created the Protein Identifier Cross-Reference (PICR) service, a web application that provides interactive and programmatic (SOAP and REST) access to a mapping algorithm that uses the UniProt Archive (UniParc) as a data warehouse to offer protein cross-references based on 100% sequence identity to proteins from over 70 distinct source databases loaded into UniParc. Mappings can be limited by source database, taxonomic ID and activity status in the source database. Users can copy/paste or upload files containing protein identifiers or sequences in FASTA format to obtain mappings using the interactive interface. Search results can be viewed in simple or detailed HTML tables or downloaded as comma-separated values (CSV) or Microsoft Excel (XLS) files suitable for use in a local database or a spreadsheet. Alternatively, a SOAP interface is available to integrate PICR functionality in other applications, as is a lightweight REST interface. Conclusion We offer a publicly available service that can interactively map protein identifiers and protein sequences to the majority of commonly used protein databases. Programmatic access is available through a standards-compliant SOAP interface or a lightweight REST interface. The PICR interface, documentation and code examples are available at . PMID:17945017

cDNA cloning and initial characterization of CYP3A43, a novel human cytochrome P450.

PubMed

Domanski, T L; Finta, C; Halpert, J R; Zaphiropoulos, P G

2001-02-01

The RACE amplification technology was used on a novel CYP3A-like exon 1 sequence detected during the reverse transcriptase/polymerase chain reaction analysis of human CYP3A gene expression. This resulted in the identification of cDNAs encompassing the complete coding sequence of a new member of the CYP3A gene subfamily, CYP3A43. Interestingly, the majority of the cDNAs identified were characterized by alternative splicing events such as exon skipping and complete or partial intron inclusion. CYP3A43 expression was detected in liver, kidney, pancreas, and prostate. The amino acid sequence is 75% identical to that of CYP3A4 and CYP3A5 and 71% identical to CYP3A7. CYP3A43 differs from CYP3A4 at six amino acid residues, found within the putative substrate recognition sites of CYP3A4, that are known to be determinants of substrate selectivity. The N terminus of CYP3A43 was modified for efficient expression of the protein in Escherichia coli, and a 6X histidine tag was added at the C terminus to facilitate purification. CYP3A43 gave a reduced carbon monoxide difference spectra with an absorbance maximum at 450 nm. The level of heterologous expression was significantly lower than that observed for CYP3A4 and CYP3A5. Immunoblot analyses revealed that CYP3A43 comigrates with CYP3A4 in polyacrylamide gel electrophoresis but does separate from CYP3A5. Monooxygenase assays were performed under a variety of conditions, several of which yielded reproducible, albeit low, testosterone hydroxylase activity. The findings from this study demonstrate that there is a novel CYP3A member expressed in human tissues, although its relative contribution to drug metabolism has yet to be ascertained.

Small-RNA Deep Sequencing Reveals Arctium tomentosum as a Natural Host of Alstroemeria virus X and a New Putative Emaravirus

PubMed Central

Bi, Yaqi; Tugume, Arthur K.; Valkonen, Jari P. T.

2012-01-01

Background Arctium species (Asteraceae) are distributed worldwide and are used as food and rich sources of secondary metabolites for the pharmaceutical industry, e.g., against avian influenza virus. RNA silencing is an antiviral defense mechanism that detects and destroys virus-derived double-stranded RNA, resulting in accumulation of virus-derived small RNAs (21–24 nucleotides) that can be used for generic detection of viruses by small-RNA deep sequencing (SRDS). Methodology/Principal Findings SRDS was used to detect viruses in the biennial wild plant species Arctium tomentosum (woolly burdock; family Asteraceae) displaying virus-like symptoms of vein yellowing and leaf mosaic in southern Finland. Assembly of the small-RNA reads resulted in contigs homologous to Alstroemeria virus X (AlsVX), a positive/single-stranded RNA virus of genus Potexvirus (family Alphaflexiviridae), or related to negative/single-stranded RNA viruses of the genus Emaravirus. The coat protein gene of AlsVX was 81% and 89% identical to the two AlsVX isolates from Japan and Norway, respectively. The deduced, partial nucleocapsid protein amino acid sequence of the emara-like virus was only 78% or less identical to reported emaraviruses and showed no variability among the virus isolates characterized. This virus—tentatively named as Woolly burdock yellow vein virus—was exclusively associated with yellow vein and leaf mosaic symptoms in woolly burdock, whereas AlsVX was detected in only one of the 52 plants tested. Conclusions/Significance These results provide novel information about natural virus infections in Acrtium species and reveal woolly burdock as the first natural host of AlsVX besides Alstroemeria (family Alstroemeriaceae). Results also revealed a new virus related to the recently emerged Emaravirus genus and demonstrated applicability of SRDS to detect negative-strand RNA viruses. SRDS potentiates virus surveys of wild plants, a research area underrepresented in plant virology, and helps reveal natural reservoirs of viruses that cause yield losses in cultivated plants. PMID:22912734

A new polymorphic and multicopy MHC gene family related to nonmammalian class I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leelayuwat, C.; Degli-Esposti, M.A.; Abraham, L.J.

1994-12-31

The authors have used genomic analysis to characterize a region of the central major histocompatibility complex (MHC) spanning {approximately} 300 kilobases (kb) between TNF and HLA-B. This region has been suggested to carry genetic factors relevant to the development of autoimmune diseases such as myasthenia gravis (MG) and insulin dependent diabetes mellitus (IDDM). Genomic sequence was analyzed for coding potential, using two neural network programs, GRAIL and GeneParser. A genomic probe, JAB, containing putative coding sequences (PERB11) located 60 kb centromeric of HLA-B, was used for northern analysis of human tissues. Multiple transcripts were detected. Southern analysis of genomic DNAmore » and overlapping YAC clones, covering the region from BAT1 to HLA-F, indicated that there are at least five copies of PERB11, four of which are located within this region of the MHC. The partial cDNA sequence of PERB11 was obtained from poly-A RNA derived from skeletal muscle. The putative amino acid sequence of PERB11 shares {approximately} 30% identity to MHC class I molecules from various species, including reptiles, chickens, and frogs, as well as to other MHC class I-like molecules, such as the IgG FcR of the mouse and rat and the human Zn-{alpha}2-glycoprotein. From direct comparison of amino acid sequences, it is concluded that PERB11 is a distinct molecule more closely related to nonmammalian than known mammalian MHC class I molecules. Genomic sequence analysis of PERB11 from five MHC ancestral haplotypes (AH) indicated that the gene is polymorphic at both DNA and protein level. The results suggest that the authors have identified a novel polymorphic gene family with multiple copies within the MHC. 48 refs., 10 figs., 2 tabs.« less

The glucose transporter 1 -GLUT1- from the white shrimp Litopenaeus vannamei is up-regulated during hypoxia.

PubMed

Martínez-Quintana, José A; Peregrino-Uriarte, Alma B; Gollas-Galván, Teresa; Gómez-Jiménez, Silvia; Yepiz-Plascencia, Gloria

2014-12-01

During hypoxia the shrimp Litopenaeus vannamei accelerates anaerobic glycolysis to obtain energy; therefore, a correct supply of glucose to the cells is needed. Facilitated glucose transport across the cells is mediated by a group of membrane embedded integral proteins called GLUT; being GLUT1 the most ubiquitous form. In this work, we report the first cDNA nucleotide and deduced amino acid sequences of a glucose transporter 1 from L. vannamei. A 1619 bp sequence was obtained by RT-PCR and RACE approaches. The 5´ UTR is 161 bp and the poly A tail is exactly after the stop codon in the mRNA. The ORF is 1485 bp and codes for 485 amino acids. The deduced protein sequence has high identity to GLUT1 proteins from several species and contains all the main features of glucose transporter proteins, including twelve transmembrane domains, the conserved motives and amino acids involved in transport activity, ligands binding and membrane anchor. Therefore, we decided to name this sequence, glucose transporter 1 of L. vannamei (LvGLUT1). A partial gene sequence of 8.87 Kbp was also obtained; it contains the complete coding sequence divided in 10 exons. LvGlut1 expression was detected in hemocytes, hepatopancreas, intestine gills, muscle and pleopods. The higher relative expression was found in gills and the lower in hemocytes. This indicates that LvGlut1 is ubiquitously expressed but its levels are tissue-specific and upon short-term hypoxia, the GLUT1 transcripts increase 3.7-fold in hepatopancreas and gills. To our knowledge, this is the first evidence of expression of GLUT1 in crustaceans.

Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

PubMed Central

Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

2015-01-01

The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

New data on epizootiology and genetics of piroplasms based on sequences of small ribosomal subunit and cytochrome b genes.

PubMed

Criado, A; Martinez, J; Buling, A; Barba, J C; Merino, S; Jefferies, R; Irwin, P J

2006-12-20

As a continuation of our studies on molecular epizootiology of piroplasmosis in Spain and other countries, we present in this contribution the finding of new hosts for some piroplasms, as well as information on their 18S rRNA gene sequences. Genetic data were complemented with sequences of apocytochrome b gene (whenever possible). The following conclusions were drawn from these molecular studies: Theileria annulata is capable of infecting dogs, since it was diagnosed in a symptomatic animal. According to cytochrome b sequences, isolates from cows and dog present slight differences. The same isolates showed, however, identical sequence in the 18S rRNA gene. This exemplifies well the usefulness of the mitochondrial gene for examining infra-specific variation. Babesia bovis is an occasional parasite of equines, since it was detected in two symptomatic horses. We found evidence of genetic polymorphism occurring in the 18S rRNA gene of Spanish T. equi-like and B. ovis isolates. B. bennetti from Spanish seagull is loosely related to B. ovis, and might represent a genetically distinct branch of babesids. A partial sequence of a cytochrome b pseudogene was obtained for the first time in Babesia canis rossi from South Africa. The pseudogene is distantly related to B. bigemina cytochrome b gene. These new findings confirm the ability of some piroplasms to infect multiple hosts, as well as the existence of a relatively wide genetic polymorphisms with respect to the cytochrome b gene. On the other hand, the existence of mtDNA-like pseudogenes of possible nuclear location in piroplasms is interesting due to their possible impact on molecular phylogeny studies.

DNA Barcodes of Asian Houbara Bustard (Chlamydotis undulata macqueenii)

PubMed Central

Arif, Ibrahim A.; Khan, Haseeb A.; Williams, Joseph B.; Shobrak, Mohammad; Arif, Waad I.

2012-01-01

Populations of Houbara Bustards have dramatically declined in recent years. Captive breeding and reintroduction programs have had limited success in reviving population numbers and thus new technological solutions involving molecular methods are essential for the long term survival of this species. In this study, we sequenced the 694 bp segment of COI gene of the four specimens of Asian Houbara Bustard (Chlamydotis undulata macqueenii). We also compared these sequences with earlier published barcodes of 11 individuals comprising different families of the orders Gruiformes, Ciconiiformes, Podicipediformes and Crocodylia (out group). The pair-wise sequence comparison showed a total of 254 variable sites across all the 15 sequences from different taxa. Three of the four specimens of Houbara Bustard had an identical sequence of COI gene and one individual showed a single nucleotide difference (G > A transition at position 83). Within the bustard family (Otididae), comparison among the three species (Asian Houbara Bustard, Great Bustard (Otis tarda) and the Little Bustard (Tetrax tetrax)), representing three different genera, showed 116 variable sites. For another family (Rallidae), the intra-family variable sites among the individuals of four different genera were found to be 146. The COI genetic distances among the 15 individuals varied from 0.000 to 0.431. Phylogenetic analysis using 619 bp nucleotide segment of COI clearly discriminated all the species representing different genera, families and orders. All the four specimens of Houbara Bustard formed a single clade and are clearly separated from other two individuals of the same family (Otis tarda and Tetrax tetrax). The nucleotide sequence of partial segment of COI gene effectively discriminated the closely related species. This is the first study reporting the barcodes of Houbara Bustard and would be helpful in future molecular studies, particularly for the conservation of this threatened bird in Saudi Arabia. PMID:22408462

Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

PubMed

Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

2008-06-15

To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

An algorithm to track laboratory zebrafish shoals.

PubMed

Feijó, Gregory de Oliveira; Sangalli, Vicenzo Abichequer; da Silva, Isaac Newton Lima; Pinho, Márcio Sarroglia

2018-05-01

In this paper, a semi-automatic multi-object tracking method to track a group of unmarked zebrafish is proposed. This method can handle partial occlusion cases, maintaining the correct identity of each individual. For every object, we extracted a set of geometric features to be used in the two main stages of the algorithm. The first stage selected the best candidate, based both on the blobs identified in the image and the estimate generated by a Kalman Filter instance. In the second stage, if the same candidate-blob is selected by two or more instances, a blob-partitioning algorithm takes place in order to split this blob and reestablish the instances' identities. If the algorithm cannot determine the identity of a blob, a manual intervention is required. This procedure was compared against a manual labeled ground truth on four video sequences with different numbers of fish and spatial resolution. The performance of the proposed method is then compared against two well-known zebrafish tracking methods found in the literature: one that treats occlusion scenarios and one that only track fish that are not in occlusion. Based on the data set used, the proposed method outperforms the first method in correctly separating fish in occlusion, increasing its efficiency by at least 8.15% of the cases. As for the second, the proposed method's overall performance outperformed the second in some of the tested videos, especially those with lower image quality, because the second method requires high-spatial resolution images, which is not a requirement for the proposed method. Yet, the proposed method was able to separate fish involved in occlusion and correctly assign its identity in up to 87.85% of the cases, without accounting for user intervention. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genome of turbot rhabdovirus exhibits unusual non-coding regions and an additional ORF that could be expressed in fish cell.

PubMed

Zhu, Ruo-Lin; Lei, Xiao-Ying; Ke, Fei; Yuan, Xiu-Ping; Zhang, Qi-Ya

2011-02-01

Genomic sequence of Scophthalmus maximus rhabdovirus (SMRV) isolated from diseased turbot has been characterized. The complete genome of SMRV comprises 11,492 nucleotides and encodes five typical rhabdovirus genes N, P, M, G and L. In addition, two open reading frames (ORF) are predicted overlapping with P gene, one upstream of P and smaller than P (temporarily called Ps), and another in P gene which may encodes a protein similar to the vesicular stomatitis virus C protein. The C ORF is contained within the P ORF. The five typical proteins share the highest sequence identities (48.9%) with the corresponding proteins of rhabdoviruses in genus Vesiculovirus. Phylogenetic analysis of partial L protein sequence indicates that SMRV is close to genus Vesiculovirus. The first 13 nucleotides at the ends of the SMRV genome are absolutely inverse complementarity. The gene junctions between the five genes show conserved polyadenylation signal (CATGA(7)) and intergenic dinucleotide (CT) followed by putative transcription initiation sequence A(A/G)(C/G)A(A/G/T), which are different from known rhabdoviruses. The entire Ps ORF was cloned and expressed, and used to generate polyclonal antibody in mice. One obvious band could be detected in SMRV-infected carp leucocyte cells (CLCs) by anti-Ps/C serum via Western blot, and the subcellular localization of Ps-GFP fusion protein exhibited cytoplasm distribution as multiple punctuate or doughnut shaped foci of uneven size. Copyright © 2010 Elsevier B.V. All rights reserved.

Parallel evolution of chordate cis-regulatory code for development.

PubMed

Doglio, Laura; Goode, Debbie K; Pelleri, Maria C; Pauls, Stefan; Frabetti, Flavia; Shimeld, Sebastian M; Vavouri, Tanya; Elgar, Greg

2013-11-01

Urochordates are the closest relatives of vertebrates and at the larval stage, possess a characteristic bilateral chordate body plan. In vertebrates, the genes that orchestrate embryonic patterning are in part regulated by highly conserved non-coding elements (CNEs), yet these elements have not been identified in urochordate genomes. Consequently the evolution of the cis-regulatory code for urochordate development remains largely uncharacterised. Here, we use genome-wide comparisons between C. intestinalis and C. savignyi to identify putative urochordate cis-regulatory sequences. Ciona conserved non-coding elements (ciCNEs) are associated with largely the same key regulatory genes as vertebrate CNEs. Furthermore, some of the tested ciCNEs are able to activate reporter gene expression in both zebrafish and Ciona embryos, in a pattern that at least partially overlaps that of the gene they associate with, despite the absence of sequence identity. We also show that the ability of a ciCNE to up-regulate gene expression in vertebrate embryos can in some cases be localised to short sub-sequences, suggesting that functional cross-talk may be defined by small regions of ancestral regulatory logic, although functional sub-sequences may also be dispersed across the whole element. We conclude that the structure and organisation of cis-regulatory modules is very different between vertebrates and urochordates, reflecting their separate evolutionary histories. However, functional cross-talk still exists because the same repertoire of transcription factors has likely guided their parallel evolution, exploiting similar sets of binding sites but in different combinations.

cap alpha. /sub i/-3 cDNA encodes the. cap alpha. subunit of G/sub k/, the stimulatory G protein of receptor-regulated K/sup +/ channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Codina, J.; Olate, J.; Abramowitz, J.

1988-05-15

cDNA cloning has identified the presence in the human genome of three genes encoding ..cap alpha.. subunits of pertussis toxin substrates, generically called G/sub i/. They are named ..cap alpha../sub i/-1, ..cap alpha../sub i/-2 and ..cap alpha../sub i/-3. However, none of these genes has been functionally identified with any of the ..cap alpha.. subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A/sub 2/, G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K/sup +/ channels. The authors now report the nucleotide sequence and the complete predicted aminomore » acid sequence of human liver ..cap alpha../sub i/-3 and the partial amino acid sequence of proteolytic fragments of the ..cap alpha.. subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of ..cap alpha../sub i/-3, thus identifying it as ..cap alpha../sub k/. The probable identity of ..cap alpha../sub i/-1 with ..cap alpha../sub p/ and possible roles for ..cap alpha../sub i/-2, as well as additional roles for ..cap alpha../sub i/-1 and ..cap alpha../sub i/-3 (..cap alpha../sub k/) are discussed.« less

West Nile virus, Anopheles flavivirus, a novel flavivirus as well as Merida-like rhabdovirus Turkey in field-collected mosquitoes from Thrace and Anatolia.

PubMed

Öncü, Ceren; Brinkmann, Annika; Günay, Filiz; Kar, Sırrı; Öter, Kerem; Sarıkaya, Yasemen; Nitsche, Andreas; Linton, Yvonne-Marie; Alten, Bülent; Ergünay, Koray

2018-01-01

Mosquitoes are involved in the transmission and maintenance of several viral diseases with significant health impact. Biosurveillance efforts have also revealed insect-specific viruses, observed to cocirculate with pathogenic strains. This report describes the findings of flavivirus and rhabdovirus screening, performed in eastern Thrace and Aegean region of Anatolia during 2016, including and expanding on locations with previously-documented virus activity. A mosquito cohort of 1545 individuals comprising 14 species were collected and screened in 108 pools via generic and specific amplification and direct metagenomics by next generation sequencing. Seven mosquito pools (6.4%) were positive in the flavivirus screening. West Nile virus lineage 1 clade 1a sequences were characterized in a pool Culex pipiens sensu lato specimens, providing the initial virus detection in Aegean region following 2010 outbreak. In an Anopheles maculipennis sensu lato pool, sequences closely-related to Anopheles flaviviruses were obtained, with similarities to several African and Australian strains of this new insect-specific flavivirus clade. In pools comprising Uranotaenia unguiculata (n=3), Cx. pipiens s.l. (n=1) and Aedes caspius (n=1) mosquitoes, sequences of a novel flavivirus, distantly-related to Flavivirus AV2011, identified previously in Spain and Turkey, were characterized. Moreover, DNA forms of the novel flavivirus were detected in two Ur. unguiculata pools. These sequences were highly-similar to the sequences amplified from viral RNA, with undisrupted reading frames, suggest the occurrence of viral DNA forms in natural conditions within mosquito hosts. Rhabdovirus screening revealed sequences of a recently-described novel virus, named the Merida-like virus Turkey (MERDLVT) in 5 Cx. pipiens s.l. pools (4.6%). Partial L and N gene sequences of MERDLVT were well-conserved among strains, with evidence for geographical clustering in phylogenetic analyses. Metagenomics provided the near-full genomic sequence in a specimen, revealing an identical genome organization and limited divergence from the prototype MERDLVT isolate. Copyright © 2017 Elsevier B.V. All rights reserved.

High Variety of Known and New RNA and DNA Viruses of Diverse Origins in Untreated Sewage

PubMed Central

Ng, Terry Fei Fan; Marine, Rachel; Wang, Chunlin; Simmonds, Peter; Kapusinszky, Beatrix; Bodhidatta, Ladaporn; Oderinde, Bamidele Soji; Wommack, K. Eric

2012-01-01

Deep sequencing of untreated sewage provides an opportunity to monitor enteric infections in large populations and for high-throughput viral discovery. A metagenomics analysis of purified viral particles in untreated sewage from the United States (San Francisco, CA), Nigeria (Maiduguri), Thailand (Bangkok), and Nepal (Kathmandu) revealed sequences related to 29 eukaryotic viral families infecting vertebrates, invertebrates, and plants (BLASTx E score, <10−4), including known pathogens (>90% protein identities) in numerous viral families infecting humans (Adenoviridae, Astroviridae, Caliciviridae, Hepeviridae, Parvoviridae, Picornaviridae, Picobirnaviridae, and Reoviridae), plants (Alphaflexiviridae, Betaflexiviridae, Partitiviridae, Sobemovirus, Secoviridae, Tombusviridae, Tymoviridae, Virgaviridae), and insects (Dicistroviridae, Nodaviridae, and Parvoviridae). The full and partial genomes of a novel kobuvirus, salivirus, and sapovirus are described. A novel astrovirus (casa astrovirus) basal to those infecting mammals and birds, potentially representing a third astrovirus genus, was partially characterized. Potential new genera and families of viruses distantly related to members of the single-stranded RNA picorna-like virus superfamily were genetically characterized and named Picalivirus, Secalivirus, Hepelivirus, Nedicistrovirus, Cadicistrovirus, and Niflavirus. Phylogenetic analysis placed these highly divergent genomes near the root of the picorna-like virus superfamily, with possible vertebrate, plant, or arthropod hosts inferred from nucleotide composition analysis. Circular DNA genomes distantly related to the plant-infecting Geminiviridae family were named Baminivirus, Nimivirus, and Niminivirus. These results highlight the utility of analyzing sewage to monitor shedding of viral pathogens and the high viral diversity found in this common pollutant and provide genetic information to facilitate future studies of these newly characterized viruses. PMID:22933275

Infection of Taenia asiatica in a Bai Person in Dali, China.

PubMed

Wang, Li; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Zhang, Shaohua; Li, Hailong; Cai, Xuepeng

2016-02-01

We report here a human case of Taenia asiatica infection which was confirmed by genetic analyses in Dali, China. A patient was found to have symptoms of taeniasis with discharge of tapeworm proglottids. By sequencing of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene, we observed nucleotide sequence identity of 99% with T. asiatica and 96% with T. saginata. Using the cytochrome b (cytb) gene, 99% identity with T. asiatica and 96% identity with T. saginata were found. Our findings suggest that taeniasis of people in Dali, China may be mainly caused by T. asiatica.

Infection of Taenia asiatica in a Bai Person in Dali, China

PubMed Central

Wang, Li; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Zhang, Shaohua; Li, Hailong; Cai, Xuepeng

2016-01-01

We report here a human case of Taenia asiatica infection which was confirmed by genetic analyses in Dali, China. A patient was found to have symptoms of taeniasis with discharge of tapeworm proglottids. By sequencing of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene, we observed nucleotide sequence identity of 99% with T. asiatica and 96% with T. saginata. Using the cytochrome b (cytb) gene, 99% identity with T. asiatica and 96% identity with T. saginata were found. Our findings suggest that taeniasis of people in Dali, China may be mainly caused by T. asiatica. PMID:26951981

Precursors of vertebrate peptide antibiotics dermaseptin b and adenoregulin have extensive sequence identities with precursors of opioid peptides dermorphin, dermenkephalin, and deltorphins.

PubMed

Amiche, M; Ducancel, F; Mor, A; Boulain, J C; Menez, A; Nicolas, P

1994-07-08

The dermaseptins are a family of broad spectrum antimicrobial peptides, 27-34 amino acids long, involved in the defense of the naked skin of frogs against microbial invasion. They are the first vertebrate peptides to show lethal effects against the filamentous fungi responsible for severe opportunistic infections accompanying immunodeficiency syndrome and the use of immunosuppressive agents. A cDNA library was constructed from skin poly(A+) RNA of the arboreal frog Phyllomedusa bicolor and screened with an oligonucleotide probe complementary to the COOH terminus of dermaseptin b. Several clones contained a full-length DNA copy of a 443-nucleotide mRNA that encoded a 78-residue dermaseptin b precursor protein. The deduced precursor contained a putative signal sequence at the NH2 terminus, a 20-residue spacer sequence extremely rich (60%) in glutamic and aspartic acids, and a single copy of a dermaseptin b progenitor sequence at the COOH terminus. One clone contained a complete copy of adenoregulin, a 33-residue peptide reported to enhance the binding of agonists to the A1 adenosine receptor. The mRNAs encoding adenoregulin and dermaseptin b were very similar: 70 and 75% nucleotide identities between the 5'- and 3'-untranslated regions, respectively; 91% amino acid identity between the signal peptides; 82% identity between the acidic spacer sequences; and 38% identity between adenoregulin and dermaseptin b. Because adenoregulin and dermaseptin b have similar precursor designs and antimicrobial spectra, adenoregulin should be considered as a new member of the dermaseptin family and alternatively named dermaseptin b II. Preprodermaseptin b and preproadenoregulin have considerable sequence identities to the precursors encoding the opioid heptapeptides dermorphin, dermenkephalin, and deltorphins. This similarity extended into the 5'-untranslated regions of the mRNAs. These findings suggest that the genes encoding the four preproproteins are all members of the same family despite the fact that they encode end products having very different biological activities. These genes might contain a homologous export exon comprising the 5'-untranslated region, the 22-residue signal peptide, the 20-24-residue acidic spacer, and the basic pair Lys-Arg.

Application of Genotyping during an Extensive Outbreak of Waterborne Giardiasis in Bergen, Norway, during Autumn and Winter 2004†

PubMed Central

Robertson, L. J.; Hermansen, L.; Gjerde, B. K.; Strand, E.; Alvsvåg, J. O.; Langeland, N.

2006-01-01

During the autumn and winter of 2004 and 2005, an extensive outbreak of waterborne giardiasis occurred in Bergen, Norway. Over 1,500 patients were diagnosed with giardiasis. Analysis of water from the implicated source revealed low numbers of Giardia cysts, but the initial contamination event probably occurred up to 10 weeks previously. While sewage leakage from a residential area is now considered to be the probable source of contamination, during the episode waste from one particular septic tank was thought to be a possible source. Genotyping of cysts from the septic tank demonstrated that they were assemblage A cysts, although the sequences were not identical to any previously published sequences. For the β-giardin gene, the closest published subgenotype was subgenotype A3; for the gdh gene, the closest published subgenotype was subgenotype A2. Genotyping of cysts from 21 patient samples revealed that they were assemblage B cysts; thus, the septic tank was unlikely to be the contamination source. Sequencing of the β-giardin and gdh genes from patient samples and a comparison of the sequences gave complex results. For the β-giardin gene, three isolates had sequences identical to subgenotype B3 sequences. However, other isolates had between one and four single-nucleotide polymorphisms (SNPs). For the gdh gene, none of the sequences were identical to the sequence published for subgenotype B3, and the sequences had between one and three SNPs. One isolate, which was identical to subgenotype B3 at the β-giardin gene, was more similar to subgenotype B2 at the gdh gene. Grouping the isolates on the basis of SNPs resulted in different groups for the two genes. The results are discussed in relation to giardiasis in Norway and to other Giardia genotyping studies. PMID:16517674

Microbial genomic taxonomy

PubMed Central

2013-01-01

A need for a genomic species definition is emerging from several independent studies worldwide. In this commentary paper, we discuss recent studies on the genomic taxonomy of diverse microbial groups and a unified species definition based on genomics. Accordingly, strains from the same microbial species share >95% Average Amino Acid Identity (AAI) and Average Nucleotide Identity (ANI), >95% identity based on multiple alignment genes, <10 in Karlin genomic signature, and > 70% in silico Genome-to-Genome Hybridization similarity (GGDH). Species of the same genus will form monophyletic groups on the basis of 16S rRNA gene sequences, Multilocus Sequence Analysis (MLSA) and supertree analysis. In addition to the established requirements for species descriptions, we propose that new taxa descriptions should also include at least a draft genome sequence of the type strain in order to obtain a clear outlook on the genomic landscape of the novel microbe. The application of the new genomic species definition put forward here will allow researchers to use genome sequences to define simultaneously coherent phenotypic and genomic groups. PMID:24365132

Complete Nucleotide Sequence of Watermelon Chlorotic Stunt Virus Originating from Oman

PubMed Central

Khan, Akhtar J.; Akhtar, Sohail; Briddon, Rob W.; Ammara, Um; Al-Matrooshi, Abdulrahman M.; Mansoor, Shahid

2012-01-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6–99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93–98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed. PMID:22852046

Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

PubMed

Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

2012-07-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

DNA sequences of three beta-1,4-endoglucanase genes from Thermomonospora fusca.

PubMed Central

Lao, G; Ghangas, G S; Jung, E D; Wilson, D B

1991-01-01

The DNA sequences of the Thermomonospora fusca genes encoding cellulases E2 and E5 and the N-terminal end of E4 were determined. Each sequence contains an identical 14-bp inverted repeat upstream of the initiation codon. There were no significant homologies between the coding regions of the three genes. The E2 gene is 73% identical to the celA gene from Microbispora bispora, but this was the only homology found with other cellulase genes. E2 belongs to a family of cellulases that includes celA from M. bispora, cenA from Cellulomonas fimi, casA from an alkalophilic Streptomyces strain, and cellobiohydrolase II from Trichoderma reesei. E4 shows 44% identity to an avocado cellulase, while E5 belongs to the Bacillus cellulase family. There were strong similarities between the amino acid sequences of the E2 and E5 cellulose binding domains, and these regions also showed homology with C. fimi and Pseudomonas fluorescens cellulose binding domains. PMID:1904434

Genetic Diversity of Crimean Congo Hemorrhagic Fever Virus Strains from Iran

PubMed Central

Chinikar, Sadegh; Bouzari, Saeid; Shokrgozar, Mohammad Ali; Mostafavi, Ehsan; Jalali, Tahmineh; Khakifirouz, Sahar; Nowotny, Norbert; Fooks, Anthony R.; Shah-Hosseini, Nariman

2016-01-01

Background: Crimean Congo hemorrhagic fever virus (CCHFV) is a member of the Bunyaviridae family and Nairovirus genus. It has a negative-sense, single stranded RNA genome approximately 19.2 kb, containing the Small, Medium, and Large segments. CCHFVs are relatively divergent in their genome sequence and grouped in seven distinct clades based on S-segment sequence analysis and six clades based on M-segment sequences. Our aim was to obtain new insights into the molecular epidemiology of CCHFV in Iran. Methods: We analyzed partial and complete nucleotide sequences of the S and M segments derived from 50 Iranian patients. The extracted RNA was amplified using one-step RT-PCR and then sequenced. The sequences were analyzed using Mega5 software. Results: Phylogenetic analysis of partial S segment sequences demonstrated that clade IV-(Asia 1), clade IV-(Asia 2) and clade V-(Europe) accounted for 80 %, 4 % and 14 % of the circulating genomic variants of CCHFV in Iran respectively. However, one of the Iranian strains (Iran-Kerman/22) was associated with none of other sequences and formed a new clade (VII). The phylogenetic analysis of complete S-segment nucleotide sequences from selected Iranian CCHFV strains complemented with representative strains from GenBank revealed similar topology as partial sequences with eight major clusters. A partial M segment phylogeny positioned the Iranian strains in either association with clade III (Asia-Africa) or clade V (Europe). Conclusion: The phylogenetic analysis revealed subtle links between distant geographic locations, which we propose might originate either from international livestock trade or from long-distance carriage of CCHFV by infected ticks via bird migration. PMID:27308271

Molecular confirmation of Hepatozoon canis in Mauritius.

PubMed

Daskalaki, Aikaterini Alexandra; Ionică, Angela Monica; Jeetah, Keshav; Gherman, Călin Mircea; Mihalca, Andrei Daniel

2018-01-01

In this study, Hepatozoon species was molecularly identified and characterized for the first time on the Indian Ocean island of Mauritius. Partial sequences of the 18S rRNA gene of the Hepatozoon isolates were analysed from three naturally infected dogs. The sequences of H. canis were similar to the 18S rRNA partial sequences (JX112783, AB365071 99%) from dog blood samples from West Indies and Nigeria. Our sequences were deposited in the GenBank database. Copyright © 2017 Elsevier B.V. All rights reserved.

Differential gene expression in the siphonophore Nanomia bijuga (Cnidaria) assessed with multiple next-generation sequencing workflows.

PubMed

Siebert, Stefan; Robinson, Mark D; Tintori, Sophia C; Goetz, Freya; Helm, Rebecca R; Smith, Stephen A; Shaner, Nathan; Haddock, Steven H D; Dunn, Casey W

2011-01-01

We investigated differential gene expression between functionally specialized feeding polyps and swimming medusae in the siphonophore Nanomia bijuga (Cnidaria) with a hybrid long-read/short-read sequencing strategy. We assembled a set of partial gene reference sequences from long-read data (Roche 454), and generated short-read sequences from replicated tissue samples that were mapped to the references to quantify expression. We collected and compared expression data with three short-read expression workflows that differ in sample preparation, sequencing technology, and mapping tools. These workflows were Illumina mRNA-Seq, which generates sequence reads from random locations along each transcript, and two tag-based approaches, SOLiD SAGE and Helicos DGE, which generate reads from particular tag sites. Differences in expression results across workflows were mostly due to the differential impact of missing data in the partial reference sequences. When all 454-derived gene reference sequences were considered, Illumina mRNA-Seq detected more than twice as many differentially expressed (DE) reference sequences as the tag-based workflows. This discrepancy was largely due to missing tag sites in the partial reference that led to false negatives in the tag-based workflows. When only the subset of reference sequences that unambiguously have tag sites was considered, we found broad congruence across workflows, and they all identified a similar set of DE sequences. Our results are promising in several regards for gene expression studies in non-model organisms. First, we demonstrate that a hybrid long-read/short-read sequencing strategy is an effective way to collect gene expression data when an annotated genome sequence is not available. Second, our replicated sampling indicates that expression profiles are highly consistent across field-collected animals in this case. Third, the impacts of partial reference sequences on the ability to detect DE can be mitigated through workflow choice and deeper reference sequencing.

Differential Gene Expression in the Siphonophore Nanomia bijuga (Cnidaria) Assessed with Multiple Next-Generation Sequencing Workflows

PubMed Central

Siebert, Stefan; Robinson, Mark D.; Tintori, Sophia C.; Goetz, Freya; Helm, Rebecca R.; Smith, Stephen A.; Shaner, Nathan; Haddock, Steven H. D.; Dunn, Casey W.

2011-01-01

We investigated differential gene expression between functionally specialized feeding polyps and swimming medusae in the siphonophore Nanomia bijuga (Cnidaria) with a hybrid long-read/short-read sequencing strategy. We assembled a set of partial gene reference sequences from long-read data (Roche 454), and generated short-read sequences from replicated tissue samples that were mapped to the references to quantify expression. We collected and compared expression data with three short-read expression workflows that differ in sample preparation, sequencing technology, and mapping tools. These workflows were Illumina mRNA-Seq, which generates sequence reads from random locations along each transcript, and two tag-based approaches, SOLiD SAGE and Helicos DGE, which generate reads from particular tag sites. Differences in expression results across workflows were mostly due to the differential impact of missing data in the partial reference sequences. When all 454-derived gene reference sequences were considered, Illumina mRNA-Seq detected more than twice as many differentially expressed (DE) reference sequences as the tag-based workflows. This discrepancy was largely due to missing tag sites in the partial reference that led to false negatives in the tag-based workflows. When only the subset of reference sequences that unambiguously have tag sites was considered, we found broad congruence across workflows, and they all identified a similar set of DE sequences. Our results are promising in several regards for gene expression studies in non-model organisms. First, we demonstrate that a hybrid long-read/short-read sequencing strategy is an effective way to collect gene expression data when an annotated genome sequence is not available. Second, our replicated sampling indicates that expression profiles are highly consistent across field-collected animals in this case. Third, the impacts of partial reference sequences on the ability to detect DE can be mitigated through workflow choice and deeper reference sequencing. PMID:21829563

Molecular analysis of the split cox1 gene from the Basidiomycota Agrocybe aegerita: relationship of its introns with homologous Ascomycota introns and divergence levels from common ancestral copies.

PubMed

Gonzalez, P; Barroso, G; Labarère, J

1998-10-05

The Basidiomycota Agrocybe aegerita (Aa) mitochondrial cox1 gene (6790 nucleotides), encoding a protein of 527aa (58377Da), is split by four large subgroup IB introns possessing site-specific endonucleases assumed to be involved in intron mobility. When compared to other fungal COX1 proteins, the Aa protein is closely related to the COX1 one of the Basidiomycota Schizophyllum commune (Sc). This clade reveals a relationship with the studied Ascomycota ones, with the exception of Schizosaccharomyces pombe (Sp) which ranges in an out-group position compared with both higher fungi divisions. When comparison is extended to other kingdoms, fungal COX1 sequences are found to be more related to algae and plant ones (more than 57.5% aa similarity) than to animal sequences (53.6% aa similarity), contrasting with the previously established close relationship between fungi and animals, based on comparisons of nuclear genes. The four Aa cox1 introns are homologous to Ascomycota or algae cox1 introns sharing the same location within the exonic sequences. The percentages of identity of the intronic nucleotide sequences suggest a possible acquisition by lateral transfers of ancestral copies or of their derived sequences. These identities extend over the whole intronic sequences, arguing in favor of a transfer of the complete intron rather than a transfer limited to the encoded ORF. The intron i4 shares 74% of identity, at the nucleotidic level, with the Podospora anserina (Pa) intron i14, and up to 90.5% of aa similarity between the encoded proteins, i.e. the highest values reported to date between introns of two phylogenetically distant species. This low divergence argues for a recent lateral transfer between the two species. On the contrary, the low sequence identities (below 36%) observed between Aa i1 and the homologous Sp i1 or Prototheca wickeramii (Pw) i1 suggest a long evolution time after the separation of these sequences. The introns i2 and i3 possessed intermediate percentages of identity with their homologous Ascomycota introns. This is the first report of the complete nucleotide sequence and molecular organization of a mitochondrial cox1 gene of any member of the Basidiomycota division.

Brucella papionis sp. nov., isolated from baboons (Papio spp.).

PubMed

Whatmore, Adrian M; Davison, Nicholas; Cloeckaert, Axel; Al Dahouk, Sascha; Zygmunt, Michel S; Brew, Simon D; Perrett, Lorraine L; Koylass, Mark S; Vergnaud, Gilles; Quance, Christine; Scholz, Holger C; Dick, Edward J; Hubbard, Gene; Schlabritz-Loutsevitch, Natalia E

2014-12-01

Two Gram-negative, non-motile, non-spore-forming coccoid bacteria (strains F8/08-60(T) and F8/08-61) isolated from clinical specimens obtained from baboons (Papio spp.) that had delivered stillborn offspring were subjected to a polyphasic taxonomic study. On the basis of 16S rRNA gene sequence similarities, both strains, which possessed identical sequences, were assigned to the genus Brucella. This placement was confirmed by extended multilocus sequence analysis (MLSA), where both strains possessed identical sequences, and whole-genome sequencing of a representative isolate. All of the above analyses suggested that the two strains represent a novel lineage within the genus Brucella. The strains also possessed a unique profile when subjected to the phenotyping approach classically used to separate species of the genus Brucella, reacting only with Brucella A monospecific antiserum, being sensitive to the dyes thionin and fuchsin, being lysed by bacteriophage Wb, Bk2 and Fi phage at routine test dilution (RTD) but only partially sensitive to bacteriophage Tb, and with no requirement for CO2 and no production of H2S but strong urease activity. Biochemical profiling revealed a pattern of enzyme activity and metabolic capabilities distinct from existing species of the genus Brucella. Molecular analysis of the omp2 locus genes showed that both strains had a novel combination of two highly similar omp2b gene copies. The two strains shared a unique fingerprint profile of the multiple-copy Brucella-specific element IS711. Like MLSA, a multilocus variable number of tandem repeat analysis (MLVA) showed that the isolates clustered together very closely, but represent a distinct group within the genus Brucella. Isolates F8/08-60(T) and F8/08-61 could be distinguished clearly from all known species of the genus Brucella and their biovars by both phenotypic and molecular properties. Therefore, by applying the species concept for the genus Brucella suggested by the ICSP Subcommittee on the Taxonomy of Brucella, they represent a novel species within the genus Brucella, for which the name Brucella papionis sp. nov. is proposed, with the type strain F8/08-60(T) ( = NCTC 13660(T) = CIRMBP 0958(T)). Crown Copyright 2014. Reproduced with the permission of the Controller of Her Majesty's Stationery Office/Queen's Printer for Scotland and AHVLA.

The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus).

PubMed

Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya

2011-05-01

The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% identical in ORF5. These sequence comparisons and previously studied biological properties indicate that PeVYV is a distinctly different virus and belongs to a new species of the genus Polerovirus.

A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection

PubMed Central

Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike

2018-01-01

ABSTRACT Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection. PMID:29564396

A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection.

PubMed

Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S

2018-01-01

Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection.

Selection of optimal oligonucleotide probes for microarrays usingmultiple criteria, global alignment and parameter estimation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xingyuan; He, Zhili; Zhou, Jizhong

2005-10-30

The oligonucleotide specificity for microarray hybridizationcan be predicted by its sequence identity to non-targets, continuousstretch to non-targets, and/or binding free energy to non-targets. Mostcurrently available programs only use one or two of these criteria, whichmay choose 'false' specific oligonucleotides or miss 'true' optimalprobes in a considerable proportion. We have developed a software tool,called CommOligo using new algorithms and all three criteria forselection of optimal oligonucleotide probes. A series of filters,including sequence identity, free energy, continuous stretch, GC content,self-annealing, distance to the 3'-untranslated region (3'-UTR) andmelting temperature (Tm), are used to check each possibleoligonucleotide. A sequence identity is calculated based onmore » gapped globalalignments. A traversal algorithm is used to generate alignments for freeenergy calculation. The optimal Tm interval is determined based on probecandidates that have passed all other filters. Final probes are pickedusing a combination of user-configurable piece-wise linear functions andan iterative process. The thresholds for identity, stretch and freeenergy filters are automatically determined from experimental data by anaccessory software tool, CommOligo_PE (CommOligo Parameter Estimator).The program was used to design probes for both whole-genome and highlyhomologous sequence data. CommOligo and CommOligo_PE are freely availableto academic users upon request.« less

Diversity and Plasticity of the Intracellular Plant Pathogen and Insect Symbiont “Candidatus Liberibacter asiaticus” as Revealed by Hypervariable Prophage Genes with Intragenic Tandem Repeats ▿ †

PubMed Central

Zhou, Lijuan; Powell, Charles A.; Hoffman, Michele T.; Li, Wenbin; Fan, Guocheng; Liu, Bo; Lin, Hong; Duan, Yongping

2011-01-01

“Candidatus Liberibacter asiaticus” is a psyllid-transmitted, phloem-limited alphaproteobacterium and the most prevalent species of “Ca. Liberibacter” associated with a devastating worldwide citrus disease known as huanglongbing (HLB). Two related and hypervariable genes (hyvI and hyvII) were identified in the prophage regions of the Psy62 “Ca. Liberibacter asiaticus” genome. Sequence analyses of the hyvI and hyvII genes in 35 “Ca. Liberibacter asiaticus” DNA isolates collected globally revealed that the hyvI gene contains up to 12 nearly identical tandem repeats (NITRs, 132 bp) and 4 partial repeats, while hyvII contains up to 2 NITRs and 4 partial repeats and shares homology with hyvI. Frequent deletions or insertions of these repeats within the hyvI and hyvII genes were observed, none of which disrupted the open reading frames. Sequence conservation within the individual repeats but an extensive variation in repeat numbers, rearrangement, and the sequences flanking the repeat region indicate the diversity and plasticity of “Ca. Liberibacter asiaticus” bacterial populations in the world. These differences were found not only in samples of distinct geographical origins but also in samples from a single origin and even from a single “Ca. Liberibacter asiaticus”-infected sample. This is the first evidence of different “Ca. Liberibacter asiaticus” populations coexisting in a single HLB-affected sample. The Florida “Ca. Liberibacter asiaticus” isolates contain both hyvI and hyvII, while all other global “Ca. Liberibacter asiaticus” isolates contain either one or the other. Interclade assignments of the putative HyvI and HyvII proteins from Florida isolates with other global isolates in phylogenetic trees imply multiple “Ca. Liberibacter asiaticus” populations in the world and a multisource introduction of the “Ca. Liberibacter asiaticus” bacterium into Florida. PMID:21784907

Evaluation of partial 16S ribosomal DNA sequencing for identification of nocardia species by using the MicroSeq 500 system with an expanded database.

PubMed

Cloud, Joann L; Conville, Patricia S; Croft, Ann; Harmsen, Dag; Witebsky, Frank G; Carroll, Karen C

2004-02-01

Identification of clinically significant nocardiae to the species level is important in patient diagnosis and treatment. A study was performed to evaluate Nocardia species identification obtained by partial 16S ribosomal DNA (rDNA) sequencing by the MicroSeq 500 system with an expanded database. The expanded portion of the database was developed from partial 5' 16S rDNA sequences derived from 28 reference strains (from the American Type Culture Collection and the Japanese Collection of Microorganisms). The expanded MicroSeq 500 system was compared to (i). conventional identification obtained from a combination of growth characteristics with biochemical and drug susceptibility tests; (ii). molecular techniques involving restriction enzyme analysis (REA) of portions of the 16S rRNA and 65-kDa heat shock protein genes; and (iii). when necessary, sequencing of a 999-bp fragment of the 16S rRNA gene. An unknown isolate was identified as a particular species if the sequence obtained by partial 16S rDNA sequencing by the expanded MicroSeq 500 system was 99.0% similar to that of the reference strain. Ninety-four nocardiae representing 10 separate species were isolated from patient specimens and examined by using the three different methods. Sequencing of partial 16S rDNA by the expanded MicroSeq 500 system resulted in only 72% agreement with conventional methods for species identification and 90% agreement with the alternative molecular methods. Molecular methods for identification of Nocardia species provide more accurate and rapid results than the conventional methods using biochemical and susceptibility testing. With an expanded database, the MicroSeq 500 system for partial 16S rDNA was able to correctly identify the human pathogens N. brasiliensis, N. cyriacigeorgica, N. farcinica, N. nova, N. otitidiscaviarum, and N. veterana.

Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus (Digenea): Species Differentiation Based On mtDNA (Barcode) and Partial LSU–rDNA Sequences

USGS Publications Warehouse

Bergmame, Laura; Huffman, Jane; Cole, Rebecca; Dayanandan, Selvadurai; Tkach, Vasyl; McLaughlin, J. Daniel

2011-01-01

Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota.

Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus (Digenea): Species Differentiation Based on mtDNA (Barcode) and Partial LSUrDNA Sequences

USGS Publications Warehouse

Bergmame, L.; Huffman, J.; Cole, R.; Dayanandan, S.; Tkach, V.; McLaughlin, J.D.

2011-01-01

Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota. ?? 2011 American Society of Parasitologists.

Indigenous and introduced potyviruses of legumes and Passiflora spp. from Australia: biological properties and comparison of coat protein sequences

USDA-ARS?s Scientific Manuscript database

Coat protein sequences of 33 Potyvirus isolates from legume and Passiflora spp. were sequenced to determine the identity of infecting viruses. Phylogenetic analysis of the sequences revealed the presence of seven distinct virus species....

Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

PubMed

Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

2007-03-01

In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

PubMed Central

Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

1994-01-01

Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

Visualizing bacterial tRNA identity determinants and antideterminants using function logos and inverse function logos

PubMed Central

Freyhult, Eva; Moulton, Vincent; Ardell, David H.

2006-01-01

Sequence logos are stacked bar graphs that generalize the notion of consensus sequence. They employ entropy statistics very effectively to display variation in a structural alignment of sequences of a common function, while emphasizing its over-represented features. Yet sequence logos cannot display features that distinguish functional subclasses within a structurally related superfamily nor do they display under-represented features. We introduce two extensions to address these needs: function logos and inverse logos. Function logos display subfunctions that are over-represented among sequences carrying a specific feature. Inverse logos generalize both sequence logos and function logos by displaying under-represented, rather than over-represented, features or functions in structural alignments. To make inverse logos, a compositional inverse is applied to the feature or function frequency distributions before logo construction, where a compositional inverse is a mathematical transform that makes common features or functions rare and vice versa. We applied these methods to a database of structurally aligned bacterial tDNAs to create highly condensed, birds-eye views of potentially all so-called identity determinants and antideterminants that confer specific amino acid charging or initiator function on tRNAs in bacteria. We recovered both known and a few potentially novel identity elements. Function logos and inverse logos are useful tools for exploratory bioinformatic analysis of structure–function relationships in sequence families and superfamilies. PMID:16473848

Plasma-membrane H(+)-ATPase gene expression is regulated by NaCl in cells of the halophyte Atriplex nummularia L.

PubMed

Niu, X; Zhu, J K; Narasimhan, M L; Bressan, R A; Hasegawa, P M

1993-01-01

An Atriplex nummularia L. cDNA probe encoding the partial sequence of an isoform of the plasma-membrane H(+)-ATPase was isolated, and used to characterize the NaCl regulation of mRNA accumulation in cultured cells of this halophyte. The peptide (477 amino acids) translated from the open reading frame has the highest sequence homology to the Nicotiana plumbaginifolia plasma-membrane H(+)-ATPase isoform pma4 (greater than 80% identity) and detected a transcript of approximately 3.7 kb on Northern blots of both total and poly(A)+ RNA. The mRNA levels were comparable in unadapted cells, adapted cells (cells adapted to and growing in 342 mM NaCl) and deadapted cells (cells previously adapted to 342 mM NaCl that are now growing without salt). Increased mRNA abundance was detected in deadapted cells within 24 h after exposure to NaCl but not in unadapted cells with similar salt treatments. The NaCl up-regulation of message abundance in deadapted cells was subject to developmental control. Analogous to those reported for glycophytes, the plasma-membrane H(+)-ATPase are encoded by a multigene family in the halophyte.

Thalassospira lucentensis gen. nov., sp. nov., a new marine member of the alpha-Proteobacteria.

PubMed

López-López, Arantxa; Pujalte, María J; Benlloch, Susana; Mata-Roig, Manuel; Rosselló-Mora, Ramón; Garay, Esperanza; Rodríguez-Valera, Francisco

2002-07-01

A novel bacterium from the Mediterranean Sea was isolated under oligotrophic conditions at in situ temperature after prolonged continuous culture. The isolates were initially characterized by partial 16S rRNA gene sequencing. Similarity searches of one of the isolates, QMT2T, indicated high sequence identity to the well-characterized Rhodospirillum rubrum, [Aquaspirillum] itersonii and [Oceanospirillum] pusillum micro-organisms, which are representatives of the alpha-subclass of the Proteobacteria. The highest level of similarity of the complete 165 rRNA gene with respect to these microorganisms was 89%. Features such as the low similarities of 165 rRNA of QMT2T with its phylogenetically close neighbours, the distinct G+C content, and the differences in phenotypic features, including pigmentation, fatty acid composition, salt tolerance, the lack of bacteriochlorophyll a, and the capacity to use carbohydrates as carbon sources, are indicative of the novel nature of the isolate QMT2T among the alpha-Proteobacteria. This report describes the classification of strain QMT2T (= DSM 14000T = CECT 5390T) as a new genus and species, Thalassospira lucentensis gen. nov, sp. nov., in the family Rhodospirillaceae.

Characterization of a novel flavivirus isolated from Culex (Melanoconion) ocossa mosquitoes from Iquitos, Peru.

PubMed

Evangelista, Julio; Cruz, Cristhopher; Guevara, Carolina; Astete, Helvio; Carey, Cristiam; Kochel, Tadeusz J; Morrison, Amy C; Williams, Maya; Halsey, Eric S; Forshey, Brett M

2013-06-01

We describe the isolation and characterization of a novel flavivirus, isolated from a pool of Culex (Melanoconion) ocossa Dyar and Knab mosquitoes collected in 2009 in an urban area of the Amazon basin city of Iquitos, Peru. Flavivirus infection was detected by indirect immunofluorescent assay of inoculated C6/36 cells using polyclonal flavivirus antibodies (St. Louis encephalitis virus, yellow fever virus and dengue virus type 1) and confirmed by RT-PCR. Based on partial sequencing of the E and NS5 gene regions, the virus isolate was most closely related to the mosquito-borne flaviviruses but divergent from known species, with less than 45 and 71 % pairwise amino acid identity in the E and NS5 gene products, respectively. Phylogenetic analysis of E and NS5 amino acid sequences demonstrated that this flavivirus grouped with mosquito-borne flaviviruses, forming a clade with Nounané virus (NOUV). Like NOUV, no replication was detected in a variety of mammalian cells (Vero-76, Vero-E6, BHK, LLCMK, MDCK, A549 and RD) or in intracerebrally inoculated newborn mice. We tentatively designate this genetically distinct flavivirus as representing a novel species, Nanay virus, after the river near where it was first detected.

Antioxidant Activity of Oxygen Evolving Enhancer Protein 1 Purified from Capsosiphon fulvescens.

PubMed

Kim, Eun-Young; Choi, Youn Hee; Lee, Jung Im; Kim, In-Hye; Nam, Taek-Jeong

2015-06-01

This study was conducted to determine the antioxidant activity of a protein purified from Capsosiphon fulvescens. The purification steps included sodium acetate (pH 6) extraction and diethylaminoethyl-cellulose, reversed phase Shodex C4P-50 column chromatography. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis indicated that the molecular weight of the purified protein was 33 kDa. The N-terminus and partial peptide amino acid sequence of this protein was identical to the sequence of oxygen evolving enhancer (OEE) 1 protein. The antioxidant activity of the OEE 1 was determined in vitro using a scavenging test with 4 types of reactive oxygen species (ROS), including the 2,2-diphenyl-1-picrylhydrazyl radical, hydroxyl radical, superoxide anion, and hydrogen peroxide (H2 O2 ). OEE 1 had higher H2 O2 scavenging activity, which proved to be the result of enzymatic antioxidants rather than nonenzymatic antioxidants. In addition, OEE 1 showed less H2 O2 -mediated ROS formation in HepG2 cells. In conclusion, this study demonstrates that OEE 1 purified from C. fulvescens is an excellent antioxidant. © 2015 Institute of Food Technologists®

Xenopus laevis and Emerging Amphibian Pathogens in Chile.

PubMed

Soto-Azat, Claudio; Peñafiel-Ricaurte, Alexandra; Price, Stephen J; Sallaberry-Pincheira, Nicole; García, María Pía; Alvarado-Rybak, Mario; Cunningham, Andrew A

2016-12-01

Amphibians face an extinction crisis with no precedence. Two emerging infectious diseases, ranaviral disease caused by viruses within the genus Ranavirus and chytridiomycosis due to Batrachochytrium dendrobatidis (Bd), have been linked with amphibian mass mortalities and population declines in many regions of the globe. The African clawed frog (Xenopus laevis) has been indicated as a vector for the spread of these pathogens. Since the 1970s, this species has been invasive in central Chile. We collected X. laevis and dead native amphibians in Chile between 2011 and 2013. We conducted post-mortem examinations and molecular tests for Ranavirus and Bd. Eight of 187 individuals (4.3 %) tested positive for Ranavirus: seven X. laevis and a giant Chilean frog (Calyptocephallela gayi). All positive cases were from the original area of X. laevis invasion. Bd was found to be more prevalent (14.4 %) and widespread than Ranavirus, and all X. laevis Bd-positive animals presented low to moderate levels of infection. Sequencing of a partial Ranavirus gene revealed 100 % sequence identity with Frog Virus 3. This is the first report of Ranavirus in Chile, and these preliminary results are consistent with a role for X. laevis as an infection reservoir for both Ranavirus and Bd.

Occurrence and genetic typing of infectious hematopoietic necrosis virus in Kamchatka, Russia

USGS Publications Warehouse

Rudakova, S.L.; Kurath, G.; Bochkova, E.V.

2007-01-01

Infectious hematopoietic necrosis virus (IHNV) is a well known rhabdoviral pathogen of salmonid fish in North America that has become established in Asia and Europe. On the Pacific coast of Russia, IHNV was first detected in hatchery sockeye from the Kamchatka Peninsula in 2001. Results of virological examinations of over 10 000 wild and cultured salmonid fish from Kamchatka during 1996 to 2005 revealed IHNV in several sockeye salmon Oncorhynchus nerka populations. The virus was isolated from spawning adults and from juveniles undergoing epidemics in both hatchery and wild sockeye populations from the Bolshaya watershed. No virus was detected in 2 other water-sheds, or in species other than sockeye salmon. Genetic typing of 8 virus isolates by seguence analysis of partial glycoprotein and nucleocapsid genes revealed that they were genetically homogeneous and fell within the U genogroup of IHNV. In phylogenetic analyses, the Russian IHNV sequences were indistinguishable from the sequences of North American U genogroup isolates that occur throughout Alaska, British Columbia, Washington, and Oregon. The high similarity, and in some cases identity, between Russian and North American IHNV isolates suggests virus transmission or exposure to a common viral reservoir in the North Pacific Ocean. ?? Inter-Research 2007.

Nuclear 28S rDNA phylogeny supports the basal placement of Noctiluca scintillans (Dinophyceae; Noctilucales) in dinoflagellates.

PubMed

Ki, Jang-Seu

2010-05-01

Noctiluca scintillans (Macartney) Kofoid et Swezy, 1921 is an unarmoured heterotrophic dinoflagellate with a global distribution, and has been considered as one of the ancestral taxa among dinoflagellates. Recently, 18S rDNA, actin, alpha-, beta-tubulin, and Hsp90-based phylogenies have shown the basal position of the noctilucids. However, the relationships of dinoflagellates in the basal lineages are still controversial. Although the nuclear rDNA (e.g. 18S, ITS-5.8S, and 28S) contains much genetic information, DNA sequences of N. scintillans rDNA molecules were insufficiently characterized as yet. Here the author sequenced a long-range nuclear rDNA, spanning from the 18S to the D5 region of the 28S rDNA, of N. scintillans. The present N. scintillans had a nearly identical genotype (>99.0% similarity) compared to other Noctiluca sequences from different geographic origins. Nucleotide divergence in the partial 28S rDNA was significantly high (p<0.05) as compared to the 18S rDNA, demonstrating that the information from 28S rDNA is more variable. The 28S rDNA phylogeny of 17 selected dinoflagellates, two perkinsids, and two apicomplexans as outgroups showed that N. scintillans and Oxyrrhis marina formed a clade that diverged separately from core dinoflagellates. Copyright (c) 2009 Elsevier GmbH. All rights reserved.

[A novel M142T mutation in the B glycosyltransferase gene associated with B3 variant in Chinese].

PubMed

Xu, Xian-guo; Hong, Xiao-zhen; Liu, Ying; Zhu, Fa-ming; Lv, Hang-jun; Yan, Li-xing

2009-06-01

To investigate the molecular genetic basis of the B3 variant of ABO blood group system with mixed-field hemagglutination in Chinese. Serological techniques were performed to characterize the erythrocyte phenotype of two discrepant samples. A sequential agglutination method and 13 short tandem repeat (STR) loci were tested to exclude the possibility of exogenous or endogenous DNA chimera. Mutations in exons 6 and 7, including partial intron of the ABO gene, were screened by polymerase chain reaction and DNA sequencing. Haplotypes of the two individuals were also analyzed by sequencing. A mixed-field hemagglutination of RBCs with anti-B and anti-AB antibodies was detected in the two unrelated individuals. Exogenous ABO-incompatible RBC transfusion and endogenous genetic chimera were excluded by sequential agglutination method and STR. The ABO phenotypes of the two individuals were classified as A1B3 according to the ABO subgroup definition. The sequence region from intron 5 to 3'-UTR of the B allele was identical to that of ABO*B101 allele, except for a T to C substitution at nucleotide position 425 in exon 7. This substitution resulted in an amino acid change of M142T in the B glycosyltransferase. A novel B allele with 425T>C substitution resulting in B3 subgroup was identified in two Chinese individuals.

Domestic dog origin of canine distemper virus in free-ranging wolves in Portugal as revealed by hemagglutinin gene characterization.

PubMed

Müller, Alexandra; Silva, Eliane; Santos, Nuno; Thompson, Gertrude

2011-07-01

Serologic evidence for canine distemper virus (CDV) has been described in grey wolves but, to our knowledge, virus strains circulating in wolves have not been characterized genetically. The emergence of CDV in several non-dog hosts has been associated with amino acid substitutions at sites 530 and 549 of the hemagglutinin (H) protein. We sequenced the H gene of wild-type canine distemper virus obtained from two free-ranging Iberian wolves (Canis lupus signatus) and from one domestic dog (Canis familiaris). More differences were found between the two wolf sequences than between one of the wolves (wolf 75) and the dog. The latter two had a very high nucleotide similarity resulting in identical H gene amino acid sequences. Possible explanations include geographic and especially temporal proximity of the CDV obtained from wolf 75 and the domestic dog, taken in 2007-2008, as opposed to that from wolf 3 taken more distantly in 1998. Analysis of the deduced amino acids of the viral hemagglutinin revealed a glycine (G) and a tyrosine (Y) at amino acid positions 530 and 549, respectively, of the partial signaling lymphocytic activation molecule (SLAM)-receptor binding region which is typically found in viral strains obtained from domestic dogs. This suggests that the CDV found in these wolves resulted from transmission events from local domestic dogs rather than from wildlife species.

The rapidly emerging ESBL-producing Escherichia coli O25-ST131 clone carries LPS core synthesis genes of the K-12 type.

PubMed

Szijártó, Valéria; Pal, Tibor; Nagy, Gabor; Nagy, Eszter; Ghazawi, Akela; al-Haj, Mohammed; El Kurdi, Sylvia; Sonnevend, Agnes

2012-07-01

The clone Escherichia coli O25 ST131, typically producing extended-spectrum beta-lactamases (ESBLs), has spread globally and became the dominant type among extraintestinal isolates at many parts of the world. However, the reasons behind the emergence and success of this clone are only partially understood. We compared the core type genes by PCR of ESBL-producing and ESBL-nonproducing strains isolated from urinary tract infections in the United Arab Emirates and found a surprisingly high frequency of the K-12 core type (44.6%) among members of the former group, while in the latter one, it was as low (3.7%), as reported earlier. The high figure was almost entirely attributable to the presence of members of the clone O25 ST131 among ESBL producers. Strains from the same clone isolated in Europe also carried the K-12 core type genes. Sequencing the entire core operon of an O25 ST131 isolate revealed a high level of similarity to known K-12 core gene sequences and an almost complete identity with a recently sequenced non-O25 ST131 fecal isolate. The exact chemical structure and whether and how this unusual core type contributed to the sudden emergence of ST131 require further investigations. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus.

PubMed

Su, Jingliang; Li, Shuang; Hu, Xudong; Yu, Xiuling; Wang, Yongyue; Liu, Peipei; Lu, Xishan; Zhang, Guozhong; Hu, Xueying; Liu, Di; Li, Xiaoxia; Su, Wenliang; Lu, Hao; Mok, Ngai Shing; Wang, Peiyi; Wang, Ming; Tian, Kegong; Gao, George F

2011-03-24

Since April 2010, a severe outbreak of duck viral infection, with egg drop, feed uptake decline and ovary-oviduct disease, has spread around the major duck-producing regions in China. A new virus, named BYD virus, was isolated in different areas, and a similar disease was reproduced in healthy egg-producing ducks, infecting with the isolated virus. The virus was re-isolated from the affected ducks and replicated well in primary duck embryo fibroblasts and Vero cells, causing the cytopathic effect. The virus was identified as an enveloped positive-stranded RNA virus with a size of approximately 55 nm in diameter. Genomic sequencing of the isolated virus revealed that it is closely related to Tembusu virus (a mosquito-borne Ntaya group flavivirus), with 87-91% nucleotide identity of the partial E (envelope) proteins to that of Tembusu virus and 72% of the entire genome coding sequence with Bagaza virus, the most closely related flavivirus with an entirely sequenced genome. Collectively our systematic studies fulfill Koch's postulates, and therefore, the causative agent of the duck egg drop syndrome occurring in China is a new flavivirus. Flavivirus is an emerging and re-emerging zoonotic pathogen and BYD virus that causes severe egg-drop, could be disastrous for the duck industry. More importantly its public health concerns should also be evaluated, and its epidemiology should be closely watched due to the zoonotic nature of flaviviruses.

Fitting and Testing Conditional Multinormal Partial Credit Models

ERIC Educational Resources Information Center

Hessen, David J.

2012-01-01

A multinormal partial credit model for factor analysis of polytomously scored items with ordered response categories is derived using an extension of the Dutch Identity (Holland in "Psychometrika" 55:5-18, 1990). In the model, latent variables are assumed to have a multivariate normal distribution conditional on unweighted sums of item…

Gene Deletion in Barley Mediated by LTR-retrotransposon BARE

PubMed Central

Shang, Yi; Yang, Fei; Schulman, Alan H.; Zhu, Jinghuan; Jia, Yong; Wang, Junmei; Zhang, Xiao-Qi; Jia, Qiaojun; Hua, Wei; Yang, Jianming; Li, Chengdao

2017-01-01

A poly-row branched spike (prbs) barley mutant was obtained from soaking a two-rowed barley inflorescence in a solution of maize genomic DNA. Positional cloning and sequencing demonstrated that the prbs mutant resulted from a 28 kb deletion including the inflorescence architecture gene HvRA2. Sequence annotation revealed that the HvRA2 gene is flanked by two LTR (long terminal repeat) retrotransposons (BARE) sharing 89% sequence identity. A recombination between the integrase (IN) gene regions of the two BARE copies resulted in the formation of an intact BARE and loss of HvRA2. No maize DNA was detected in the recombination region although the flanking sequences of HvRA2 gene showed over 73% of sequence identity with repetitive sequences on 10 maize chromosomes. It is still unknown whether the interaction of retrotransposons between barley and maize has resulted in the recombination observed in the present study. PMID:28252053

Radiolabeled Escherichia coli heat-stable enterotoxin analogs for in vivo imaging of colorectal cancer

NASA Astrophysics Data System (ADS)

Giblin, M. F.; Sieckman, G. L.; Owen, N. K.; Hoffman, T. J.; Forte, L. R.; Volkert, W. A.

2005-12-01

The human Escherichia coli heat-stable enterotoxin (STh, amino acid sequence N1SSNYCCELCCNPACTGCY19) binds specifically to the guanylate cyclase C (GC-C) receptor, which is present in high density on the apical surface of normal intestinal epithelial cells as well as on the surface of human colon cancer cells. In the current study, two STh analogs were synthesized and evaluated in vitro and in vivo. Both analogs shared identical 6-19 core sequences, and had N-terminal pendant DOTA moieties. The analogs differed in the identity of a 6 amino acid peptide sequence intervening between DOTA and the 6-19 core. In one analog, the peptide was an RGD-containing sequence found in human fibronectin (GRGDSP), while in the other this peptide sequence was randomly scrambled (GRDSGP). The results indicated that the presence of the human fibronectin sequence in the hybrid peptide did not affect tumor localization in vivo.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Common Amino Acid Subsequences in a Universal Proteome—Relevance for Food Science

PubMed Central

Minkiewicz, Piotr; Darewicz, Małgorzata; Iwaniak, Anna; Sokołowska, Jolanta; Starowicz, Piotr; Bucholska, Justyna; Hrynkiewicz, Monika

2015-01-01

A common subsequence is a fragment of the amino acid chain that occurs in more than one protein. Common subsequences may be an object of interest for food scientists as biologically active peptides, epitopes, and/or protein markers that are used in comparative proteomics. An individual bioactive fragment, in particular the shortest fragment containing two or three amino acid residues, may occur in many protein sequences. An individual linear epitope may also be present in multiple sequences of precursor proteins. Although recent recommendations for prediction of allergenicity and cross-reactivity include not only sequence identity, but also similarities in secondary and tertiary structures surrounding the common fragment, local sequence identity may be used to screen protein sequence databases for potential allergens in silico. The main weakness of the screening process is that it overlooks allergens and cross-reactivity cases without identical fragments corresponding to linear epitopes. A single peptide may also serve as a marker of a group of allergens that belong to the same family and, possibly, reveal cross-reactivity. This review article discusses the benefits for food scientists that follow from the common subsequences concept. PMID:26340620

Novel Detection of Coxiella spp., Theileria luwenshuni, and T. ovis Endosymbionts in Deer Keds (Lipoptena fortisetosa).

PubMed

Lee, Seung-Hun; Kim, Kyoo-Tae; Kwon, Oh-Deog; Ock, Younsung; Kim, Taeil; Choi, Donghag; Kwak, Dongmi

2016-01-01

We describe for the first time the detection of Coxiella-like bacteria (CLB), Theileria luwenshuni, and T. ovis endosymbionts in blood-sucking deer keds. Eight deer keds attached to a Korean water deer were identified as Lipoptena fortisetosa (Diptera: Hippoboscidae) by morphological and genetic analyses. Among the endosymbionts assessed, CLB, Theileria luwenshuni, and T. ovis were identified in L. fortisetosa by PCR and nucleotide sequencing. Based on phylogeny, CLB 16S rRNA sequences were classified into clade B, sharing 99.4% identity with CLB from Haemaphysalis longicornis in South Korea. Although the virulence of CLB to vertebrates is still controversial, several studies have reported clinical symptoms in birds due to CLB infections. The 18S rRNA sequences of T. luwenshuni and T. ovis in this study were 98.8-100% identical to those in GenBank, and all of the obtained sequences of T. ovis and T. luwenshuni in this study were 100% identical to each other, respectively. Although further studies are required to positively confirm L. fortisetosa as a biological vector of these pathogens, strong genetic relationships among sequences from this and previous studies suggest potential transmission among mammalian hosts by ticks and keds.

Complete genome sequence of a new begomovirus associated with yellow mosaic disease of Hemidesmus indicus in India.

PubMed

Reddy, M Sreekanth; Kanakala, S; Srinivas, K P; Hema, M; Malathi, V G; Sreenivasulu, P

2014-05-01

The complete DNA A genome of a virus isolate associated with yellow mosaic disease of a medicinal plant, Hemidesmus indicus, from India was cloned and sequenced. The length of DNA A was 2825 nucleotides, 35 nucleotides longer than the unit genome of monopartite begomoviruses. Comparison of the nucleotide sequence of DNA A of the virus isolate with those of other begomoviruses showed maximum sequence identity of 69 % to DNA A of ageratum yellow vein China virus (AYVCNV; AJ558120) and 68 % with tomato yellow leaf curl virus- LBa4 (TYLCV; EF185318), and it formed a distinct clade in phylogenetic analysis. The genome organization of the present virus isolate was found to be similar to that of Old World monopartite begomoviruses. The genome was considered to be monopartite, because association of DNA B and β satellite DNA components was not detected. Based on its sequence identity (<70 %) to all other begomoviruses known to date and ICTV (International Committee on Taxonomy of Viruses) species demarcating criteria (<89 % identity), it is considered a member of a novel begomovirus species, and the tentative name "Hemidesmus yellow mosaic virus" (HeYMV) is proposed.

Phylogenetic Analysis of Theileria annulata Infected Cell Line S15 Iran Vaccine Strain.

PubMed

Habibi, Gh

2012-01-01

Bovine theileriosis results from infection with obligate intracellular protozoa of the genus Theileria. The phylogenetic relationships between two isolates of Theileria annulata, and 36 Theileria spp., as well as 6 outgroup including Babesia spp. and coccidian protozoa were analyzed using the 18S rRNA gene sequence. The target DNA segment was amplified by PCR. The PCR product was used for direct sequencing. The length of the 18S rRNA gene of all Theileria spp. involved in this study was around 1,400 bp. A phylogenetic tree was inferred based on the 18S rRNA gene sequence of the Iran and Iraq isolates, and other species of Theileria available in GenBank. In the constructed tree, Theileria annulata (Iran vaccine strain) was closely related to other T. annulata from Europe, Asia, as well as T. lestoquardi, T. parva and T. taurotragi all in one clade. Phylogenetic analyses based on small subunit ribosomal RNA gene suggested that the percent identity of the sequence of Iran vaccine strain was completely the same as Iraq sequence (100% identical), but the similarity of Iran vaccine strain with other T. annulata reported from China, Spain and Italy determined the 97.9 to 99.9% identity.

Cloning of an avilamycin biosynthetic gene cluster from Streptomyces viridochromogenes Tü57.

PubMed Central

Gaisser, S; Trefzer, A; Stockert, S; Kirschning, A; Bechthold, A

1997-01-01

A 65-kb region of DNA from Streptomyces viridochromogenes Tü57, containing genes encoding proteins involved in the biosynthesis of avilamycins, was isolated. The DNA sequence of a 6.4-kb fragment from this region revealed four open reading frames (ORF1 to ORF4), three of which are fully contained within the sequenced fragment. The deduced amino acid sequence of AviM, encoded by ORF2, shows 37% identity to a 6-methylsalicylic acid synthase from Penicillium patulum. Cultures of S. lividans TK24 and S. coelicolor CH999 containing plasmids with ORF2 on a 5.5-kb PstI fragment were able to produce orsellinic acid, an unreduced version of 6-methylsalicylic acid. The amino acid sequence encoded by ORF3 (AviD) is 62% identical to that of StrD, a dTDP-glucose synthase from S. griseus. The deduced amino acid sequence of AviE, encoded by ORF4, shows 55% identity to a dTDP-glucose dehydratase (StrE) from S. griseus. Gene insertional inactivation experiments of aviE abolished avilamycin production, indicating the involvement of aviE in the biosynthesis of avilamycins. PMID:9335272

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan.

PubMed

Masatani, Tatsunori; Hayashi, Kei; Andoh, Masako; Tateno, Morihiro; Endo, Yasuyuki; Asada, Masahito; Kusakisako, Kodai; Tanaka, Tetsuya; Gokuden, Mutsuyo; Hozumi, Nodoka; Nakadohzono, Fumiko; Matsuo, Tomohide

2017-06-01

To reveal the distribution of tick-borne parasites, we established a novel nested polymerase chain reaction (PCR) system to detect the most common agents of tick-borne parasitic diseases, namely Babesia, Theileria, and Hepatozoon parasites. We collected host-seeking or animal-feeding ticks in Kagoshima Prefecture, the southernmost region of Kyusyu Island in southwestern Japan. Twenty of the total of 776 tick samples displayed a specific band of the appropriate size (approximately 1.4-1.6kbp) for the 18S rRNA genes in the novel nested PCR (20/776: 2.58%). These PCR products have individual sequences of Babesia spp. (from 8 ticks), Theileria spp. (from 9 ticks: one tick sample including at least two Theileria spp. sequences), and Hepatozoon spp. (from 3 ticks). Phylogenetic analyses revealed that these sequences were close to those of undescribed Babesia spp. detected in feral raccoons in Japan (5 sequences; 3 sequences being identical), Babesia gibsoni-like parasites detected in pigs in China (3 sequences; all sequences being identical), Theileria spp. detected in sika deer in Japan and China (10 sequences; 2 sequences being identical), Hepatozoon canis (one sequence), and Hepatozoon spp. detected in Japanese martens in Japan (two sequences). In summary, we showed that various tick-borne parasites exist in Kagoshima, the southern region in Japan by using the novel nested PCR system. These including undescribed species such as Babesia gibsoni-like parasites previously detected in pigs in China. Importantly, our results revealed new combinations of ticks and protozoan parasites in southern Japan. The results of this study will aid in the recognition of potential parasitic animal diseases caused by tick-borne parasites. Copyright © 2017 Elsevier GmbH. All rights reserved.

First molecular characterization of canine hepatozoonosis in Argentina: evaluation of asymptomatic Hepatozoon canis infection in dogs from Buenos Aires.

PubMed

Eiras, Diego Fernando; Basabe, Julia; Scodellaro, Carla F; Banach, Diana B; Matos, María L; Krimer, Alejandro; Baneth, Gad

2007-11-10

Canine hepatozoonosis is an expanding tick-borne disease in Argentina. Hepatozoonosis was studied during 1 year in six dogs from the same household in Buenos Aires. Blood parasitemia with Hepatozoon gamonts was found in five dogs and all six were positive by PCR for Hepatozoon sp. Although the levels of parasitemia fluctuated during the year, no clinical signs of disease were detected during the follow up period. Amplification and sequencing of a 650 bases fragment of the 18S rRNA gene from all six dogs yielded fragments that were 99% identical to H. canis. The results of the partial 18S rRNA genotyping with the sub-clinical course of infection and lack of severe hematological abnormalities are compatible with clinical and molecular descriptions of Hepatozoon canis infection from other areas of the world. This is the first molecular characterization of Hepatozoon from Argentina.

Novel Strain of Andes Virus Associated with Fatal Human Infection, Central Bolivia

PubMed Central

Cruz, Cristhopher D.; Vallejo, Efrain; Agudo, Roberto; Vargas, Jorge; Blazes, David L.; Guevara, Carolina; Laguna-Torres, V. Alberto; Halsey, Eric S.; Kochel, Tadeusz J.

2012-01-01

To better describe the genetic diversity of hantaviruses associated with human illness in South America, we screened blood samples from febrile patients in Chapare Province in central Bolivia during 2008–2009 for recent hantavirus infection. Hantavirus RNA was detected in 3 patients, including 1 who died. Partial RNA sequences of small and medium segments from the 3 patients were most closely related to Andes virus lineages but distinct (<90% nt identity) from reported strains. A survey for IgG against hantaviruses among residents of Chapare Province indicated that 12.2% of the population had past exposure to >1 hantaviruses; the highest prevalence was among agricultural workers. Because of the high level of human exposure to hantavirus strains and the severity of resulting disease, additional studies are warranted to determine the reservoirs, ecologic range, and public health effect of this novel strain of hantavirus. PMID:22515983

The Clock gene clone and its circadian rhythms in Pelteobagrus vachelli

NASA Astrophysics Data System (ADS)

Qin, Chuanjie; Shao, Ting

2015-05-01

The Clock gene, a key molecule in circadian systems, is widely distributed in the animal kingdom. We isolated a 936-bp partial cDNA sequence of the Clock gene ( Pva-clock) from the darkbarbel catfish Pelteobagrus vachelli that exhibited high identity with Clock genes of other species of fish and animals (65%-88%). The putative domains included a basic helix-loop-helix (bHLH) domain and two period-ARNT-single-minded (PAS) domains, which were also similar to those in other species of fish and animals. Pva-Clock was primarily expressed in the brain, and was detected in all of the peripheral tissues sampled. Additionally, the pattern of Pva-Clock expression over a 24-h period exhibited a circadian rhythm in the brain, liver and intestine, with the acrophase at zeitgeber time 21:35, 23:00, and 23:23, respectively. Our results provide insight into the function of the molecular Clock of P. vachelli.

Detection of human norovirus from frozen raspberries in a cluster of gastroenteritis outbreaks.

PubMed

Maunula, L; Roivainen, M; Keränen, M; Mäkela, S; Söderberg, K; Summa, M; von Bonsdorff, C H; Lappalainen, M; Korhonen, T; Kuusi, M; Niskanen, T

2009-12-10

We describe a cluster of norovirus outbreaks affecting about 200 people in Southern Finland in September and October 2009. All outbreaks occurred after consumption of imported raspberries from the same batch intended for the catering sector. Human norovirus genotype GI.4 was found in frozen raspberries. The berries were served in toppings of cakes in separate catering settings or mixed in curd cheese as a snack for children in a daycare center. The relative risk for consumption of the berry dish was 3.0 (p

Attachment of Asaia bogorensis Originating in Fruit-Flavored Water to Packaging Materials

PubMed Central

Otlewska, Anna; Antolak, Hubert

2014-01-01

The objective of this study was to investigate the adhesion of isolated spoilage bacteria to packaging materials used in the food industry. Microorganisms were isolated from commercial fruit-flavored mineral water in plastic bottles with flocks as a visual defect. The Gram-negative rods were identified using the molecular method through the amplification of a partial region of the 16S rRNA gene. Based on the sequence identity (99.6%) between the spoilage organism and a reference strain deposited in GenBank, the spoilage isolate was identified as Asaia bgorensis. Experiments on bacterial adhesion were conducted using plates made of glass and polystyrene (packaging materials commonly used in the beverage industry). Cell adhesion ability was determined using luminometry, plate count, and the microscopic method. The strain of A. bogorensis was characterized by strong adhesion properties which were dependent on the surface type, with the highest cell adhesion detected on polystyrene. PMID:25295262

MINORITY STRESS, POSITIVE IDENTITY DEVELOPMENT, AND DEPRESSIVE SYMPTOMS: IMPLICATIONS FOR RESILIENCE AMONG SEXUAL MINORITY MALE YOUTH

PubMed Central

Bruce, Douglas; Harper, Gary W.; Bauermeister, Jose A.

2015-01-01

Introduction Minority stress processes have been shown to have significant associations with negative mental health outcomes among sexual minority populations. Given that adversity may be experienced growing up as a sexual minority in heteronormative, if not heterosexist, environments, our research on resilience among sexual minority male youth proposes that positive identity development may buffer the effects of a range of minority stress processes. Methods An ethnically diverse sample of 200 sexual minority males ages 16–24 (mean age, 20.9 years) was recruited using mixed recruitment methods. We developed and tested two new measures: concealment stress during adolescence and sexual minority-related positive identity development. We then tested a path model that assessed the effects of minority stressors, positive identity development, and social support on major depressive symptoms. Results Experience of stigma was associated with internalized homophobia (β=.138, p<.05) and major depressive symptoms (β=1.076, OR=2.933, p<.001), and internalized homophobia partially mediated experience’s effects on major depression (β=.773, OR=2.167, p<.001). Concealment stress was associated with positive identity development (β=.155, p<.05) and internalized homophobia (β=.418, p<.001), and positive identity development partially mediated concealment stress’s effects on internalized homophobia (β=−.527, p<.001). Concealment stress demonstrated a direct effect on major depression (β=1.400, OR=4.056, p<.001), and indirect paths to social support through positive identity development. Conclusions With these results, we offer an exploratory model that empirically identifies significant paths among minority stress dimensions, positive identity development, and major depressive symptoms. This study helps further our understanding of minority stress, identity development, and resources of resilience among sexual minority male youth. PMID:26478901

MINORITY STRESS, POSITIVE IDENTITY DEVELOPMENT, AND DEPRESSIVE SYMPTOMS: IMPLICATIONS FOR RESILIENCE AMONG SEXUAL MINORITY MALE YOUTH.

PubMed

Bruce, Douglas; Harper, Gary W; Bauermeister, Jose A

2015-09-01

Minority stress processes have been shown to have significant associations with negative mental health outcomes among sexual minority populations. Given that adversity may be experienced growing up as a sexual minority in heteronormative, if not heterosexist, environments, our research on resilience among sexual minority male youth proposes that positive identity development may buffer the effects of a range of minority stress processes. An ethnically diverse sample of 200 sexual minority males ages 16-24 (mean age, 20.9 years) was recruited using mixed recruitment methods. We developed and tested two new measures: concealment stress during adolescence and sexual minority-related positive identity development. We then tested a path model that assessed the effects of minority stressors, positive identity development, and social support on major depressive symptoms. Experience of stigma was associated with internalized homophobia (β=.138, p<.05) and major depressive symptoms (β=1.076, OR=2.933, p<.001), and internalized homophobia partially mediated experience's effects on major depression (β=.773, OR=2.167, p<.001). Concealment stress was associated with positive identity development (β=.155, p<.05) and internalized homophobia (β=.418, p<.001), and positive identity development partially mediated concealment stress's effects on internalized homophobia (β=-.527, p<.001). Concealment stress demonstrated a direct effect on major depression (β=1.400, OR=4.056, p<.001), and indirect paths to social support through positive identity development. With these results, we offer an exploratory model that empirically identifies significant paths among minority stress dimensions, positive identity development, and major depressive symptoms. This study helps further our understanding of minority stress, identity development, and resources of resilience among sexual minority male youth.

Political, religious and occupational identities in context: placing identity status paradigm in context.

PubMed

Solomontos-Kountouri, Olga; Hurry, Jane

2008-04-01

This study critically contrasts global identity with domain-specific identities (political, religious and occupational) and considers context and gender as integral parts of identity. In a cross-sectional survey, 1038 Greek Cypriot adolescents (449 boys and 589 girls, mean age 16.8) from the three different types of secondary schools (state, state technical and private) and from different SES completed part of the Extended Objective Measure of Ego Identity Status-2 (EOMEIS-2). The macro-context of Greek Cypriot society is used to understand the role of context in adolescents' identities. Results showed that Greek Cypriot young people were not in the same statuses across their global, political, religious and occupational identities. This heterogeneity in the status of global identity and of each identity domain is partially explained by differences in gender, type of school and SES (socio-economic status). The fact that identity status is found to be reactive to context suggests that developmental stage models of identity status should place greater emphasis on context.

Partial Row-Sums of Pascal's Triangle

ERIC Educational Resources Information Center

Ollerton, Richard L.

2007-01-01

Identities for many and varied combinations of binomial coefficients abound. Indeed, because of the wide range of interrelationships it is possible that a great deal of mathematical effort has been wasted in proving essentially equivalent formulae. As well as proving identities these methods can be used to rule out closed form solutions (at least…

Bean common mosaic virus isolates causing different symptoms in asparagus bean in China differ greatly in the 5'-parts of their genomes.

PubMed

Zheng, Hongying; Chen, Jiong; Chen, Jianping; Adams, Michael J; Hou, Mingsheng

2002-06-01

Potyvirus isolates from asparagus bean ( Vigna sesquipedalis) plants in Zhejiang province, China, caused either rugose and vein banding mosaic symptoms (isolate R) or severe yellowing (isolate Y) in this host, but were otherwise similar in host range. Both isolates were completely sequenced and shown to be isolates of Bean common mosaic virus (BCMV). The complete sequences were 9992 (R) or 10062 (Y) nucleotides long and shared 91.7% identical nucleotides (93.2% identical amino acids) in their genomes and were more distantly related to the BCMV-Peanut stripe virus sequence (PStV). The isolates were much less similar to one another in the 5'-UTR and the N-terminal region of the P1 protein. In the P1, isolate Y was closer to PStV (76.1% identical amino acids) than to isolate R (64.8%). Phylogenetic analyses of the coat protein region showed that the new isolates grouped with other isolates from Vigna spp., forming the blackeye cowpea mosaic strain subgroup of BCMV with 94-98% nucleotides (96-99% amino acids) identical to one another and about 90% identity to other BCMV isolates. Other significant subgroupings amongst published BCMV isolates were detected.

Human papillomavirus infection in females with normal cervical cytology: Genotyping and phylogenetic analysis among women in Punjab, Pakistan.

PubMed

Aziz, Hafsa; Iqbal, Huma; Mahmood, Humera; Fatima, Shazia; Faheem, Mohammad; Sattar, Areej Abdul; Tabassum, Sobia; Napper, Sanum; Batool, Syeda; Rasheed, Nuzhat

2018-01-01

Globally, cervical cancer is the fourth most common cancer in women and the seventh most common cancer overall, accounting for an estimated 300 000 annual deaths. Human papillomavirus (HPV) is the second most common cause of cervical cancer worldwide. HPV screening is not a common practice in Pakistan. The aim of this study was to determine the prevalence of HPV and HPV types in women with a normal cytology of the cervix living in the upper and lower regions of Punjab, Pakistan, and to analyze the risk factors for HPV in this region. PCR analysis was performed for 1011 female patients with a normal cytology of the cervix from various districts of Punjab Province, Pakistan. Risk factors for the acquisition of HPV were studied. High-risk HPV types (HPV16 and HPV18) were detected using the Abbott Real Time HR HPV test. To determine the genotype, partial L1 region sequences of HPV-positive samples were subjected to sequencing using MY/09/MY11 primers, and a phylogenetic tree was constructed using CLC software. The study found a 4.74% prevalence of HPV, with the most frequent HPV type found being the low-risk HPV6 (in 25% of infected individuals), followed by HPV55 (22.9%), HPV11 (20.8%), and high-risk types HPV45 (12.5%), HPV33 (8.33%), HPV18 (6.25%), and HPV16 (4.16%). Phylogenetic analysis of all HPV types in this study showed 80-99% nucleotide identity with types related to the same species. The sequences were clustered with China, India, Mexico, Iran, Slovenia, and Germany, showing the diversity in origin of the various genotypes prevalent in Pakistan. In this population with a normal cervical cytology, the prevalence of high-risk HPV types was very low. The major prevalent HPV genotype in Punjab Province of Pakistan was the low-risk HPV type 6, followed by HPV type 55. Sequencing of the partial L1 region suggested that the region was highly conserved in all reported sequences. This study highlights the need to conduct robust epidemiological studies in the region and to develop regular HPV screening so that the situation does not reach an alarming stage resulting in cervical cancer. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Human alpha 7 acetylcholine receptor: cloning of the alpha 7 subunit from the SH-SY5Y cell line and determination of pharmacological properties of native receptors and functional alpha 7 homomers expressed in Xenopus oocytes.

PubMed

Peng, X; Katz, M; Gerzanich, V; Anand, R; Lindstrom, J

1994-03-01

The alpha-bungarotoxin-binding acetylcholine receptors from the human neuroblastoma cell line SH-SY5Y were found to cross-react with some monoclonal antibodies to alpha 7 subunits of nicotinic acetylcholine receptors from chicken brain. The human alpha 7 subunit cDNA from SH-SY5Y was cloned, revealing 94% amino acid sequence identity to rat alpha 7 subunits and 92% identity to chicken alpha 7 subunits. Native human alpha 7 receptors showed affinities for some ligands similar to those previously observed with native chicken alpha 7 receptors, but for other ligands there were large species-specific differences in binding affinity. These results paralleled properties of alpha 7 homomers expressed in Xenopus oocytes. Human alpha 7 homomers exhibited rapidly desensitizing, inwardly rectifying, agonist-induced, cation currents that triggered Ca(2+)-sensitive Cl- channels in the oocytes. A change in efficacy from partial agonist for chicken alpha 7 homomers to full agonist for human alpha 7 homomers was exhibited by 1,1-dimethyl-4-phenylpiperazinium. This result reveals a large species-specific pharmacological difference, despite small differences in alpha 7 sequences. This is important for understanding the effects of these drugs in humans and for identifying amino acids that may contribute to the acetylcholine binding site, for analysis by in vitro mutagenesis. These results also characterize properties of native alpha 7 receptors and alpha 7 homomers that will provide criteria for functional properties expected of structural subunits, when these can be identified, cloned, and coexpressed with alpha 7 subunits.

Characterization of X-OCRL, a Xenopus laevis homologue of OCRL-1, the Lowe oculocerebrorenal syndrome candidate gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reilly, D.S.; Nussbaum, R.L.

1994-09-01

The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less

Pathology and diagnosis of avian bornavirus infection in wild Canada geese (Branta canadensis), trumpeter swans (Cygnus buccinator) and mute swans (Cygnus olor) in Canada: a retrospective study.

PubMed

Delnatte, Pauline; Ojkic, Davor; Delay, Josepha; Campbell, Doug; Crawshaw, Graham; Smith, Dale A

2013-04-01

Nine hundred and fifty-five pathology cases collected in Ontario between 1992 and 2011 from wild free-ranging Canada geese, trumpeter swans and mute swans were retrospectively evaluated for the pathology associated with avian bornavirus (ABV) infection. Cases were selected based on the presence of upper gastrointestinal impaction, central nervous system histopathology or clinical history suggestive of ABV infection. The proportion of birds meeting at least one of these criteria was significantly higher at the Toronto Zoo (30/132) than elsewhere in Ontario (21/823). Central, peripheral and autonomic nervous tissues were examined for the presence of lymphocytes and plasma cells on histopathology. The presence of virus was assessed by immunohistochemistry and reverse transcriptase-polymerase chain reaction (RT-PCR) on frozen brains and on formalin-fixed paraffin-embedded tissues. Among selected cases, 86.3% (44/51) were considered positive on histopathology, 56.8% (29/51) were positive by immunohistochemistry, and RT-PCR was positive on 88.2% (15/17) of the frozen brains and 78.4% (40/51) of the formalin-fixed paraffin-embedded samples. Histopathological lesions included gliosis and lymphoplasmacytic perivascular cuffing in brain (97.7%), spinal cord (50%), peripheral nerves (55.5%) and myenteric ganglia or nerves (62.8%), resembling lesions described in parrots affected with proventricular dilatation disease. Partial amino acid sequences of the nucleocapsid gene from seven geese were 100% identical amongst themselves and 98.1 to 100% identical to the waterfowl sequences recently described in the USA. Although ABV has been identified in apparently healthy geese, our study confirmed that ABV can also be associated with significant disease in wild waterfowl species.

Extracellular synthesis gold nanotriangles using biomass of Streptomyces microflavus.

PubMed

Soltani Nejad, Meysam; Khatami, Mehrdad; Shahidi Bonjar, Gholam Hosein

2016-02-01

Applications of nanotechnology and nano-science have ever-expanding breakthroughs in medicine, agriculture and industries in recent years; therefore, synthesis of metals nanoparticle (NP) has special significance. Synthesis of NPs by chemical methods are long, costly and hazardous for environment so biosynthesis has been developing interest for researchers. In this regard, the extracellular biosynthesis of gold nanotriangles (AuNTs) performed by use of the soil Streptomycetes. Streptomycetes isolated from rice fields of Guilan Province, Iran, showed biosynthetic activity for producing AuNTs via in vitro experiments. Among all 15 Streptomyces spp. isolates, isolate No. 5 showed high biosynthesis activity. To determine the bacterium taxonomical identity at genus level, its colonies characterised morphologically by use of scanning electron microscope. The polymerase chain reaction (PCR) molecular analysis of active isolate represented its identity partially. In this regard, 16S rRNA gene of the isolate was amplified using universal bacterial primers FD1 and RP2. The PCR products were purified and sequenced. Sequence analysis of 16S rDNA was then conducted using National Center for Biotechnology Information Basic Local Alignment Search Tool method. The AuNTs obtained were characterised by ultraviolet-visible spectroscopy, atomic force microscopy, transmission electron microscopy and energy dispersive X-ray spectroscopy, Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction spectroscopy analyses. The authors results indicated that Streptomyces microflavus isolate 5 bio-synthesises extracellular AuNTs in the range of 10-100 nm. Synthesised SNPs size ranged from 10 to 100 nm. In comparison with chemical methods for synthesis of metal NPs, the biosynthesis of AuNTs by Streptomyces source is a fast, simple and eco-friendly method. The isolate is a good candidate for further investigations to optimise its production efficacy for further industrial goals in biosynthesis of AuNTs.

Human Rhinovirus 87 and Enterovirus 68 Represent a Unique Serotype with Rhinovirus and Enterovirus Features

PubMed Central

Blomqvist, Soile; Savolainen, Carita; Råman, Laura; Roivainen, Merja; Hovi, Tapani

2002-01-01

It has recently been reported that all but one of the 102 known serotypes of the genus Rhinovirus segregate into two genetic clusters (C. Savolainen, S. Blomqvist, M. N. Mulders, and T. Hovi, J. Gen. Virol. 83:333-340, 2002). The only exception is human rhinovirus 87 (HRV87). Here we demonstrate that HRV87 is genetically and antigenically highly similar to enterovirus 68 (EV68) and is related to EV70, the other member of human enterovirus group D. The partial nucleotide sequences of the 5′ untranslated region, capsid regions VP4/VP2 and VP1, and the 3D RNA polymerase gene of the HRV87 prototype strain F02-3607 Corn showed 97.3, 97.8, 95.2, and 95.9% identity to the corresponding regions of EV68 prototype strain Fermon. The amino acid identities were 100 and 98.1% for the products of the two capsid regions and 97.9% for 3D RNA polymerase. Antigenic cross-reaction between HRV87 and EV68 was indicated by microneutralization with monotypic antisera. Phylogenetic analysis showed definite clustering of HRV87 and EV68 with EV70 for all sequences examined. Both HRV87 and EV68 were shown to be acid sensitive by two different assays, while EV70 was acid resistant, which is typical of enteroviruses. The cytopathic effect induced by HRV87 or EV68 was inhibited by monoclonal antibodies to the decay-accelerating factor known to be the receptor of EV70. We conclude that HRV87 and EV68 are strains of the same picornavirus serotype presenting features of both rhinoviruses and enteroviruses. PMID:12409401

Molecular cloning, characterization and expression analysis of TLR9, MyD88 and TRAF6 genes in common carp (Cyprinus carpio).

PubMed

Kongchum, Pawapol; Hallerman, Eric M; Hulata, Gideon; David, Lior; Palti, Yniv

2011-01-01

Induction of innate immune pathways is critical for early host defense, but there is limited understanding of how teleost fishes recognize pathogen molecules and activate these pathways. In mammals, cells of the innate immune system detect pathogenic molecular structures using pattern recognition receptors (PRRs). TLR9 functions as a PRR that recognizes CpG motifs in bacterial and viral DNA and requires adaptor molecules MyD88 and TRAF6 for signal transduction. Here we report full-length cDNA isolation, structural characterization and tissue mRNA expression analysis of the common carp (cc) TLR9, MyD88 and TRAF6 gene orthologs. The ccTLR9 open-reading frame (ORF) is predicted to encode a 1064-amino acid (aa) protein. We found that MyD88 and TRAF6 genes are duplicated in common carp. This is the first report of TRAF6 duplication in a vertebrate genome and stronger evidence in support of MyD88 duplication is provided. The ccMyD88a and b ORFs are predicted to encode 288-aa and 284-aa peptides, respectively. They share 91% aa sequence identity between paralogs. The ccTRAF6a and b ORFs are both predicted to encode 543-aa peptides sharing 95% aa sequence identity between paralogs. The ccTLR9 gene is contained in a single large exon. The ccMyD88a and ccMyD88b coding sequences span five exons. The TRAF6b gene spans six exons. PCR amplification to obtain the entire coding sequence of ccTRAF6a gene was not successful. The 2104-bp fragment amplified covers the 3' end of the gene and it contains a partial sequence of one exon and three complete exons. The predicated protein domains of the ccTLR9, ccMyD88 and ccTRAF6 are conserved and resemble orthologs from other vertebrates. Real-time quantitative PCR assays of the ccTLR9, MyD88a and b, and TRAF6a and b gene transcripts in healthy common carp indicated that mRNA expression varied between tissues. Differential expression of duplicate copies were found for ccMyD88 and ccTRAF6 in white and red muscle tissues, suggesting that paralogs may have evolved and attained a new function. The genomic information we describe in this paper provides evidence of sequence and structural conservation of immune response genes in common carp. Published by Elsevier Ltd.

Deep Sequencing Analysis of Apple Infecting Viruses in Korea

PubMed Central

Cho, In-Sook; Igori, Davaajargal; Lim, Seungmo; Choi, Gug-Seoun; Hammond, John; Lim, Hyoun-Sub; Moon, Jae Sun

2016-01-01

Deep sequencing has generated 52 contigs derived from five viruses; Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV), Apple stem pitting virus (ASPV), Apple green crinkle associated virus (AGCaV), and Apricot latent virus (ApLV) were identified from eight apple samples showing small leaves and/or growth retardation. Nucleotide (nt) sequence identity of the assembled contigs was from 68% to 99% compared to the reference sequences of the five respective viral genomes. Sequences of ASPV and ASGV were the most abundantly represented by the 52 contigs assembled. The presence of the five viruses in the samples was confirmed by RT-PCR using specific primers based on the sequences of each assembled contig. All five viruses were detected in three of the samples, whereas all samples had mixed infections with at least two viruses. The most frequently detected virus was ASPV, followed by ASGV, ApLV, ACLSV, and AGCaV which were withal found in mixed infections in the tested samples. AGCaV was identified in assembled contigs ID 1012480 and 93549, which showed 82% and 78% nt sequence identity with ORF1 of AGCaV isolate Aurora-1. ApLV was identified in three assembled contigs, ID 65587, 1802365, and 116777, which showed 77%, 78%, and 76% nt sequence identity respectively with ORF1 of ApLV isolate LA2. Deep sequencing assay was shown to be a valuable and powerful tool for detection and identification of known and unknown virome in infected apple trees, here identifying ApLV and AGCaV in commercial orchards in Korea for the first time. PMID:27721694

Subgrouping Automata: automatic sequence subgrouping using phylogenetic tree-based optimum subgrouping algorithm.

PubMed

Seo, Joo-Hyun; Park, Jihyang; Kim, Eun-Mi; Kim, Juhan; Joo, Keehyoung; Lee, Jooyoung; Kim, Byung-Gee

2014-02-01

Sequence subgrouping for a given sequence set can enable various informative tasks such as the functional discrimination of sequence subsets and the functional inference of unknown sequences. Because an identity threshold for sequence subgrouping may vary according to the given sequence set, it is highly desirable to construct a robust subgrouping algorithm which automatically identifies an optimal identity threshold and generates subgroups for a given sequence set. To meet this end, an automatic sequence subgrouping method, named 'Subgrouping Automata' was constructed. Firstly, tree analysis module analyzes the structure of tree and calculates the all possible subgroups in each node. Sequence similarity analysis module calculates average sequence similarity for all subgroups in each node. Representative sequence generation module finds a representative sequence using profile analysis and self-scoring for each subgroup. For all nodes, average sequence similarities are calculated and 'Subgrouping Automata' searches a node showing statistically maximum sequence similarity increase using Student's t-value. A node showing the maximum t-value, which gives the most significant differences in average sequence similarity between two adjacent nodes, is determined as an optimum subgrouping node in the phylogenetic tree. Further analysis showed that the optimum subgrouping node from SA prevents under-subgrouping and over-subgrouping. Copyright © 2013. Published by Elsevier Ltd.

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Exercisers' identities and exercise dependence: the mediating effect of exercise commitment.

PubMed

Lu, Frank Jing-Horng; Hsu, Eva Ya-Wen; Wang, Junn-Ming; Huang, Mei-Yao; Chang, Jo-Ning; Wang, Chien-Hsin

2012-10-01

The purpose of this study was to examine the associations of exercise identity, exercise commitment, exercise dependence, and, particularly, the mediating effects of exercise commitment on the relationship between exercise identity and exercise dependence. 253 Taiwanese regular exercisers completed measures, including the Exercise Dependence Scale-Revised, the Exercise Identity Scale, the Exercise Commitment Scale, and the Godin Leisure Time Exercise Questionnaire. Results showed that exercise identity, exercise dependence, and two types of exercise commitment were moderately to highly correlated. Furthermore, structural equation modelling indicated that a "have to" commitment partially mediated the relationship between exercise identity and exercise dependence. Based on the mediating role of a "have to" commitment, the findings are particularly informative to exercise instructors and for exercise program managers.

Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.

PubMed

Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G

1997-03-01

cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP 1a and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (Armoracia rusticana) isoperoxidases HRP C, HRP E5 and the similar Arabidopsis isoperoxidases ATP Ca, ATP Cb, and ATP Ea. However ATP 1a is 87% identical in amino acid sequence to a peroxidase encoded by an mRNA isolated from cotton (Gossypium hirsutum). As cotton and Arabidopsis belong to rather diverse families (Malvaceae and Crucifereae, respectively), in contrast with Arabidopsis and horseradish (both Crucifereae), the high degree of sequence identity indicates that this novel type of peroxidase, albeit of unknown function, is likely to be widespread in plant species. The atp 1 and atp 2 types of cDNA sequences were the most redundant among the 28 different isoperoxidases identified among about 200 peroxidase encoding ESTs. Interestingly, 8 out of totally 38 EST sequences coding for ATP 1 showed three identical nucleotide substitutions. This variant form is designated ATP 1b. Similarly, six out of totally 16 EST sequences coding for ATP 2 showed a number of deletions and nucleotide changes. This variant form is designated ATP 2b. The selected EST clones are full-length and contain coding regions of 993 nucleotides for atp 1a, and 984 nucleotides for atp 2a. These regions show 61% DNA sequence identity. The predicted mature proteins ATP 1a, and ATP 2a are 57% identical in sequence and contain the structurally and functionally important residues, characteristic of the plant peroxidase superfamily. However, they do show two differences of importance to peroxidase catalysis: (1) the asparagine residue linked with the active site distal histidine via hydrogen bonding is absent; (2) an N-glycosylation site is located right at the entrance to the heme channel. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to identify mRNAs coding for ATP 1a/b and ATP 2a/b in germinating seeds, seedlings, roots, leaves, stems, flowers and cell suspension culture using elongation factor 1alpha (EF-1alpha) for the first time as a positive control. Both mRNAs were transcribed at levels comparable to EF-1alpha in all plant tissues investigated which were more than two days old, and in cell suspension culture. In addition, the mRNA coding for ATP 1a/b was found in two day old germinating seeds. The abundant transcription of ATP 1a/b and ATP 2a/b is in line with their many entries in dbEST, and indicates essential roles for these novel peroxidases.

Characterization of a potent platelet aggregation inducer from Cerastes cerastes (Egyptian sand viper) venom.

PubMed

Basheer, A R; el-Asmar, M F; Soslau, G

1995-07-03

A potent, proteinaceous inducer of platelet aggregation designated as IVa, has been purified to homogeneity from Cerastes cerastes venom by molecular sieve and ion exchange chromatography. It is composed of 2 subunits with total M(r) of 62,000 as shown by native gel chromatography and chemical cross-linking with disuccinimidyl suberate. It is not clear at the present time whether both subunits are identical gene products, however, both have identical N-terminal sequences for the first 15 amino acids. The protein has a pI above 9.6. IVa (0.1 micrograms/ml) could aggregate platelets up to 80% and was inhibited by p-APMSF, leupeptin, iodoacetamide, protein kinase C inhibitor, phosphatase inhibitor, ATP and PGE1, while it was insensitive to acetylsalicylic acid, ADP scavenger system, protein kinase A inhibitor and hirudin. Protein IVa is a serine proteinase with thrombin-like activity as it hydrolysed thrombin chromogenic substrate CBS 34.47, its aggregatory activity was partially inhibited by monoclonal antibodies against GPIb and the thrombin receptor, as was the thrombin, and its ability to induce intracellular Ca2+ release was blocked by pretreating platelets with thrombin. Unlike thrombin, the IVa protein showed very weak coagulant activity as indicated by plasma recalcification time and fibrinogen clotting time although it could hydrolyse fibrinogen alpha-chains.

Ectopic expression of a Catalpa bungei (Bignoniaceae) PISTILLATA homologue rescues the petal and stamen identities in Arabidopsis pi-1 mutant.

PubMed

Jing, Danlong; Xia, Yan; Chen, Faju; Wang, Zhi; Zhang, Shougong; Wang, Junhui

2015-02-01

PISTILLATA (PI) plays crucial roles in Arabidopsis flower development by specifying petal and stamen identities. To investigate the molecular mechanisms underlying organ development of woody angiosperm in Catalpa, we isolated and identified a PI homologue, referred to as CabuPI (C. bungei PISTILLATA), from two genetically cognate C. bungei (Bignoniaceae) bearing single and double flowers. Sequence and phylogenetic analyses revealed that the gene is closest related to the eudicot PI homologues. Moreover, a highly conserved PI-motif is found in the C-terminal regions of CabuPI. Semi-quantitative and quantitative real time PCR analyses showed that the expression of CabuPI was restricted to petals and stamens. However, CabuPI expression in the petals and stamens persisted throughout all floral development stages, but the expression levels were different. In 35S::CabuPI transgenic homozygous pi-1 mutant Arabidopsis, the second and the third whorl floral organs produced normal petals and a different number of stamens, respectively. Furthermore, ectopic expression of the CabuPI in transgenic wild-type or heterozygote pi-1 mutant Arabidopsis caused the first whorl sepal partially converted into a petal-like structure. These results clearly reveal the functional conservation of PI homologues between C. bungei and Arabidopsis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Complete genome sequence of the first human parechovirus type 3 isolated in Taiwan.

PubMed

Chang, Jenn-Tzong; Yang, Chih-Shiang; Chen, Bao-Chen; Chen, Yao-Shen; Chang, Tsung-Hsien

2017-11-01

The first human parechovirus 3 (HPeV3 VGHKS-2007) in Taiwan was identified from a clinical specimen from a male infant. The entire genome of the HPeV3 isolate was sequenced and compared to known HPeV3 sequences. Genome alignment data showed that HPeV3 VGHKS-2007 shares the highest nucleotide identity, 99%, with the Japanese strain of HPeV3 1361K-162589-Yamagata-2008. All HPeV3 isolates possess at least 97% amino acid identity. The analysis of the genome sequence of HPeV3 VGHKS-2007 will facilitate future investigations of the epidemiology and pathogenicity of HPeV3 infection. Copyright © 2017. Published by Elsevier Taiwan LLC.

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

PubMed

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Molecular characterization of two prunus necrotic ringspot virus isolates from Canada.

PubMed

Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming

2012-05-01

We determined the entire RNA1, 2 and 3 sequences of two prunus necrotic ringspot virus (PNRSV) isolates, Chr3 from cherry and Pch12 from peach, obtained from an orchard in the Niagara Fruit Belt, Canada. The RNA1, 2 and 3 of the two isolates share nucleotide sequence identities of 98.6%, 98.4% and 94.5%, respectively. Their RNA1- and 2-encoded amino acid sequences are about 98% identical to the corresponding sequences of a cherry isolate, CH57, the only other PNRSV isolate with complete RNA1 and 2 sequences available. Phylogenetic analysis of the coat protein and movement protein encoded by RNA3 of Pch12 and Chr3 and published PNRSV isolates indicated that Chr3 belongs to the PV96 group and Pch12 belongs to the PV32 group.

FragIdent--automatic identification and characterisation of cDNA-fragments.

PubMed

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Complete sequence and diversity of a maize-associated Polerovirus in East Africa.

PubMed

Massawe, Deogracious P; Stewart, Lucy R; Kamatenesi, Jovia; Asiimwe, Theodore; Redinbaugh, Margaret G

2018-06-01

Since 2011-2012, Maize lethal necrosis (MLN) has emerged in East Africa, causing massive yield loss and propelling research to identify viruses and virus populations present in maize. As expected, next generation sequencing (NGS) has revealed diverse and abundant viruses from the family Potyviridae, primarily sugarcane mosaic virus (SCMV), and maize chlorotic mottle virus (MCMV) (Tombusviridae), which are known to cause MLN by synergistic co-infection. In addition to these expected viruses, we identified a virus in the genus Polerovirus (family Luteoviridae) in 104/172 samples selected for MLN or other potential virus symptoms from Kenya, Uganda, Rwanda, and Tanzania. This polerovirus (MF974579) nucleotide sequence is 97% identical to maize-associated viruses recently reported in China, termed 'maize yellow mosaic virus' (MaYMV) and maize yellow dwarf virus (MaYMV; KU291101, KU291107, MYDV-RMV2; KT992824); and 99% identical to MaYMV (KY684356) infecting sugarcane and itch grass in Nigeria; 83% identical to a barley-associated polerovirus recently identified in Korea (BVG; KT962089); and 79% identical to the U.S. maize-infecting polerovirus maize yellow dwarf virus (MYDV-RMV; KT992824). Nucleotide sequences from ORF0 of 20 individual East African isolates collected from Kenya, Uganda, Rwanda, and Tanzania shared 98% or higher identity, and were detected in 104/172 (60.5%) of samples collected for virus-like symptoms, indicating extensive prevalence but limited diversity of this virus in East Africa. We refer to this virus as "MYDV-like polerovirus" until symptoms of the virus in maize are known.

Identification of a novel vitivirus from grapevines in New Zealand.

PubMed

Blouin, Arnaud G; Keenan, Sandi; Napier, Kathryn R; Barrero, Roberto A; MacDiarmid, Robin M

2018-01-01

We report a sequence of a novel vitivirus from Vitis vinifera obtained using two high-throughput sequencing (HTS) strategies on RNA. The initial discovery from small-RNA sequencing was confirmed by HTS of the total RNA and Sanger sequencing. The new virus has a genome structure similar to the one reported for other vitiviruses, with five open reading frames (ORFs) coding for the conserved domains described for members of that genus. Phylogenetic analysis of the complete genome sequence confirmed its affiliation to the genus Vitivirus, with the closest described viruses being grapevine virus E (GVE) and Agave tequilana leaf virus (ATLV). However, the virus we report is distinct and shares only 51% amino acid sequence identity with GVE in the replicase polyprotein and 66.8% amino acid sequence identity with ATLV in the coat protein. This is well below the threshold determined by the ICTV for species demarcation, and we propose that this virus represents a new species. It is provisionally named "grapevine virus G".

Sequences Associated with Centromere Competency in the Human Genome

PubMed Central

Hayden, Karen E.; Strome, Erin D.; Merrett, Stephanie L.; Lee, Hye-Ran; Rudd, M. Katharine

2013-01-01

Centromeres, the sites of spindle attachment during mitosis and meiosis, are located in specific positions in the human genome, normally coincident with diverse subsets of alpha satellite DNA. While there is strong evidence supporting the association of some subfamilies of alpha satellite with centromere function, the basis for establishing whether a given alpha satellite sequence is or is not designated a functional centromere is unknown, and attempts to understand the role of particular sequence features in establishing centromere identity have been limited by the near identity and repetitive nature of satellite sequences. Utilizing a broadly applicable experimental approach to test sequence competency for centromere specification, we have carried out a genomic and epigenetic functional analysis of endogenous human centromere sequences available in the current human genome assembly. The data support a model in which functionally competent sequences confer an opportunity for centromere specification, integrating genomic and epigenetic signals and promoting the concept of context-dependent centromere inheritance. PMID:23230266

Complete genome sequence of Southern tomato virus naturally infecting tomatoes in Bangladesh using small RNA deep sequencing

USDA-ARS?s Scientific Manuscript database

The complete genome sequence of a Southern tomato virus (STV) isolate on tomato plants in a seed production field in Bangladesh was obtained for the first time using next generation sequencing. The identified isolate STV_BD-13 shares high degree of sequence identity (99%) with several known STV isol...

Complete genome sequence of southern tomato virus identified from China using next generation sequencing

USDA-ARS?s Scientific Manuscript database

Complete genome sequence of a double-stranded RNA (dsRNA) virus, southern tomato virus (STV), on tomatoes in China, was elucidated using small RNAs deep sequencing. The identified STV_CN12 shares 99% sequence identity to other isolates from Mexico, France, Spain, and U.S. This is the first report ...

[Homology analysis of the extended-V region of the surface proteins in different serotype Streptococcus mutans].

PubMed

He, Kui-Fang; Liu, Jian-Guo; Liu, Tian-Jia; Yang, De-Qin; Zhuang, Heng; Li, Song

2006-08-01

To analysis the homology among the extended-V region of the surface proteins in different serotype Streptococcus mutans (c, f, d, g) and to find out it's significance in anti-caries vaccine. The DNA of the bacteria (standarded serotype c, d, f, g and partial serotype c clinicals) was extracted and the extended-V region (SrV+, 1 384-2 514 bp) was amplified using polymerase chain reaction (PCR). Then the products were assessed using restriction fragment length polymorphism (RFLP) by endonuclease Dde I. The genotypings were sequenced and analysised using the program of BLAST on NCBI Gene Bank database. About 1.13 kb fragments were produced both in serotype c and f, the serotype d and g were failed. The RFLP results showed that five different patterns(A, B, C, D, E) among the 117 PCR products were reveled by Dde I. The ration of the genotypings A and B were the most among the strains, the C was lower, the D and E respectively was 1 and 3 strains per genotype. OMZ175 (serotype f) was belong to B genotype. Selected one of the A, B, C genotypings to sequenced and blasted. Then the results of the blastn showed that the identities of the gene sequence were 92%-98% between the serotype c and serotype f, part sequence of the serotype g was homology with the SrV+ of the serotype c, the protein sequence among serotype c, d, f, g were 77%-82%. It is reasonable to use some putative pipetides to study the anti-caries vaccine among the extended-V regions of the surface proteins in different serotype (c, d, f, g) in S. mutans.

Characterization of the novel antifungal protein PgAFP and the encoding gene of Penicillium chrysogenum.

PubMed

Rodríguez-Martín, Andrea; Acosta, Raquel; Liddell, Susan; Núñez, Félix; Benito, M José; Asensio, Miguel A

2010-04-01

The strain RP42C from Penicillium chrysogenum produces a small protein PgAFP that inhibits the growth of some toxigenic molds. The molecular mass of the protein determined by electrospray ionization mass spectrometry (ESI-MS) was 6 494Da. PgAFP showed a cationic character with an estimated pI value of 9.22. Upon chemical and enzymatic treatments of PgAFP, no evidence for N- or O-glycosylations was obtained. Five partial sequences of PgAFP were obtained by Edman degradation and by ESI-MS/MS after trypsin and chymotrypsin digestions. Using degenerate primers from these peptide sequences, a segment of 70bp was amplified by PCR from pgafp gene. 5'- and 3'-ends of pgafp were obtained by RACE-PCR with gene-specific primers designed from the 70bp segment. The complete pgafp sequence of 404bp was obtained using primers designed from 5'- and 3'-ends. Comparison of genomic and cDNA sequences revealed a 279bp coding region interrupted by two introns of 63 and 62bp. The precursor of the antifungal protein consists of 92 amino acids and appears to be processed to the mature 58 amino acids PgAFP. The deduced amino acid sequence of the mature protein shares 79% identity to the antifungal protein Anafp from Aspergillus niger. PgAFP is a new protein that belongs to the group of small, cysteine-rich, and basic proteins with antifungal activity produced by ascomycetes. Given that P. chrysogenum is regarded as safe mold commonly found in foods, PgAFP may be useful to prevent growth of toxigenic molds in food and agricultural products. Copyright (c) 2009 Elsevier Inc. All rights reserved.

Identification, Characterization, and Recombinant Expression of Epidermicin NI01, a Novel Unmodified Bacteriocin Produced by Staphylococcus epidermidis That Displays Potent Activity against Staphylococci

PubMed Central

Sandiford, Stephanie

2012-01-01

We describe the discovery, purification, characterization, and expression of an antimicrobial peptide, epidermicin NI01, which is an unmodified bacteriocin produced by Staphylococcus epidermidis strain 224. It is a highly cationic, hydrophobic, plasmid-encoded peptide that exhibits potent antimicrobial activity toward a wide range of pathogenic Gram-positive bacteria including methicillin-resistant Staphylococcus aureus (MRSA), enterococci, and biofilm-forming S. epidermidis strains. Purification of the peptide was achieved using a combination of hydrophobic interaction, cation exchange, and high-performance liquid chromatography (HPLC). Matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) analysis yielded a molecular mass of 6,074 Da, and partial sequence data of the peptide were elucidated using a combination of tandem mass spectrometry (MS/MS) and de novo sequencing. The draft genome sequence of the producing strain was obtained using 454 pyrosequencing technology, thus enabling the identification of the structural gene using the de novo peptide sequence data previously obtained. Epidermicin NI01 contains 51 residues with four tryptophan and nine lysine residues, and the sequence showed approximately 50% identity to peptides lacticin Z, lacticin Q, and aureocin A53, all of which belong to a new family of unmodified type II-like bacteriocins. The peptide is active in the nanomolar range against S. epidermidis, MRSA isolates, and vancomycin-resistant enterococci. Other unique features displayed by epidermicin include a high degree of protease stability and the ability to retain antimicrobial activity over a pH range of 2 to 10, and exposure to the peptide does not result in development of resistance in susceptible isolates. In this study we also show the structural gene alone can be cloned into Escherichia coli strain BL21(DE3), and expression yields active peptide. PMID:22155816

Candida mesorugosa sp. nov., a novel yeast species similar to Candida rugosa, isolated from a tertiary hospital in Brazil.

PubMed

Chaves, Guilherme M; Terçarioli, Gisela R; Padovan, Ana Carolina B; Rosas, Robert C; Ferreira, Renata C; Melo, Analy S A; Colombo, Arnaldo L

2013-04-01

Candida rugosa is a yeast species that is emerging as a causative agent of invasive infection, particularly in Latin America. Recently, C. pseudorugosa was proposed as a new species closely related to C. rugosa. We evaluated in this investigation the genetic heterogeneity within the C. rugosa species complex. All clinical isolates used in this study were identified phenotypically as C. rugosa but were genotypically different from the C. rugosa type, ATCC 10571. RAPD marker analysis revealed less than 83% similarity between our clinical isolates and the C. rugosa type strain. The D1/D2 region sequences of our clinical isolates showed 98% identity with C. rugosa but only 94-95% identity with C. pseudorugosa. The ITS rDNA sequences of the Brazilian isolates showed 91% identity with the C. rugosa ATCC 10571 ITS sequence. Network and Bayesian analyses of ITS and housekeeping gene sequences separated our clinical isolates into different branches from C. rugosa type strain. These differences are sufficient to reassign our isolates to a distinct species, named C. mesorugosa.

Thermophilic cellobiohydrolase

DOEpatents

Sapra, Rajat; Park, Joshua I.; Datta, Supratim; Simmons, Blake A.

2017-04-18

The present invention provides for a composition comprising a polypeptide comprising a first amino acid sequence having at least 70% identity with the amino acid sequence of Csac GH5 wherein said first amino acid sequence has a thermostable or thermophilic cellobiohydrolase (CBH) or exoglucanase activity.

Predicting organizational citizenship behavior from the functional analysis and role identity perspectives: further evidence in Spanish employees.

PubMed

Dávila, Ma Celeste; Finkelstein, Marcia A

2010-05-01

Organizational citizenship behavior (OCB) is a prosocial activity with similarities to volunteerism. The purpose of this work is to contribute new evidence about the relevance to OCB of two models of sustained volunteerism, functional analysis and role identity theory. A total of 983 Spanish employees at49 organizations completed surveys measuring amount of OCB, motives for engaging in citizenship behavior, and the degree to which respondents developed an organizational citizen role identity. The results showed that both motives and role identity were significant predictors of OCB, with motive partially mediating the role identity-OCB relationship. The findings suggest that similar mechanisms are involved in sustaining volunteerism and OCB.

Sinorhizobium meliloti strains TII7 and A5 by Multilocus Sequence Typing (MLST) have chromsomes identical with Rm1021 and form an effective and ineffective symbiosis with Medicago truncatula line Jemalong A17, respectively

USDA-ARS?s Scientific Manuscript database

The strains TII7 and A5 formed an effective and ineffective symbiosis with Medicago truncatula Jemalong A17, respectively. Both were shown to have identical chromsomes with strains Rm1021 and RCR2011 using a Multilocus Sequence Typing method. The 2260 bp segments of DNA stretching from the 3’ end ...