The partial-reinforcement extinction effect and the contingent-sampling hypothesis.

PubMed

Hochman, Guy; Erev, Ido

2013-12-01

The partial-reinforcement extinction effect (PREE) implies that learning under partial reinforcements is more robust than learning under full reinforcements. While the advantages of partial reinforcements have been well-documented in laboratory studies, field research has failed to support this prediction. In the present study, we aimed to clarify this pattern. Experiment 1 showed that partial reinforcements increase the tendency to select the promoted option during extinction; however, this effect is much smaller than the negative effect of partial reinforcements on the tendency to select the promoted option during the training phase. Experiment 2 demonstrated that the overall effect of partial reinforcements varies inversely with the attractiveness of the alternative to the promoted behavior: The overall effect is negative when the alternative is relatively attractive, and positive when the alternative is relatively unattractive. These results can be captured with a contingent-sampling model assuming that people select options that provided the best payoff in similar past experiences. The best fit was obtained under the assumption that similarity is defined by the sequence of the last four outcomes.

Evaluation of full S1 gene sequencing of classical and variant infectious bronchitis viruses extracted from allantoic fluid and FTA cards.

PubMed

Manswr, Basim; Ball, Christopher; Forrester, Anne; Chantrey, Julian; Ganapathy, Kannan

2018-08-01

Sequence variability in the S1 gene determines the genotype of infectious bronchitis virus (IBV) strains. A single RT-PCR assay was developed to amplify and sequence the full S1 gene for six classical and variant IBVs (M41, D274, 793B, IS/885/00, IS/1494/06 and Q1) enriched in allantoic fluid (AF) or the same AF inoculated onto Flinders Technology Association (FTA) cards. Representative strains from each genotype were grown in specific-pathogen-free eggs and RNA was extracted from AF. Full S1 gene amplification was achieved using primer A and primer 22.51. Products were sequenced using primers A, 1050+, 1380+ and SX3+ to obtain short sequences covering the full gene. Following serial dilutions of AF, detection limits of the partial assay were higher than those of the full S1 gene. Partial S1 sequences exhibited higher-than-average nucleotide similarity percentages (79%; 352 bp) compared to full S1 sequences (77%; 1756 bp), suggesting that full S1 analysis allows greater strain differentiation. For IBV detection from AF-inoculated FTA cards, four serotypes were incubated for up to 21 days at three temperatures, 4°C, room temperature (approximately 24°C) and 40°C. RNA was extracted and tested with partial and full S1 protocols. Through partial sequencing, all IBVs were successfully detected at all sampling points and storage temperatures. In contrast, using full S1 sequencing it was not possible to amplify the gene beyond 14 days or when stored at 40°C. Data presented show that for full S1 sequencing, a substantial amount of RNA is needed. Field samples collected onto FTA cards are unlikely to yield such quantity or quality. AF: allantoic fluid; CD50: ciliostatic dose 50; FTA: Flinders Technology Association; IB: infectious bronchitis; IBV: infectious bronchitis virus.

Dynamics of actin evolution in dinoflagellates.

PubMed

Kim, Sunju; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F

2011-04-01

Dinoflagellates have unique nuclei and intriguing genome characteristics with very high DNA content making complete genome sequencing difficult. In dinoflagellates, many genes are found in multicopy gene families, but the processes involved in the establishment and maintenance of these gene families are poorly understood. Understanding the dynamics of gene family evolution in dinoflagellates requires comparisons at different evolutionary scales. Studies of closely related species provide fine-scale information relative to species divergence, whereas comparisons of more distantly related species provides broad context. We selected the actin gene family as a highly expressed conserved gene previously studied in dinoflagellates. Of the 142 sequences determined in this study, 103 were from the two closely related species, Dinophysis acuminata and D. caudata, including full length and partial cDNA sequences as well as partial genomic amplicons. For these two Dinophysis species, at least three types of sequences could be identified. Most copies (79%) were relatively similar and in nucleotide trees, the sequences formed two bushy clades corresponding to the two species. In comparisons within species, only eight to ten nucleotide differences were found between these copies. The two remaining types formed clades containing sequences from both species. One type included the most similar sequences in between-species comparisons with as few as 12 nucleotide differences between species. The second type included the most divergent sequences in comparisons between and within species with up to 93 nucleotide differences between sequences. In all the sequences, most variation occurred in synonymous sites or the 5' UnTranslated Region (UTR), although there was still limited amino acid variation between most sequences. Several potential pseudogenes were found (approximately 10% of all sequences depending on species) with incomplete open reading frames due to frameshifts or early stop codons. Overall, variation in the actin gene family fits best with the "birth and death" model of evolution based on recent duplications, pseudogenes, and incomplete lineage sorting. Divergence between species was similar to variation within species, so that actin may be too conserved to be useful for phylogenetic estimation of closely related species.

Identification of Genes Encoding Conjugated Bile Salt Hydrolase and Transport in Lactobacillus johnsonii 100-100

PubMed Central

Elkins, Christopher A.; Savage, Dwayne C.

1998-01-01

Cytosolic extracts of Lactobacillus johnsonii 100-100 (previously reported as Lactobacillus sp. strain 100-100) contain four heterotrimeric isozymes composed of two peptides, α and β, with conjugated bile salt hydrolase (BSH) activity. We now report cloning, from the genome of strain 100-100, a 2,977-bp DNA segment that expresses BSH activity in Escherichia coli. The sequencing of this segment showed that it contained one complete and two partial open reading frames (ORFs). The 3′ partial ORF (927 nucleotides) was predicted by BLAST and confirmed with 5′ and 3′ deletions to be a BSH gene. Thermal asymmetric interlaced PCR was used to extend and complete the 948-nucleotide sequence of the BSH gene 3′ of the cloned segment. The predicted amino acid sequence of the 5′ partial ORF (651 nucleotides) was about 80% similar to the C-terminal half of the largest, complete ORF (1,353 nucleotides), and these two putative proteins were similar to several amine, multidrug resistance, and sugar transport proteins of the major facilitator superfamily. E. coli DH5α cells transformed with a construct containing these ORFs, in concert with an extracellular factor produced by strain 100-100, demonstrated levels of uptake of [14C]taurocholic acid that were increased as much as threefold over control levels. [14C]Cholic acid was taken up in similar amounts by strain DH5α pSportI (control) and DH5α p2000 (transport clones). These findings support a hypothesis that the ORFs are conjugated bile salt transport genes which may be arranged in an operon with BSH genes. PMID:9721268

Partial sequencing analysis of the NS5B region confirmed the predominance of hepatitis C virus genotype 1 infection in Jeddah, Saudi Arabia.

PubMed

El Hadad, Sahar; Al-Hamdan, Hesa; Linjawi, Sabah

2017-01-01

Chronic hepatitis C virus (HCV) infection and its progression are major health problems that many countries including Saudi Arabia are facing. Determination of HCV genotypes and subgenotypes is critical for epidemiological and clinical analysis and aids in the determination of the ideal treatment strategy that needs to be followed and the expected therapy response. Although HCV infection has been identified as the second most predominant type of hepatitis in Saudi Arabia, little is known about the molecular epidemiology and genetic variability of HCV circulating in the Jeddah province of Saudi Arabia. The aim of this study was to determine the dominance of various HCV genotypes and subgenotypes circulating in Jeddah using partial sequencing of the NS5B region. To the best of our knowledge, this is the first study of its kind in Saudi Arabia. To characterize HCV genotypes and subgenotypes, serum samples from 56 patients with chronic HCV infection were collected and subjected to partial NS5B gene amplification and sequence analysis. Phylogenetic analysis of the NS5B partial sequences revealed that HCV/1 was the predominant genotype (73%), followed by HCV/4 (24.49%) and HCV/3 (2.04%). Moreover, pairwise analysis also confirmed these results based on the average specific nucleotide distance identity: ±0.112, ±0.112, and ±0.179 for HCV/1, HCV/4, and HCV/3, respectively, without any interference between genotypes. Notably, the phylogenetic tree of the HCV/1 subgenotypes revealed that all the isolates (100%) from the present study belonged to the HCV/1a subgenotype. Our findings also revealed similarities in the nucleotide sequences between HCV circulating in Saudi Arabia and those circulating in countries such as Morocco, Egypt, Canada, India, Pakistan, and France. These results indicated that determination of HCV genotypes and subgenotypes based on partial sequence analysis of the NS5B region is accurate and reliable for HCV subtype determination.

Retrotransposon insertion targeting: a mechanism for homogenization of centromere sequences on nonhomologous chromosomes.

PubMed

Birchler, James A; Presting, Gernot G

2012-04-01

The centromeres of most eukaryotic organisms consist of highly repetitive arrays that are similar across nonhomologous chromosomes. These sequences evolve rapidly, thus posing a mystery as to how such arrays can be homogenized. Recent work in species in which centromere-enriched retrotransposons occur indicates that these elements preferentially insert into the centromeric regions. In two different Arabidopsis species, a related element was recognized in which the specificity for such targeting was altered. These observations provide a partial explanation for how homogenization of centromere DNA sequences occurs.

Complete genomic sequences for hepatitis C virus subtypes 4b, 4c, 4d, 4g, 4k, 4l, 4m, 4n, 4o, 4p, 4q, 4r and 4t.

PubMed

Li, Chunhua; Lu, Ling; Wu, Xianghong; Wang, Chuanxi; Bennett, Phil; Lu, Teng; Murphy, Donald

2009-08-01

In this study, we characterized the full-length genomic sequences of 13 distinct hepatitis C virus (HCV) genotype 4 isolates/subtypes: QC264/4b, QC381/4c, QC382/4d, QC193/4g, QC383/4k, QC274/4l, QC249/4m, QC97/4n, QC93/4o, QC139/4p, QC262/4q, QC384/4r and QC155/4t. These were amplified, using RT-PCR, from the sera of patients now residing in Canada, 11 of which were African immigrants. The resulting genomes varied between 9421 and 9475 nt in length and each contains a single ORF of 9018-9069 nt. The sequences showed nucleotide similarities of 77.3-84.3 % in comparison with subtypes 4a (GenBank accession no. Y11604) and 4f (EF589160) and 70.6-72.8 % in comparison with genotype 1 (M62321/1a, M58335/1b, D14853/1c, and 1?/AJ851228) reference sequences. These similarities were often higher than those currently defined by HCV classification criteria for subtype (75.0-80.0 %) and genotype (67.0-70.0 %) division, respectively. Further analyses of the complete and partial E1 and partial NS5B sequences confirmed these 13 'provisionally assigned subtypes'.

Prevalence and molecular characterization of Hepatozoon canis in dogs from urban and rural areas in Southeast Brazil.

PubMed

de Miranda, R L; O'Dwyer, L H; de Castro, J R; Metzger, B; Rubini, A S; Mundim, A V; Eyal, O; Talmi-Frank, D; Cury, M C; Baneth, G

2014-10-01

The objective of this survey was to investigate the prevalence of Hepatozoon infection in dogs in the rural and urban areas of Uberlândia, Brazil by PCR and molecular characterization. DNA was obtained from blood samples collected from 346 local dogs from both genders and various ages. Seventeen PCR products from positive blood samples of urban dogs and 13 from the rural dogs were sequenced. Partial sequences of the 18S rRNA gene indicated that all 30 dogs were infected with Hepatozoon canis similar in sequence to H. canis from southern Europe. Four local dog sequences were submitted to GenBank (accessions JN835188; KF692038; KF692039; KF692040). This study indicates that H. canis is the cause of canine hepatozoonosis in Uberlândia and that infection is similarly widespread in rural and urban dogs. Copyright © 2014. Published by Elsevier Ltd.

Molecular phylogeny of some avian species using Cytochrome b gene sequence analysis

PubMed Central

Awad, A; Khalil, S. R; Abd-Elhakim, Y. M

2015-01-01

Veritable identification and differentiation of avian species is a vital step in conservative, taxonomic, forensic, legal and other ornithological interventions. Therefore, this study involved the application of molecular approach to identify some avian species i.e. Chicken (Gallus gallus), Muskovy duck (Cairina moschata), Japanese quail (Coturnix japonica), Laughing dove (Streptopelia senegalensis), and Rock pigeon (Columba livia). Genomic DNA was extracted from blood samples and partial sequence of the mitochondrial cytochrome b gene (358 bp) was amplified and sequenced using universal primers. Sequences alignment and phylogenetic analyses were performed by CLC main workbench program. The obtained five sequences were deposited in GenBank and compared with those previously registered in GenBank. The similarity percentage was 88.60% between Gallus gallus and Coturnix japonica and 80.46% between Gallus gallus and Columba livia. The percentage of identity between the studied species and GenBank species ranged from 77.20% (Columba oenas and Anas platyrhynchos) to 100% (Gallus gallus and Gallus sonneratii, Coturnix coturnix and Coturnix japonica, Meleagris gallopavo and Columba livia). Amplification of the partial sequence of mitochondrial cytochrome b gene proved to be practical for identification of an avian species unambiguously. PMID:27175180

Discrimination of germline V genes at different sequencing lengths and mutational burdens: A new tool for identifying and evaluating the reliability of V gene assignment.

PubMed

Zhang, Bochao; Meng, Wenzhao; Prak, Eline T Luning; Hershberg, Uri

2015-12-01

Immune repertoires are collections of lymphocytes that express diverse antigen receptor gene rearrangements consisting of Variable (V), (Diversity (D) in the case of heavy chains) and Joining (J) gene segments. Clonally related cells typically share the same germline gene segments and have highly similar junctional sequences within their third complementarity determining regions. Identifying clonal relatedness of sequences is a key step in the analysis of immune repertoires. The V gene is the most important for clone identification because it has the longest sequence and the greatest number of sequence variants. However, accurate identification of a clone's germline V gene source is challenging because there is a high degree of similarity between different germline V genes. This difficulty is compounded in antibodies, which can undergo somatic hypermutation. Furthermore, high-throughput sequencing experiments often generate partial sequences and have significant error rates. To address these issues, we describe a novel method to estimate which germline V genes (or alleles) cannot be discriminated under different conditions (read lengths, sequencing errors or somatic hypermutation frequencies). Starting with any set of germline V genes, this method measures their similarity using different sequencing lengths and calculates their likelihood of unambiguous assignment under different levels of mutation. Hence, one can identify, under different experimental and biological conditions, the germline V genes (or alleles) that cannot be uniquely identified and bundle them together into groups of specific V genes with highly similar sequences. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular studies on larvae of Pseudoterranova parasite of Trichiurus lepturus Linnaeus, 1758 and Pomatomus saltatrix (Linnaeus, 1766) off Brazilian waters.

PubMed

Borges, Juliana N; Cunha, Luiz F G; Miranda, Daniele F; Monteiro-Neto, Cassiano; Santos, Cláudia P

2015-12-01

Pseudoterranova larvae parasitizing cutlassfish Trichiurus lepturus and bluefish Pomatomus saltatrix from Southwest Atlantic coast of Brazil were studied in this work by morphological, ultrastructural and molecular approaches. The genetic analysis were performed for the ITS2 intergenic region specific for Pseudoterranova decipiens, the partial 28S (LSU) of ribosomal DNA and the mtDNA cox-1 region. We obtained results for the 28S region and mtDNA cox-1 that was amplified using the polymerase chain reaction and sequenced to evaluate the phylogenetic relationships between sequences of this study and sequences from the GenBank. The morphological profile indicated that all the nine specimens collected from both fish were L3 larvae of Pseudoterranova sp. The genetic profile confirmed the generic level but due to the absence of similar sequences for adult parasites on GenBank for the regions amplifyied, it was not possible to identify them to the species level. The sequences obtained presented 89% of similarity with Pseudoterranova decipiens (28S sequences) and Contracaecum osculatum B (mtDNA cox-1). The low similarity allied to the fact that the amplification with the specific primer for P. decipiens didn't occur, lead us to conclude that our sequences don't belong to P. decipiens complex.

Partial characterization of normal and Haemophilus influenzae-infected mucosal complementary DNA libraries in chinchilla middle ear mucosa.

PubMed

Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D

2010-04-01

We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.

Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

PubMed Central

Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

2010-01-01

Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

Two distinct DNA sequences recognized by transcription factors represent enthalpy and entropy optima

PubMed Central

Yin, Yimeng; Das, Pratyush K; Jolma, Arttu; Zhu, Fangjie; Popov, Alexander; Xu, You; Nilsson, Lennart

2018-01-01

Most transcription factors (TFs) can bind to a population of sequences closely related to a single optimal site. However, some TFs can bind to two distinct sequences that represent two local optima in the Gibbs free energy of binding (ΔG). To determine the molecular mechanism behind this effect, we solved the structures of human HOXB13 and CDX2 bound to their two optimal DNA sequences, CAATAAA and TCGTAAA. Thermodynamic analyses by isothermal titration calorimetry revealed that both sites were bound with similar ΔG. However, the interaction with the CAA sequence was driven by change in enthalpy (ΔH), whereas the TCG site was bound with similar affinity due to smaller loss of entropy (ΔS). This thermodynamic mechanism that leads to at least two local optima likely affects many macromolecular interactions, as ΔG depends on two partially independent variables ΔH and ΔS according to the central equation of thermodynamics, ΔG = ΔH - TΔS. PMID:29638214

West Nile Virus Isolation in Human and Mosquitoes, Mexico

PubMed Central

Elizondo-Quiroga, Darwin; Davis, C. Todd; Fernandez-Salas, Ildefonso; Escobar-Lopez, Roman; Olmos, Dolores Velasco; Gastalum, Lourdes Cecilia Soto; Acosta, Magaly Aviles; Elizondo-Quiroga, Armando; Gonzalez-Rojas, Jose I.; Cordero, Juan F. Contreras; Guzman, Hilda; Travassos da Rosa, Amelia; Blitvich, Bradley J.; Barrett, Alan D.T.; Beaty, Barry J.

2005-01-01

West Nile virus has been isolated for the first time in Mexico, from a sick person and from mosquitoes (Culex quinquefasciatus). Partial sequencing and analysis of the 2 isolates indicate that they are genetically similar to other recent isolates from northern Mexico and the western United States. PMID:16229779

Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

PubMed

Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

2014-08-01

Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Isolation of Candidatus Bartonella melophagi from Human Blood1

PubMed Central

Maggi, Ricardo G.; Kosoy, Michael; Mintzer, Melanie

2009-01-01

Candidatus Bartonella melophagi was isolated by blood culture from 2 women, 1 of whom was co-infected with B. henselae. Partial 16S rRNA, RNA polymerase B, and citrate synthase genes and 16S–23S internal transcribed spacer sequences indicated that human isolates were similar to Candidatus B. melophagi. PMID:19116054

Morphologic and Molecular Characterization of a Demodex (Acari: Demodicidae) Species from White-Tailed Deer (Odocoileus virginianus)

PubMed Central

Yabsley, Michael J.; Clay, Sarah E.; Gibbs, Samantha E. J.; Cunningham, Mark W.; Austel, Michaela G.

2013-01-01

Demodex mites, although usually nonpathogenic, can cause a wide range of dermatological lesions ranging from mild skin irritation and alopecia to severe furunculosis. Recently, a case of demodicosis from a white-tailed deer (Odocoileus virginianus) revealed a Demodex species morphologically distinct from Demodex odocoilei. All life cycle stages were considerably larger than D. odocoilei and although similar in size to D. kutzeri and D. acutipes from European cervids, numerous morphometrics distinguished the four species. Adult males and females were 209.1 ± 13.1 and 225.5 ± 13.4 μm in length, respectively. Ova, larva, and nymphs measured 65.1 ± 4.1, 124.9 ± 11.6, and 205.1 ± 19.4 μm in length, respectively. For phylogenetic analyses, a portion of the 18S rRNA gene was amplified and sequenced from samples of the WTD Demodex sp., two Demodex samples from domestic dogs, and Demodex ursi from a black bear. Phylogenetic analyses indicated that the WTD Demodex was most similar to D. musculi from laboratory mice. A partial sequence from D. ursi was identical to the WTD Demodex sequence; however, these two species can be differentiated morphologically. This paper describes a second Demodex species from white-tailed deer and indicates that 18S rRNA is useful for phylogenetic analysis of most Demodex species, but two morphologically distinct species had identical partial sequences. Additional gene targets should be investigated for phylogenetic and parasite-host association studies. PMID:27335854

rpoB-Based Identification of Nonpigmented and Late-Pigmenting Rapidly Growing Mycobacteria

PubMed Central

Adékambi, Toïdi; Colson, Philippe; Drancourt, Michel

2003-01-01

Nonpigmented and late-pigmenting rapidly growing mycobacteria (RGM) are increasingly isolated in clinical microbiology laboratories. Their accurate identification remains problematic because classification is labor intensive work and because new taxa are not often incorporated into classification databases. Also, 16S rRNA gene sequence analysis underestimates RGM diversity and does not distinguish between all taxa. We determined the complete nucleotide sequence of the rpoB gene, which encodes the bacterial β subunit of the RNA polymerase, for 20 RGM type strains. After using in-house software which analyzes and graphically represents variability stretches of 60 bp along the nucleotide sequence, our analysis focused on a 723-bp variable region exhibiting 83.9 to 97% interspecies similarity and 0 to 1.7% intraspecific divergence. Primer pair Myco-F-Myco-R was designed as a tool for both PCR amplification and sequencing of this region for molecular identification of RGM. This tool was used for identification of 63 RGM clinical isolates previously identified at the species level on the basis of phenotypic characteristics and by 16S rRNA gene sequence analysis. Of 63 clinical isolates, 59 (94%) exhibited <2% partial rpoB gene sequence divergence from 1 of 20 species under study and were regarded as correctly identified at the species level. Mycobacterium abscessus and Mycobacterium mucogenicum isolates were clearly distinguished from Mycobacterium chelonae; Mycobacterium mageritense isolates were clearly distinguished from “Mycobacterium houstonense.” Four isolates were not identified at the species level because they exhibited >3% partial rpoB gene sequence divergence from the corresponding type strain; they belonged to three taxa related to M. mucogenicum, Mycobacterium smegmatis, and Mycobacterium porcinum. For M. abscessus and M. mucogenicum, this partial sequence yielded a high genetic heterogeneity within the clinical isolates. We conclude that molecular identification by analysis of the 723-bp rpoB sequence is a rapid and accurate tool for identification of RGM. PMID:14662964

Sites Inferred by Metabolic Background Assertion Labeling (SIMBAL): adapting the Partial Phylogenetic Profiling algorithm to scan sequences for signatures that predict protein function

PubMed Central

2010-01-01

Background Comparative genomics methods such as phylogenetic profiling can mine powerful inferences from inherently noisy biological data sets. We introduce Sites Inferred by Metabolic Background Assertion Labeling (SIMBAL), a method that applies the Partial Phylogenetic Profiling (PPP) approach locally within a protein sequence to discover short sequence signatures associated with functional sites. The approach is based on the basic scoring mechanism employed by PPP, namely the use of binomial distribution statistics to optimize sequence similarity cutoffs during searches of partitioned training sets. Results Here we illustrate and validate the ability of the SIMBAL method to find functionally relevant short sequence signatures by application to two well-characterized protein families. In the first example, we partitioned a family of ABC permeases using a metabolic background property (urea utilization). Thus, the TRUE set for this family comprised members whose genome of origin encoded a urea utilization system. By moving a sliding window across the sequence of a permease, and searching each subsequence in turn against the full set of partitioned proteins, the method found which local sequence signatures best correlated with the urea utilization trait. Mapping of SIMBAL "hot spots" onto crystal structures of homologous permeases reveals that the significant sites are gating determinants on the cytosolic face rather than, say, docking sites for the substrate-binding protein on the extracellular face. In the second example, we partitioned a protein methyltransferase family using gene proximity as a criterion. In this case, the TRUE set comprised those methyltransferases encoded near the gene for the substrate RF-1. SIMBAL identifies sequence regions that map onto the substrate-binding interface while ignoring regions involved in the methyltransferase reaction mechanism in general. Neither method for training set construction requires any prior experimental characterization. Conclusions SIMBAL shows that, in functionally divergent protein families, selected short sequences often significantly outperform their full-length parent sequence for making functional predictions by sequence similarity, suggesting avenues for improved functional classifiers. When combined with structural data, SIMBAL affords the ability to localize and model functional sites. PMID:20102603

srRNA evolution and phylogenetic relationships of the genus Naegleria (Protista: Rhizopoda).

PubMed

Baverstock, P R; Illana, S; Christy, P E; Robinson, B S; Johnson, A M

1989-05-01

A rapid RNA sequencing technique was used to partially sequence the small-subunit ribosomal RNA (srRNA) of four species of the amoeboid genus Naegleria. The extent of nucleotide sequence divergence between the two most divergent species was roughly similar to that found between mammals and frogs. However, the pattern of variation among the Naegleria species was quite different from that found for those species of tetrapods characterized to date. A phylogenetic analysis of the consensus Naegleria sequence showed that Naegleria was not monophyletic with either Acanthamoeba castellanii or Dictyostelium discoideum, two other amoebas for which sequences were available. It was shown that the semiconserved regions of the srRNA molecule evolve in a clocklike fashion and that the clock is time dependent rather than generation dependent.

Partial gene sequences for the A subunit of methyl-coenzyme M reductase (mcrI) as a phylogenetic tool for the family Methanosarcinaceae

NASA Technical Reports Server (NTRS)

Springer, E.; Sachs, M. S.; Woese, C. R.; Boone, D. R.

1995-01-01

Representatives of the family Methanosarcinaceae were analyzed phylogenetically by comparing partial sequences of their methyl-coenzyme M reductase (mcrI) genes. A 490-bp fragment from the A subunit of the gene was selected, amplified by the PCR, cloned, and sequenced for each of 25 strains belonging to the Methanosarcinaceae. The sequences obtained were aligned with the corresponding portions of five previously published sequences, and all of the sequences were compared to determine phylogenetic distances by Fitch distance matrix methods. We prepared analogous trees based on 16S rRNA sequences; these trees corresponded closely to the mcrI trees, although the mcrI sequences of pairs of organisms had 3.01 +/- 0.541 times more changes than the respective pairs of 16S rRNA sequences, suggesting that the mcrI fragment evolved about three times more rapidly than the 16S rRNA gene. The qualitative similarity of the mcrI and 16S rRNA trees suggests that transfer of genetic information between dissimilar organisms has not significantly affected these sequences, although we found inconsistencies between some mcrI distances that we measured and and previously published DNA reassociation data. It is unlikely that multiple mcrI isogenes were present in the organisms that we examined, because we found no major discrepancies in multiple determinations of mcrI sequences from the same organism. Our primers for the PCR also match analogous sites in the previously published mcrII sequences, but all of the sequences that we obtained from members of the Methanosarcinaceae were more closely related to mcrI sequences than to mcrII sequences, suggesting that members of the Methanosarcinaceae do not have distinct mcrII genes.

Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

NASA Astrophysics Data System (ADS)

Sun, S. M.; Slightom, J. L.; Hall, T. C.

1981-01-01

A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

Isolation, cloning, and characterization of a partial novel aro A gene in common reed (Phragmites australis).

PubMed

Taravat, Elham; Zebarjadi, Alireza; Kahrizi, Danial; Yari, Kheirollah

2015-05-01

Among the essential amino acids, phenylalanine, tryptophan, and tyrosine are aromatic amino acids which are synthesized by the shikimate pathway in plants and bacteria. Herbicide glyphosate can inhibit the biosynthesis of these amino acids. So, identification of the gene tolerant to glyphosate is very important. It has been shown that the common reed or Phragmites australis Cav. (Poaceae) is relatively tolerant to glyphosate. The aim of the current research is identification, cloning, sequencing, and registering of partial aro A gene of the common reed P. australis. The partial aro A gene of common reed (P. australis) was cloned in Escherichia coli and the amino acid sequence was identified/determined for the first time. This is the first report for isolation, cloning, and sequencing of a part of aro A gene from the common reed. A 670 bp fragment including two introns (86 bp and 289 bp) was obtained. The open reading frame (ORF) region in part of gene was encoded for 98 amino acids. Alignment showed high similarity among this region with Zea mays (L.) (Poaceae) (94.6%), Eleusine indica L. Gaertn (Poaceae) (94.2%), and Zoysia japonica Steud. (Poaceae) (94.2%). The alignment of amino acid sequence of the investigated part of the gene showed a homology with aro A from several other plants. This conserved region forms the enzyme active site. The alignment results of nucleotide and amino acid residues with related sequences showed that there are some differences among them. The relative glyphosate tolerance in the common reed may be related to these differences.

Genomic and molecular analysis of phage CMP1 from Clavibacter michiganensis subspecies michiganensis

PubMed Central

Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf

2011-01-01

Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections. PMID:21687530

Genomic and molecular analysis of phage CMP1 from Clavibacter michiganensis subspecies michiganensis.

PubMed

Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf; Dreiseikelmann, Brigitte

2011-01-01

Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections.

Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

PubMed

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

Lactobacillus Strain Diversity Based on Partial hsp60 Gene Sequences and Design of PCR-Restriction Fragment Length Polymorphism Assays for Species Identification and Differentiation▿ †

PubMed Central

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages. PMID:17993558

Component identification of electron transport chains in curdlan-producing Agrobacterium sp. ATCC 31749 and its genome-specific prediction using comparative genome and phylogenetic trees analysis.

PubMed

Zhang, Hongtao; Setubal, Joao Carlos; Zhan, Xiaobei; Zheng, Zhiyong; Yu, Lijun; Wu, Jianrong; Chen, Dingqiang

2011-06-01

Agrobacterium sp. ATCC 31749 (formerly named Alcaligenes faecalis var. myxogenes) is a non-pathogenic aerobic soil bacterium used in large scale biotechnological production of curdlan. However, little is known about its genomic information. DNA partial sequence of electron transport chains (ETCs) protein genes were obtained in order to understand the components of ETC and genomic-specificity in Agrobacterium sp. ATCC 31749. Degenerate primers were designed according to ETC conserved sequences in other reported species. DNA partial sequences of ETC genes in Agrobacterium sp. ATCC 31749 were cloned by the PCR method using degenerate primers. Based on comparative genomic analysis, nine electron transport elements were ascertained, including NADH ubiquinone oxidoreductase, succinate dehydrogenase complex II, complex III, cytochrome c, ubiquinone biosynthesis protein ubiB, cytochrome d terminal oxidase, cytochrome bo terminal oxidase, cytochrome cbb (3)-type terminal oxidase and cytochrome caa (3)-type terminal oxidase. Similarity and phylogenetic analyses of these genes revealed that among fully sequenced Agrobacterium species, Agrobacterium sp. ATCC 31749 is closest to Agrobacterium tumefaciens C58. Based on these results a comprehensive ETC model for Agrobacterium sp. ATCC 31749 is proposed.

Discovery of a novel retrovirus sequence in an Australian native rodent (Melomys burtoni): a putative link between gibbon ape leukemia virus and koala retrovirus.

PubMed

Simmons, Greg; Clarke, Daniel; McKee, Jeff; Young, Paul; Meers, Joanne

2014-01-01

Gibbon ape leukaemia virus (GALV) and koala retrovirus (KoRV) share a remarkably close sequence identity despite the fact that they occur in distantly related mammals on different continents. It has previously been suggested that infection of their respective hosts may have occurred as a result of a species jump from another, as yet unidentified vertebrate host. To investigate possible sources of these retroviruses in the Australian context, DNA samples were obtained from 42 vertebrate species and screened using PCR in order to detect proviral sequences closely related to KoRV and GALV. Four proviral partial sequences totalling 2880 bases which share a strong similarity with KoRV and GALV were detected in DNA from a native Australian rodent, the grassland melomys, Melomys burtoni. We have designated this novel gammaretrovirus Melomys burtoni retrovirus (MbRV). The concatenated nucleotide sequence of MbRV shares 93% identity with the corresponding sequence from GALV-SEATO and 83% identity with KoRV. The geographic ranges of the grassland melomys and of the koala partially overlap. Thus a species jump by MbRV from melomys to koalas is conceivable. However the genus Melomys does not occur in mainland South East Asia and so it appears most likely that another as yet unidentified host was the source of GALV.

FrameD: A flexible program for quality check and gene prediction in prokaryotic genomes and noisy matured eukaryotic sequences.

PubMed

Schiex, Thomas; Gouzy, Jérôme; Moisan, Annick; de Oliveira, Yannick

2003-07-01

We describe FrameD, a program that predicts coding regions in prokaryotic and matured eukaryotic sequences. Initially targeted at gene prediction in bacterial GC rich genomes, the gene model used in FrameD also allows to predict genes in the presence of frameshifts and partially undetermined sequences which makes it also very suitable for gene prediction and frameshift correction in unfinished sequences such as EST and EST cluster sequences. Like recent eukaryotic gene prediction programs, FrameD also includes the ability to take into account protein similarity information both in its prediction and its graphical output. Its performances are evaluated on different bacterial genomes. The web site (http://genopole.toulouse.inra.fr/bioinfo/FrameD/FD) allows direct prediction, sequence correction and translation and the ability to learn new models for new organisms.

Genetic diversity of Burkholderia (Proteobacteria) species from the Caatinga and Atlantic rainforest biomes in Bahia, Brazil.

PubMed

Santini, A C; Santos, H R M; Gross, E; Corrêa, R X

2013-03-11

The genus Burkholderia (β-Proteobacteria) currently comprises more than 60 species, including parasites, symbionts and free-living organisms. Several new species of Burkholderia have recently been described showing a great diversity of phenotypes. We examined the diversity of Burkholderia spp in environmental samples collected from Caatinga and Atlantic rainforest biomes of Bahia, Brazil. Legume nodules were collected from five locations, and 16S rDNA and recA genes of the isolated microorganisms were analyzed. Thirty-three contigs of 16S rRNA genes and four contigs of the recA gene related to the genus Burkholderia were obtained. The genetic dissimilarity of the strains ranged from 0 to 2.5% based on 16S rDNA analysis, indicating two main branches: one distinct branch of the dendrogram for the B. cepacia complex and another branch that rendered three major groups, partially reflecting host plants and locations. A dendrogram designed with sequences of this research and those designed with sequences of Burkholderia-type strains and the first hit BLAST had similar topologies. A dendrogram similar to that constructed by analysis of 16S rDNA was obtained using sequences of the fragment of the recA gene. The 16S rDNA sequences enabled sufficient identification of relevant similarities and groupings amongst isolates and the sequences that we obtained. Only 6 of the 33 isolates analyzed via 16S rDNA sequencing showed high similarity with the B. cepacia complex. Thus, over 3/4 of the isolates have potential for biotechnological applications.

Homology of aspartyl- and lysyl-tRNA synthetases.

PubMed Central

Gampel, A; Tzagoloff, A

1989-01-01

The yeast nuclear gene MSD1 coding for mitochondrial aspartyl-tRNA synthetase has been cloned and sequenced. The identity of the gene is confirmed by the following evidence. (i) The primary structure of the protein derived from the gene sequence is similar to that of the yeast cytoplasmic aspartyl-tRNA synthetase. (ii) In situ disruption of MSD1 in a respiratory-competent haploid strain of yeast induces a pleiotropic phenotype consistent with a lesion in mitochondrial protein synthesis. (iii) Mitochondria from a mutant with a disrupted chromosomal copy of MSD1 are unable to acylate mitochondrial aspartyl-tRNA. The primary structures of the cytoplasmic and mitochondrial aspartyl-tRNA synthetases are similar to the yeast cytoplasmic lysyl-tRNA synthetase, suggesting that the two types of synthetases may have a common evolutionary origin. Searches of the current protein banks also have revealed a high degree of sequence similarity of the lysyl-tRNA synthetase to the product of the Escherichia coli herC gene and to the partial sequence of a protein encoded by an unidentified reading frame located adjacent to the E. coli frdA gene. Based on the sequence similarities and the map positions of the herC and frdA loci, we propose herC to be the structural gene of the constitutively expressed lysyl-tRNA synthetase of E. coli and the unidentified reading frame to be the structural gene of the heat-inducible lysyl-tRNA synthetase. Images PMID:2668951

Unusual RNA plant virus integration in the soybean genome leads to the production of small RNAs.

PubMed

da Fonseca, Guilherme Cordenonsi; de Oliveira, Luiz Felipe Valter; de Morais, Guilherme Loss; Abdelnor, Ricardo Vilela; Nepomuceno, Alexandre Lima; Waterhouse, Peter M; Farinelli, Laurent; Margis, Rogerio

2016-05-01

Horizontal gene transfer (HGT) is known to be a major force in genome evolution. The acquisition of genes from viruses by eukaryotic genomes is a well-studied example of HGT, including rare cases of non-retroviral RNA virus integration. The present study describes the integration of cucumber mosaic virus RNA-1 into soybean genome. After an initial metatranscriptomic analysis of small RNAs derived from soybean, the de novo assembly resulted a 3029-nt contig homologous to RNA-1. The integration of this sequence in the soybean genome was confirmed by DNA deep sequencing. The locus where the integration occurred harbors the full RNA-1 sequence followed by the partial sequence of an endogenous mRNA and another sequence of RNA-1 as an inverted repeat and allowing the formation of a hairpin structure. This region recombined into a retrotransposon located inside an exon of a soybean gene. The nucleotide similarity of the integrated sequence compared to other Cucumber mosaic virus sequences indicates that the integration event occurred recently. We described a rare event of non-retroviral RNA virus integration in soybean that leads to the production of a double-stranded RNA in a similar fashion to virus resistance RNAi plants. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Inferring microRNA regulation of mRNA with partially ordered samples of paired expression data and exogenous prediction algorithms.

PubMed

Godsey, Brian; Heiser, Diane; Civin, Curt

2012-01-01

MicroRNAs (miRs) are known to play an important role in mRNA regulation, often by binding to complementary sequences in "target" mRNAs. Recently, several methods have been developed by which existing sequence-based target predictions can be combined with miR and mRNA expression data to infer true miR-mRNA targeting relationships. It has been shown that the combination of these two approaches gives more reliable results than either by itself. While a few such algorithms give excellent results, none fully addresses expression data sets with a natural ordering of the samples. If the samples in an experiment can be ordered or partially ordered by their expected similarity to one another, such as for time-series or studies of development processes, stages, or types, (e.g. cell type, disease, growth, aging), there are unique opportunities to infer miR-mRNA interactions that may be specific to the underlying processes, and existing methods do not exploit this. We propose an algorithm which specifically addresses [partially] ordered expression data and takes advantage of sample similarities based on the ordering structure. This is done within a Bayesian framework which specifies posterior distributions and therefore statistical significance for each model parameter and latent variable. We apply our model to a previously published expression data set of paired miR and mRNA arrays in five partially ordered conditions, with biological replicates, related to multiple myeloma, and we show how considering potential orderings can improve the inference of miR-mRNA interactions, as measured by existing knowledge about the involved transcripts.

Mass spectrometry-based protein identification by integrating de novo sequencing with database searching.

PubMed

Wang, Penghao; Wilson, Susan R

2013-01-01

Mass spectrometry-based protein identification is a very challenging task. The main identification approaches include de novo sequencing and database searching. Both approaches have shortcomings, so an integrative approach has been developed. The integrative approach firstly infers partial peptide sequences, known as tags, directly from tandem spectra through de novo sequencing, and then puts these sequences into a database search to see if a close peptide match can be found. However the current implementation of this integrative approach has several limitations. Firstly, simplistic de novo sequencing is applied and only very short sequence tags are used. Secondly, most integrative methods apply an algorithm similar to BLAST to search for exact sequence matches and do not accommodate sequence errors well. Thirdly, by applying these methods the integrated de novo sequencing makes a limited contribution to the scoring model which is still largely based on database searching. We have developed a new integrative protein identification method which can integrate de novo sequencing more efficiently into database searching. Evaluated on large real datasets, our method outperforms popular identification methods.

Diversity and three-dimensional structures of the alpha Mcr of the methanogenic Archaea from the anoxic region of Tucuruí Lake, in Eastern Brazilian Amazonia

PubMed Central

Santana, Priscila Bessa; Junior, Rubens Ghilardi; Alves, Claudio Nahum; Silva, Jeronimo Lameira; McCulloch, John Anthony; Schneider, Maria Paula Cruz; da Costa da Silva, Artur

2012-01-01

Methanogenic archaeans are organisms of considerable ecological and biotechnological interest that produce methane through a restricted metabolic pathway, which culminates in the reaction catalyzed by the Methyl-coenzyme M reductase (Mcr) enzyme, and results in the release of methane. Using a metagenomic approach, the gene of the α subunit of mcr (mcrα) was isolated from sediment sample from an anoxic zone, rich in decomposing organic material, obtained from the Tucuruí hydroelectric dam reservoir in eastern Brazilian Amazonia. The partial nucleotide sequences obtained were 83 to 95% similar to those available in databases, indicating a low diversity of archaeans in the reservoir. Two orders were identified - the Methanomicrobiales, and a unique Operational Taxonomic Unit (OTU) forming a clade with the Methanosarcinales according to low bootstrap values. Homology modeling was used to determine the three-dimensional (3D) structures, for this the partial nucleotide sequence of the mcrα were isolated and translated on their partial amino acid sequences. The 3D structures of the archaean Mcrα observed in the present study varied little, and presented approximately 70% identity in comparison with the Mcrα of Methanopyrus klanderi. The results demonstrated that the community of methanogenic archaeans of the anoxic C1 region of the Tucurui reservoir is relatively homogeneous. PMID:22481885

Growth-active peptides are produced from alpha-lactalbumin and lysozyme.

PubMed

Kanda, Yoshikazu; Hisayasu, Sanae; Abe, Yasuko; Katsura, Kenichiro; Mashimo, Keico

2007-07-19

We determined the growth-active domains of milk-growth factor (MGF), human alpha-lactalbumin (HMLA) and human lysozyme (HMLZ), and their sequences. Fetal calf serum (FCS) showed inhibitors against proteases. The growth-stimulation of IMR90 cells in CG medium (free-serum) without FCS was induced in a dose-dependent manner up to 400 ng/ml of HMLA, HMLZ or chicken lysozyme (ChLZ), and also in a time-dependent manner until 48 h but was induced gradually until 1000 ng/ml of bovine alpha-lactalbumin (BVLA). The HMLAL6-peptide (HMLAL6), a cleaved product from HMLA by Endpeptidase Lys C, was growth-stimulative. The sequence of HMLAL6 was matched to 35 amino-acid residues (from No. 59 to No. 93 of HMLA), owing to the sequences of HMLAL6R3, HMLAL6R5 and HMLAL6R7 after the reduction of HMLAL6. The sequences of the reduced peptides from MGFL7-peptide (MGFL7: a cleaved product from MGF by Endpeptidase lysine C matched to those of the peptides from HMLAL6, and were similarly identified as the partial sequence of HMLA (59-93, H(2)N-L.W.C.?.K./S.S.Q.V.P.Q.S.R.N.I.?.D.I.S.?.D.K./F.L. D.D.D.I.T.D.D.I.M.?.A.-COOH). The sequence of HMLZ is similar to that of HMLA. HMLZT7-peptide (HMLZT7), a cleaved product of HMLZ by trypsin, was confirmed to have growth-stimulating activity and it's sequence was partially identified as Y. W.?.N.D.G.K.T.P.G.A.V.N.A.?.H.L. -, owing to the results of HMLZT7R1 (reduction of HMLZT7) and HMLZA7R2 (reduction of HMLZA7-peptide (HMLZA7) cleaved product of HMLZ by Endpeptidase Arg C) and is accordingly the sequence from No. 63 to No. 97 of HMLZ. Therefore, the peptides produced from LA and LZ by proteolysis may play a role of growth-stimulation.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Screening for and isolation and identification of malathion-degrading bacteria: cloning and sequencing a gene that potentially encodes the malathion-degrading enzyme, carboxylestrase in soil bacteria.

PubMed

Goda, Sayed K; Elsayed, Iman E; Khodair, Taha A; El-Sayed, Walaa; Mohamed, Mervat E

2010-11-01

Five malathion-degrading bacterial strains were enriched and isolated from soil samples collected from different agricultural sites in Cairo, Egypt. Malathion was used as a sole source of carbon (50 mg/l) to enumerate malathion degraders, which were designated as IS1, IS2, IS3, IS4, and IS5. They were identified, based on their morphological and biochemical characteristics, as Pseudomonas sp., Pseudomonas putida, Micrococcus lylae, Pseudomonas aureofaciens, and Acetobacter liquefaciens, respectively. IS1 and IS2, which showed the highest degrading activity, were selected for further identification by partial sequence analysis of their 16S rRNA genes. The 16S rRNA gene of IS1 shared 99% similarity with that of Alphaprotoebacterium BAL284, while IS2 scored 100% similarity with that of Pseudomonas putida 32zhy. Malathion residues almost completely disappeared within 6 days of incubation in IS2 liquid cultures. LC/ESI-MS analysis confirmed the degradation of malathion to malathion monocarboxylic and dicarboxylic acids, which formed as a result of carboxylesterase activity. A carboxylesterase gene (CE) was amplified from the IS2 genome by using specifically designed PCR primers. The sequence analysis showed a significant similarity to a known CE gene in different Pseudomonas sp. We report here the isolation of a new malathion-degrading bacteria from soils in Egypt that may be very well adapted to the climatic and environmental conditions of the country. We also report the partial cloning of a new CE gene. Due to their high biodegradation activity, the bacteria isolated from this work merit further study as potential biological agents for the remediation of soil, water, or crops contaminated with the pesticide malathion.

Phylogenetic tree of 16s rRNA sequences from sulfate-reducing bacteria in a sandy marine sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Devereux, R.; Mundfrom, G.W.

1994-01-01

Phylogenetic divergence among sulfate-reducing bateria in an estuarine sediment sample was investigated by PCR amplification and comparison of partial 16S rDNA sequences. Twenty unique 16S rDNA sequences were found, 12 from delta subclass bacteria based on overall sequence similarity (82-91%). Two successive PCR amplifications were used to obtain and clone the 16S rDNA. The first reaction used templates derived from phosphate-buffered saline washed sediment with primers designed to amplify nearly full-length bacterial domain 16S rDNA. A produce from a first reaction was used as template in a second reaction with primers designed to selectivity amplify a region of 16S rDNAmore » genes of sulfate-reducing bacteria. A phylogenetic tree incorporating the cloned sequences suggests the presence of yet to be cultivated lines of sulfate-reducing bacteria within the sediment sample.« less

Genome sequence analysis of predicted polyprenol reductase gene from mangrove plant kandelia obovata

NASA Astrophysics Data System (ADS)

Basyuni, M.; Sagami, H.; Baba, S.; Oku, H.

2018-03-01

It has been previously reported that dolichols but not polyprenols were predominated in mangrove leaves and roots. Therefore, the occurrence of larger amounts of dolichol in leaves of mangrove plants implies that polyprenol reductase is responsible for the conversion of polyprenol to dolichol may be active in mangrove leaves. Here we report the early assessment of probably polyprenol reductase gene from genome sequence of mangrove plant Kandelia obovata. The functional assignment of the gene was based on a homology search of the sequences against the non-redundant (nr) peptide database of NCBI using Blastx. The degree of sequence identity between DNA sequence and known polyprenol reductase was confirmed using the Blastx probability E-value, total score, and identity. The genome sequence data resulted in three partial sequences, termed c23157 (700 bp), c23901 (960 bp), and c24171 (531 bp). The c23157 gene showed the highest similarity (61%) to predicted polyprenol reductase 2- like from Gossypium raimondii with E-value 2e-100. The second gene was c23901 to exhibit high similarity (78%) to the steroid 5-alpha-reductase Det2 from J. curcas with E-value 2e-140. Furthermore, the c24171 gene depicted highest similarity (79%) to the polyprenol reductase 2 isoform X1 from Jatropha curcas with E- value 7e-21.The present study suggested that the c23157, c23901, and c24171, genes may encode predicted polyprenol reductase. The c23157, c23901, c24171 are therefore the new type of predicted polyprenol reductase from K. obovata.

The siRNA Non-seed Region and Its Target Sequences Are Auxiliary Determinants of Off-Target Effects.

PubMed

Kamola, Piotr J; Nakano, Yuko; Takahashi, Tomoko; Wilson, Paul A; Ui-Tei, Kumiko

2015-12-01

RNA interference (RNAi) is a powerful tool for post-transcriptional gene silencing. However, the siRNA guide strand may bind unintended off-target transcripts via partial sequence complementarity by a mechanism closely mirroring micro RNA (miRNA) silencing. To better understand these off-target effects, we investigated the correlation between sequence features within various subsections of siRNA guide strands, and its corresponding target sequences, with off-target activities. Our results confirm previous reports that strength of base-pairing in the siRNA seed region is the primary factor determining the efficiency of off-target silencing. However, the degree of downregulation of off-target transcripts with shared seed sequence is not necessarily similar, suggesting that there are additional auxiliary factors that influence the silencing potential. Here, we demonstrate that both the melting temperature (Tm) in a subsection of siRNA non-seed region, and the GC contents of its corresponding target sequences, are negatively correlated with the efficiency of off-target effect. Analysis of experimentally validated miRNA targets demonstrated a similar trend, indicating a putative conserved mechanistic feature of seed region-dependent targeting mechanism. These observations may prove useful as parameters for off-target prediction algorithms and improve siRNA 'specificity' design rules.

Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

PubMed

Kanai, T H; Ueda, S; Nakamura, T

2000-01-31

Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

Molecular diversity and evolutionary history of rabies virus strains circulating in the Balkans.

PubMed

McElhinney, L M; Marston, D A; Freuling, C M; Cragg, W; Stankov, S; Lalosevic, D; Lalosevic, V; Müller, T; Fooks, A R

2011-09-01

Molecular studies of European classical rabies viruses (RABV) have revealed a number of geographically clustered lineages. To study the diversity of Balkan RABV, partial nucleoprotein (N) gene sequences were analysed from a unique panel of isolates (n = 210), collected from various hosts between 1972 and 2006. All of the Balkan isolates grouped within the European/Middle East Lineage, with the majority most closely related to East European strains. A number of RABV from Bosnia & Herzegovina and Montenegro, collected between 1986 and 2006, grouped with the West European strains, believed to be responsible for the rabies epizootic that spread throughout Europe in the latter half of the 20th Century. In contrast, no Serbian RABV belonged to this sublineage. However, a distinct group of Serbian fox RABV provided further evidence for the southwards wildlife-mediated movement of rabies from Hungary, Romania and Serbia into Bulgaria. To determine the optimal region for evolutionary analysis, partial, full and concatenated N-gene and glycoprotein (G) gene sequences were compared. Whilst both the divergence times and evolutionary rates were similar irrespective of genomic region, the 95 % highest probability density (HPD) limits were significantly reduced for full N-gene and concatenated NG-gene sequences compared with partial gene sequences. Bayesian coalescent analysis estimated the date of the most common recent ancestor of the Balkan RABV to be 1885 (95 % HPD, 1852-1913), and skyline plots suggested an expansion of the local viral population in 1980-1990, which coincides with the observed emergence of fox rabies in the region.

The convergence of the order sequence and the solution function sequence on fractional partial differential equation

NASA Astrophysics Data System (ADS)

Rusyaman, E.; Parmikanti, K.; Chaerani, D.; Asefan; Irianingsih, I.

2018-03-01

One of the application of fractional ordinary differential equation is related to the viscoelasticity, i.e., a correlation between the viscosity of fluids and the elasticity of solids. If the solution function develops into function with two or more variables, then its differential equation must be changed into fractional partial differential equation. As the preliminary study for two variables viscoelasticity problem, this paper discusses about convergence analysis of function sequence which is the solution of the homogenous fractional partial differential equation. The method used to solve the problem is Homotopy Analysis Method. The results show that if given two real number sequences (αn) and (βn) which converge to α and β respectively, then the solution function sequences of fractional partial differential equation with order (αn, βn) will also converge to the solution function of fractional partial differential equation with order (α, β).

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Lelliottia aquatilis sp. nov., isolated from drinking water.

PubMed

Kämpfer, Peter; Glaeser, Stefanie P; Packroff, Gabriele; Behringer, Katja; Exner, Martin; Chakraborty, Trinad; Schmithausen, Ricarda M; Doijad, Swapnil

2018-06-22

Five beige-pigmented, oxidase-negative bacterial isolates, 6331-17 T , 6332-17, 6333-17, 6334-17 and 9827-07, isolated either from a drinking water storage reservoir or drinking water in 2006 and 2017 in Germany, were examined in detail applying by a polyphasic taxonomic approach. Cells of the isolates were rod-shaped and Gram-stain-negative. Comparison of the 16S rRNA gene sequences of these five isolates showed highest sequence similarities to Lelliottia amnigena (99.98 %) and Lelliottia nimipressuralis (99.99 %). Multilocus sequence analyses based on concatenated partial rpoB, gyrB, infB and atpD sequences confirmed the clustering of these isolates with Lelliottia species, but also revealed a clear distinction to the closest related type strains. Analysis of the genome sequences of these isolates indicated >70 % in silico DNA-DNA hybridization and high average nucleotide identities between strains. Nevertheless, they showed only <70 and <95 % similarity to the type strains of these two Lelliottia species. The fatty acid profiles of these isolates were very similar and consisted of the major fatty acids C16:0, C17 : 0cyclo, C15 : 0iso 2-OH/C16 : 1ω7c and C18 : 1ω7c. In addition, physiological/biochemical tests revealed high phenotypic similarity to each other. These cumulative data indicate that these isolates represent a novel Lelliottia species, for which the name Lelliottia aquatilis sp. nov. is proposed, with strain 6331-17 T (=CCM 8846 T =CIP 111609 T =LMG 30560 T ) as the type strain.

Phylogeny and S1 Gene Variation of Infectious Bronchitis Virus Detected in Broilers and Layers in Turkey.

PubMed

Yilmaz, Huseyin; Altan, Eda; Cizmecigil, Utku Y; Gurel, Aydin; Ozturk, Gulay Yuzbasioglu; Bamac, Ozge Erdogan; Aydin, Ozge; Britton, Paul; Monne, Isabella; Cetinkaya, Burhan; Morgan, Kenton L; Faburay, Bonto; Richt, Juergen A; Turan, Nuri

2016-09-01

The avian coronavirus infectious bronchitis virus (AvCoV-IBV) is recognized as an important global pathogen because new variants are a continuous threat to the poultry industry worldwide. This study investigates the genetic origin and diversity of AvCoV-IBV by analysis of the S1 sequence derived from 49 broiler flocks and 14 layer flocks in different regions of Turkey. AvCoV-IBV RNA was detected in 41 (83.6%) broiler flocks and nine (64.2%) of the layer flocks by TaqMan real-time RT-PCR. In addition, AvCoV-IBV RNA was detected in the tracheas 27/30 (90%), lungs 31/49 (62.2%), caecal tonsils 7/22 (31.8%), and kidneys 4/49 (8.1%) of broiler flocks examined. Pathologic lesions, hemorrhages, and mononuclear infiltrations were predominantly observed in tracheas and to a lesser extent in the lungs and a few in kidneys. A phylogenetic tree based on partial S1 sequences of the detected AvCoV-IBVs (including isolates) revealed that 1) viruses detected in five broiler flocks were similar to the IBV vaccines Ma5, H120, M41; 2) viruses detected in 24 broiler flocks were similar to those previously reported from Turkey and to Israel variant-2 strains; 3) viruses detected in seven layer flocks were different from those found in any of the broiler flocks but similar to viruses previously reported from Iran, India, and China (similar to Israel variant-1 and 4/91 serotypes); and 4) that the AVCoV-IBV, Israeli variant-2 strain, found to be circulating in Turkey appears to be undergoing molecular evolution. In conclusion, genetically different AvCoV-IBV strains, including vaccine-like strains, based on their partial S1 sequence, are circulating in broiler and layer chicken flocks in Turkey and the Israeli variant-2 strain is undergoing evolution.

Genetic variation and dynamics of infections of equid herpesvirus 5 in individual horses.

PubMed

Back, Helena; Ullman, Karin; Leijon, Mikael; Söderlund, Robert; Penell, Johanna; Ståhl, Karl; Pringle, John; Valarcher, Jean-François

2016-01-01

Equid herpesvirus 5 (EHV-5) is related to the human Epstein-Barr virus (human herpesvirus 4) and has frequently been observed in equine populations worldwide. EHV-5 was previously assumed to be low to non-pathogenic; however, studies have also related the virus to the severe lung disease equine multinodular pulmonary fibrosis (EMPF). Genetic information of EHV-5 is scanty: the whole genome was recently described and only limited nucleotide sequences are available. In this study, samples were taken twice 1 year apart from eight healthy horses at the same professional training yard and samples from a ninth horse that was diagnosed with EMPF with samples taken pre- and post-mortem to analyse partial glycoprotein B (gB) gene of EHV-5 by using next-generation sequencing. The analysis resulted in 27 partial gB gene sequences, 11 unique sequence types and five amino acid sequences. These sequences could be classified within four genotypes (I-IV) of the EHV-5 gB gene based on the degree of similarity of the nucleotide and amino acid sequences, and in this work horses were shown to be identified with up to three different genotypes simultaneously. The observations showed a range of interactions between EHV-5 and the host over time, where the same virus persists in some horses, whereas others have a more dynamic infection pattern including strains from different genotypes. This study provides insight into the genetic variation and dynamics of EHV-5, and highlights that further work is needed to understand the EHV-5 interaction with its host.

Phylogenetic Analysis of the Synnema-Producing Genus Synnemapestaloides

PubMed Central

Watanabe, Kyoko; Sekiguchi, Mao; Sato, Toyozo; Hsiang, Tom; Kaneko, Shigeru; Tanaka, Kazuaki; Kanda, Masaru; Fujita, Naoko; Nozawa, Shunsuke

2016-01-01

Synnemapestaloides rhododendri, the type species of the genus Synnemapestaloides, is a pathogen of Rhododendron brachycarpum. This fungus produces six-celled conidia with appendages at both end cells, and are generated by annellidic conidiogenous cells on the synnema. These conidial structures are similar to those of the genus Pestalotia. The monotypic genus Synnemapestaloides is currently classified in the family Amphisphaeriaceae solely based on conidial morphology. Here we demonstrate that Synnemapestaloides represents a distinct genus in the family Sporocadaceae (Amphisphaeriales) based on differences in the nucleotide sequences of the partial large subunit rDNA gene, the rDNA internal transcribed spacer, and the partial β-tubulin. The genus most closely related to Synnemapestaloides is Seimatosporium and the species most similar to Synnemapestaloides rhododendri is Seim. foliicola which produces short synnema-like conidiomata (sporodochia). These results demonstrate that Seim. foliicola should be transferred to Synnemapestaloides, and also demonstrate that Sporocadaceae can have synnematal in addition to pycnidial and acervular conidiomata. PMID:29376945

DUK - A Fast and Efficient Kmer Based Sequence Matching Tool

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Mingkun; Copeland, Alex; Han, James

2011-03-21

A new tool, DUK, is developed to perform matching task. Matching is to find whether a query sequence partially or totally matches given reference sequences or not. Matching is similar to alignment. Indeed many traditional analysis tasks like contaminant removal use alignment tools. But for matching, there is no need to know which bases of a query sequence matches which position of a reference sequence, it only need know whether there exists a match or not. This subtle difference can make matching task much faster than alignment. DUK is accurate, versatile, fast, and has efficient memory usage. It uses Kmermore » hashing method to index reference sequences and Poisson model to calculate p-value. DUK is carefully implemented in C++ in object oriented design. The resulted classes can also be used to develop other tools quickly. DUK have been widely used in JGI for a wide range of applications such as contaminant removal, organelle genome separation, and assembly refinement. Many real applications and simulated dataset demonstrate its power.« less

Interuser Interference Analysis for Direct-Sequence Spread-Spectrum Systems Part I: Partial-Period Cross-Correlation

NASA Technical Reports Server (NTRS)

Ni, Jianjun (David)

2012-01-01

This presentation discusses an analysis approach to evaluate the interuser interference for Direct-Sequence Spread-Spectrum (DSSS) Systems for Space Network (SN) Users. Part I of this analysis shows that the correlation property of pseudo noise (PN) sequences is the critical factor which determines the interuser interference performance of the DSSS system. For non-standard DSSS systems in which PN sequence s period is much larger than one data symbol duration, it is the partial-period cross-correlation that determines the system performance. This study reveals through an example that a well-designed PN sequence set (e.g. Gold Sequence, in which the cross-correlation for a whole-period is well controlled) may have non-controlled partial-period cross-correlation which could cause severe interuser interference for a DSSS system. Since the analytical derivation of performance metric (bit error rate or signal-to-noise ratio) based on partial-period cross-correlation is prohibitive, the performance degradation due to partial-period cross-correlation will be evaluated using simulation in Part II of this analysis in the future.

Functional analysis reveals the possible role of the C-terminal sequences and PI motif in the function of lily (Lilium longiflorum) PISTILLATA (PI) orthologues

PubMed Central

Chen, Ming-Kun; Hsieh, Wen-Ping; Yang, Chang-Hsien

2012-01-01

Two lily (Lilium longiflorum) PISTILLATA (PI) genes, Lily MADS Box Gene 8 and 9 (LMADS8/9), were characterized. LMADS9 lacked 29 C-terminal amino acids including the PI motif that was present in LMADS8. Both LMADS8/9 mRNAs were prevalent in the first and second whorl tepals during all stages of development and were expressed in the stamen only in young flower buds. LMADS8/9 could both form homodimers, but the ability of LMADS8 homodimers to bind to CArG1 was relatively stronger than that of LMADS9 homodimers. 35S:LMADS8 completely, and 35S:LMADS9 only partially, rescued the second whorl petal formation and partially converted the first whorl sepal into a petal-like structure in Arabidopsis pi-1 mutants. Ectopic expression of LMADS8-C (with deletion of the 29 amino acids of the C-terminal sequence) or LMADS8-PI (with only the PI motif deleted) only partially rescued petal formation in pi mutants, which was similar to what was observed in 35S:LMADS9/pi plants. In contrast, 35:LMADS9+L8C (with the addition of the 29 amino acids of the LMADS8 C-terminal sequence) or 35S:LMADS9+L8PI (with the addition of the LMADS8 PI motif) demonstrated an increased ability to rescue petal formation in pi mutants, which was similar to what was observed in 35S:LMADS8/pi plants. Furthermore, ectopic expression of LMADS8-M (with the MADS domain truncated) generated more severe dominant negative phenotypes than those seen in 35S:LMADS9-M flowers. These results revealed that the 29 amino acids including the PI motif in the C-terminal region of the lily PI orthologue are valuable for its function in regulating perianth organ formation. PMID:22068145

Molecular Characterization of Epiphytic Bacterial Communities on Charophycean Green Algae

PubMed Central

Fisher, Madeline M.; Wilcox, Lee W.; Graham, Linda E.

1998-01-01

Epiphytic bacterial communities within the sheath material of three filamentous green algae, Desmidium grevillii, Hyalotheca dissiliens, and Spondylosium pulchrum (class Charophyceae, order Zygnematales), collected from a Sphagnum bog were characterized by PCR amplification, cloning, and sequencing of 16S ribosomal DNA. A total of 20 partial sequences and nine different sequence types were obtained, and one sequence type was recovered from the bacterial communities on all three algae. By phylogenetic analysis, the cloned sequences were placed into several major lineages of the Bacteria domain: the Flexibacter/Cytophaga/Bacteroides phylum and the α, β, and γ subdivisions of the phylum Proteobacteria. Analysis at the subphylum level revealed that the majority of our sequences were not closely affiliated with those of known, cultured taxa, although the estimated evolutionary distances between our sequences and their nearest neighbors were always less than 0.1 (i.e., greater than 90% similar). This result suggests that the majority of sequences obtained in this study represent as yet phenotypically undescribed bacterial species and that the range of bacterial-algal interactions that occur in nature has not yet been fully described. PMID:9797295

Isolation of a novel Orientia species (O. chuto sp. nov.) from a patient infected in Dubai.

PubMed

Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D; Paris, Daniel H; Richards, Allen L; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P J; Graves, Stephen; Stenos, John

2010-12-01

In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name "Orientia chuto," and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected.

Isolation of a Novel Orientia Species (O. chuto sp. nov.) from a Patient Infected in Dubai ▿

PubMed Central

Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D.; Paris, Daniel H.; Richards, Allen L.; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P. J.; Graves, Stephen; Stenos, John

2010-01-01

In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name “Orientia chuto,” and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected. PMID:20926708

Isolation and characterisation of a pod dehiscence zone-specific polygalacturonase from Brassica napus.

PubMed

Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B

1996-06-01

Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.

Toxigenic Corynebacterium ulcerans isolated from a free-roaming red fox (Vulpes vulpes).

PubMed

Sting, Reinhard; Ketterer-Pintur, Sandra; Contzen, Matthias; Mauder, Norman; Süss-Dombrowski, Christine

2015-01-01

Corynebacterium (C.) ulcerans could be isolated from the spleen of a red fox (Vulpes vulpes) that had been found dead in the state of Baden-Württemberg, Germany. Pathohistological examination suggested that the fox had died of distemper, as was confirmed by PCR. The isolate was identified biochemically, by MALDI-TOF MS, FT-IR and by partial 16S rRNA, rpoB and tox gene sequencing. Using the Elek test the C. ulcerans isolate demonstrated diphtheria toxin production. FT-IR and sequencing data obtained from the C. ulcerans isolate from the red fox showed higher similarity to isolates from humans than to those from wild game.

A small test of a sequence-based typing method: definition of the B*1520 allele.

PubMed

Domena, J D; Little, A M; Arnett, K L; Adams, E J; Marsh, S G; Parham, P

1994-10-01

Santamaria et al. (Human Immunology 1993 37: 39-50) describe a method of sequence-based typing (SBT) for HLA-A, B and C alleles said to give "unambiguous typing of any sample, heterozygous or homozygous, without requiring additional typing information". From SBT analysis, which involves determination of partial sequences of mixed alleles, these investigators reported that cell lines KT17 (HLA-B35,62) and OLGA (HLA-B62) from the reference panel of the 10th International Histocompatibility Workshop express novel variants of HLA-B15 (B1501-MN6) and HLA-B35 (B3501-MN7) respectively. To study further the novel alleles, we cloned and sequenced full-length HLA-B cDNA clones isolated from the KT17 and OLGA cell lines. We find that KT17 expresses B*3501, as assigned by SBT, and B*1501, the common allele encoding the B62 antigen. We were unable to confirm that KT17 expresses the novel B1501-MN6 variant identified by SBT. For OLGA our analysis confirms the partial sequences obtained by SBT. Thus OLGA expresses B*1501 and a novel HLA-B allele. The complete sequence of the latter shows it is a hybrid having exons 1 and 2 in common with B*1501 and other B15 subtypes and exons 3-7 in common with B*3501 and related molecules including B*5301 and B*5801. The novel allele has been designated B*1520 because of its sequence similarity with the B15 group; furthermore, serological analysis shows that the B*1520 product does not express epitopes in common with either B35, B53 or B58. The B*1520 heavy chain has a similar isoelectric point to A*3101; B*1520 was undetected by previous applications of isoelectric focusing because B*1520 and A31 are both expressed by OLGA. In conclusion, HLA-B typing of two cell lines by cDNA cloning and sequencing gives concordant results with SBT for three of the four alleles. The cause of the discrepancy for the fourth allele is unknown, however, this finding indicates that the novel HLA-A, B and C sequences emerging from SBT studies need independent verification.

A Novel Partial Sequence Alignment Tool for Finding Large Deletions

PubMed Central

Aruk, Taner; Ustek, Duran; Kursun, Olcay

2012-01-01

Finding large deletions in genome sequences has become increasingly more useful in bioinformatics, such as in clinical research and diagnosis. Although there are a number of publically available next generation sequencing mapping and sequence alignment programs, these software packages do not correctly align fragments containing deletions larger than one kb. We present a fast alignment software package, BinaryPartialAlign, that can be used by wet lab scientists to find long structural variations in their experiments. For BinaryPartialAlign, we make use of the Smith-Waterman (SW) algorithm with a binary-search-based approach for alignment with large gaps that we called partial alignment. BinaryPartialAlign implementation is compared with other straight-forward applications of SW. Simulation results on mtDNA fragments demonstrate the effectiveness (runtime and accuracy) of the proposed method. PMID:22566777

A new sequence for single-shot diffusion-weighted NMR spectroscopy by the trace of the diffusion tensor.

PubMed

Valette, Julien; Giraudeau, Céline; Marchadour, Charlotte; Djemai, Boucif; Geffroy, Françoise; Ghaly, Mohamed Ahmed; Le Bihan, Denis; Hantraye, Philippe; Lebon, Vincent; Lethimonnier, Franck

2012-12-01

Diffusion-weighted spectroscopy is a unique tool for exploring the intracellular microenvironment in vivo. In living systems, diffusion may be anisotropic, when biological membranes exhibit particular orientation patterns. In this work, a volume selective diffusion-weighted sequence is proposed, allowing single-shot measurement of the trace of the diffusion tensor, which does not depend on tissue anisotropy. With this sequence, the minimal echo time is only three times the diffusion time. In addition, cross-terms between diffusion gradients and other gradients are cancelled out. An adiabatic version, similar to localization by adiabatic selective refocusing sequence, is then derived, providing partial immunity against cross-terms. Proof of concept is performed ex vivo on chicken skeletal muscle by varying tissue orientation and intra-voxel shim. In vivo performance of the sequence is finally illustrated in a U87 glioblastoma mouse model, allowing the measurement of the trace apparent diffusion coefficient for six metabolites, including J-modulated metabolites. Although measurement performed along three separate orthogonal directions would bring similar accuracy on trace apparent diffusion coefficient under ideal conditions, the method described here should be useful for probing intimate properties of the cells with minimal experimental bias. Copyright © 2012 Wiley Periodicals, Inc.

Role of Modular Polyketide Synthases in the Production of Polyether Ladder Compounds in Ciguatoxin-Producing Gambierdiscus polynesiensis and G. excentricus (Dinophyceae).

PubMed

Kohli, Gurjeet S; Campbell, Katrina; John, Uwe; Smith, Kirsty F; Fraga, Santiago; Rhodes, Lesley L; Murray, Shauna A

2017-09-01

Gambierdiscus, a benthic dinoflagellate, produces ciguatoxins that cause the human illness Ciguatera. Ciguatoxins are polyether ladder compounds that have a polyketide origin, indicating that polyketide synthases (PKS) are involved in their production. We sequenced transcriptomes of Gambierdiscus excentricus and Gambierdiscus polynesiensis and found 264 contigs encoding single domain ketoacyl synthases (KS; G. excentricus: 106, G. polynesiensis: 143) and ketoreductases (KR; G. excentricus: 7, G. polynesiensis: 8) with sequence similarity to type I PKSs, as reported in other dinoflagellates. In addition, 24 contigs (G. excentricus: 3, G. polynesiensis: 21) encoding multiple PKS domains (forming typical type I PKSs modules) were found. The proposed structure produced by one of these megasynthases resembles a partial carbon backbone of a polyether ladder compound. Seventeen contigs encoding single domain KS, KR, s-malonyltransacylase, dehydratase and enoyl reductase with sequence similarity to type II fatty acid synthases (FAS) in plants were found. Type I PKS and type II FAS genes were distinguished based on the arrangement of domains on the contigs and their sequence similarity and phylogenetic clustering with known PKS/FAS genes in other organisms. This differentiation of PKS and FAS pathways in Gambierdiscus is important, as it will facilitate approaches to investigating toxin biosynthesis pathways in dinoflagellates. © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.

Molecular biological studies of adult and metacercarial stages of Petasiger exaeretus Dietz, 1909 (Digenea: Echinostomatidae).

PubMed

Cech, Gábor; Molnár, Kálmán; Székely, Csaba

2017-06-01

Molnár et al. (2015) reported two types of echinostomatid metacercariae in the lateral line organ of Hungarian fish species. Type 1 metacercariae possessed 27 collar spines and 16 uniform and three larger dorsal spines, whereas Type 2 metacercariae bore 27 collar spines and 19 equal-sized dorsal spines. In the recent work, molecular studies carried out on the ITS region and partial 28S rDNA sequences of two types of echinostomatid metacercariae and the sequences of adult stages of the species of Petasiger Dietz, 1909 collected from cormorants (Phalacrocorax carbo L.) showed that some of the Type 2 metacercariae corresponded to Petasiger exaeretus Dietz, 1909, whereas other morphologically similar metacercariae were identified as Petasiger phalacrocoracis (Yamaguti, 1939). The sequences of the Type 1 metacercariae with three larger dorsal spines could not be identified with any of the known sequences from echinostomatid trematodes.

Unprecedented genomic diversity of AhR1 and AhR2 genes in Atlantic salmon (Salmo salar L.).

PubMed

Hansson, Maria C; Wittzell, Håkan; Persson, Kerstin; von Schantz, Torbjörn

2004-06-24

Aryl hydrocarbon receptor (AhR) genes encode proteins involved in mediating the toxic responses induced by several environmental pollutants. Here, we describe the identification of the first two AhR1 (alpha and beta) genes and two additional AhR2 (alpha and beta) genes in the tetraploid species Atlantic salmon (Salmo salar L.) from a cosmid library screening. Cosmid clones containing genomic salmon AhR sequences were isolated using a cDNA clone containing the coding region of the Atlantic salmon AhR2gamma as a probe. Screening revealed 14 positive clones, from which four were chosen for further analyses. One of the cosmids contained genomic AhR sequences that were highly similar to the rainbow trout (Oncorhynchus mykiss) AhR2alpha and beta genes. SMART RACE amplified two complete, highly similar but not identical AhR type 2 sequences from salmon cDNA, which from phylogenetic analyses were determined as the rainbow trout AhR2alpha and beta orthologs. The salmon AhR2alpha and beta encode proteins of 1071 and 1058 residues, respectively, and encompass characteristic AhR sequence elements like a basic-helix-loop-helix (bHLH) and two PER-ARNT-SIM (PAS) domains. Both genes are transcribed in liver, spleen and muscle tissues of adult salmon. A second cosmid contained partial sequences, which were identical to the previously characterized AhR2gamma gene. The last two cosmids contained partial genomic AhR sequences, which were more similar to other AhR type 1 fish genes than the four characterized salmon AhR2 genes. However, attempts to amplify the corresponding complete cDNA sequences of the inserts proved very difficult, suggesting that these genes are non-functional or very weakly transcribed in the examined tissues. Phylogenetic analyses of the conserved regions did, however, clearly indicate that these two AhRs belong to the AhR type 1 clade and have been assigned as the Atlantic salmon AhR1alpha and AhR1beta genes. Taken together, these findings demonstrate that multiple AhR genes are present in Atlantic salmon genome, which likely is a consequence of previous genome duplications in the evolutionary past of salmonids. Plausible explanations for the high incidence of AhR genes in fish and more specifically in salmonids, like rapid divergences in specialized functions, are discussed.

Evolutionary Dynamics of the Gametologous CTNNB1 Gene on the Z and W Chromosomes of Snakes.

PubMed

Laopichienpong, Nararat; Muangmai, Narongrit; Chanhome, Lawan; Suntrarachun, Sunutcha; Twilprawat, Panupon; Peyachoknagul, Surin; Srikulnath, Kornsorn

2017-03-01

Snakes exhibit genotypic sex determination with female heterogamety (ZZ males and ZW females), and the state of sex chromosome differentiation also varies among lineages. To investigate the evolutionary history of homologous genes located in the nonrecombining region of differentiated sex chromosomes in snakes, partial sequences of the gametologous CTNNB1 gene were analyzed for 12 species belonging to henophid (Cylindrophiidae, Xenopeltidae, and Pythonidae) and caenophid snakes (Viperidae, Elapidae, and Colubridae). Nonsynonymous/synonymous substitution ratios (Ka/Ks) in coding sequences were low (Ka/Ks < 1) between CTNNB1Z and CTNNB1W, suggesting that these 2 genes may have similar functional properties. However, frequencies of intron sequence substitutions and insertion–deletions were higher in CTNNB1Z than CTNNB1W, suggesting that Z-linked sequences evolved faster than W-linked sequences. Molecular phylogeny based on both intron and exon sequences showed the presence of 2 major clades: 1) Z-linked sequences of Caenophidia and 2) W-linked sequences of Caenophidia clustered with Z-linked sequences of Henophidia, which suggests that the sequence divergence between CTNNB1Z and CTNNB1W in Caenophidia may have occurred by the cessation of recombination after the split from Henophidia.

Second-generation sequencing of entire mitochondrial coding-regions (∼15.4 kb) holds promise for study of the phylogeny and taxonomy of human body lice and head lice.

PubMed

Xiong, H; Campelo, D; Pollack, R J; Raoult, D; Shao, R; Alem, M; Ali, J; Bilcha, K; Barker, S C

2014-08-01

The Illumina Hiseq platform was used to sequence the entire mitochondrial coding-regions of 20 body lice, Pediculus humanus Linnaeus, and head lice, P. capitis De Geer (Phthiraptera: Pediculidae), from eight towns and cities in five countries: Ethiopia, France, China, Australia and the U.S.A. These data (∼310 kb) were used to see how much more informative entire mitochondrial coding-region sequences were than partial mitochondrial coding-region sequences, and thus to guide the design of future studies of the phylogeny, origin, evolution and taxonomy of body lice and head lice. Phylogenies were compared from entire coding-region sequences (∼15.4 kb), entire cox1 (∼1.5 kb), partial cox1 (∼700 bp) and partial cytb (∼600 bp) sequences. On the one hand, phylogenies from entire mitochondrial coding-region sequences (∼15.4 kb) were much more informative than phylogenies from entire cox1 sequences (∼1.5 kb) and partial gene sequences (∼600 to ∼700 bp). For example, 19 branches had > 95% bootstrap support in our maximum likelihood tree from the entire mitochondrial coding-regions (∼15.4 kb) whereas the tree from 700 bp cox1 had only two branches with bootstrap support > 95%. Yet, by contrast, partial cytb (∼600 bp) and partial cox1 (∼486 bp) sequences were sufficient to genotype lice to Clade A, B or C. The sequences of the mitochondrial genomes of the P. humanus, P. capitis and P. schaeffi Fahrenholz studied are in NCBI GenBank under the accession numbers KC660761-800, KC685631-6330, KC241882-97, EU219988-95, HM241895-8 and JX080388-407. © 2014 The Royal Entomological Society.

Application of MLST and Pilus Gene Sequence Comparisons to Investigate the Population Structures of Actinomyces naeslundii and Actinomyces oris

PubMed Central

Henssge, Uta; Do, Thuy; Gilbert, Steven C.; Cox, Steven; Clark, Douglas; Wickström, Claes; Ligtenberg, A. J. M.; Radford, David R.; Beighton, David

2011-01-01

Actinomyces naeslundii and Actinomyces oris are members of the oral biofilm. Their identification using 16S rRNA sequencing is problematic and better achieved by comparison of metG partial sequences. A. oris is more abundant and more frequently isolated than A. naeslundii. We used a multi-locus sequence typing approach to investigate the genotypic diversity of these species and assigned A. naeslundii (n = 37) and A. oris (n = 68) isolates to 32 and 68 sequence types (ST), respectively. Neighbor-joining and ClonalFrame dendrograms derived from the concatenated partial sequences of 7 house-keeping genes identified at least 4 significant subclusters within A. oris and 3 within A. naeslundii. The strain collection we had investigated was an under-representation of the total population since at least 3 STs composed of single strains may represent discrete clusters of strains not well represented in the collection. The integrity of these sub-clusters was supported by the sequence analysis of fimP and fimA, genes coding for the type 1 and 2 fimbriae, respectively. An A. naeslundii subcluster was identified with both fimA and fimP genes and these strains were able to bind to MUC7 and statherin while all other A. naeslundii strains possessed only fimA and did not bind to statherin. An A. oris subcluster harboured a fimA gene similar to that of Actinomyces odontolyticus but no detectable fimP failed to bind significantly to either MUC7 or statherin. These data are evidence of extensive genotypic and phenotypic diversity within the species A. oris and A. naeslundii but the status of the subclusters identified here will require genome comparisons before their phylogenic position can be unequivocally established. PMID:21738661

Application of MLST and pilus gene sequence comparisons to investigate the population structures of Actinomyces naeslundii and Actinomyces oris.

PubMed

Henssge, Uta; Do, Thuy; Gilbert, Steven C; Cox, Steven; Clark, Douglas; Wickström, Claes; Ligtenberg, A J M; Radford, David R; Beighton, David

2011-01-01

Actinomyces naeslundii and Actinomyces oris are members of the oral biofilm. Their identification using 16S rRNA sequencing is problematic and better achieved by comparison of metG partial sequences. A. oris is more abundant and more frequently isolated than A. naeslundii. We used a multi-locus sequence typing approach to investigate the genotypic diversity of these species and assigned A. naeslundii (n = 37) and A. oris (n = 68) isolates to 32 and 68 sequence types (ST), respectively. Neighbor-joining and ClonalFrame dendrograms derived from the concatenated partial sequences of 7 house-keeping genes identified at least 4 significant subclusters within A. oris and 3 within A. naeslundii. The strain collection we had investigated was an under-representation of the total population since at least 3 STs composed of single strains may represent discrete clusters of strains not well represented in the collection. The integrity of these sub-clusters was supported by the sequence analysis of fimP and fimA, genes coding for the type 1 and 2 fimbriae, respectively. An A. naeslundii subcluster was identified with both fimA and fimP genes and these strains were able to bind to MUC7 and statherin while all other A. naeslundii strains possessed only fimA and did not bind to statherin. An A. oris subcluster harboured a fimA gene similar to that of Actinomyces odontolyticus but no detectable fimP failed to bind significantly to either MUC7 or statherin. These data are evidence of extensive genotypic and phenotypic diversity within the species A. oris and A. naeslundii but the status of the subclusters identified here will require genome comparisons before their phylogenic position can be unequivocally established.

Veillonella infantium sp. nov., an anaerobic, Gram-stain-negative coccus isolated from tongue biofilm of a Thai child.

PubMed

Mashima, Izumi; Liao, Yu-Chieh; Miyakawa, Hiroshi; Theodorea, Citra F; Thawboon, Boonyanit; Thaweboon, Sroisiri; Scannapieco, Frank A; Nakazawa, Futoshi

2018-04-01

A strain of a novel anaerobic, Gram-stain-negative coccus was isolated from the tongue biofilm of a Thai child. This strain was shown, at the phenotypic level and based on 16S rRNA gene sequencing, to be a member of the genus Veillonella. Comparative analysis of the 16S rRNA, dnaK and rpoB gene sequences indicated that phylogenetically the strain comprised a distinct novel branch within the genus Veillonella. The novel strain showed 99.8, 95.1 and 95.9 % similarity to partial 16S rRNA, dnaK and rpoB gene sequences, respectively, to the type strains of the two most closely related species, Veillonelladispar ATCC 17748 T and Veillonellatobetsuensis ATCC BAA-2400 T . The novel strain could be discriminated from previously reported species of the genus Veillonella based on partial dnaK and rpoB gene sequencing and average nucleotide identity values. The major acid end-product produced by this strain was acetic acid under anaerobic conditions in trypticase-yeast extract-haemin with 1 % (w/v) glucose or fructose medium. Lactate was fermented to acetic acid and propionic acid. Based on these observations, this strain represents a novel species, for which the name Veillonella infantium sp. nov. is proposed. The type strain is T11011-4 T (=JCM 31738 T =TSD-88 T ).

Identification of full-length proviral DNA of porcine endogenous retrovirus from Chinese Wuzhishan miniature pigs inbred.

PubMed

Ma, Yuyuan; Lv, Maomin; Xu, Shu; Wu, Jianmin; Tian, Kegong; Zhang, Jingang

2010-07-01

Existence of porcine endogenous retrovirus (PERV) hinders pigs to be used in clinical xenotransplantation to alleviate the shortage of human transplants. Chinese miniature pigs are potential organ donors for xenotransplantation in China. However, so far, an adequate level of information on the molecular characteristics of PERV from Chinese miniature pigs has not been available. We described here the cloning and characterization of full-length proviral DNA of PERV from Chinese Wuzhishan miniature pigs inbred (WZSP). Full-length nucleotide sequences of PERV-WZSP and other PERVs were aligned and phylogenetic tree was constructed from deduced amino-acid sequences of env. The results demonstrated that the full-length proviral DNA of PERV-WZSP belongs to gammaretrovirus and shares high similarity with other PERVs. Sequence analysis also suggested that different patterns of LTR existed in the same porcine germ line and partial PERV-C sequence may recombine with PERV-A sequence in LTR. (c) 2008 Elsevier Ltd. All rights reserved.

Report of Two Fatal Cases of Mycobacterium mucogenicum Central Nervous System Infection in Immunocompetent Patients

PubMed Central

Adékambi, Toïdi; Foucault, Cedric; La Scola, Bernard; Drancourt, Michel

2006-01-01

Neurological infections due to rapidly growing mycobacteria (RGM) have rarely been reported. We recently investigated two unrelated immunocompetent patients, one with community-acquired lymphocytic meningitis and the other with cerebral thrombophlebitis. Mycobacterium mucogenicum was isolated in pure culture and detected by PCR sequencing of cerebrospinal fluid samples. Both patients eventually died. The two isolates exhibited an overlapping antimicrobial susceptibility pattern. They were susceptible in vitro to tetracyclines, macrolides, quinolones, amikacin, imipenem, cefoxitin, and trimethoprim-sulfamethoxazole and resistant to ceftriaxone. They shared 100% 16S rRNA gene sequence similarity with M. mucogenicum ATCC 49650T over 1,482 bp. Their partial rpoB sequences shared 97.8% and 98.1% similarity with M. mucogenicum ATCC 49650T, suggesting that the two isolates were representative of two sequevars of M. mucogenicum species. This case report should make clinicians aware that M. mucogenicum, an RGM frequently isolated from tap water or from respiratory specimens and mostly without clinical significance, can even be encountered in the central nervous system of immunocompetent patients. PMID:16517863

Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

PubMed Central

Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

2006-01-01

Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

Evidence for free-living Bacteroides in Cladophora along the shores of the Great Lakes

USGS Publications Warehouse

Whitman, Richard L.; Byappanahalli, Muruleedhara; Spoljaric, Ashley; Przybyla-Kelly, Katarzyna; Shively, Dawn A.; Nevers, Meredith

2014-01-01

Bacteroides is assumed to be restricted to the alimentary canal of animals and humans and is considered to be non-viable in ambient environments. We hypothesized that Bacteroides could persist and replicate within beach-stranded Cladophora glomerata mats in southern Lake Michigan, USA. Mean Bacteroides concentration (per GenBac3 Taqman quantitative PCR assay) during summer 2012 at Jeorse Park Beach was 5.2 log calibrator cell equivalents (CCE) g-1 dry weight (dw), ranging from 3.7 to 6.7. We monitored a single beach-stranded mat for 3 wk; bacterial concentrations increased by 1.6 log CCE g-1 dw and correlated significantly with ambient temperature (p = 0.003). Clonal growth was evident, as observed by >99% nucleotide sequence similarity among clones. In in vitro studies, Bacteroides concentrations increased by 5.5 log CCE g-1 after 7 d (27°C) in fresh Cladophora collected from rocks. Partial sequencing of the 16S rRNA gene of 36 clones from the incubation experiment showed highly similar genotypes (≥97% sequence overlap). The closest enteric Bacteroides spp. from the National Center for Biotechnology Information database were only 87 to 91% similar. Genomic similarity, clonality, growth, and persistence collectively suggest that putative, free-living Bacteroides inhabit Cladophora mats of southern Lake Michigan. These findings may have important biological, medical, regulatory, microbial source tracking, and public health implications.

RECOVIR Software for Identifying Viruses

NASA Technical Reports Server (NTRS)

Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

2013-01-01

Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

Redescription of Haemogregarina garnhami (Apicomplexa: Adeleorina) from the blood of Psammophis schokari (Serpentes: Colubridae) as Hepatozoon garnhami n. comb. based on molecular, morphometric and morphologic characters.

PubMed

Abdel-Baki, Abdel-Azeem S; Al-Quraishy, Saleh; Zhang, J Y

2014-06-01

Hepatozoon garnhami n. comb. was redescribed from Schokari sand snakes (Psammophis schokari) collected from Riyadh city in Saudi Arabia. Gametocytes were found in the peripheral blood of 2 of 15 snakes examined. Based on the similar morphological and morphometric characteristics, the same host and a similar host habitat environment, it can be concluded for the first time that the present species is conspecific with Haemogregarina garnhami previously reported from Psammophis shokari aegyptius. To further characterize this parasite, the partial 18S rRNA gene was amplified and sequenced. The sequence analysis also showed that Haemogregarina garnhami should be reassigned into the genus Hepatozoon as Hepatozoon garnhami which has 99.5% (859/863 bp) sequence similarity to Hepatozoon ayorgbor, infecting the erythrocytes of Python regius in Ghana. Phylogenetic analysis showed that H. garnhami formed a mixed clade with Hepatozoon spp. from geckos, snakes and rodents and ophidian Hepatozoon spp. did not form a separated phylogenetic unit. Also, Psammophis schokari-infecting Hepatozoon contained several different genetic lineages. To our knowledge, the present work extends the geographic distribution of H. garnhami and is the first report of Hepatozoon infection in snakes from Saudi Arabia.

Mutant swarms of a totivirus-like entities are present in the red macroalga Chondrus crispus and have been partially transferred to the nuclear genome.

PubMed

Rousvoal, Sylvie; Bouyer, Betty; López-Cristoffanini, Camilo; Boyen, Catherine; Collén, Jonas

2016-08-01

Chondrus crispus Stackhouse (Gigartinales) is a red seaweed found on North Atlantic rocky shores. Electrophoresis of RNA extracts showed a prominent band with a size of around 6,000 bp. Sequencing of the band revealed several sequences with similarity to totiviruses, double-stranded RNA viruses that normally infect fungi. This virus-like entity was named C. crispus virus (CcV). It should probably be regarded as an extreme viral quasispecies or a mutant swarm since low identity (<65%) was found between sequences. Totiviruses typically code for two genes: one capsid gene (gag) and one RNA-dependent RNA polymerase gene (pol) with a pseudoknot structure between the genes. Both the genes and the intergenic structures were found in the CcV sequences. A nonidentical gag gene was also found in the nuclear genome of C. crispus, with associated expressed sequence tags (EST) and upstream regulatory features. The gene was presumably horizontally transferred from the virus to the alga. Similar dsRNA bands were seen in extracts from different life cycle stages of C. crispus and from all geographic locations tested. In addition, similar bands were also observed in RNA extractions from other red algae; however, the significance of this apparently widespread phenomenon is unknown. Neither phenotype caused by the infection nor any virus particles or capsid proteins were identified; thus, the presence of viral particles has not been validated. These findings increase the known host range of totiviruses to include marine red algae. © 2016 Phycological Society of America.

Sequencing, bioinformatic characterization and expression pattern of a putative amino acid transporter from the parasitic cestode Echinococcus granulosus.

PubMed

Camicia, Federico; Paredes, Rodolfo; Chalar, Cora; Galanti, Norbel; Kamenetzky, Laura; Gutierrez, Ariana; Rosenzvit, Mara C

2008-03-31

We have sequenced and partially characterized an Echinococcus granulosus cDNA, termed egat1, from a protoscolex signal sequence trap (SST) cDNA library. The isolated 1627 bp long cDNA contains an ORF of 489 amino acids and shows an amino acid identity of 30% with neutral and excitatory amino acid transporters members of the Dicarboxylate/Amino Acid Na+ and/or H+ Cation Symporter family (DAACS) (TC 2.A.23). Additional bioinformatics analysis of EgAT1, confirmed the results obtained by similarity searches and showed the presence of 9 to 10 transmembrane domains, consensus sequences for N-glycosylation between the third and fourth transmembrane domain, a highly similar hydropathy profile with ASCT1 (a known member of DAACS family), high score with SDF (Sodium Dicarboxilate Family) and similar motifs with EDTRANSPORT, a fingerprint of excitatory amino acid transporters. The localization of the putative amino acid transporter was analyzed by in situ hybridization and immunofluorescence in protoscoleces and associated germinal layer. The in situ hybridization labelling indicates the distribution of egat1 mRNA throughout the tegument. EgAT1 protein, which showed in Western blots a molecular mass of approximately 60 kD, is localized in the subtegumental region of the metacestode, particularly around suckers and rostellum of protoscoleces and layers from brood capsules. The sequence and expression analyses of EgAT1 pave the way for functional analysis of amino acids transporters of E. granulosus and its evaluation as new drug targets against cystic echinococcosis.

Host switch during evolution of a genetically distinct hantavirus in the American shrew mole (Neurotrichus gibbsii)

PubMed Central

Kang, Hae Ji; Bennett, Shannon N.; Dizney, Laurie; Sumibcay, Laarni; Arai, Satoru; Ruedas, Luis A.; Song, Jin-Won; Yanagihara, Richard

2009-01-01

A genetically distinct hantavirus, designated Oxbow virus (OXBV), was detected in tissues of an American shrew mole (Neurotrichus gibbsii), captured in Gresham, Oregon, in September 2003. Pairwise analysis of full-length S- and M- and partial L-segment nucleotide and amino acid sequences of OXBV indicated low sequence similarity with rodent-borne hantaviruses. Phylogenetic analyses using maximum-likelihood and Bayesian methods, and host-parasite evolutionary comparisons, showed that OXBV and Asama virus, a hantavirus recently identified from the Japanese shrew mole (Urotrichus talpoides), were related to soricine shrew-borne hantaviruses from North America and Eurasia, respectively, suggesting parallel evolution associated with cross-species transmission. PMID:19394994

Molecular identification of catalases from Nicotiana plumbaginifolia (L.).

PubMed

Willekens, H; Villarroel, R; Van Montagu, M; Inzé, D; Van Camp, W

1994-09-19

We have isolated three different catalase cDNAs from Nicotiana plumbaginifolia (cat1, cat2, and cat3) and a partial sequence of a fourth catalase gene (cat4) that shows no discernible expression based on Northern analysis. The catalase sequences were used to determine the similarity with other plant catalases and to study the transcriptional response to paraquat, 3-aminotriazole, and salicylic acid. 3-Aminotriazole induces mRNA levels of cat1, cat2 and cat3, indicating that a reduction in catalase activity positively affects catalase mRNA abundance. Salicylic acid that binds catalase in vitro, had no effect on catalase transcript levels at physiological concentrations. Paraquat resulted in the induction of cat1.

MHC class I loci of the Bar-Headed goose (Anser indicus)

PubMed Central

2010-01-01

MHC class I proteins mediate functions in anti-pathogen defense. MHC diversity has already been investigated by many studies in model avian species, but here we chose the bar-headed goose, a worldwide migrant bird, as a non-model avian species. Sequences from exons encoding the peptide-binding region (PBR) of MHC class I molecules were isolated from liver genomic DNA, to investigate variation in these genes. These are the first MHC class I partial sequences of the bar-headed goose to be reported. A preliminary analysis suggests the presence of at least four MHC class I genes, which share great similarity with those of the goose and duck. A phylogenetic analysis of bar-headed goose, goose and duck MHC class I sequences using the NJ method supports the idea that they all cluster within the anseriforms clade. PMID:21637434

"Multiple partial recognitions in dynamic equilibrium" in the binding sites of proteins form the molecular basis of promiscuous recognition of structurally diverse ligands.

PubMed

Kohda, Daisuke

2018-04-01

Promiscuous recognition of ligands by proteins is as important as strict recognition in numerous biological processes. In living cells, many short, linear amino acid motifs function as targeting signals in proteins to specify the final destination of the protein transport. In general, the target signal is defined by a consensus sequence containing wild-characters, and hence represented by diverse amino acid sequences. The classical lock-and-key or induced-fit/conformational selection mechanism may not cover all aspects of the promiscuous recognition. On the basis of our crystallographic and NMR studies on the mitochondrial Tom20 protein-presequence interaction, we proposed a new hypothetical mechanism based on "a rapid equilibrium of multiple states with partial recognitions". This dynamic, multiple recognition mode enables the Tom20 receptor to recognize diverse mitochondrial presequences with nearly equal affinities. The plant Tom20 is evolutionally unrelated to the animal Tom20 in our study, but is a functional homolog of the animal/fungal Tom20. NMR studies by another research group revealed that the presequence binding by the plant Tom20 was not fully explained by simple interaction modes, suggesting the presence of a similar dynamic, multiple recognition mode. Circumstantial evidence also suggested that similar dynamic mechanisms may be applicable to other promiscuous recognitions of signal peptides by the SRP54/Ffh and SecA proteins.

Diagnostics of Neisseriaceae and Moraxellaceae by Ribosomal DNA Sequencing: Ribosomal Differentiation of Medical Microorganisms

PubMed Central

Harmsen, Dag; Singer, Christian; Rothgänger, Jörg; Tønjum, Tone; Sybren de Hoog, Gerrit; Shah, Haroun; Albert, Jürgen; Frosch, Matthias

2001-01-01

Fast and reliable identification of microbial isolates is a fundamental goal of clinical microbiology. However, in the case of some fastidious gram-negative bacterial species, classical phenotype identification based on either metabolic, enzymatic, or serological methods is difficult, time-consuming, and/or inadequate. 16S or 23S ribosomal DNA (rDNA) bacterial sequencing will most often result in accurate speciation of isolates. Therefore, the objective of this study was to find a hypervariable rDNA stretch, flanked by strongly conserved regions, which is suitable for molecular species identification of members of the Neisseriaceae and Moraxellaceae. The inter- and intrageneric relationships were investigated using comparative sequence analysis of PCR-amplified partial 16S and 23S rDNAs from a total of 94 strains. When compared to the type species of the genera Acinetobacter, Moraxella, and Neisseria, an average of 30 polymorphic positions was observed within the partial 16S rDNA investigated (corresponding to Escherichia coli positions 54 to 510) for each species and an average of 11 polymorphic positions was observed within the 202 nucleotides of the 23S rDNA gene (positions 1400 to 1600). Neisseria macacae and Neisseria mucosa subsp. mucosa (ATCC 19696) had identical 16S and 23S rDNA sequences. Species clusters were heterogeneous in both genes in the case of Acinetobacter lwoffii, Moraxella lacunata, and N. mucosa. Neisseria meningitidis isolates failed to cluster only in the 23S rDNA subset. Our data showed that the 16S rDNA region is more suitable than the partial 23S rDNA for the molecular diagnosis of Neisseriaceae and Moraxellaceae and that a reference database should include more than one strain of each species. All sequence chromatograms and taxonomic and disease-related information are available as part of our ribosomal differentiation of medical microorganisms (RIDOM) web-based service (http://www.ridom.hygiene.uni-wuerzburg.de/). Users can submit a sequence and conduct a similarity search against the RIDOM reference database for microbial identification purposes. PMID:11230407

The dynamic range of response set activation during action sequencing.

PubMed

Behmer, Lawrence P; Crump, Matthew J C

2017-03-01

We show that theories of response scheduling for sequential action can be discriminated on the basis of their predictions for the dynamic range of response set activation during sequencing, which refers to the momentary span of activation states for completed and to-be-completed actions in a response set. In particular, theories allow that future actions in a plan are partially activated, but differ with respect to the width of the range, which refers to the number of future actions that are partially activated. Similarly, theories differ on the width of the range for recently completed actions that are assumed to be rapidly deactivated or gradually deactivated in a passive fashion. We validate a new typing task for measuring momentary activation states of actions across a response set during action sequencing. Typists recruited from Amazon Mechanical Turk copied a paragraph by responding to a "go" signal that usually cued the next letter but sometimes cued a near-past or future letter (n-3, -2, -1, 0, +2, +3). The activation states for producing letters across go-signal positions can be inferred from RTs and errors. In general, we found evidence of graded parallel activation for future actions and rapid deactivation of more distal past actions. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Analysis of the mitochondrial genome of cheetahs (Acinonyx jubatus) with neurodegenerative disease.

PubMed

Burger, Pamela A; Steinborn, Ralf; Walzer, Christian; Petit, Thierry; Mueller, Mathias; Schwarzenberger, Franz

2004-08-18

The complete mitochondrial genome of Acinonyx jubatus was sequenced and mitochondrial DNA (mtDNA) regions were screened for polymorphisms as candidates for the cause of a neurodegenerative demyelinating disease affecting captive cheetahs. The mtDNA reference sequences were established on the basis of the complete sequences of two diseased and two nondiseased animals as well as partial sequences of 26 further individuals. The A. jubatus mitochondrial genome is 17,047-bp long and shows a high sequence similarity (91%) to the domestic cat. Based on single nucleotide polymorphisms (SNPs) in the control region (CR) and pedigree information, the 18 myelopathic and 12 non-myelopathic cheetahs included in this study were classified into haplotypes I, II and III. In view of the phenotypic comparability of the neurodegenerative disease observed in cheetahs and human mtDNA-associated diseases, specific coding regions including the tRNAs leucine UUR, lysine, serine UCN, and partial complex I and V sequences were screened. We identified a heteroplasmic and a homoplasmic SNP at codon 507 in the subunit 5 (MTND5) of complex I. The heteroplasmic haplotype I-specific valine to methionine substitution represents a nonconservative amino acid change and was found in 11 myelopathic and eight non-myelopathic cheetahs with levels ranging from 29% to 79%. The homoplasmic conservative amino acid substitution valine to alanine was identified in two myelopathic animals of haplotype II. In addition, a synonymous SNP in the codon 76 of the MTND4L gene was found in the single haplotype III animal. The amino acid exchanges in the MTND5 gene were not associated with the occurrence of neurodegenerative disease in captive cheetahs.

Two myxozoans from the urinary tract of topsmelt, Atherinops affinis

USGS Publications Warehouse

Sanders, Justin L.; Jaramillo, Alejandra G.; Ashford, Jacob E.; Feist, Stephen W.; Lafferty, Kevin D.; Kent, Michael L.

2015-01-01

Two myxozoan species were observed in the kidney of topsmelt, Atherinops affinis, during a survey of parasites of estuarine fishes in the Carpinteria Salt Marsh Reserve, California. Fish collected on three dates in 2012 and 2013 were sectioned and examined histologically. Large extrasporogonic stages occurred in the renal interstitium of several fish from the first two collections (5/8, 11/20, respectively), and, in some fish, these replaced over 80% of the kidney. In addition, presporogonic and polysporogonic stages occurred in the lumen of the renal tubules, collecting and mesonephric ducts. The latter contained subspherical spores with up to 4 polar capsules, consistent with the genus Chloromyxum. For the third collection (15 May 2013, n=30), we portioned kidneys for examination by histology, wet mount, and DNA extraction for small subunit ribosomal gene sequencing. Histology showed the large extrasporogonic forms in the kidney interstitium of 3 fish, and 2 other fish with subspherical myxospores in the lumen of the renal tubules with smooth valves and two spherical polar capsules consistent with the genus Sphaerospora. Chloromyxum-type myxospores were observed in the renal tubules of one fish by wet mount. Sequencing of the kidney tissue from this fish yielded a partial SSU rDNA sequence of 1769 bp. Phylogenetic reconstruction suggested this organism to be a novel species of Chloromyxum, most similar to Chloromyxum careni (84% similarity). In addition, subspherical myxospores with smooth valves and two spherical polar capsules consistent with the genus Sphaerospora were observed in wet mounts of 2 fish. Sequencing of the kidney tissue from 1 fish yielded a partial SSU rDNA sequence of 1937 bp. Phylogenetic reconstruction suggests this organism to be a novel species of Sphaerospora most closely related to Sphaerospora epinepheli (93%). We conclude that these organisms represent novel species of the genera Chloromyxum and Sphaerospora based on host, location, and SSU rDNA sequence. We further conclude that the formation of large, histozoic extrasprogonic stages in the renal interstitium represent developmental stages of the Chloromyxum species for the following reasons: 1. Large extrasporogonic stages stages were only observed in fish with Chloromyxum-type spores developing within the renal tubules, 2. DNA sequence consistent with the Chloromyxum sp. was only detected in fish with the large extrasporogonic stages and 3.Sphaerospora species have extrasporogonic forms, but they are considerably smaller and are comprised of much fewer cells.

Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1

PubMed Central

Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.

2000-01-01

Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440

Molecular confirmation of Trichomonas gallinae and other parabasalids from Brazil using the 5.8S and ITS-1 rRNA regions.

PubMed

Ecco, Roselene; Preis, Ingred S; Vilela, Daniel A R; Luppi, Marcela M; Malta, Marcelo C C; Beckstead, Robert B; Stimmelmayr, Raphaela; Stimmelmayer, Raphaela; Gerhold, Richard W

2012-11-23

Clinical, gross, and histopathology lesions and molecular characterization of Trichomonas spp. infection were described in two striped owls (Asio (Rhinoptynx) clamator), one American kestrel (Falco sparverius), two green-winged saltators (Saltator similis), and in a toco toucan (Ramphastos toco) from Brazil. These birds presented clinical signs including emaciation, ruffled feathers, abundant salivation and open mouth breathing presumably due to abundant caseous material. Gross lesions were characterized by multifocal yellow friable plaques on the surface of the tongue, pharynx and/or caseous masses partially occluding the laryngeal entrance. In the owls, the caseous material extended into the mandibular muscles and invaded the sinuses of the skull. Histopathologically, marked necrotic and inflammatory lesions were associated with numerous round to oval, pale eosinophilic structures (6-10μm) with basophilic nuclei, consistent with trichomonads. Organisms similar to those described above also were found in the liver of the two green-winged saltators. To the authors' knowledge, this is the first report of trichomonosis in a striped owl and a toco toucan. Sequence analysis of the Trichomonas spp. internal transcribed spacer 1 (ITS-1) region and partial 5.8S of the ribosomal RNA (rRNA) disclosed significant genetic diversity. Two sequences had 100% identity to Trichomonas gallinae, whereas two sequences had a 99% and 92% identity to a Trichomonas vaginalis-like sequence, respectively. One sequence (green-winged saltator 502-08) had a 100% identity to a newly recognized genus Simplicomonas. Copyright © 2012 Elsevier B.V. All rights reserved.

Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus).

PubMed

Pawar, Rahul Mohanchandra; Poornachandar, Anantula; Arun, Attur Shanmugam; Manikandan, Santhanam; Shivaji, Sisinthy

2011-12-15

Hepatozoon species are parasites that infect a wide variety of domestic and wild animals. The objective of the study was to detect the occurrence of Hepatozoon ursi in Indian sloth bears and to characterize the parasite based on phylogenetic analysis of the partial 18S rRNA gene sequence. Hepatozoon infection could be detected in 38 (70%) out of fifty-four blood samples of Indian sloth bears (captive and wild), suggestive of high prevalence of Hepatozoon infection in Indian sloth bears. Sequencing of partial 18S rRNA gene of the positive samples and BLAST analysis indicated that the nearest phylogenetic neighbour was H. ursi with which they exhibited 99-100% similarity. Additionally, Hepatozoon sp. isolated from wild sloth bears of India were identical to those in captive sloth bears and phylogenetically related to H. ursi reported from Japanese black bears from Japan. To our knowledge, this is the first report on the molecular characterization of H. ursi infection in Indian sloth bears. Copyright © 2011 Elsevier B.V. All rights reserved.

Chromosomal localization and partial genomic structure of the human peroxisome proliferator activated receptor-gamma (hPPAR gamma) gene.

PubMed

Beamer, B A; Negri, C; Yen, C J; Gavrilova, O; Rumberger, J M; Durcan, M J; Yarnall, D P; Hawkins, A L; Griffin, C A; Burns, D K; Roth, J; Reitman, M; Shuldiner, A R

1997-04-28

We determined the chromosomal localization and partial genomic structure of the coding region of the human PPAR gamma gene (hPPAR gamma), a nuclear receptor important for adipocyte differentiation and function. Sequence analysis and long PCR of human genomic DNA with primers that span putative introns revealed that intron positions and sizes of hPPAR gamma are similar to those previously determined for the mouse PPAR gamma gene[13]. Fluorescent in situ hybridization localized hPPAR gamma to chromosome 3, band 3p25. Radiation hybrid mapping with two independent primer pairs was consistent with hPPAR gamma being within 1.5 Mb of marker D3S1263 on 3p25-p24.2. These sequences of the intron/exon junctions of the 6 coding exons shared by hPPAR gamma 1 and hPPAR gamma 2 will facilitate screening for possible mutations. Furthermore, D3S1263 is a suitable polymorphic marker for linkage analysis to evaluate PPAR gamma's potential contribution to genetic susceptibility to obesity, lipoatrophy, insulin resistance, and diabetes.

Molecular characterization of Hepatozoon spp. infection in endangered Indian wild felids and canids.

PubMed

Pawar, Rahul Mohanchandra; Poornachandar, Anantula; Srinivas, Pasham; Rao, Kancharapu Ramachandra; Lakshmikantan, Uthandaraman; Shivaji, Sisinthy

2012-05-25

Hepatozoon species are parasites that infect a wide variety of domestic and wild animals. The objective of this study was to perform the molecular detection and characterization of Hepatozoon spp. in Asiatic lion, Indian tiger, Indian leopard, Indian wild dog, Indian domestic dog and cat based on partial 18S rRNA gene sequences from Hepatozoon spp. in the naturally infected animals. Hepatozoon spp. could be detected in blood samples of 5 out of 9 Asiatic lions, 2 out of 5 Indian tigers, 2 out of 4 Indian leopards and 2 out of 2 Indian wild dogs and, 2 out of 4 domestic cats and 2 out of 3 domestic dog samples by PCR. Sequencing of PCR amplicon and BLAST analysis of partial 18S rRNA gene sequences indicated that the Hepatozoon spp. in Asiatic lion, Bengal tiger, Indian leopard and domestic cat was Hepatozoon felis (98-99% similarity) and in the Indian wild and domestic dog the phylogenetic neighbour was Hepatozoon canis (97-100% similarity). Presence of H. felis and H. canis in both domestic and wild animals suggested that they are not host specific and the same parasite causes infection in domestic and wild felids and canids in India and from different parts of the world. To our knowledge, this is the first report on detection and molecular characterization of H. felis infection in Asiatic lions, Indian tigers, Indian leopards and H. canis in Indian wild dog. Hepatozoon spp. may be a potential pathogen and an opportunistic parasite in immuno-compromised animals and could thus represent a threat to endangered Indian wild felids and canids. Copyright © 2011 Elsevier B.V. All rights reserved.

Zuotin, a putative Z-DNA binding protein in Saccharomyces cerevisiae

NASA Technical Reports Server (NTRS)

Zhang, S.; Lockshin, C.; Herbert, A.; Winter, E.; Rich, A.

1992-01-01

A putative Z-DNA binding protein, named zuotin, was purified from a yeast nuclear extract by means of a Z-DNA binding assay using [32P]poly(dG-m5dC) and [32P]oligo(dG-Br5dC)22 in the presence of B-DNA competitor. Poly(dG-Br5dC) in the Z-form competed well for the binding of a zuotin containing fraction, but salmon sperm DNA, poly(dG-dC) and poly(dA-dT) were not effective. Negatively supercoiled plasmid pUC19 did not compete, whereas an otherwise identical plasmid pUC19(CG), which contained a (dG-dC)7 segment in the Z-form was an excellent competitor. A Southwestern blot using [32P]poly(dG-m5dC) as a probe in the presence of MgCl2 identified a protein having a molecular weight of 51 kDa. The 51 kDa zuotin was partially sequenced at the N-terminal and the gene, ZUO1, was cloned, sequenced and expressed in Escherichia coli; the expressed zuotin showed similar Z-DNA binding activity, but with lower affinity than zuotin that had been partially purified from yeast. Zuotin was deduced to have a number of potential phosphorylation sites including two CDC28 (homologous to the human and Schizosaccharomyces pombe cdc2) phosphorylation sites. The hexapeptide motif KYHPDK was found in zuotin as well as in several yeast proteins, DnaJ of E.coli, csp29 and csp32 proteins of Drosophila and the small t and large T antigens of the polyoma virus. A 60 amino acid segment of zuotin has similarity to several histone H1 sequences. Disruption of ZUO1 in yeast resulted in a slow growth phenotype.

Analysis of Ribosome Inactivating Protein (RIP): A Bioinformatics Approach

NASA Astrophysics Data System (ADS)

Jothi, G. Edward Gnana; Majilla, G. Sahaya Jose; Subhashini, D.; Deivasigamani, B.

2012-10-01

In spite of the medical advances in recent years, the world is in need of different sources to encounter certain health issues.Ribosome Inactivating Proteins (RIPs) were found to be one among them. In order to get easy access about RIPs, there is a need to analyse RIPs towards constructing a database on RIPs. Also, multiple sequence alignment was done towards screening for homologues of significant RIPs from rare sources against RIPs from easily available sources in terms of similarity. Protein sequences were retrieved from SWISS-PROT and are further analysed using pair wise and multiple sequence alignment.Analysis shows that, 151 RIPs have been characterized to date. Amongst them, there are 87 type I, 37 type II, 1 type III and 25 unknown RIPs. The sequence length information of various RIPs about the availability of full or partial sequence was also found. The multiple sequence alignment of 37 type I RIP using the online server Multalin, indicates the presence of 20 conserved residues. Pairwise alignment and multiple sequence alignment of certain selected RIPs in two groups namely Group I and Group II were carried out and the consensus level was found to be 98%, 98% and 90% respectively.

Babesia lengau associated with cerebral and haemolytic babesiosis in two domestic cats.

PubMed

Bosman, Anna-Mari; Oosthuizen, Marinda C; Venter, Estelle H; Steyl, Johan C A; Gous, Tertius A; Penzhorn, Barend L

2013-05-01

Although reported sporadically from various countries, feline babesiosis appears to be a significant clinical entity only in South Africa, where Babesia felis is usually incriminated as the causative agent. Babesia lengau, recently described from asymptomatic cheetahs, has now possibly been incriminated as the causative agent in two severe clinical cases in domestic cats. Both cats were euthanised in extremis. While typical feline babesiosis in South Africa is an afebrile disease with a chronic manifestation, there was acute onset of severe clinical signs in both cats and their body temperatures were above the normal range when they were presented for treatment. Haemolytic anaemia was confirmed in one case. To our knowledge, this is the first report of cerebral babesiosis in cats.On reverse line blot 18S rDNA PCR products obtained from both cats showed positive hybridization profiles with the B. lengau species-specific probe. The two partial parasite 18S rRNA gene sequences obtained, showed high sequence similarity (99.9%) to B. lengau. In a representative tree constructed by the neighbor-joining method using the two-parameter model of Kimura the two obtained partial 18S rDNA sequences and that of B. lengau formed a monophyletic group with B. conradae and sequences previously isolated from humans and wildlife in the western USA. All clinical cases of feline babesiosis in South Africa are not necessarily caused by B. felis. Other piroplasms, e.g. B. lengau, may be incriminated in clinical cases, especially those occurring outside the known endemic area.

A reassessment of the evolutionary timescale of bat rabies viruses based upon glycoprotein gene sequences.

PubMed

Kuzmina, Natalia A; Kuzmin, Ivan V; Ellison, James A; Taylor, Steven T; Bergman, David L; Dew, Beverly; Rupprecht, Charles E

2013-10-01

Rabies, an acute progressive encephalomyelitis caused by viruses in the genus Lyssavirus, is one of the oldest known infectious diseases. Although dogs and other carnivores represent the greatest threat to public health as rabies reservoirs, it is commonly accepted that bats are the primary evolutionary hosts of lyssaviruses. Despite early historical documentation of rabies, molecular clock analyses indicate a quite young age of lyssaviruses, which is confusing. For example, the results obtained for partial and complete nucleoprotein gene sequences of rabies viruses (RABV), or for a limited number of glycoprotein gene sequences, indicated that the time of the most recent common ancestor (TMRCA) for current bat RABV diversity in the Americas lies in the seventeenth to eighteenth centuries and might be directly or indirectly associated with the European colonization. Conversely, several other reports demonstrated high genetic similarity between lyssavirus isolates, including RABV, obtained within a time interval of 25-50 years. In the present study, we attempted to re-estimate the age of several North American bat RABV lineages based on the largest set of complete and partial glycoprotein gene sequences compiled to date (n = 201) employing a codon substitution model. Although our results overlap with previous estimates in marginal areas of the 95 % high probability density (HPD), they suggest a longer evolutionary history of American bat RABV lineages (TMRCA at least 732 years, with a 95 % HPD 436-1107 years).

Characterisation of a collagen gene subfamily from the potato cyst nematode Globodera pallida.

PubMed

Gray, L J; Curtis, R H; Jones, J T

2001-01-24

We have isolated two full-length genomic DNA sequences, which encode the cuticle collagen proteins GP-COL-1 and GP-COL-2, from the potato cyst nematode Globodera pallida. A third, partial collagen gene ORF termed gp-col-t(t=truncated) has also been isolated and appears to represent an unexpressed pseudogene. The gp-col-1 and gp-col-2 genes both contain three short (<97 bp) introns which disrupt coding regions predicted to specify proteins with molecular weights of 33 and 32.7 kDa respectively. All three sequences show high similarity to each other and to the previously isolated G. pallida cDNA clone gp-col-8. The conserved pattern of cysteine residues and non-(Gly-X-Y)(n) region sequence similarity observed in all four G. pallida genes suggests that these molecules form part of the same subfamily of collagens. Southern analysis indicates that this subfamily is likely to contain further members. The G. pallida collagen sequences show striking similarity to twelve genes from Caenorhabditis elegans which collectively represent the recently classified Group 1a collagen subfamily. No data exists on the function of this subfamily in C. elegans. gp-col-1 and gp-col-2 are developmentally regulated with transcripts of both genes detected in adult virgin and gravid females but not in pre-parasitic second stage juveniles. A similar expression pattern is observed for the Group 1a collagen lemmi 5 from Meloidogyne incognita perhaps indicating a generic link between subfamily and function during the various changes in cuticular structure which accompany nematode growth and reproduction. Immunochemical studies indicate that the GP-COL-1 protein is specifically located in the hypodermis of G. pallida adult females.

High-speed optical phase-shifting apparatus

DOEpatents

Zortman, William A.

2016-11-08

An optical phase shifter includes an optical waveguide, a plurality of partial phase shifting elements arranged sequentially, and control circuitry electrically coupled to the partial phase shifting elements. The control circuitry is adapted to provide an activating signal to each of the N partial phase shifting elements such that the signal is delayed by a clock cycle between adjacent partial phase shifting elements in the sequence. The transit time for a guided optical pulse train between the input edges of consecutive partial phase shifting elements in the sequence is arranged to be equal to a clock cycle, thereby enabling pipelined processing of the optical pulses.

Amino acid sequence of the Amur tiger prion protein.

PubMed

Wu, Changde; Pang, Wanyong; Zhao, Deming

2006-10-01

Prion diseases are fatal neurodegenerative disorders in human and animal associated with conformational conversion of a cellular prion protein (PrP(C)) into the pathologic isoform (PrP(Sc)). Various data indicate that the polymorphisms within the open reading frame (ORF) of PrP are associated with the susceptibility and control the species barrier in prion diseases. In the present study, partial Prnp from 25 Amur tigers (tPrnp) were cloned and screened for polymorphisms. Four single nucleotide polymorphisms (T423C, A501G, C511A, A610G) were found; the C511A and A610G nucleotide substitutions resulted in the amino acid changes Lysine171Glutamine and Alanine204Threoine, respectively. The tPrnp amino acid sequence is similar to house cat (Felis catus ) and sheep, but differs significantly from other two cat Prnp sequences that were previously deposited in GenBank.

Expressed MHC class II genes in sea otters (Enhydra lutris) from geographically disparate populations

USGS Publications Warehouse

Bowen, Lizabeth; Aldridge, B.M.; Miles, A. Keith; Stott, J.L.

2006-01-01

The major histocompatibility complex (MHC) is central to maintaining the immunologic vigor of individuals and populations. Classical MHC class II genes were targeted for partial sequencing in sea otters (Enhydra lutris) from populations in California, Washington, and Alaska. Sequences derived from sea otter peripheral blood leukocyte mRNAs were similar to those classified as DQA, DQB, DRA, and DRB in other species. Comparisons of the derived amino acid compositions supported the classification of these as functional molecules from at least one DQA, DQB, and DRA locus and at least two DRB loci. While limited in scope, phylogenetic analysis of the DRB peptide‐binding region suggested the possible existence of distinct clades demarcated by geographic region. These preliminary findings support the need for additional MHC gene sequencing and expansion to a comprehensive study targeting additional otters.

Fast Dissemination of New HIV-1 CRF02/A1 Recombinants in Pakistan

PubMed Central

Chen, Yue; Hora, Bhavna; DeMarco, Todd; Shah, Sharaf Ali; Ahmed, Manzoor; Sanchez, Ana M.; Su, Chang; Carter, Meredith; Stone, Mars; Hasan, Rumina; Hasan, Zahra; Busch, Michael P.; Denny, Thomas N.; Gao, Feng

2016-01-01

A number of HIV-1 subtypes are identified in Pakistan by characterization of partial viral gene sequences. Little is known whether new recombinants are generated and how they disseminate since whole genome sequences for these viruses have not been characterized. Near full-length genome (NFLG) sequences were obtained by amplifying two overlapping half genomes or next generation sequencing from 34 HIV-1-infected individuals in Pakistan. Phylogenetic tree analysis showed that the newly characterized sequences were 16 subtype As, one subtype C, and 17 A/G recombinants. Further analysis showed that all 16 subtype A1 sequences (47%), together with the vast majority of sequences from Pakistan from other studies, formed a tight subcluster (A1a) within the subtype A1 clade, suggesting that they were derived from a single introduction. More in-depth analysis of 17 A/G NFLG sequences showed that five shared similar recombination breakpoints as in CRF02 (15%) but were phylogenetically distinct from the prototype CRF02 by forming a tight subcluster (CRF02a) while 12 (38%) were new recombinants between CRF02a and A1a or a divergent A1b viruses. Unique recombination patterns among the majority of the newly characterized recombinants indicated ongoing recombination. Interestingly, recombination breakpoints in these CRF02/A1 recombinants were similar to those in prototype CRF02 viruses, indicating that recombination at these sites more likely generate variable recombinant viruses. The dominance and fast dissemination of new CRF02a/A1 recombinants over prototype CRF02 suggest that these recombinant have more adapted and may become major epidemic strains in Pakistan. PMID:27973597

Mitochondrial DNA variation and phylogenetic relationships among five tuna species based on sequencing of D-loop region.

PubMed

Kumar, Girish; Kocour, Martin; Kunal, Swaraj Priyaranjan

2016-05-01

In order to assess the DNA sequence variation and phylogenetic relationship among five tuna species (Auxis thazard, Euthynnus affinis, Katsuwonus pelamis, Thunnus tonggol, and T. albacares) out of all four tuna genera, partial sequences of the mitochondrial DNA (mtDNA) D-loop region were analyzed. The estimate of intra-specific sequence variation in studied species was low, ranging from 0.027 to 0.080 [Kimura's two parameter distance (K2P)], whereas values of inter-specific variation ranged from 0.049 to 0.491. The longtail tuna (T. tonggol) and yellowfin tuna (T. albacares) were found to share a close relationship (K2P = 0.049) while skipjack tuna (K. pelamis) was most divergent studied species. Phylogenetic analysis using Maximum-Likelihood (ML) and Neighbor-Joining (NJ) methods supported the monophyletic origin of Thunnus species. Similarly, phylogeny of Auxis and Euthynnus species substantiate the monophyly. However, results showed a distinct origin of K. pelamis from genus Thunnus as well as Auxis and Euthynnus. Thus, the mtDNA D-loop region sequence data supports the polyphyletic origin of tuna species.

Evidence for Interspecies Gene Transfer in the Evolution of 2,4-Dichlorophenoxyacetic Acid Degraders

PubMed Central

McGowan, Catherine; Fulthorpe, Roberta; Wright, Alice; Tiedje, J. M.

1998-01-01

Small-subunit ribosomal DNA (SSU rDNA) from 20 phenotypically distinct strains of 2,4-dichlorophenoxyacetic acid (2,4-D)-degrading bacteria was partially sequenced, yielding 18 unique strains belonging to members of the alpha, beta, and gamma subgroups of the class Proteobacteria. To understand the origin of 2,4-D degradation in this diverse collection, the first gene in the 2,4-D pathway, tfdA, was sequenced. The sequences fell into three unique classes found in various members of the beta and gamma subgroups of Proteobacteria. None of the α-Proteobacteria yielded tfdA PCR products. A comparison of the dendrogram of the tfdA genes with that of the SSU rDNA genes demonstrated incongruency in phylogenies, and hence 2,4-D degradation must have originated from gene transfer between species. Only those strains with tfdA sequences highly similar to the tfdA sequence of strain JMP134 (tfdA class I) transferred all the 2,4-D genes and conferred the 2,4-D degradation phenotype to a Burkholderia cepacia recipient. PMID:9758850

An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl desaturase homolog

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van De Loo, F.J.; Broun, P.; Turner, S.

1995-07-18

Recent spectroscopic evidence implicating a binuclear iron site at the reaction center of fatty acyl desaturases suggested to us that certain fatty acyl hydroxylases may share significant amino acid sequence similarity with desaturases. To test this theory, we prepared a cDNA library from developing endosperm of the castor-oil plant (Ricinus communis L.) and obtained partial nucleotide sequences for 468 anonymous clones that were not expressed at high levels in leaves, a tissue deficient in 12-hydroxyoleic acid. This resulted in the identification of several cDNA clones encoding a polypeptide of 387 amino acids with a predicted molecular weight of 44,407 andmore » with {approx}67% sequence homology to microsomal oleate desaturase from Arabidopsis. Expression of a full-length clone under control of the cauliflower mosaic virus 35S promoter in transgenic tobacco resulted in the accumulation of low levels of 12-hydroxyoleic acid in seeds, indicating that the clone encodes the castor oleate hydroxylase. These results suggest that fatty acyl desaturases and hydroxylases share similar reaction mechanisms and provide an example of enzyme evolution. 26 refs., 6 figs., 1 tab.« less

Prevotella massiliensis sp. nov. isolated from human blood.

PubMed

Berger, Pierre; Adékambi, Toïdi; Mallet, Marie-Noelle; Drancourt, Michel

2005-12-01

We report a bacterial isolate (Marseille isolate) recovered from the blood of a patient hospitalized in an intensive care unit, presenting with severe trauma, fever and mechanical ventilation. Colonies appeared at 37 degrees C on blood agar after 72 h incubation. This isolate was a strictly anaerobic, Gram-negative rod phenotypically related to other Prevotella species described to date: non-motile, catalase-negative, oxidase-positive, non-glucose fermenting, resistant to vancomycin and susceptible to kanamycin. Cells exhibited a trilamellar membrane under electron microscopy. The fatty acid methyl ester profile was marginally related to that of Clostridium botulinum group A (distance: 26.27%) and Bifidobacterium bifidum GC subgroup B (distance: 26.38%). 16S rRNA gene sequence similarity was 90.0% with that of Prevotella oris and 89.1% with that of Prevotella melaninogenica. Partial rpoB gene sequence similarity was 84.5 and 86.4% with P. oris and P. melaninogenica, respectively. According to current standards, phenotypic traits, 16S rRNA and rpoB gene sequence analyses indicated that the Marseille isolate belonged to a previously unrecognized species of the genus Prevotella, and we propose classifying it in the new taxon "Prevotella massiliensis" sp. nov.

The leukocyte common antigen (CD45): a putative receptor-linked protein tyrosine phosphatase.

PubMed Central

Charbonneau, H; Tonks, N K; Walsh, K A; Fischer, E H

1988-01-01

A major protein tyrosine phosphatase (PTPase 1B) has been isolated in essentially homogeneous form from the soluble and particulate fractions of human placenta. Unexpectedly, partial amino acid sequences displayed no homology with the primary structures of the protein Ser/Thr phosphatases deduced from cDNA clones. However, the sequence is strikingly similar to the tandem C-terminal homologous domains of the leukocyte common antigen (CD45). A 157-residue segment of PTPase 1B displayed 40% and 33% sequence identity with corresponding regions from cytoplasmic domains I and II of human CD45. Similar degrees of identity have been observed among the catalytic domains of families of regulatory proteins such as protein kinases and cyclic nucleotide phosphodiesterases. On this basis, it is proposed that the CD45 family has protein tyrosine phosphatase activity and may represent a set of cell-surface receptors involved in signal transduction. This suggests that the repertoire of signal transduction mechanisms may include the direct control of an intracellular protein tyrosine phosphatase, offering the possibility of a regulatory balance with those protein tyrosine kinases that act at the internal surface of the membrane. Images PMID:2845400

Encephalitozoonosis in two inland bearded dragons (Pogona vitticeps).

PubMed

Richter, B; Csokai, J; Graner, I; Eisenberg, T; Pantchev, N; Eskens, H U; Nedorost, N

2013-02-01

Microsporidiosis is reported rarely in reptiles. Sporadic multisystemic granulomatous disease of captive bearded dragons (Pogona vitticeps) has been associated with microsporidia showing Encephalitozoon-like morphology. Two such cases are described herein. Both animals displayed clinical signs suggestive of renal failure. Necropsy examination revealed granulomatous lesions in the liver and adrenal area in both animals, and in several other organs in one animal. The lesions were associated with intracellular protozoa consistent with microsporidia. Ultrastructural examination of the organisms revealed morphology similar to Encephalitozoon spp. Immunohistochemistry and chromogenic in-situ hybridization for Encephalitozoon cuniculi were positive in both animals. Nucleotide sequencing of the partial small subunit ribosomal RNA gene and the complete internal transcribed spacer (ITS) region revealed high similarity with published E. cuniculi sequences in both animals. However, the ITS region showed a GTTT-repeat pattern distinct from mammalian E. cuniculi strains. This may be a novel E. cuniculi strain associated with multisystemic granulomatous disease in bearded dragons. Copyright © 2012 Elsevier Ltd. All rights reserved.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-11-11

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed Central

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-01-01

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

Effect of cerebral spinal fluid suppression for diffusional kurtosis imaging.

PubMed

Yang, Alicia W; Jensen, Jens H; Hu, Caixia C; Tabesh, Ali; Falangola, Maria F; Helpern, Joseph A

2013-02-01

To evaluate the cerebral spinal fluid (CSF) partial volume effect on diffusional kurtosis imaging (DKI) metrics in white matter and cortical gray matter. Four healthy volunteers participated in this study. Standard DKI and fluid-attenuated inversion recovery (FLAIR) DKI experiments were performed using a twice-refocused-spin-echo diffusion sequence. The conventional diffusion tensor imaging (DTI) metrics of fractional anisotropy (FA), mean, axial, and radial diffusivity (MD, D[symbol in text], D[symbol in text] together with DKI metrics of mean, axial, and radial kurtosis (MK, K[symbol in text], K[symbol in text], were measured and compared. Single image slices located above the lateral ventricles, with similar anatomical features for each subject, were selected to minimize the effect of CSF from the ventricles. In white matter, differences of less than 10% were observed between diffusion metrics measured with standard DKI and FLAIR-DKI sequences, suggesting minimal CSF contamination. For gray matter, conventional DTI metrics differed by 19% to 52%, reflecting significant CSF partial volume effects. Kurtosis metrics, however, changed by 11% or less, indicating greater robustness with respect to CSF contamination. Kurtosis metrics are less sensitive to CSF partial voluming in cortical gray matter than conventional diffusion metrics. The kurtosis metrics may then be more specific indicators of changes in tissue microstructure, provided the effect sizes for the changes are comparable. Copyright © 2012 Wiley Periodicals, Inc.

Characterizing partial AZFc deletions of the Y chromosome with amplicon-specific sequence markers

PubMed Central

Navarro-Costa, Paulo; Pereira, Luísa; Alves, Cíntia; Gusmão, Leonor; Proença, Carmen; Marques-Vidal, Pedro; Rocha, Tiago; Correia, Sónia C; Jorge, Sónia; Neves, António; Soares, Ana P; Nunes, Joaquim; Calhaz-Jorge, Carlos; Amorim, António; Plancha, Carlos E; Gonçalves, João

2007-01-01

Background The AZFc region of the human Y chromosome is a highly recombinogenic locus containing multi-copy male fertility genes located in repeated DNA blocks (amplicons). These AZFc gene families exhibit slight sequence variations between copies which are considered to have functional relevance. Yet, partial AZFc deletions yield phenotypes ranging from normospermia to azoospermia, thwarting definite conclusions on their real impact on fertility. Results The amplicon content of partial AZFc deletion products was characterized with novel amplicon-specific sequence markers. Data indicate that partial AZFc deletions are a male infertility risk [odds ratio: 5.6 (95% CI: 1.6–30.1)] and although high diversity of partial deletion products and sequence conversion profiles were recorded, the AZFc marker profiles detected in fertile men were also observed in infertile men. Additionally, the assessment of rearrangement recurrence by Y-lineage analysis indicated that while partial AZFc deletions occurred in highly diverse samples, haplotype diversity was minimal in fertile men sharing identical marker profiles. Conclusion Although partial AZFc deletion products are highly heterogeneous in terms of amplicon content, this plasticity is not sufficient to account for the observed phenotypical variance. The lack of causative association between the deletion of specific gene copies and infertility suggests that AZFc gene content might be part of a multifactorial network, with Y-lineage evolution emerging as a possible phenotype modulator. PMID:17903263

HYBRIDIZATION PROPERTIES OF DNA SEQUENCES DIRECTING THE SYNTHESIS OF MESSENGER RNA AND HETEROGENEOUS NUCLEAR RNA

PubMed Central

Greenberg, Jay R.; Perry, Robert P.

1971-01-01

The relationship of the DNA sequences from which polyribosomal messenger RNA (mRNA) and heterogeneous nuclear RNA (NRNA) of mouse L cells are transcribed was investigated by means of hybridization kinetics and thermal denaturation of the hybrids. Hybridization was performed in formamide solutions at DNA excess. Under these conditions most of the hybridizing mRNA and NRNA react at values of Dot (DNA concentration multiplied by time) expected for RNA transcribed from the nonrepeated or rarely repeated fraction of the genome. However, a fraction of both mRNA and NRNA hybridize at values of Dot about 10,000 times lower, and therefore must be transcribed from highly redundant DNA sequences. The fraction of NRNA hybridizing to highly repeated sequences is about 1.7 times greater than the corresponding fraction of mRNA. The hybrids formed by the rapidly reacting fractions of both NRNA and mRNA melt over a narrow temperature range with a midpoint about 11°C below that of native L cell DNA. This indicates that these hybrids consist of partially complementary sequences with approximately 11% mismatching of bases. Hybrids formed by the slowly reacting fraction of NRNA melt within 4°–6°C of native DNA, indicating very little, if any, mismatching of bases. Hybrids of the slowly reacting components of mRNA, formed under conditions of sufficiently low RNA input, have a high thermal stability, similar to that observed for hybrids of the slowly reacting NRNA component. However, when higher inputs of mRNA are used, hybrids are formed which have a strikingly lower thermal stability. This observation can be explained by assuming that there is sufficient similarity among the relatively rare DNA sequences coding for mRNA so that under hybridization conditions, in which these DNA sequences are not truly in excess, reversible hybrids exhibiting a considerable amount of mispairing are formed. The fact that a comparable phenomenon has not been observed for NRNA may mean that there is less similarity among the relatively rare DNA sequences coding for NRNA than there is among the rare sequences coding for mRNA. PMID:4999767

Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

PubMed

Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

2004-01-01

The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

Aligning the unalignable: bacteriophage whole genome alignments.

PubMed

Bérard, Sèverine; Chateau, Annie; Pompidor, Nicolas; Guertin, Paul; Bergeron, Anne; Swenson, Krister M

2016-01-13

In recent years, many studies focused on the description and comparison of large sets of related bacteriophage genomes. Due to the peculiar mosaic structure of these genomes, few informative approaches for comparing whole genomes exist: dot plots diagrams give a mostly qualitative assessment of the similarity/dissimilarity between two or more genomes, and clustering techniques are used to classify genomes. Multiple alignments are conspicuously absent from this scene. Indeed, whole genome aligners interpret lack of similarity between sequences as an indication of rearrangements, insertions, or losses. This behavior makes them ill-prepared to align bacteriophage genomes, where even closely related strains can accomplish the same biological function with highly dissimilar sequences. In this paper, we propose a multiple alignment strategy that exploits functional collinearity shared by related strains of bacteriophages, and uses partial orders to capture mosaicism of sets of genomes. As classical alignments do, the computed alignments can be used to predict that genes have the same biological function, even in the absence of detectable similarity. The Alpha aligner implements these ideas in visual interactive displays, and is used to compute several examples of alignments of Staphylococcus aureus and Mycobacterium bacteriophages, involving up to 29 genomes. Using these datasets, we prove that Alpha alignments are at least as good as those computed by standard aligners. Comparison with the progressive Mauve aligner - which implements a partial order strategy, but whose alignments are linearized - shows a greatly improved interactive graphic display, while avoiding misalignments. Multiple alignments of whole bacteriophage genomes work, and will become an important conceptual and visual tool in comparative genomics of sets of related strains. A python implementation of Alpha, along with installation instructions for Ubuntu and OSX, is available on bitbucket (https://bitbucket.org/thekswenson/alpha).

Molecular characterization of kudoid parasites (Myxozoa: Multivalvulida) from somatic muscles of Pacific bluefin (Thunnus orientalis) and yellowfin (T. albacores) tuna.

PubMed

Abe, Niichiro; Maehara, Tomofumi

2013-06-01

The public health importance of Kudoa infection in fish remains unclear. Recently in Japan a Kudoa species, K. septempunctata, was newly implicated as a causative agent of unidentified food poisoning related to the consumption of raw olive flounder. Other marine fishery products are also suspected as causative raw foods of unidentified food poisoning. For this study, we detected kudoid parasites from sliced raw muscle tissues of a young Pacific bluefin and an adult yellowfin tuna. No cyst or pseudocyst was evident in muscles macroscopically, but pseudocysts were detected in both samples histologically. One substitution (within 1100 bp overlap) and ten substitutions (within 753 bp overlap) were found respectively between the partial sequences of 18S and 28S rDNAs from both isolates. Nucleotide sequence similarity searching of 18S and 28S rDNAs from both isolates showed the highest identity with those of K. neothunni from tuna. Based on the spore morphology, the mode of parasitism, and the nucleotide sequence similarity, these isolates from a Pacific bluefin and a yellowfin tuna were identified as K. neothunni. Phylogenetic analysis of the 28S rDNA sequence revealed that K. neothunni is classifiable into two genotypes: one from Pacific bluefin and the other from yellowfin tuna. Recently, an unidentified kudoid parasite morphologically and genetically similar K. neothunni were detected from stocked tuna samples in unidentified food poisoning cases in Japan. The possibility exists that K. neothunni, especially from the Pacific bluefin tuna, causes food poisoning, as does K. septempunctata.

Shark complement: an assessment.

PubMed

Smith, S L

1998-12-01

The classical (CCP) and alternative (ACP) pathways of complement activation have been established for the nurse shark (Ginglymostoma cirratum). The isolation of a cDNA clone encoding a mannan-binding protein-associated serine protease (MASP)-1-like protein from the Japanese dogfish (Triakis scyllia) suggests the presence of a lectin pathway. The CCP consists of six functionally distinct components: C1n, C2n, C3n, C4n, C8n and C9n, and is activated by immune complexes in the presence of Ca++ and Mg++ ions. The ACP is antibody independent, requiring Mg++ ions and a heat-labile 90 kDa factor B-like protein for activity. Proteins considered homologues of C1q, C3 and C4 (C2n) of the mammalian complement system have been isolated from nurse shark serum. Shark C1q is composed of at least two chain types each showing 50% identity to human C1q chains A and B. Partial sequence of the globular domain of one of the chains shows it to be C1q-like rather than like mannan-binding protein. N-terminal amino acid sequences of the alpha and beta chain of shark C3 and C4 molecules show significant identity with corresponding human C3 and C4 chains. A sequence representing shark C4 gamma chain, shows little similarity to human C4 gamma chain. The terminal shark components C8n and C9n are functional analogues of mammalian C8 and C9. Anaphylatoxin activity has been demonstrated in activated shark serum, and porcine C5a desArg induces shark leucocyte chemotaxis. The deduced amino acid sequence of a partial C3 cDNA clone from the nurse shark shows 50%, 30% and 24% homology with the corresponding region of mammalian C3, C4 and alpha 2-macroglobulin. Deduced amino acid sequence data from partial Bf/C2 cDNA clones, two from the nurse shark and one from the Japanese dogfish, suggest that at least one species of elasmobranch has two distinct Bf/C2 genes.

Gene Discovery through Transcriptome Sequencing for the Invasive Mussel Limnoperna fortunei

PubMed Central

Uliano-Silva, Marcela; Americo, Juliana Alves; Brindeiro, Rodrigo; Dondero, Francesco; Prosdocimi, Francisco; de Freitas Rebelo, Mauro

2014-01-01

The success of the Asian bivalve Limnoperna fortunei as an invader in South America is related to its high acclimation capability. It can inhabit waters with a wide range of temperatures and salinity and handle long-term periods of air exposure. We describe the transcriptome of L. fortunei aiming to give a first insight into the phenotypic plasticity that allows non-native taxa to become established and widespread. We sequenced 95,219 reads from five main tissues of the mussel L. fortunei using Roche’s 454 and assembled them to form a set of 84,063 unigenes (contigs and singletons) representing partial or complete gene sequences. We annotated 24,816 unigenes using a BLAST sequence similarity search against a NCBI nr database. Unigenes were divided into 20 eggNOG functional categories and 292 KEGG metabolic pathways. From the total unigenes, 1,351 represented putative full-length genes of which 73.2% were functionally annotated. We described the first partial and complete gene sequences in order to start understanding bivalve invasiveness. An expansion of the hsp70 gene family, seen also in other bivalves, is present in L. fortunei and could be involved in its adaptation to extreme environments, e.g. during intertidal periods. The presence of toll-like receptors gives a first insight into an immune system that could be more complex than previously assumed and may be involved in the prevention of disease and extinction when population densities are high. Finally, the apparent lack of special adaptations to extremely low O2 levels is a target worth pursuing for the development of a molecular control approach. PMID:25047650

Comparison of partial and full nitrification processes applied for treating high-strength nitrogen wastewaters: microbial ecology through nitrous oxide production.

PubMed

Ahn, Joon Ho; Kwan, Tiffany; Chandran, Kartik

2011-04-01

The goal of this study was to compare the microbial ecology, gene expression, biokinetics, and N2O emissions from a lab-scale bioreactor operated sequentially in full-nitrification and partial-nitrification modes. Based on sequencing of 16S rRNA and ammonia monooxygenase subunit A (amoA) genes, ammonia oxidizing bacteria (AOB) populations during full- and partial-nitrification modes were distinct from one another. The concentrations of AOB (XAOB) and their respiration rates during full- and partial-nitrification modes were statistically similar, whereas the concentrations of nitrite oxidizing bacteria (XNOB) and their respiration rates declined significantly after the switch from full- to partial-nitrification. The transition from full-nitrification to partial nitrification resulted in a protracted transient spike of nitrous oxide (N2O) and nitric oxide (NO) emissions, which later stabilized. The trends in N2O and NO emissions correlated well with trends in the expression of nirK and norB genes that code for the production of these gases in AOB. Both the transient and stabilized N2O and NO emissions during partial nitrification were statistically higher than those during steady-state full-nitrification. Based on these results, partial nitrification strategies for biological nitrogen removal, although attractive for their reduced operating costs and energy demand, may need to be optimized against the higher carbon foot-print attributed to their N2O emissions.

Sequencing of the needle transcriptome from Norway spruce (Picea abies Karst L.) reveals lower substitution rates, but similar selective constraints in gymnosperms and angiosperms

PubMed Central

2012-01-01

Background A detailed knowledge about spatial and temporal gene expression is important for understanding both the function of genes and their evolution. For the vast majority of species, transcriptomes are still largely uncharacterized and even in those where substantial information is available it is often in the form of partially sequenced transcriptomes. With the development of next generation sequencing, a single experiment can now simultaneously identify the transcribed part of a species genome and estimate levels of gene expression. Results mRNA from actively growing needles of Norway spruce (Picea abies) was sequenced using next generation sequencing technology. In total, close to 70 million fragments with a length of 76 bp were sequenced resulting in 5 Gbp of raw data. A de novo assembly of these reads, together with publicly available expressed sequence tag (EST) data from Norway spruce, was used to create a reference transcriptome. Of the 38,419 PUTs (putative unique transcripts) longer than 150 bp in this reference assembly, 83.5% show similarity to ESTs from other spruce species and of the remaining PUTs, 3,704 show similarity to protein sequences from other plant species, leaving 4,167 PUTs with limited similarity to currently available plant proteins. By predicting coding frames and comparing not only the Norway spruce PUTs, but also PUTs from the close relatives Picea glauca and Picea sitchensis to both Pinus taeda and Taxus mairei, we obtained estimates of synonymous and non-synonymous divergence among conifer species. In addition, we detected close to 15,000 SNPs of high quality and estimated gene expression differences between samples collected under dark and light conditions. Conclusions Our study yielded a large number of single nucleotide polymorphisms as well as estimates of gene expression on transcriptome scale. In agreement with a recent study we find that the synonymous substitution rate per year (0.6 × 10−09 and 1.1 × 10−09) is an order of magnitude smaller than values reported for angiosperm herbs. However, if one takes generation time into account, most of this difference disappears. The estimates of the dN/dS ratio (non-synonymous over synonymous divergence) reported here are in general much lower than 1 and only a few genes showed a ratio larger than 1. PMID:23122049

Enterobacter muelleri sp. nov., isolated from the rhizosphere of Zea mays.

PubMed

Kämpfer, Peter; McInroy, John A; Glaeser, Stefanie P

2015-11-01

A beige-pigmented, oxidase-negative bacterial strain (JM-458T), isolated from a rhizosphere sample, was studied using a polyphasic taxonomic approach. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain JM-458T with sequences of the type strains of closely related species of the genus Enterobacter showed that it shared highest sequence similarity with Enterobacter mori (98.7 %), Enterobacter hormaechei (98.3 %), Enterobacter cloacae subsp. dissolvens, Enterobacter ludwigii and Enterobacter asburiae (all 98.2 %). 16S rRNA gene sequence similarities to all other Enterobacter species were below 98 %. Multilocus sequence analysis based on concatenated partial rpoB, gyrB, infB and atpD gene sequences showed a clear distinction of strain JM-458T from its closest related type strains. The fatty acid profile of the strain consisted of C16 : 0, C17 : 0 cyclo, iso-C15 : 0 2-OH/C16 : 1ω7c and C18 : 1ω7c as major components. DNA-DNA hybridizations between strain JM-458T and the type strains of E. mori, E. hormaechei and E. ludwigii resulted in relatedness values of 29 % (reciprocal 25 %), 24 % (reciprocal 43 %) and 16 % (reciprocal 17 %), respectively. DNA-DNA hybridization results together with multilocus sequence analysis results and differential biochemical and chemotaxonomic properties showed that strain JM-458T represents a novel species of the genus Enterobacter, for which the name Enterobacter muelleri sp. nov. is proposed. The type strain is JM-458T ( = DSM 29346T = CIP 110826T = LMG 28480T = CCM 8546T).

Molecular cloning, characterization, and immunolocalization of two lactate dehydrogenase homologous genes from Taenia solium.

PubMed

Du, Wuying; Hu, Fengyu; Yang, Yabo; Hu, Dong; Hu, Xuchu; Yu, Xinbing; Xu, Jin; Dai, Jialin; Liao, Xinjiang; Huang, Jiang

2011-09-01

Two novel genes encoding lactate dehydrogenase A (LDHA) and B (LDHB) homologues, respectively, were identified from the cDNA libraries of adult Taenia solium (T. solium). The two deduced amino acid sequences both show more than 50% identity to the homologues for Danio rerio, Xenopus laevis, Schistosoma japonicum, Sus scrofa, Homo sapiens, et al. The identity of the amino acid sequence between TsLDHA and TsLDHB is 57.4%, and that of the nucleotide sequence is 61.5%. Recombinant TsLDHA homologue (rTsLDHA) and TsLDHB homologue (rTsLDHB) were expressed in Escherichia coli BL21/DE3 and purified. Though there were some differences in the sequence, the two LDH isozyme homologues show similarity in the conserved LDH domain, topological structure, primary immunological traits, localization on the tegument of T. solium adult, and partial physicochemical properties. The linear B-cell epitope analysis of TsLDHA and TsLDHB discovered a TsLDHA specific epitope. The purified rTsLDHA and rTsLDHB could be recognized by rat immuno-sera, serum from swine, or a patient infected with T. solium, respectively, but Western blot analysis showed cross-reactions, not only between these two LDH members but also with other common human tapeworms or helminths. The results suggested that the two LDH homologues are similar in the characteristics of LDH family, and they are not specific antigens for immunodiagnosis.

Purification, amino acid sequence and characterisation of kangaroo IGF-I.

PubMed

Yandell, C A; Francis, G L; Wheldrake, J F; Upton, Z

1998-01-01

Insulin-like growth factor-I (IGF-I) and IGF-II have been purified to homogeneity from kangaroo (Macropus fuliginosus) serum, thus this represents the first report of the purification, sequencing and characterisation of marsupial IGFs. N-Terminal protein sequencing reveals that there are six amino acid differences between kangaroo and human IGF-I. Kangaroo IGF-II has been partially sequenced and no differences were found between human and kangaroo IGF-II in the 53 residues identified. Thus the IGFs appear to be remarkably structurally conserved during mammalian radiation. In addition, in vitro characterisation of kangaroo IGF-I demonstrated that the functional properties of human, kangaroo and chicken IGF-I are very similar. In an assay measuring the ability of the proteins to stimulate protein synthesis in rat L6 myoblasts, all IGF-I proteins were found to be equally potent. The ability of all three proteins to compete for binding with radiolabelled human IGF-I to type-1 IGF receptors in L6 myoblasts and in Sminthopsis crassicaudata transformed lung fibroblasts, a marsupial cell line, was comparable. Furthermore, kangaroo and human IGF-I react equally in a human IGF-I RIA using a human reference standard, radiolabelled human IGF-I and a polyclonal antibody raised against recombinant human IGF-I. This study indicates that not only is the primary structure of eutherian and metatherian IGF-I conserved, but also the proteins appear to be functionally similar.

Thalassospira lucentensis gen. nov., sp. nov., a new marine member of the alpha-Proteobacteria.

PubMed

López-López, Arantxa; Pujalte, María J; Benlloch, Susana; Mata-Roig, Manuel; Rosselló-Mora, Ramón; Garay, Esperanza; Rodríguez-Valera, Francisco

2002-07-01

A novel bacterium from the Mediterranean Sea was isolated under oligotrophic conditions at in situ temperature after prolonged continuous culture. The isolates were initially characterized by partial 16S rRNA gene sequencing. Similarity searches of one of the isolates, QMT2T, indicated high sequence identity to the well-characterized Rhodospirillum rubrum, [Aquaspirillum] itersonii and [Oceanospirillum] pusillum micro-organisms, which are representatives of the alpha-subclass of the Proteobacteria. The highest level of similarity of the complete 165 rRNA gene with respect to these microorganisms was 89%. Features such as the low similarities of 165 rRNA of QMT2T with its phylogenetically close neighbours, the distinct G+C content, and the differences in phenotypic features, including pigmentation, fatty acid composition, salt tolerance, the lack of bacteriochlorophyll a, and the capacity to use carbohydrates as carbon sources, are indicative of the novel nature of the isolate QMT2T among the alpha-Proteobacteria. This report describes the classification of strain QMT2T (= DSM 14000T = CECT 5390T) as a new genus and species, Thalassospira lucentensis gen. nov, sp. nov., in the family Rhodospirillaceae.

Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

PubMed

Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

2007-03-01

In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

Reclassification of Actinobacillus muris as Muribacter muris gen. nov., comb. nov.

PubMed

Nicklas, Werner; Bisgaard, Magne; Aalbæk, Bent; Kuhnert, Peter; Christensen, Henrik

2015-10-01

To reinvestigate the taxonomy of [Actinobacillus] muris, 474 strains, mainly from mice and rats, were characterized by phenotype and 130 strains selected for genotypic characterization by 16S rRNA and partial rpoB gene sequencing. The type strain was further investigated by whole-genome sequencing. Phylogenetic analysis of the DNA sequences showed one monophyletic group with intragroup similarities of 96.7 and 97.2 % for the 16S rRNA and rpoB genes, respectively. The highest 16S rRNA gene sequence similarity to a taxon with a validly published name outside the group was 95.9 %, to the type strain of [Pasteurella] pneumotropica. The closest related taxon based on rpoB sequence comparison was 'Haemophilus influenzae-murium', with 88.4 % similarity. A new genus and a new combination, Muribacter muris gen. nov., comb. nov., are proposed based on a distinct phylogenetic position based on 16S rRNA and rpoB gene sequence comparisons, with major divergence from the existing genera of the family Pasteurellaceae. The new genus has the characteristics of [A.] muris with the emendation that acid formation from ( - )-d-mannitol and hydrolysis of aesculin are variable, while the α-glucosidase test is positive. There is no requirement for exogenously supplied NAD (V factor) for the majority of strains investigated; however, one strain was found to require NAD. The major fatty acids of the type strain of Muribacter muris were C14 : 0, C14 : 0 3-OH/iso-C16 : 1 I, C16 : 1ω7c and C16 : 0, which is in line with most genera of the Pasteurellaceae. The type strain of Muribacter muris is CCUG 16938T ( = NCTC 12432T = ATCC 49577T).

Zonadhesin D3-Polypeptides Vary among Species but Are Similar in Equus Species Capable of Interbreeding1

PubMed Central

Tardif, Steve; Brady, Heidi A.; Breazeale, Kelly R.; Bi, Ming; Thompson, Leslie D.; Bruemmer, Jason E.; Bailey, Laura B.; Hardy, Daniel M.

2009-01-01

Zonadhesin is a rapidly evolving protein in the sperm acrosome that confers species specificity to sperm-zona pellucida adhesion. Though structural variation in zonadhesin likely contributes to its species-specific function, the protein has not previously been characterized in organisms capable of interbreeding. Here we compared properties of zonadhesin in several animals, including the horse (Equus caballus), donkey (E. asinus), and Grevy's zebra (E. grevyi) to determine if variation in zonadhesin correlates with ability of gametes to cross-fertilize. Zonadhesin localized to the apical acrosomes of spermatozoa from all three Equus species, similar to its localization in other animals. Likewise, in horse and donkey testis, zonadhesin was detected only in germ cells, first in the acrosomal granule of round spermatids and then in the developing acrosomes of elongating spermatids. Among non-Equus species, D3-domain polypeptides of mature, processed zonadhesin varied markedly in size and detergent solubility. However, zonadhesin D3-domain polypeptides in horse, donkey, and zebra spermatozoa exhibited identical electrophoretic mobility and detergent solubility. Equus zonadhesin D3-polypeptides (p110/p80 doublet) were most similar in size to porcine and bovine zonadhesin D3-polypeptides (p105). Sequence comparisons revealed that the horse zonadhesin precursor's domain content and arrangement are similar to those of zonadhesin from other large animals. Partial sequences of horse and donkey zonadhesin were much more similar to each other (>99% identity) than they were to orthologous sequences of human, pig, rabbit, and mouse zonadhesin (52%–72% identity). We conclude that conservation of zonadhesin D3-polypeptide properties correlates with ability of Equus species to interbreed. PMID:19794156

Genome sequencing identifies Listeria fleischmannii subsp. coloradonensis subsp. nov., isolated from a ranch.

PubMed

den Bakker, Henk C; Manuel, Clyde S; Fortes, Esther D; Wiedmann, Martin; Nightingale, Kendra K

2013-09-01

Twenty Listeria-like isolates were obtained from environmental samples collected on a cattle ranch in northern Colorado; all of these isolates were found to share an identical partial sigB sequence, suggesting close relatedness. The isolates were similar to members of the genus Listeria in that they were Gram-stain-positive, short rods, oxidase-negative and catalase-positive; the isolates were similar to Listeria fleischmannii because they were non-motile at 25 °C. 16S rRNA gene sequencing for representative isolates and whole genome sequencing for one isolate was performed. The genome of the type strain of Listeria fleischmannii (strain LU2006-1(T)) was also sequenced. The draft genomes were very similar in size and the average MUMmer nucleotide identity across 91% of the genomes was 95.16%. Genome sequence data were used to design primers for a six-gene multi-locus sequence analysis (MLSA) scheme. Phylogenies based on (i) the near-complete 16S rRNA gene, (ii) 31 core genes and (iii) six housekeeping genes illustrated the close relationship of these Listeria-like isolates to Listeria fleischmannii LU2006-1(T). Sufficient genetic divergence of the Listeria-like isolates from the type strain of Listeria fleischmannii and differing phenotypic characteristics warrant these isolates to be classified as members of a distinct infraspecific taxon, for which the name Listeria fleischmannii subsp. coloradonensis subsp. nov. is proposed. The type strain is TTU M1-001(T) ( =BAA-2414(T) =DSM 25391(T)). The isolates of Listeria fleischmannii subsp. coloradonensis subsp. nov. differ from the nominate subspecies by the inability to utilize melezitose, turanose and sucrose, and the ability to utilize inositol. The results also demonstrate the utility of whole genome sequencing to facilitate identification of novel taxa within a well-described genus. The genomes of both subspecies of Listeria fleischmannii contained putative enhancin genes; the Listeria fleischmannii subsp. coloradonensis subsp. nov. genome also encoded a putative mosquitocidal toxin. The presence of these genes suggests possible adaptation to an insect host, and further studies are needed to probe niche adaptation of Listeria fleischmannii.

The Fecal Viral Flora of Wild Rodents

PubMed Central

Phan, Tung G.; Kapusinszky, Beatrix; Wang, Chunlin; Rose, Robert K.; Lipton, Howard L.; Delwart, Eric L.

2011-01-01

The frequent interactions of rodents with humans make them a common source of zoonotic infections. To obtain an initial unbiased measure of the viral diversity in the enteric tract of wild rodents we sequenced partially purified, randomly amplified viral RNA and DNA in the feces of 105 wild rodents (mouse, vole, and rat) collected in California and Virginia. We identified in decreasing frequency sequences related to the mammalian viruses families Circoviridae, Picobirnaviridae, Picornaviridae, Astroviridae, Parvoviridae, Papillomaviridae, Adenoviridae, and Coronaviridae. Seventeen small circular DNA genomes containing one or two replicase genes distantly related to the Circoviridae representing several potentially new viral families were characterized. In the Picornaviridae family two new candidate genera as well as a close genetic relative of the human pathogen Aichi virus were characterized. Fragments of the first mouse sapelovirus and picobirnaviruses were identified and the first murine astrovirus genome was characterized. A mouse papillomavirus genome and fragments of a novel adenovirus and adenovirus-associated virus were also sequenced. The next largest fraction of the rodent fecal virome was related to insect viruses of the Densoviridae, Iridoviridae, Polydnaviridae, Dicistroviriade, Bromoviridae, and Virgaviridae families followed by plant virus-related sequences in the Nanoviridae, Geminiviridae, Phycodnaviridae, Secoviridae, Partitiviridae, Tymoviridae, Alphaflexiviridae, and Tombusviridae families reflecting the largely insect and plant rodent diet. Phylogenetic analyses of full and partial viral genomes therefore revealed many previously unreported viral species, genera, and families. The close genetic similarities noted between some rodent and human viruses might reflect past zoonoses. This study increases our understanding of the viral diversity in wild rodents and highlights the large number of still uncharacterized viruses in mammals. PMID:21909269

In-depth characterization of breast cancer tumor-promoting cell transcriptome by RNA sequencing and microarrays

PubMed Central

Soldà, Giulia; Merlino, Giuseppe; Fina, Emanuela; Brini, Elena; Moles, Anna; Cappelletti, Vera; Daidone, Maria Grazia

2016-01-01

Numerous studies have reported the existence of tumor-promoting cells (TPC) with self-renewal potential and a relevant role in drug resistance. However, pathways and modifications involved in the maintenance of such tumor subpopulations are still only partially understood. Sequencing-based approaches offer the opportunity for a detailed study of TPC including their transcriptome modulation. Using microarrays and RNA sequencing approaches, we compared the transcriptional profiles of parental MCF7 breast cancer cells with MCF7-derived TPC (i.e. MCFS). Data were explored using different bioinformatic approaches, and major findings were experimentally validated. The different analytical pipelines (Lifescope and Cufflinks based) yielded similar although not identical results. RNA sequencing data partially overlapped microarray results and displayed a higher dynamic range, although overall the two approaches concordantly predicted pathway modifications. Several biological functions were altered in TPC, ranging from production of inflammatory cytokines (i.e., IL-8 and MCP-1) to proliferation and response to steroid hormones. More than 300 non-coding RNAs were defined as differentially expressed, and 2,471 potential splicing events were identified. A consensus signature of genes up-regulated in TPC was derived and was found to be significantly associated with insensitivity to fulvestrant in a public breast cancer patient dataset. Overall, we obtained a detailed portrait of the transcriptome of a breast cancer TPC line, highlighted the role of non-coding RNAs and differential splicing, and identified a gene signature with a potential as a context-specific biomarker in patients receiving endocrine treatment. PMID:26556871

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

Purification and Partial Characterization of a Novel Bacteriocin Synthesized by Lactobacillus paracasei HD1-7 Isolated from Chinese Sauerkraut Juice.

PubMed

Ge, Jingping; Sun, Yanyang; Xin, Xing; Wang, Ying; Ping, Wenxiang

2016-01-14

Bacteriocins have antimicrobial activities against food-spoiling bacteria and food-borne pathogens. Paracin 1.7, a bacteriocin synthesized by Lactobacillus paracasei HD1-7 isolated from Chinese sauerkraut juice, was studied. Following partial purification with ammonium sulfate precipitation, CM Sepharose Fast Flow, and Sephadex G-10 chromatography, the molecular weight of Paracin 1.7 was about 10 kDa based on Tricine-SDS-PAGE results. A 2.87 fold purified bacteriocin was produced, reaching a final yield of 39.93% and the specific activity of 1.56 × 10(3) AU/mg. The N-terminal amino acid sequence of Paracin 1.7 was VSNTFFA, and the LC/LTQ results revealed that the N-terminal amino acid sequence was similar to that of ABC-type oligopeptide transport system protein and N-acetylmuramoyl-L-alanine amidase. Paracin 1.7 was sensitive to protease K, had antimicrobial activities at a broad pH range (3.0-8.0), and was heat resistant (121 °C for 20 min). Paracin 1.7 from Lactobacillus paracasei HD1-7 is a novel bacteriocin that has potential applications in food preservation.

Purification and Partial Characterization of a Novel Bacteriocin Synthesized by Lactobacillus paracasei HD1-7 Isolated from Chinese Sauerkraut Juice

PubMed Central

Ge, Jingping; Sun, Yanyang; Xin, Xing; Wang, Ying; Ping, Wenxiang

2016-01-01

Bacteriocins have antimicrobial activities against food-spoiling bacteria and food-borne pathogens. Paracin 1.7, a bacteriocin synthesized by Lactobacillus paracasei HD1-7 isolated from Chinese sauerkraut juice, was studied. Following partial purification with ammonium sulfate precipitation, CM Sepharose Fast Flow, and Sephadex G-10 chromatography, the molecular weight of Paracin 1.7 was about 10 kDa based on Tricine-SDS-PAGE results. A 2.87 fold purified bacteriocin was produced, reaching a final yield of 39.93% and the specific activity of 1.56 × 103 AU/mg. The N-terminal amino acid sequence of Paracin 1.7 was VSNTFFA, and the LC/LTQ results revealed that the N-terminal amino acid sequence was similar to that of ABC-type oligopeptide transport system protein and N-acetylmuramoyl-L-alanine amidase. Paracin 1.7 was sensitive to protease K, had antimicrobial activities at a broad pH range (3.0–8.0), and was heat resistant (121 °C for 20 min). Paracin 1.7 from Lactobacillus paracasei HD1-7 is a novel bacteriocin that has potential applications in food preservation. PMID:26763314

Pulse-like partial ruptures and high-frequency radiation at creeping-locked transition during megathrust earthquakes

NASA Astrophysics Data System (ADS)

Michel, Sylvain; Avouac, Jean-Philippe; Lapusta, Nadia; Jiang, Junle

2017-08-01

Megathrust earthquakes tend to be confined to fault areas locked in the interseismic period and often rupture them only partially. For example, during the 2015 M7.8 Gorkha earthquake, Nepal, a slip pulse propagating along strike unzipped the bottom edge of the locked portion of the Main Himalayan Thrust (MHT). The lower edge of the rupture produced dominant high-frequency (>1 Hz) radiation of seismic waves. We show that similar partial ruptures occur spontaneously in a simple dynamic model of earthquake sequences. The fault is governed by standard laboratory-based rate-and-state friction with the aging law and contains one homogenous velocity-weakening (VW) region embedded in a velocity-strengthening (VS) area. Our simulations incorporate inertial wave-mediated effects during seismic ruptures (they are thus fully dynamic) and account for all phases of the seismic cycle in a self-consistent way. Earthquakes nucleate at the edge of the VW area and partial ruptures tend to stay confined within this zone of higher prestress, producing pulse-like ruptures that propagate along strike. The amplitude of the high-frequency sources is enhanced in the zone of higher, heterogeneous stress at the edge of the VW area.

Pulse-Like Partial Ruptures and High-Frequency Radiation at Creeping-Locked Transition during Megathrust Earthquakes

NASA Astrophysics Data System (ADS)

Michel, S. G. R. M.; Avouac, J. P.; Lapusta, N.; Jiang, J.

2017-12-01

Megathrust earthquakes tend to be confined to fault areas locked in the interseismic period and often rupture them only partially. For example, during the 2015 M7.8 Gorkha earthquake, Nepal, a slip pulse propagating along strike unzipped the bottom edge of the locked portion of the Main Himalayan Thrust (MHT). The lower edge of the rupture produced dominant high-frequency (>1 Hz) radiation of seismic waves. We show that similar partial ruptures occur spontaneously in a simple dynamic model of earthquake sequences. The fault is governed by standard laboratory-based rate-and-state friction with the ageing law and contains one homogenous velocity-weakening (VW) region embedded in a velocity-strengthening (VS) area. Our simulations incorporate inertial wave-mediated effects during seismic ruptures (they are thus fully dynamic) and account for all phases of the seismic cycle in a self-consistent way. Earthquakes nucleate at the edge of the VW area and partial ruptures tend to stay confined within this zone of higher prestress, producing pulse-like ruptures that propagate along strike. The amplitude of the high-frequency sources is enhanced in the zone of higher, heterogeneous stress at the edge of the VW area.

West Nile virus, Anopheles flavivirus, a novel flavivirus as well as Merida-like rhabdovirus Turkey in field-collected mosquitoes from Thrace and Anatolia.

PubMed

Öncü, Ceren; Brinkmann, Annika; Günay, Filiz; Kar, Sırrı; Öter, Kerem; Sarıkaya, Yasemen; Nitsche, Andreas; Linton, Yvonne-Marie; Alten, Bülent; Ergünay, Koray

2018-01-01

Mosquitoes are involved in the transmission and maintenance of several viral diseases with significant health impact. Biosurveillance efforts have also revealed insect-specific viruses, observed to cocirculate with pathogenic strains. This report describes the findings of flavivirus and rhabdovirus screening, performed in eastern Thrace and Aegean region of Anatolia during 2016, including and expanding on locations with previously-documented virus activity. A mosquito cohort of 1545 individuals comprising 14 species were collected and screened in 108 pools via generic and specific amplification and direct metagenomics by next generation sequencing. Seven mosquito pools (6.4%) were positive in the flavivirus screening. West Nile virus lineage 1 clade 1a sequences were characterized in a pool Culex pipiens sensu lato specimens, providing the initial virus detection in Aegean region following 2010 outbreak. In an Anopheles maculipennis sensu lato pool, sequences closely-related to Anopheles flaviviruses were obtained, with similarities to several African and Australian strains of this new insect-specific flavivirus clade. In pools comprising Uranotaenia unguiculata (n=3), Cx. pipiens s.l. (n=1) and Aedes caspius (n=1) mosquitoes, sequences of a novel flavivirus, distantly-related to Flavivirus AV2011, identified previously in Spain and Turkey, were characterized. Moreover, DNA forms of the novel flavivirus were detected in two Ur. unguiculata pools. These sequences were highly-similar to the sequences amplified from viral RNA, with undisrupted reading frames, suggest the occurrence of viral DNA forms in natural conditions within mosquito hosts. Rhabdovirus screening revealed sequences of a recently-described novel virus, named the Merida-like virus Turkey (MERDLVT) in 5 Cx. pipiens s.l. pools (4.6%). Partial L and N gene sequences of MERDLVT were well-conserved among strains, with evidence for geographical clustering in phylogenetic analyses. Metagenomics provided the near-full genomic sequence in a specimen, revealing an identical genome organization and limited divergence from the prototype MERDLVT isolate. Copyright © 2017 Elsevier B.V. All rights reserved.

Navigating the tip of the genomic iceberg: Next-generation sequencing for plant systematics.

PubMed

Straub, Shannon C K; Parks, Matthew; Weitemier, Kevin; Fishbein, Mark; Cronn, Richard C; Liston, Aaron

2012-02-01

Just as Sanger sequencing did more than 20 years ago, next-generation sequencing (NGS) is poised to revolutionize plant systematics. By combining multiplexing approaches with NGS throughput, systematists may no longer need to choose between more taxa or more characters. Here we describe a genome skimming (shallow sequencing) approach for plant systematics. Through simulations, we evaluated optimal sequencing depth and performance of single-end and paired-end short read sequences for assembly of nuclear ribosomal DNA (rDNA) and plastomes and addressed the effect of divergence on reference-guided plastome assembly. We also used simulations to identify potential phylogenetic markers from low-copy nuclear loci at different sequencing depths. We demonstrated the utility of genome skimming through phylogenetic analysis of the Sonoran Desert clade (SDC) of Asclepias (Apocynaceae). Paired-end reads performed better than single-end reads. Minimum sequencing depths for high quality rDNA and plastome assemblies were 40× and 30×, respectively. Divergence from the reference significantly affected plastome assembly, but relatively similar references are available for most seed plants. Deeper rDNA sequencing is necessary to characterize intragenomic polymorphism. The low-copy fraction of the nuclear genome was readily surveyed, even at low sequencing depths. Nearly 160000 bp of sequence from three organelles provided evidence of phylogenetic incongruence in the SDC. Adoption of NGS will facilitate progress in plant systematics, as whole plastome and rDNA cistrons, partial mitochondrial genomes, and low-copy nuclear markers can now be efficiently obtained for molecular phylogenetics studies.

The nucleotide sequence of Watermelon mosaic virus (WMV, Potyvirus) reveals interspecific recombination between two related potyviruses in the 5' part of the genome.

PubMed

Desbiez, C; Lecoq, H

2004-08-01

Watermelon mosaic virus (WMV, Potyvirus) is a potyvirus with a worldwide distribution, mostly in temperate and mediterranean regions. According to the partial sequences that were available, WMV appeared to share high sequence similarity with Soybean mosaic virus (SMV), and it was almost considered as a strain of SMV in spite of its different and much broader host range. Like SMV, it was also related to legume-infecting potyviruses belonging to the " Bean common mosaic virus (BCMV) subgroup". In this paper we obtained the full-length sequence of WMV, and we confirmed that this virus is very closely related to SMV in most of its genome; however, there is evidence for an interspecific recombination in the P1 protein, as the P1 of WMV was 135 amino-acids longer than that of SMV, and the N-terminal half of the P1 showed no relation to SMV but was 85% identical to BCMV. This suggests that WMV has emerged through an ancestral recombination event, and supports the distinction of WMV and SMV as separate taxonomic units.

Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

2003-06-01

OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally importantmore » for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.« less

RNA polymerase beta-subunit gene (rpoB) sequence analysis for the identification of Bacteroides spp.

PubMed

Ko, K S; Kuwahara, T; Haehwa, L; Yoon, Y-J; Kim, B-J; Lee, K-H; Ohnishi, Y; Kook, Y-H

2007-01-01

Partial rpoB sequences (317 bp) of 11 species of Bacteroides, two Porphyromonas spp. and two Prevotella spp. were compared to delineate the genetic relationships among Bacteroides and closely related anaerobic species. The high level of inter-species sequence dissimilarities (7.6-20.8%) allowed the various Bacteroides spp. to be distinguished. The position of the Bacteroides distasonis and Bacteriodes merdae cluster in the rpoB tree was different from the position in the 16S rRNA gene tree. Based on rpoB sequence similarity and clustering in the rpoB tree, it was possible to correctly re-identify 80 clinical isolates of Bacteroides. In addition to two subgroups, cfiA-negative (division I) and cfiA-positive (division II), of Bacteroides fragilis isolates, two distinct subgroups were also found among Bacteroides ovatus and Bacteroides thetaiotaomicron isolates. Bacteroides genus-specific rpoB PCR and B. fragilis species-specific rpoB PCR allowed Bacteroides spp. to be differentiated from Porphyromonas and Prevotella spp., and also allowed B. fragilis to be differentiated from other non-fragilisBacteroides spp. included in the present study.

Endosymbiont interference and microbial diversity of the Pacific coast tick, Dermacentor occidentalis, in San Diego County, California.

PubMed

Gurfield, Nikos; Grewal, Saran; Cua, Lynnie S; Torres, Pedro J; Kelley, Scott T

2017-01-01

The Pacific coast tick, Dermacentor occidentalis Marx, is found throughout California and can harbor agents that cause human diseases such as anaplasmosis, ehrlichiosis, tularemia, Rocky Mountain spotted fever and rickettsiosis 364D. Previous studies have demonstrated that nonpathogenic endosymbiotic bacteria can interfere with Rickettsia co-infections in other tick species. We hypothesized that within D. occidentalis ticks, interference may exist between different nonpathogenic endosymbiotic or nonendosymbiotic bacteria and Spotted Fever group Rickettsia (SFGR). Using PCR amplification and sequencing of the romp A gene and intergenic region we identified a cohort of SFGR-infected and non-infected D. occidentalis ticks collected from San Diego County. We then amplified a partial segment of the 16S rRNA gene and used next-generation sequencing to elucidate the microbiomes and levels of co-infection in the ticks. The SFGR R. philipii str. 364D and R. rhipicephali were detected in 2.3% and 8.2% of the ticks, respectively, via romp A sequencing. Interestingly, next generation sequencing revealed an inverse relationship between the number of Francisella- like endosymbiont (FLE) 16S rRNA sequences and Rickettsia 16S rRNA sequences within individual ticks that is consistent with partial interference between FLE and SFGR infecting ticks. After excluding the Rickettsia and FLE endosymbionts from the analysis, there was a small but significant difference in microbial community diversity and a pattern of geographic isolation by distance between collection locales. In addition, male ticks had a greater diversity of bacteria than female ticks and ticks that weren't infected with SFGR had similar microbiomes to canine skin microbiomes. Although experimental studies are required for confirmation, our findings are consistent with the hypothesis that FLEs and, to a lesser extent, other bacteria, interfere with the ability of D. occidentalis to be infected with certain SFGR. The results also raise interesting possibilities about the effects of putative vertebrate hosts on the tick microbiome.

HIP1 propagates in cyanobacterial DNA via nucleotide substitutions but promotes excision at similar frequencies in Escherichia coli and Synechococcus PCC 7942.

PubMed

Robinson, P J; Cranenburgh, R M; Head, I M; Robinson, N J

1997-04-01

The sequence 5'-GCGATCGC-3', designated HIP1, for highly iterated palindrome, was first identified at the borders of a gene-deletion event and subsequently shown to constitute up to 2.5% of the DNA in some cyanobacteria. It is now reported that HIP1 is polyphyletic, occurring in several distinct cyanobacterial lineages and not defining a clade. HIP1 does not introduce gaps into sequence alignments. It aligns with partial HIP1 sites in related sequences showing that it propagates by nucleotide substitutions rather than insertion. Constructs have been created to determine the frequencies at which deletion events occur between palindromes located within the selectable marker neo. Deletion between HIP1 sites was more frequent in Synechococcus PCC 7942 than deletion between control palindromes, 5'-CCGATCGG-3', designated PAL0. However, this is not due to a recombinase that recognises HIP1 and is peculiar to cyanobacteria because similar deletion frequencies were detected in Escherichia coli. Furthermore, the frequency of deletion of DNA flanked asymmetrically by one HIP1 site and one PAL0 site was less than the frequency of deletion of DNA flanked asymmetrically by identical copies of either palindrome. This is consistent with deletion by copy-choice.

Ursidibacter maritimus gen. nov., sp. nov. and Ursidibacter arcticus sp. nov., two new members of the family Pasteurellaceae isolated from the oral cavity of bears.

PubMed

Johanne Hansen, Mie; Strøm Braaten, Mira; Miki Bojesen, Anders; Christensen, Henrik; Sonne, Christian; Dietz, Rune; Frost Bertelsen, Mads

2015-10-01

Thirty-three suspected strains of the family Pasteurellaceae isolated from the oral cavity of polar and brown bears were characterized by genotypic and phenotypic tests. Phylogenetic analysis of partial 16S rRNA gene and rpoB sequences showed that the investigated isolates formed two closely related monophyletic groups, representing two novel species of a new genus. Based on 16S rRNA gene sequence comparison Bibersteinia trehalosi was the closest related species with a validly published name, with 95.4 % similarity to the polar bear group and 94.4 % similarity to the brown bear group. Otariodibacter oris was the closest related species based on rpoB sequence comparison with a similarity of 89.8 % with the polar bear group and 90 % with the brown bear group. The new genus could be separated from existing genera of the family Pasteurellaceae by three to ten phenotypic characters, and the two novel species could be separated from each other by two phenotypic characters. It is proposed that the strains should be classified as representatives of a new genus, Ursidibacter gen. nov., with two novel species: the type species Ursidibacter maritimus sp. nov., isolated from polar bears (type strain Pb43106T = CCUG 65144T = DSM 28137T, DNA G+C content 39.3 mol%), and Ursidibacter arcticus sp. nov., isolated from brown bears (type strain Bamse61T = CCUG 65145T = DSM 28138T).

Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

PubMed

Zhao, Ya-E; Wu, Li-Ping

2012-09-01

To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

Robust analysis of semiparametric renewal process models

PubMed Central

Lin, Feng-Chang; Truong, Young K.; Fine, Jason P.

2013-01-01

Summary A rate model is proposed for a modulated renewal process comprising a single long sequence, where the covariate process may not capture the dependencies in the sequence as in standard intensity models. We consider partial likelihood-based inferences under a semiparametric multiplicative rate model, which has been widely studied in the context of independent and identical data. Under an intensity model, gap times in a single long sequence may be used naively in the partial likelihood with variance estimation utilizing the observed information matrix. Under a rate model, the gap times cannot be treated as independent and studying the partial likelihood is much more challenging. We employ a mixing condition in the application of limit theory for stationary sequences to obtain consistency and asymptotic normality. The estimator's variance is quite complicated owing to the unknown gap times dependence structure. We adapt block bootstrapping and cluster variance estimators to the partial likelihood. Simulation studies and an analysis of a semiparametric extension of a popular model for neural spike train data demonstrate the practical utility of the rate approach in comparison with the intensity approach. PMID:24550568

Enteroaggregative Escherichia coli is the predominant diarrheagenic E. coli pathotype among irrigation water and food sources in South Africa.

PubMed

Aijuka, Matthew; Santiago, Araceli E; Girón, Jorge A; Nataro, James P; Buys, Elna M

2018-08-02

Diarrheagenic E. coli (DEC) has been implicated in foodborne outbreaks worldwide and have been associated with childhood stunting in the absence of diarrhoea. Infection is extraordinarily common, but the routes of transmission have not been determined. Therefore, determining the most prevalent pathotypes in food and environmental sources may help provide better guidance to various stakeholders in ensuring food safety and public health and advancing understanding of the epidemiology of enteric disease. We characterized 205 E. coli strains previously isolated from producer distributor bulk milk (PDBM)(118), irrigation water (48), irrigated lettuce (29) and street vendor coleslaw (10) in South Africa. Enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), enteroaggregative E. coli (EAEC) and diffusely adherent E. coli (DAEC) were sought. We used PCR and partial gene sequencing for all 205 strains while 46 out of 205 that showed poor resolution were subsequently characterized using cell adherence (HeLa cells). PCR and partial gene sequencing of aatA and/or aaiC genes confirmed EAEC (2%, 5 out of 205) as the only pathotype. Phylogenetic analysis of sequenced EAEC strains with E. coli strains in GenBank showing ≥80% nucleotide sequence similarity based on possession of aaiC and aatA generated distinct clusters of strains separated predominantly based on their source of isolation (food source or human stool) suggesting a potential role of virulence genes in source tracking. EAEC 24%, 11 out of 46 strains (PDBM = 15%, irrigation water = 7%, irrigated lettuce = 2%) was similarly the predominant pathotype followed by strains showing invasiveness to HeLa cells, 4%, 2 out of 46 (PDBM = 2%, irrigated lettuce = 2%), among stains characterized using cell adherence. Therefore, EAEC may be the leading cause of DEC associated food and water-borne enteric infection in South Africa. Additionally, solely using molecular based methods targeting virulence gene determinants may underestimate prevalence, especially among heterogeneous pathogens such as EAEC. Copyright © 2018 Elsevier B.V. All rights reserved.

Genetic characterization of L-Zagreb mumps vaccine strain.

PubMed

Ivancic, Jelena; Gulija, Tanja Kosutic; Forcic, Dubravko; Baricevic, Marijana; Jug, Renata; Mesko-Prejac, Majda; Mazuran, Renata

2005-04-01

Eleven mumps vaccine strains, all containing live attenuated virus, have been used throughout the world. Although L-Zagreb mumps vaccine has been licensed since 1972, only its partial nucleotide sequence was previously determined (accession numbers , and ). Therefore, we sequenced the entire genome of L-Zagreb vaccine strain (Institute of Immunology Inc., Zagreb, Croatia). In order to investigate the genetic stability of the vaccine, sequences of both L-Zagreb master seed and currently produced vaccine batch were determined and no difference between them was observed. A phylogenetic analysis based on SH gene sequence has shown that L-Zagreb strain does not belong to any of established mumps genotypes and that it is most similar to old, laboratory preserved European strains (1950s-1970s). L-Zagreb nucleotide and deduced protein sequences were compared with other mumps virus sequences obtained from the GenBank. Emphasis was put on functionally important protein regions and known antigenic epitopes. The extensive comparisons of nucleotide and deduced protein sequences between L-Zagreb vaccine strain and other previously determined mumps virus sequences have shown that while the functional regions of HN, V, and L proteins are well conserved among various mumps strains, there can be a substantial amino acid difference in antigenic epitopes of all proteins and in functional regions of F protein. No molecular pattern was identified that can be used as a distinction marker between virulent and attenuated strains.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

PubMed

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

PubMed Central

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

PubMed Central

Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

2015-01-01

The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

Cultivation of Hard-To-Culture Subsurface Mercury-Resistant Bacteria and Discovery of New merA Gene Sequences▿

PubMed Central

Rasmussen, L. D.; Zawadsky, C.; Binnerup, S. J.; Øregaard, G.; Sørensen, S. J.; Kroer, N.

2008-01-01

Mercury-resistant bacteria may be important players in mercury biogeochemistry. To assess the potential for mercury reduction by two subsurface microbial communities, resistant subpopulations and their merA genes were characterized by a combined molecular and cultivation-dependent approach. The cultivation method simulated natural conditions by using polycarbonate membranes as a growth support and a nonsterile soil slurry as a culture medium. Resistant bacteria were pregrown to microcolony-forming units (mCFU) before being plated on standard medium. Compared to direct plating, culturability was increased up to 2,800 times and numbers of mCFU were similar to the total number of mercury-resistant bacteria in the soils. Denaturing gradient gel electrophoresis analysis of DNA extracted from membranes suggested stimulation of growth of hard-to-culture bacteria during the preincubation. A total of 25 different 16S rRNA gene sequences were observed, including Alpha-, Beta-, and Gammaproteobacteria; Actinobacteria; Firmicutes; and Bacteroidetes. The diversity of isolates obtained by direct plating included eight different 16S rRNA gene sequences (Alpha- and Betaproteobacteria and Actinobacteria). Partial sequencing of merA of selected isolates led to the discovery of new merA sequences. With phylum-specific merA primers, PCR products were obtained for Alpha- and Betaproteobacteria and Actinobacteria but not for Bacteroidetes and Firmicutes. The similarity to known sequences ranged between 89 and 95%. One of the sequences did not result in a match in the BLAST search. The results illustrate the power of integrating advanced cultivation methodology with molecular techniques for the characterization of the diversity of mercury-resistant populations and assessing the potential for mercury reduction in contaminated environments. PMID:18441111

First description of Grapevine leafroll-associated virus 5 in Argentina and partial genome sequence.

PubMed

Gómez Talquenca, Sebastián; Muñoz, Claudio; Grau, Oscar; Gracia, Olga

2009-02-01

An accession of Vitis vinifera cv. Red Globe from Argentina, was found to be infected with Grapevine leafroll-associated virus-5 by ELISA. It was partially sequenced, and three ORFs, corresponding to HSP70h, HSP90h, and CP, were found. This isolate shares a high aminoacid identity with the previously reported sequence of the virus, and identities between 80% and 90% with previously reported GLRaV-9 and GLRaV-4 isolates. The analysis of the sequence supports the clustering together with GLRaV-4 and GLRV-9 inside the Ampelovirus genus.

Detection and identification of Rickettsia species in Ixodes tick populations from Estonia.

PubMed

Katargina, Olga; Geller, Julia; Ivanova, Anna; Värv, Kairi; Tefanova, Valentina; Vene, Sirkka; Lundkvist, Åke; Golovljova, Irina

2015-09-01

A total of 1640 ticks collected in different geographical parts of Estonia were screened for the presence of Rickettsia species DNA by real-time PCR. DNA of Rickettsia was detected in 83 out of 1640 questing ticks with an overall prevalence of 5.1%. The majority of the ticks infected by rickettsiae were Ixodes ricinus (74 of 83), while 9 of the 83 positive ticks were Ixodes persulcatus. For rickettsial species identification, a part of the citrate synthase gltA gene was sequenced. The majority of the positive samples were identified as Rickettsia helvetica (81 out of 83) and two of the samples were identified as Rickettsia monacensis and Candidatus R. tarasevichiae, respectively. Genetic characterization based on the partial gltA gene showed that the Estonian sequences within the R. helvetica, R. monacensis and Candidatus R. tarasevichiae species demonstrated 100% similarity with sequences deposited in GenBank, originating from Rickettsia species distributed over large territories from Europe to Asia. Copyright © 2015 Elsevier GmbH. All rights reserved.

Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

PubMed Central

Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

1990-01-01

Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

Fast and efficient search for MPEG-4 video using adjacent pixel intensity difference quantization histogram feature

NASA Astrophysics Data System (ADS)

Lee, Feifei; Kotani, Koji; Chen, Qiu; Ohmi, Tadahiro

2010-02-01

In this paper, a fast search algorithm for MPEG-4 video clips from video database is proposed. An adjacent pixel intensity difference quantization (APIDQ) histogram is utilized as the feature vector of VOP (video object plane), which had been reliably applied to human face recognition previously. Instead of fully decompressed video sequence, partially decoded data, namely DC sequence of the video object are extracted from the video sequence. Combined with active search, a temporal pruning algorithm, fast and robust video search can be realized. The proposed search algorithm has been evaluated by total 15 hours of video contained of TV programs such as drama, talk, news, etc. to search for given 200 MPEG-4 video clips which each length is 15 seconds. Experimental results show the proposed algorithm can detect the similar video clip in merely 80ms, and Equal Error Rate (ERR) of 2 % in drama and news categories are achieved, which are more accurately and robust than conventional fast video search algorithm.

A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

PubMed

Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

1994-12-01

We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

Hc-daf-2 encodes an insulin-like receptor kinase in the barber's pole worm, Haemonchus contortus, and restores partial dauer regulation.

PubMed

Li, Facai; Lok, James B; Gasser, Robin B; Korhonen, Pasi K; Sandeman, Mark R; Shi, Deshi; Zhou, Rui; Li, Xiangrui; Zhou, Yanqin; Zhao, Junlong; Hu, Min

2014-06-01

Infective L3s (iL3s) of parasitic nematodes share common behavioural, morphological and developmental characteristics with the developmentally arrested (dauer) larvae of the free-living nematode Caenorhabditis elegans. It is proposed that similar molecular mechanisms regulate entry into or exit from the dauer stage in C. elegans, and the transition from free-living to parasitic forms of parasitic nematodes. In C. elegans, one of the key factors regulating the dauer transition is the insulin-like receptor (designated Ce-DAF-2) encoded by the gene Ce-daf-2. However, nothing is known about DAF-2 homologues in most parasitic nematodes. Here, using a PCR-based approach, we identified and characterised a gene (Hc-daf-2) and its inferred product (Hc-DAF-2) in Haemonchus contortus (a socioeconomically important parasitic nematode of ruminants). The sequence of Hc-DAF-2 displays significant sequence homology to insulin receptors (IR) in both vertebrates and invertebrates, and contains conserved structural domains. A sequence encoding an important proteolytic motif (RKRR) identified in the predicted peptide sequence of Hc-DAF-2 is consistent with that of the human IR, suggesting that it is involved in the formation of the IR complex. The Hc-daf-2 gene was transcribed in all life stages of H. contortus, with a significant up-regulation in the iL3 compared with other stages. To compare patterns of expression between Hc-daf-2 and Ce-daf-2, reporter constructs fusing the Ce-daf-2 or Hc-daf-2 promoter to sequence encoding GFP were microinjected into the N2 strain of C. elegans, and transgenic lines were established and examined. Both genes showed similar patterns of expression in amphidial (head) neurons, which relate to sensation and signal transduction. Further study by heterologous genetic complementation in a daf-2-deficient strain of C. elegans (CB1370) showed partial rescue of function by Hc-daf-2. Taken together, these findings provide a first insight into the roles of Hc-daf-2/Hc-DAF-2 in the biology and development of H. contortus, particularly in the transition to parasitism. Copyright © 2014 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Unraveling the sequence and structure of the protein osteocalcin from a 42 ka fossil horse

NASA Astrophysics Data System (ADS)

Ostrom, Peggy H.; Gandhi, Hasand; Strahler, John R.; Walker, Angela K.; Andrews, Philip C.; Leykam, Joseph; Stafford, Thomas W.; Kelly, Robert L.; Walker, Danny N.; Buckley, Mike; Humpula, James

2006-04-01

We report the first complete amino acid sequence and evidence of secondary structure for osteocalcin from a temperate fossil. The osteocalcin derives from a 42 ka equid bone excavated from Juniper Cave, Wyoming. Results were determined by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-MS) and Edman sequencing with independent confirmation of the sequence in two laboratories. The ancient sequence was compared to that of three modern taxa: horse ( Equus caballus), zebra ( Equus grevyi), and donkey ( Equus asinus). Although there was no difference in sequence among modern taxa, MALDI-MS and Edman sequencing show that residues 48 and 49 of our modern horse are Thr, Ala rather than Pro, Val as previously reported (Carstanjen B., Wattiez, R., Armory, H., Lepage, O.M., Remy, B., 2002. Isolation and characterization of equine osteocalcin. Ann. Med. Vet.146(1), 31-38). MALDI-MS and Edman sequencing data indicate that the osteocalcin sequence of the 42 ka fossil is similar to that of modern horse. Previously inaccessible structural attributes for ancient osteocalcin were observed. Glu 39 rather than Gln 39 is consistent with deamidation, a process known to occur during fossilization and aging. Two post-translational modifications were documented: Hyp 9 and a disulfide bridge. The latter suggests at least partial retention of secondary structure. As has been done for ancient DNA research, we recommend standards for preparation and criteria for authenticating results of ancient protein sequencing.

DNA barcoding survey of Trichoderma diversity in soil and litter of the Colombian lowland Amazonian rainforest reveals Trichoderma strigosellum sp. nov. and other species.

PubMed

López-Quintero, Carlos A; Atanasova, Lea; Franco-Molano, A Esperanza; Gams, Walter; Komon-Zelazowska, Monika; Theelen, Bart; Müller, Wally H; Boekhout, Teun; Druzhinina, Irina

2013-11-01

The diversity of Trichoderma (Hypocreales, Ascomycota) colonizing leaf litter as well as the rhizosphere of Garcinia macrophylla (Clusiaceae) was investigated in primary and secondary rain forests in Colombian Amazonia. DNA barcoding of 107 strains based on the internal transcribed spacers 1 and 2 (ITS1 and 2) of the ribosomal RNA gene cluster and the partial sequence of the translation elongation factor 1 alpha (tef1) gene revealed that the diversity of Trichoderma was dominated (71 %) by three common cosmopolitan species, namely Trichoderma harzianum sensu lato (41 %), Trichoderma spirale (17 %) and Trichoderma koningiopsis (13 %). Four ITS 1 and 2 phylotypes (13 strains) could not be identified with certainty. Multigene phylogenetic analysis and phenotype profiling of four strains with an ITS1 and 2 phylotype similar to Trichoderma strigosum revealed a new sister species of the latter that is described here as Trichoderma strigosellum sp. nov. Sequence similarity searches revealed that this species also occurs in soils of Malaysia and Cameroon, suggesting a pantropical distribution.

A PRESTO-SENSE sequence with alternating partial-Fourier encoding for rapid susceptibility-weighted 3D MRI time series.

PubMed

Klarhöfer, Markus; Dilharreguy, Bixente; van Gelderen, Peter; Moonen, Chrit T W

2003-10-01

A 3D sequence for dynamic susceptibility imaging is proposed which combines echo-shifting principles (such as PRESTO), sensitivity encoding (SENSE), and partial-Fourier acquisition. The method uses a moderate SENSE factor of 2 and takes advantage of an alternating partial k-space acquisition in the "slow" phase encode direction allowing an iterative reconstruction using high-resolution phase estimates. Offering an isotropic spatial resolution of 4 x 4 x 4 mm(3), the novel sequence covers the whole brain including parts of the cerebellum in 0.5 sec. Its temporal signal stability is comparable to that of a full-Fourier, full-FOV EPI sequence having the same dynamic scan time but much less brain coverage. Initial functional MRI experiments showed consistent activation in the motor cortex with an average signal change slightly less than that of EPI. Copyright 2003 Wiley-Liss, Inc.

Characterization and Expression of the Lucina pectinata Oxygen and Sulfide Binding Hemoglobin Genes

PubMed Central

López-Garriga, Juan; Cadilla, Carmen L.

2016-01-01

The clam Lucina pectinata lives in sulfide-rich muds and houses intracellular symbiotic bacteria that need to be supplied with hydrogen sulfide and oxygen. This clam possesses three hemoglobins: hemoglobin I (HbI), a sulfide-reactive protein, and hemoglobin II (HbII) and III (HbIII), which are oxygen-reactive. We characterized the complete gene sequence and promoter regions for the oxygen reactive hemoglobins and the partial structure and promoters of the HbI gene from Lucina pectinata. We show that HbI has two mRNA variants, where the 5’end had either a sequence of 96 bp (long variant) or 37 bp (short variant). The gene structure of the oxygen reactive Hbs is defined by having 4-exons/3-introns with conservation of intron location at B12.2 and G7.0 and the presence of pre-coding introns, while the partial gene structure of HbI has the same intron conservation but appears to have a 5-exon/ 4-intron structure. A search for putative transcription factor binding sites (TFBSs) was done with the promoters for HbII, HbIII, HbI short and HbI long. The HbII, HbIII and HbI long promoters showed similar predicted TFBSs. We also characterized MITE-like elements in the HbI and HbII gene promoters and intronic regions that are similar to sequences found in other mollusk genomes. The gene expression levels of the clam Hbs, from sulfide-rich and sulfide-poor environments showed a significant decrease of expression in the symbiont-containing tissue for those clams in a sulfide-poor environment, suggesting that the sulfide concentration may be involved in the regulation of these proteins. Gene expression evaluation of the two HbI mRNA variants indicated that the longer variant is expressed at higher levels than the shorter variant in both environments. PMID:26824233

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene

PubMed Central

Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281

New record of Ascaridia nymphii (Secernentea: Ascaridiidae) from macaw parrot, Ara chloroptera, in China.

PubMed

Yang, Fang; Zhang, Pan; Shi, Xianli; Li, Kangxin; Wang, Minwei; Fu, Yeqi; Yan, Xinxin; Hang, Jianxiong; Li, Guoqing

2018-06-01

Present study was performed to identify the species of ascarids from macaw parrot, Ara chloroptera, in China. Total 6 ascarids (3 males and 3 females) were collected in the feces of 3 macaws at Guangzhou Zoo in Guangdong Province, China. Their morphological characteristics with dimensions were observed under a light microscope, and their genetic characters were analyzed with the partial 18S rDNA, ITS rDNA and nad4 gene sequences, respectively. Results showed that all worms have no interlabia but male worms have two alate spicules, well-developed precloacal sucker and a tail with ventrolateral caudal alae and 11 pairs of papillae. The partial 18S rDNA, ITS rDNA and nad4 sequences were 831bp, 1015bp and 394bp in length, respectively. They showed the highest similarity of 99.8% (18S rDNA) with Ascaridia nymphii, 93.8% identities (ITS rDNA) with A. columbae and 98.5% to 99.5% identities (nad4) with Ascaridia sp. from infected parrot. All Ascaridia nematodes from the macaws were clustered into one clade and formed monophyletic group of Ascaridia with A. columbae and A. galli in two phylogenetic trees. It is observed that the combining morphological and sequencing data from three loci, the present Ascaridia species was identified as Ascaridia nymphii, which is the first record of A. nymphii from macaw parrot in China. Copyright © 2018 Elsevier B.V. All rights reserved.

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

Analysis of the complete genome of the first Irkut virus isolate from China: comparison across the Lyssavirus genus.

PubMed

Liu, Ye; Li, Nan; Zhang, Shoufeng; Zhang, Fei; Lian, Hai; Wang, Ying; Zhang, Jinxia; Hu, Rongliang

2013-12-01

The genome of Irkut virus, isolate IRKV-THChina12, the first non-rabies lyssavirus from China (of bat origin), has been completely sequenced. In general, coding and non-coding regions of this viral genome are similar to those of other lyssaviruses. However, alignment of the deduced amino acid sequences of the structural proteins of IRKV-THChina12 with those of other lyssavirus representatives revealed significant variability between viral species. The nucleoprotein and matrix protein were found to be the most conserved, followed by the large protein, glycoprotein and phosphoprotein. Differences in the antigenic sites in glycoprotein may result in only partial protection of the available rabies biologics against Irkut virus, which is of particular concern for pre- and post-exposure rabies prophylaxis. Copyright © 2013 Elsevier Inc. All rights reserved.

COMPUTER SIMULATION STUDY OF AMYLOID FIBRIL FORMATION BY PALINDROMIC SEQUENCES IN PRION PEPTIDES

PubMed Central

Wagoner, Victoria; Cheon, Mookyung; Chang, Iksoo; Hall, Carol

2011-01-01

We simulate the aggregation of large systems containing palindromic peptides from the Syrian hamster prion protein SHaPrP 113–120 (AGAAAAGA) and the mouse prion protein MoPrP 111–120 (VAGAAAAGAV) and eight sequence variations: GAAAAAAG, (AG)4, A8, GAAAGAAA, A10, V10, GAVAAAAVAG, and VAVAAAAVAV The first two peptides are thought to act as the Velcro that holds the parent prion proteins together in amyloid structures and can form fibrils themselves. Kinetic events along the fibrillization pathway influence the types of structures that occur and variations in the sequence affect aggregation kinetics and fibrillar structure. Discontinuous molecular dynamics simulations using the PRIME20 force field are performed on systems containing 48 peptides starting from a random coil configuration. Depending on the sequence, fibrillar structures form spontaneously over a range of temperatures, below which amorphous aggregates form and above which no aggregation occurs. AGAAAAGA forms well organized fibrillar structures whereas VAGAAAAGAV forms less well organized structures that are partially fibrillar and partially amorphous. The degree of order in the fibrillar structure stems in part from the types of kinetic events leading up to its formation, with AGAAAAGA forming less amorphous structures early in the simulation than VAGAAAAGAV. The ability to form fibrils increases as the chain length and the length of the stretch of hydrophobic residues increase. However as the hydrophobicity of the sequence increases, the ability to form well-ordered structures decreases. Thus, longer hydrophobic sequences form slightly disordered aggregates that are partially fibrillar and partially amorphous. Subtle changes in sequence result in slightly different fibril structures. PMID:21557317

Blastocystis phylogeny among various isolates from humans to insects.

PubMed

Yoshikawa, Hisao; Koyama, Yukiko; Tsuchiya, Erika; Takami, Kazutoshi

2016-12-01

Blastocystis is a common unicellular eukaryotic parasite found not only in humans, but also in various kinds of animal species worldwide. Since Blastocystis isolates are morphologically indistinguishable, many molecular biological approaches have been applied to classify these isolates. The complete or partial sequences of the small subunit rRNA gene (SSU rDNA) are mainly used for comparisons and phylogenetic analyses among Blastocystis isolates. However, various lengths of the partial SSU rDNA sequence have been used for phylogenetic inference among genetically different isolates. Based on the complete SSU rDNA sequences, consensus terminology of nine subtypes (STs) of Blastocystis sp. that were supported by phylogenetically monophyletic nine clades was proposed in 2007. Thereafter, eight additional kinds of STs comprising non-human mammalian Blastocystis isolates have been reported based on the phylogeny of SSU rDNA sequences, while STs 11 and 12 were only proposed on the base of partial sequences. Although many sequence data from mammalian and avian Blastocystis are registered in GenBank, only limited data on SSU rDNA are available for poikilotherm-derived Blastocystis isolates. Therefore, the phylogenetic positions of the reptilian/amphibian Blastocystis clades are unstable. The phylogenetic inference of various STs comprising mammalian and/or avian Blastocystis isolates was verified herein based on comparisons between partial and complete SSU rDNA sequences, and the phylogenetic positions of reptilian and amphibian Blastocystis isolates were also investigated using 14 new Blastocystis isolates from reptiles with all known isolates from other reptilians, amphibians, and insects registered in GenBank. Copyright © 2016. Published by Elsevier Ireland Ltd.

Partial Gene Cloning and Enzyme Structure Modeling of Exolevanase Fragment from Bacillus subtilis

NASA Astrophysics Data System (ADS)

Azhar, M.; Natalia, D.; Syukur, S.; Andriani, N.; Jamsari, J.

2018-04-01

Inulin hydrolysis thermophilic and thermotolerant bacteria are potential sources of inulin hydrolysis enzymes. Partial gene that encodes inulin hydrolysis enzymes had been isolated from Bacillus subtilis using polymerase chain reaction (PCR) method with the DPE.slFandDPE.eR degenerative primers. The partial gene was cloned into pGEM-T Easy vector with E. coli as host cells and analyzed using BLASTx, CrustalW2, and Phyre2 programs. Size of thepartial gene had been found539 bp that encoded 179aminoacid residues of protein fragment. The sequences of protein fragment was more similar to exolevanase than exoinulinase. The protein fragment had conserved motif FSGS, and specific hits GH32 β-fructosidase. It had three residues of active site and five residues of substrate binding. The active site on the protein fragment were D (1-WLNDP-5), D (125-FRDPK-129) and E (177-WEC-179). Substrate binding on the protein fragment were ND (1-WLNDP-5), Q (18-FYQY-21), FS (60-FSGS-63) RD (125-FRDPK-129) and E (177-WEC-179).

Subgenome-specific assembly of vitamin E biosynthesis genes and expression patterns during seed development provide insight into the evolution of oat genome.

PubMed

Gutierrez-Gonzalez, Juan J; Garvin, David F

2016-11-01

Vitamin E is essential for humans and thus must be a component of a healthy diet. Among the cereal grains, hexaploid oats (Avena sativa L.) have high vitamin E content. To date, no gene sequences in the vitamin E biosynthesis pathway have been reported for oats. Using deep sequencing and orthology-guided assembly, coding sequences of genes for each step in vitamin E synthesis in oats were reconstructed, including resolution of the sequences of homeologs. Three homeologs, presumably representing each of the three oat subgenomes, were identified for the main steps of the pathway. Partial sequences, likely representing pseudogenes, were recovered in some instances as well. Pairwise comparisons among homeologs revealed that two of the three putative subgenome-specific homeologs are almost identical for each gene. Synonymous substitution rates indicate the time of divergence of the two more similar subgenomes from the distinct one at 7.9-8.7 MYA, and a divergence between the similar subgenomes from a common ancestor 1.1 MYA. A new proposed evolutionary model for hexaploid oat formation is discussed. Homeolog-specific gene expression was quantified during oat seed development and compared with vitamin E accumulation. Homeolog expression largely appears to be similar for most of genes; however, for some genes, homoeolog-specific transcriptional bias was observed. The expression of HPPD, as well as certain homoeologs of VTE2 and VTE4, is highly correlated with seed vitamin E accumulation. Our findings expand our understanding of oat genome evolution and will assist efforts to modify vitamin E content and composition in oats. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

ScaffoldSeq: Software for characterization of directed evolution populations.

PubMed

Woldring, Daniel R; Holec, Patrick V; Hackel, Benjamin J

2016-07-01

ScaffoldSeq is software designed for the numerous applications-including directed evolution analysis-in which a user generates a population of DNA sequences encoding for partially diverse proteins with related functions and would like to characterize the single site and pairwise amino acid frequencies across the population. A common scenario for enzyme maturation, antibody screening, and alternative scaffold engineering involves naïve and evolved populations that contain diversified regions, varying in both sequence and length, within a conserved framework. Analyzing the diversified regions of such populations is facilitated by high-throughput sequencing platforms; however, length variability within these regions (e.g., antibody CDRs) encumbers the alignment process. To overcome this challenge, the ScaffoldSeq algorithm takes advantage of conserved framework sequences to quickly identify diverse regions. Beyond this, unintended biases in sequence frequency are generated throughout the experimental workflow required to evolve and isolate clones of interest prior to DNA sequencing. ScaffoldSeq software uniquely handles this issue by providing tools to quantify and remove background sequences, cluster similar protein families, and dampen the impact of dominant clones. The software produces graphical and tabular summaries for each region of interest, allowing users to evaluate diversity in a site-specific manner as well as identify epistatic pairwise interactions. The code and detailed information are freely available at http://research.cems.umn.edu/hackel. Proteins 2016; 84:869-874. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Complete mitochondrial genomes of eleven extinct or possibly extinct bird species.

PubMed

Anmarkrud, Jarl A; Lifjeld, Jan T

2017-03-01

Natural history museum collections represent a vast source of ancient and historical DNA samples from extinct taxa that can be utilized by high-throughput sequencing tools to reveal novel genetic and phylogenetic information about them. Here, we report on the successful sequencing of complete mitochondrial genome sequences (mitogenomes) from eleven extinct bird species, using de novo assembly of short sequences derived from toepad samples of degraded DNA from museum specimens. For two species (the Passenger Pigeon Ectopistes migratorius and the South Island Piopio Turnagra capensis), whole mitogenomes were already available from recent studies, whereas for five others (the Great Auk Pinguinis impennis, the Imperial Woodpecker Campehilus imperialis, the Huia Heteralocha acutirostris, the Kauai Oo Moho braccathus and the South Island Kokako Callaeas cinereus), there were partial mitochondrial sequences available for comparison. For all seven species, we found sequence similarities of >98%. For the remaining four species (the Kamao Myadestes myadestinus, the Paradise Parrot Psephotellus pulcherrimus, the Ou Psittirostra psittacea and the Lesser Akialoa Akialoa obscura), there was no sequence information available for comparison, so we conducted blast searches and phylogenetic analyses to determine their phylogenetic positions and identify their closest extant relatives. These mitogenomes will be valuable for future analyses of avian phylogenetics and illustrate the importance of museum collections as repositories for genomics resources. © 2016 John Wiley & Sons Ltd.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

NASA Astrophysics Data System (ADS)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

PubMed

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-12-31

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

PubMed Central

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-01-01

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215

Some New Sets of Sequences of Fuzzy Numbers with Respect to the Partial Metric

PubMed Central

Ozluk, Muharrem

2015-01-01

In this paper, we essentially deal with Köthe-Toeplitz duals of fuzzy level sets defined using a partial metric. Since the utilization of Zadeh's extension principle is quite difficult in practice, we prefer the idea of level sets in order to construct some classical notions. In this paper, we present the sets of bounded, convergent, and null series and the set of sequences of bounded variation of fuzzy level sets, based on the partial metric. We examine the relationships between these sets and their classical forms and give some properties including definitions, propositions, and various kinds of partial metric spaces of fuzzy level sets. Furthermore, we study some of their properties like completeness and duality. Finally, we obtain the Köthe-Toeplitz duals of fuzzy level sets with respect to the partial metric based on a partial ordering. PMID:25695102

Constraining controls on carbonate sequences with high-resolution chronostratigraphy: Upper Miocene, Cabo de Gata region, SE Spain

USGS Publications Warehouse

Montgomery, P.; Farr, M.R.; Franseen, E.K.; Goldstein, R.H.

2001-01-01

A high-resolution chronostratigraphy has been developed for Miocene shallow-water carbonate strata in the Cabo de Gata region of SE Spain for evaluation of local, regional and global factors that controlled platform architecture prior to and during the Messinian salinity crisis. Paleomagnetic data were collected from strata at three localities. Mean natural remanent magnetization (NRM) ranges between 1.53 ?? 10-8 and 5.2 ?? 10-3 Am2/kg. Incremental thermal and alternating field demagnetization isolated the characteristic remanent magnetization (ChRM). Rock magnetic studies show that the dominant magnetic mineral is magnetite, but mixtures of magnetite and hematite occur. A composite chronostratigraphy was derived from five stratigraphic sections. Regional stratigraphic data, biostratigraphic data, and an 40Ar/39Ar date of 8.5 ?? 0.1 Ma, for an interbedded volcanic flow, place the strata in geomagnetic polarity Chrons C4r to C3r. Sequence-stratigraphic and diagenetic evidence indicate a major unconformity at the base of depositional sequence (DS)3 that contains a prograding reef complex, suggesting that approximately 250 000 yr of record (Subchrons C3Br.2r to 3Br.1r) are missing near the Messinian-Tortonian boundary. Correlation to the GPTS shows that the studied strata represent five third- to fourth-order DSs. Basal units are temperate to subtropical ramps (DS1A, DS1B, DS2); these are overlain by subtropical to tropical reefal platforms (DS3), which are capped by subtropical to tropical cyclic carbonates (Terminal Carbonate Complex, TCC). Correlation of the Cabo de Gata record to the Melilla area of Morocco, and the Sorbas basin of Spain indicate that early - Late Tortonian ramp strata from these areas are partially time-equivalent. Similar strata are extensively developed in the Western Mediterranean and likely were influenced by a cool climate or influx of nutrients during an overall rise in global sea-level. After ramp deposition, a sequence boundary (SB3) in Cabo de Gata correlates with a sequence boundary in Morocco and a published third-order eustatic fall suggesting at least a partial eustatic control for the sequence boundary. Coral reefs began to develop earlier in Cabo de Gata than at Melilla or Sorbas, arguing for local factors affecting this major environmental transition. Later Messinian reefs (DS3) from all areas are time-equivalent, suggesting a regional or global control on their formation. Some Halimeda-rich horizons in the Western Mediterranean are not time-equivalent event strata as hypothesized by others. Correlation of the relative sea-level curve for the fringing reef complex (DS3) with a published eustatic curve suggests at least a partial third-order global eustatic control for the highstand part of the sequence. Downstepping DS3 reefs and initial subaerial exposure of earlier DS3 reef strata approximately correlate with initiation of a series of subaerial unconformities in the South Pacific. The longer-term relative fall in sea-level during DS3 downstepping reef progradation does not correlate with a published third-order eustatic fall. Eustatic sea-level fluctuations may have been associated with initiation of the Mediterranean Messinian salinity crisis, but the longer-term fall may have been linked to tectonic uplift in the Mediterranean region. Widespread distribution of 'TCC-style' cycles of approximately the same age suggests a regional (Western Mediterranean) or global control on sea-level change responsible for TCC cycles. In addition, four subaerial exposure-capped TCC cycles may correlate with similar subaerial unconformities in the South Pacific, suggesting at least a partial eustatic control on TCC cyclicity. The high rates of relative sea-level change needed to generate a minimum of 25-30 m sea-level changes associated with each cycle are consistent with glacio-eustacy along with rapid evaporitic drawdown in the Mediterranean. ?? 2001 Elsevier Science B.V. All rights reserved.

Comparison of physical chewing measures to consumer typed Mouth Behavior.

PubMed

Wilson, Arran; Jeltema, Melissa; Morgenstern, Marco P; Motoi, Lidia; Kim, Esther; Hedderley, Duncan

2018-06-01

The purpose of this study was to investigate the hypotheses that when presented with foods that could be chewed in different ways, (1) are participants jaw movements and chewing sequence measures correlated with Mouth Behavior (MB) group, as measured by the JBMB typing tool? (2) can MB group membership can be predicted from jaw movement and chewing sequence measures? One hundred subjects (69 female and 31 male, mean age 27 ± 7.7 years) were given four different foods (Mentos, Walkers, Cheetos Puffs, Twix) and video recordings of their jaw movements made. Twenty-nine parameters were calculated on each chewing sequence with 27 also calculated for the first half and second half of chewing sequence. Subjects were assigned to a MB group using the JBMB typing tool which gives four MB groups ("Chewers," "Crunchers," "Smooshers," and "Suckers"). The differences between individual chewing parameters and MB group were assessed with analysis of variance which showed only small differences in average chewing parameters between the MB groups. By using discriminant analysis, it was possible to partially discriminate between MB groups based on changes in their chewing parameters between foods with different material properties and stages of the chewing. A 19-variable model correctly predicted 68% of the subjects' membership of a MB group. This partially confirms our first hypothesis that when presented with foods that could be chewed in different ways participants will use a chewing sequence and jaw movements that correlate with their MB as measured by the JBMB typing tool. The way consumers chew their food has an impact on their texture perception of that food. While there is a wide range of chewing behaviors between consumers, they can be grouped into broad categories to better target both product design and product testing by sensory panel. In this study, consumers who were grouped on their texture preference (MB group) had jaw movements, when chewing a range of foods, which partially reflected group membership. Therefore, while MB group membership could not be predicted from jaw movement measurements, there were similarities in jaw movements within the members of the groups. A better understanding of how jaw movement during chewing relates to consumer sensory perception would aid in new solid product design with controlled textural attributes. © 2018 Wiley Periodicals, Inc.

Molecular detection of Rickettsia species in ticks collected from the southwestern provinces of the Republic of Korea.

PubMed

Noh, Yoontae; Lee, Yeong Seon; Kim, Heung-Chul; Chong, Sung-Tae; Klein, Terry A; Jiang, Ju; Richards, Allen L; Lee, Hae Kyeong; Kim, Su Yeon

2017-01-10

Rickettsiae constitute a group of arthropod-borne, Gram-negative, obligate intracellular bacteria that are the causative agents of diseases ranging from mild to life threatening that impact on medical and veterinary health worldwide. A total of 6,484 ticks were collected by tick drag from June-October 2013 in the southwestern provinces of the Republic of Korea (ROK) (Jeollanam, n = 3,995; Jeollabuk, n = 680; Chungcheongnam, n = 1,478; and Chungcheongbuk, n = 331). Ticks were sorted into 311 pools according to species, collection site, and stage of development. DNA preparations of tick pools were assayed for rickettsiae by 17 kDa antigen gene and ompA nested PCR (nPCR) assays and the resulting amplicons sequenced to determine the identity and prevalence of spotted fever group rickettsiae (SFGR). Haemaphysalis longicornis (4,471; 52 adults, 123 nymphs and 4,296 larvae) were the most commonly collected ticks, followed by Haemaphysalis flava (1,582; 28 adults, 263 nymphs and 1,291 larvae), and Ixodes nipponensis (431; 25 adults, 5 nymphs and 401 larvae). The minimum field infection rate/100 ticks (assuming 1 positive tick/pool) was 0.93% for the 17 kDa antigen gene and 0.82% for the ompA nPCR assays. The partial 17 kDa antigen and ompA gene sequences from positive pools of H. longicornis were similar to: Rickettsia sp. HI550 (99.4-100%), Rickettsia sp. FUJ98 (99.3-100%), Rickettsia sp. HIR/D91 (99.3-100%), and R. japonica (99.7%). One sequence of the partial 17 kDa antigen gene for H. flava was similar to Rickettsia sp. 17kd-005 (99.7%), while seven sequences of the 17 kDa antigen gene obtained from I. nipponensis ticks were similar to R. monacensis IrR/Munich (98.7-100%) and Rickettsia sp. IRS3 (98.9%). SFG rickettsiae were detected in three species of ixodid ticks collected in the southwestern provinces of the ROK during 2013. A number of rickettsiae have been recently reported from ticks in Korea, some of which were identified as medically important. Results from this study and previous reports demonstrate the need to conduct longitudinal investigations to identify tick-borne rickettsiae and better understand their geographical distributions and potential impact on medical and veterinary health, in addition to risk communication and development of rickettsial disease prevention strategies.

Sparse orthogonal population representation of spatial context in the retrosplenial cortex.

PubMed

Mao, Dun; Kandler, Steffen; McNaughton, Bruce L; Bonin, Vincent

2017-08-15

Sparse orthogonal coding is a key feature of hippocampal neural activity, which is believed to increase episodic memory capacity and to assist in navigation. Some retrosplenial cortex (RSC) neurons convey distributed spatial and navigational signals, but place-field representations such as observed in the hippocampus have not been reported. Combining cellular Ca 2+ imaging in RSC of mice with a head-fixed locomotion assay, we identified a population of RSC neurons, located predominantly in superficial layers, whose ensemble activity closely resembles that of hippocampal CA1 place cells during the same task. Like CA1 place cells, these RSC neurons fire in sequences during movement, and show narrowly tuned firing fields that form a sparse, orthogonal code correlated with location. RSC 'place' cell activity is robust to environmental manipulations, showing partial remapping similar to that observed in CA1. This population code for spatial context may assist the RSC in its role in memory and/or navigation.Neurons in the retrosplenial cortex (RSC) encode spatial and navigational signals. Here the authors use calcium imaging to show that, similar to the hippocampus, RSC neurons also encode place cell-like activity in a sparse orthogonal representation, partially anchored to the allocentric cues on the linear track.

On Asymptotically Good Ramp Secret Sharing Schemes

NASA Astrophysics Data System (ADS)

Geil, Olav; Martin, Stefano; Martínez-Peñas, Umberto; Matsumoto, Ryutaroh; Ruano, Diego

Asymptotically good sequences of linear ramp secret sharing schemes have been intensively studied by Cramer et al. in terms of sequences of pairs of nested algebraic geometric codes. In those works the focus is on full privacy and full reconstruction. In this paper we analyze additional parameters describing the asymptotic behavior of partial information leakage and possibly also partial reconstruction giving a more complete picture of the access structure for sequences of linear ramp secret sharing schemes. Our study involves a detailed treatment of the (relative) generalized Hamming weights of the considered codes.

Bellerophon: A program to detect chimeric sequences in multiple sequence alignments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2003-12-23

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.

16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

PubMed

Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

2013-12-01

Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

Retrospective study reveals the circulation of norovirus genotype GII.P21-GII.2 in Romania

PubMed

Dinu, Sorin; Szmal, Camelia; Damian, Maria; Oprişan, Gabriela

2016-01-01

Noroviruses are the leading cause of acute gastroenteritis, causing significant economic burden globally. Infection is self-limiting, occurring as sporadic cases or producing outbreaks associated with consumption of contaminated water or food. All age groups are affected and person to person transmission is frequent. Except a recent outbreak in Romania caused by the emergent genotype GII.P17-GII.17, few data regarding the circulation of noroviruses in our country are available. We retrospectively analyzed stool samples from acute gastroenteritis patients hospitalized in Romania between 2005 and 2008. Noroviruses were detected by RT-PCR and phylogenetic analysis was inferred from partial sequences spanning ORF1 and ORF2. Recombinant GII.P21-GII.2 isolates were found in two adult patients from a cluster of acute gastroenteritis in 2006. Molecular analysis based on partial genomic sequences indicated high degree of similarity between the two isolates and grouped them with cosmopolitan strains circulating in the same period of time. Along with the high rate of mutation, recombination is an important driving force in norovirus evolution. GII.P21 isolates, formerly known as GII.b recombinants, have been detected in Europe since 2000 and associated with sporadic cases and outbreaks of gastroenteritis worldwide. This is the first work describing norovirus GII.P21-GII.2 identified in Romania.

Genetic Characterization of a Panel of Diverse HIV-1 Isolates at Seven International Sites

PubMed Central

Chen, Yue; Sanchez, Ana M.; Sabino, Ester; Hunt, Gillian; Ledwaba, Johanna; Hackett, John; Swanson, Priscilla; Hewlett, Indira; Ragupathy, Viswanath; Vikram Vemula, Sai; Zeng, Peibin; Tee, Kok-Keng; Chow, Wei Zhen; Ji, Hezhao; Sandstrom, Paul; Denny, Thomas N.; Busch, Michael P.; Gao, Feng

2016-01-01

HIV-1 subtypes and drug resistance are routinely tested by many international surveillance groups. However, results from different sites often vary. A systematic comparison of results from multiple sites is needed to determine whether a standardized protocol is required for consistent and accurate data analysis. A panel of well-characterized HIV-1 isolates (N = 50) from the External Quality Assurance Program Oversight Laboratory (EQAPOL) was assembled for evaluation at seven international sites. This virus panel included seven subtypes, six circulating recombinant forms (CRFs), nine unique recombinant forms (URFs) and three group O viruses. Seven viruses contained 10 major drug resistance mutations (DRMs). HIV-1 isolates were prepared at a concentration of 107 copies/ml and compiled into blinded panels. Subtypes and DRMs were determined with partial or full pol gene sequences by conventional Sanger sequencing and/or Next Generation Sequencing (NGS). Subtype and DRM results were reported and decoded for comparison with full-length genome sequences generated by EQAPOL. The partial pol gene was amplified by RT-PCR and sequenced for 89.4%-100% of group M viruses at six sites. Subtyping results of majority of the viruses (83%-97.9%) were correctly determined for the partial pol sequences. All 10 major DRMs in seven isolates were detected at these six sites. The complete pol gene sequence was also obtained by NGS at one site. However, this method missed six group M viruses and sequences contained host chromosome fragments. Three group O viruses were only characterized with additional group O-specific RT-PCR primers employed by one site. These results indicate that PCR protocols and subtyping tools should be standardized to efficiently amplify diverse viruses and more consistently assign virus genotypes, which is critical for accurate global subtype and drug resistance surveillance. Targeted NGS analysis of partial pol sequences can serve as an alternative approach, especially for detection of low-abundance DRMs. PMID:27314585

Genetic Characterization of a Panel of Diverse HIV-1 Isolates at Seven International Sites.

PubMed

Hora, Bhavna; Keating, Sheila M; Chen, Yue; Sanchez, Ana M; Sabino, Ester; Hunt, Gillian; Ledwaba, Johanna; Hackett, John; Swanson, Priscilla; Hewlett, Indira; Ragupathy, Viswanath; Vikram Vemula, Sai; Zeng, Peibin; Tee, Kok-Keng; Chow, Wei Zhen; Ji, Hezhao; Sandstrom, Paul; Denny, Thomas N; Busch, Michael P; Gao, Feng

2016-01-01

HIV-1 subtypes and drug resistance are routinely tested by many international surveillance groups. However, results from different sites often vary. A systematic comparison of results from multiple sites is needed to determine whether a standardized protocol is required for consistent and accurate data analysis. A panel of well-characterized HIV-1 isolates (N = 50) from the External Quality Assurance Program Oversight Laboratory (EQAPOL) was assembled for evaluation at seven international sites. This virus panel included seven subtypes, six circulating recombinant forms (CRFs), nine unique recombinant forms (URFs) and three group O viruses. Seven viruses contained 10 major drug resistance mutations (DRMs). HIV-1 isolates were prepared at a concentration of 107 copies/ml and compiled into blinded panels. Subtypes and DRMs were determined with partial or full pol gene sequences by conventional Sanger sequencing and/or Next Generation Sequencing (NGS). Subtype and DRM results were reported and decoded for comparison with full-length genome sequences generated by EQAPOL. The partial pol gene was amplified by RT-PCR and sequenced for 89.4%-100% of group M viruses at six sites. Subtyping results of majority of the viruses (83%-97.9%) were correctly determined for the partial pol sequences. All 10 major DRMs in seven isolates were detected at these six sites. The complete pol gene sequence was also obtained by NGS at one site. However, this method missed six group M viruses and sequences contained host chromosome fragments. Three group O viruses were only characterized with additional group O-specific RT-PCR primers employed by one site. These results indicate that PCR protocols and subtyping tools should be standardized to efficiently amplify diverse viruses and more consistently assign virus genotypes, which is critical for accurate global subtype and drug resistance surveillance. Targeted NGS analysis of partial pol sequences can serve as an alternative approach, especially for detection of low-abundance DRMs.

Analysis of sequences from field samples reveals the presence of the recently described pepper vein yellows virus (genus Polerovirus) in six additional countries.

PubMed

Knierim, Dennis; Tsai, Wen-Shi; Kenyon, Lawrence

2013-06-01

Polerovirus infection was detected by reverse transcription polymerase chain reaction (RT-PCR) in 29 pepper plants (Capsicum spp.) and one black nightshade plant (Solanum nigrum) sample collected from fields in India, Indonesia, Mali, Philippines, Thailand and Taiwan. At least two representative samples for each country were selected to generate a general polerovirus RT-PCR product of 1.4 kb length for sequencing. Sequence analysis of the partial genome sequences revealed the presence of pepper vein yellows virus (PeVYV) in all 13 samples. A 1990 Australian herbarium sample of pepper described by serological means as infected with capsicum yellows virus (CYV) was identified by sequence analysis of a partial CP sequence as probably infected with a potato leaf roll virus (PLRV) isolate.

Knowing the future: partial foreknowledge effects on the programming of prosaccades and antisaccades.

PubMed

Abegg, Mathias; Manoach, Dara S; Barton, Jason J S

2011-01-01

Foreknowledge about the demands of an upcoming trial may be exploited to optimize behavioural responses. In the current study we systematically investigated the benefits of partial foreknowledge--that is, when some but not all aspects of a future trial are known in advance. For this we used an ocular motor paradigm with horizontal prosaccades and antisaccades. Predictable sequences were used to create three partial foreknowledge conditions: one with foreknowledge about the stimulus location only, one with foreknowledge about the task set only, and one with foreknowledge about the direction of the required response only. These were contrasted with a condition of no-foreknowledge and a condition of complete foreknowledge about all three parameters. The results showed that the three types of foreknowledge affected saccadic efficiency differently. While foreknowledge about stimulus-location had no effect on efficiency, task foreknowledge had some effect and response-foreknowledge was as effective as complete foreknowledge. Foreknowledge effects on switch costs followed a similar pattern in general, but were not specific for switching of the trial attribute for which foreknowledge was available. We conclude that partial foreknowledge has a differential effect on efficiency, most consistent with preparatory activation of a motor schema in advance of the stimulus, with consequent benefits for both switched and repeated trials. Copyright © 2010 Elsevier Ltd. All rights reserved.

Genetic relationships among Hylocereus and Selenicereus vine cacti (Cactaceae): evidence from hybridization and cytological studies.

PubMed

Tel-Zur, Noemi; Abbo, Shahal; Bar-Zvi, Dudy; Mizrahi, Yosef

2004-10-01

Hylocereus and Selenicereus are native to tropical and sub-tropical America. Based on its taxonomic status and crossability relations it was postulated that H. megalanthus (syn. S. megalanthus) is an allotetraploid (2n = 4x = 44) derived from natural hybridization between two closely related diploid taxa. The present work aimed at elucidating the genetic relationships between species of the two genera. Crosses were performed and the putative hybrids were analysed by chromosome counts and morphological traits. The ploidy level of hybrids was confirmed by fluorescent in situ hybridization (FISH) of rDNA sites. Genomic in situ hybridization (GISH) was used in an attempt to identify the putative diploid genome donors of H. megalanthus and an artificial interploid hybrid. Reciprocal crosses among four diploid Hylocereus species (H. costaricensis, H. monacanthus (syn. H. polyrhizus), H. undatus and Hylocereus sp.) yielded viable diploid hybrids, with regular chromosome pairing. Reciprocal crosses between these Hylocereus spp. and H. megalanthus yielded viable triploid, pentaploid, hexaploid and aneuploid hybrids. Morphological and phenological traits confirm the hybrid origin. In situ detection of rDNA sites was in accord with the ploidy status of the species and hybrid studied. GISH results indicated that overall sequence composition of H. megalanthus is similar to that of H. ocamponis and S. grandiflorus. High sequence similarity was also found between the parental genomes of H. monacanthus and H. megalanthus in one triploid hybrid. The ease of obtaining partially fertile F1 hybrids and the relative sequence similarity (in GISH study) suggest close genetic relationships among the taxa analysed.

Brunenders: a partially attenuated historic poliovirus type I vaccine strain.

PubMed

Sanders, Barbara P; Liu, Ying; Brandjes, Alies; van Hoek, Vladimir; de Los Rios Oakes, Isabel; Lewis, John; Wimmer, Eckard; Custers, Jerome H H V; Schuitemaker, Hanneke; Cello, Jeronimo; Edo-Matas, Diana

2015-09-01

Brunenders, a type I poliovirus (PV) strain, was developed in 1952 by J. F. Enders and colleagues through serial in vitro passaging of the parental Brunhilde strain, and was reported to display partial neuroattenuation in monkeys. This phenotype of attenuation encouraged two vaccine manufacturers to adopt Brunenders as the type I component for their inactivated poliovirus vaccines (IPVs) in the 1950s, although today no licensed IPV vaccine contains Brunenders. Here we confirmed, in a transgenic mouse model, the report of Enders on the reduced neurovirulence of Brunenders. Although dramatically neuroattenuated relative to WT PV strains, Brunenders remains more virulent than the attenuated oral vaccine strain, Sabin 1. Importantly, the neuroattenuation of Brunenders does not affect in vitro growth kinetics and in vitro antigenicity, which were similar to those of Mahoney, the conventional type I IPV vaccine strain. We showed, by full nucleotide sequencing, that Brunhilde and Brunenders differ at 31 nucleotides, eight of which lead to amino acid changes, all located in the capsid. Upon exchanging the Brunenders capsid sequence with that of the Mahoney capsid, WT neurovirulence was regained in vivo, suggesting a role for the capsid mutations in Brunenders attenuation. To date, as polio eradication draws closer, the switch to using attenuated strains for IPV is actively being pursued. Brunenders preceded this novel strategy as a partially attenuated IPV strain, accompanied by decades of successful use in the field. Providing data on the attenuation of Brunenders may be of value in the further construction of attenuated PV strains to support the grand pursuit of the global eradication of poliomyelitis.

Diversity in VP3, NSP3, and NSP4 of rotavirus B detected from Japanese cattle.

PubMed

Hayashi-Miyamoto, Michiko; Murakami, Toshiaki; Minami-Fukuda, Fujiko; Tsuchiaka, Shinobu; Kishimoto, Mai; Sano, Kaori; Naoi, Yuki; Asano, Keigo; Ichimaru, Toru; Haga, Kei; Omatsu, Tsutomu; Katayama, Yukie; Oba, Mami; Aoki, Hiroshi; Shirai, Junsuke; Ishida, Motohiko; Katayama, Kazuhiko; Mizutani, Tetsuya; Nagai, Makoto

2017-04-01

Bovine rotavirus B (RVB) is an etiological agent of diarrhea mostly in adult cattle. Currently, a few sequences of viral protein (VP)1, 2, 4, 6, and 7 and nonstructural protein (NSP)1, 2, and 5 of bovine RVB are available in the DDBJ/EMBL/GenBank databases, and none have been reported for VP3, NSP3, and NSP4. In order to fill this gap in the genetic characterization of bovine RVB strains, we used a metagenomics approach and sequenced and analyzed the complete coding sequences (CDS) of VP3, NSP3, and NSP4 genes, as well as the partial or complete CDS of other genes of RVBs detected from Japanese cattle. VP3, NSP3, and NSP4 of bovine RVBs shared low nucleotide sequence identities (63.3-64.9% for VP3, 65.9-68.2% for NSP3, and 52.6-56.2% for NSP4) with those of murine, human, and porcine RVBs, suggesting that bovine RVBs belong to a novel genotype. Furthermore, significantly low amino acid sequence identities were observed for NSP4 (36.1-39.3%) between bovine RVBs and the RVBs of other species. In contrast, hydrophobic plot analysis of NSP4 revealed profiles similar to those of RVBs of other species and rotavirus A (RVA) strains. Phylogenetic analyses of all gene segments revealed that bovine RVB strains formed a cluster that branched distantly from other RVBs. These results suggest that bovine RVBs have evolved independently from other RVBs but in a similar manner to other rotaviruses. These findings provide insights into the evolution and diversity of RVB strains. Copyright © 2017 Elsevier B.V. All rights reserved.

Serratia aquatilis sp. nov., isolated from drinking water systems.

PubMed

Kämpfer, Peter; Glaeser, Stefanie P

2016-01-01

A cream-white-pigmented, oxidase-negative bacterium (strain 2015-2462-01T), isolated from a drinking water system, was investigated in detail to determine its taxonomic position. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain 2015-2462-01T with sequences of the type strains of closely related species of the genus Serratia revealed highest similarity to Serratia fonticola (98.4 %), Serratia proteamaculans (97.8 %), Serratia liquefaciens and Serratia grimesii (both 97.7 %). 16S rRNA gene sequence similarities to all other Serratia species were below 97.4 %. Multilocus sequence analysis (MLSA) on the basis of concatenated partial gyrB, rpoB, infB and atpD gene sequences showed a clear distinction of strain 2015-2462-01T from the type strains of the closest related Serratia species. The fatty acid profile of the strain consisted of C16 : 1 ω7c, C16 : 0; C14 : 0 and C14 : 0 3-OH/iso-C16 : 1 I as major components. DNA-DNA hybridizations between 2015-2462-01T and S. fonticola ATCC 29844T resulted in a relatedness value of 27 % (reciprocal 20 %). This DNA-DNA hybridization result in combination with the MLSA results and the differential biochemical properties indicated that strain 2015-2462-01T represents a novel species of the genus Serratia, for which the name Serratia aquatilis sp. nov. is proposed. The type strain is 2015-2462-01T ( = LMG 29119T = CCM 8626T).

Comprehensive Insights in the Mycobacterium avium subsp. paratuberculosis Genome Using New WGS Data of Sheep Strain JIII-386 from Germany

PubMed Central

Möbius, Petra; Hölzer, Martin; Felder, Marius; Nordsiek, Gabriele; Groth, Marco; Köhler, Heike; Reichwald, Kathrin; Platzer, Matthias; Marz, Manja

2015-01-01

Mycobacterium avium (M. a.) subsp. paratuberculosis (MAP)—the etiologic agent of Johne’s disease—affects cattle, sheep, and other ruminants worldwide. To decipher phenotypic differences among sheep and cattle strains (belonging to MAP-S [Type-I/III], respectively, MAP-C [Type-II]), comparative genome analysis needs data from diverse isolates originating from different geographic regions of the world. This study presents the so far best assembled genome of a MAP-S-strain: Sheep isolate JIII-386 from Germany. One newly sequenced cattle isolate (JII-1961, Germany), four published MAP strains of MAP-C and MAP-S from the United States and Australia, and M. a. subsp. hominissuis (MAH) strain 104 were used for assembly improvement and comparisons. All genomes were annotated by BacProt and results compared with NCBI (National Center for Biotechnology Information) annotation. Corresponding protein-coding sequences (CDSs) were detected, but also CDSs that were exclusively determined by either NCBI or BacProt. A new Shine–Dalgarno sequence motif (5′-AGCTGG-3′) was extracted. Novel CDSs including PE-PGRS family protein genes and about 80 noncoding RNAs exhibiting high sequence conservation are presented. Previously found genetic differences between MAP-types are partially revised. Four of ten assumed MAP-S-specific large sequence polymorphism regions (LSPSs) are still present in MAP-C strains; new LSPSs were identified. Independently of the regional origin of the strains, the number of individual CDSs and single nucleotide variants confirms the strong similarity of MAP-C strains and shows higher diversity among MAP-S strains. This study gives ambiguous results regarding the hypothesis that MAP-S is the evolutionary intermediate between MAH and MAP-C, but it clearly shows a higher similarity of MAP to MAH than to Mycobacterium intracellulare. PMID:26384038

The central domain of bovine submaxillary mucin consists of over 50 tandem repeats of 329 amino acids. Chromosomal localization of the BSM1 gene and relations to ovine and porcine counterparts.

PubMed

Jiang, W; Gupta, D; Gallagher, D; Davis, S; Bhavanandan, V P

2000-04-01

We previously elucidated five distinct protein domains (I-V) for bovine submaxillary mucin, which is encoded by two genes, BSM1 and BSM2. Using Southern blot analysis, genomic cloning and sequencing of the BSM1 gene, we now show that the central domain (V) consists of approximately 55 tandem repeats of 329 amino acids and that domains III-V are encoded by a 58.4-kb exon, the largest exon known for all genes to date. The BSM1 gene was mapped by fluorescence in situ hybridization to the proximal half of chromosome 5 at bands q2. 2-q2.3. The amino-acid sequence of six tandem repeats (two full and four partial) were found to have only 92-94% identities. We propose that the variability in the amino-acid sequences of the mucin tandem repeat is important for generating the combinatorial library of saccharides that are necessary for the protective function of mucins. The deduced peptide sequences of the central domain match those determined from the purified bovine submaxillary mucin and also show 68-94% identity to published peptide sequences of ovine submaxillary mucin. This indicates that the core protein of ovine submaxillary mucin is closely related to that of bovine submaxillary mucin and contains similar tandem repeats in the central domain. In contrast, the central domain of porcine submaxillary mucin is reported to consist of 81-amino-acid tandem repeats. However, both bovine submaxillary mucin and porcine submaxillary mucin contain similar N-terminal and C-terminal domains and the corresponding genes are in the conserved linkage regions of the respective genomes.

RNA regulators responding to ribosomal protein S15 are frequent in sequence space

PubMed Central

Slinger, Betty L.; Meyer, Michelle M.

2016-01-01

There are several natural examples of distinct RNA structures that interact with the same ligand to regulate the expression of homologous genes in different organisms. One essential question regarding this phenomenon is whether such RNA regulators are the result of convergent or divergent evolution. Are the RNAs derived from some common ancestor and diverged to the point where we cannot identify the similarity, or have multiple solutions to the same biological problem arisen independently? A key variable in assessing these alternatives is how frequently such regulators arise within sequence space. Ribosomal protein S15 is autogenously regulated via an RNA regulator in many bacterial species; four apparently distinct regulators have been functionally validated in different bacterial phyla. Here, we explore how frequently such regulators arise within a partially randomized sequence population. We find many RNAs that interact specifically with ribosomal protein S15 from Geobacillus kaustophilus with biologically relevant dissociation constants. Furthermore, of the six sequences we characterize, four show regulatory activity in an Escherichia coli reporter assay. Subsequent footprinting and mutagenesis analysis indicates that protein binding proximal to regulatory features such as the Shine–Dalgarno sequence is sufficient to enable regulation, suggesting that regulation in response to S15 is relatively easily acquired. PMID:27580716

Coxiella Detection in Ticks from Wildlife and Livestock in Malaysia

PubMed Central

Khoo, Jing-Jing; Lim, Fang-Shiang; Chen, Fezshin; Phoon, Wai-Hong; Khor, Chee-Sieng; Pike, Brian L.; Chang, Li-Yen

2016-01-01

Abstract Recent studies have shown that ticks harbor Coxiella-like bacteria, which are potentially tick-specific endosymbionts. We recently described the detection of Coxiella-like bacteria and possibly Coxiella burnetii in ticks found from rural areas in Malaysia. In the present study, we collected ticks, including Haemaphysalis bispinosa, Haemaphysalis hystricis, Dermacentor compactus, Dermacentor steini, and Amblyomma sp. from wildlife and domesticated goats from four different locations in Malaysia. Coxiella 16s rRNA genomic sequences were detected by PCR in 89% of ticks tested. Similarity analysis and phylogenetic analyses of the 16s rRNA and rpoB partial sequences were performed for 10 representative samples selected based on the tick species, sex, and location. The findings here suggested the presence of C. burnetii in two samples, each from D. steini and H. hystricis. The sequences of both samples clustered with published C. burnetii sequences. The remaining eight tick samples were shown to harbor 16s rRNA sequences of Coxiella-like bacteria, which clustered phylogenetically according to the respective tick host species. The findings presented here added to the growing evidence of the association between Coxiella-like bacteria and ticks across species and geographical boundaries. The importance of C. burnetii found in ticks in Malaysia warrants further investigation. PMID:27763821

Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).

PubMed

Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc

2011-01-01

DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.

Comparing COI and ITS as DNA Barcode Markers for Mushrooms and Allies (Agaricomycotina)

PubMed Central

Dentinger, Bryn T. M.; Didukh, Maryna Y.; Moncalvo, Jean-Marc

2011-01-01

DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (∼450 bp) representing ∼100 morphospecies from ∼650 collections of Agaricomycotina using several sets of new primers. Large introns (∼1500 bp) at variable locations were detected in ∼5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (∼30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms. PMID:21966418

Striking similarities in amino acid sequence among nonstructural proteins encoded by RNA viruses that have dissimilar genomic organization.

PubMed Central

Haseloff, J; Goelet, P; Zimmern, D; Ahlquist, P; Dasgupta, R; Kaesberg, P

1984-01-01

The plant viruses alfalfa mosaic virus (AMV) and brome mosaic virus (BMV) each divide their genetic information among three RNAs while tobacco mosaic virus (TMV) contains a single genomic RNA. Amino acid sequence comparisons suggest that the single proteins encoded by AMV RNA 1 and BMV RNA 1 and by AMV RNA 2 and BMV RNA 2 are related to the NH2-terminal two-thirds and the COOH-terminal one-third, respectively, of the largest protein encoded by TMV. Separating these two domains in the TMV RNA sequence is an amber termination codon, whose partial suppression allows translation of the downstream domain. Many of the residues that the TMV read-through domain and the segmented plant viruses have in common are also conserved in a read-through domain found in the nonstructural polyprotein of the animal alphaviruses Sindbis and Middelburg. We suggest that, despite substantial differences in gene organization and expression, all of these viruses use related proteins for common functions in RNA replication. Reassortment of functional modules of coding and regulatory sequence from preexisting viral or cellular sources, perhaps via RNA recombination, may be an important mechanism in RNA virus evolution. PMID:6611550

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

Dobrava hantavirus variants found in Apodemus flavicollis mice in Kırklareli Province, Turkey.

PubMed

Polat, Ceylan; Sironen, Tarja; Plyusnina, Angelina; Karatas, Ahmet; Sozen, Mustafa; Matur, Ferhat; Vapalahti, Olli; Oktem, I Mehmet Ali; Plyusnin, Alexander

2018-05-01

Hantaviruses infect humans via inhalation of viral particles within secretions of infected rodents or rarely through direct contact with infected rodents. Determining the prevalence of hantavirus infections among rodent populations is of vital importance to obtain information on hantavirus-related cases and to predict possible outbreaks. We hypothesized that DOBV strains circulating in the Thrace Region in Turkey would be related to other Balkan DOBV strains. In this study, hantavirus infections in the rodent population of the Kırklareli-İğneada Region (north-western Turkey, near the Bulgarian border) were investigated. This region is of particular importance, as it is located in the south-eastern margin of the European continent and was used as an entrance point of Asian faunal elements into Europe. DOBV infection was detected in eight of 73 rodents; all were of the Apodemus flavicollis species. Partial sequences of the viral S-, M-, and L-genome segments were recovered and compared with previously reported DOBV sequences. The newly characterized Turkish strains were similar to other DOBV variants. Silent nucleotide mutations were dominant. The hantavirus prevalence in the İğneada region was similar to what has been reported in Greece and Bulgaria. For the first time, the M-segment sequences of DOBV from Turkey were recovered and genetic data of hantaviruses from Thrace region of Turkey were obtained. © 2018 Wiley Periodicals, Inc.

Structural studies of viperin, an antiviral radical SAM enzyme.

PubMed

Fenwick, Michael K; Li, Yue; Cresswell, Peter; Modis, Yorgo; Ealick, Steven E

2017-06-27

Viperin is an IFN-inducible radical S -adenosylmethionine (SAM) enzyme that inhibits viral replication. We determined crystal structures of an anaerobically prepared fragment of mouse viperin (residues 45-362) complexed with S -adenosylhomocysteine (SAH) or 5'-deoxyadenosine (5'-dAdo) and l-methionine (l-Met). Viperin contains a partial (βα) 6 -barrel fold with a disordered N-terminal extension (residues 45-74) and a partially ordered C-terminal extension (residues 285-362) that bridges the partial barrel to form an overall closed barrel structure. Cys84, Cys88, and Cys91 located after the first β-strand bind a [4Fe-4S] cluster. The active site architecture of viperin with bound SAH (a SAM analog) or 5'-dAdo and l-Met (SAM cleavage products) is consistent with the canonical mechanism of 5'-deoxyadenosyl radical generation. The viperin structure, together with sequence alignments, suggests that vertebrate viperins are highly conserved and that fungi contain a viperin-like ortholog. Many bacteria and archaebacteria also express viperin-like enzymes with conserved active site residues. Structural alignments show that viperin is similar to several other radical SAM enzymes, including the molybdenum cofactor biosynthetic enzyme MoaA and the RNA methyltransferase RlmN, which methylates specific nucleotides in rRNA and tRNA. The viperin putative active site contains several conserved positively charged residues, and a portion of the active site shows structural similarity to the GTP-binding site of MoaA, suggesting that the viperin substrate may be a nucleoside triphosphate of some type.

Effect of partially replacing a barley-based concentrate with flaxseed-based products on the rumen bacterial population of lactating Holstein dairy cows.

PubMed

Castillo-Lopez, E; Moats, J; Aluthge, N D; Ramirez Ramirez, H A; Christensen, D A; Mutsvangwa, T; Penner, G B; Fernando, S C

2018-01-01

The effects of partial replacement of a barley-based concentrate with flaxseed-based products on the rumen bacterial population of lactating Holstein dairy cows were evaluated. Treatments fed were CONT, a normal diet that included barley silage, alfalfa hay and a barley-based concentrate that contained no flaxseed or faba beans; FLAX, inclusion of a nonextruded flaxseed-based product containing 55·0% flaxseed, 37·8% field peas and 6·9% alfalfa; EXT, similar to FLAX, but the product was extruded and EXTT, similar to FLAX, but product was extruded and field peas were replaced by high-tannin faba beans. The rumen bacterial population was evaluated by utilizing 16S rRNA gene sequencing. Most abundant phyla, families and genera were unaffected. However, some taxa were affected; for example, unsaturated fatty acid content was negatively correlated with Clostridiaceae, and tannin content was negatively correlated with BS11 and Paraprevotellaceae. Predominant rumen bacterial taxa were not affected, but the abundance of some taxa found in lower proportions shifted, possibly due to sensitivity to unsaturated fatty acids or tannins. Flaxseed-based products were effective for partially replacing barley-based concentrate in rations of lactating dairy cows. No negative effects of these products were observed on the abundance of predominant rumen bacterial taxa, with only minor shifts in less abundant bacteria. © 2017 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of Society for Applied Microbiology.

A New Zamilon-like Virophage Partial Genome Assembled from a Bioreactor Metagenome

PubMed Central

Bekliz, Meriem; Verneau, Jonathan; Benamar, Samia; Raoult, Didier; La Scola, Bernard; Colson, Philippe

2015-01-01

Virophages replicate within viral factories inside the Acanthamoeba cytoplasm, and decrease the infectivity and replication of their associated giant viruses. Culture isolation and metagenome analyses have suggested that they are common in our environment. By screening metagenomic databases in search of amoebal viruses, we detected virophage-related sequences among sequences generated from the same non-aerated bioreactor metagenome as recently screened by another team for virophage capsid-encoding genes. We describe here the assembled partial genome of a virophage closely related to Zamilon, which infects Acanthamoeba with mimiviruses of lineages B and C but not A. Searches for sequences related to amoebal giant viruses, other Megavirales representatives and virophages were conducted using BLAST against this bioreactor metagenome (PRJNA73603). Comparative genomic and phylogenetic analyses were performed using sequences from previously identified virophages. A total of 72 metagenome contigs generated from the bioreactor were identified as best matching with sequences from Megavirales representatives, mostly Pithovirus sibericum, pandoraviruses and amoebal mimiviruses from three lineages A–C, as well as from virophages. In addition, a partial genome from a Zamilon-like virophage, we named Zamilon 2, was assembled. This genome has a size of 6716 base pairs, corresponding to 39% of the Zamilon genome, and comprises partial or full-length homologs for 15 Zamilon predicted open reading frames (ORFs). Mean nucleotide and amino acid identities for these 15 Zamilon 2 ORFs with their Zamilon counterparts were 89% (range, 81–96%) and 91% (range, 78–99%), respectively. Notably, these ORFs included two encoding a capsid protein and a packaging ATPase. Comparative genomics and phylogenetic analyses indicated that the partial genome was that of a new Zamilon-like virophage. Further studies are needed to gain better knowledge of the tropism and prevalence of virophages in our biosphere and in humans. PMID:26640459

Characterization of isolates of meloidogyne from rice-wheat production fields in Nepal.

PubMed

Pokharel, Ramesh R; Abawi, George S; Zhang, Ning; Duxbury, John M; Smart, Christine D

2007-09-01

Thirty-three isolates of root-knot nematode were recovered from soil samples from rice-wheat fields in Nepal and maintained on rice cv. BR 11. The isolates were characterized using morphology, host range and DNA sequence analyses in order to ascertain their identity. Results indicated phenotypic similarity (juvenile measurements, perennial pattern, host range and gall shape) of the Nepalese isolates with Meloidogyne graminicola, with minor variations. The rice varieties LA 110 and Labelle were susceptible to all of the Nepalese isolates, but differences in the aggressiveness of the isolates were observed. Phylogenetic analyses based on the sequences of partial internal transcribed spacer (ITS) of the rRNA genes indicated that all Nepalese isolates formed a distinct clade with known isolates of M. graminicola with high bootstrap support. Furthermore, two groups were identified within the M. graminicola clade. No correlation between ITS haplotype and aggressiveness or host range was found among the tested isolates.

Deep ART Neural Model for Biologically Inspired Episodic Memory and Its Application to Task Performance of Robots.

PubMed

Park, Gyeong-Moon; Yoo, Yong-Ho; Kim, Deok-Hwa; Kim, Jong-Hwan; Gyeong-Moon Park; Yong-Ho Yoo; Deok-Hwa Kim; Jong-Hwan Kim; Yoo, Yong-Ho; Park, Gyeong-Moon; Kim, Jong-Hwan; Kim, Deok-Hwa

2018-06-01

Robots are expected to perform smart services and to undertake various troublesome or difficult tasks in the place of humans. Since these human-scale tasks consist of a temporal sequence of events, robots need episodic memory to store and retrieve the sequences to perform the tasks autonomously in similar situations. As episodic memory, in this paper we propose a novel Deep adaptive resonance theory (ART) neural model and apply it to the task performance of the humanoid robot, Mybot, developed in the Robot Intelligence Technology Laboratory at KAIST. Deep ART has a deep structure to learn events, episodes, and even more like daily episodes. Moreover, it can retrieve the correct episode from partial input cues robustly. To demonstrate the effectiveness and applicability of the proposed Deep ART, experiments are conducted with the humanoid robot, Mybot, for performing the three tasks of arranging toys, making cereal, and disposing of garbage.

Detection of Nipah virus RNA in fruit bat (Pteropus giganteus) from India.

PubMed

Yadav, Pragya D; Raut, Chandrashekhar G; Shete, Anita M; Mishra, Akhilesh C; Towner, Jonathan S; Nichol, Stuart T; Mourya, Devendra T

2012-09-01

The study deals with the survey of different bat populations (Pteropus giganteus, Cynopterus sphinx, and Megaderma lyra) in India for highly pathogenic Nipah virus (NiV), Reston Ebola virus, and Marburg virus. Bats (n = 140) from two states in India (Maharashtra and West Bengal) were tested for IgG (serum samples) against these viruses and for virus RNAs. Only NiV RNA was detected in a liver homogenate of P. giganteus captured in Myanaguri, West Bengal. Partial sequence analysis of nucleocapsid, glycoprotein, fusion, and phosphoprotein genes showed similarity with the NiV sequences from earlier outbreaks in India. A serum sample of this bat was also positive by enzyme-linked immunosorbent assay for NiV-specific IgG. This is the first report on confirmation of Nipah viral RNA in Pteropus bat from India and suggests the possible role of this species in transmission of NiV in India.

Detection and partial molecular characterization of atypical plum pox virus isolates from naturally infected sour cherry.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna

2013-06-01

Atypical isolates of plum pox virus (PPV) were discovered in naturally infected sour cherry in urban ornamental plantings in Moscow, Russia. The isolates were detected by polyclonal double antibody sandwich ELISA and RT-PCR using universal primers specific for the 3'-non-coding and coat protein (CP) regions of the genome but failed to be recognized by triple antibody sandwich ELISA with the universal monoclonal antibody 5B and by RT-PCR using primers specific to for PPV strains D, M, C and W. Sequence analysis of the CP genes of nine isolates revealed 99.2-100 % within-group identity and 62-85 % identity to conventional PPV strains. Phylogenetic analysis showed that the atypical isolates represent a group that is distinct from the known PPV strains. Alignment of the N-terminal amino acid sequences of CP demonstrated their close similarity to those of a new tentative PPV strain, CR.

The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

PubMed

Vaira, A M; Accotto, G P; Costantini, A; Milne, R G

2003-06-01

A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

Characterization of Apricot pseudo-chlorotic leaf spot virus, A Novel Trichovirus Isolated from Stone Fruit Trees.

PubMed

Liberti, D; Marais, A; Svanella-Dumas, L; Dulucq, M J; Alioto, D; Ragozzino, A; Rodoni, B; Candresse, T

2005-04-01

ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.

The geochemistry and petrogenesis of an ophiolitic sequence from Pindos, Greece

NASA Astrophysics Data System (ADS)

Capedri, S.; Venturelli, G.; Bocchi, G.; Dostal, J.; Garuti, G.; Rossi, A.

1980-06-01

The ophiolites of Northern Pindos have been studied in a section close to the village of Perivoli (Grevena District). The section comprises cumulus rocks ranging from ultramafics to gabbros, overlain by dolerites (non-cumulus microgabbro) capped by thick frequently pillowed lava flows. The sequence is cut by basaltic dykes. While the cumulus rocks and the dolerites are mostly fresh, the lavas and dykes are strongly transformed. Major and trace element (Ni, Cr, Sc, Y, Zr, Nb, Sr, Ba, Zn, Cu, V, Li) data are presented for selected samples from the sequence. For some elements, the volcanic/subvolcanic rocks (flows, dykes, dolerites) exhibit wide chemical characteristics which are considered to mainly reflect variations within the parent magmas. Some lavas appear to be closely comparable with the present-day ocean-floor basalts, while other flows and most of the dykes are strongly depleted in some “incompatible” elements and are similar to some rocks from immature island arcs. The dolerites have transitional chemical features. The Pindos lavas differ from Western Mediterranean ophiolites in that the former have lower Ti,P,Zr,Y, higher Fe tot. and normally higher Ti/Zr ratio. The volcanic/subvolcanic rocks from Pindos have been derived from separate magmas. Some lavas were possibly produced by variable partial melting of an already depleted mantle source, while the lavas exhibiting ocean-floor affinity were probably generated by partial melting of a less depleted source. The wide chemical variations of the Pindos lavas cannot be easily explained by an ocean-ridge system. An “island arc-marginal basin system” could better account for the observed chemical features.

Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens).

PubMed

Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei

2016-08-01

Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin.

Characterisation of parapoxviruses isolated from Norwegian semi-domesticated reindeer (Rangifer tarandus tarandus)

PubMed Central

Klein, Joern; Tryland, Morten

2005-01-01

Background Two outbreaks of the disease contagious ecthyma were reported in 1999 and 2000 in Norwegian semi-domesticated reindeer (Rangifer tarandus tarandus). Contagious ecthyma is an epidermal disease of sheep and goats worldwide, which is caused by the zoonotic parapoxvirus orf virus. Characterisation of clinical samples from the two outbreaks in semi-domesticated reindeer in Norway by electron microscopy and PCR (B2L) revealed typical parapoxvirus particles and partial gene sequences corresponding to parapoxvirus, respectively. If contagious ecthyma in reindeer is caused by orf virus, the virus may be transferred from sheep and goats, via people, equipment and common use of pastures and corrals, to reindeer. Another possibility is that contagious ecthyma in reindeer is caused by a hitherto unclassified member of the parapoxvirus genus that circulates among reindeer herds and remains endemic in Norway. Results Genomic comparisons of one standard orf strain (orf NZ2) and the reindeer isolates, employing restriction fragment length polymorphism (RFLP) and random amplified polymorphic DNA (RAPD) analysis, demonstrated high similarity between the reindeer viruses and known orf virus strains. Partial DNA sequences of two different viral genes were determined for the different isolates and compared with corresponding parapoxvirus genebank sequences. The comparison/alignment and construction of phylogenetic trees also point to an affiliation of the reindeer viruses to the species orf virus. Conclusion The results of this work imply that the parapoxvirus causing contagious ecthyma in Norwegian semi-domesticated reindeer belongs to the species orf virus and that the orf virus crosses the host species barrier from sheep and goat to semi-domesticated reindeer. PMID:16143041

Virome analysis for identification of novel mammalian viruses in bat species from Chinese provinces.

PubMed

Wu, Zhiqiang; Ren, Xianwen; Yang, Li; Hu, Yongfeng; Yang, Jian; He, Guimei; Zhang, Junpeng; Dong, Jie; Sun, Lilian; Du, Jiang; Liu, Liguo; Xue, Ying; Wang, Jianmin; Yang, Fan; Zhang, Shuyi; Jin, Qi

2012-10-01

Bats are natural hosts for a large variety of zoonotic viruses. This study aimed to describe the range of bat viromes, including viruses from mammals, insects, fungi, plants, and phages, in 11 insectivorous bat species (216 bats in total) common in six provinces of China. To analyze viromes, we used sequence-independent PCR amplification and next-generation sequencing technology (Solexa Genome Analyzer II; Illumina). The viromes were identified by sequence similarity comparisons to known viruses. The mammalian viruses included those of the Adenoviridae, Herpesviridae, Papillomaviridae, Retroviridae, Circoviridae, Rhabdoviridae, Astroviridae, Flaviridae, Coronaviridae, Picornaviridae, and Parvovirinae; insect viruses included those of the Baculoviridae, Iflaviridae, Dicistroviridae, Tetraviridae, and Densovirinae; fungal viruses included those of the Chrysoviridae, Hypoviridae, Partitiviridae, and Totiviridae; and phages included those of the Caudovirales, Inoviridae, and Microviridae and unclassified phages. In addition to the viruses and phages associated with the insects, plants, and bacterial flora related to the diet and habitation of bats, we identified the complete or partial genome sequences of 13 novel mammalian viruses. These included herpesviruses, papillomaviruses, a circovirus, a bocavirus, picornaviruses, a pestivirus, and a foamy virus. Pairwise alignments and phylogenetic analyses indicated that these novel viruses showed little genetic similarity with previously reported viruses. This study also revealed a high prevalence and diversity of bat astroviruses and coronaviruses in some provinces. These findings have expanded our understanding of the viromes of bats in China and hinted at the presence of a large variety of unknown mammalian viruses in many common bat species of mainland China.

Virome Analysis for Identification of Novel Mammalian Viruses in Bat Species from Chinese Provinces

PubMed Central

Wu, Zhiqiang; Ren, Xianwen; Yang, Li; Hu, Yongfeng; Yang, Jian; He, Guimei; Zhang, Junpeng; Dong, Jie; Sun, Lilian; Du, Jiang; Liu, Liguo; Xue, Ying; Wang, Jianmin; Yang, Fan

2012-01-01

Bats are natural hosts for a large variety of zoonotic viruses. This study aimed to describe the range of bat viromes, including viruses from mammals, insects, fungi, plants, and phages, in 11 insectivorous bat species (216 bats in total) common in six provinces of China. To analyze viromes, we used sequence-independent PCR amplification and next-generation sequencing technology (Solexa Genome Analyzer II; Illumina). The viromes were identified by sequence similarity comparisons to known viruses. The mammalian viruses included those of the Adenoviridae, Herpesviridae, Papillomaviridae, Retroviridae, Circoviridae, Rhabdoviridae, Astroviridae, Flaviridae, Coronaviridae, Picornaviridae, and Parvovirinae; insect viruses included those of the Baculoviridae, Iflaviridae, Dicistroviridae, Tetraviridae, and Densovirinae; fungal viruses included those of the Chrysoviridae, Hypoviridae, Partitiviridae, and Totiviridae; and phages included those of the Caudovirales, Inoviridae, and Microviridae and unclassified phages. In addition to the viruses and phages associated with the insects, plants, and bacterial flora related to the diet and habitation of bats, we identified the complete or partial genome sequences of 13 novel mammalian viruses. These included herpesviruses, papillomaviruses, a circovirus, a bocavirus, picornaviruses, a pestivirus, and a foamy virus. Pairwise alignments and phylogenetic analyses indicated that these novel viruses showed little genetic similarity with previously reported viruses. This study also revealed a high prevalence and diversity of bat astroviruses and coronaviruses in some provinces. These findings have expanded our understanding of the viromes of bats in China and hinted at the presence of a large variety of unknown mammalian viruses in many common bat species of mainland China. PMID:22855479

Molecular characterization of human T-cell lymphotropic virus type 1 full and partial genomes by Illumina massively parallel sequencing technology.

PubMed

Pessôa, Rodrigo; Watanabe, Jaqueline Tomoko; Nukui, Youko; Pereira, Juliana; Casseb, Jorge; Kasseb, Jorge; de Oliveira, Augusto César Penalva; Segurado, Aluisio Cotrim; Sanabani, Sabri Saeed

2014-01-01

Here, we report on the partial and full-length genomic (FLG) variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs), 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and 7 adult T-cell leukemia/lymphoma (ATLL) patients, using an Illumina paired-end protocol. Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis. A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14) and FLG (n = 76) data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5%) individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA) and that 4 individuals (4.5%) were infected with the Japanese sub-subtypes (aB). A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data will add to our current understanding of the evolutionary history of this medically important virus.

Accurate Classification of RNA Structures Using Topological Fingerprints

PubMed Central

Li, Kejie; Gribskov, Michael

2016-01-01

While RNAs are well known to possess complex structures, functionally similar RNAs often have little sequence similarity. While the exact size and spacing of base-paired regions vary, functionally similar RNAs have pronounced similarity in the arrangement, or topology, of base-paired stems. Furthermore, predicted RNA structures often lack pseudoknots (a crucial aspect of biological activity), and are only partially correct, or incomplete. A topological approach addresses all of these difficulties. In this work we describe each RNA structure as a graph that can be converted to a topological spectrum (RNA fingerprint). The set of subgraphs in an RNA structure, its RNA fingerprint, can be compared with the fingerprints of other RNA structures to identify and correctly classify functionally related RNAs. Topologically similar RNAs can be identified even when a large fraction, up to 30%, of the stems are omitted, indicating that highly accurate structures are not necessary. We investigate the performance of the RNA fingerprint approach on a set of eight highly curated RNA families, with diverse sizes and functions, containing pseudoknots, and with little sequence similarity–an especially difficult test set. In spite of the difficult test set, the RNA fingerprint approach is very successful (ROC AUC > 0.95). Due to the inclusion of pseudoknots, the RNA fingerprint approach both covers a wider range of possible structures than methods based only on secondary structure, and its tolerance for incomplete structures suggests that it can be applied even to predicted structures. Source code is freely available at https://github.rcac.purdue.edu/mgribsko/XIOS_RNA_fingerprint. PMID:27755571

Comparative evaluation of the identification of rapidly growing non-tuberculous mycobacteria by mass spectrometry (MALDI-TOF MS), GenoType Mycobacterium CM/AS assay and partial sequencing of the rpoβ gene with phylogenetic analysis as a reference method.

PubMed

Costa-Alcalde, José Javier; Barbeito-Castiñeiras, Gema; González-Alba, José María; Aguilera, Antonio; Galán, Juan Carlos; Pérez-Del-Molino, María Luisa

2018-06-02

The American Thoracic Society and the Infectious Diseases Society of America recommend that clinically significant non-tuberculous mycobacteria (NTM) should be identified to the species level in order to determine their clinical significance. The aim of this study was to evaluate identification of rapidly growing NTM (RGM) isolated from clinical samples by using MALDI-TOF MS and a commercial molecular system. The results were compared with identification using a reference method. We included 46 clinical isolates of RGM and identified them using the commercial molecular system GenoType ® CM/AS (Hain, Lifescience, Germany), MALDI-TOF MS (Bruker) and, as reference method, partial rpoβ gene sequencing followed by BLAST and phylogenetic analysis with the 1093 sequences available in the GeneBank. The degree of agreement between GenoType ® and MALDI-TOF MS and the reference method, partial rpoβ sequencing, was 27/43 (62.8%) and 38/43 cases (88.3%) respectively. For all the samples correctly classified by GenoType ® , we obtained the same result with MALDI-TOF MS (27/27). However, MALDI-TOF MS also correctly identified 68.75% (11/16) of the samples that GenoType ® had misclassified (p=0.005). MALDI-TOF MS classified significantly better than GenoType ® . When a MALDI-TOF MS score >1.85 was achieved, MALDI-TOF MS and partial rpoβ gene sequencing were equivalent. GenoType ® was not able to distinguish between species belonging to the M. fortuitum complex. MALDI-TOF MS methodology is simple, rapid and associated with lower consumable costs than GenoType ® . The partial rpoβ sequencing methods with BLAST and phylogenetic analysis were not able to identify some RGM unequivocally. Therefore, sequencing of additional regions would be indicated in these cases. Copyright © 2018 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Glutamate cysteine ligase (GCL) in the freshwater bivalve Unio tumidus: impact of storage conditions and seasons on activity and identification of partial coding sequence of the catalytic subunit.

PubMed

Coffinet, Stéphanie; Cossu-Leguille, Carole; Rodius, François; Vasseur, Paule

2008-09-01

Glutamate cysteine ligase (GCL; EC 6.3.2.2) is the first enzyme involved in the synthesis of glutathione. A HPLC method with fluorimetric detection was used to measure GCL activity in the gills and the digestive gland of the freshwater bivalve, Unio tumidus. Storage conditions were optimized in order to prevent decrease of GCL activity and consisted in freezing the cytosolic fraction in the presence of protease (1 mM phenylmethylsulfonic fluoric acid) and gamma-glutamyltranspeptidase (1 mM L-serine borate mixture and 0.5 mM acivicin) inhibitors. Seasonal variations of activity in the digestive gland and to a lesser extent in the gills were found with activity increasing in spring compared to winter. No sex differences were revealed. The GCL coding sequence was identified using degenerated primers designed in the highly conserved regions of the catalytic subunit of GCL. The partial sequence identified encoded for 121 amino acids. The comparison of the identified partial coding sequence of U. tumidus with those available from vertebrates and invertebrates indicated that GCL sequence was highly conserved.

Genetic diversity, morphological uniformity and polyketide production in dinoflagellates (Amphidinium, Dinoflagellata).

PubMed

Murray, Shauna A; Garby, Tamsyn; Hoppenrath, Mona; Neilan, Brett A

2012-01-01

Dinoflagellates are an intriguing group of eukaryotes, showing many unusual morphological and genetic features. Some groups of dinoflagellates are morphologically highly uniform, despite indications of genetic diversity. The species Amphidinium carterae is abundant and cosmopolitan in marine environments, grows easily in culture, and has therefore been used as a 'model' dinoflagellate in research into dinoflagellate genetics, polyketide production and photosynthesis. We have investigated the diversity of 'cryptic' species of Amphidinium that are morphologically similar to A. carterae, including the very similar species Amphidinium massartii, based on light and electron microscopy, two nuclear gene regions (LSU rDNA and ITS rDNA) and one mitochondrial gene region (cytochrome b). We found that six genetically distinct cryptic species (clades) exist within the species A. massartii and four within A. carterae, and that these clades differ from one another in molecular sequences at levels comparable to other dinoflagellate species, genera or even families. Using primers based on an alignment of alveolate ketosynthase sequences, we isolated partial ketosynthase genes from several Amphidinium species. We compared these genes to known dinoflagellate ketosynthase genes and investigated the evolution and diversity of the strains of Amphidinium that produce them.

Genetic Diversity, Morphological Uniformity and Polyketide Production in Dinoflagellates (Amphidinium, Dinoflagellata)

PubMed Central

Hoppenrath, Mona; Neilan, Brett A.

2012-01-01

Dinoflagellates are an intriguing group of eukaryotes, showing many unusual morphological and genetic features. Some groups of dinoflagellates are morphologically highly uniform, despite indications of genetic diversity. The species Amphidinium carterae is abundant and cosmopolitan in marine environments, grows easily in culture, and has therefore been used as a ‘model’ dinoflagellate in research into dinoflagellate genetics, polyketide production and photosynthesis. We have investigated the diversity of ‘cryptic’ species of Amphidinium that are morphologically similar to A. carterae, including the very similar species Amphidinium massartii, based on light and electron microscopy, two nuclear gene regions (LSU rDNA and ITS rDNA) and one mitochondrial gene region (cytochrome b). We found that six genetically distinct cryptic species (clades) exist within the species A. massartii and four within A. carterae, and that these clades differ from one another in molecular sequences at levels comparable to other dinoflagellate species, genera or even families. Using primers based on an alignment of alveolate ketosynthase sequences, we isolated partial ketosynthase genes from several Amphidinium species. We compared these genes to known dinoflagellate ketosynthase genes and investigated the evolution and diversity of the strains of Amphidinium that produce them. PMID:22675531

Application of phase consistency to improve time efficiency and image quality in dual echo black-blood carotid angiography.

PubMed

Kholmovski, Eugene G; Parker, Dennis L

2005-07-01

There is a considerable similarity between proton density-weighted (PDw) and T2-weighted (T2w) images acquired by dual echo fast spin-echo (FSE) sequences. The similarity manifests itself not only in image space as correspondence between intensities of PDw and T2w images, but also in phase space as consistency between phases of PDw and T2w images. Methods for improving the imaging efficiency and image quality of dual echo FSE sequences based on this feature have been developed. The total scan time of dual echo FSE acquisition may be reduced by as much as 25% by incorporating an estimate of the image phase from a fully sampled PDw image when reconstructing partially sampled T2w images. The quality of T2w images acquired using phased array coils may be significantly improved by using the developed noise reduction reconstruction scheme, which is based on the correspondence between the PDw and T2w image intensities and the consistency between the PDw and T2w image phases. Studies of phantom and human subject MRI data were performed to evaluate the effectiveness of the techniques.

A new orthopteran-parasitizing horsehair worm, Acutogordius taiwanensis sp. n., with a redescription of Chordodes formosanus and novel host records from Taiwan (Nematomorpha, Gordiida)

PubMed Central

Chiu, Ming-Chung; Huang, Chin-Gi; Wu, Wen-Jer; Shiao, Shiuh-Feng

2017-01-01

Abstract A description of a new species of horsehair worm, Acutogordius taiwanensis sp. n., a redescription of Chordodes formosanus, and novel host records for the latter are provided. Acutogordius taiwanensis sp. n. is morphologically similar to A. protectus with moderately flat areoles on its tail tips, but is distinguishable by small mid-body ornamentations. Despite the distinct differences in the post-cloacal crescents between 14 male samples, their conspecific status, along with that of nine female samples, was upheld by a phylogenetic comparison of partial cytochrome oxidase subunit I (COI) sequences. Chordodes formosanus is another common horsehair worm species in Taiwan, which was previously believed to specifically parasitize Hierodula mantids. However, in this study, five C. formosanus were observed emerging from an Acromantis mantid, and two long-horned grasshopper hosts (Leptoteratura sp. and Holochlora japonica). These five worms showed high degrees of similarity in COI sequences and morphology, but one of these individuals bore abnormal crowned areoles, which has never been observed in C. formosanus, and may be attributed to the incomplete development of this particular individual. PMID:28824281

Phylogenic analysis of human bocavirus detected in children with acute respiratory infection in Yaounde, Cameroon.

PubMed

Kenmoe, Sebastien; Vernet, Marie-Astrid; Njankouo-Ripa, Mohamadou; Penlap, Véronique Beng; Vabret, Astrid; Njouom, Richard

2017-07-17

Human Bocavirus (HBoV) was first identified in 2005 and has been shown to be a common cause of respiratory infections and gastroenteritis in children. In a recent study, we found that 10.7% of children with acute respiratory infections (ARI) were infected by HBoV. Genetic characterization of this virus remains unknown in Central Africa, particularly in Cameroon Leeding us to evaluate the molecular characteristics of HBoV strains in Cameroonian children with ARI. Phylogenetic analysis of partial HBoV VP1/2 sequences showed a low level of nucleotide variation and the circulation of HBoV genotype 1 (HBoV-1) only. Three clades were obtained, two clustering with each of the reference strains ST1 and ST2, and a third group consisting of only Cameroon strains. By comparing with the Swedish reference sequences, ST1 and ST2, Cameroon sequences showed nucleotide and amino acid similarities of respectively 97.36-100% and 98.35-100%. These results could help improve strategies for monitoring and control of respiratory infections in Cameroon.

First record of Pantropical spotted dolphins Stenella attenuata in the Yellow Sea, China

NASA Astrophysics Data System (ADS)

Wu, Fuxing; Wang, Xianyan; Zhang, Qiuxia; Miao, Xing; Zhang, Ting; Zhu, Qian

2015-07-01

On October 1, 2009, sixteen dolphins were obtained from fishermen by incidental catching in the Yellow Sea, China. As the dolphins' skin color was ambiguous, morphological parameters were measured, and mitochondrial DNA cytochrome b (Cyt b) gene sequence was studied to identify the species. Morphological characteristics were consistent with Pantropical spotted dolphins, Stenella attenuata. Furthermore, a partial mitochondrial DNA cytochrome b (Cyt b) gene sequence as long as 328-bp was studied by extracting genomic DNA from the skins, and six haplotypes were detected in the sixteen dolphins. By comparing homologous sequences available in GenBank (www.ncbi.nlm.nih.gov), all the six haplotypes had maximal genetic similarity with Pantropical spotted dolphin. Eight species of cetacean (whales and dolphins) are now recognised in the Yellow Sea. To the best of our knowledge, this is the first record of Pantropical spotted dolphins from this region. Despite this species being listed as a Grade II National Key Protected Animal since 1988, little is known of its biology in Chinese waters. We recommend remedial research be undertaken to ensure appropriate management.

Genetic characterization of a new astrovirus detected in dogs suffering from diarrhoea.

PubMed

Toffan, Anna; Jonassen, Christine Monceyron; De Battisti, Cristian; Schiavon, Eliana; Kofstad, Tone; Capua, Ilaria; Cattoli, Giovanni

2009-10-20

Astroviruses have been described in several animals species frequently associated with diarrhoea, especially in young animals. In dogs, astrovirus-like particles have been observed sporadically and very little is known about their epidemiology and characteristics. In this paper, we describe the detection of astrovirus-like particles in symptomatic puppies. Furthermore, for the first time in this species, the presumptive identification made by electron microscopy was confirmed by genetic analysis of the viral RNA conducted directly on the clinical specimens. Genetic sequences of ORF2 (2443 nt), encoding for the capsid protein, and partial sequence of ORF1b (346 nt), encoding for the viral polymerase, identified the viruses as member of the family Astroviridae. The phylogenetic analysis clearly clustered canine astroviruses in the genus Mamastrovirus. Relative closest similarities were revealed with a cluster comprising human, porcine and feline astroviruses, based on the ORF2 sequences available. Based on the species definition for astroviruses and on the data obtained in this study, we suggest a new species of astrovirus - canine astrovirus, CaAstV - to be included in the genus Mamastrovirus.

Genetic diversity in Trypanosoma theileri from Sri Lankan cattle and water buffaloes.

PubMed

Yokoyama, Naoaki; Sivakumar, Thillaiampalam; Fukushi, Shintaro; Tattiyapong, Muncharee; Tuvshintulga, Bumduuren; Kothalawala, Hemal; Silva, Seekkuge Susil Priyantha; Igarashi, Ikuo; Inoue, Noboru

2015-01-30

Trypanosoma theileri is a hemoprotozoan parasite that infects various ruminant species. We investigated the epidemiology of this parasite among cattle and water buffalo populations bred in Sri Lanka, using a diagnostic PCR assay based on the cathepsin L-like protein (CATL) gene. Blood DNA samples sourced from cattle (n=316) and water buffaloes (n=320) bred in different geographical areas of Sri Lanka were PCR screened for T. theileri. Parasite DNA was detected in cattle and water buffaloes alike in all the sampling locations. The overall T. theileri-positive rate was higher in water buffaloes (15.9%) than in cattle (7.6%). Subsequently, PCR amplicons were sequenced and the partial CATL sequences were phylogenetically analyzed. The identity values for the CATL gene were 89.6-99.7% among the cattle-derived sequences, compared with values of 90.7-100% for the buffalo-derived sequences. However, the cattle-derived sequences shared 88.2-100% identity values with those from buffaloes. In the phylogenetic tree, the Sri Lankan CATL gene sequences fell into two major clades (TthI and TthII), both of which contain CATL sequences from several other countries. Although most of the CATL sequences from Sri Lankan cattle and buffaloes clustered independently, two buffalo-derived sequences were observed to be closely related to those of the Sri Lankan cattle. Furthermore, a Sri Lankan buffalo sequence clustered with CATL gene sequences from Brazilian buffalo and Thai cattle. In addition to reporting the first PCR-based survey of T. theileri among Sri Lankan-bred cattle and water buffaloes, the present study found that some of the CATL gene fragments sourced from water buffaloes shared similarity with those determined from cattle in this country. Copyright © 2014 Elsevier B.V. All rights reserved.

The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

PubMed

Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

2018-05-17

Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Genome sequencing of the redbanded stink bug (Piezodorus guildinii)

USDA-ARS?s Scientific Manuscript database

We assembled a partial genome sequence from the redbanded stink bug, Piezodorus guildinii from Illumina MiSeq sequencing runs. The sequence has been submitted and published under NCBI GenBank Accession Number JTEQ01000000. The BioProject and BioSample Accession numbers are PRJNA263369 and SAMN030997...

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

Molecular analysis of partial VP-2 gene amplified from rectal swab samples of diarrheic dogs in Pakistan confirms the circulation of canine parvovirus genetic variant CPV-2a and detects sequences of feline panleukopenia virus (FPV).

PubMed

Ahmed, Nisar; Riaz, Adeel; Zubair, Zahra; Saqib, Muhammad; Ijaz, Sehrish; Nawaz-Ul-Rehman, Muhammad Shah; Al-Qahtani, Ahmed; Mubin, Muhammad

2018-03-15

The infection in dogs due to canine parvovirus (CPV), is a highly contagious one with high mortality rate. The present study was undertaken for a detailed genetic analysis of partial VP2 gene i.e., 630 bp isolated from rectal swab samples of infected domestic and stray dogs from all areas of district Faisalabad. Monitoring of viruses is important, as continuous prevalence of viral infection might be associated with emergence of new virulent strains. In the present study, 40 rectal swab samples were collected from diarrheic dogs from different areas of district Faisalabad, Pakistan, in 2014-15 and screened for the presence of CPV by immunochromatography. Most of these dogs were stray dogs showing symptoms of diarrhea. Viral DNA was isolated and partial VP2 gene was amplified using gene specific primer pair Hfor/Hrev through PCR. Amplified fragments were cloned in pTZ57R/T (Fermentas) and completely sequenced. Sequences were analyzed and assembled by the Lasergene DNA analysis package (v8; DNAStar Inc., Madison, WI, USA). The results with immunochromatography showed that 33/40 (82%) of dogs were positive for CPV. We were able to amplify a fragment of 630 bp from 25 samples. In 25 samples the sequences of CPV-2a were detected showing the amino acid substitution Ser297Ala and presence of amino acid (426-Asn) in partial VP2 protein. Interestingly the BLAST analysis showed the of feline panleukopenia virus (FPV) sequences in 3 samples which were already positive for new CPV-2a, with 99% sequence homology to other FPV sequences present in GenBank. Phylogenetic analysis showed clustering of partial CPV-VP-2 gene with viruses from China, India, Japan and Uruguay identifying a new variant, whereas the 3 FPV sequences showed immediate ancestral relationship with viruses from Portugal, South Africa and USA. Interesting observation was that CPV are clustering away from the commercial vaccine strains. In this work we provide a better understanding of CPV prevailing in Pakistan at molecular level. The detection of FPV could be a case of real co-infection or a case of dual presence, due to ingestion of contaminated food.

Novel rod-shaped viruses isolated from garlic, Allium sativum, possessing a unique genome organization.

PubMed

Sumi, S; Tsuneyoshi, T; Furutani, H

1993-09-01

Rod-shaped flexuous viruses were partially purified from garlic plants (Allium sativum) showing typical mosaic symptoms. The genome was shown to be composed of RNA with a poly(A) tail of an estimated size of 10 kb as shown by denaturing agarose gel electrophoresis. We constructed cDNA libraries and screened four independent clones, which were designated GV-A, GV-B, GV-C and GV-D, using Northern and Southern blot hybridization. Nucleotide sequence determination of the cDNAs, two of which correspond to nearly one-third of the virus genomic RNA, shows that all of these viruses possess an identical genomic structure and that also at least four proteins are encoded in the viral cDNA, their M(r)s being estimated to be 15K, 27K, 40K and 11K. The 15K open reading frame (ORF) encodes the core-like sequence of a zinc finger protein preceded by a cluster of basic amino acid residues. The 27K ORF probably encodes the viral coat protein (CP), based on both the existence of some conserved sequences observed in many other rod-shaped or flexuous virus CPs and an overall amino acid sequence similarity to potexvirus and carlavirus CPs. The 11K ORF shows significant amino acid sequence similarities to the corresponding 12K proteins of the potexviruses and carlaviruses. On the other hand, the 40K ORF product does not resemble any other plant virus gene products reported so far. The genomic organization in the 3' region of the garlic viruses resembles, but clearly differs from, that of carlaviruses. Phylogenetic analysis based upon the amino acid sequence of the viral capsid protein also indicates that the garlic viruses have a unique and distinct domain different from those of the potexvirus and carlavirus groups. The results suggest that the garlic viruses described here belong to an unclassified and new virus group closely related to the carlaviruses.

Fast and accurate de novo genome assembly from long uncorrected reads

PubMed Central

Vaser, Robert; Sović, Ivan; Nagarajan, Niranjan

2017-01-01

The assembly of long reads from Pacific Biosciences and Oxford Nanopore Technologies typically requires resource-intensive error-correction and consensus-generation steps to obtain high-quality assemblies. We show that the error-correction step can be omitted and that high-quality consensus sequences can be generated efficiently with a SIMD-accelerated, partial-order alignment–based, stand-alone consensus module called Racon. Based on tests with PacBio and Oxford Nanopore data sets, we show that Racon coupled with miniasm enables consensus genomes with similar or better quality than state-of-the-art methods while being an order of magnitude faster. PMID:28100585

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Genetic Relationships among Hylocereus and Selenicereus Vine Cacti (Cactaceae): Evidence from Hybridization and Cytological Studies

PubMed Central

TEL-ZUR, NOEMI; ABBO, SHAHAL; BAR-ZVI, DUDY; MIZRAHI, YOSEF

2004-01-01

• Background and Aims Hylocereus and Selenicereus are native to tropical and sub-tropical America. Based on its taxonomic status and crossability relations it was postulated that H. megalanthus (syn. S. megalanthus) is an allotetraploid (2n = 4x = 44) derived from natural hybridization between two closely related diploid taxa. The present work aimed at elucidating the genetic relationships between species of the two genera. • Methods Crosses were performed and the putative hybrids were analysed by chromosome counts and morphological traits. The ploidy level of hybrids was confirmed by fluorescent in situ hybridization (FISH) of rDNA sites. Genomic in situ hybridization (GISH) was used in an attempt to identify the putative diploid genome donors of H. megalanthus and an artificial interploid hybrid. • Key Results Reciprocal crosses among four diploid Hylocereus species (H. costaricensis, H. monacanthus (syn. H. polyrhizus), H. undatus and Hylocereus sp.) yielded viable diploid hybrids, with regular chromosome pairing. Reciprocal crosses between these Hylocereus spp. and H. megalanthus yielded viable triploid, pentaploid, hexaploid and aneuploid hybrids. Morphological and phenological traits confirm the hybrid origin. In situ detection of rDNA sites was in accord with the ploidy status of the species and hybrid studied. GISH results indicated that overall sequence composition of H. megalanthus is similar to that of H. ocamponis and S. grandiflorus. High sequence similarity was also found between the parental genomes of H. monacanthus and H. megalanthus in one triploid hybrid. • Conclusions The ease of obtaining partially fertile F1 hybrids and the relative sequence similarity (in GISH study) suggest close genetic relationships among the taxa analysed. PMID:15329334

A novel multifunctional O-methyltransferase implicated in a dual methylation pathway associated with lignin biosynthesis in loblolly pine

PubMed Central

Li, Laigeng; Popko, Jacqueline L.; Zhang, Xing-Hai; Osakabe, Keishi; Tsai, Chung-Jui; Joshi, Chandrashekhar P.; Chiang, Vincent L.

1997-01-01

S-adenosyl-l-methionine (SAM)-dependent O-methyltransferases (OMTs) catalyze the methylation of hydroxycinnamic acid derivatives for the synthesis of methylated plant polyphenolics, including lignin. The distinction in the extent of methylation of lignins in angiosperms and gymnosperms, mediated by substrate-specific OMTs, represents one of the fundamental differences in lignin biosynthesis between these two classes of plants. In angiosperms, two types of structurally and functionally distinct lignin pathway OMTs, caffeic acid 3-O-methyltransferases (CAOMTs) and caffeoyl CoA 3-O-methyltransferases (CCoAOMTs), have been reported and extensively studied. However, little is known about lignin pathway OMTs in gymnosperms. We report here the first cloning of a loblolly pine (Pinus taeda) xylem cDNA encoding a multifunctional enzyme, SAM:hydroxycinnamic Acids/hydroxycinnamoyl CoA Esters OMT (AEOMT). The deduced protein sequence of AEOMT is partially similar to, but clearly distinguishable from, that of CAOMTs and does not exhibit any significant similarity with CCoAOMT protein sequences. However, functionally, yeast-expressed AEOMT enzyme catalyzed the methylation of CAOMT substrates, caffeic and 5-hydroxyferulic acids, as well as CCoAOMT substrates, caffeoyl CoA and 5-hydroxyferuloyl CoA esters, with similar specific activities and was completely inactive with substrates associated with flavonoid synthesis. The lignin-related substrates were also efficiently methylated in crude extracts of loblolly pine secondary xylem. Our results support the notion that, in the context of amino acid sequence and biochemical function, AEOMT represents a novel SAM-dependent OMT, with both CAOMT and CCoAOMT activities and thus the potential to mediate a dual methylation pathway in lignin biosynthesis in loblolly pine xylem. PMID:9144260

A novel multifunctional O-methyltransferase implicated in a dual methylation pathway associated with lignin biosynthesis in loblolly pine.

PubMed

Li, L; Popko, J L; Zhang, X H; Osakabe, K; Tsai, C J; Joshi, C P; Chiang, V L

1997-05-13

S-adenosyl-L-methionine (SAM)-dependent O-methyltransferases (OMTs) catalyze the methylation of hydroxycinnamic acid derivatives for the synthesis of methylated plant polyphenolics, including lignin. The distinction in the extent of methylation of lignins in angiosperms and gymnosperms, mediated by substrate-specific OMTs, represents one of the fundamental differences in lignin biosynthesis between these two classes of plants. In angiosperms, two types of structurally and functionally distinct lignin pathway OMTs, caffeic acid 3-O-methyltransferases (CAOMTs) and caffeoyl CoA 3-O-methyltransferases (CCoAOMTs), have been reported and extensively studied. However, little is known about lignin pathway OMTs in gymnosperms. We report here the first cloning of a loblolly pine (Pinus taeda) xylem cDNA encoding a multifunctional enzyme, SAM:hydroxycinnamic Acids/hydroxycinnamoyl CoA Esters OMT (AEOMT). The deduced protein sequence of AEOMT is partially similar to, but clearly distinguishable from, that of CAOMTs and does not exhibit any significant similarity with CCoAOMT protein sequences. However, functionally, yeast-expressed AEOMT enzyme catalyzed the methylation of CAOMT substrates, caffeic and 5-hydroxyferulic acids, as well as CCoAOMT substrates, caffeoyl CoA and 5-hydroxyferuloyl CoA esters, with similar specific activities and was completely inactive with substrates associated with flavonoid synthesis. The lignin-related substrates were also efficiently methylated in crude extracts of loblolly pine secondary xylem. Our results support the notion that, in the context of amino acid sequence and biochemical function, AEOMT represents a novel SAM-dependent OMT, with both CAOMT and CCoAOMT activities and thus the potential to mediate a dual methylation pathway in lignin biosynthesis in loblolly pine xylem.

The first genome sequences of human bocaviruses from Vietnam

PubMed Central

Thanh, Tran Tan; Van, Hoang Minh Tu; Hong, Nguyen Thi Thu; Nhu, Le Nguyen Truc; Anh, Nguyen To; Tuan, Ha Manh; Hien, Ho Van; Tuong, Nguyen Manh; Kien, Trinh Trung; Khanh, Truong Huu; Nhan, Le Nguyen Thanh; Hung, Nguyen Thanh; Chau, Nguyen Van Vinh; Thwaites, Guy; van Doorn, H. Rogier; Tan, Le Van

2017-01-01

As part of an ongoing effort to generate complete genome sequences of hand, foot and mouth disease-causing enteroviruses directly from clinical specimens, two complete coding sequences and two partial genomic sequences of human bocavirus 1 (n=3) and 2 (n=1) were co-amplified and sequenced, representing the first genome sequences of human bocaviruses from Vietnam. The sequences may aid future study aiming at understanding the evolution of the virus. PMID:28090592

Comparison of growth on mannitol salt agar, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, VITEK® 2 with partial sequencing of 16S rRNA gene for identification of coagulase-negative staphylococci.

PubMed

Ayeni, Funmilola A; Andersen, Camilla; Nørskov-Lauritsen, Niels

2017-04-01

Mannitol salt agar (MSA) is often used in resources' limited laboratories for identification of S. aureus however, coagulase-negative staphylococci (CoNS) grows and ferments mannitol on MSA. 171 strains of CoNS which have been previously misidentified as S. aureus due to growth on MSA were collected from different locations in Nigeria and two methods for identification of CoNS were compared i.e. ViTEK 2 and MALDI-TOF MS with partial 16S rRNA gene sequencing as gold standard. Partial tuf gene sequencing was used for contradicting identification. All 171 strains (13 species) grew on MSA and ferments mannitol. All tested strains of S. epidermidis, S. haemolyticus, S. nepalensis, S. pasteuri, S. sciuri,, S. warneri, S. xylosus, S. capitis were correctly identified by MALDI-TOF while variable identification were observed in S. saprophyticus and S. cohnii (90%, 81%). There was low identification of S. arlettae (14%) while all strains of S. kloosii and S. gallinarum were misidentified. There is absence of S. gallinarum in the MALDI-TOF database at the period of this study. All tested strains of S. epidermidis, S. gallinarum, S. haemolyticus, S. sciuri,, S. warneri, S. xylosus and S. capitis were correctly identified by ViTEK while variable identification were observed in S. saprophyticus, S. arlettae, S. cohnii, S. kloosii, (84%, 86%, 75%, 60%) and misidentification of S. nepalensis, S. pasteuri. Partial sequencing of 16S rRNA gene was used as gold standard for most strains except S. capitis and S. xylosus where the two species were misidentified by partial sequencing of 16S rRNA contrary to MALDI-TOF and ViTEK identification. Tuf gene sequencing was used for correct identification. Characteristic growth on MSA for CoNS is also identical to S. aureus growth on the media and therefore, MSA could not differentiate between S. aureus and CoNS. The percentage accuracy of ViTEK was better than MALDI-TOF in identification of CoNS. Although partial sequencing of 16S rRNA gene was used as gold standard in this study, it could not correctly identify S. capitis and S. xylosus. Copyright © 2017 Elsevier Ltd. All rights reserved.

Partial characterization of an atypical family I inorganic pyrophosphatase from cattle tick Rhipicephalus (Boophilus) microplus.

PubMed

Costa, Evenilton P; Campos, Eldo; de Andrade, Caroline P; Façanha, Arnoldo R; Saramago, Luiz; Masuda, Aoi; Vaz, Itabajara da Silva; Fernandez, Jorge H; Moraes, Jorge; Logullo, Carlos

2012-03-23

The present paper presents the partial characterization of a family I inorganic pyrophosphatase from the hard tick Rhipicephalus (Boophilus) microplus (BmPPase). The BmPPase gene was cloned from the tick embryo and sequenced. The deduced amino acid sequence shared high similarity with other eukaryotic PPases, on the other hand, BmPPase presented some cysteine residues non-conserved in other groups. This pyrophosphatase is inhibited by Ca(2+), and the inhibition is antagonized by Mg(2+), suggesting that the balance between free Ca(2+) and free Mg(2+) in the eggs could be involved in BmPPase activity control. We observed that the BmPPase transcripts are present in the fat body, midgut and ovary of ticks, in two developmental stages (partially and fully engorged females). However, higher transcription amounts were found in ovary from fully engorged females. BmPPase activity was considerably abolished by the thiol reagent dithionitrobenzoic acid (DTNB), suggesting that cysteine residues are exposed in its structure. Therefore, these cysteine residues play a critical role in the structural stability of BmPPase. Molecular dynamics simulation analysis indicates that BmPPase is the first Family I PPase that could promote disulfide bonds between cysteine residues 138-339 and 167-295. Finally, we believe that these cysteine residues exposed in the BmPPase structure can play an important controlling role regarding enzyme activity, which would be an interesting mechanism of redox control. The results presented here also indicate that this enzyme can be involved in embryogenesis of this arthropod, and may be useful as a target in the development of new tick control strategies. Published by Elsevier B.V.

Characterization of rabies virus from a human case in Nepal.

PubMed

Pant, G R; Horton, D L; Dahal, M; Rai, J N; Ide, S; Leech, S; Marston, D A; McElhinney, L M; Fooks, A R

2011-04-01

Rabies is endemic throughout most of Asia, with the majority of human cases transmitted by domestic dogs (Canis familiaris). Here, we report a case of rabies in a 12-year-old girl in the Lalitpur district of Nepal that might have been prevented by better public awareness and timely post-exposure prophylaxis. Molecular characterization of the virus showed 100% identity over a partial nucleoprotein gene sequence to previous isolates from Nepal belonging to the 'arctic-like' lineage of rabies virus. Sequence analysis of both partial nucleoprotein and glycoprotein genes showed differences in consensus sequence after passage in vitro but not after passage in vivo.

Partial mitochondrial DNA sequences suggest the existence of a cryptic species within the Leucosphyrus group of the genus Anopheles (Diptera: Culicidae), forest malaria vectors, in northern Vietnam.

PubMed

Takano, Kohei Takenaka; Nguyen, Ngoc Thi Hong; Nguyen, Binh Thi Huong; Sunahara, Toshihiko; Yasunami, Michio; Nguyen, Manh Duc; Takagi, Masahiro

2010-04-30

During the last decade, Southeast Asian countries have been very successful in reducing the burden of malaria. However, malaria remains endemic in these countries, especially in remote and forested areas. The Leucosphyrus group of the genus Anopheles harbors the most important malaria vectors in forested areas of Southeast Asia. In Vietnam, previous molecular studies have resulted in the identification of only Anopheles dirus sensu stricto (previously known as An. dirus species A) among the Leucosphyrus group members. However, Vietnamese entomologists have recognized that mosquitoes belonging to the Leucosphyrus group in northern Vietnam exhibit morphological characteristics similar to those of Anopheles takasagoensis, which has been reported only from Taiwan. Here, we aimed to confirm the genetic and morphological identities of the members of the Leucosphyrus group in Vietnam. In the molecular phylogenetic trees reconstructed using partial COI and ND6 mitochondrial gene sequences, samples collected from southern and central Vietnam clustered together with GenBank sequences of An. dirus that were obtained from Thailand. However, samples from northern Vietnam formed a distinct clade separated from both An. dirus and An. takasagoensis by other valid species. The results suggest the existence of a cryptic species in northern Vietnam that is morphologically similar to, but phylogenetically distant from both An. dirus and An. takasagoensis. We have tentatively designated this possible cryptic species as Anopheles aff. takasagoensis for convenience, until a valid name is assigned. However, it is difficult to distinguish the species solely on the basis of morphological characteristics. Further studies on such as karyotypes and polytene chromosome banding patterns are necessary to confirm whether An. aff. takasagoensis is a valid species. Moreover, studies on (1) the geographic distribution, which is potentially spreading along the Vietnam, China, Laos, and Myanmar borders; (2) morphological and ecological characteristics; and (3) vectorial capacity of this newly identified cryptic species of An. dirus, which is one of the most important malaria vectors in the mainland of Southeast Asia, are necessary for planning efficient malaria vector control programs in this region.

Identification and phylogenetic relationship of Iranian strains of various Leishmania species isolated from cutaneous and visceral cases of leishmaniasis based on N-acetylglucosamine-1-phosphate transferase gene.

PubMed

Hajjaran, Homa; Mohebali, Mehdi; Teimouri, Aref; Oshaghi, Mohammad Ali; Mirjalali, Hamed; Kazemi-Rad, Elham; Shiee, Mohammad Reza; Naddaf, Saied Reza

2014-08-01

The identity of Iranian Leishmania species has been resolved to some extent by some genetic markers. In this study, based on N-acetylglucosamine-1-phosphate transferase (nagt) gene, we further elucidated the identity and phylogeny of the prevalent species in this country. DNAs of 121 isolates belonging to cutaneous leishmaniasis (CL) patients, canine visceral leishmaniasis (CVL) cases, and Rhombomys opimus rodents were amplified by targeting a partial sequence of nagt gene. All the amplicons were analyzed with restriction fragment length polymorphism (RFLP) using Acc1 enzyme, and 49 amplicons representing different reservoir hosts were sequenced and aligned with similar sequences from GenBank database. The RFLP analysis revealed that 41 CL patients were infected Leishmania tropica and 36 with Leishmania major. Among 10 CVL isolates, 6 were identified as Leishmania infantum and 4 as L. tropica. Amongst 34 rodents' isolates, 11 and 23 isolates exhibited patterns similar to those of L. major, and L. tropica/Leishmania turanica, respectively. The sequencing results from all CL patients, CVL cases, and 4 reservoir rodents were in agreement with RFLP analysis and showed 99-100% homologies with the registered species of L. major, L. tropica, and L. infantum from Turkey, Tunisia, Iraq and Israel. Of the 7 rodent isolates exhibiting RFLP patterns similar to L. tropica/L. turanica, 3 exhibited the highest homologies (99-100%) with L. turanica and 4 with Leishmania gerbilli. The 49 nagt DNA sequences were grouped into five clusters representing L. major, L. tropica, L. infantum, L. turanica and L. gerbilli species, encompassing 19 haplotypes. No correlation was observed between intraspecies divergence and geographic distribution of haplotypes. The L. tropica haplotypes exhibited more homologies with those of L. infantum than L. major (97.2% vs. 96.9%), a probable indication to the potential ability of L. tropica to visceralize. Characterization of Iranian Leishmania isolates using nagt gene allowed unambiguous identification of five prevalent species with a high-resolution phylogeny. Copyright © 2014 Elsevier B.V. All rights reserved.

A multilevel ant colony optimization algorithm for classical and isothermic DNA sequencing by hybridization with multiplicity information available.

PubMed

Kwarciak, Kamil; Radom, Marcin; Formanowicz, Piotr

2016-04-01

The classical sequencing by hybridization takes into account a binary information about sequence composition. A given element from an oligonucleotide library is or is not a part of the target sequence. However, the DNA chip technology has been developed and it enables to receive a partial information about multiplicity of each oligonucleotide the analyzed sequence consist of. Currently, it is not possible to assess the exact data of such type but even partial information should be very useful. Two realistic multiplicity information models are taken into consideration in this paper. The first one, called "one and many" assumes that it is possible to obtain information if a given oligonucleotide occurs in a reconstructed sequence once or more than once. According to the second model, called "one, two and many", one is able to receive from biochemical experiment information if a given oligonucleotide is present in an analyzed sequence once, twice or at least three times. An ant colony optimization algorithm has been implemented to verify the above models and to compare with existing algorithms for sequencing by hybridization which utilize the additional information. The proposed algorithm solves the problem with any kind of hybridization errors. Computational experiment results confirm that using even the partial information about multiplicity leads to increased quality of reconstructed sequences. Moreover, they also show that the more precise model enables to obtain better solutions and the ant colony optimization algorithm outperforms the existing ones. Test data sets and the proposed ant colony optimization algorithm are available on: http://bioserver.cs.put.poznan.pl/download/ACO4mSBH.zip. Copyright © 2016 Elsevier Ltd. All rights reserved.

Direct cortical stimulation of inferior frontal cortex disrupts both speech and music production in highly trained musicians.

PubMed

Leonard, Matthew K; Desai, Maansi; Hungate, Dylan; Cai, Ruofan; Singhal, Nilika S; Knowlton, Robert C; Chang, Edward F

2018-05-22

Music and speech are human-specific behaviours that share numerous properties, including the fine motor skills required to produce them. Given these similarities, previous work has suggested that music and speech may at least partially share neural substrates. To date, much of this work has focused on perception, and has not investigated the neural basis of production, particularly in trained musicians. Here, we report two rare cases of musicians undergoing neurosurgical procedures, where it was possible to directly stimulate the left hemisphere cortex during speech and piano/guitar music production tasks. We found that stimulation to left inferior frontal cortex, including pars opercularis and ventral pre-central gyrus, caused slowing and arrest for both speech and music, and note sequence errors for music. Stimulation to posterior superior temporal cortex only caused production errors during speech. These results demonstrate partially dissociable networks underlying speech and music production, with a shared substrate in frontal regions.

Molecular and physiological properties of bacteriophages from North America and Germany affecting the fire blight pathogen Erwinia amylovora

PubMed Central

Müller, Ina; Lurz, Rudi; Kube, Michael; Quedenau, Claudia; Jelkmann, Wilhelm; Geider, Klaus

2011-01-01

Summary For possible control of fire blight affecting apple and pear trees, we characterized Erwinia amylovora phages from North America and Germany. The genome size determined by electron microscopy (EM) was confirmed by sequence data and major coat proteins were identified from gel bands by mass spectroscopy. By their morphology from EM data, φEa1h and φEa100 were assigned to the Podoviridae and φEa104 and φEa116 to the Myoviridae. Host ranges were essentially confined to E. amylovora, strains of the species Erwinia pyrifoliae, E. billingiae and even Pantoea stewartii were partially sensitive. The phages φEa1h and φEa100 were dependent on the amylovoran capsule of E. amylovora, φEa104 and φEa116 were not. The Myoviridae efficiently lysed their hosts and protected apple flowers significantly better than the Podoviridae against E. amylovora and should be preferred in biocontrol experiments. We have also isolated and partially characterized E. amylovora phages from apple orchards in Germany. They belong to the Podoviridae or Myoviridae with a host range similar to the phages isolated in North America. In EM measurements, the genome sizes of the Podoviridae were smaller than the genomes of the Myoviridae from North America and from Germany, which differed from each other in corresponding nucleotide sequences. PMID:21791029

An index-based algorithm for fast on-line query processing of latent semantic analysis

PubMed Central

Li, Pohan; Wang, Wei

2017-01-01

Latent Semantic Analysis (LSA) is widely used for finding the documents whose semantic is similar to the query of keywords. Although LSA yield promising similar results, the existing LSA algorithms involve lots of unnecessary operations in similarity computation and candidate check during on-line query processing, which is expensive in terms of time cost and cannot efficiently response the query request especially when the dataset becomes large. In this paper, we study the efficiency problem of on-line query processing for LSA towards efficiently searching the similar documents to a given query. We rewrite the similarity equation of LSA combined with an intermediate value called partial similarity that is stored in a designed index called partial index. For reducing the searching space, we give an approximate form of similarity equation, and then develop an efficient algorithm for building partial index, which skips the partial similarities lower than a given threshold θ. Based on partial index, we develop an efficient algorithm called ILSA for supporting fast on-line query processing. The given query is transformed into a pseudo document vector, and the similarities between query and candidate documents are computed by accumulating the partial similarities obtained from the index nodes corresponds to non-zero entries in the pseudo document vector. Compared to the LSA algorithm, ILSA reduces the time cost of on-line query processing by pruning the candidate documents that are not promising and skipping the operations that make little contribution to similarity scores. Extensive experiments through comparison with LSA have been done, which demonstrate the efficiency and effectiveness of our proposed algorithm. PMID:28520747

An index-based algorithm for fast on-line query processing of latent semantic analysis.

PubMed

Zhang, Mingxi; Li, Pohan; Wang, Wei

2017-01-01

Latent Semantic Analysis (LSA) is widely used for finding the documents whose semantic is similar to the query of keywords. Although LSA yield promising similar results, the existing LSA algorithms involve lots of unnecessary operations in similarity computation and candidate check during on-line query processing, which is expensive in terms of time cost and cannot efficiently response the query request especially when the dataset becomes large. In this paper, we study the efficiency problem of on-line query processing for LSA towards efficiently searching the similar documents to a given query. We rewrite the similarity equation of LSA combined with an intermediate value called partial similarity that is stored in a designed index called partial index. For reducing the searching space, we give an approximate form of similarity equation, and then develop an efficient algorithm for building partial index, which skips the partial similarities lower than a given threshold θ. Based on partial index, we develop an efficient algorithm called ILSA for supporting fast on-line query processing. The given query is transformed into a pseudo document vector, and the similarities between query and candidate documents are computed by accumulating the partial similarities obtained from the index nodes corresponds to non-zero entries in the pseudo document vector. Compared to the LSA algorithm, ILSA reduces the time cost of on-line query processing by pruning the candidate documents that are not promising and skipping the operations that make little contribution to similarity scores. Extensive experiments through comparison with LSA have been done, which demonstrate the efficiency and effectiveness of our proposed algorithm.

Sequence analysis of a few species of termites (Order: Isoptera) on the basis of partial characterization of COII gene.

PubMed

Sobti, Ranbir Chander; Kumari, Mamtesh; Sharma, Vijay Lakshmi; Sodhi, Monika; Mukesh, Manishi; Shouche, Yogesh

2009-11-01

The present study was aimed to get the nucleotide sequences of a part of COII mitochondrial gene amplified from individuals of five species of Termites (Isoptera: Termitidae: Macrotermitinae). Four of them belonged to the genus Odontotermes (O. obesus, O. horni, O. bhagwatii and Odontotermes sp.) and one to Microtermes (M. obesi). Partial COII gene fragments were amplified by using specific primers. The sequences so obtained were characterized to calculate the frequencies of each nucleotide bases and a high A + T content was observed. The interspecific pairwise sequence divergence in Odontotermes species ranged from 6.5% to 17.1% across COII fragment. M. obesi sequence diversity ranged from 2.5 with Odontotermes sp. to 19.0% with O. bhagwatii. Phylogenetic trees drawn on the basis of distance neighbour-joining method revealed three main clades clustering all the individuals according to their genera and families.

Pseudomonas fluorescens-like bacteria from the stomach: a microbiological and molecular study.

PubMed

Patel, Saurabh Kumar; Pratap, Chandra Bhan; Verma, Ajay Kumar; Jain, Ashok Kumar; Dixit, Vinod Kumar; Nath, Gopal

2013-02-21

To characterize oxidase- and urease-producing bacterial isolates, grown aerobically, that originated from antral biopsies of patients suffering from acid peptic diseases. A total of 258 antral biopsy specimens were subjected to isolation of bacteria followed by tests for oxidase and urease production, acid tolerance and aerobic growth. The selected isolates were further characterized by molecular techniques viz. amplifications for 16S rRNA using universal eubacterial and HSP60 gene specific primers. The amplicons were subjected to restriction analysis and partial sequencing. A phylogenetic tree was generated using unweighted pair group method with arithmetic mean (UPGMA) from evolutionary distance computed with bootstrap test of phylogeny. Assessment of acidity tolerance of bacteria isolated from antrum was performed using hydrochloric acid from 10(-7) mol/L to 10(-1) mol/L. Of the 258 antral biopsy specimens collected from patients, 179 (69.4%) were positive for urease production by rapid urease test and 31% (80/258) yielded typical Helicobacter pylori (H. pylori) after 5-7 d of incubation under a microaerophilic environment. A total of 240 (93%) antral biopsies yielded homogeneous semi-translucent and small colonies after overnight incubation. The partial 16S rRNA sequences revealed that the isolates had 99% similarity with Pseudomonas species. A phylogenetic tree on the basis of 16S rRNA sequences denoted that JQ927226 and JQ927227 were likely to be related to Pseudomonas fluorescens (P. fluorescens). On the basis of HSP60 sequences applied to the UPGMA phylogenetic tree, it was observed that isolated strains in an aerobic environment were likely to be P. fluorescens, and HSP60 sequences had more discriminatory potential rather than 16S rRNA sequences. Interestingly, this bacterium was acid tolerant for hours at low pH. Further, a total of 250 (96.9%) genomic DNA samples of 258 biopsy specimens and DNA from 240 bacterial isolates were positive for the 613 bp amplicons by targeting P. fluorescens-specific conserved putative outer membrane protein gene sequences. This study indicates that bacterial isolates from antral biopsies grown aerobically were P. fluorescens, and thus acid-tolerant bacteria other than H. pylori can also colonize the stomach and may be implicated in pathogenesis/protection.

Molecular characterization of influenza viruses collected from young children in Uberlandia, Brazil - from 2001 to 2010.

PubMed

de Mattos Silva Oliveira, Thelma Fátima; Yokosawa, Jonny; Motta, Fernando Couto; Siqueira, Marilda Mendonça; da Silveira, Hélio Lopes; Queiróz, Divina Aparecida Oliveira

2015-02-18

Influenza remains a major health problem due to the seasonal epidemics that occur every year caused by the emergence of new influenza virus strains. Hemagglutinin (HA) and neuraminidase (NA) glycoproteins are under selective pressure and subjected to frequent changes by antigenic drift. Therefore, our main objective was to investigate the influenza cases in Uberlândia city, Midwestern Brazil, in order to monitor the appearance of new viral strains, despite the availability of a prophylactic vaccine. Nasopharyngeal samples were collected from 605 children less than five years of age presenting with acute respiratory disease and tested by immunofluorescence assay (IFA) for detection of adenovirus, respiratory syncytial virus, parainfluenza virus types 1, 2, and 3 and influenza virus types A and B. A reverse transcription-PCR (RT-PCR) for influenza viruses A and B was carried out to amplify partial segments of the HA and NA genes. The nucleotide sequences were analyzed and compared with sequences of the virus strains of the vaccine available in the same year of sample collection. Forty samples (6.6%) were tested positive for influenza virus by IFA and RT-PCR, with 39 samples containing virus of type A and one of type B. By RT-PCR, the type A viruses were further characterized in subtypes H3N2, H1N2 and H1N1 (41.0%, 17.9%, and 2.6%, respectively). Deduced amino acid sequence analysis of the partial hemagglutinin sequence compared to sequences from vaccine strains, revealed that all strains found in Uberlândia had variations in the antigenic sites. The sequences of the receptor binding sites were preserved, although substitutions with similar amino acids were observed in few cases. The neuraminidase sequences did not show significant changes. All the H3 isolates detected in the 2001-2003 period had drifted from vaccine strain, unlike the isolates of the 2004-2007 period. These results suggest that the seasonal influenza vaccine effectiveness could be reduced because of A H3N2 variants that circulated in 2001-2003 years. Thus, an early monitoring of variants circulating in the country or in a region may provide important information about the probable efficacy of the vaccine that will be administered in an influenza season.

Novel Xylose Dehydrogenase in the Halophilic Archaeon Haloarcula marismortui†

PubMed Central

Johnsen, Ulrike; Schönheit, Peter

2004-01-01

During growth of the halophilic archaeon Haloarcula marismortui on d-xylose, a specific d-xylose dehydrogenase was induced. The enzyme was purified to homogeneity. It constitutes a homotetramer of about 175 kDa and catalyzed the oxidation of xylose with both NADP+ and NAD+ as cosubstrates with 10-fold higher affinity for NADP+. In addition to d-xylose, d-ribose was oxidized at similar kinetic constants, whereas d-glucose was used with about 70-fold lower catalytic efficiency (kcat/Km). With the N-terminal amino acid sequence of the subunit, an open reading frame (ORF)—coding for a 39.9-kDA protein—was identified in the partially sequenced genome of H. marismortui. The function of the ORF as the gene designated xdh and coding for xylose dehydrogenase was proven by its functional overexpression in Escherichia coli. The recombinant enzyme was reactivated from inclusion bodies following solubilization in urea and refolding in the presence of salts, reduced and oxidized glutathione, and substrates. Xylose dehydrogenase showed the highest sequence similarity to glucose-fructose oxidoreductase from Zymomonas mobilis and other putative bacterial and archaeal oxidoreductases. Activities of xylose isomerase and xylulose kinase, the initial reactions of xylose catabolism of most bacteria, could not be detected in xylose-grown cells of H. marismortui, and the genes that encode them, xylA and xylB, were not found in the genome of H. marismortui. Thus, we propose that this first characterized archaeal xylose dehydrogenase catalyzes the initial step in xylose degradation by H. marismortui. PMID:15342590

First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)

PubMed Central

Bockwoldt, Mathias; Hagen, Live H.; Pope, Phillip B.; Sundset, Monica A.

2016-01-01

The faecal microbiota of muskoxen (n=3) pasturing on Ryøya (69° 33′ N 18° 43′ E), Norway, in late September was characterized using high-throughput sequencing of partial 16S rRNA gene regions. A total of 16 209 high-quality sequence reads from bacterial domains and 19 462 from archaea were generated. Preliminary taxonomic classifications of 806 bacterial operational taxonomic units (OTUs) resulted in 53.7–59.3 % of the total sequences being without designations beyond the family level. Firmicutes (70.7–81.1 % of the total sequences) and Bacteroidetes (16.8–25.3 %) constituted the two major bacterial phyla, with uncharacterized members within the family Ruminococcaceae (28.9–40.9 %) as the major phylotype. Multiple-library comparisons between muskoxen and other ruminants indicated a higher similarity for muskoxen faeces and reindeer caecum (P>0.05) and some samples from cattle faeces. The archaeal sequences clustered into 37 OTUs, with dominating phylotypes affiliated to the methane-producing genus Methanobrevibacter (80–92 % of the total sequences). UniFrac analysis demonstrated heterogeneity between muskoxen archaeal libraries and those from reindeer and roe deer (P=1.0e-02, Bonferroni corrected), but not with foregut fermenters. The high proportion of cellulose-degrading Ruminococcus-affiliated bacteria agrees with the ingestion of a highly fibrous diet. Further experiments are required to elucidate the role played by these novel bacteria in the digestion of this fibrous Artic diet eaten by muskoxen. PMID:28348861

Application of representational difference analysis to identify genomic differences between Bradyrhizobium elkanii and B. Japonicum species.

PubMed

Soares, René Arderius; Passaglia, Luciane Maria Pereira

2010-10-01

Bradyrhizobium elkanii is successfully used in the formulation of commercial inoculants and, together with B. japonicum, it fully supplies the plant nitrogen demands. Despite the similarity between B. japonicum and B. elkanii species, several works demonstrated genetic and physiological differences between them. In this work Representational Difference Analysis (RDA) was used for genomic comparison between B. elkanii SEMIA 587, a crop inoculant strain, and B. japonicum USDA 110, a reference strain. Two hundred sequences were obtained. From these, 46 sequences belonged exclusively to the genome of B. elkanii strain, and 154 showed similarity to sequences from B. japonicum genome. From the 46 sequences with no similarity to sequences from B. japonicum, 39 showed no similarity to sequences in public databases and seven showed similarity to sequences of genes coding for known proteins. These seven sequences were divided in three groups: similar to sequences from other Bradyrhizobium strains, similar to sequences from other nitrogen-fixing bacteria, and similar to sequences from non nitrogen-fixing bacteria. These new sequences could be used as DNA markers in order to investigate the rates of genetic material gain and loss in natural Bradyrhizobium strains.

Optimizing multiple sequence alignments using a genetic algorithm based on three objectives: structural information, non-gaps percentage and totally conserved columns.

PubMed

Ortuño, Francisco M; Valenzuela, Olga; Rojas, Fernando; Pomares, Hector; Florido, Javier P; Urquiza, Jose M; Rojas, Ignacio

2013-09-01

Multiple sequence alignments (MSAs) are widely used approaches in bioinformatics to carry out other tasks such as structure predictions, biological function analyses or phylogenetic modeling. However, current tools usually provide partially optimal alignments, as each one is focused on specific biological features. Thus, the same set of sequences can produce different alignments, above all when sequences are less similar. Consequently, researchers and biologists do not agree about which is the most suitable way to evaluate MSAs. Recent evaluations tend to use more complex scores including further biological features. Among them, 3D structures are increasingly being used to evaluate alignments. Because structures are more conserved in proteins than sequences, scores with structural information are better suited to evaluate more distant relationships between sequences. The proposed multiobjective algorithm, based on the non-dominated sorting genetic algorithm, aims to jointly optimize three objectives: STRIKE score, non-gaps percentage and totally conserved columns. It was significantly assessed on the BAliBASE benchmark according to the Kruskal-Wallis test (P < 0.01). This algorithm also outperforms other aligners, such as ClustalW, Multiple Sequence Alignment Genetic Algorithm (MSA-GA), PRRP, DIALIGN, Hidden Markov Model Training (HMMT), Pattern-Induced Multi-sequence Alignment (PIMA), MULTIALIGN, Sequence Alignment Genetic Algorithm (SAGA), PILEUP, Rubber Band Technique Genetic Algorithm (RBT-GA) and Vertical Decomposition Genetic Algorithm (VDGA), according to the Wilcoxon signed-rank test (P < 0.05), whereas it shows results not significantly different to 3D-COFFEE (P > 0.05) with the advantage of being able to use less structures. Structural information is included within the objective function to evaluate more accurately the obtained alignments. The source code is available at http://www.ugr.es/~fortuno/MOSAStrE/MO-SAStrE.zip.

Detection and isolation of novel rhizopine-catabolizing bacteria from the environment

PubMed

Gardener; de Bruijn FJ

1998-12-01

Microbial rhizopine-catabolizing (Moc) activity was detected in serial dilutions of soil and rhizosphere washes. The activity observed generally ranged between 10(6) and 10(7) catabolic units per g, and the numbers of nonspecific culture-forming units were found to be approximately 10 times higher. A diverse set of 37 isolates was obtained by enrichment on scyllo-inosamine-containing media. However, none of the bacteria that were isolated were found to contain DNA sequences homologous to the known mocA, mocB, and mocC genes of Sinorhizobium meliloti L5-30. Twenty-one of the isolates could utilize an SI preparation as the sole carbon and nitrogen source for growth. Partial sequencing of 16S ribosomal DNAs (rDNAs) amplified from these strains indicated that five distinct bacterial genera (Arthrobacter, Sinorhizobium, Pseudomonas, Aeromonas, and Alcaligenes) were represented in this set. Only 6 of these 21 isolates could catabolize 3-O-methyl-scyllo-inosamine under standard assay conditions. Two of these, strains D1 and R3, were found to have 16S rDNA sequences very similar to those of Sinorhizobium meliloti. However, these strains are not symbiotically effective on Medicago sativa, and DNA sequences homologous to the nodB and nodC genes were not detected in strains D1 and R3 by Southern hybridization analysis.

Detection and Isolation of Novel Rhizopine-Catabolizing Bacteria from the Environment

PubMed Central

Gardener, Brian B. McSpadden; de Bruijn, Frans J.

1998-01-01

Microbial rhizopine-catabolizing (Moc) activity was detected in serial dilutions of soil and rhizosphere washes. The activity observed generally ranged between 106 and 107 catabolic units per g, and the numbers of nonspecific culture-forming units were found to be approximately 10 times higher. A diverse set of 37 isolates was obtained by enrichment on scyllo-inosamine-containing media. However, none of the bacteria that were isolated were found to contain DNA sequences homologous to the known mocA, mocB, and mocC genes of Sinorhizobium meliloti L5-30. Twenty-one of the isolates could utilize an SI preparation as the sole carbon and nitrogen source for growth. Partial sequencing of 16S ribosomal DNAs (rDNAs) amplified from these strains indicated that five distinct bacterial genera (Arthrobacter, Sinorhizobium, Pseudomonas, Aeromonas, and Alcaligenes) were represented in this set. Only 6 of these 21 isolates could catabolize 3-O-methyl-scyllo-inosamine under standard assay conditions. Two of these, strains D1 and R3, were found to have 16S rDNA sequences very similar to those of Sinorhizobium meliloti. However, these strains are not symbiotically effective on Medicago sativa, and DNA sequences homologous to the nodB and nodC genes were not detected in strains D1 and R3 by Southern hybridization analysis. PMID:9835587

Involvement of two genetic lineages of Sarcoptes scabiei mites in a local mange epizootic of wild mammals in Japan.

PubMed

Makouloutou, Patrice; Suzuki, Kazuo; Yokoyama, Mayumi; Takeuchi, Masahiko; Yanagida, Tetsuya; Sato, Hiroshi

2015-01-01

Similar to wild mammals on the continents, mange caused by the mange mite, Sarcoptes scabiei (Acari: Sarcoptidae) is spreading in wild mammals in most of Japan. We collected crusted or alopetic skin from 120 raccoon dogs (Nyctereutes procyonoides viverrinus), three raccoons (Procyon lotor), six Japanese badgers (Meles anakuma), one Japanese marten (Martes melampus), one stray dog (Canis lupus familiaris), four wild boars (Sus scrofa leucomystax), and one Japanese serow (Capricornis crispus), mainly in an area where mangy wild animals have been increasingly noted in the past 4 yr. The second internal transcribed spacer (ITS2) region of the ribosomal RNA gene and the partial 16S and cytochrome c oxidase subunit I (cox-1) genes of mitochondrial DNA (mtDNA) were characterized in these skin samples. The ITS2 sequencing (404 base pairs [bp]) identified the causative mite for mangy skin lesions of 128 animals as S. scabiei, regardless of host origin. The cat mite (Notoedres cati) was the cause in one raccoon dog and one raccoon. Most mites had almost identical ITS2 nucleotide sequences to those recorded in a variety of mammals worldwide. Partial 16S and cox-1 fragments of mtDNA amplified and sequenced successfully (331 bp and 410 bp, respectively) showed an identical nucleotide sequence except for one site (C vs. T) for the former and four sites (G, C, C, C vs. A, T, T, T, respectively) for the latter fragment. These substitutions were always synchronized, with the two mitochondrial DNA haplotypes (i.e., C/GCCC and T/ATTT) appearing to separately colonize in geographic units. The T/ATTT haplotype fell into a clade where animal-derived mites worldwide dominated, whereas the C/GCCC haplotype formed a geographic branch unique to Japanese isolates. These results suggest that heterologous populations of monospecific S. scabiei are expanding their populations and distributions regardless of host species in an apparently local mange epizootic of wild mammals in Japan.

Genetic analysis of H9N2 avian influenza viruses circulated in broiler flocks: a case study in Iraq in 2014-2015.

PubMed

Kraidi, Qayssar Ali; Madadgar, Omid; Ghalyanchi Langeroudi, Arash; Karimi, Vahid

2017-04-01

H9N2 avian influenza viruses (AIVs) have been recorded in Eurasian for several years. Since 2004-2005, the disease has become endemic in Iraq, causing serious economic losses in the poultry industry. The hemagglutinin (HA) and neuraminidase (NA), two out of eight protein-coding genes, play an important role during the early stage of infection and hinder virus assembling. Little is known about the genetic information of the H9N2 viruses currently circulating in Iraq; thus, gene sequences of six AIVS of the H9N2 subtype have been detected and analyzed in the period of 2014-2015 from different outbreaks of broiler flocks in five provinces situated in the middle and southern parts of Iraq. Genetic comparison of the partial sequences of HA gene indicated that all Iraqi viruses are related to each other and could be divided into two subgroups. Viruses of the first and the second subgroups demonstrated a high similar identity with Pakistani and Iranian viruses, respectively. The nucleotide sequences of the NA protein of the all studied Iraqi viruses were very similar (95.2-100% identity), and shared high nucleotide sequence identity with Iranian, Pakistani, and Lebanese strains. All six recent viruses possessed histidine, alanine, and leucine at positions 183, 190, and 226, respectively, which are the key residues in receptor-binding sites. The Iraqi viruses were closely related to viruses of G1-like lineage isolated from poultry flocks of Iran and Pakistan, suggesting that possible epidemiological links could be derived from a common origin. Further investigations are required and should include the viral isolation and full-length molecular characterization of H9N2 AIVs in this area.

Piscine reovirus: Genomic and molecular phylogenetic analysis from farmed and wild salmonids collected on the Canada/US Pacific Coast

USGS Publications Warehouse

Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul S.; Richmond, Zina; Purcell, Maureen K.; Johns, Robert; Johnson, Stewart C.; Sakasida, Sonja M.

2015-01-01

Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period.

Piscine Reovirus: Genomic and Molecular Phylogenetic Analysis from Farmed and Wild Salmonids Collected on the Canada/US Pacific Coast

PubMed Central

Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul; Richmond, Zina; Johns, Robert; Purcell, Maureen K.; Johnson, Stewart C.; Saksida, Sonja M.

2015-01-01

Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period. PMID:26536673

The Genetic Diversity of Mesodinium and Associated Cryptophytes

PubMed Central

Johnson, Matthew D.; Beaudoin, David J.; Laza-Martinez, Aitor; Dyhrman, Sonya T.; Fensin, Elizabeth; Lin, Senjie; Merculief, Aaron; Nagai, Satoshi; Pompeu, Mayza; Setälä, Outi; Stoecker, Diane K.

2016-01-01

Ciliates from the genus Mesodinium are globally distributed in marine and freshwater ecosystems and may possess either heterotrophic or mixotrophic nutritional modes. Members of the Mesodinium major/rubrum species complex photosynthesize by sequestering and maintaining organelles from cryptophyte prey, and under certain conditions form periodic or recurrent blooms (= red tides). Here, we present an analysis of the genetic diversity of Mesodinium and cryptophyte populations from 10 environmental samples (eight globally dispersed habitats including five Mesodinium blooms), using group-specific primers for Mesodinium partial 18S, ITS, and partial 28S rRNA genes as well as cryptophyte large subunit RuBisCO genes (rbcL). In addition, 22 new cryptophyte and four new M. rubrum cultures were used to extract DNA and sequence rbcL and 18S-ITS-28S genes, respectively, in order to provide a stronger phylogenetic context for our environmental sequences. Bloom samples were analyzed from coastal Brazil, Chile, two Northeastern locations in the United States, and the Pribilof Islands within the Bering Sea. Additionally, samples were also analyzed from the Baltic and Barents Seas and coastal California under non-bloom conditions. Most blooms were dominated by a single Mesodinium genotype, with coastal Brazil and Chile blooms composed of M. major and the Eastern USA blooms dominated by M. rubrum variant B. Sequences from all four blooms were dominated by Teleaulax amphioxeia-like cryptophytes. Non-bloom communities revealed more diverse assemblages of Mesodinium spp., including heterotrophic species and the mixotrophic Mesodinium chamaeleon. Similarly, cryptophyte diversity was also higher in non-bloom samples. Our results confirm that Mesodinium blooms may be caused by M. major, as well as multiple variants of M. rubrum, and further implicate T. amphioxeia as the key cryptophyte species linked to these phenomena in temperate and subtropical regions. PMID:28066344

The Genetic Diversity of Mesodinium and Associated Cryptophytes.

PubMed

Johnson, Matthew D; Beaudoin, David J; Laza-Martinez, Aitor; Dyhrman, Sonya T; Fensin, Elizabeth; Lin, Senjie; Merculief, Aaron; Nagai, Satoshi; Pompeu, Mayza; Setälä, Outi; Stoecker, Diane K

2016-01-01

Ciliates from the genus Mesodinium are globally distributed in marine and freshwater ecosystems and may possess either heterotrophic or mixotrophic nutritional modes. Members of the Mesodinium major/rubrum species complex photosynthesize by sequestering and maintaining organelles from cryptophyte prey, and under certain conditions form periodic or recurrent blooms (= red tides). Here, we present an analysis of the genetic diversity of Mesodinium and cryptophyte populations from 10 environmental samples (eight globally dispersed habitats including five Mesodinium blooms), using group-specific primers for Mesodinium partial 18S, ITS, and partial 28S rRNA genes as well as cryptophyte large subunit RuBisCO genes ( rbcL ). In addition, 22 new cryptophyte and four new M. rubrum cultures were used to extract DNA and sequence rbcL and 18S-ITS-28S genes, respectively, in order to provide a stronger phylogenetic context for our environmental sequences. Bloom samples were analyzed from coastal Brazil, Chile, two Northeastern locations in the United States, and the Pribilof Islands within the Bering Sea. Additionally, samples were also analyzed from the Baltic and Barents Seas and coastal California under non-bloom conditions. Most blooms were dominated by a single Mesodinium genotype, with coastal Brazil and Chile blooms composed of M. major and the Eastern USA blooms dominated by M. rubrum variant B. Sequences from all four blooms were dominated by Teleaulax amphioxeia -like cryptophytes. Non-bloom communities revealed more diverse assemblages of Mesodinium spp., including heterotrophic species and the mixotrophic Mesodinium chamaeleon . Similarly, cryptophyte diversity was also higher in non-bloom samples. Our results confirm that Mesodinium blooms may be caused by M. major , as well as multiple variants of M. rubrum , and further implicate T. amphioxeia as the key cryptophyte species linked to these phenomena in temperate and subtropical regions.

Sequences downstream of AAUAAA signals affect pre-mRNA cleavage and polyadenylation in vitro both directly and indirectly.

PubMed Central

Ryner, L C; Takagaki, Y; Manley, J L

1989-01-01

To investigate the role of sequences lying downstream of the conserved AAUAAA hexanucleotide in pre-mRNA cleavage and polyadenylation, deletions or substitutions were constructed in polyadenylation signals from simian virus 40 and adenovirus, and their effects were assayed in both crude and fractionated HeLa cell nuclear extracts. As expected, these sequences influenced the efficiency of both cleavage and polyadenylation as well as the accuracy of the cleavage reaction. Sequences near or upstream of the actual site of poly(A) addition appeared to specify a unique cleavage site, since their deletion resulted, in some cases, in heterogeneous cleavage. Furthermore, the sequences that allowed the simian virus 40 late pre-RNA to be cleaved preferentially by partially purified cleavage activity were also those at the cleavage site itself. Interestingly, sequences downstream of the cleavage site interacted with factors not directly involved in catalyzing cleavage and polyadenylation, since the effects of deletions were substantially diminished when partially purified components were used in assays. In addition, these sequences contained elements that could affect 3'-end formation both positively and negatively. Images PMID:2566911

A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

PubMed

Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

2015-01-01

The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

The mitochondrial genome of the Arizona Snowfly Mesocapnia arizonensis (Plecoptera, Capniidae).

PubMed

Elbrecht, Vasco; Leese, Florian

2016-09-01

We assembled the mitochondrial genome of the capniid stonefly Mesocapnia arizonensis (Baumann & Gaufin, 1969) using Illumina HiSeq sequence data. The recovered mitogenome is 14,921 bp in length and includes 13 protein-coding genes, 2 ribosomal RNA genes and 22 transfer RNA genes. The control region could only be assembled partially. Gene order resembles that of basal arthropods. This is the first partial mitogenome sequence for the stonefly superfamily group Euholognatha and will be useful in future phylogenetic analyses.

UniDrug-target: a computational tool to identify unique drug targets in pathogenic bacteria.

PubMed

Chanumolu, Sree Krishna; Rout, Chittaranjan; Chauhan, Rajinder S

2012-01-01

Targeting conserved proteins of bacteria through antibacterial medications has resulted in both the development of resistant strains and changes to human health by destroying beneficial microbes which eventually become breeding grounds for the evolution of resistances. Despite the availability of more than 800 genomes sequences, 430 pathways, 4743 enzymes, 9257 metabolic reactions and protein (three-dimensional) 3D structures in bacteria, no pathogen-specific computational drug target identification tool has been developed. A web server, UniDrug-Target, which combines bacterial biological information and computational methods to stringently identify pathogen-specific proteins as drug targets, has been designed. Besides predicting pathogen-specific proteins essentiality, chokepoint property, etc., three new algorithms were developed and implemented by using protein sequences, domains, structures, and metabolic reactions for construction of partial metabolic networks (PMNs), determination of conservation in critical residues, and variation analysis of residues forming similar cavities in proteins sequences. First, PMNs are constructed to determine the extent of disturbances in metabolite production by targeting a protein as drug target. Conservation of pathogen-specific protein's critical residues involved in cavity formation and biological function determined at domain-level with low-matching sequences. Last, variation analysis of residues forming similar cavities in proteins sequences from pathogenic versus non-pathogenic bacteria and humans is performed. The server is capable of predicting drug targets for any sequenced pathogenic bacteria having fasta sequences and annotated information. The utility of UniDrug-Target server was demonstrated for Mycobacterium tuberculosis (H37Rv). The UniDrug-Target identified 265 mycobacteria pathogen-specific proteins, including 17 essential proteins which can be potential drug targets. UniDrug-Target is expected to accelerate pathogen-specific drug targets identification which will increase their success and durability as drugs developed against them have less chance to develop resistances and adverse impact on environment. The server is freely available at http://117.211.115.67/UDT/main.html. The standalone application (source codes) is available at http://www.bioinformatics.org/ftp/pub/bioinfojuit/UDT.rar.

Microstructures and Petrology of Melt Inclusions in the Anatectic Sequence of Jubrique (Betic Cordillera, S Spain): Implications for Crustal Anatexis

NASA Astrophysics Data System (ADS)

Acosta-vigil, A.; Barich, A.; Garrido, C. J.; Cesare, B.; Tajčmanová, L.; Bartoli, O.

2014-12-01

We report a new occurrence of melt inclusions in polymetamorphic granulitic gneisses of the Jubrique unit, a complete though thinned crustal section located above the Ronda peridotite slab (Betic Cordillera, S Spain). The gneissic sequence is composed of mylonitic gneisses at the bottom and porphyroblastic gneisses on top. Mylonitic gneisses are strongly deformed rocks with abundant garnet and rare biotite. Except for the presence of melt inclusions, microstructures indicating the former presence of melt are rare or absent. Upwards in the sequence garnet decreases whereas biotite increases in proportion. Melt inclusions are present from cores to rims of garnets throughout the entire sequence. Most of the former melt inclusions are now totally crystallized and correspond to nanogranites, whereas some of them are partially made of glass or, more rarely, are totally glassy. They show negative crystal shapes and range in size from ≈5 to 200 micrometers, with a mean size of ≈30-40 micrometers. Daughter phases in nanogranites and partially crystallized melt inclusions include quartz, feldspars, biotite and muscovite; accidental minerals include kyanite, graphite, zircon, monazite, rutile and ilmenite; glass has a granitic composition. Melt inclusions are mostly similar throughout all the gneissic sequence. Some fluid inclusions, of possible primary origin, are spatially associated with melt inclusions, indicating that at some point during the suprasolidus history of these rocks granitic melt and fluid coexisted. Thermodynamic modeling and conventional thermobarometry of mylonitic gneisses provide peak conditions of ≈850 ºC and 12-14 kbar, corresponding to cores of large garnets with inclusions of kyanite and rutile. Post-peak conditions of ≈800-850 ºC and 5-6 kbar are represented by rim regions of large garnets with inclusions of sillimanite and ilmenite, cordierite-quartz-biotite coronas replacing garnet rims, and the matrix with oriented sillimanite. Previous conventional petrologic studies on these strongly deformed rocks have proposed that anatexis started during decompression from peak to post-peak conditions and in the field of sillimanite. The study of melt inclusions shows, however, that melt was already present in the system at peak conditions, and that most garnet grew in the presence of melt.

Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

PubMed

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2004-09-22

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

Detection of somatic, subclonal and mosaic CNVs from sequencing | Division of Cancer Prevention

Cancer.gov

Progress in technology has made individual genome sequencing a clinical reality, with partial genome sequencing already in use in clinical care. In fact, it is expected that within a few years whole genome sequencing will be a standard procedure that will allow discovering personal genomic variants of all types and thus greatly facilitate individualized medicine. However, fast

Confirmation of a novel siadenovirus species detected in raptors: partial sequence and phylogenetic analysis.

PubMed

Kovács, Endre R; Benko, Mária

2009-03-01

Partial genome characterisation of a novel adenovirus, found recently in organ samples of multiple species of dead birds of prey, was carried out by sequence analysis of PCR-amplified DNA fragments. The virus, named as raptor adenovirus 1 (RAdV-1), has originally been detected by a nested PCR method with consensus primers targeting the adenoviral DNA polymerase gene. Phylogenetic analysis with the deduced amino acid sequence of the small PCR product has implied a new siadenovirus type present in the samples. Since virus isolation attempts remained unsuccessful, further characterisation of this putative novel siadenovirus was carried out with the use of PCR on the infected organ samples. The DNA sequence of the central genome part of RAdV-1, encompassing nine full (pTP, 52K, pIIIa, III, pVII, pX, pVI, hexon, protease) and two partial (DNA polymerase and DBP) genes and exceeding 12 kb pairs in size, was determined. Phylogenetic tree reconstructions, based on several genes, unambiguously confirmed the preliminary classification of RAdV-1 as a new species within the genus Siadenovirus. Further study of RAdV-1 is of interest since it represents a rare adenovirus genus of yet undetermined host origin.

Molecular characterization of Calocedrus rupestris Aver., H.T. Nguyen & L.K. Phan, 2008 (Cupressaceae) based on ITS1 partial sequence.

PubMed

Long, P K; Trang, N T P; Averyanov, L V; Loc, P K

2011-11-21

Calocedrus rupestris Aver., H.T. Nguyen & L.K. Phan was described in 2008 based on some morphological characters that were not sufficiently significant to discriminate it as a species distinct from C. macrolepis Kurz. We applied a new approach to resolve these conflicting views by using sequence data from DNA (ITS) to elucidate phylogenetic relationships between the two species. Analyses of a partial ITS1 sequence in 5 individuals of 2 subpopulations of C. macrolepis and 18 individuals of 8 subpopulations of C. rupestris collected in Vietnam were done. Molecular characterization of the two species showed its low divergence with the lack of autapomorphic characters. In addition, the ITS1 partial sequences of some C. rupestris individuals were identical with C. macrolepis. Due to the less distinctive morphology between C. rupestris and C. macrolepis, the divergence between them does not exceed the interspecific levels, and therefore, C. rupestris could not be regarded as an independent species in relation to C. macrolepis but only as one of its varieties, C. macrolepis var. rupestris (Aver., H.T. Nguyen & L.K. Phan) L.K. Phan, Long K. Phan & Aver.

Species-specific identification of commercial probiotic strains.

PubMed

Yeung, P S M; Sanders, M E; Kitts, C L; Cano, R; Tong, P S

2002-05-01

Products containing probiotic bacteria are gaining popularity, increasing the importance of their accurate speciation. Unfortunately, studies have suggested that improper labeling of probiotic species is common in commercial products. Species identification of a bank of commercial probiotic strains was attempted using partial 16S rDNA sequencing, carbohydrate fermentation analysis, and cellular fatty acid methyl ester analysis. Results from partial 16S rDNA sequencing indicated discrepancies between species designations for 26 out of 58 strains tested, including two ATCC Lactobacillus strains. When considering only the commercial strains obtained directly from the manufacturers, 14 of 29 strains carried species designations different from those obtained by partial 16S rDNA sequencing. Strains from six commercial products were species not listed on the label. The discrepancies mainly occurred in Lactobacillus acidophilus and Lactobacillus casei groups. Carbohydrate fermentation analysis was not sensitive enough to identify species within the L. acidophilus group. Fatty acid methyl ester analysis was found to be variable and inaccurate and is not recommended to identify probiotic lactobacilli.

Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification.

PubMed

Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

2015-05-01

Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. ivan.borozan@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification

PubMed Central

Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

2015-01-01

Motivation: Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Results: Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. Availability and implementation: All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. Contact: ivan.borozan@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573913

Isolation and characterization of adrenoleukodystrophy protein (ALDP) related sequences in the human genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geraghty, M.T.; Stetten, G.; Kearns, W.

1994-09-01

X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less

Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution

PubMed Central

Modahl, Cassandra M.; Mackessy, Stephen P.

2016-01-01

Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides access to cDNA sequences in the absence of living specimens, even from commercial venom sources, to evaluate important regional differences in venom composition and to study snake venom protein evolution. PMID:27280639

Structure of the membrane channel porin from Rhodopseudomonas blastica at 2.0 A resolution.

PubMed Central

Kreusch, A.; Neubüser, A.; Schiltz, E.; Weckesser, J.; Schulz, G. E.

1994-01-01

The crystal structure of a membrane channel, homotrimeric porin from Rhodopseudomonas blastica has been determined at 2.0 A resolution by multiple isomorphous replacement and structural refinement. The current model has an R-factor of 16.5% and consists of 289 amino acids, 238 water molecules, and 3 detergent molecules per subunit. The partial protein sequence and subsequently the complete DNA sequence were determined. The general architecture is similar to those of the structurally known porins. As a particular feature there are 3 adjacent binding sites for n-alkyl chains at the molecular 3-fold axis. The side chain arrangement in the channel indicates a transverse electric field across each of the 3 pore eyelets, which may explain the discrimination against nonpolar solutes. Moreover, there are 2 significantly ordered girdles of aromatic residues at the nonpolar/polar borderlines of the interface between protein and membrane. Possibly, these residues shield the polypeptide conformation against adverse membrane fluctuations. PMID:8142898

Pine Gene Discovery Project - Final Report - 08/31/1997 - 02/28/2001

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whetten, R. W.; Sederoff, R. R.; Kinlaw, C.

2001-04-30

Integration of pines into the large scope of plant biology research depends on study of pines in parallel with study of annual plants, and on availability of research materials from pine to plant biologists interested in comparing pine with annual plant systems. The objectives of the Pine Gene Discovery Project were to obtain 10,000 partial DNA sequences of genes expressed in loblolly pine, to determine which of those pine genes were similar to known genes from other organisms, and to make the DNA sequences and isolated pine genes available to plant researchers to stimulate integration of pines into the widermore » scope of plant biology research. Those objectives have been completed, and the results are available to the public. Requests for pine genes have been received from a number of laboratories that would otherwise not have included pine in their research, indicating that progress is being made toward the goal of integrating pine research into the larger molecular biology research community.« less

Mycobacterium minnesotense sp. nov., a photochromogenic bacterium isolated from sphagnum peat bogs.

PubMed

Hannigan, Geoffrey D; Krivogorsky, Bogdana; Fordice, Daniel; Welch, Jacqueline B; Dahl, John L

2013-01-01

Several intermediate-growing, photochromogenic bacteria were isolated from sphagnum peat bogs in northern Minnesota, USA. Acid-fast staining and 16S rRNA gene sequence analysis placed these environmental isolates in the genus Mycobacterium, and colony morphologies and PCR restriction analysis patterns of the isolates were similar. Partial sequences of hsp65 and dnaJ1 from these isolates showed that Mycobacterium arupense ATCC BAA-1242(T) was the closest mycobacterial relative, and common biochemical characteristics and antibiotic susceptibilities existed between the isolates and M. arupense ATCC BAA-1242(T). However, compared to nonchromogenic M. arupense ATCC BAA-1242(T), the environmental isolates were photochromogenic, had a different mycolic acid profile and had reduced cell-surface hydrophobicity in liquid culture. The data reported here support the conclusion that the isolates are representatives of a novel mycobacterial species, for which the name Mycobacterium minnesotense sp. nov. is proposed. The type strain is DL49(T) (=DSM 45633(T) = JCM 17932(T) = NCCB 100399(T)).

POOL server: machine learning application for functional site prediction in proteins.

PubMed

Somarowthu, Srinivas; Ondrechen, Mary Jo

2012-08-01

We present an automated web server for partial order optimum likelihood (POOL), a machine learning application that combines computed electrostatic and geometric information for high-performance prediction of catalytic residues from 3D structures. Input features consist of THEMATICS electrostatics data and pocket information from ConCavity. THEMATICS measures deviation from typical, sigmoidal titration behavior to identify functionally important residues and ConCavity identifies binding pockets by analyzing the surface geometry of protein structures. Both THEMATICS and ConCavity (structure only) do not require the query protein to have any sequence or structure similarity to other proteins. Hence, POOL is applicable to proteins with novel folds and engineered proteins. As an additional option for cases where sequence homologues are available, users can include evolutionary information from INTREPID for enhanced accuracy in site prediction. The web site is free and open to all users with no login requirements at http://www.pool.neu.edu. m.ondrechen@neu.edu Supplementary data are available at Bioinformatics online.

Ependymin, a gene involved in regeneration and neuroplasticity in vertebrates, is overexpressed during regeneration in the echinoderm Holothuria glaberrima.

PubMed

Suárez-Castillo, Edna C; Medina-Ortíz, Wanda E; Roig-López, José L; García-Arrarás, José E

2004-06-09

We report the characterization of an ependymin-related gene (EpenHg) from a regenerating intestine cDNA library of the sea cucumber Holothuria glaberrima. This finding is remarkable because no ependymin sequence has ever been reported from invertebrates. Database comparisons of the conceptual translation of the EpenHg gene reveal 63% similarity (47% identity) with mammalian ependymin-related proteins (MERPs) and close relationship with the frog and piscine ependymins. We also report the partial sequences of ependymin representatives from another species of sea cucumber and from a sea urchin species. Conventional and real-time reverse transcriptase polymerase chain reaction (RT-PCRs) show that the gene is expressed in several echinoderm tissues, including esophagus, mesenteries, gonads, respiratory trees, hemal system, tentacles and body wall. Moreover, the ependymin product in the intestine is overexpressed during sea cucumber intestinal regeneration. The discovery of ependymins in echinoderms, a group well known for their regenerative capacities, can give us an insight on the evolution and roles of ependymin molecules.

Isolation and identification of efficient Egyptian malathion-degrading bacterial isolates.

PubMed

Hamouda, S A; Marzouk, M A; Abbassy, M A; Abd-El-Haleem, D A; Shamseldin, Abdelaal

2015-03-01

Bacterial isolates degrading malathion were isolated from the soil and agricultural waste water due to their ability to grow on minimal salt media amended with malathion as a sole carbon source. Efficiencies of native Egyptian bacterial malathion-degrading isolates were investigated and the study generated nine highly effective malathion-degrading bacterial strains among 40. Strains were identified by partial sequencing of 16S rDNA analysis. Comparative analysis of 16S rDNA sequences revealed that these bacteria are similar with the genus Acinetobacter and Bacillus spp. and RFLP based PCR of 16S rDNA gave four different RFLP patterns among strains with enzyme HinfI while with enzyme HaeI they gave two RFLP profiles. The degradation rate of malathion in liquid culture was estimated using gas chromatography. Bacterial strains could degrade more than 90% of the initial malathion concentration (1000 ppm) within 4 days. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effective, homogeneous and transient interference with cytosine methylation in plant genomic DNA by zebularine

PubMed Central

Baubec, Tuncay; Pecinka, Ales; Rozhon, Wilfried; Mittelsten Scheid, Ortrun

2009-01-01

Covalent modification by methylation of cytosine residues represents an important epigenetic hallmark. While sequence analysis after bisulphite conversion allows correlative analyses with single-base resolution, functional analysis by interference with DNA methylation is less precise, due to the complexity of methylation enzymes and their targets. A cytidine analogue, 5-azacytidine, is frequently used as an inhibitor of DNA methyltransferases, but its rapid degradation in aqueous solution is problematic for culture periods of longer than a few hours. Application of zebularine, a more stable cytidine analogue with a similar mode of action that is successfully used as a methylation inhibitor in Neurospora and mammalian tumour cell lines, can significantly reduce DNA methylation in plants in a dose-dependent and transient manner independent of sequence context. Demethylation is connected with transcriptional reactivation and partial decondensation of heterochromatin. Zebularine represents a promising new and versatile tool for investigating the role of DNA methylation in plants with regard to transcriptional control, maintenance and formation of (hetero-) chromatin. PMID:18826433

Herpesvirus papio: state and properties of intracellular viral DNA in baboon lymphoblastoid cell lines.

PubMed

Falk, L; Lindahl, T; Bjursell, G; Klein, G

1979-07-15

Herpesvirus papio (HVP) is an indigenous B-lymphotropic virus of baboons (Papio sp.) present in latent form in baboon lymphoblastoid cell lines. It shares cross-reacting viral capsid and early antigens with the Epstein-Barr virus (EBV), and HVP DNA and EBV DNA show partial sequence homology. EBV-specific complementary RNA was employed here as a probe to investigate the physical state of the HVP DNA component in baboon lymphoblastoid cells after fractionation of cellular DNA by density gradient centrifugation. Five virus-producing cultures contained both free and integrated HVP DNA sequences while one non-producing cell line had two or three viral genome equivalents per cell in an apparently integrated form. Further analysis of one virus-producing line showed that the free HVP DNA fraction was composed of both linear and circular viral DNA. Contour length measurements of HVP circular DNA molecules by electron microscopy revealed that they were similar in length to the EBV circular DNA present in human lymphoblastoid cells.

First description of atypical furunculosis in freshwater farmed Atlantic salmon, Salmo salar L., in Chile.

PubMed

Godoy, M; Gherardelli, V; Heisinger, A; Fernández, J; Olmos, P; Ovalle, L; Ilardi, P; Avendaño-Herrera, R

2010-05-01

We report the first isolation, identification and characterization of a group of Chilean strains of atypical Aeromonas salmonicida isolated from freshwater farmed Atlantic salmon, Salmo salar. Affected fish showed superficial ulcers and pale liver with or without petechial haemorrhages. Outbreaks of the disease occurred in two farms in the south of Chile about 2200 km apart. Five strains were isolated in pure culture and identified by serological assays and immunofluorescence tests as belonging to Aeromonas salmonicida. Although the bacterial isolates were phenotypically homogeneous, minor differences with the reference strain A. salmonicida subsp. salmonicida ATCC 33658 were noted. Three specific primer sets and partial 16S rRNA gene sequencing allowed the identification of the Chilean isolates as atypical A. salmonicida, with A. salmonicida subsp. achromogenes and A. salmonicida subsp. masoucida as their closest relatives (100% sequence similarity). Molecular typing indicated that the atypical isolates belong to two genetic groups that were associated with the geographical origin.

The First Siphoviridae Family Bacteriophages Infecting Bordetella bronchiseptica Isolated from Environment.

PubMed

Petrovic, Aleksandra; Kostanjsek, Rok; Rakhely, Gabor; Knezevic, Petar

2017-02-01

Bordetella bronchiseptica is a well-known etiological agent of kennel cough in dogs and cats and one of the two causative agents of atrophic rhinitis, a serious swine disease. The aim of the study was to isolate B. bronchiseptica bacteriophages from environmental samples for the first time. A total of 29 phages from 65 water samples were isolated using the strain ATCC 10580 as a host. The lytic spectra of the phages were examined at 25 and 37 °C, using 12 strains of B. bronchiseptica. All phages were able to plaque on 25.0 % to 41.7 % of the strains. The selected phages showed similar morphology (Siphoviridae, morphotype B2), but variation of RFLP patterns and efficacy of plating on various strains. The partial genome sequence of phage vB_BbrS_CN1 showed its similarity to phages from genus Yuavirus. Using PCR, it was confirmed that the phages do not originate from the host strain, and environmental origin was additionally confirmed by the analysis of host genome sequence in silico and plating heated and unheated samples in parallel. Accordingly, this is the first isolation of B. bronchiseptica phages from environment and the first isolation and characterization of phages of B. bronchiseptica belonging to family Siphoviridae.

Heterogenity of Echinococcus canadensis genotype 6 - the main causative agent of cystic echinococcosis in Birjand, Eastern Iran.

PubMed

Karamian, Mehdi; Haghighi, Fatemeh; Hemmati, Mina; Taylor, Walter Robert; Salehabadi, Alireza; Ghatee, Mohammad Amin

2017-10-15

Little is known about the genotypes of Echinococcus spp. and their life cycles in eastern Iran. We analysed the partial sequences of the nad1 and cox1 genes from 17 isolates from hydatid cyst-infected patients (n=9), camels (n=5) and sheep (n=3) in Birjand, eastern Iran. A new primer pair was also used to amplify the long fragment (1180bp) of the cox1 gene. All camel and eight human isolates were G6 strains of Echinococcus canadensis while one human isolate and the three sheep isolates were G1 genotypes (sheep strain) of E. granulosus sensu stricto (s.s.). Nad1 and cox1 sequence analyses showed high G6 genetic homogeneity, similar to previously reported G6 strains from southeast and central Iran, Sudan and Mauritania. Low nucleotide and haplotype diversity similar to G6 strains from Russia (Altai republic) and Kazakhstan was also found, consistent with a bottleneck effect. In this study, G6 was the most common Echinococcus genotype. Genetic homogeneity of east, southeast and central Iranian G6 and its low genetic diversity may be due limited mobility and contact between humans and camels from other regions because of large, inhospitable deserts. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular characterization of crane Coccidia, Eimeria gruis and E. reichenowi, found in feces of migratory cranes.

PubMed

Matsubayashi, Makoto; Takami, Kazutoshi; Abe, Niichiro; Kimata, Isao; Tani, Hiroyuki; Sasai, Kazumi; Baba, Eiichiroh

2005-08-01

Eimeria gruis and E. reichenowi have lethal pathogenicity to a number of species of cranes. These parasites develop at multiple organs or tissues in infected cranes, thus lacking the specificity of infection sites shown by other Eimeria spp. in spite of morphologic similarity. To date, there have been many reports of crane Eimeria infections, however, genetic examinations of these parasites have never been published. In the present study, we isolated oocysts of E. gruis and E. reichenowi from crane feces at a wintering area in Japan. By phylogenic analysis, we first demonstrated that partial sequences of the isolates formed their own cluster, located separately from other Eimeria spp.

Chemical synthesis of 2',5'-oligoribonucleotides.

PubMed

Hirao, I; Nishino, S; Kamaike, K; Nishiyama, S; Ueda, S; Yamamoto, H; Ishido, Y

1983-01-01

Partial phenylcarbamoylation of ribonucleosides by metal carboxylates - phenyl isocyanate system was found to be induced at 2'-position with high regioselectivity in good yields, similar to that by amines - phenyl isocyanate system; these results prompted us to perform synthesis of oligoribonucleotides bearing 2'-5' phosphodiester linkage starting either from 5'-0-acetyl-2'-0-phenylcarbamoyl or from 2', 5'-bis(phenylcarbamo)yl derivatives through the sequence of reactions, i.e. tetrahydropyranylation at 3'-position, decarbamoylation and deacylation with sodium methoxide in methanol both at 2'- and 5'-positions, dimethoxytritylation at 5'-position, and phosphorylation at 2'-position with 5-chloro-8-quinolylphosphate/8-quinolinesulfonyl chloride, followed by the usual coupling procedures by Takaku et al).

Analysis of the Function of a Putative 2,3-Diphosphoglyceric Acid-Dependent Phosphoglycerate Mutase from Bacillus subtilis

PubMed Central

Pearson, Claire L.; Loshon, Charles A.; Pedersen, Lotte B.; Setlow, Barbara; Setlow, Peter

2000-01-01

A Bacillus subtilis gene termed yhfR encodes the only B. subtilis protein with significant sequence similarity to 2,3-diphosphoglycerate-dependent phosphoglycerate mutases (dPGM). This gene is expressed at a low level during growth and sporulation, but deletion of yhfR had no effect on growth, sporulation, or spore germination and outgrowth. YhfR was expressed in and partially purified from Escherichia coli but had little if any PGM activity and gave no detectable PGM activity in B. subtilis. These data indicate that B. subtilis does not require YhfR and most likely does not require a dPGM. PMID:10869096

Analysis of expressed sequence tags of the cyclically parthenogenetic rotifer Brachionus plicatilis.

PubMed

Suga, Koushirou; Welch, David Mark; Tanaka, Yukari; Sakakura, Yoshitaka; Hagiwara, Atsushi

2007-08-01

Rotifers are among the most common non-arthropod animals and are the most experimentally tractable members of the basal assemblage of metazoan phyla known as Gnathifera. The monogonont rotifer Brachionus plicatilis is a developing model system for ecotoxicology, aquatic ecology, cryptic speciation, and the evolution of sex, and is an important food source for finfish aquaculture. However, basic knowledge of the genome and transcriptome of any rotifer species has been lacking. We generated and partially sequenced a cDNA library from B. plicatilis and constructed a database of over 2300 expressed sequence tags corresponding to more than 450 transcripts. About 20% of the transcripts had no significant similarity to database sequences by BLAST; most of these contained open reading frames of significant length but few had recognized Pfam motifs. Sixteen transcripts accounted for 25% of the ESTs; four of these had no significant similarity to BLAST or Pfam databases. Putative up- and downstream untranslated regions are relatively short and AT rich. In contrast to bdelloid rotifers, there was no evidence of a conserved trans-spliced leader sequence among the transcripts and most genes were single-copy. Despite the small size of this EST project it revealed several important features of the rotifer transcriptome and of individual monogonont genes. Because there is little genomic data for Gnathifera, the transcripts we found with no known function may represent genes that are species-, class-, phylum- or even superphylum-specific; the fact that some are among the most highly expressed indicates their importance. The absence of trans-spliced leader exons in this monogonont species contrasts with their abundance in bdelloid rotifers and indicates that the presence of this phenomenon can vary at the subphylum level. Our EST database provides a relatively large quantity of transcript-level data for B. plicatilis, and more generally of rotifers and other gnathiferan phyla, and can be browsed and searched at gmod.mbl.edu.

Analysis of Expressed Sequence Tags of the Cyclically Parthenogenetic Rotifer Brachionus plicatilis

PubMed Central

Suga, Koushirou; Mark Welch, David; Tanaka, Yukari; Sakakura, Yoshitaka; Hagiwara, Atsushi

2007-01-01

Background Rotifers are among the most common non-arthropod animals and are the most experimentally tractable members of the basal assemblage of metazoan phyla known as Gnathifera. The monogonont rotifer Brachionus plicatilis is a developing model system for ecotoxicology, aquatic ecology, cryptic speciation, and the evolution of sex, and is an important food source for finfish aquaculture. However, basic knowledge of the genome and transcriptome of any rotifer species has been lacking. Methodology/Principal Findings We generated and partially sequenced a cDNA library from B. plicatilis and constructed a database of over 2300 expressed sequence tags corresponding to more than 450 transcripts. About 20% of the transcripts had no significant similarity to database sequences by BLAST; most of these contained open reading frames of significant length but few had recognized Pfam motifs. Sixteen transcripts accounted for 25% of the ESTs; four of these had no significant similarity to BLAST or Pfam databases. Putative up- and downstream untranslated regions are relatively short and AT rich. In contrast to bdelloid rotifers, there was no evidence of a conserved trans-spliced leader sequence among the transcripts and most genes were single-copy. Conclusions/Significance Despite the small size of this EST project it revealed several important features of the rotifer transcriptome and of individual monogonont genes. Because there is little genomic data for Gnathifera, the transcripts we found with no known function may represent genes that are species-, class-, phylum- or even superphylum-specific; the fact that some are among the most highly expressed indicates their importance. The absence of trans-spliced leader exons in this monogonont species contrasts with their abundance in bdelloid rotifers and indicates that the presence of this phenomenon can vary at the subphylum level. Our EST database provides a relatively large quantity of transcript-level data for B. plicatilis, and more generally of rotifers and other gnathiferan phyla, and can be browsed and searched at gmod.mbl.edu. PMID:17668053

Genes encoding two Theileria parva antigens recognized by CD8+ T-cells exhibit sequence diversity in South Sudanese cattle populations but the majority of alleles are similar to the Muguga component of the live vaccine cocktail

PubMed Central

Pelle, Roger; Mwacharo, Joram M.; Njahira, Moses N.; Marcellino, Wani L.; Kiara, Henry; Malak, Agol K.; EL Hussein, Abdel Rahim M.; Bishop, Richard; Skilton, Robert A.

2017-01-01

East Coast fever (ECF), caused by Theileria parva infection, is a frequently fatal disease of cattle in eastern, central and southern Africa, and an emerging disease in South Sudan. Immunization using the infection and treatment method (ITM) is increasingly being used for control in countries affected by ECF, but not yet in South Sudan. It has been reported that CD8+ T-cell lymphocytes specific for parasitized cells play a central role in the immunity induced by ITM and a number of T. parva antigens recognized by parasite-specific CD8+ T-cells have been identified. In this study we determined the sequence diversity among two of these antigens, Tp1 and Tp2, which are under evaluation as candidates for inclusion in a sub-unit vaccine. T. parva samples (n = 81) obtained from cattle in four geographical regions of South Sudan were studied for sequence polymorphism in partial sequences of the Tp1 and Tp2 genes. Eight positions (1.97%) in Tp1 and 78 positions (15.48%) in Tp2 were shown to be polymorphic, giving rise to four and 14 antigen variants in Tp1 and Tp2, respectively. The overall nucleotide diversity in the Tp1 and Tp2 genes was π = 1.65% and π = 4.76%, respectively. The parasites were sampled from regions approximately 300 km apart, but there was limited evidence for genetic differentiation between populations. Analyses of the sequences revealed limited numbers of amino acid polymorphisms both overall and in residues within the mapped CD8+ T-cell epitopes. Although novel epitopes were identified in the samples from South Sudan, a large number of the samples harboured several epitopes in both antigens that were similar to those in the T. parva Muguga reference stock, which is a key component in the widely used live vaccine cocktail. PMID:28231338

SARNAclust: Semi-automatic detection of RNA protein binding motifs from immunoprecipitation data

PubMed Central

Dotu, Ivan; Adamson, Scott I.; Coleman, Benjamin; Fournier, Cyril; Ricart-Altimiras, Emma; Eyras, Eduardo

2018-01-01

RNA-protein binding is critical to gene regulation, controlling fundamental processes including splicing, translation, localization and stability, and aberrant RNA-protein interactions are known to play a role in a wide variety of diseases. However, molecular understanding of RNA-protein interactions remains limited; in particular, identification of RNA motifs that bind proteins has long been challenging, especially when such motifs depend on both sequence and structure. Moreover, although RNA binding proteins (RBPs) often contain more than one binding domain, algorithms capable of identifying more than one binding motif simultaneously have not been developed. In this paper we present a novel pipeline to determine binding peaks in crosslinking immunoprecipitation (CLIP) data, to discover multiple possible RNA sequence/structure motifs among them, and to experimentally validate such motifs. At the core is a new semi-automatic algorithm SARNAclust, the first unsupervised method to identify and deconvolve multiple sequence/structure motifs simultaneously. SARNAclust computes similarity between sequence/structure objects using a graph kernel, providing the ability to isolate the impact of specific features through the bulge graph formalism. Application of SARNAclust to synthetic data shows its capability of clustering 5 motifs at once with a V-measure value of over 0.95, while GraphClust achieves only a V-measure of 0.083 and RNAcontext cannot detect any of the motifs. When applied to existing eCLIP sets, SARNAclust finds known motifs for SLBP and HNRNPC and novel motifs for several other RBPs such as AGGF1, AKAP8L and ILF3. We demonstrate an experimental validation protocol, a targeted Bind-n-Seq-like high-throughput sequencing approach that relies on RNA inverse folding for oligo pool design, that can validate the components within the SLBP motif. Finally, we use this protocol to experimentally interrogate the SARNAclust motif predictions for protein ILF3. Our results support a newly identified partially double-stranded UUUUUGAGA motif similar to that known for the splicing factor HNRNPC. PMID:29596423

On new classes of solutions of nonlinear partial differential equations in the form of convergent special series

NASA Astrophysics Data System (ADS)

Filimonov, M. Yu.

2017-12-01

The method of special series with recursively calculated coefficients is used to solve nonlinear partial differential equations. The recurrence of finding the coefficients of the series is achieved due to a special choice of functions, in powers of which the solution is expanded in a series. We obtain a sequence of linear partial differential equations to find the coefficients of the series constructed. In many cases, one can deal with a sequence of linear ordinary differential equations. We construct classes of solutions in the form of convergent series for a certain class of nonlinear evolution equations. A new class of solutions of generalized Boussinesque equation with an arbitrary function in the form of a convergent series is constructed.

Towards pathogenomics: a web-based resource for pathogenicity islands

PubMed Central

Yoon, Sung Ho; Park, Young-Kyu; Lee, Soohyun; Choi, Doil; Oh, Tae Kwang; Hur, Cheol-Goo; Kim, Jihyun F.

2007-01-01

Pathogenicity islands (PAIs) are genetic elements whose products are essential to the process of disease development. They have been horizontally (laterally) transferred from other microbes and are important in evolution of pathogenesis. In this study, a comprehensive database and search engines specialized for PAIs were established. The pathogenicity island database (PAIDB) is a comprehensive relational database of all the reported PAIs and potential PAI regions which were predicted by a method that combines feature-based analysis and similarity-based analysis. Also, using the PAI Finder search application, a multi-sequence query can be analyzed onsite for the presence of potential PAIs. As of April 2006, PAIDB contains 112 types of PAIs and 889 GenBank accessions containing either partial or all PAI loci previously reported in the literature, which are present in 497 strains of pathogenic bacteria. The database also offers 310 candidate PAIs predicted from 118 sequenced prokaryotic genomes. With the increasing number of prokaryotic genomes without functional inference and sequenced genetic regions of suspected involvement in diseases, this web-based, user-friendly resource has the potential to be of significant use in pathogenomics. PAIDB is freely accessible at . PMID:17090594

Rhizobial characterization in revegetated areas after bauxite mining.

PubMed

Borges, Wardsson Lustrino; Prin, Yves; Ducousso, Marc; Le Roux, Christine; de Faria, Sergio Miana

2016-01-01

Little is known regarding how the increased diversity of nitrogen-fixing bacteria contributes to the productivity and diversity of plants in complex communities. However, some authors have shown that the presence of a diverse group of nodulating bacteria is required for different plant species to coexist. A better understanding of the plant symbiotic organism diversity role in natural ecosystems can be extremely useful to define recovery strategies of environments that were degraded by human activities. This study used ARDRA, BOX-PCR fingerprinting and sequencing of the 16S rDNA gene to assess the diversity of root nodule nitrogen-fixing bacteria in former bauxite mining areas that were replanted in 1981, 1985, 1993, 1998, 2004 and 2006 and in a native forest. Among the 12 isolates for which the 16S rDNA gene was partially sequenced, eight, three and one isolate(s) presented similarity with sequences of the genera Bradyrhizobium, Rhizobium and Mesorhizobium, respectively. The richness, Shannon and evenness indices were the highest in the area that was replanted the earliest (1981) and the lowest in the area that was replanted most recently (2006). Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Isolation and Molecular Characterization of Novel Infectious Bronchitis Virus Variants from Vaccinated Broiler Flocks in Egypt.

PubMed

Abdel-Sabour, Mohammed A; Al-Ebshahy, Emad M; Khaliel, Samy A; Abdel-Wanis, Nabil A; Yanai, Tokuma

2017-09-01

The present study aimed to determine the molecular characteristics of circulating infectious bronchitis virus (IBV) strains in vaccinated broiler flocks in the Giza and Fayoum governorates. Thirty-four isolates were collected, and egg propagation revealed their ability to induce typical IBV lesions after three to five successive passages. Three selected isolates were identified as IBV using a real-time reverse transcriptase-PCR assay targeted the nucleocapsid (N) gene and further characterized by partial spike (S) gene sequence analysis. Phylogenetic analysis revealed their clustering into two variant groups. Group I consisted of one variant (VSVRI_F3), which had 99.1% nucleotide sequence identity to the Q1 reference strain. Group II consisted of variants VSVRI_G4 and VSVRI_G9, which showed 92.8%-94.3% nucleotide identity with the Egyptian variants Eg/12120S/2012, Eg/12197B/2012, and Eg/1265B/2012. Regarding the deduced amino acid sequence, the three variants had 77.1%-85.2% similarity with the vaccine strains currently used in Egypt. These findings highlight the importance of monitoring the prevalence of IBV variants in vaccinated broiler flocks as well as adopting an appropriate vaccination strategy.

Assessment of the microbial diversity of Brazilian kefir grains by PCR-DGGE and pyrosequencing analysis.

PubMed

Leite, A M O; Mayo, B; Rachid, C T C C; Peixoto, R S; Silva, J T; Paschoalin, V M F; Delgado, S

2012-09-01

The microbial diversity and community structure of three different kefir grains from different parts of Brazil were examined via the combination of two culture-independent methods: PCR-denaturing gradient gel electrophoresis (PCR-DGGE) and pyrosequencing. PCR-DGGE showed Lactobacillus kefiranofaciens and Lactobacillus kefiri to be the major bacterial populations in all three grains. The yeast community was dominated by Saccharomyces cerevisiae. Pyrosequencing produced a total of 14,314 partial 16S rDNA sequence reads from the three grains. Sequence analysis grouped the reads into three phyla, of which Firmicutes was dominant. Members of the genus Lactobacillus were the most abundant operational taxonomic units (OTUs) in all samples, accounting for up to 96% of the sequences. OTUs belonging to other lactic and acetic acid bacteria genera, such as Lactococcus, Leuconostoc, Streptococcus and Acetobacter, were also identified at low levels. Two of the grains showed identical DGGE profiles and a similar number of OTUs, while the third sample showed the highest diversity by both techniques. Pyrosequencing allowed the identification of bacteria that were present in small numbers and rarely associated with the microbial community of this complex ecosystem. Copyright © 2012 Elsevier Ltd. All rights reserved.

First insight into dead wood protistan diversity: a molecular sampling of bright-spored Myxomycetes (Amoebozoa, slime-moulds) in decaying beech logs.

PubMed

Clissmann, Fionn; Fiore-Donno, Anna Maria; Hoppe, Björn; Krüger, Dirk; Kahl, Tiemo; Unterseher, Martin; Schnittler, Martin

2015-06-01

Decaying wood hosts a large diversity of seldom investigated protists. Environmental sequencing offers novel insights into communities, but has rarely been applied to saproxylic protists. We investigated the diversity of bright-spored wood-inhabiting Myxomycetes by environmental sequencing. Myxomycetes have a complex life cycle culminating in the formation of mainly macroscopic fruiting bodies, highly variable in shape and colour that are often found on decaying logs. Our hypothesis was that diversity of bright-spored Myxomycetes would increase with decay. DNA was extracted from wood chips collected from 17 beech logs of varying decay stages from the Hainich-Dün region in Central Germany. We obtained 260 partial small subunit ribosomal RNA gene sequences of bright-spored Myxomycetes that were assembled into 29 OTUs, of which 65% were less than 98% similar to those in the existing database. The OTU richness revealed by molecular analysis surpassed that of a parallel inventory of fruiting bodies. We tested several environmental variables and identified pH, rather than decay stage, as the main structuring factor of myxomycete distribution. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Novel molecular approach to define pest species status and tritrophic interactions from historical Bemisia specimens.

PubMed

Tay, W T; Elfekih, S; Polaszek, A; Court, L N; Evans, G A; Gordon, K H J; De Barro, P J

2017-03-27

Museum specimens represent valuable genomic resources for understanding host-endosymbiont/parasitoid evolutionary relationships, resolving species complexes and nomenclatural problems. However, museum collections suffer DNA degradation, making them challenging for molecular-based studies. Here, the mitogenomes of a single 1912 Sri Lankan Bemisia emiliae cotype puparium, and of a 1942 Japanese Bemisia puparium are characterised using a Next-Generation Sequencing approach. Whiteflies are small sap-sucking insects including B. tabaci pest species complex. Bemisia emiliae's draft mitogenome showed a high degree of homology with published B. tabaci mitogenomes, and exhibited 98-100% partial mitochondrial DNA Cytochrome Oxidase I (mtCOI) gene identity with the B. tabaci species known as Asia II-7. The partial mtCOI gene of the Japanese specimen shared 99% sequence identity with the Bemisia 'JpL' genetic group. Metagenomic analysis identified bacterial sequences in both Bemisia specimens, while hymenopteran sequences were also identified in the Japanese Bemisia puparium, including complete mtCOI and rRNA genes, and various partial mtDNA genes. At 88-90% mtCOI sequence identity to Aphelinidae wasps, we concluded that the 1942 Bemisia nymph was parasitized by an Eretmocerus parasitoid wasp. Our approach enables the characterisation of genomes and associated metagenomic communities of museum specimens using 1.5 ng gDNA, and to infer historical tritrophic relationships in Bemisia whiteflies.

Event-related potential correlates of declarative and non-declarative sequence knowledge.

PubMed

Ferdinand, Nicola K; Rünger, Dennis; Frensch, Peter A; Mecklinger, Axel

2010-07-01

The goal of the present study was to demonstrate that declarative and non-declarative knowledge acquired in an incidental sequence learning task contributes differentially to memory retrieval and leads to dissociable ERP signatures in a recognition memory task. For this purpose, participants performed a sequence learning task and were classified as verbalizers, partial verbalizers, or nonverbalizers according to their ability to verbally report the systematic response sequence. Thereafter, ERPs were recorded in a recognition memory task time-locked to sequence triplets that were either part of the previously learned sequence or not. Although all three groups executed old sequence triplets faster than new triplets in the recognition memory task, qualitatively distinct ERP patterns were found for participants with and without reportable knowledge. Verbalizers and, to a lesser extent, partial verbalizers showed an ERP correlate of recollection for parts of the incidentally learned sequence. In contrast, nonverbalizers showed a different ERP effect with a reverse polarity that might reflect priming. This indicates that an ensemble of qualitatively different processes is at work when declarative and non-declarative sequence knowledge is retrieved. By this, our findings favor a multiple-systems view postulating that explicit and implicit learning are supported by different and functionally independent systems. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.

2005-08-26

Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. Amore » minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.« less

Identification of the Bovine Arachnomelia Mutation by Massively Parallel Sequencing Implicates Sulfite Oxidase (SUOX) in Bone Development

PubMed Central

Drögemüller, Cord; Tetens, Jens; Sigurdsson, Snaevar; Gentile, Arcangelo; Testoni, Stefania; Lindblad-Toh, Kerstin; Leeb, Tosso

2010-01-01

Arachnomelia is a monogenic recessive defect of skeletal development in cattle. The causative mutation was previously mapped to a ∼7 Mb interval on chromosome 5. Here we show that array-based sequence capture and massively parallel sequencing technology, combined with the typical family structure in livestock populations, facilitates the identification of the causative mutation. We re-sequenced the entire critical interval in a healthy partially inbred cow carrying one copy of the critical chromosome segment in its ancestral state and one copy of the same segment with the arachnomelia mutation, and we detected a single heterozygous position. The genetic makeup of several partially inbred cattle provides extremely strong support for the causality of this mutation. The mutation represents a single base insertion leading to a premature stop codon in the coding sequence of the SUOX gene and is perfectly associated with the arachnomelia phenotype. Our findings suggest an important role for sulfite oxidase in bone development. PMID:20865119

New partial sequences of phosphoenolpyruvate carboxylase as molecular phylogenetic markers.

PubMed

Gehrig, H; Heute, V; Kluge, M

2001-08-01

To better understand the evolution of the enzyme phosphoenolpyruvate carboxylase (PEPC) and to test its versatility as a molecular character in phylogenetic and taxonomic studies, we have characterized and compared 70 new partial PEPC nucleotide and amino acid sequences (about 1100 bp of the 3' side of the gene) from 50 plant species (24 species of Bryophyta, 1 of Pteridophyta, and 25 of Spermatophyta). Together with previously published data, the new set of sequences allowed us to construct the up to now most complete phylogenetic tree of PEPC, where the PEPC sequences cluster according to both the taxonomic positions of the donor plants and the assumed specific function of the PEPC isoforms. Altogether, the study further strengthens the view that PEPC sequences can provide interesting information for the reconstruction of phylogenetic relations between organisms and metabolic pathways. To avoid confusion in future discussion, we propose a new nomenclature for the denotation of PEPC isoforms. Copyright 2001 Academic Press.

New high through put approach to study ancient microbial phylogenetic diversity in permafrost

NASA Astrophysics Data System (ADS)

Spirina, E.; Cole, J.; Chai, B.; Gilichinksy, D.; Tiedje, J.

2003-04-01

The study of microbial diversity in the deep ancient permafrost can help to answer many questions: (1) what kind of mechanisms keeps microbial cells alive, (2) how many of phylogenetic groups exist in situ and never had been cultivated, (3) what is the difference between modern and ancient microorganisms? From this point, distinct environments were examined: Arctic and Antarctic modern soil and permafrost. 16S rDNA genes were amplified from genomic DNA extracted from both original frozen samples and the same samples incubated at 10oC for 8 weeks under both aerobic and anaerobic conditions to determine those capable to grow. High throughput DNA sequencing was performed on the cloned PCR products to obtain partial 16S rDNA gene sequences. The unique script was written to automatically compare over 2,000 partial sequences with those rrn sequences in the Ribosomal Database Project (RDP) release 8.1 using the SEQUENCE MATCH. Sequences were grouped into categories from the RDPs phylogenetic hierarchy based on the closest database matches. Investigation revealed significant microbial diversity; two phylogenetic groups were predominant in all samples: Proteobacteria and Gram Positive Bacteria. Microbial community composition within those groups is different from sample to sample. However, similar genera, such as Arthrobacter, Bacillus, Citrobacter, Caulobacter, Comamonas, Flavobacterium, Nocardioides, Pseudomonas, Rhodocyclus, Rhodococcus, Sphingobacterium, Sphingomonas, Streptococcus, Terrabacter appeared in both polar regions. The greatest microbial diversity was detected in Arctic surface samples. According to RDPs phylogenetic hierarchy those organisms are related to Proteobacteria_SD, Gram Positive Bacteria_SD, Leptospirillum-Nitrospira, Nitrospina_SD, Flexibacter-Cytophaga-Bacteroides, Planctomyces and Relatives. Both the aerobic and anaerobic low temperatures soil incubation yielded some microbes not detected in the original samples. It should be possible, using phylogenetic diversity from the same organisms from modern top layers to the several millions years old, to find out what are the differences among members of the same species as we go back in time. Then, if we compare those mutations rate with geological time, we can speculate on how fast or slow evolution or adaptation takes place and for that particular type of organism. This is a beginning of studies concerning the biological clocks extending back the duration of the permanently frozen state in the terrestrial and extraterrestrial soils, i. e. the age of biota.

A generalized global alignment algorithm.

PubMed

Huang, Xiaoqiu; Chao, Kun-Mao

2003-01-22

Homologous sequences are sometimes similar over some regions but different over other regions. Homologous sequences have a much lower global similarity if the different regions are much longer than the similar regions. We present a generalized global alignment algorithm for comparing sequences with intermittent similarities, an ordered list of similar regions separated by different regions. A generalized global alignment model is defined to handle sequences with intermittent similarities. A dynamic programming algorithm is designed to compute an optimal general alignment in time proportional to the product of sequence lengths and in space proportional to the sum of sequence lengths. The algorithm is implemented as a computer program named GAP3 (Global Alignment Program Version 3). The generalized global alignment model is validated by experimental results produced with GAP3 on both DNA and protein sequences. The GAP3 program extends the ability of standard global alignment programs to recognize homologous sequences of lower similarity. The GAP3 program is freely available for academic use at http://bioinformatics.iastate.edu/aat/align/align.html.

Partial DNA-guided Cas9 enables genome editing with reduced off-target activity

PubMed Central

Yin, Hao; Song, Chun-Qing; Suresh, Sneha; Kwan, Suet-Yan; Wu, Qiongqiong; Walsh, Stephen; Ding, Junmei; Bogorad, Roman L; Zhu, Lihua Julie; Wolfe, Scot A; Koteliansky, Victor; Xue, Wen; Langer, Robert; Anderson, Daniel G

2018-01-01

CRISPR–Cas9 is a versatile RNA-guided genome editing tool. Here we demonstrate that partial replacement of RNA nucleotides with DNA nucleotides in CRISPR RNA (crRNA) enables efficient gene editing in human cells. This strategy of partial DNA replacement retains on-target activity when used with both crRNA and sgRNA, as well as with multiple guide sequences. Partial DNA replacement also works for crRNA of Cpf1, another CRISPR system. We find that partial DNA replacement in the guide sequence significantly reduces off-target genome editing through focused analysis of off-target cleavage, measurement of mismatch tolerance and genome-wide profiling of off-target sites. Using the structure of the Cas9–sgRNA complex as a guide, the majority of the 3′ end of crRNA can be replaced with DNA nucleotide, and the 5 - and 3′-DNA-replaced crRNA enables efficient genome editing. Cas9 guided by a DNA–RNA chimera may provide a generalized strategy to reduce both the cost and the off-target genome editing in human cells. PMID:29377001

In vitro isolation and molecular characterization of an Ehrlichia canis strain from São Paulo, Brazil

PubMed Central

Aguiar, Daniel M.; Hagiwara, Mitika K.; Labruna, Marcelo B.

2008-01-01

An Ehrlichia canis isolate was obtained from an naturally infected dog exhibiting clinical signs of ehrlichiosis in São Paulo Municipality, state of São Paulo, Brazil. The isolate was characterized by PCR and DNA sequencing of portions of the ehrlichial genes dsb, 16SrRNA, and p28. Partial dsb and 16S rRNA sequences were identical to three and five other E. canis strains, respectively, from different countries and continents (including North America, Africa, Asia and Europe). Conversely, the p28 partial sequence for this E. canis (São Paulo) differed by 1, 2, and 2 nucleotides from the corresponding sequences of the E. canis strains Jake (from USA), Oklahoma (USA), and VHE (Venezuela), respectively. The results in this study indicate that E. canis is the only recognized Ehrlichia species infecting dogs in Brazil. PMID:24031251

Complete Genomic Sequence and Comparative Analysis of the Genome Segments of Sweet Potato Chlorotic Stunt Virus in China

PubMed Central

Qin, Yanhong; Wang, Li; Zhang, Zhenchen; Qiao, Qi; Zhang, Desheng; Tian, Yuting; Wang, Shuang; Wang, Yongjiang; Yan, Zhaoling

2014-01-01

Background Sweet potato chlorotic stunt virus (family Closteroviridae, genus Crinivirus) features a large bipartite, single-stranded, positive-sense RNA genome. To date, only three complete genomic sequences of SPCSV can be accessed through GenBank. SPCSV was first detected from China in 2011, only partial genomic sequences have been determined in the country. No report on the complete genomic sequence and genome structure of Chinese SPCSV isolates or the genetic relation between isolates from China and other countries is available. Methodology/Principal Findings The complete genomic sequences of five isolates from different areas in China were characterized. This study is the first to report the complete genome sequences of SPCSV from whitefly vectors. Genome structure analysis showed that isolates of WA and EA strains from China have the same coding protein as isolates Can181-9 and m2-47, respectively. Twenty cp genes and four RNA1 partial segments were sequenced and analyzed, and the nucleotide identities of complete genomic, cp, and RNA1 partial sequences were determined. Results indicated high conservation among strains and significant differences between WA and EA strains. Genetic analysis demonstrated that, except for isolates from Guangdong Province, SPCSVs from other areas belong to the WA strain. Genome organization analysis showed that the isolates in this study lack the p22 gene. Conclusions/Significance We presented the complete genome sequences of SPCSV in China. Comparison of nucleotide identities and genome structures between these isolates and previously reported isolates showed slight differences. The nucleotide identities of different SPCSV isolates showed high conservation among strains and significant differences between strains. All nine isolates in this study lacked p22 gene. WA strains were more extensively distributed than EA strains in China. These data provide important insights into the molecular variation and genomic structure of SPCSV in China as well as genetic relationships among isolates from China and other countries. PMID:25170926

Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

PubMed Central

Kyöstiö, S R; Cramer, C L; Lacy, G H

1991-01-01

The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

Gene Discovery through Genomic Sequencing of Brucella abortus

PubMed Central

Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

2001-01-01

Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979

Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

PubMed

Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

2014-10-09

A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

Purification, characterization and molecular cloning of chymotrypsin inhibitor peptides from the venom of Burmese Daboia russelii siamensis.

PubMed

Guo, Chun-Teng; McClean, Stephen; Shaw, Chris; Rao, Ping-Fan; Ye, Ming-Yu; Bjourson, Anthony J

2013-05-01

One novel Kunitz BPTI-like peptide designated as BBPTI-1, with chymotrypsin inhibitory activity was identified from the venom of Burmese Daboia russelii siamensis. It was purified by three steps of chromatography including gel filtration, cation exchange and reversed phase. A partial N-terminal sequence of BBPTI-1, HDRPKFCYLPADPGECLAHMRSF was obtained by automated Edman degradation and a Ki value of 4.77nM determined. Cloning of BBPTI-1 including the open reading frame and 3' untranslated region was achieved from cDNA libraries derived from lyophilized venom using a 3' RACE strategy. In addition a cDNA sequence, designated as BBPTI-5, was also obtained. Alignment of cDNA sequences showed that BBPTI-5 exhibited an identical sequence to BBPTI-1 cDNA except for an eight nucleotide deletion in the open reading frame. Gene variations that represented deletions in the BBPTI-5 cDNA resulted in a novel protease inhibitor analog. Amino acid sequence alignment revealed that deduced peptides derived from cloning of their respective precursor cDNAs from libraries showed high similarity and homology with other Kunitz BPTI proteinase inhibitors. BBPTI-1 and BBPTI-5 consist of 60 and 66 amino acid residues respectively, including six conserved cysteine residues. As these peptides have been reported to have influence on the processes of coagulation, fibrinolysis and inflammation, their potential application in biomedical contexts warrants further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.

Sequence-similar, structure-dissimilar protein pairs in the PDB.

PubMed

Kosloff, Mickey; Kolodny, Rachel

2008-05-01

It is often assumed that in the Protein Data Bank (PDB), two proteins with similar sequences will also have similar structures. Accordingly, it has proved useful to develop subsets of the PDB from which "redundant" structures have been removed, based on a sequence-based criterion for similarity. Similarly, when predicting protein structure using homology modeling, if a template structure for modeling a target sequence is selected by sequence alone, this implicitly assumes that all sequence-similar templates are equivalent. Here, we show that this assumption is often not correct and that standard approaches to create subsets of the PDB can lead to the loss of structurally and functionally important information. We have carried out sequence-based structural superpositions and geometry-based structural alignments of a large number of protein pairs to determine the extent to which sequence similarity ensures structural similarity. We find many examples where two proteins that are similar in sequence have structures that differ significantly from one another. The source of the structural differences usually has a functional basis. The number of such proteins pairs that are identified and the magnitude of the dissimilarity depend on the approach that is used to calculate the differences; in particular sequence-based structure superpositioning will identify a larger number of structurally dissimilar pairs than geometry-based structural alignments. When two sequences can be aligned in a statistically meaningful way, sequence-based structural superpositioning provides a meaningful measure of structural differences. This approach and geometry-based structure alignments reveal somewhat different information and one or the other might be preferable in a given application. Our results suggest that in some cases, notably homology modeling, the common use of nonredundant datasets, culled from the PDB based on sequence, may mask important structural and functional information. We have established a data base of sequence-similar, structurally dissimilar protein pairs that will help address this problem (http://luna.bioc.columbia.edu/rachel/seqsimstrdiff.htm).

Analysis of eight out genes in a cluster required for pectic enzyme secretion by Erwinia chrysanthemi: sequence comparison with secretion genes from other gram-negative bacteria.

PubMed Central

Lindeberg, M; Collmer, A

1992-01-01

Many extracellular proteins produced by Erwinia chrysanthemi require the out gene products for transport across the outer membrane. In a previous report (S. Y. He, M. Lindeberg, A. K. Chatterjee, and A. Collmer, Proc. Natl. Acad. Sci. USA 88:1079-1083, 1991) cosmid pCPP2006, sufficient for secretion of Erwinia chrysanthemi extracellular proteins by Escherichia coli, was partially sequenced, revealing four out genes sharing high homology with pulH through pulK from Klebsiella oxytoca. The nucleotide sequence of eight additional out genes reveals homology with pulC through pulG, pulL, pulM, pulO, and other genes involved in secretion by various gram-negative bacteria. Although signal sequences and hydrophobic regions are generally conserved between Pul and Out proteins, four out genes contain unique inserts, a pulN homolog is not present, and outO appears to be transcribed separately from outC through outM. The sequenced region was subcloned, and an additional 7.6-kb region upstream was identified as being required for secretion in E. coli. out gene homologs were found on Erwinia carotovora cosmid clone pAKC651 but were not detected in E. coli. The outC-through-outM operon is weakly induced by polygalacturonic acid and strongly expressed in the early stationary phase. The out and pul genes are highly similar in sequence, hydropathic properties, and overall arrangement but differ in both transcriptional organization and the nature of their induction. Images PMID:1429461

Molecular and physiological properties of bacteriophages from North America and Germany affecting the fire blight pathogen Erwinia amylovora.

PubMed

Müller, Ina; Lurz, Rudi; Kube, Michael; Quedenau, Claudia; Jelkmann, Wilhelm; Geider, Klaus

2011-11-01

For possible control of fire blight affecting apple and pear trees, we characterized Erwinia amylovora phages from North America and Germany. The genome size determined by electron microscopy (EM) was confirmed by sequence data and major coat proteins were identified from gel bands by mass spectroscopy. By their morphology from EM data, φEa1h and φEa100 were assigned to the Podoviridae and φEa104 and φEa116 to the Myoviridae. Host ranges were essentially confined to E. amylovora, strains of the species Erwinia pyrifoliae, E. billingiae and even Pantoea stewartii were partially sensitive. The phages φEa1h and φEa100 were dependent on the amylovoran capsule of E. amylovora, φEa104 and φEa116 were not. The Myoviridae efficiently lysed their hosts and protected apple flowers significantly better than the Podoviridae against E. amylovora and should be preferred in biocontrol experiments. We have also isolated and partially characterized E. amylovora phages from apple orchards in Germany. They belong to the Podoviridae or Myoviridae with a host range similar to the phages isolated in North America. In EM measurements, the genome sizes of the Podoviridae were smaller than the genomes of the Myoviridae from North America and from Germany, which differed from each other in corresponding nucleotide sequences. © 2011 The Authors. Microbial Biotechnology © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

A novel beta-glucosidase from the cell wall of maize (Zea mays L.): rapid purification and partial characterization

NASA Technical Reports Server (NTRS)

Nematollahi, W. P.; Roux, S. J.

1999-01-01

Plants have a variety of glycosidic conjugates of hormones, defense compounds, and other molecules that are hydrolyzed by beta-glucosidases (beta-D-glucoside glucohydrolases, E.C. 3.2.1.21). Workers have reported several beta-glucosidases from maize (Zea mays L.; Poaceae), but have localized them mostly by indirect means. We have purified and partly characterized a 58-Ku beta-glucosidase from maize, which we conclude from a partial sequence analysis, from kinetic data, and from its localization is not identical to any of those already reported. A monoclonal antibody, mWP 19, binds this enzyme, and localizes it in the cell walls of maize coleoptiles. An earlier report showed that mWP19 inhibits peroxidase activity in crude cell wall extracts and can immunoprecipitate peroxidase activity from these extracts, yet purified preparations of the 58 Ku protein had little or no peroxidase activity. The level of sequence similarity between beta-glucosidases and peroxidases makes it unlikely that these enzymes share epitopes in common. Contrary to a previous conclusion, these results suggest that the enzyme recognized by mWP19 is not a peroxidase, but there is a wall peroxidase closely associated with the 58 Ku beta-glucosidase in crude preparations. Other workers also have co-purified distinct proteins with beta-glucosidases. We found no significant charge in the level of immunodetectable beta-glucosidase in mesocotyls or coleoptiles that precedes the red light-induced changes in the growth rate of these tissues.

Algebraic Methods to Design Signals

DTIC Science & Technology

2015-08-27

sequence pairs with optimal correlation values. 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially balanced incomplete block designs with two...IEEE Transactions Information Theory, Volume: 58, Issue: 11, Nov 2012, Page(s): 6968 – 6978 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially

Lactobacillus brantae sp. nov., isolated from faeces of Canada geese (Branta canadensis).

PubMed

Volokhov, Dmitriy V; Amselle, Megan; Beck, Brian J; Popham, David L; Whittaker, Paul; Wang, Hua; Kerrigan, Elizabeth; Chizhikov, Vladimir E

2012-09-01

Three strains of lactic acid bacteria (LAB) were isolated from the faeces of apparently healthy wild Canada geese (Branta canadensis) in 2010 by cultivating faecal LAB on Rogosa SL agar under aerobic conditions. These three isolates were found to share 99.9 % gene sequence similarity of their 16S rRNA, their 16S-23S intergenic transcribed spacer region (ITS), partial 23S rRNA, rpoB, rpoC, rpoA and pheS gene sequences. However, the three strains exhibited lower levels of sequence similarity of these genetic targets to all known LAB, and the phylogenetically closest species to the geese strains were Lactobacillus casei, Lactobacillus paracasei, Lactobacillus rhamnosus and Lactobacillus saniviri. In comparison to L. casei ATCC 393(T), L. paracasei ATCC 25302(T), L. rhamnosus ATCC 7469(T) and L. saniviri DSM 24301(T), the novel isolates reacted uniquely in tests for cellobiose, galactose, mannitol, citric acid, aesculin and dextrin, and gave negative results in tests for l-proline arylamidase and l-pyrrolydonyl-arylamidase, and in the Voges-Proskauer test. Biochemical tests for cellobiose, aesculin, galactose, gentiobiose, mannitol, melezitose, ribose, salicin, sucrose, trehalose, raffinose, turanose, amygdalin and arbutin could be used for differentiation between L. saniviri and the novel strains. On the basis of phenotypic and genotypic characteristics, and phylogenetic data, the three isolates represent a novel species of the genus Lactobacillus, for which the name Lactobacillus brantae sp. nov. is proposed. The type strain is SL1108(T) (= ATCC BAA-2142(T) = LMG 26001(T) = DSM 23927(T)) and two additional strains are SL1170 and SL60106.

Forensically Relevant Blow Flies in Lebanon Survey and Identification Using Molecular Markers (Diptera: Calliphoridae).

PubMed

Shayya, Salman; Debruyne, Régis; Nel, André; Azar, Dany

2018-05-12

Calliphoridae are among the first insects associated to decomposing animal remains. We have collected 1,841 specimens of three calliphorid genera: Calliphora, Lucilia, and Chrysomya, from different Lebanese localities as a first step in implementing a database of insects of forensic relevance for the country. Blow-flies are crucial for the estimation of the postmortem interval. DNA-based identification is a rapid and accurate method, often used for morphologically similar species, especially for immatures or incomplete specimens. In this study, we test the suitability of three genetic markers to identify adults and immature stages of calliphorids, viz., mitochondrial cytochrome c oxidase subunit I (COI) barcode, a region including partial sequences of mitochondrial Cyt-b-tRNAser-ND1, and second internal transcribed spacer (ITS2) region of nuclear ribosomal DNA. Forty Lebanese specimens of various developmental stages (egg, larva, wandering third instar, pupa, newly emerged adult, and mature adult) were identified among the three calliphorid genera: Calliphora, Lucilia, and Chrysomya, and compared with published sequences to confirm their specific assignation. Phylogenetic analyses showed the robustness of ITS2 and COI to identify calliphorids at species level. Nevertheless, ITS2 failed to discriminate Lucilia caesar (Linnaeus) (Diptera, Calliphoridae) from Lucilia illustris (Meigen) (Diptera, Calliphoridae), and COI had a similar issue with Lucilia sericata (Meigen) (Diptera, Calliphoridae) and Lucilia cuprina (Wiedemann) (Diptera, Calliphoridae). Thus, these two markers are complementary. This work contributes new nucleotide sequences for Lebanon. It is a first step in implementing a molecular database of forensic relevant insects for the country.

Lactobacillus insicii sp. nov., isolated from fermented raw meat.

PubMed

Ehrmann, Matthias A; Kröckel, Lothar; Lick, Sonja; Radmann, Pia; Bantleon, Annegret; Vogel, Rudi F

2016-01-01

The analysis of the bacterial microbiota of retain samples of pork salami revealed an isolate (strain TMW 1.2011T) that could neither be assigned to typical genera of starter organisms nor to any other known meat-associated species. Cells were Gram-stain-positive, short, straight rods occurring singly, in pairs or short chains. Phylogenetic analysis of the 16S rRNA gene sequence and specific phenotypic characteristics showed that strain TMW 1.2011T belonged to the phylogenetic Lactobacillus alimentarius group, and the closest neighbours were Lactobacillus nodensis JCM 14932T (97.8 % 16S rRNA gene sequence similarity), Lactobacillus tucceti DSM 20183T (97.4 %), 'Lactobacillus ginsenosidimutans' EMML 3041 (97.3 %), Lactobacillus versmoldensis DSM 14857T (96.9 %) and Lactobacillus furfuricola JCM 18764T (97.2 %). Similarities using partial gene sequences of the alternative chronometers pheS, dnaK and rpoA also support these relationships. DNA-DNA relatedness between the novel isolate and L. nodensis JCM 14932T, L. versmoldensis DSM 14857T and L. tucceti DSM 20183T, L. furfuricola JCM 18764T and 'L. ginsenosidimutans' EMML 3041 were below 70 % and the DNA G+C content was 36.3 mol%. The cell-wall peptidoglycan type is l-Lys-Gly-d-Asp. Based on phylogenetic, chemotaxonomic and physiological evidence, strain TMW 1.2011T represents a novel species of the genus Lactobacillus, for which the name Lactobacillus insicii sp. nov. is proposed. The type strain is TMW 1.2011T ( = CECT 8802T = DSM 29801T).

Characterization of free nitrogen fixing bacteria of the genus Azotobacter in organic vegetable-grown Colombian soils

PubMed Central

Jiménez, Diego Javier; Montaña, José Salvador; Martínez, María Mercedes

2011-01-01

With the purpose of isolating and characterizing free nitrogen fixing bacteria (FNFB) of the genus Azotobacter, soil samples were collected randomly from different vegetable organic cultures with neutral pH in different zones of Boyacá-Colombia. Isolations were done in selective free nitrogen Ashby-Sucrose agar obtaining a recovery of 40%. Twenty four isolates were evaluated for colony and cellular morphology, pigment production and metabolic activities. Molecular characterization was carried out using amplified ribosomal DNA restriction analysis (ARDRA). After digestion of 16S rDNA Y1-Y3 PCR products (1487pb) with AluI, HpaII and RsaI endonucleases, a polymorphism of 16% was obtained. Cluster analysis showed three main groups based on DNA fingerprints. Comparison between ribotypes generated by isolates and in silico restriction of 16S rDNA partial sequences with same restriction enzymes was done with Gen Workbench v.2.2.4 software. Nevertheless, Y1-Y2 PCR products were analysed using BLASTn. Isolate C5T from tomato (Lycopersicon esculentum) grown soils presented the same in silico restriction patterns with A. chroococcum (AY353708) and 99% of similarity with the same sequence. Isolate C5CO from cauliflower (Brassica oleracea var. botrytis) grown soils showed black pigmentation in Ashby-Benzoate agar and high similarity (91%) with A. nigricans (AB175651) sequence. In this work we demonstrated the utility of molecular techniques and bioinformatics tools as a support to conventional techniques in characterization of the genus Azotobacter from vegetable-grown soils. PMID:24031700

Temporal lobe dual pathology in malignant migrating partial seizures in infancy.

PubMed

Coppola, Giangennaro; Operto, Francesca Felicia; Auricchio, Gianfranca; D'Amico, Alessandra; Fortunato, Delia; Pascotto, Antonio

2007-06-01

A child had the characteristic clinical and EEG pattern of migrating partial seizures in infancy with left temporal lobe atrophy, hippocampal sclerosis and cortical-subcortical blurring. Seizures were drug-resistant, with recurring episodes of status epilepticus. The child developed microcephaly with arrest of psychomotor development. Focal brain lesions, in the context of migrating partial seizures, have not been previously reported.[Published with video sequences].

A Systematic Bayesian Integration of Epidemiological and Genetic Data

PubMed Central

Lau, Max S. Y.; Marion, Glenn; Streftaris, George; Gibson, Gavin

2015-01-01

Genetic sequence data on pathogens have great potential to inform inference of their transmission dynamics ultimately leading to better disease control. Where genetic change and disease transmission occur on comparable timescales additional information can be inferred via the joint analysis of such genetic sequence data and epidemiological observations based on clinical symptoms and diagnostic tests. Although recently introduced approaches represent substantial progress, for computational reasons they approximate genuine joint inference of disease dynamics and genetic change in the pathogen population, capturing partially the joint epidemiological-evolutionary dynamics. Improved methods are needed to fully integrate such genetic data with epidemiological observations, for achieving a more robust inference of the transmission tree and other key epidemiological parameters such as latent periods. Here, building on current literature, a novel Bayesian framework is proposed that infers simultaneously and explicitly the transmission tree and unobserved transmitted pathogen sequences. Our framework facilitates the use of realistic likelihood functions and enables systematic and genuine joint inference of the epidemiological-evolutionary process from partially observed outbreaks. Using simulated data it is shown that this approach is able to infer accurately joint epidemiological-evolutionary dynamics, even when pathogen sequences and epidemiological data are incomplete, and when sequences are available for only a fraction of exposures. These results also characterise and quantify the value of incomplete and partial sequence data, which has important implications for sampling design, and demonstrate the abilities of the introduced method to identify multiple clusters within an outbreak. The framework is used to analyse an outbreak of foot-and-mouth disease in the UK, enhancing current understanding of its transmission dynamics and evolutionary process. PMID:26599399

Effects of a Non-Conservative Sequence on the Properties of β-glucuronidase from Aspergillus terreus Li-20

PubMed Central

Liu, Yanli; Huangfu, Jie; Qi, Feng; Kaleem, Imdad; E, Wenwen; Li, Chun

2012-01-01

We cloned the β-glucuronidase gene (AtGUS) from Aspergillus terreus Li-20 encoding 657 amino acids (aa), which can transform glycyrrhizin into glycyrrhetinic acid monoglucuronide (GAMG) and glycyrrhetinic acid (GA). Based on sequence alignment, the C-terminal non-conservative sequence showed low identity with those of other species; thus, the partial sequence AtGUS(-3t) (1–592 aa) was amplified to determine the effects of the non-conservative sequence on the enzymatic properties. AtGUS and AtGUS(-3t) were expressed in E. coli BL21, producing AtGUS-E and AtGUS(-3t)-E, respectively. At the similar optimum temperature (55°C) and pH (AtGUS-E, 6.6; AtGUS(-3t)-E, 7.0) conditions, the thermal stability of AtGUS(-3t)-E was enhanced at 65°C, and the metal ions Co2+, Ca2+ and Ni2+ showed opposite effects on AtGUS-E and AtGUS(-3t)-E, respectively. Furthermore, Km of AtGUS(-3t)-E (1.95 mM) was just nearly one-seventh that of AtGUS-E (12.9 mM), whereas the catalytic efficiency of AtGUS(-3t)-E was 3.2 fold higher than that of AtGUS-E (7.16 vs. 2.24 mM s−1), revealing that the truncation of non-conservative sequence can significantly improve the catalytic efficiency of AtGUS. Conformational analysis illustrated significant difference in the secondary structure between AtGUS-E and AtGUS(-3t)-E by circular dichroism (CD). The results showed that the truncation of the non-conservative sequence could preferably alter and influence the stability and catalytic efficiency of enzyme. PMID:22347419

Investigation of SnSPR1, a novel and abundant surface protein of Sarcocystis neurona merozoites.

PubMed

Zhang, Deqing; Howe, Daniel K

2008-04-15

An expressed sequence tag (EST) sequencing project has produced over 15,000 partial cDNA sequences from the equine pathogen Sarcocystis neurona. While many of the sequences are clear homologues of previously characterized genes, a significant number of the S. neurona ESTs do not exhibit similarity to anything in the extensive sequence databases that have been generated. In an effort to characterize parasite proteins that are novel to S. neurona, a seemingly unique gene was selected for further investigation based on its abundant representation in the collection of ESTs and the predicted presence of a signal peptide and glycolipid anchor addition on the encoded protein. The gene was expressed in E. coli, and monospecific polyclonal antiserum against the recombinant protein was produced by immunization of a rabbit. Characterization of the native protein in S. neurona merozoites and schizonts revealed that it is a low molecular weight surface protein that is expressed throughout intracellular development of the parasite. The protein was designated Surface Protein 1 (SPR1) to reflect its display on the outer surface of merozoites and to distinguish it from the ubiquitous SAG/SRS surface antigens of the heteroxenous Coccidia. Interestingly, infection assays in the presence of the polyclonal antiserum suggested that SnSPR1 plays some role in attachment and/or invasion of host cells by S. neurona merozoites. The work described herein represents a general template for selecting and characterizing the various unidentified gene sequences that are plentiful in the EST databases for S. neurona and other apicomplexans. Furthermore, this study illustrates the value of investigating these novel sequences since it can offer new candidates for diagnostic or vaccine development while also providing greater insight into the biology of these parasites.

Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms.

PubMed

Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J

1998-08-01

Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

PubMed

Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

2004-01-21

We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

Conserved Sequences at the Origin of Adenovirus DNA Replication

PubMed Central

Stillman, Bruce W.; Topp, William C.; Engler, Jeffrey A.

1982-01-01

The origin of adenovirus DNA replication lies within an inverted sequence repetition at either end of the linear, double-stranded viral DNA. Initiation of DNA replication is primed by a deoxynucleoside that is covalently linked to a protein, which remains bound to the newly synthesized DNA. We demonstrate that virion-derived DNA-protein complexes from five human adenovirus serological subgroups (A to E) can act as a template for both the initiation and the elongation of DNA replication in vitro, using nuclear extracts from adenovirus type 2 (Ad2)-infected HeLa cells. The heterologous template DNA-protein complexes were not as active as the homologous Ad2 DNA, most probably due to inefficient initiation by Ad2 replication factors. In an attempt to identify common features which may permit this replication, we have also sequenced the inverted terminal repeated DNA from human adenovirus serotypes Ad4 (group E), Ad9 and Ad10 (group D), and Ad31 (group A), and we have compared these to previously determined sequences from Ad2 and Ad5 (group C), Ad7 (group B), and Ad12 and Ad18 (group A) DNA. In all cases, the sequence around the origin of DNA replication can be divided into two structural domains: a proximal A · T-rich region which is partially conserved among these serotypes, and a distal G · C-rich region which is less well conserved. The G · C-rich region contains sequences similar to sequences present in papovavirus replication origins. The two domains may reflect a dual mechanism for initiation of DNA replication: adenovirus-specific protein priming of replication, and subsequent utilization of this primer by host replication factors for completion of DNA synthesis. Images PMID:7143575

Using nearly full-genome HIV sequence data improves phylogeny reconstruction in a simulated epidemic

PubMed Central

Yebra, Gonzalo; Hodcroft, Emma B.; Ragonnet-Cronin, Manon L.; Pillay, Deenan; Brown, Andrew J. Leigh; Fraser, Christophe; Kellam, Paul; de Oliveira, Tulio; Dennis, Ann; Hoppe, Anne; Kityo, Cissy; Frampton, Dan; Ssemwanga, Deogratius; Tanser, Frank; Keshani, Jagoda; Lingappa, Jairam; Herbeck, Joshua; Wawer, Maria; Essex, Max; Cohen, Myron S.; Paton, Nicholas; Ratmann, Oliver; Kaleebu, Pontiano; Hayes, Richard; Fidler, Sarah; Quinn, Thomas; Novitsky, Vladimir; Haywards, Andrew; Nastouli, Eleni; Morris, Steven; Clark, Duncan; Kozlakidis, Zisis

2016-01-01

HIV molecular epidemiology studies analyse viral pol gene sequences due to their availability, but whole genome sequencing allows to use other genes. We aimed to determine what gene(s) provide(s) the best approximation to the real phylogeny by analysing a simulated epidemic (created as part of the PANGEA_HIV project) with a known transmission tree. We sub-sampled a simulated dataset of 4662 sequences into different combinations of genes (gag-pol-env, gag-pol, gag, pol, env and partial pol) and sampling depths (100%, 60%, 20% and 5%), generating 100 replicates for each case. We built maximum-likelihood trees for each combination using RAxML (GTR + Γ), and compared their topologies to the corresponding true tree’s using CompareTree. The accuracy of the trees was significantly proportional to the length of the sequences used, with the gag-pol-env datasets showing the best performance and gag and partial pol sequences showing the worst. The lowest sampling depths (20% and 5%) greatly reduced the accuracy of tree reconstruction and showed high variability among replicates, especially when using the shortest gene datasets. In conclusion, using longer sequences derived from nearly whole genomes will improve the reliability of phylogenetic reconstruction. With low sample coverage, results can be highly variable, particularly when based on short sequences. PMID:28008945

Using nearly full-genome HIV sequence data improves phylogeny reconstruction in a simulated epidemic.

PubMed

Yebra, Gonzalo; Hodcroft, Emma B; Ragonnet-Cronin, Manon L; Pillay, Deenan; Brown, Andrew J Leigh

2016-12-23

HIV molecular epidemiology studies analyse viral pol gene sequences due to their availability, but whole genome sequencing allows to use other genes. We aimed to determine what gene(s) provide(s) the best approximation to the real phylogeny by analysing a simulated epidemic (created as part of the PANGEA_HIV project) with a known transmission tree. We sub-sampled a simulated dataset of 4662 sequences into different combinations of genes (gag-pol-env, gag-pol, gag, pol, env and partial pol) and sampling depths (100%, 60%, 20% and 5%), generating 100 replicates for each case. We built maximum-likelihood trees for each combination using RAxML (GTR + Γ), and compared their topologies to the corresponding true tree's using CompareTree. The accuracy of the trees was significantly proportional to the length of the sequences used, with the gag-pol-env datasets showing the best performance and gag and partial pol sequences showing the worst. The lowest sampling depths (20% and 5%) greatly reduced the accuracy of tree reconstruction and showed high variability among replicates, especially when using the shortest gene datasets. In conclusion, using longer sequences derived from nearly whole genomes will improve the reliability of phylogenetic reconstruction. With low sample coverage, results can be highly variable, particularly when based on short sequences.

Analysis of 16S-23S intergenic spacer regions of the rRNA operons in Edwardsiella ictaluri and Edwardsiella tarda isolates from fish.

PubMed

Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H

2005-01-01

To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.

miRvestigator: web application to identify miRNAs responsible for co-regulated gene expression patterns discovered through transcriptome profiling.

PubMed

Plaisier, Christopher L; Bare, J Christopher; Baliga, Nitin S

2011-07-01

Transcriptome profiling studies have produced staggering numbers of gene co-expression signatures for a variety of biological systems. A significant fraction of these signatures will be partially or fully explained by miRNA-mediated targeted transcript degradation. miRvestigator takes as input lists of co-expressed genes from Caenorhabditis elegans, Drosophila melanogaster, G. gallus, Homo sapiens, Mus musculus or Rattus norvegicus and identifies the specific miRNAs that are likely to bind to 3' un-translated region (UTR) sequences to mediate the observed co-regulation. The novelty of our approach is the miRvestigator hidden Markov model (HMM) algorithm which systematically computes a similarity P-value for each unique miRNA seed sequence from the miRNA database miRBase to an overrepresented sequence motif identified within the 3'-UTR of the query genes. We have made this miRNA discovery tool accessible to the community by integrating our HMM algorithm with a proven algorithm for de novo discovery of miRNA seed sequences and wrapping these algorithms into a user-friendly interface. Additionally, the miRvestigator web server also produces a list of putative miRNA binding sites within 3'-UTRs of the query transcripts to facilitate the design of validation experiments. The miRvestigator is freely available at http://mirvestigator.systemsbiology.net.

Molecular analysis of carbon monoxide-oxidizing bacteria associated with recent Hawaiian volcanic deposits.

PubMed

Dunfield, Kari E; King, Gary M

2004-07-01

Genomic DNA extracts from four sites at Kilauea Volcano were used as templates for PCR amplification of the large subunit (coxL) of aerobic carbon monoxide dehydrogenase. The sites included a 42-year-old tephra deposit, a 108-year-old lava flow, a 212-year-old partially vegetated ash-and-tephra deposit, and an approximately 300-year-old forest. PCR primers amplified coxL sequences from the OMP clade of CO oxidizers, which includes isolates such as Oligotropha carboxidovorans, Mycobacterium tuberculosis, and Pseudomonas thermocarboxydovorans. PCR products were used to create clone libraries that provide the first insights into the diversity and phylogenetic affiliations of CO oxidizers in situ. On the basis of phylogenetic and statistical analyses, clone libraries for each site were distinct. Although some clone sequences were similar to coxL sequences from known organisms, many sequences appeared to represent phylogenetic lineages not previously known to harbor CO oxidizers. On the basis of average nucleotide diversity and average pairwise difference, a forested site supported the most diverse CO-oxidizing populations, while an 1894 lava flow supported the least diverse populations. Neither parameter correlated with previous estimates of atmospheric CO uptake rates, but both parameters correlated positively with estimates of microbial biomass and respiration. Collectively, the results indicate that the CO oxidizer functional group associated with recent volcanic deposits of the remote Hawaiian Islands contains substantial and previously unsuspected diversity.

Molecular Analysis of Carbon Monoxide-Oxidizing Bacteria Associated with Recent Hawaiian Volcanic Deposits†

PubMed Central

Dunfield, Kari E.; King, Gary M.

2004-01-01

Genomic DNA extracts from four sites at Kilauea Volcano were used as templates for PCR amplification of the large subunit (coxL) of aerobic carbon monoxide dehydrogenase. The sites included a 42-year-old tephra deposit, a 108-year-old lava flow, a 212-year-old partially vegetated ash-and-tephra deposit, and an approximately 300-year-old forest. PCR primers amplified coxL sequences from the OMP clade of CO oxidizers, which includes isolates such as Oligotropha carboxidovorans, Mycobacterium tuberculosis, and Pseudomonas thermocarboxydovorans. PCR products were used to create clone libraries that provide the first insights into the diversity and phylogenetic affiliations of CO oxidizers in situ. On the basis of phylogenetic and statistical analyses, clone libraries for each site were distinct. Although some clone sequences were similar to coxL sequences from known organisms, many sequences appeared to represent phylogenetic lineages not previously known to harbor CO oxidizers. On the basis of average nucleotide diversity and average pairwise difference, a forested site supported the most diverse CO-oxidizing populations, while an 1894 lava flow supported the least diverse populations. Neither parameter correlated with previous estimates of atmospheric CO uptake rates, but both parameters correlated positively with estimates of microbial biomass and respiration. Collectively, the results indicate that the CO oxidizer functional group associated with recent volcanic deposits of the remote Hawaiian Islands contains substantial and previously unsuspected diversity. PMID:15240307

"Maxillary lateral incisor partial anodontia sequence": a clinical entity with epigenetic origin.

PubMed

Consolaro, Alberto; Cardoso, Maurício Almeida; Consolaro, Renata Bianco

2017-01-01

The relationship between maxillary lateral incisor anodontia and the palatal displacement of unerupted maxillary canines cannot be considered as a multiple tooth abnormality with defined genetic etiology in order to be regarded as a "syndrome". Neither were the involved genes identified and located in the human genome, nor was it presumed on which chromosome the responsible gene would be located. The palatal maxillary canine displacement in cases of partial anodontia of the maxillary lateral incisor is potentially associated with environmental changes caused by its absence in its place of formation and eruption, which would characterize an epigenetic etiology. The lack of the maxillary lateral incisor in the canine region means removing one of the reference guides for the eruptive trajectory of the maxillary canine, which would therefore, not erupt and /or impact on the palate. Consequently, and in sequence, it would lead to malocclusion, maxillary atresia, transposition, prolonged retention of the deciduous canine and resorption in the neighboring teeth. Thus, we can say that we are dealing with a set of anomalies and multiple sequential changes known as sequential development anomalies or, simply, sequence. Once the epigenetics and sequential condition is accepted for this clinical picture, it could be called "Maxillary Lateral Incisor Partial Anodontia Sequence."

Subgrouping Automata: automatic sequence subgrouping using phylogenetic tree-based optimum subgrouping algorithm.

PubMed

Seo, Joo-Hyun; Park, Jihyang; Kim, Eun-Mi; Kim, Juhan; Joo, Keehyoung; Lee, Jooyoung; Kim, Byung-Gee

2014-02-01

Sequence subgrouping for a given sequence set can enable various informative tasks such as the functional discrimination of sequence subsets and the functional inference of unknown sequences. Because an identity threshold for sequence subgrouping may vary according to the given sequence set, it is highly desirable to construct a robust subgrouping algorithm which automatically identifies an optimal identity threshold and generates subgroups for a given sequence set. To meet this end, an automatic sequence subgrouping method, named 'Subgrouping Automata' was constructed. Firstly, tree analysis module analyzes the structure of tree and calculates the all possible subgroups in each node. Sequence similarity analysis module calculates average sequence similarity for all subgroups in each node. Representative sequence generation module finds a representative sequence using profile analysis and self-scoring for each subgroup. For all nodes, average sequence similarities are calculated and 'Subgrouping Automata' searches a node showing statistically maximum sequence similarity increase using Student's t-value. A node showing the maximum t-value, which gives the most significant differences in average sequence similarity between two adjacent nodes, is determined as an optimum subgrouping node in the phylogenetic tree. Further analysis showed that the optimum subgrouping node from SA prevents under-subgrouping and over-subgrouping. Copyright © 2013. Published by Elsevier Ltd.

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Reclassification of Bacillus beijingensis Qiu et al. 2009 and Bacillus ginsengi Qiu et al. 2009 as Bhargavaea beijingensis comb. nov. and Bhargavaea ginsengi comb. nov. and emended description of the genus Bhargavaea.

PubMed

Verma, Pankaj; Pandey, Prashant Kumar; Gupta, Arvind Kumar; Seong, Chi Nam; Park, Seong Chan; Choe, Han Na; Baik, Keun Sik; Patole, Milind Shivaji; Shouche, Yogesh Shreepad

2012-10-01

We have carried out a polyphasic taxonomic characterization of Bacillus beijingensis DSM 19037(T) and Bacillus ginsengi DSM 19038(T), which are closely related phylogenetically to Bhargavaea cecembensis LMG 24411(T). All three strains are Gram-stain-positive, non-motile, moderately halotolerant and non-spore-forming. 16S rRNA gene sequence analyses showed that the strains constituted a coherent cluster, with sequence similarities between 99.7 and 98.7 %. The percentage similarity on the basis of amino acid sequences deduced from partial gyrB gene nucleotide sequences of these three type strains was 96.1-92.7 %. Phylogenetic trees based on the 16S rRNA gene and GyrB amino acid sequences, obtained by using three different algorithms, were consistent and showed that these three species constituted a deeply rooted cluster separated from the clades represented by the genera Bacillus, Planococcus, Planomicrobium, Sporosarcina, Lysinibacillus, Viridibacillus, Kurthia and Geobacillus, supporting their placement in the genus Bhargavaea. All three type strains have menaquinone MK-8 as the major respiratory quinone and showed similar fatty acid profiles. The main polar lipids present in the three type strains were diphosphatidylglycerol and phosphatidylglycerol, and the three strains showed peptidoglycan type A4α with L-lysine as the diagnostic diamino acid. The DNA G+C contents of Bacillus beijingensis DSM 19037(T), Bacillus ginsengi DSM 19038(T) and Bhargavaea cecembensis LMG 24411(T) were 53.1, 50.2 and 53.7 mol%, respectively. The level of DNA-DNA hybridization among the three strains was 57-39 %, indicating that they are members of different species of the genus Bhargavaea. The phenotypic data are consistent with the placement of these three species in a single genus and support their differentiation at the species level. On the basis of these data, we have emended the description of the genus Bhargavaea and propose the reclassification of Bacillus beijingensis and Bacillus ginsengi to the genus Bhargavaea, as Bhargavaea beijingensis comb. nov. (type strain ge10(T)  = DSM 19037(T)  = CGMCC 1.6762(T)) and Bhargavaea ginsengi comb. nov. (type strain ge14(T)  = DSM 19038(T)  = CGMCC 1.6763(T)).

Peak-to-average power ratio reduction in orthogonal frequency division multiplexing-based visible light communication systems using a modified partial transmit sequence technique

NASA Astrophysics Data System (ADS)

Liu, Yan; Deng, Honggui; Ren, Shuang; Tang, Chengying; Qian, Xuewen

2018-01-01

We propose an efficient partial transmit sequence technique based on genetic algorithm and peak-value optimization algorithm (GAPOA) to reduce high peak-to-average power ratio (PAPR) in visible light communication systems based on orthogonal frequency division multiplexing (VLC-OFDM). By analysis of hill-climbing algorithm's pros and cons, we propose the POA with excellent local search ability to further process the signals whose PAPR is still over the threshold after processed by genetic algorithm (GA). To verify the effectiveness of the proposed technique and algorithm, we evaluate the PAPR performance and the bit error rate (BER) performance and compare them with partial transmit sequence (PTS) technique based on GA (GA-PTS), PTS technique based on genetic and hill-climbing algorithm (GH-PTS), and PTS based on shuffled frog leaping algorithm and hill-climbing algorithm (SFLAHC-PTS). The results show that our technique and algorithm have not only better PAPR performance but also lower computational complexity and BER than GA-PTS, GH-PTS, and SFLAHC-PTS technique.

Partial AZFc duplications not deletions are associated with male infertility in the Yi population of Yunnan Province, China.

PubMed

Ye, Jun-jie; Ma, Li; Yang, Li-juan; Wang, Jin-huan; Wang, Yue-li; Guo, Hai; Gong, Ning; Nie, Wen-hui; Zhao, Shu-hua

2013-09-01

There are many reports on associations between spermatogenesis and partial azoospermia factor c (AZFc) deletions as well as duplications; however, results are conflicting, possibly due to differences in methodology and ethnic background. The purpose of this study is to investigate the association of AZFc polymorphisms and male infertility in the Yi ethnic population, residents within Yunnan Province, China. A total of 224 infertile patients and 153 fertile subjects were selected in the Yi ethnic population. The study was performed by sequence-tagged site plus/minus (STS+/-) analysis followed by gene dosage and gene copy definition analysis. Y haplotypes of 215 cases and 115 controls were defined by 12 binary markers using single nucleotide polymorphism on Y chromosome (Y-SNP) multiplex assays based on single base primer extension technology. The distribution of Y haplotypes was not significantly different between the case and control groups. The frequencies of both gr/gr (7.6% vs. 8.5%) and b2/b3 (6.3% vs. 8.5%) deletions do not show significant differences. Similarly, single nucleotide variant (SNV) analysis shows no significant difference of gene copy definition between the cases and controls. However, the frequency of partial duplications in the infertile group (4.0%) is significantly higher than that in the control group (0.7%). Further, we found a case with sY1206 deletion which had two CDY1 copies but removed half of DAZ genes. Our results show that male infertility is associated with partial AZFc duplications, but neither gr/gr nor b2/b3 deletions, suggesting that partial AZFc duplications rather than deletions are risk factors for male infertility in Chinese-Yi population.

Application of discrete Fourier inter-coefficient difference for assessing genetic sequence similarity.

PubMed

King, Brian R; Aburdene, Maurice; Thompson, Alex; Warres, Zach

2014-01-01

Digital signal processing (DSP) techniques for biological sequence analysis continue to grow in popularity due to the inherent digital nature of these sequences. DSP methods have demonstrated early success for detection of coding regions in a gene. Recently, these methods are being used to establish DNA gene similarity. We present the inter-coefficient difference (ICD) transformation, a novel extension of the discrete Fourier transformation, which can be applied to any DNA sequence. The ICD method is a mathematical, alignment-free DNA comparison method that generates a genetic signature for any DNA sequence that is used to generate relative measures of similarity among DNA sequences. We demonstrate our method on a set of insulin genes obtained from an evolutionarily wide range of species, and on a set of avian influenza viral sequences, which represents a set of highly similar sequences. We compare phylogenetic trees generated using our technique against trees generated using traditional alignment techniques for similarity and demonstrate that the ICD method produces a highly accurate tree without requiring an alignment prior to establishing sequence similarity.

Correction for Eddy Current-Induced Echo-Shifting Effect in Partial-Fourier Diffusion Tensor Imaging.

PubMed

Truong, Trong-Kha; Song, Allen W; Chen, Nan-Kuei

2015-01-01

In most diffusion tensor imaging (DTI) studies, images are acquired with either a partial-Fourier or a parallel partial-Fourier echo-planar imaging (EPI) sequence, in order to shorten the echo time and increase the signal-to-noise ratio (SNR). However, eddy currents induced by the diffusion-sensitizing gradients can often lead to a shift of the echo in k-space, resulting in three distinct types of artifacts in partial-Fourier DTI. Here, we present an improved DTI acquisition and reconstruction scheme, capable of generating high-quality and high-SNR DTI data without eddy current-induced artifacts. This new scheme consists of three components, respectively, addressing the three distinct types of artifacts. First, a k-space energy-anchored DTI sequence is designed to recover eddy current-induced signal loss (i.e., Type 1 artifact). Second, a multischeme partial-Fourier reconstruction is used to eliminate artificial signal elevation (i.e., Type 2 artifact) associated with the conventional partial-Fourier reconstruction. Third, a signal intensity correction is applied to remove artificial signal modulations due to eddy current-induced erroneous T2(∗) -weighting (i.e., Type 3 artifact). These systematic improvements will greatly increase the consistency and accuracy of DTI measurements, expanding the utility of DTI in translational applications where quantitative robustness is much needed.

Correction for Eddy Current-Induced Echo-Shifting Effect in Partial-Fourier Diffusion Tensor Imaging

PubMed Central

Truong, Trong-Kha; Song, Allen W.; Chen, Nan-kuei

2015-01-01

In most diffusion tensor imaging (DTI) studies, images are acquired with either a partial-Fourier or a parallel partial-Fourier echo-planar imaging (EPI) sequence, in order to shorten the echo time and increase the signal-to-noise ratio (SNR). However, eddy currents induced by the diffusion-sensitizing gradients can often lead to a shift of the echo in k-space, resulting in three distinct types of artifacts in partial-Fourier DTI. Here, we present an improved DTI acquisition and reconstruction scheme, capable of generating high-quality and high-SNR DTI data without eddy current-induced artifacts. This new scheme consists of three components, respectively, addressing the three distinct types of artifacts. First, a k-space energy-anchored DTI sequence is designed to recover eddy current-induced signal loss (i.e., Type 1 artifact). Second, a multischeme partial-Fourier reconstruction is used to eliminate artificial signal elevation (i.e., Type 2 artifact) associated with the conventional partial-Fourier reconstruction. Third, a signal intensity correction is applied to remove artificial signal modulations due to eddy current-induced erroneous T 2 ∗-weighting (i.e., Type 3 artifact). These systematic improvements will greatly increase the consistency and accuracy of DTI measurements, expanding the utility of DTI in translational applications where quantitative robustness is much needed. PMID:26413505

Enterocin T, a novel class IIa bacteriocin produced by Enterococcus sp. 812.

PubMed

Chen, Yi-Sheng; Yu, Chi-Rong; Ji, Si-Hua; Liou, Min-Shiuan; Leong, Kun-Hon; Pan, Shwu-Fen; Wu, Hui-Chung; Lin, Yu-Hsuan; Yu, Bi; Yanagida, Fujitoshi

2013-09-01

Enterococcus sp. 812, isolated from fresh broccoli, was previously found to produce a bacteriocin active against a number of Gram-positive bacteria, including Listeria monocytogenes. Bacteriocin activity decreased slightly after autoclaving (121 °C for 15 min), but was inactivated by protease K. Mass spectrometry analysis revealed the bacteriocin mass to be approximately 4,521.34 Da. N-terminal amino acid sequencing yielded a partial sequence, NH2-ATYYGNGVYXDKKKXWVEWGQA, by Edman degradation, which contained the consensus class IIa bacteriocin motif YGNGV in the N-terminal region. The obtained partial sequence showed high homology with some enterococcal bacteriocins; however, no identical peptide or protein was found. This peptide was therefore considered to be a novel bacteriocin produced by Enterococcus sp. 812 and was termed enterocin T.

Pantoea hericii sp. nov., Isolated from the Fruiting Bodies of Hericium erinaceus.

PubMed

Rong, Chengbo; Ma, Yuanwei; Wang, Shouxian; Liu, Yu; Chen, Sanfeng; Huang, Bin; Wang, Jing; Xu, Feng

2016-06-01

Three Gram-negative, facultatively anaerobic bacterial isolates were obtained from the fruiting bodies of the edible mushroom Hericium erinaceus showing symptoms of soft rot disease in Beijing, China. Sequences of partial 16S rRNA gene placed these isolates in the genus Pantoea. Multilocus sequence analysis based on the partial sequences of atpD, gyrB, infB and rpoB revealed P. eucalypti and P. anthophila as their closest phylogenetic relatives and indicated that these isolates constituted a possible novel species. DNA-DNA hybridization studies confirmed the classification of these isolates as a novel species and phenotypic tests allowed for differentiation from the closest phylogenetic neighbours. The name Pantoea hericii sp. nov. [Type strain LMG 28847(T) = CGMCC 1.15224(T) = JZB 2120024(T)] is proposed.

Model-free aftershock forecasts constructed from similar sequences in the past

NASA Astrophysics Data System (ADS)

van der Elst, N.; Page, M. T.

2017-12-01

The basic premise behind aftershock forecasting is that sequences in the future will be similar to those in the past. Forecast models typically use empirically tuned parametric distributions to approximate past sequences, and project those distributions into the future to make a forecast. While parametric models do a good job of describing average outcomes, they are not explicitly designed to capture the full range of variability between sequences, and can suffer from over-tuning of the parameters. In particular, parametric forecasts may produce a high rate of "surprises" - sequences that land outside the forecast range. Here we present a non-parametric forecast method that cuts out the parametric "middleman" between training data and forecast. The method is based on finding past sequences that are similar to the target sequence, and evaluating their outcomes. We quantify similarity as the Poisson probability that the observed event count in a past sequence reflects the same underlying intensity as the observed event count in the target sequence. Event counts are defined in terms of differential magnitude relative to the mainshock. The forecast is then constructed from the distribution of past sequences outcomes, weighted by their similarity. We compare the similarity forecast with the Reasenberg and Jones (RJ95) method, for a set of 2807 global aftershock sequences of M≥6 mainshocks. We implement a sequence-specific RJ95 forecast using a global average prior and Bayesian updating, but do not propagate epistemic uncertainty. The RJ95 forecast is somewhat more precise than the similarity forecast: 90% of observed sequences fall within a factor of two of the median RJ95 forecast value, whereas the fraction is 85% for the similarity forecast. However, the surprise rate is much higher for the RJ95 forecast; 10% of observed sequences fall in the upper 2.5% of the (Poissonian) forecast range. The surprise rate is less than 3% for the similarity forecast. The similarity forecast may be useful to emergency managers and non-specialists when confidence or expertise in parametric forecasting may be lacking. The method makes over-tuning impossible, and minimizes the rate of surprises. At the least, this forecast constitutes a useful benchmark for more precisely tuned parametric forecasts.

Natural infection of Cryptosporidium muris (Apicomplexa: Cryptosporiidae) in Siberian chipmunks.

PubMed

Hůrková, Lada; Hajdusek, Ondrej; Modrý, David

2003-04-01

Coprologic examination of nine Siberian chipmunks (Eutamias sibiricus) imported from Southeast Asia revealed infection with Cryptosporidium sp. Experimental inoculation of BALB/c mice proved their susceptibility to the infection. Infected mice shed oocysts 14-35 days postinfection. Oocyst morphology was similar to that reported for C. muris in previous studies, oocysts were 8.1 (7.0-9.0) x 5.9 (5.0-6.5) microns. Clinical signs were absent in naturally infected chipmunks and experimental mice. Histologic examinations of mice revealed numerous developmental stages of C. muris in the glandular stomach. Analysis of partial small subunit rRNA gene sequences confirmed identity of these isolates as C. muris. Our results represent the first report of C. muris in members of the family Sciuridae.

Two Complete Genome Sequences of Phasey Bean Mild Yellows Virus, a Novel Member of the Luteoviridae from Australia

PubMed Central

Kehoe, Monica; Coutts, Brenda; van Leur, Joop; Filardo, Fiona; Thomas, John

2016-01-01

We present here the complete genome sequences of a novel polerovirus from Trifolium subterraneum (subterranean clover) and Cicer arietinum (chickpea) and compare these to a partial viral genome sequence obtained from Macroptilium lathyroides (phasey bean). We propose the name phasey bean mild yellows virus for this novel polerovirus. PMID:26847905

Analysis for complete genomic sequence of HLA-B and HLA-C alleles in the Chinese Han population.

PubMed

Zhu, F; He, Y; Zhang, W; He, J; He, J; Xu, X; Lv, H; Yan, L

2011-08-01

In the present study, we have determined the complete genomic sequence and analysed the intron polymorphism of partial HLA-B and HLA-C alleles in the Chinese Han population. Over 3.0 kb DNA fragments of HLA-B and HLA-C loci were amplified by polymerase chain reaction from partial 5' untranslated region to 3' noncoding region respectively, and then the amplified products were sequenced. Full-length nucleotide sequences of 14 HLA-B alleles and 10 HLA-C alleles were obtained and have been submitted to GenBank and IMGT/HLA database. Two novel alleles of HLA-B*52:01:01:02 and HLA-B*59:01:01:02 were identified, and the complete genomic sequence of HLA-B*52:01:01:01 was firstly reported. Totally 157 and 167 polymorphism positions were found in the full-length genomic sequence of HLA-B and HLA-C loci respectively. Our results suggested that many single nucleotide polymorphisms existed in the exon and intron regions, and the data can provide useful information for understanding the evolution of HLA-B and HLA-C alleles. © 2011 Blackwell Publishing Ltd.

Investigating Correlation between Protein Sequence Similarity and Semantic Similarity Using Gene Ontology Annotations.

PubMed

Ikram, Najmul; Qadir, Muhammad Abdul; Afzal, Muhammad Tanvir

2018-01-01

Sequence similarity is a commonly used measure to compare proteins. With the increasing use of ontologies, semantic (function) similarity is getting importance. The correlation between these measures has been applied in the evaluation of new semantic similarity methods, and in protein function prediction. In this research, we investigate the relationship between the two similarity methods. The results suggest absence of a strong correlation between sequence and semantic similarities. There is a large number of proteins with low sequence similarity and high semantic similarity. We observe that Pearson's correlation coefficient is not sufficient to explain the nature of this relationship. Interestingly, the term semantic similarity values above 0 and below 1 do not seem to play a role in improving the correlation. That is, the correlation coefficient depends only on the number of common GO terms in proteins under comparison, and the semantic similarity measurement method does not influence it. Semantic similarity and sequence similarity have a distinct behavior. These findings are of significant effect for future works on protein comparison, and will help understand the semantic similarity between proteins in a better way.

[Molecular identification and detection of moon jellyfish (Aurelia sp.) based on partial sequencing of mitochondrial 16S rDNA and COI].

PubMed

Wang, Jian-Yan; Zhen, Yu; Wang, Guo-shan; Mi, Tie-Zhu; Yu, Zhi-gang

2013-03-01

Taking the moon jellyfish Aurelia sp. commonly found in our coastal sea areas as test object, its genome DNA was extracted, the partial sequences of mt-16S rDNA (650 bp) and mt-COI (709 bp) were PCR-amplified, and, after purification, cloning, and sequencing, the sequences obtained were BLASTn-analyzed. The sequences of greater difference with those of the other jellyfish were chosen, and eight specific primers for the mt-16S rDNA and mt-COI of Aurelia sp. were designed, respectively. The specificity test indicated that the primer AS3 for the mt-16S rDNA and the primer AC3 for the mt-COI were excellent in rapidly detecting the target jellyfish from Rhopilema esculentum, Nemopilema nomurai, Cyanea nozakii, Acromitus sp., and Aurelia sp., and thus, the techniques for the molecular identification and detection of moon jellyfish were preliminarily established, which could get rid of the limitations in classical morphological identification of Aurelia sp. , being able to find the Aurelia sp. in the samples more quickly and accurately.

Easy and accurate reconstruction of whole HIV genomes from short-read sequence data with shiver.

PubMed

Wymant, Chris; Blanquart, François; Golubchik, Tanya; Gall, Astrid; Bakker, Margreet; Bezemer, Daniela; Croucher, Nicholas J; Hall, Matthew; Hillebregt, Mariska; Ong, Swee Hoe; Ratmann, Oliver; Albert, Jan; Bannert, Norbert; Fellay, Jacques; Fransen, Katrien; Gourlay, Annabelle; Grabowski, M Kate; Gunsenheimer-Bartmeyer, Barbara; Günthard, Huldrych F; Kivelä, Pia; Kouyos, Roger; Laeyendecker, Oliver; Liitsola, Kirsi; Meyer, Laurence; Porter, Kholoud; Ristola, Matti; van Sighem, Ard; Berkhout, Ben; Cornelissen, Marion; Kellam, Paul; Reiss, Peter; Fraser, Christophe

2018-01-01

Studying the evolution of viruses and their molecular epidemiology relies on accurate viral sequence data, so that small differences between similar viruses can be meaningfully interpreted. Despite its higher throughput and more detailed minority variant data, next-generation sequencing has yet to be widely adopted for HIV. The difficulty of accurately reconstructing the consensus sequence of a quasispecies from reads (short fragments of DNA) in the presence of large between- and within-host diversity, including frequent indels, may have presented a barrier. In particular, mapping (aligning) reads to a reference sequence leads to biased loss of information; this bias can distort epidemiological and evolutionary conclusions. De novo assembly avoids this bias by aligning the reads to themselves, producing a set of sequences called contigs. However contigs provide only a partial summary of the reads, misassembly may result in their having an incorrect structure, and no information is available at parts of the genome where contigs could not be assembled. To address these problems we developed the tool shiver to pre-process reads for quality and contamination, then map them to a reference tailored to the sample using corrected contigs supplemented with the user's choice of existing reference sequences. Run with two commands per sample, it can easily be used for large heterogeneous data sets. We used shiver to reconstruct the consensus sequence and minority variant information from paired-end short-read whole-genome data produced with the Illumina platform, for sixty-five existing publicly available samples and fifty new samples. We show the systematic superiority of mapping to shiver's constructed reference compared with mapping the same reads to the closest of 3,249 real references: median values of 13 bases called differently and more accurately, 0 bases called differently and less accurately, and 205 bases of missing sequence recovered. We also successfully applied shiver to whole-genome samples of Hepatitis C Virus and Respiratory Syncytial Virus. shiver is publicly available from https://github.com/ChrisHIV/shiver.

High Degree of Interlaboratory Reproducibility of Human Immunodeficiency Virus Type 1 Protease and Reverse Transcriptase Sequencing of Plasma Samples from Heavily Treated Patients

PubMed Central

Shafer, Robert W.; Hertogs, Kurt; Zolopa, Andrew R.; Warford, Ann; Bloor, Stuart; Betts, Bradley J.; Merigan, Thomas C.; Harrigan, Richard; Larder, Brendon A.

2001-01-01

We assessed the reproducibility of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) and protease sequencing using cryopreserved plasma aliquots obtained from 46 heavily treated HIV-1-infected individuals in two laboratories using dideoxynucleotide sequencing. The rates of complete sequence concordance between the two laboratories were 99.1% for the protease sequence and 99.0% for the RT sequence. Approximately 90% of the discordances were partial, defined as one laboratory detecting a mixture and the second laboratory detecting only one of the mixture's components. Only 0.1% of the nucleotides were completely discordant between the two laboratories, and these were significantly more likely to occur in plasma samples with lower plasma HIV-1 RNA levels. Nucleotide mixtures were detected at approximately 1% of the nucleotide positions, and in every case in which one laboratory detected a mixture, the second laboratory either detected the same mixture or detected one of the mixture's components. The high rate of concordance in detecting mixtures and the fact that most discordances between the two laboratories were partial suggest that most discordances were caused by variation in sampling of the HIV-1 quasispecies by PCR rather than by technical errors in the sequencing process itself. PMID:11283081

Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

PubMed Central

Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

2013-01-01

Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

Black-blood native T1 mapping: Blood signal suppression for reduced partial voluming in the myocardium.

PubMed

Weingärtner, Sebastian; Meßner, Nadja M; Zöllner, Frank G; Akçakaya, Mehmet; Schad, Lothar R

2017-08-01

To study the feasibility of black-blood contrast in native T 1 mapping for reduction of partial voluming at the blood-myocardium interface. A saturation pulse prepared heart-rate-independent inversion recovery (SAPPHIRE) T 1 mapping sequence was combined with motion-sensitized driven-equilibrium (MSDE) blood suppression for black-blood T 1 mapping at 3 Tesla. Phantom scans were performed to assess the T 1 time accuracy. In vivo black-blood and conventional SAPPHIRE T 1 mapping was performed in eight healthy subjects and analyzed for T 1 times, precision, and inter- and intraobserver variability. Furthermore, manually drawn regions of interest (ROIs) in all T 1 maps were dilated and eroded to analyze the dependence of septal T 1 times on the ROI thickness. Phantom results and in vivo myocardial T 1 times show comparable accuracy with black-blood compared to conventional SAPPHIRE (in vivo: black-blood: 1562 ± 56 ms vs. conventional: 1583 ± 58 ms, P = 0.20); Using black-blood SAPPHIRE precision was significantly lower (standard deviation: 133.9 ± 24.6 ms vs. 63.1 ± 6.4 ms, P < .0001), and blood T 1 time measurement was not possible. Significantly increased interobserver interclass correlation coefficient (ICC) (0.996 vs. 0.967, P = 0.011) and similar intraobserver ICC (0.979 vs. 0.939, P = 0.11) was obtained with the black-blood sequence. Conventional SAPPHIRE showed strong dependence on the ROI thickness (R 2 = 0.99). No such trend was observed using the black-blood approach (R 2 = 0.29). Black-blood SAPPHIRE successfully eliminates partial voluming at the blood pool in native myocardial T 1 mapping while providing accurate T 1 times, albeit at a reduced precision. Magn Reson Med 78:484-493, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

Identification of an HIV-1 BG Intersubtype Recombinant Form (CRF73_BG), Partially Related to CRF14_BG, Which Is Circulating in Portugal and Spain

PubMed Central

Fernández-García, Aurora; Delgado, Elena; Cuevas, María Teresa; Vega, Yolanda; Montero, Vanessa; Sánchez, Mónica; Carrera, Cristina; López-Álvarez, María José; Miralles, Celia; Pérez-Castro, Sonia; Cilla, Gustavo; Hinojosa, Carmen; Pérez-Álvarez, Lucía; Thomson, Michael M.

2016-01-01

HIV-1 exhibits a characteristically high genetic diversity, with the M group, responsible for the pandemic, being classified into nine subtypes, 72 circulating recombinant forms (CRFs) and numerous unique recombinant forms (URFs). Here we characterize the near full-length genome sequence of an HIV-1 BG intersubtype recombinant virus (X3208) collected in Galicia (Northwest Spain) which exhibits a mosaic structure coincident with that of a previously characterized BG recombinant virus (9601_01), collected in Germany and epidemiologically linked to Portugal, and different from currently defined CRFs. Similar recombination patterns were found in partial genome sequences from three other BG recombinant viruses, one newly derived, from a virus collected in Spain, and two retrieved from databases, collected in France and Portugal, respectively. Breakpoint coincidence and clustering in phylogenetic trees of these epidemiologically-unlinked viruses allow to define a new HIV-1 CRF (CRF73_BG). CRF73_BG shares one breakpoint in the envelope with CRF14_BG, which circulates in Portugal and Spain, and groups with it in a subtype B envelope fragment, but the greatest part of its genome does not appear to derive from CRF14_BG, although both CRFs share as parental strain the subtype G variant circulating in the Iberian Peninsula. Phylogenetic clustering of partial pol and env segments from viruses collected in Portugal and Spain with X3208 and 9691_01 indicates that CRF73_BG is circulating in both countries, with proportions of around 2–3% Portuguese database HIV-1 isolates clustering with CRF73_BG. The fact that an HIV-1 recombinant virus characterized ten years ago as a URF has been shown to represent a CRF suggests that the number of HIV-1 CRFs may be much greater than currently known. PMID:26900693

Candidate nematicidal proteins in a new Pseudomonas veronii isolate identified by its antagonistic properties against Xiphinema index.

PubMed

Canchignia, Hayron; Altimira, Fabiola; Montes, Christian; Sánchez, Evelyn; Tapia, Eduardo; Miccono, María; Espinoza, Daniel; Aguirre, Carlos; Seeger, Michael; Prieto, Humberto

2017-03-17

The nematode Xiphinema index affects grape vines and transmits important viruses associated with fanleaf degeneration. Pseudomonas spp. are an extensive bacterial group in which important biodegradation and/or biocontrol properties can occur for several strains in the group. The aim of this study was to identify new Pseudomonas isolates with antagonist activity against X. index. Forty bacterial isolates were obtained from soil and root samples from Chilean vineyards. Thirteen new fluorescent pseudomonads were found and assessed for their antagonistic capability. The nematicide Pseudomonas protegens CHA0 was used as a control. Challenges of nematode individuals in King's B semi-solid agar Petri dishes facilitated the identification of the Pseudomonas veronii isolate R4, as determined by a 16S rRNA sequence comparison. This isolate was as effective as CHA0 as an antagonist of X. index, although it had a different lethality kinetic. Milk-induced R4 cultures exhibited protease and lipase activities in cell supernatants using both gelatin/tributyrin Petri dish assays and zymograms. Three proteins with these activities were isolated and subjected to mass spectrometry. Amino acid partial sequences enabled the identification of a 49-kDa protease similar to metalloprotease AprA and two lipases of 50 kDa and 69 kDa similar to LipA and ExoU, respectively. Electron microscopy analyses of challenged nematodes revealed degraded cuticle after R4 supernatant treatment. These results represent a new and unexplored property in this species associated with the presence of secretable lipases and protease, similar to characterized enzymes present in biocontrol pseudomonads.

Novel colicin Fy of Yersinia frederiksenii inhibits pathogenic Yersinia strains via YiuR-mediated reception, TonB import, and cell membrane pore formation.

PubMed

Bosák, Juraj; Laiblová, Petra; Smarda, Jan; Dedicová, Daniela; Smajs, David

2012-04-01

A novel colicin type, designated colicin Fy, was found to be encoded and produced by the strain Yersinia frederiksenii Y27601. Colicin Fy was active against both pathogenic and nonpathogenic strains of the genus Yersinia. Plasmid YF27601 (5,574 bp) of Y. frederiksenii Y27601 was completely sequenced. The colicin Fy activity gene (cfyA) and the colicin Fy immunity gene (cfyI) were identified. The deduced amino acid sequence of colicin Fy was very similar in its C-terminal pore-forming domain to colicin Ib (69% identity in the last 178 amino acid residues), indicating pore forming as its lethal mode of action. Transposon mutagenesis of the colicin Fy-susceptible strain Yersinia kristensenii Y276 revealed the yiuR gene (ykris001_4440), which encodes the YiuR outer membrane protein with unknown function, as the colicin Fy receptor molecule. Introduction of the yiuR gene into the colicin Fy-resistant strain Y. kristensenii Y104 restored its susceptibility to colicin Fy. In contrast, the colicin Fy-resistant strain Escherichia coli TOP10F' acquired susceptibility to colicin Fy only when both the yiuR and tonB genes from Y. kristensenii Y276 were introduced. Similarities between colicins Fy and Ib, similarities between the Cir and YiuR receptors, and the detected partial cross-immunity of colicin Fy and colicin Ib producers suggest a common evolutionary origin of the colicin Fy-YiuR and colicin Ib-Cir systems.

Novel Colicin FY of Yersinia frederiksenii Inhibits Pathogenic Yersinia Strains via YiuR-Mediated Reception, TonB Import, and Cell Membrane Pore Formation

PubMed Central

Bosák, Juraj; Laiblová, Petra; Šmarda, Jan; Dědičová, Daniela

2012-01-01

A novel colicin type, designated colicin FY, was found to be encoded and produced by the strain Yersinia frederiksenii Y27601. Colicin FY was active against both pathogenic and nonpathogenic strains of the genus Yersinia. Plasmid YF27601 (5,574 bp) of Y. frederiksenii Y27601 was completely sequenced. The colicin FY activity gene (cfyA) and the colicin FY immunity gene (cfyI) were identified. The deduced amino acid sequence of colicin FY was very similar in its C-terminal pore-forming domain to colicin Ib (69% identity in the last 178 amino acid residues), indicating pore forming as its lethal mode of action. Transposon mutagenesis of the colicin FY-susceptible strain Yersinia kristensenii Y276 revealed the yiuR gene (ykris001_4440), which encodes the YiuR outer membrane protein with unknown function, as the colicin FY receptor molecule. Introduction of the yiuR gene into the colicin FY-resistant strain Y. kristensenii Y104 restored its susceptibility to colicin FY. In contrast, the colicin FY-resistant strain Escherichia coli TOP10F′ acquired susceptibility to colicin FY only when both the yiuR and tonB genes from Y. kristensenii Y276 were introduced. Similarities between colicins FY and Ib, similarities between the Cir and YiuR receptors, and the detected partial cross-immunity of colicin FY and colicin Ib producers suggest a common evolutionary origin of the colicin FY-YiuR and colicin Ib-Cir systems. PMID:22343298

Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

PubMed

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

PubMed Central

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

Biosynthetic Investigations of Lactonamycin and Lactonamycin Z: Cloning of the Biosynthetic Gene Clusters and Discovery of an Unusual Starter Unit▿ †

PubMed Central

Zhang, Xiujun; Alemany, Lawrence B.; Fiedler, Hans-Peter; Goodfellow, Michael; Parry, Ronald J.

2008-01-01

The antibiotics lactonamycin and lactonamycin Z provide attractive leads for antibacterial drug development. Both antibiotics contain a novel aglycone core called lactonamycinone. To gain insight into lactonamycinone biosynthesis, cloning and precursor incorporation experiments were undertaken. The lactonamycin gene cluster was initially cloned from Streptomyces rishiriensis. Sequencing of ca. 61 kb of S. rishiriensis DNA revealed the presence of 57 open reading frames. These included genes coding for the biosynthesis of l-rhodinose, the sugar found in lactonamycin, and genes similar to those in the tetracenomycin biosynthetic gene cluster. Since lactonamycin production by S. rishiriensis could not be sustained, additional proof for the identity of the S. rishiriensis cluster was obtained by cloning the lactonamycin Z gene cluster from Streptomyces sanglieri. Partial sequencing of the S. sanglieri cluster revealed 15 genes that exhibited a very high degree of similarity to genes within the lactonamycin cluster, as well as an identical organization. Double-crossover disruption of one gene in the S. sanglieri cluster abolished lactonamycin Z production, and production was restored by complementation. These results confirm the identity of the genetic locus cloned from S. sanglieri and indicate that the highly similar locus in S. rishiriensis encodes lactonamycin biosynthetic genes. Precursor incorporation experiments with S. sanglieri revealed that lactonamycinone is biosynthesized in an unusual manner whereby glycine or a glycine derivative serves as a starter unit that is extended by nine acetate units. Analysis of the gene clusters and of the precursor incorporation data suggested a hypothetical scheme for lactonamycinone biosynthesis. PMID:18070976

Avalanche of entanglement and correlations at quantum phase transitions.

PubMed

Krutitsky, Konstantin V; Osterloh, Andreas; Schützhold, Ralf

2017-06-16

We study the ground-state entanglement in the quantum Ising model with nearest neighbor ferromagnetic coupling J and find a sequential increase of entanglement depth d with growing J. This entanglement avalanche starts with two-point entanglement, as measured by the concurrence, and continues via the three-tangle and four-tangle, until finally, deep in the ferromagnetic phase for J = ∞, arriving at a pure L-partite (GHZ type) entanglement of all L spins. Comparison with the two, three, and four-point correlations reveals a similar sequence and shows strong ties to the above entanglement measures for small J. However, we also find a partial inversion of the hierarchy, where the four-point correlation exceeds the three- and two-point correlations, well before the critical point is reached. Qualitatively similar behavior is also found for the Bose-Hubbard model, suggesting that this is a general feature of a quantum phase transition. This should be taken into account in the approximations starting from a mean-field limit.

Changing bacterial profile of Sundarbans, the world heritage mangrove: impact of anthropogenic interventions.

PubMed

Chakraborty, Arpita; Bera, Amit; Mukherjee, Arghya; Basak, Pijush; Khan, Imroze; Mondal, Arindam; Roy, Arunava; Bhattacharyya, Anish; SenGupta, Sohan; Roy, Debojyoti; Nag, Sudip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree

2015-04-01

Mangrove microbial communities and their associated activities have profound impact on biogeochemical cycles. Although microbial composition and structure are known to be influenced by biotic and abiotic factors in the mangrove sediments, finding direct correlations between them remains a challenge. In this study we have explored sediment bacterial diversity of the Sundarbans, a world heritage site using a culture-independent molecular approach. Bacterial diversity was analyzed from three different locations with a history of exposure to differential anthropogenic activities. 16S rRNA gene libraries were constructed and partial sequencing of the clones was performed to identify the microbial strains. We identified bacterial strains known to be involved in a variety of biodegradation/biotransformation processes including hydrocarbon degradation, and heavy metal resistance. Canonical Correspondence Analysis of the environmental and exploratory datasets revealed correlations between the ecological indices associated with pollutant levels and bacterial diversity across the sites. Our results indicate that sites with similar exposure of anthropogenic intervention reflect similar patterns of microbial diversity besides spatial commonalities.

Production and properties of the native Chromobacterium violaceum fucose-binding lectin (CV-IIL) compared to homologous lectins of Pseudomonas aeruginosa (PA-IIL) and Ralstonia solanacearum (RS-IIL).

PubMed

Zinger-Yosovich, Keren; Sudakevitz, Dvora; Imberty, Anne; Garber, Nachman C; Gilboa-Garber, Nechama

2006-02-01

Chromobacterium violaceum is a versatile, violet pigment (violacein)-producing beta-proteobacterium, confined to tropical and subtropical regions, dwelling in soil and water, like Pseudomonas aeruginosa and Ralstonia solanacearum. These three bacteria are saprophytes that occasionally become aggressive opportunistic pathogens virulently attacking animals (the first two) and plants (the third). The recent availability of their genome sequences enabled identification in the C. violaceum genome of an ORF (locus no. 1744) that is similar to those of P. aeruginosa and R. solanacearum lectins, PA-IIL and RS-IIL, respectively. A recombinant protein, CV-IIL, encoded by that ORF exhibited fucose>mannose-specific lectin activity resembling PA-IIL. This paper describes production and properties of the native CV-IIL, which, like PA-IIL and RS-IIL, is probably also a quorum-sensing-driven secondary metabolite, appearing concomitantly with violacein. Its formation is repressed in the CV026 mutant of C. violaceum, which lacks endogenous N-acylhomoserine lactone. The upstream extragenic sequence of its ORF contains a 20 bp sequence (5'-101-120) with partial similarities to the luxI-box and the related P. aeruginosa and R. solanacearum promoter boxes of quorum-sensing-controlled genes. The lectin level is augmented by addition of trehalose to the medium. The subunit size of CV-IIL (around 11.86 kDa) is similar to those of PA-IIL (11.73 kDa) and RS-IIL (11.60 kDa). Like PA-IIL, in the tetrameric form CV-IIL preferentially agglutinates alpha1-2 fucosylated H-positive human erythrocytes (regardless of their A, B or O type), as opposed to the O(h) Bombay type, but differs from it in having no interaction with rabbit erythrocytes and in displaying stronger affinity to l-galactose than to l-fucose. The greater similarity of CV-IIL to PA-IIL than to RS-IIL might be related to the selective adaptation of both C. violaceum and P. aeruginosa to animal tissues versus the preferential homing of R. solanacearum to plants.

Sequence Analysis and Initial Characterization of Two Isozymes of Hydroxylaminobenzene Mutase from Pseudomonas pseudoalcaligenes JS45

PubMed Central

Davis, John K.; Paoli, George C.; He, Zhongqi; Nadeau, Lloyd J.; Somerville, Charles C.; Spain, Jim C.

2000-01-01

Pseudomonas pseudoalcaligenes JS45 grows on nitrobenzene by a partially reductive pathway in which the intermediate hydroxylaminobenzene is enzymatically rearranged to 2-aminophenol by hydroxylaminobenzene mutase (HAB mutase). The properties of the enzyme, the reaction mechanism, and the evolutionary origin of the gene(s) encoding the enzyme are unknown. In this study, two open reading frames (habA and habB), each encoding an HAB mutase enzyme, were cloned from a P. pseudoalcaligenes JS45 genomic library and sequenced. The open reading frames encoding HabA and HabB are separated by 2.5 kb and are divergently transcribed. The deduced amino acid sequences of HabA and HabB are 44% identical. The HAB mutase specific activities in crude extracts of Escherichia coli clones synthesizing either HabA or HabB were similar to the specific activities of extracts of strain JS45 grown on nitrobenzene. HAB mutase activity in E. coli extracts containing HabB withstood heating at 85°C for 10 min, but extracts containing HabA were inactivated when they were heated at temperatures above 60°C. HAB mutase activity in extracts of P. pseudoalcaligenes JS45 grown on nitrobenzene exhibited intermediate temperature stability. Although both the habA gene and the habB gene conferred HAB mutase activity when they were separately cloned and expressed in E. coli, reverse transcriptase PCR analysis indicated that only habA is transcribed in P. pseudoalcaligenes JS45. A mutant strain derived from strain JS45 in which the habA gene was disrupted was unable to grow on nitrobenzene, which provided physiological evidence that HabA is involved in the degradation of nitrobenzene. A strain in which habB was disrupted grew on nitrobenzene. Gene Rv3078 of Mycobacterium tuberculosis H37Rv encodes a protein whose deduced amino acid sequence is 52% identical to the HabB amino acid sequence. E. coli containing M. tuberculosis gene Rv3078 cloned into pUC18 exhibited low levels of HAB mutase activity. Sequences that exhibit similarity to transposable element sequences are present between habA and habB, as well as downstream of habB, which suggests that horizontal gene transfer resulted in acquisition of one or both of the hab genes. PMID:10877793

Genetic analysis of Enterobius vermicularis isolated from a chimpanzee with lethal hemorrhagic colitis and pathology of the associated lesions.

PubMed

Yaguchi, Yuji; Okabayashi, Sachi; Abe, Niichiro; Masatou, Haruhisa; Iida, Shinya; Teramoto, Isao; Matsubayashi, Makoto; Shibahara, Tomoyuki

2014-11-01

Human pinworms, Enterobius vermicularis, are normally recognized as minor pathogens. However, a fatal case of human pinworm infection has been reported in a nonhuman primate, a zoo reared chimpanzee. Here, we histopathologically examined the lesions in tissues from the deceased chimpanzee and genetically characterized the isolated worms to investigate the pathogenicity and determine the phylogeny. We identified ulcers deep in the submucosa where many parasites were found to have invaded the lamina propria mucosa or submucous tissue. An inflammatory reaction consisting mainly of neutrophils and lymphocytes but not eosinophils was observed around the parasites, and intense hemorrhage in the lamina propria was confirmed. The parasites were morphologically similar to E. vermicularis based on the shape of the copulatory spicules. Mitochondrial cytochrome c oxidase subunit 1 gene products were amplified from worm DNA by PCR and were genetically identified as E. vermicularis based on >98.7% similarity of partial sequences. Phylogenetic analysis revealed that the sequences clustered together with other chimpanzee E. vermicularis isolates in a group which has been referred to as type C and which differs from human isolates (type A). The samples were negative for bacterial pathogens and Entamoeba histolytica indicating that E. vermicularis could be pathogenic in chimpanzees. Phylogenetic clustering of the isolates indicated that the parasite may be host specific.

Geology of the Ulugh Muztagh area, northern Tibet

USGS Publications Warehouse

Burchfiel, B.C.; Molnar, P.; Zhao, Ziyun; Liang, K'uangyi; Wang, Shuji; Huang, Minmin; Sutter, J.

1989-01-01

Within the Ulugh Muztagh area, north central Tibet, an east-west-trending ophiolitic melange marks a suture that apparently was formed during a late Triassic or slightly younger collision between a continental fragment to the south and the rest of Asia. The southern continental fragment carries a thick sequence of upper Triassic sandstone, but the contact between the sandstone and the ophiolitic melange is covered by a younger redbed sequence of unknown age. A suite of 2-mica, tourmaline-bearing leucogranite plutons and dikes intruded the Triassic sandstone at shallow crustal levels 10.5 to 8.4 Ma. These rocks range from granite to tonalite in composition, are geochemically very similar to slightly older High Himalayan leucogranite and are interpreted to have been derived by the partial melting of crustal material. We interpret this to mean that crustal thickening began in this part of the Tibetan plateau at least by 10.5 Ma. Welded rhyolitic tuff rests on a conglomerate that consists of abundant debris from the Ulugh Muztagh intrusive rocks and has yielded Ar Ar ages of about 4 Ma. The tuffs are geochemically identical to the intrusive rocks suggesting that crustal thickening may have continued to 4 Ma. Crustal thickening probably occurred by distributed crustal shortening similar to shortening now occurring north of Ulugh Muztagh along the northern margin of the Tibetan Plateau. ?? 1989.

First serological and molecular evidence of PPRV occurrence in Ghardaïa district, center of Algeria.

PubMed

Kardjadj, Moustafa; Ben-Mahdi, Meriem-Hind; Luka, Pam Dachung

2015-10-01

In February 2012, an outbreak of peste des petits ruminants (PPR) was suspected in Ghardaïa district at the center of Algeria. Clinical, serological, and molecular investigations were performed to confirm the occurrence of PPRV. The overall morbidity, mortality, and case fatality rates of the ten flocks investigated were 12.2, 2.5, and 20.3 %, respectively. At the flock level, positivity to PPR was 100, 90, and 100 % by competitive ELISA (c-ELISA), RT-PCR of blood samples, and oculo-nasal swabs, respectively. At the individual levels, the present study showed that out of 186 samples collected from the same animals 17/62 (27.41 %), 14/62 (22.85 %), and 36/62 (58.06 %) were positive by c-ELISA, RT-PCR of blood samples, and RT PCR of oculo-nasal swabs, respectively. The positivity of PPR was significantly higher using RT-PCR of oculo-nasal swabs than c-ELISA and RT-PCR of blood samples. The N gene partial sequence of five PPRV-positive amplicons revealed 100 % homology among them and phylogenetically belonged to lineage IV. The sequences also showed similarity range of 97-99 % with the strains implicated in the Moroccan and Tunisian outbreaks, however, suggesting that a similar strain is circulating across this area of the Maghreb and highlighting the need for a regional control approach.

Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

PubMed Central

Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

2012-01-01

Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

Pseudomonas aestusnigri sp. nov., isolated from crude oil-contaminated intertidal sand samples after the Prestige oil spill.

PubMed

Sánchez, David; Mulet, Magdalena; Rodríguez, Ana C; David, Zoyla; Lalucat, Jorge; García-Valdés, Elena

2014-03-01

Strains VGXO14(T) and Vi1 were isolated from the Atlantic intertidal shore from Galicia, Spain, after the Prestige oil spill. Both strains were Gram-negative rod-shaped bacteria with one polar inserted flagellum, strictly aerobic, and able to grow at 18-37°C, pH 6-10 and 2-10% NaCl. A preliminary analysis of the 16S rRNA and the partial rpoD gene sequences indicated that these strains belonged to the Pseudomonas genus but were distinct from any known Pseudomonas species. A polyphasic taxonomic approach including phylogenetic, chemotaxonomic, phenotypic and genotypic data confirmed that the strains belonged to the Pseudomonas pertucinogena group. In a multilocus sequence analysis, the similarity of VGXO14(T) and Vi1 to the closest type strain of the group, Pseudomonas pachastrellae, was 90.4%, which was lower than the threshold of 97% established to discriminate species in the Pseudomonas genus. The DNA-DNA hybridisation similarity between strains VGXO14(T) and Vi1 was 79.6%, but below 70% with the type strains in the P. pertucinogena group. Therefore, the strains should be classified within the genus Pseudomonas as a novel species, for which the name Pseudomonas aestusnigri is proposed. The type strain is VGXO14(T) (=CCUG 64165(T)=CECT 8317(T)). Copyright © 2013 Elsevier GmbH. All rights reserved.

Method and apparatus for biological sequence comparison

DOEpatents

Marr, T.G.; Chang, W.I.

1997-12-23

A method and apparatus are disclosed for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence. 5 figs.

Method and apparatus for biological sequence comparison

DOEpatents

Marr, Thomas G.; Chang, William I-Wei

1997-01-01

A method and apparatus for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence.

Isolation of a species-specific mitochondrial DNA sequence for identification of Tilletia indica, the Karnal bunt of wheat fungus.

PubMed Central

Ferreira, M A; Tooley, P W; Hatziloukas, E; Castro, C; Schaad, N W

1996-01-01

Mitochondrial DNA (mtDNA) from five isolates of Tilletia indica was isolated and digested with several restriction enzymes. A 2.3-kb EcoRI fragment was chosen, cloned, and shown to hybridize with total DNA restricted with EcoRI from T. indica and not from a morphologically similar smut fungus, Tilletia barclayana. The clone was partially sequenced, and primers were designed and tested under high-stringency conditions in PCR assays. The primer pair Ti1/Ti4 amplified a 2.3-kb fragment from total DNA of 17 T. indica isolates from India, Pakistan, and Mexico. DNA from 25 isolates of other smut fungi (T. barclayana, Tilletia foetida, Tilletia caries, Tilletia fusca, and Tilletia controversa) did not produce any bands, as detected by ethidium bromide-stained agarose gels and Southern hybridizations. The sensitivity of the assay was determined and increased by using a single nested primer in a second round of amplification, so that 1 pg of total mycelial DNA could be detected. The results indicated that the primers which originated from a cloned mtDNA sequence can be used to differentiate T. indica from other Tilletia species and have the potential to identify teliospores contaminating wheat seeds. PMID:8572716

Evidence for positive selection and recombination hotspots in Deformed wing virus (DWV).

PubMed

Dalmon, A; Desbiez, C; Coulon, M; Thomasson, M; Le Conte, Y; Alaux, C; Vallon, J; Moury, B

2017-01-25

Deformed wing virus (DWV) is considered one of the most damaging pests in honey bees since the spread of its vector, Varroa destructor. In this study, we sequenced the whole genomes of two virus isolates and studied the evolutionary forces that act on DWV genomes. The isolate from a Varroa-tolerant bee colony was characterized by three recombination breakpoints between DWV and the closely related Varroa destructor virus-1 (VDV-1), whereas the variant from the colony using conventional Varroa management was similar to the originally described DWV. From the complete sequence dataset, nine independent DWV-VDV-1 recombination breakpoints were detected, and recombination hotspots were found in the 5' untranslated region (5' UTR) and the conserved region encoding the helicase. Partial sequencing of the 5' UTR and helicase-encoding region in 41 virus isolates suggested that most of the French isolates were recombinants. By applying different methods based on the ratio between non-synonymous (dN) and synonymous (dS) substitution rates, we identified four positions that showed evidence of positive selection. Three of these positions were in the putative leader protein (Lp), and one was in the polymerase. These findings raise the question of the putative role of the Lp in viral evolution.

Origin of anti-tumor activity of the cysteine-containing GO peptides and further optimization of their cytotoxic properties

NASA Astrophysics Data System (ADS)

Tyuryaeva, Irina I.; Lyublinskaya, Olga G.; Podkorytov, Ivan S.; Skrynnikov, Nikolai R.

2017-01-01

Antitumor GO peptides have been designed as dimerization inhibitors of prominent oncoprotein mucin 1. In this study we demonstrate that activity of GO peptides is independent of the level of cellular expression of mucin 1. Furthermore, these peptides prove to be broadly cytotoxic, causing cell death also in normal cells such as dermal fibroblasts and endometrial mesenchymal stem cells. To explore molecular mechanism of their cytotoxicity, we have designed and tested a number of new peptide sequences containing the key CxC or CxxC motifs. Of note, these sequences bear no similarity to mucin 1 except that they also contain a pair of proximal cysteines. Several of the new peptides turned out to be significantly more potent than their GO prototypes. The results suggest that cytotoxicity of these peptides stems from their (moderate) activity as disulfide oxidoreductases. It is expected that such peptides, which we have termed DO peptides, are involved in disulfide-dithiol exchange reaction, resulting in formation of adventitious disulfide bridges in cell proteins. In turn, this leads to a partial loss of protein function and rapid onset of apoptosis. We anticipate that coupling DO sequences with tumor-homing transduction domains can create a potentially valuable new class of tumoricidal peptides.

Origin of anti-tumor activity of the cysteine-containing GO peptides and further optimization of their cytotoxic properties

PubMed Central

Tyuryaeva, Irina I.; Lyublinskaya, Olga G.; Podkorytov, Ivan S.; Skrynnikov, Nikolai R.

2017-01-01

Antitumor GO peptides have been designed as dimerization inhibitors of prominent oncoprotein mucin 1. In this study we demonstrate that activity of GO peptides is independent of the level of cellular expression of mucin 1. Furthermore, these peptides prove to be broadly cytotoxic, causing cell death also in normal cells such as dermal fibroblasts and endometrial mesenchymal stem cells. To explore molecular mechanism of their cytotoxicity, we have designed and tested a number of new peptide sequences containing the key CxC or CxxC motifs. Of note, these sequences bear no similarity to mucin 1 except that they also contain a pair of proximal cysteines. Several of the new peptides turned out to be significantly more potent than their GO prototypes. The results suggest that cytotoxicity of these peptides stems from their (moderate) activity as disulfide oxidoreductases. It is expected that such peptides, which we have termed DO peptides, are involved in disulfide-dithiol exchange reaction, resulting in formation of adventitious disulfide bridges in cell proteins. In turn, this leads to a partial loss of protein function and rapid onset of apoptosis. We anticipate that coupling DO sequences with tumor-homing transduction domains can create a potentially valuable new class of tumoricidal peptides. PMID:28091523

Molecular analysis of 16S rRNA genes identifies potentially periodontal pathogenic bacteria and archaea in the plaque of partially erupted third molars.

PubMed

Mansfield, J M; Campbell, J H; Bhandari, A R; Jesionowski, A M; Vickerman, M M

2012-07-01

Small subunit rRNA sequencing and phylogenetic analysis were used to identify cultivable and uncultivable microorganisms present in the dental plaque of symptomatic and asymptomatic partially erupted third molars to determine the prevalence of putative periodontal pathogens in pericoronal sites. Template DNA prepared from subgingival plaque collected from partially erupted symptomatic and asymptomatic mandibular third molars and healthy incisors was used in polymerase chain reaction with broad-range oligonucleotide primers to amplify 16S rRNA bacterial and archaeal genes. Amplicons were cloned, sequenced, and compared with known nucleotide sequences in online databases to identify the microorganisms present. Two thousand three hundred two clones from the plaque of 12 patients carried bacterial sequences from 63 genera belonging to 11 phyla, including members of the uncultivable TM7, SR1, and Chloroflexi, and difficult-to-cultivate Synergistetes and Spirochaetes. Dialister invisus, Filifactor alocis, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella denticola, Tannerella forsythia, and Treponema denticola, which have been associated with periodontal disease, were found in significantly greater abundance in pericoronal compared with incisor sites. Dialister invisus and F nucleatum were found in greater abundance in sites exhibiting clinical symptoms. The archaeal species, Methanobrevibacter oralis, which has been associated with severe periodontitis, was found in 3 symptomatic patients. These findings have provided new insights into the complex microbiota of pericoronitis. Several bacterial and archaeal species implicated in periodontal disease were recovered in greater incidence and abundance from the plaque of partially erupted third molars compared with incisors, supporting the hypothesis that the pericoronal region may provide a favored niche for periodontal pathogens in otherwise healthy mouths. Copyright © 2012 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

PubMed

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

PubMed Central

Chang, Wei Shan

2014-01-01

Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria.

PubMed

Oluwayelu, D O; Todd, D; Olaleye, O D

2008-12-01

This work reports the first molecular analysis study of chicken anaemia virus (CAV) in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6% and 4% nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2% amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/CI-8 and NGR/CI-9) were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

Microstructures and petrology of melt inclusions in the anatectic sequence of Jubrique (Betic Cordillera, S Spain): Implications for crustal anatexis

NASA Astrophysics Data System (ADS)

Barich, Amel; Acosta-Vigil, Antonio; Garrido, Carlos J.; Cesare, Bernardo; Tajčmanová, Lucie; Bartoli, Omar

2014-10-01

We report a new occurrence of melt inclusions in polymetamorphic granulitic gneisses of the Jubrique unit, a complete though strongly thinned crustal section located above the Ronda peridotite slab (Betic Cordillera, S Spain). The gneissic sequence is composed of mylonitic gneisses at the bottom and in contact with the peridotites, and porphyroblastic gneisses on top. Mylonitic gneisses are strongly deformed rocks with abundant garnet and rare biotite. Except for the presence of melt inclusions, microstructures indicating the former presence of melt are rare or absent. Upwards in the sequence, garnet decreases whereas biotite increases in modal proportion. Melt inclusions are present from cores to rims of garnets throughout the entire sequence. Most of the former melt inclusions are now totally crystallized and correspond to nanogranites, whereas some of them are partially made of glass or, more rarely, are totally glassy. They show negative crystal shapes and range in size from ≈ 5 to 200 μm, with a mean size of ≈ 30-40 μm. Daughter phases in nanogranites and partially crystallized melt inclusions include quartz, feldspars, biotite and muscovite; accidental minerals include kyanite, graphite, zircon, monazite, rutile and ilmenite; glass has a granitic composition. Melt inclusions are mostly similar throughout all the gneissic sequence. Some fluid inclusions, of possible primary origin, are spatially associated with melt inclusions, indicating that at some point during the suprasolidus history of these rocks granitic melt and fluid coexisted. Thermodynamic modeling and conventional thermobarometry of mylonitic gneisses provide peak conditions of ≈ 850 °C and 12-14 kbar, corresponding to cores of large garnets with inclusions of kyanite and rutile. Post-peak conditions of ≈ 800-850 °C and 5-6 kbar are represented by rim regions of large garnets with inclusions of sillimanite and ilmenite, cordierite-quartz-biotite coronas replacing garnet rims, and the matrix with oriented sillimanite. Previous conventional petrologic studies on these strongly deformed rocks have proposed that anatexis started during decompression from peak to post-peak conditions and in the field of sillimanite. The study of melt inclusions shows, however, that melt was already present in the system at peak conditions, and that most garnet grew in the presence of melt.

The earliest maize from San Marcos Tehuacán is a partial domesticate with genomic evidence of inbreeding

PubMed Central

Vallebueno-Estrada, Miguel; Rodríguez-Arévalo, Isaac; Rougon-Cardoso, Alejandra; Martínez González, Javier; García Cook, Angel; Vielle-Calzada, Jean-Philippe

2016-01-01

Pioneering archaeological expeditions lead by Richard MacNeish in the 1960s identified the valley of Tehuacán as an important center of early Mesoamerican agriculture, providing by far the widest collection of ancient crop remains, including maize. In 2012, a new exploration of San Marcos cave (Tehuacán, Mexico) yielded nonmanipulated maize specimens dating at a similar age of 5,300–4,970 calibrated y B.P. On the basis of shotgun sequencing and genomic comparisons to Balsas teosinte and modern maize, we show herein that the earliest maize from San Marcos cave was a partial domesticate diverging from the landraces and containing ancestral allelic variants that are absent from extant maize populations. Whereas some domestication loci, such as teosinte branched1 (tb1) and brittle endosperm2 (bt2), had already lost most of the nucleotide variability present in Balsas teosinte, others, such as teosinte glume architecture1 (tga1) and sugary1 (su1), conserved partial levels of nucleotide variability that are absent from extant maize. Genetic comparisons among three temporally convergent samples revealed that they were homozygous and identical by descent across their genome. Our results indicate that the earliest maize from San Marcos was already inbred, opening the possibility for Tehuacán maize cultivation evolving from reduced founder populations of isolated and perhaps self-pollinated individuals. PMID:27872313

The earliest maize from San Marcos Tehuacán is a partial domesticate with genomic evidence of inbreeding.

PubMed

Vallebueno-Estrada, Miguel; Rodríguez-Arévalo, Isaac; Rougon-Cardoso, Alejandra; Martínez González, Javier; García Cook, Angel; Montiel, Rafael; Vielle-Calzada, Jean-Philippe

2016-12-06

Pioneering archaeological expeditions lead by Richard MacNeish in the 1960s identified the valley of Tehuacán as an important center of early Mesoamerican agriculture, providing by far the widest collection of ancient crop remains, including maize. In 2012, a new exploration of San Marcos cave (Tehuacán, Mexico) yielded nonmanipulated maize specimens dating at a similar age of 5,300-4,970 calibrated y B.P. On the basis of shotgun sequencing and genomic comparisons to Balsas teosinte and modern maize, we show herein that the earliest maize from San Marcos cave was a partial domesticate diverging from the landraces and containing ancestral allelic variants that are absent from extant maize populations. Whereas some domestication loci, such as teosinte branched1 (tb1) and brittle endosperm2 (bt2), had already lost most of the nucleotide variability present in Balsas teosinte, others, such as teosinte glume architecture1 (tga1) and sugary1 (su1), conserved partial levels of nucleotide variability that are absent from extant maize. Genetic comparisons among three temporally convergent samples revealed that they were homozygous and identical by descent across their genome. Our results indicate that the earliest maize from San Marcos was already inbred, opening the possibility for Tehuacán maize cultivation evolving from reduced founder populations of isolated and perhaps self-pollinated individuals.

The neural dynamics of song syntax in songbirds

NASA Astrophysics Data System (ADS)

Jin, Dezhe

2010-03-01

Songbird is ``the hydrogen atom'' of the neuroscience of complex, learned vocalizations such as human speech. Songs of Bengalese finch consist of sequences of syllables. While syllables are temporally stereotypical, syllable sequences can vary and follow complex, probabilistic syntactic rules, which are rudimentarily similar to grammars in human language. Songbird brain is accessible to experimental probes, and is understood well enough to construct biologically constrained, predictive computational models. In this talk, I will discuss the structure and dynamics of neural networks underlying the stereotypy of the birdsong syllables and the flexibility of syllable sequences. Recent experiments and computational models suggest that a syllable is encoded in a chain network of projection neurons in premotor nucleus HVC (proper name). Precisely timed spikes propagate along the chain, driving vocalization of the syllable through downstream nuclei. Through a computational model, I show that that variable syllable sequences can be generated through spike propagations in a network in HVC in which the syllable-encoding chain networks are connected into a branching chain pattern. The neurons mutually inhibit each other through the inhibitory HVC interneurons, and are driven by external inputs from nuclei upstream of HVC. At a branching point that connects the final group of a chain to the first groups of several chains, the spike activity selects one branch to continue the propagation. The selection is probabilistic, and is due to the winner-take-all mechanism mediated by the inhibition and noise. The model predicts that the syllable sequences statistically follow partially observable Markov models. Experimental results supporting this and other predictions of the model will be presented. We suggest that the syntax of birdsong syllable sequences is embedded in the connection patterns of HVC projection neurons.

Cloning and sequencing of the cDNA species for mammalian dimeric dihydrodiol dehydrogenases.

PubMed Central

Arimitsu, E; Aoki, S; Ishikura, S; Nakanishi, K; Matsuura, K; Hara, A

1999-01-01

Cynomolgus and Japanese monkey kidneys, dog and pig livers and rabbit lens contain dimeric dihydrodiol dehydrogenase (EC 1.3.1.20) associated with high carbonyl reductase activity. Here we have isolated cDNA species for the dimeric enzymes by reverse transcriptase-PCR from human intestine in addition to the above five animal tissues. The amino acid sequences deduced from the monkey, pig and dog cDNA species perfectly matched the partial sequences of peptides digested from the respective enzymes of these animal tissues, and active recombinant proteins were expressed in a bacterial system from the monkey and human cDNA species. Northern blot analysis revealed the existence of a single 1.3 kb mRNA species for the enzyme in these animal tissues. The human enzyme shared 94%, 85%, 84% and 82% amino acid identity with the enzymes of the two monkey strains (their sequences were identical), the dog, the pig and the rabbit respectively. The sequences of the primate enzymes consisted of 335 amino acid residues and lacked one amino acid compared with the other animal enzymes. In contrast with previous reports that other types of dihydrodiol dehydrogenase, carbonyl reductases and enzymes with either activity belong to the aldo-keto reductase family or the short-chain dehydrogenase/reductase family, dimeric dihydrodiol dehydrogenase showed no sequence similarity with the members of the two protein families. The dimeric enzyme aligned with low degrees of identity (14-25%) with several prokaryotic proteins, in which 47 residues are strictly or highly conserved. Thus dimeric dihydrodiol dehydrogenase has a primary structure distinct from the previously known mammalian enzymes and is suggested to constitute a novel protein family with the prokaryotic proteins. PMID:10477285

Amalga-like virus infecting Antonospora locustae, a microsporidian pathogen of grasshoppers, plus related viruses associated with other arthropods.

PubMed

Pyle, Jesse D; Keeling, Patrick J; Nibert, Max L

2017-04-02

A previously reported Expressed Sequence Tag (EST) library from spores of microsporidian Antonospora locustae includes a number of clones with sequence similarities to plant amalgaviruses. Reexamining the sequence accessions from that library, we found additional such clones, contributing to a 3247-nt contig that approximates the length of an amalga-like virus genome. Using A. locustae spores stored from that previous study, and new ones obtained from the same source, we newly visualized the putative dsRNA genome of this virus and obtained amplicons yielding a 3387-nt complete genome sequence. Phylogenetic analyses suggested it as prototype strain of a new genus in family Amalgaviridae. The genome contains two partially overlapping long ORFs, with downstream ORF2 in the +1 frame relative to ORF1 and a proposed motif for +1 ribosomal frameshifting in the region of overlap. Subsequent database searches using the predicted fusion protein sequence of this new amalga-like virus identified related sequences in the transcriptome of a basal hexapod, the springtail species Tetrodontophora bielanensis. We speculate that this second new amalga-like virus (contig length, 3475 nt) likely also derived from a microsporidian, or related organism, which was associated with the springtail specimens at the time of sampling for transcriptome analysis. Other findings of interest include evidence that the ORF1 translation products of these two new amalga-like viruses contain a central region of predicted α-helical coiled coil, as recently reported for plant amalgaviruses, and transcriptome-based evidence for another new amalga-like virus in the transcriptome of another basal hexapod, the two-pronged bristletail species Campodea augens. Copyright © 2017 Elsevier B.V. All rights reserved.

Sequence information signal processor

DOEpatents

Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.

1999-01-01

An electronic circuit is used to compare two sequences, such as genetic sequences, to determine which alignment of the sequences produces the greatest similarity. The circuit includes a linear array of series-connected processors, each of which stores a single element from one of the sequences and compares that element with each successive element in the other sequence. For each comparison, the processor generates a scoring parameter that indicates which segment ending at those two elements produces the greatest degree of similarity between the sequences. The processor uses the scoring parameter to generate a similar scoring parameter for a comparison between the stored element and the next successive element from the other sequence. The processor also delivers the scoring parameter to the next processor in the array for use in generating a similar scoring parameter for another pair of elements. The electronic circuit determines which processor and alignment of the sequences produce the scoring parameter with the highest value.

Soup to Tree: The Phylogeny of Beetles Inferred by Mitochondrial Metagenomics of a Bornean Rainforest Sample

PubMed Central

Crampton-Platt, Alex; Timmermans, Martijn J.T.N.; Gimmel, Matthew L.; Kutty, Sujatha Narayanan; Cockerill, Timothy D.; Vun Khen, Chey; Vogler, Alfried P.

2015-01-01

In spite of the growth of molecular ecology, systematics and next-generation sequencing, the discovery and analysis of diversity is not currently integrated with building the tree-of-life. Tropical arthropod ecologists are well placed to accelerate this process if all specimens obtained through mass-trapping, many of which will be new species, could be incorporated routinely into phylogeny reconstruction. Here we test a shotgun sequencing approach, whereby mitochondrial genomes are assembled from complex ecological mixtures through mitochondrial metagenomics, and demonstrate how the approach overcomes many of the taxonomic impediments to the study of biodiversity. DNA from approximately 500 beetle specimens, originating from a single rainforest canopy fogging sample from Borneo, was pooled and shotgun sequenced, followed by de novo assembly of complete and partial mitogenomes for 175 species. The phylogenetic tree obtained from this local sample was highly similar to that from existing mitogenomes selected for global coverage of major lineages of Coleoptera. When all sequences were combined only minor topological changes were induced against this reference set, indicating an increasingly stable estimate of coleopteran phylogeny, while the ecological sample expanded the tip-level representation of several lineages. Robust trees generated from ecological samples now enable an evolutionary framework for ecology. Meanwhile, the inclusion of uncharacterized samples in the tree-of-life rapidly expands taxon and biogeographic representation of lineages without morphological identification. Mitogenomes from shotgun sequencing of unsorted environmental samples and their associated metadata, placed robustly into the phylogenetic tree, constitute novel DNA “superbarcodes” for testing hypotheses regarding global patterns of diversity. PMID:25957318

Delineating slowly and rapidly evolving fractions of the Drosophila genome.

PubMed

Keith, Jonathan M; Adams, Peter; Stephen, Stuart; Mattick, John S

2008-05-01

Evolutionary conservation is an important indicator of function and a major component of bioinformatic methods to identify non-protein-coding genes. We present a new Bayesian method for segmenting pairwise alignments of eukaryotic genomes while simultaneously classifying segments into slowly and rapidly evolving fractions. We also describe an information criterion similar to the Akaike Information Criterion (AIC) for determining the number of classes. Working with pairwise alignments enables detection of differences in conservation patterns among closely related species. We analyzed three whole-genome and three partial-genome pairwise alignments among eight Drosophila species. Three distinct classes of conservation level were detected. Sequences comprising the most slowly evolving component were consistent across a range of species pairs, and constituted approximately 62-66% of the D. melanogaster genome. Almost all (>90%) of the aligned protein-coding sequence is in this fraction, suggesting much of it (comprising the majority of the Drosophila genome, including approximately 56% of non-protein-coding sequences) is functional. The size and content of the most rapidly evolving component was species dependent, and varied from 1.6% to 4.8%. This fraction is also enriched for protein-coding sequence (while containing significant amounts of non-protein-coding sequence), suggesting it is under positive selection. We also classified segments according to conservation and GC content simultaneously. This analysis identified numerous sub-classes of those identified on the basis of conservation alone, but was nevertheless consistent with that classification. Software, data, and results available at www.maths.qut.edu.au/-keithj/. Genomic segments comprising the conservation classes available in BED format.

Divergence of the phytochrome gene family predates angiosperm evolution and suggests that Selaginella and Equisetum arose prior to Psilotum.

PubMed

Kolukisaoglu, H U; Marx, S; Wiegmann, C; Hanelt, S; Schneider-Poetsch, H A

1995-09-01

Thirty-two partial phytochrome sequences from algae, mosses, ferns, gymnosperms, and angiosperms (11 of them newly released ones from our laboratory) were analyzed by distance and character-state approaches (PHYLIP, TREECON, PAUP). In addition, 12 full-length sequences were analyzed. Despite low bootstrap values at individual internal nodes, the inferred trees (neighbor-joining, Fitch, maximum parsimony) generally showed similar branching orders consistent with other molecular data. Lower plants formed two distinct groups. One basal group consisted of Selaginella, Equisetum, and mosses; the other consisted of a monophyletic cluster of frond-bearing pteridophytes. Psilotum was a member of the latter group and hence perhaps was not, as sometimes suggested, a close relative of the first vascular plants. The results further suggest that phytochrome gene duplication giving rise to a- and b- and later to c-types may have taken place within seedfern genomes. Distance matrices dated the separation of mono- and dicotyledons back to about 260 million years before the present (Myr B.P.) and the separation of Metasequoia and Picea to a fossil record-compatible value of 230 Myr B.P. The Ephedra sequence clustered with the c- or a-type and Metasequoia and Picea sequences clustered with the b-type lineage. The "paleoherb" Nymphaea branched off from the c-type lineage prior to the divergence of mono- and dicotyledons on the a- and b-type branches. Sequences of Piper (another "paleoherb") created problems in that they branched off from different phytochrome lineages at nodes contradicting distance from the inferred trees' origin.

Two Complete Genome Sequences of Phasey Bean Mild Yellows Virus, a Novel Member of the Luteoviridae from Australia.

PubMed

Sharman, Murray; Kehoe, Monica; Coutts, Brenda; van Leur, Joop; Filardo, Fiona; Thomas, John

2016-02-04

We present here the complete genome sequences of a novel polerovirus from Trifolium subterraneum (subterranean clover) and Cicer arietinum (chickpea) and compare these to a partial viral genome sequence obtained from Macroptilium lathyroides (phasey bean). We propose the name phasey bean mild yellows virus for this novel polerovirus. Copyright © 2016 Sharman et al.

A Genome-Scale Investigation of How Sequence, Function, and Tree-Based Gene Properties Influence Phylogenetic Inference.

PubMed

Shen, Xing-Xing; Salichos, Leonidas; Rokas, Antonis

2016-09-02

Molecular phylogenetic inference is inherently dependent on choices in both methodology and data. Many insightful studies have shown how choices in methodology, such as the model of sequence evolution or optimality criterion used, can strongly influence inference. In contrast, much less is known about the impact of choices in the properties of the data, typically genes, on phylogenetic inference. We investigated the relationships between 52 gene properties (24 sequence-based, 19 function-based, and 9 tree-based) with each other and with three measures of phylogenetic signal in two assembled data sets of 2,832 yeast and 2,002 mammalian genes. We found that most gene properties, such as evolutionary rate (measured through the percent average of pairwise identity across taxa) and total tree length, were highly correlated with each other. Similarly, several gene properties, such as gene alignment length, Guanine-Cytosine content, and the proportion of tree distance on internal branches divided by relative composition variability (treeness/RCV), were strongly correlated with phylogenetic signal. Analysis of partial correlations between gene properties and phylogenetic signal in which gene evolutionary rate and alignment length were simultaneously controlled, showed similar patterns of correlations, albeit weaker in strength. Examination of the relative importance of each gene property on phylogenetic signal identified gene alignment length, alongside with number of parsimony-informative sites and variable sites, as the most important predictors. Interestingly, the subsets of gene properties that optimally predicted phylogenetic signal differed considerably across our three phylogenetic measures and two data sets; however, gene alignment length and RCV were consistently included as predictors of all three phylogenetic measures in both yeasts and mammals. These results suggest that a handful of sequence-based gene properties are reliable predictors of phylogenetic signal and could be useful in guiding the choice of phylogenetic markers. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Hepatozoon canis infection in Slovakia: imported or autochthonous?

PubMed

Majláthová, Viktória; Hurníková, Zuzana; Majláth, Igor; Petko, Branislav

2007-01-01

Tissue samples from nine red foxes (four samples of striated muscle tissue and five samples of heart tissue) that originated from the Michalovce district (Slovakia), an area with endemic occurrence of canine babesiosis were examined by PCR method using primers amplifying a fragment of the 18S rRNA spanning the V4 region of Babesia and Theileria. An unexpected determination of 450 bp DNA fragment of Hepatozoon canis was found in four samples. Partial sequences of the 18S rRNA gene from the H. canis showed 100% similarity with the sequence from Brasil isolate of H. canis from a pampas fox (Pseudalopex gymnocercus) (AY471615) as well as from a fox in Spain (AY150067) and from a dog in Brazil (AY864677). In the present study, we report the first PCR detection of Hepatozoon canis in a naturally infected red fox from Slovakia, a Rhipicephalus sanguineus-free region. We assume that the infection was spread by infected R. sanguineus that might have been brought to Slovakia by travelers, by golden jackals, or by foxes migrating because of expansion of golden jackals and environmental and climate changes.

High Bacterial Diversity in Permanently Cold Marine Sediments

PubMed Central

Ravenschlag, Katrin; Sahm, Kerstin; Pernthaler, Jakob; Amann, Rudolf

1999-01-01

A 16S ribosomal DNA (rDNA) clone library from permanently cold marine sediments was established. Screening 353 clones by dot blot hybridization with group-specific oligonucleotide probes suggested a predominance of sequences related to bacteria of the sulfur cycle (43.4% potential sulfate reducers). Within this fraction, the major cluster (19.0%) was affiliated with Desulfotalea sp. and other closely related psychrophilic sulfate reducers isolated from the same habitat. The cloned sequences showed between 93 and 100% similarity to these bacteria. Two additional groups were frequently encountered: 13% of the clones were related to Desulfuromonas palmitatis, and a second group was affiliated with Myxobacteria spp. and Bdellovibrio spp. Many clones (18.1%) belonged to the γ subclass of the class Proteobacteria and were closest to symbiotic or free-living sulfur oxidizers. Probe target groups were further characterized by amplified rDNA restriction analysis to determine diversity within the groups and within the clone library. Rarefaction analysis suggested that the total diversity assessed by 16S rDNA analysis was very high in these permanently cold sediments and was only partially revealed by screening of 353 clones. PMID:10473405

Martian soil stratigraphy and rock coatings observed in color-enhanced Viking Lander images

NASA Technical Reports Server (NTRS)

Strickland, E. L., III

1979-01-01

Subtle color variations of martian surface materials were enhanced in eight Viking Lander (VL) color images. Well-defined soil units recognized at each site (six at VL-1 and four at VL-2), are identified on the basis of color, texture, morphology, and contact relations. The soil units at the Viking 2 site form a well-defined stratigraphic sequence, whereas the sequence at the Viking 1 site is only partially defined. The same relative soil colors occur at the two sites, suggesting that similar soil units are widespread on Mars. Several types of rock surface materials can be recognized at the two sites; dark, relatively 'blue' rock surfaces are probably minimally weathered igneous rock, whereas bright rock surfaces, with a green/(blue + red) ratio higher than that of any other surface material, are interpreted as a weathering product formed in situ on the rock. These rock surface types are common at both sites. Soil adhering to rocks is common at VL-2, but rare at VL-1. The mechanism that produces the weathering coating on rocks probably operates planet-wide.

Simian hepatitis A virus derived from a captive rhesus monkey in India is similar to the strain isolated from wild African green monkeys in Kenya.

PubMed

Arankalle, V A; Ramakrishnan, J

2009-03-01

A simian hepatitis A virus (HAV) was identified retrospectively in a faecal sample from a rhesus monkey in India, inoculated in 1995 with a faecal suspension from a suspected patient of non-A to E hepatitis. The monkey was in captivity for 2 years in one of the experimental primate facilities in western India before being moved to the National Institute of Virology, Pune for experimentation. Phylogenetic analysis based on a partial sequence of the 5' noncoding region placed this virus in genotype V, the only other member being the AGM-27 strain recovered in 1986 from African green monkeys in Kenya. The source of infection of the monkey remains unclear. The full genome was amplified in nine fragments and sequenced. The genome of the Indian simian HAV (IND-SHAV) is 7425 nucleotides long including the poly-A tail of 14 nucleotides at the 3' end. At the nucleotide and amino acid levels, IND-SHAV was 99.8 and 100% identical with AGM27, respectively.

Roseomonas tokyonensis sp. nov. isolated from a biofilm sample obtained from a cooling tower in Tokyo, Japan.

PubMed

Furuhata, Katsunori; Ishizaki, Naoto; Edagawa, Akiko; Fukuyama, Masafumi

2013-01-01

Strain K-20(T), a Gram-negative, nonmotile, nonspore-forming and strictly aerobic coccobacillus, which produces a pale pink pigment (R2A agar medium, 30℃, seven days) was isolated from a sample of biofilm obtained from a cooling tower in Tokyo, Japan. A phylogenetic analysis of the 16S rRNA partial gene sequences (1,439 bp) showed that the strain (accession number: AB297501) was related to Roseomonas frigidaquae CW67(T) and Roseomonas stagni HS-69(T) with 97.4% and 96.9% sequence similarity, respectively. Strain K-20(T) formed a distinct cluster with Roseomonas frigidaquae CW67(T) in the phylogenetic tree at a high bootstrap value (93%); however, distance was recognized between the strains. In addition, the DNA-DNA hybridization level between strain K-20(T) and Roseomonas frigidaquae JCM 15073(T) was 33%. The taxonomic data indicate that K-20(T) (=JCM 14634(T) =KCTC 32152(T)) should be classified in the genus Roseomonas as the type strain of a novel species, Roseomonas tokyonensis sp. nov.

Programming and reprogramming sequence timing following high and low contextual interference practice.

PubMed

Wright, David L; Magnuson, Curt E; Black, Charles B

2005-09-01

Individuals practiced two unique discrete sequence production tasks that differed in their relative time profile in either a blocked or random practice schedule. Each participant was subsequently administered a "precuing" protocol to examine the cost of initially compiling or modifying the plan for an upcoming movement's relative timing. The findings indicated that, in general, random practice facilitated the programming of the required movement timing, and this was accomplished while exhibiting greater accuracy in movement production. Participants exposed to random practice exhibited the greatest motor programming benefit, when a modification to an already prepared movement timing profile was required. When movement timing was only partially constructed prior to the imperative signal, the individuals who were trained in blocked and random practice formats accrued a similar cost to complete the programming process. These data provide additional support for the recent claim of Immink & Wright (2001) that at least some of the benefit from experience in a random as opposed to blocked training context can be localized to superior development and implementation of the motor programming process before executing the movement.

A Cluster of Cuticle Protein Genes of Drosophila Melanogaster at 65a: Sequence, Structure and Evolution

PubMed Central

Charles, J. P.; Chihara, C.; Nejad, S.; Riddiford, L. M.

1997-01-01

A 36-kb genomic DNA segment of the Drosophila melanogaster genome containing 12 clustered cuticle genes has been mapped and partially sequenced. The cluster maps at 65A 5-6 on the left arm of the third chromosome, in agreement with the previously determined location of a putative cluster encompassing the genes for the third instar larval cuticle proteins LCP5, LCP6 and LCP8. This cluster is the largest cuticle gene cluster discovered to date and shows a number of surprising features that explain in part the genetic complexity of the LCP5, LCP6 and LCP8 loci. The genes encoding LCP5 and LCP8 are multiple copy genes and the presence of extensive similarity in their coding regions gives the first evidence for gene conversion in cuticle genes. In addition, five genes in the cluster are intronless. Four of these five have arisen by retroposition. The other genes in the cluster have a single intron located at an unusual location for insect cuticle genes. PMID:9383064

B1 gradient coherence selection using a tapered stripline.

PubMed

van Meerten, S G J; Tijssen, K C H; van Bentum, P J M; Kentgens, A P M

2018-01-01

Pulsed-field gradients are common in modern liquid state NMR pulse sequences. They are often used instead of phase cycles for the selection of coherence pathways, thereby decreasing the time required for the NMR experiment. Soft off-resonance pulses with a B 1 gradient result in a spatial encoding similar to that created by pulsed-field (B 0 ) gradients. In this manuscript we show that pulse sequences with pulsed-field gradients can easily be converted to one which uses off-resonance B 1 field gradient (OFFBEAT) pulses. The advantage of B 1 gradient pulses for coherence selection is that the chemical shift evolution during the pulses is (partially) suppressed. Therefore no refocusing echos are required to correct for evolution during the gradient pulses. A tapered stripline is shown to be a convenient tool for creating a well-defined gradient in the B 1 field strength. B 1 gradient coherence selection using a tapered stripline is a simple and cheap alternative to B 0 pulsed-field gradients. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from giant panda and raccoon dogs in China

PubMed Central

2013-01-01

Background Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. In this study, we sequenced and phylogenetic analyses of the hemagglutinin (H) genes from eight canine distemper virus (CDV) isolates obtained from seven raccoon dogs (Nyctereutes procyonoides) and a giant panda (Ailuropoda melanoleuca) in China. Results Phylogenetic analysis of the partial hemagglutinin gene sequences showed close clustering for geographic lineages, clearly distinct from vaccine strains and other wild-type foreign CDV strains, all the CDV strains were characterized as Asia-1 genotype and were highly similar to each other (91.5-99.8% nt and 94.4-99.8% aa). The giant panda and raccoon dogs all were 549Y on the HA protein in this study, irrespective of the host species. Conclusions These findings enhance our knowledge of the genetic characteristics of Chinese CDV isolates, and may facilitate the development of effective strategies for monitoring and controlling CDV for wild canids and non-cainds in China. PMID:23566727

Tracking flow of leukocytes in blood for drug analysis

NASA Astrophysics Data System (ADS)

Basharat, Arslan; Turner, Wesley; Stephens, Gillian; Badillo, Benjamin; Lumpkin, Rick; Andre, Patrick; Perera, Amitha

2011-03-01

Modern microscopy techniques allow imaging of circulating blood components under vascular flow conditions. The resulting video sequences provide unique insights into the behavior of blood cells within the vasculature and can be used as a method to monitor and quantitate the recruitment of inflammatory cells at sites of vascular injury/ inflammation and potentially serve as a pharmacodynamic biomarker, helping screen new therapies and individualize dose and combinations of drugs. However, manual analysis of these video sequences is intractable, requiring hours per 400 second video clip. In this paper, we present an automated technique to analyze the behavior and recruitment of human leukocytes in whole blood under physiological conditions of shear through a simple multi-channel fluorescence microscope in real-time. This technique detects and tracks the recruitment of leukocytes to a bioactive surface coated on a flow chamber. Rolling cells (cells which partially bind to the bioactive matrix) are detected counted, and have their velocity measured and graphed. The challenges here include: high cell density, appearance similarity, and low (1Hz) frame rate. Our approach performs frame differencing based motion segmentation, track initialization and online tracking of individual leukocytes.

Isolation and molecular identification of echovirus 13 isolated from patients of aseptic meningitis in Korea, 2002.

PubMed

Cheon, Doo-Sung; Lee, Jiwon; Lee, Kangbum; Lee, Sunhwa; Park, Kwisung; Ahn, Jungbae; Jee, Youngmee; Yoon, Jaedeuk; Cho, Haewol

2004-07-01

During 2002, several epidemics of aseptic meningitis were attributed to echovirus 13 in Korea. The causative agents of these outbreaks were isolated and identified using rhabdosarcoma cells, HEp-2 and Buffalo green monkey kidney cells, and a neutralization test using monospecific antiserum. Fifty-four echovirus 13 isolates were isolated from patients with aseptic meningitis in the provinces, Seoul, Kyonggi, Gwangju, Jeonju, Busan, and Ulsan. Symptoms associated with aseptic meningitis infection in patients included the occurrence of headaches and mild fever. Molecular characterization of echovirus 13 samples was achieved by sequence and phylogenetic analyses on partial VP1 sequences from 20 Korean isolates and 10 foreign isolates listed in Genbank. Minor variation was observed among the Korean isolates, which formed a unique cluster with isolates of German and Japanese origin. The marked similarities between isolates could be attributed to a relatively recent arrival of the virus in Korea. This is the first such investigation of aseptic meningitis caused by echovirus 13 on the Korean peninsula. Copyright 2004 Wiley-Liss, Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

WANG,YIFENG; XU,HUIFANG

Correctly identifying the possible alteration products and accurately predicting their occurrence in a repository-relevant environment are the key for the source-term calculation in a repository performance assessment. Uraninite in uranium deposits has long been used as a natural analog to spent fuel in a repository because of their chemical and structural similarity. In this paper, a SEM/AEM investigation has been conducted on a partially alternated uraninite sample from a uranium ore deposit of Shinkolobwe of Congo. The mineral formation sequences were identified: uraninite {yields} uranyl hydrates {yields} uranyl silicates {yields} Ca-uranyl silicates or uraninite {yields} uranyl silicates {yields} Ca-uranyl silicates.more » Reaction-path calculations were conducted for the oxidative dissolution of spent fuel in a representative Yucca Mountain groundwater. The predicted sequence is in general consistent with the SEM observations. The calculations also show that uranium carbonate minerals are unlikely to become major solubility-controlling mineral phases in a Yucca Mountain environment. Some discrepancies between model predictions and field observations are observed. Those discrepancies may result from poorly constrained thermodynamic data for uranyl silicate minerals.« less

Genetic structure of typical and atypical populations of Candida albicans from Africa.

PubMed

Forche, A; Schönian, G; Gräser, Y; Vilgalys, R; Mitchell, T G

1999-11-01

Atypical isolates of the pathogenic yeast Candida albicans have been reported with increasing frequency. To investigate the origin of a set of atypical isolates and their relationship to typical isolates, we employed a combination of molecular phylogenetic and population genetic analyses using rDNA sequencing, PCR fingerprinting, and analysis of co-dominant DNA nucleotide polymorphisms to characterize the population structure of one typical and two atypical populations of C. albicans from Angola and Madagascar. The extent of clonality and recombination was assessed in each population. The analyses revealed that the structure of all three populations of C. albicans was predominantly clonal but, as in previous studies, there was also evidence for recombination. Allele frequencies differed significantly between the typical and the atypical populations, suggesting very low levels of gene flow between them. However, allele frequencies were quite similar in the two atypical C. albicans populations, suggesting that they are closely related. Phylogenetic analysis of partial sequences encoding the nuclear 26S rDNA demonstrated that all three populations belong to a single monophyletic group, which includes the type strain of C. albicans. Copyright 1999 Academic Press.

Mouse Dux is myotoxic and shares partial functional homology with its human paralog DUX4

PubMed Central

Eidahl, Jocelyn O.; Giesige, Carlee R.; Domire, Jacqueline S.; Wallace, Lindsay M.; Fowler, Allison M.; Guckes, Susan M.; Garwick-Coppens, Sara E.; Labhart, Paul

2016-01-01

Abstract D4Z4 repeats are present in at least 11 different mammalian species, including humans and mice. Each repeat contains an open reading frame encoding a double homeodomain (DUX) family transcription factor. Aberrant expression of the D4Z4 ORF called DUX4 is associated with the pathogenesis of Facioscapulohumeral muscular dystrophy (FSHD). DUX4 is toxic to numerous cell types of different species, and over-expression caused dysmorphism and developmental arrest in frogs and zebrafish, embryonic lethality in transgenic mice, and lesions in mouse muscle. Because DUX4 is a primate-specific gene, questions have been raised about the biological relevance of over-expressing it in non-primate models, as DUX4 toxicity could be related to non-specific cellular stress induced by over-expressing a DUX family transcription factor in organisms that did not co-evolve its regulated transcriptional networks. We assessed toxic phenotypes of DUX family genes, including DUX4, DUX1, DUX5, DUXA, DUX4-s, Dux-bl and mouse Dux. We found that DUX proteins were not universally toxic, and only the mouse Dux gene caused similar toxic phenotypes as human DUX4. Using RNA-seq, we found that 80% of genes upregulated by Dux were similarly increased in DUX4-expressing cells. Moreover, 43% of Dux-responsive genes contained ChIP-seq binding sites for both Dux and DUX4, and both proteins had similar consensus binding site sequences. These results suggested DUX4 and Dux may regulate some common pathways, and despite diverging from a common progenitor under different selective pressures for millions of years, the two genes maintain partial functional homology. PMID:28173143

Estimation of pairwise sequence similarity of mammalian enhancers with word neighbourhood counts.

PubMed

Göke, Jonathan; Schulz, Marcel H; Lasserre, Julia; Vingron, Martin

2012-03-01

The identity of cells and tissues is to a large degree governed by transcriptional regulation. A major part is accomplished by the combinatorial binding of transcription factors at regulatory sequences, such as enhancers. Even though binding of transcription factors is sequence-specific, estimating the sequence similarity of two functionally similar enhancers is very difficult. However, a similarity measure for regulatory sequences is crucial to detect and understand functional similarities between two enhancers and will facilitate large-scale analyses like clustering, prediction and classification of genome-wide datasets. We present the standardized alignment-free sequence similarity measure N2, a flexible framework that is defined for word neighbourhoods. We explore the usefulness of adding reverse complement words as well as words including mismatches into the neighbourhood. On simulated enhancer sequences as well as functional enhancers in mouse development, N2 is shown to outperform previous alignment-free measures. N2 is flexible, faster than competing methods and less susceptible to single sequence noise and the occurrence of repetitive sequences. Experiments on the mouse enhancers reveal that enhancers active in different tissues can be separated by pairwise comparison using N2. N2 represents an improvement over previous alignment-free similarity measures without compromising speed, which makes it a good candidate for large-scale sequence comparison of regulatory sequences. The software is part of the open-source C++ library SeqAn (www.seqan.de) and a compiled version can be downloaded at http://www.seqan.de/projects/alf.html. Supplementary data are available at Bioinformatics online.

Metabolic markers and microecological characteristics of tongue coating in patients with chronic gastritis

PubMed Central

2013-01-01

Background In Traditional Chinese Medicine (TCM), tongue diagnosis has been an important diagnostic method for the last 3000 years. Tongue diagnosis is a non-invasive, simple and valuable diagnostic tool. TCM treats the tongue coating on a very sensitive scale that reflects physiological and pathological changes in the organs, especially the spleen and stomach. Tongue coating can diagnose disease severity and determine the TCM syndrome (“Zheng” in Chinese). The biological bases of different tongue coating appearances are still poorly understood and lack systematic investigation at the molecular level. Methods Tongue coating samples were collected from 70 chronic gastritis patients and 20 normal controls. 16S rRNA denatured gradient gel electrophoresis (16S rRNA–DGGE) and liquid chromatography and mass spectrometry (LC–MS) were designed to profile tongue coatings. The statistical techniques used were principal component analysis and partial least squares–discriminate analysis. Results Ten potential metabolites or markers were found in chronic gastritis patients, including UDP-D-galactose, 3-ketolactose, and vitamin D2, based on LC–MS. Eight significantly different strips were observed in samples from chronic gastritis patients based on 16S rRNA–DGGE. Two strips, Strips 8 and 10, were selected for gene sequencing. Strip 10 sequencing showed a 100% similarity to Rothia mucilaginosa. Strip 8 sequencing showed a 96.2% similarity to Moraxella catarrhalis. Conclusions Changes in glucose metabolism could possibly form the basis of tongue coating conformation in chronic gastritis patients. The study revealed important connections between metabolic components, microecological components and tongue coating in chronic gastritis patients. Compared with other diagnostic regimens, such as blood tests or tissue biopsies, tongue coating is more amenable to, and more convenient for, both patients and doctors. PMID:24041039

Characterization of Streptomyces spp. isolated from the rhizosphere of oil palm and evaluation of their ability to suppress basal stem rot disease in oil palm seedlings when applied as powder formulations in a glasshouse trial.

PubMed

Shariffah-Muzaimah, S A; Idris, A S; Madihah, A Z; Dzolkhifli, O; Kamaruzzaman, S; Maizatul-Suriza, M

2017-12-18

Ganoderma boninense, the main causal agent of oil palm (Elaeis guineensis) basal stem rot (BSR), severely reduces oil palm yields around the world. To reduce reliance on fungicide applications to control BSR, we are investigating the efficacy of alternative control methods, such as the application of biological control agents. In this study, we used four Streptomyces-like actinomycetes (isolates AGA43, AGA48, AGA347 and AGA506) that had been isolated from the oil palm rhizosphere and screened for antagonism towards G. boninense in a previous study. The aim of this study was to characterize these four isolates and then to assess their ability to suppress BSR in oil palm seedlings when applied individually to the soil in a vermiculite powder formulation. Analysis of partial 16S rRNA gene sequences (512 bp) revealed that the isolates exhibited a very high level of sequence similarity (> 98%) with GenBank reference sequences. Isolates AGA347 and AGA506 showed 99% similarity with Streptomyces hygroscopicus subsp. hygroscopicus and Streptomyces ahygroscopicus, respectively. Isolates AGA43 and AGA48 also belonged to the Streptomyces genus. The most effective formulation, AGA347, reduced BSR in seedlings by 73.1%. Formulations using the known antifungal producer Streptomyces noursei, AGA043, AGA048 or AGA506 reduced BSR by 47.4, 30.1, 54.8 and 44.1%, respectively. This glasshouse trial indicates that these Streptomyces spp. show promise as potential biological control agents against Ganoderma in oil palm. Further investigations are needed to determine the mechanism of antagonism and to increase the shelf life of Streptomyces formulations.

Porcine calbindin-D9k gene: expression in endometrium, myometrium, and placenta in the absence of a functional estrogen response element in intron A.

PubMed

Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C

1995-01-01

The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.

Identification and Characterization of Three Differentially Expressed Genes, Encoding S-Adenosylhomocysteine Hydrolase, Methionine Aminopeptidase, and a Histone-Like Protein, in the Toxic Dinoflagellate Alexandrium fundyense†

PubMed Central

Taroncher-Oldenburg, Gaspar; Anderson, Donald M.

2000-01-01

Genes showing differential expression related to the early G1 phase of the cell cycle during synchronized circadian growth of the toxic dinoflagellate Alexandrium fundyense were identified and characterized by differential display (DD). The determination in our previous work that toxin production in Alexandrium is relegated to a narrow time frame in early G1 led to the hypothesis that transcriptionally up- or downregulated genes during this subphase of the cell cycle might be related to toxin biosynthesis. Three genes, encoding S-adenosylhomocysteine hydrolase (Sahh), methionine aminopeptidase (Map), and a histone-like protein (HAf), were isolated. Sahh was downregulated, while Map and HAf were upregulated, during the early G1 phase of the cell cycle. Sahh and Map encoded amino acid sequences with about 90 and 70% similarity to those encoded by several eukaryotic and prokaryotic Sahh and Map genes, respectively. The partial Map sequence also contained three cobalt binding motifs characteristic of all Map genes. HAf encoded an amino acid sequence with 60% similarity to those of two histone-like proteins from the dinoflagellate Crypthecodinium cohnii Biecheler. This study documents the potential of applying DD to the identification of genes that are related to physiological processes or cell cycle events in phytoplankton under conditions where small sample volumes represent an experimental constraint. The identification of an additional 21 genes with various cell cycle-related DD patterns also provides evidence for the importance of pretranslational or transcriptional regulation in dinoflagellates, contrary to previous reports suggesting the possibility that translational mechanisms are the primary means of circadian regulation in this group of organisms. PMID:10788388

The disorderly conduct of Hsc70 and its interaction with the Alzheimer's related Tau protein.

PubMed

Taylor, Isabelle R; Ahmad, Atta; Wu, Taia; Nordhues, Bryce A; Bhullar, Anup; Gestwicki, Jason E; Zuiderweg, Erik R P

2018-05-15

Hsp70 chaperones bind to various protein substrates for folding, trafficking, and degradation. Considerable structural information is available about how prokaryotic Hsp70 (DnaK) binds substrates, but less is known about mammalian Hsp70s, of which there are 13 isoforms encoded in the human genome. Here, we report the interaction between the human Hsp70 isoform heat shock cognate 71 KDa protein (Hsc70 or HSPA8) and peptides derived from the microtubule-associated protein tau, which is linked to Alzheimer's disease. For structural studies, we used an Hsc70 construct (called BETA) comprising the substrate-binding domain, but lacking the lid. Importantly, we found that truncating the lid does not significantly impair Hsc70's chaperone activity or allostery in vitro. Using NMR, we show that BETA is partially dynamically disordered in the absence of substrate and that binding of the tau sequence GKVQIINKKG (with a KD = 500 nM) causes dramatic rigidification of BETA. Nuclear Overhauser effect distance measurements revealed that tau binds to the canonical substrate-binding cleft, similar to the binding observed with DnaK. To further develop BETA as a tool for studying Hsc70 interactions, we also measured BETA binding in NMR and fluorescent competition assays to peptides derived from huntingtin, insulin, a second tau-recognition sequence, and a KFERQ-like sequence linked to chaperone-mediated autophagy. We found that the insulin C-peptide binds BETA with high affinity (KD < 100 nM), whereas the others do not (KD > 100 μM). Together, our findings reveal several similarities and differences in how prokaryotic and mammalian Hsp70 isoforms interact with different substrate peptides. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Genetic and molecular characterization of a gene encoding a wide specificity purine permease of Aspergillus nidulans reveals a novel family of transporters conserved in prokaryotes and eukaryotes.

PubMed

Diallinas, G; Gorfinkiel, L; Arst, H N; Cecchetto, G; Scazzocchio, C

1995-04-14

In Aspergillus nidulans, loss-of-function mutations in the uapA and azgA genes, encoding the major uric acid-xanthine and hypoxanthine-adenine-guanine permeases, respectively, result in impaired utilization of these purines as sole nitrogen sources. The residual growth of the mutant strains is due to the activity of a broad specificity purine permease. We have identified uapC, the gene coding for this third permease through the isolation of both gain-of-function and loss-of-function mutations. Uptake studies with wild-type and mutant strains confirmed the genetic analysis and showed that the UapC protein contributes 30% and 8-10% to uric acid and hypoxanthine transport rates, respectively. The uapC gene was cloned, its expression studied, its sequence and transcript map established, and the sequence of its putative product analyzed. uapC message accumulation is: (i) weakly induced by 2-thiouric acid; (ii) repressed by ammonium; (iii) dependent on functional uaY and areA regulatory gene products (mediating uric acid induction and nitrogen metabolite repression, respectively); (iv) increased by uapC gain-of-function mutations which specifically, but partially, suppress a leucine to valine mutation in the zinc finger of the protein coded by the areA gene. The putative uapC gene product is a highly hydrophobic protein of 580 amino acids (M(r) = 61,251) including 12-14 putative transmembrane segments. The UapC protein is highly similar (58% identity) to the UapA permease and significantly similar (23-34% identity) to a number of bacterial transporters. Comparisons of the sequences and hydropathy profiles of members of this novel family of transporters yield insights into their structure, functionally important residues, and possible evolutionary relationships.

A method for probing the mutational landscape of amyloid structure.

PubMed

O'Donnell, Charles W; Waldispühl, Jérôme; Lis, Mieszko; Halfmann, Randal; Devadas, Srinivas; Lindquist, Susan; Berger, Bonnie

2011-07-01

Proteins of all kinds can self-assemble into highly ordered β-sheet aggregates known as amyloid fibrils, important both biologically and clinically. However, the specific molecular structure of a fibril can vary dramatically depending on sequence and environmental conditions, and mutations can drastically alter amyloid function and pathogenicity. Experimental structure determination has proven extremely difficult with only a handful of NMR-based models proposed, suggesting a need for computational methods. We present AmyloidMutants, a statistical mechanics approach for de novo prediction and analysis of wild-type and mutant amyloid structures. Based on the premise of protein mutational landscapes, AmyloidMutants energetically quantifies the effects of sequence mutation on fibril conformation and stability. Tested on non-mutant, full-length amyloid structures with known chemical shift data, AmyloidMutants offers roughly 2-fold improvement in prediction accuracy over existing tools. Moreover, AmyloidMutants is the only method to predict complete super-secondary structures, enabling accurate discrimination of topologically dissimilar amyloid conformations that correspond to the same sequence locations. Applied to mutant prediction, AmyloidMutants identifies a global conformational switch between Aβ and its highly-toxic 'Iowa' mutant in agreement with a recent experimental model based on partial chemical shift data. Predictions on mutant, yeast-toxic strains of HET-s suggest similar alternate folds. When applied to HET-s and a HET-s mutant with core asparagines replaced by glutamines (both highly amyloidogenic chemically similar residues abundant in many amyloids), AmyloidMutants surprisingly predicts a greatly reduced capacity of the glutamine mutant to form amyloid. We confirm this finding by conducting mutagenesis experiments. Our tool is publically available on the web at http://amyloid.csail.mit.edu/. lindquist_admin@wi.mit.edu; bab@csail.mit.edu.

Monitoring pyrethroid insecticide resistance in major malaria vector Anopheles culicifacies: comparison of molecular tools and conventional susceptibility test.

PubMed

Djadid, Navid Dinparast; Forouzesh, Flora; Karimi, Mohsen; Raeisi, Ahmad; Hassan-Zehi, Abdoulghaffar; Zakeri, Sedigheh

2007-07-01

Anopheles culicifacies is a main malaria vector in southeastern part of Iran, bordring Afghanistan and Pakistan. So far, resistance to DDT, dieldrin, malathion and partial tolerance to pyrethroids has been reported in An. stephensi, but nothing confirmed on resistance status of An. culicifacies in Iran. In current study, along with WHO routine susceptibility test with DDT (4%), dieldrin (0.4%), malathion (5%), permethrin (0.25%), lambadacyhalothrin (0.1%), and deltamethrin 0.025, we cloned and sequenced segment VI of domain II (SII6) in voltage-gated sodium channel (vgsc) gene of An. culicifacies specimens collected in Sistan and Baluchistan province (Iran). A 221-bp amplified fragment showed 91% and 93% similarity with exon I and exon II of An. gambiae. The size of intron II in An. culicifacies is 62 bp, while in An. gambiae is 57 bp. The major difference within An. culicifacies specimens and also with An. gambiae is in position 29 of exon I, which led to substitution of Leu to His amino acid. This data will act as first report on partial sequence of vgsc gene and its polymorphism in An. culicifacies. A Leu to His amino acid substitution detected upstream the formerly known knockdown resistance (kdr) mutation site could be an indication for other possible mutations related to insecticide resistance. However, the result of WHO susceptibility test carried out in Baluchistan of Iran revealed a level of tolerance to DDT and dieldrin, but almost complete susceptibility to pyrethroids in An. culicifacies. We postulate that the molecular diagnostic tool developed for detection and identification of kdr-related mutations in An. culicifacies, could be useful in monitoring insecticide resistance in Iran and neighbouring countries such as Pakistan and Afghanistan. A phylogenetic tree also constructed based on the sequence of exon I and II, which readily separated An. culicifacies populations from An. stephensi, An. fluviatilis and An. gambiae.

Class I KNOX genes are associated with organogenesis during bulbil formation in Agave tequilana.

PubMed

Abraham-Juárez, María Jazmín; Martínez-Hernández, Aída; Leyva-González, Marco Antonio; Herrera-Estrella, Luis; Simpson, June

2010-09-01

Bulbil formation in Agave tequilana was analysed with the objective of understanding this phenomenon at the molecular and cellular levels. Bulbils formed 14-45 d after induction and were associated with rearrangements in tissue structure and accelerated cell multiplication. Changes at the cellular level during bulbil development were documented by histological analysis. In addition, several cDNA libraries produced from different stages of bulbil development were generated and partially sequenced. Sequence analysis led to the identification of candidate genes potentially involved in the initiation and development of bulbils in Agave, including two putative class I KNOX genes. Real-time reverse transcription-PCR and in situ hybridization revealed that expression of the putative Agave KNOXI genes occurs at bulbil initiation and specifically in tissue where meristems will develop. Functional analysis of Agave KNOXI genes in Arabidopsis thaliana showed the characteristic lobed phenotype of KNOXI ectopic expression in leaves, although a slightly different phenotype was observed for each of the two Agave genes. An Arabidopsis KNOXI (knat1) mutant line (CS30) was successfully complemented with one of the Agave KNOX genes and partially complemented by the other. Analysis of the expression of the endogenous Arabidopsis genes KNAT1, KNAT6, and AS1 in the transformed lines ectopically expressing or complemented by the Agave KNOX genes again showed different regulatory patterns for each Agave gene. These results show that Agave KNOX genes are functionally similar to class I KNOX genes and suggest that spatial and temporal control of their expression is essential during bulbil formation in A. tequilana.

Histone octamer trans-transfer: a signature mechanism of ATP-dependent chromatin remodelling unravelled in wheat nuclear extract

PubMed Central

Raut, Vishal V.; Pandey, Shashibhal M.; Sainis, Jayashree K.

2011-01-01

Background and Scope In eukaryotes, chromatin remodelling complexes are shown to be responsible for nucleosome mobility, leading to increased accessibility of DNA for DNA binding proteins. Although the existence of such complexes in plants has been surmised mainly at the genetic level from bioinformatics studies and analysis of mutants, the biochemical existence of such complexes has remained unexplored. Methods Histone H1-depleted donor chromatin was prepared by micrococcal nuclease digestion of wheat nuclei and fractionation by exclusion chromatography. Nuclear extract was partially purified by cellulose phosphate ion exchange chromatography. Histone octamer trans-transfer activity was analysed using the synthetic nucleosome positioning sequence in the absence and presence of ATP and its analogues. ATPase activity was measured as 32Pi released using liquid scintillation counting. Key Results ATP-dependent histone octamer trans-transfer activity, partially purified from wheat nuclei using cellulose phosphate, showed ATP-dependent octamer displacement in trans from the H1-depleted native donor chromatin of wheat to the labelled synthetic nucleosome positioning sequence. It also showed nucleosome-dependent ATPase activity. Substitution of ATP by ATP analogues, namely ATPγS, AMP-PNP and ADP abolished the octamer trans-transfer, indicating the requirement of ATP hydrolysis for this activity. Conclusions ATP-dependent histone octamer transfer in trans is a recognized activity of chromatin remodelling complexes required for chromatin structure dynamics in non-plant species. Our results suggested that wheat nuclei also possess a typical chromatin remodelling activity, similar to that in other eukaryotes. This is the first report on chromatin remodelling activity in vitro from plants. PMID:21896571

Identification of small secreted peptides (SSPs) in maize and expression analysis of partial SSP genes in reproductive tissues.

PubMed

Li, Ye Long; Dai, Xin Ren; Yue, Xun; Gao, Xin-Qi; Zhang, Xian Sheng

2014-10-01

Maize 1,491 small secreted peptides were identified, which were classified according to the character of peptide sequences. Partial SSP gene expressions in reproductive tissues were determined by qRT-PCR. Small secreted peptides (SSPs) are important cell-cell communication messengers in plants. Most information on plant SSPs come from Arabidopsis thaliana and Oryza sativa, while little is known about the SSPs of other grass species such as maize (Zea mays). In this study, we identified 1,491 SSP genes from maize genomic sequences. These putative SSP genes were distributed throughout the ten maize chromosomes. Among them, 611 SSPs were classified into 198 superfamilies according to their conserved domains, and 725 SSPs with four or more cysteines at their C-termini shared similar cysteine arrangements with their counterparts in other plant species. Moreover, the SSPs requiring post-translational modification, as well as defensin-like (DEFL) proteins, were identified. Further, the expression levels of 110 SSP genes were analyzed in reproductive tissues, including male flower, pollen, silk, and ovary. Most of the genes encoding basal-layer antifungal peptide-like, small coat proteins-like, thioredoxin-like proteins, γ-thionins-like, and DEFL proteins showed high expression levels in the ovary and male flower compared with their levels in silk and mature pollen. The rapid alkalinization factor-like genes were highly expressed only in the mature ovary and mature pollen, and pollen Ole e 1-like genes showed low expression in silk. The results of this study provide basic information for further analysis of SSP functions in the reproductive process of maize.

Molecular characterization of canine parvovirus and canine enteric coronavirus in diarrheic dogs on the island of St. Kitts: First report from the Caribbean region.

PubMed

Navarro, Ryan; Nair, Rajeev; Peda, Andrea; Aung, Meiji Soe; Ashwinie, G S; Gallagher, Christa A; Malik, Yashpal S; Kobayashi, Nobumichi; Ghosh, Souvik

2017-08-15

Although canine parvovirus (CPV) and canine enteric coronavirus (CCoV) are important enteric pathogens of dogs and have been studied extensively in different parts of the world, there are no reports on these viruses from the Caribbean region. During 2015-2016, a total of 104 diarrheic fecal samples were collected from puppies and adult dogs, with or without hemorrhagic gastroenteritis, on the Caribbean island of St. Kitts (KNA). By PCR, 25 (24%, n=104) samples tested positive for CPV. Based on analysis of the complete deduced VP2 amino acid sequences, 20 of the KNA CPV strains were assigned to new CPV-2a (also designated as CPV-2a-297A). On the other hand, the VP2 genes of the remaining 5 strains were partially characterized, or could not be sequenced. New CPV-2a was the predominant CPV variant in St. Kitts, contrasting the molecular epidemiology of CPV variants reported in most studies from nearby North and South American countries. By RT-PCR, CCoVs were detected in 5 samples (4.8%, n=104). Based on analysis of partial M-protein gene, the KNA CCoV strains were assigned to CCoV-I genotype, and were closely related to CCoV-I strains from Brazil. To our knowledge, this is the first report on detection and genetic diversity of CPV and CCoV in dogs from the Caribbean region, and underscores the importance of similar studies in the other Caribbean islands. Copyright © 2017 Elsevier B.V. All rights reserved.

Is the phonological similarity effect in working memory due to proactive interference?

PubMed

Baddeley, Alan D; Hitch, Graham J; Quinlan, Philip T

2018-04-12

Immediate serial recall of verbal material is highly sensitive to impairment attributable to phonological similarity. Although this has traditionally been interpreted as a within-sequence similarity effect, Engle (2007) proposed an interpretation based on interference from prior sequences, a phenomenon analogous to that found in the Peterson short-term memory (STM) task. We use the method of serial reconstruction to test this in an experiment contrasting the standard paradigm in which successive sequences are drawn from the same set of phonologically similar or dissimilar words and one in which the vowel sound on which similarity is based is switched from trial to trial, a manipulation analogous to that producing release from PI in the Peterson task. A substantial similarity effect occurs under both conditions although there is a small advantage from switching across similar sequences. There is, however, no evidence for the suggestion that the similarity effect will be absent from the very first sequence tested. Our results support the within-sequence similarity rather than a between-list PI interpretation. Reasons for the contrast with the classic Peterson short-term forgetting task are briefly discussed. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Screening for Hepatozoon parasites in gerbils and potential predators in South Africa.

PubMed

Harris, D James; Pereira, Ana; Halajian, Ali; Luus-Powell, Wilmien J; Kunutu, Katlego D

2017-02-08

Samples of gerbils and their potential predators were screened for the presence of Hepatozoon parasites (Apicomplexa: Adeleorina) using both microscopic examination and sequencing of partial 18S rRNA sequences. Positive samples were compared to published sequences in a phylogenetic framework. The results indicate that genets can be infected with Hepatozoon felis. A Cape fox was infected with Hepatozoon canis, whereas the sequence from an infected rodent fell within a group of parasites primarily recovered from other rodents and snakes.

Penicillium excelsum sp. nov from the Brazil Nut Tree Ecosystem in the Amazon Basin'.

PubMed

Taniwaki, Marta Hiromi; Pitt, John I; Iamanaka, Beatriz T; Massi, Fernanda P; Fungaro, Maria Helena P; Frisvad, Jens C

2015-01-01

A new Penicillium species, P. excelsum, is described here using morphological characters, extrolite and partial sequence data from the ITS, β-tubulin and calmodulin genes. It was isolated repeatedly using samples of nut shells and flowers from the brazil nut tree, Bertolletia excelsa, as well as bees and ants from the tree ecosystem in the Amazon rainforest. The species produces andrastin A, curvulic acid, penicillic acid and xanthoepocin, and has unique partial β-tubulin and calmodulin gene sequences. The holotype of P. excelsum is CCT 7772, while ITAL 7572 and IBT 31516 are cultures derived from the holotype.

Penicillium excelsum sp. nov from the Brazil Nut Tree Ecosystem in the Amazon Basin’

PubMed Central

Taniwaki, Marta Hiromi; Pitt, John I.; Iamanaka, Beatriz T.; Massi, Fernanda P.; Fungaro, Maria Helena P.; Frisvad, Jens C.

2015-01-01

A new Penicillium species, P. excelsum, is described here using morphological characters, extrolite and partial sequence data from the ITS, β-tubulin and calmodulin genes. It was isolated repeatedly using samples of nut shells and flowers from the brazil nut tree, Bertolletia excelsa, as well as bees and ants from the tree ecosystem in the Amazon rainforest. The species produces andrastin A, curvulic acid, penicillic acid and xanthoepocin, and has unique partial β-tubulin and calmodulin gene sequences. The holotype of P. excelsum is CCT 7772, while ITAL 7572 and IBT 31516 are cultures derived from the holotype. PMID:26717519

Brucella papionis sp. nov., isolated from baboons (Papio spp.)

PubMed Central

Davison, Nicholas; Cloeckaert, Axel; Al Dahouk, Sascha; Zygmunt, Michel S.; Brew, Simon D.; Perrett, Lorraine L.; Koylass, Mark S.; Vergnaud, Gilles; Quance, Christine; Scholz, Holger C.; Dick, Edward J.; Hubbard, Gene; Schlabritz-Loutsevitch, Natalia E.

2014-01-01

Two Gram-negative, non-motile, non-spore-forming coccoid bacteria (strains F8/08-60T and F8/08-61) isolated from clinical specimens obtained from baboons (Papio spp.) that had delivered stillborn offspring were subjected to a polyphasic taxonomic study. On the basis of 16S rRNA gene sequence similarities, both strains, which possessed identical sequences, were assigned to the genus Brucella. This placement was confirmed by extended multilocus sequence analysis (MLSA), where both strains possessed identical sequences, and whole-genome sequencing of a representative isolate. All of the above analyses suggested that the two strains represent a novel lineage within the genus Brucella. The strains also possessed a unique profile when subjected to the phenotyping approach classically used to separate species of the genus Brucella, reacting only with Brucella A monospecific antiserum, being sensitive to the dyes thionin and fuchsin, being lysed by bacteriophage Wb, Bk2 and Fi phage at routine test dilution (RTD) but only partially sensitive to bacteriophage Tb, and with no requirement for CO2 and no production of H2S but strong urease activity. Biochemical profiling revealed a pattern of enzyme activity and metabolic capabilities distinct from existing species of the genus Brucella. Molecular analysis of the omp2 locus genes showed that both strains had a novel combination of two highly similar omp2b gene copies. The two strains shared a unique fingerprint profile of the multiple-copy Brucella-specific element IS711. Like MLSA, a multilocus variable number of tandem repeat analysis (MLVA) showed that the isolates clustered together very closely, but represent a distinct group within the genus Brucella. Isolates F8/08-60T and F8/08-61 could be distinguished clearly from all known species of the genus Brucellaand their biovars by both phenotypic and molecular properties. Therefore, by applying the species concept for the genus Brucellasuggested by the ICSP Subcommittee on the Taxonomy of Brucella, they represent a novel species within the genus Brucella, for which the name Brucella papionis sp. nov. is proposed, with the type strain F8/08-60T ( = NCTC 13660T = CIRMBP 0958T). PMID:25242540

"De-novo" amino acid sequence elucidation of protein G'e by combined "top-down" and "bottom-up" mass spectrometry.

PubMed

Yefremova, Yelena; Al-Majdoub, Mahmoud; Opuni, Kwabena F M; Koy, Cornelia; Cui, Weidong; Yan, Yuetian; Gross, Michael L; Glocker, Michael O

2015-03-01

Mass spectrometric de-novo sequencing was applied to review the amino acid sequence of a commercially available recombinant protein G´ with great scientific and economic importance. Substantial deviations to the published amino acid sequence (Uniprot Q54181) were found by the presence of 46 additional amino acids at the N-terminus, including a so-called "His-tag" as well as an N-terminal partial α-N-gluconoylation and α-N-phosphogluconoylation, respectively. The unexpected amino acid sequence of the commercial protein G' comprised 241 amino acids and resulted in a molecular mass of 25,998.9 ± 0.2 Da for the unmodified protein. Due to the higher mass that is caused by its extended amino acid sequence compared with the original protein G' (185 amino acids), we named this protein "protein G'e." By means of mass spectrometric peptide mapping, the suggested amino acid sequence, as well as the N-terminal partial α-N-gluconoylations, was confirmed with 100% sequence coverage. After the protein G'e sequence was determined, we were able to determine the expression vector pET-28b from Novagen with the Xho I restriction enzyme cleavage site as the best option that was used for cloning and expressing the recombinant protein G'e in E. coli. A dissociation constant (K(d)) value of 9.4 nM for protein G'e was determined thermophoretically, showing that the N-terminal flanking sequence extension did not cause significant changes in the binding affinity to immunoglobulins.

Localization of the lysine epsilon-aminotransferase (lat) and delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase (pcbAB) genes from Streptomyces clavuligerus and production of lysine epsilon-aminotransferase activity in Escherichia coli.

PubMed Central

Tobin, M B; Kovacevic, S; Madduri, K; Hoskins, J A; Skatrud, P L; Vining, L C; Stuttard, C; Miller, J R

1991-01-01

Lysine epsilon-aminotransferase (LAT) in the beta-lactam-producing actinomycetes is considered to be the first step in the antibiotic biosynthetic pathway. Cloning of restriction fragments from Streptomyces clavuligerus, a beta-lactam producer, into Streptomyces lividans, a nonproducer that lacks LAT activity, led to the production of LAT in the host. DNA sequencing of restriction fragments containing the putative lat gene revealed a single open reading frame encoding a polypeptide with an approximately Mr 49,000. Expression of this coding sequence in Escherichia coli led to the production of LAT activity. Hence, LAT activity in S. clavuligerus is derived from a single polypeptide. A second open reading frame began immediately downstream from lat. Comparison of this partial sequence with the sequences of delta-(L-alpha-aminoadipyl)-L-cysteinyl-D valine (ACV) synthetases from Penicillium chrysogenum and Cephalosporium acremonium and with nonribosomal peptide synthetases (gramicidin S and tyrocidine synthetases) found similarities among the open reading frames. Since mapping of the putative N and C termini of S. clavuligerus pcbAB suggests that the coding region occupies approximately 12 kbp and codes for a polypeptide related in size to the fungal ACV synthetases, the molecular characterization of the beta-lactam biosynthetic cluster between pcbC and cefE (approximately 25 kbp) is nearly complete. Images PMID:1917855

Detection and molecular identification of leishmania RNA virus (LRV) in Iranian Leishmania species.

PubMed

Hajjaran, Homa; Mahdi, Maryam; Mohebali, Mehdi; Samimi-Rad, Katayoun; Ataei-Pirkooh, Angila; Kazemi-Rad, Elham; Naddaf, Saied Reza; Raoofian, Reza

2016-12-01

Leishmania RNA virus (LRV) was first detected in members of the subgenus Leishmania (Viannia), and later, the virulence and metastasis of the New World species were attributed to this virus. The data on the presence of LRV in Old World species are confined to Leishmania major and a few Leishmania aethiopica isolates. The aim of this study was to survey the presence of LRV in various Iranian Leishmania species originating from patients and animal reservoir hosts. Genomic nucleic acids were extracted from 50 cultured isolates belonging to the species Leishmania major, Leishmania tropica, and Leishmania infantum. A partial sequence of the viral RNA-dependent RNA polymerase (RdRp) gene was amplified, sequenced and compared with appropriate sequences from the GenBank database. We detected the virus in two parasite specimens: an isolate of L. infantum derived from a visceral leishmaniasis (VL) patient who was unresponsive to meglumine antimoniate treatment, and an L. major isolate originating from a great gerbil, Rhombomys opimus. The Iranian LRV sequences showed the highest similarities to an Old World L. major LRV2 and were genetically distant from LRV1 isolates detected in New World Leishmania parasites. We could not attribute treatment failure in VL patient to the presence of LRV due to the limited number of specimens analyzed. Further studies with inclusion of more clinical samples are required to elucidate the potential role of LRVs in pathogenesis or treatment failure of Old World leishmaniasis.

Genome of turbot rhabdovirus exhibits unusual non-coding regions and an additional ORF that could be expressed in fish cell.

PubMed

Zhu, Ruo-Lin; Lei, Xiao-Ying; Ke, Fei; Yuan, Xiu-Ping; Zhang, Qi-Ya

2011-02-01

Genomic sequence of Scophthalmus maximus rhabdovirus (SMRV) isolated from diseased turbot has been characterized. The complete genome of SMRV comprises 11,492 nucleotides and encodes five typical rhabdovirus genes N, P, M, G and L. In addition, two open reading frames (ORF) are predicted overlapping with P gene, one upstream of P and smaller than P (temporarily called Ps), and another in P gene which may encodes a protein similar to the vesicular stomatitis virus C protein. The C ORF is contained within the P ORF. The five typical proteins share the highest sequence identities (48.9%) with the corresponding proteins of rhabdoviruses in genus Vesiculovirus. Phylogenetic analysis of partial L protein sequence indicates that SMRV is close to genus Vesiculovirus. The first 13 nucleotides at the ends of the SMRV genome are absolutely inverse complementarity. The gene junctions between the five genes show conserved polyadenylation signal (CATGA(7)) and intergenic dinucleotide (CT) followed by putative transcription initiation sequence A(A/G)(C/G)A(A/G/T), which are different from known rhabdoviruses. The entire Ps ORF was cloned and expressed, and used to generate polyclonal antibody in mice. One obvious band could be detected in SMRV-infected carp leucocyte cells (CLCs) by anti-Ps/C serum via Western blot, and the subcellular localization of Ps-GFP fusion protein exhibited cytoplasm distribution as multiple punctuate or doughnut shaped foci of uneven size. Copyright © 2010 Elsevier B.V. All rights reserved.

Molecular cloning and characterization of a novel RING zinc-finger protein gene up-regulated under in vitro salt stress in cassava.

PubMed

dos Reis, Sávio Pinho; Tavares, Liliane de Souza Conceição; Costa, Carinne de Nazaré Monteiro; Brígida, Aílton Borges Santa; de Souza, Cláudia Regina Batista

2012-06-01

Cassava (Manihot esculenta Crantz) is one of the world's most important food crops. It is cultivated mainly in developing countries of tropics, since its root is a major source of calories for low-income people due to its high productivity and resistance to many abiotic and biotic factors. A previous study has identified a partial cDNA sequence coding for a putative RING zinc finger in cassava storage root. The RING zinc finger protein is a specialized type of zinc finger protein found in many organisms. Here, we isolated the full-length cDNA sequence coding for M. esculenta RZF (MeRZF) protein by a combination of 5' and 3' RACE assays. BLAST analysis showed that its deduced amino acid sequence has a high level of similarity to plant proteins of RZF family. MeRZF protein contains a signature sequence motif for a RING zinc finger at its C-terminal region. In addition, this protein showed a histidine residue at the fifth coordination site, likely belonging to the RING-H2 subgroup, as confirmed by our phylogenetic analysis. There is also a transmembrane domain in its N-terminal region. Finally, semi-quantitative RT-PCR assays showed that MeRZF expression is increased in detached leaves treated with sodium chloride. Here, we report the first evidence of a RING zinc finger gene of cassava showing potential role in response to salt stress.

Reconstruction of the 2014 eruption sequence of Ontake Volcano from recorded images and interviews

NASA Astrophysics Data System (ADS)

Oikawa, Teruki; Yoshimoto, Mitsuhiro; Nakada, Setsuya; Maeno, Fukashi; Komori, Jiro; Shimano, Taketo; Takeshita, Yoshihiro; Ishizuka, Yoshihiro; Ishimine, Yasuhiro

2016-05-01

A phreatic eruption at Mount Ontake (3067 m) on September 27, 2014, led to 64 casualties, including missing people. In this paper, we clarify the eruption sequence of the 2014 eruption from recorded images (photographs and videos obtained by climbers) and interviews with mountain guides and workers in mountain huts. The onset of eruption was sudden, without any clear precursory surface phenomena (such as ground rumbling or strong smell of sulfide). Our data indicate that the eruption sequence can be divided into three phases. Phase 1: The eruption started with dry pyroclastic density currents (PDCs) caused by ash column collapse. The PDCs flowed down 2.5 km SW and 2 km NW from the craters. In addition, PDCs moved horizontally by approximately 1.5 km toward N and E beyond summit ridges. The temperature of PDCs at the summit area partially exceeded 100 °C, and an analysis of interview results suggested that the temperature of PDCs was mostly in the range of 30-100 °C. At the summit area, there were violent falling ballistic rocks. Phase 2: When the outflow of PDCs stopped, the altitude of the eruption column increased; tephra with muddy rain started to fall; and ambient air temperature decreased. Falling ballistic rocks were almost absent during this phase. Phase 3: Finally, muddy hot water flowed out from the craters. These models reconstructed from observations are consistent with the phreatic eruption models and typical eruption sequences recorded at similar volcanoes.

Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)

NASA Technical Reports Server (NTRS)

Shibata, K.; Abe, S.; Davies, E.

2001-01-01

Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.

Molecular cloning and expression of the CRISP family of proteins in the boar.

PubMed

Vadnais, Melissa L; Foster, Douglas N; Roberts, Kenneth P

2008-12-01

The family of mammalian cysteine-rich secretory proteins (CRISP) have been well characterized in the rat, mouse, and human. Here we report the molecular cloning and expression analysis of CRISP1, CRISP2, and CRISP3 in the boar. A partial sequence published in the National Center for Biotechnology Information (NCBI) database was used to derive the full-length sequences for CRISP1 and CRISP2 using rapid amplification of cDNA ends. RT-PCR confirmed the expression of these mRNAs in the boar reproductive tract, and real time RT-PCR showed CRISP1 to be highly expressed throughout the epididymis, with CRISP2 highly expressed in the testis. A search of the porcine genomic sequence in the NCBI database identified a BAC (CH242-199E6) encoding the CRISP1 gene. This BAC is derived from porcine Chromosome 7 and is syntenic with the regions of the mouse, rat, and human genomes encoding the CRISP gene family. This BAC was found to encode a third CRISP protein with a predicted amino acid sequence of high similarity to human CRISP3. Using RT-PCR we show that CRISP3 expression in the boar reproductive tract is confined to the prostate. Recombinant porcine (rp) CRISP2 protein was produced and purified. When incubated with capacitated boar sperm, rpCRISP2 induced an acrosome reaction, consistent with its demonstrated ability to alter the activity of calcium channels.

Parallel evolution of chordate cis-regulatory code for development.

PubMed

Doglio, Laura; Goode, Debbie K; Pelleri, Maria C; Pauls, Stefan; Frabetti, Flavia; Shimeld, Sebastian M; Vavouri, Tanya; Elgar, Greg

2013-11-01

Urochordates are the closest relatives of vertebrates and at the larval stage, possess a characteristic bilateral chordate body plan. In vertebrates, the genes that orchestrate embryonic patterning are in part regulated by highly conserved non-coding elements (CNEs), yet these elements have not been identified in urochordate genomes. Consequently the evolution of the cis-regulatory code for urochordate development remains largely uncharacterised. Here, we use genome-wide comparisons between C. intestinalis and C. savignyi to identify putative urochordate cis-regulatory sequences. Ciona conserved non-coding elements (ciCNEs) are associated with largely the same key regulatory genes as vertebrate CNEs. Furthermore, some of the tested ciCNEs are able to activate reporter gene expression in both zebrafish and Ciona embryos, in a pattern that at least partially overlaps that of the gene they associate with, despite the absence of sequence identity. We also show that the ability of a ciCNE to up-regulate gene expression in vertebrate embryos can in some cases be localised to short sub-sequences, suggesting that functional cross-talk may be defined by small regions of ancestral regulatory logic, although functional sub-sequences may also be dispersed across the whole element. We conclude that the structure and organisation of cis-regulatory modules is very different between vertebrates and urochordates, reflecting their separate evolutionary histories. However, functional cross-talk still exists because the same repertoire of transcription factors has likely guided their parallel evolution, exploiting similar sets of binding sites but in different combinations.

A snapshot of the microbiome of Amblyomma tuberculatum ticks infesting the gopher tortoise, an endangered species.

PubMed

Budachetri, Khemraj; Gaillard, Daniel; Williams, Jaclyn; Mukherjee, Nabanita; Karim, Shahid

2016-10-01

The gopher tortoise tick, Amblyomma tuberculatum, has a unique relationship with the gopher tortoise, Gopherus polyphemus, found in sandy habitats across the southeastern United States. We aimed to understand the overall bacterial community associated with A. tuberculatum while also focusing on spotted fever group Rickettsia. These tortoises in the Southern Mississippi region are a federally threatened species; therefore, we have carefully trapped the tortoises and removed the species-specific ticks attached to them. Genomic DNA was extracted from individual ticks and used to explore overall bacterial load using pyrosequencing of bacterial 16S rRNA on 454-sequencing platform. The spotted fever group of Rickettsia was explored by amplifying rickettsial outer membrane protein A (rompA) gene by nested PCR. Sequencing results revealed 330 bacterial operational taxonomic units (OTUs) after all the necessary curation of sequences. Four whole A. tuberculatum ticks showed Proteobacteria, Firmicutes, Actinobacteria and Bacteroidetes as the most dominant phyla with a total of 74 different bacterial genera detected. Together Rickettsiae and Francisella showed >85% abundance, thus dominating the bacterial community structure. Partial sequences obtained from ompA amplicons revealed the presence of an uncharacterized Rickettsia similar to the Rickettsial endosymbiont of A. tuberculatum. This is the first preliminary profile of a complete bacterial community from gopher tortoise ticks and warrants further investigation regarding the functional role of Rickettsial and Francisella-like endosymbionts in tick physiology. Copyright © 2016 Elsevier GmbH. All rights reserved.

DsaV methyltransferase and its isoschizomers contain a conserved segment that is similar to the segment in Hhai methyltransferase that is in contact with DNA bases.

PubMed Central

Gopal, J; Yebra, M J; Bhagwat, A S

1994-01-01

The methyltransferase (MTase) in the DsaV restriction--modification system methylates within 5'-CCNGG sequences. We have cloned the gene for this MTase and determined its sequence. The predicted sequence of the MTase protein contains sequence motifs conserved among all cytosine-5 MTases and is most similar to other MTases that methylate CCNGG sequences, namely M.ScrFI and M.SsoII. All three MTases methylate the internal cytosine within their recognition sequence. The 'variable' region within the three enzymes that methylate CCNGG can be aligned with the sequences of two enzymes that methylate CCWGG sequences. Remarkably, two segments within this region contain significant similarity with the region of M.HhaI that is known to contact DNA bases. These alignments suggest that many cytosine-5 MTases are likely to interact with DNA using a similar structural framework. Images PMID:7971279

BLAST and FASTA similarity searching for multiple sequence alignment.

PubMed

Pearson, William R

2014-01-01

BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.

Genome sequences of Phytophthora enable translational plant disease management and accelerate research

Treesearch

Niklaus J. Grünwald

2012-01-01

Whole and partial genome sequences are becoming available at an ever-increasing pace. For many plant pathogen systems, we are moving into the era of genome resequencing. The first Phytophthora genomes, P. ramorum and P. sojae, became available in 2004, followed shortly by P. infestans...

Aspergillus section Versicolores: nine new species and multilocus DNA sequence based phylogeny

USDA-ARS?s Scientific Manuscript database

ß-tubulin, calmodulin, internal transcribed spacer and partial lsu-rDNA, RNA polymerase, DNA replication licensing factor Mcm7, and pre-rRNA processing protein Tsr1 were amplified and sequenced from 62 A. versicolor clade isolates and analyzed phylogenetically using the concordance model to establis...

Aspergillus section Versicolores, nine new species and multilocus DNA sequence based phylogeny

USDA-ARS?s Scientific Manuscript database

ß-tubulin, calmodulin, internal transcribed spacer and partial lsu-rDNA, RNA polymerase, DNA replication licensing factor Mcm7, and pre-rRNA processing protein Tsr1 were amplified and sequenced from 62 A. versicolor clade isolates and analyzed phylogenetically using the concordance model to establis...

Consolidation of glycosyl hydrolase family 30 : a dual domain 4/7 hydrolase family consisting of two structurally distinct groups

Treesearch

Franz J. St John; Javier M. Gonzalez; Edwin Pozharski

2010-01-01

In this work glycosyl hydrolase (GH) family 30 (GH30) is analyzed and shown to consist of its currently classified member sequences as well as several homologous sequence groups currently assigned within family GH5. A large scale amino acid sequence alignment and a phylogenetic tree were generated and GH30 groups and subgroups were designated. A partial rearrangement...

De novo assembly and characterization of bark transcriptome using Illumina sequencing and development of EST-SSR markers in rubber tree (Hevea brasiliensis Muell. Arg.)

PubMed Central

2012-01-01

Background In rubber tree, bark is one of important agricultural and biological organs. However, the molecular mechanism involved in the bark formation and development in rubber tree remains largely unknown, which is at least partially due to lack of bark transcriptomic and genomic information. Therefore, it is necessary to carried out high-throughput transcriptome sequencing of rubber tree bark to generate enormous transcript sequences for the functional characterization and molecular marker development. Results In this study, more than 30 million sequencing reads were generated using Illumina paired-end sequencing technology. In total, 22,756 unigenes with an average length of 485 bp were obtained with de novo assembly. The similarity search indicated that 16,520 and 12,558 unigenes showed significant similarities to known proteins from NCBI non-redundant and Swissprot protein databases, respectively. Among these annotated unigenes, 6,867 and 5,559 unigenes were separately assigned to Gene Ontology (GO) and Clusters of Orthologous Group (COG). When 22,756 unigenes searched against the Kyoto Encyclopedia of Genes and Genomes Pathway (KEGG) database, 12,097 unigenes were assigned to 5 main categories including 123 KEGG pathways. Among the main KEGG categories, metabolism was the biggest category (9,043, 74.75%), suggesting the active metabolic processes in rubber tree bark. In addition, a total of 39,257 EST-SSRs were identified from 22,756 unigenes, and the characterizations of EST-SSRs were further analyzed in rubber tree. 110 potential marker sites were randomly selected to validate the assembly quality and develop EST-SSR markers. Among 13 Hevea germplasms, PCR success rate and polymorphism rate of 110 markers were separately 96.36% and 55.45% in this study. Conclusion By assembling and analyzing de novo transcriptome sequencing data, we reported the comprehensive functional characterization of rubber tree bark. This research generated a substantial fraction of rubber tree transcriptome sequences, which were very useful resources for gene annotation and discovery, molecular markers development, genome assembly and annotation, and microarrays development in rubber tree. The EST-SSR markers identified and developed in this study will facilitate marker-assisted selection breeding in rubber tree. Moreover, this study also supported that transcriptome analysis based on Illumina paired-end sequencing is a powerful tool for transcriptome characterization and molecular marker development in non-model species, especially those with large and complex genomes. PMID:22607098

Incidence of three Kudoa spp., K. neothunni, K. hexapunctata, and K. thunni (Myxosporea: Multivalvulida), in Thunnus tunas distributed in the western Pacific Ocean.

PubMed

Kasai, Akihiro; Tsuduki, Hideaki; Jimenez, Lea Angsinco; Li, Ying-Chun; Tanaka, Shuhei; Sato, Hiroshi

2017-04-01

A variety of tunas of the genus Thunnus are consumed daily in Japan as sliced raw fish (sashimi and sushi). The consumption of fresh sliced raw fish, i.e., unfrozen or uncooked, can sometimes cause food poisoning that is manifested by transient diarrhea and vomiting for a single day. One of the causes of this type of food poisoning has been identified as live Kudoa septempunctata (Myxosporea: Multivalvulida) in the olive flounder (Paralichthys olivaceus). Furthermore, raw slices of fresh tunas are highly suspected to be a possible causative fish of similar food poisoning in Japan. In the present study, we conducted a survey of kudoid infections in tunas (the yellowfin tuna Thunnus albacares, the Pacific bluefin tuna Thunnus orientalis, and the longtail tuna Thunnus tonggol) fished in the western Pacific Ocean off Japan and several East Asian countries and characterized morphologically and genetically the kudoid myxospores in pseudocysts or cysts dispersed in the trunk muscles. Pseudocysts of solely Kudoa hexapunctata were identified in the Pacific bluefin tuna (four isolates), whereas in the yellowfin tuna (21 isolates) pseudocysts of Kudoa neothunni and K. hexapunctata were detected at a ratio of 15:6, respectively, in addition to cyst-forming Kudoa thunni in five yellowfin tunas. In the trunk muscles of six longtail tunas examined, pseudocysts of K. neothunni (all six fish) and K. hexapunctata (two fish) were densely dispersed. The myxospores of K. neothunni found in these longtail tunas had seven shell valves and polar capsules (SV/PC) instead of the more common six SV/PC arranged symmetrically. Nucleotide sequences of the 18S and 28S ribosomal RNA gene (rDNA), some with the internal transcribed spacer regions as well, of K. hexapunctata and K. neothunni from the three Thunnus spp., including the seven-SV/PC morphotype, were very similar to previously characterized nucleotide sequences of each species, whereas the 18S and 28S rDNA of four isolates of K. thunni from yellowfin tunas showed a range of nucleotide variations of 99.0-99.9% identity over 1752-1763-bp long partial 18S rDNA and 97.4-99.9% identity over 797-802-bp long partial 28S rDNA. Therefore, this rather high variation of the rDNA nucleotide sequences of K. thunni proved to be contrary to the few variations of K. neothunni and K. hexapunctata rDNA nucleotide sequences. The present study provides a new host record of the longtail tuna for K. neothunni and K. hexapunctata and reveals a high prevalence of the seven-SV/PC myxospore morphotype of K. neothunni in this tuna host.

Unusual varieties and duplication of Rig-I like receptors encoded in the marine mollusk, Crassostrea gigas

NASA Astrophysics Data System (ADS)

Tian, Z. H.; Jiao, C. Z.

2017-07-01

RIG-I like receptors (RLRs) play key roles in sensing non-self nucleic acids in cytoplasm and trigger antiviral innate immune response in vertebrates and human body. Here we carried out in silico analysis to identify and investigate the putative RLRs encoded in the genome of marine mollusk, Crassostrea gigas (cgRLRs), an invertebrate species. We found the unusual duplication and varieties on domain architecture of putative cgRLRs encoded in the genome of C. gigas. Three putative cgRLRs (accessions numbers are EKC24603, EKC31344.1 and EKC38304.1 on GenBank), have the similar domain architecture with that of human RIG-I or MDA5, and one protein (EKC34573.1) with that of human LGP2; The fifth putative cgRLRs (EKC38303.1) is somewhat similar with human RIG-I/MDA5 except that it has only one caspase activation and recruitment domain (CARD) in its N-terminal. Other nine proteins were identified to be partialy similar with RLRs while with the incomplete sequences, which maybe reflect the events of partial duplication of cgRLRs genes occurred in the oyster genome.

The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

PubMed Central

Petti, C. A.; Polage, C. R.; Schreckenberger, P.

2005-01-01

Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

Characterization of two new rhabdoviruses isolated from midges (Culicoides SPP) in the Brazilian Amazon: proposed members of a new genus, Bracorhabdovirus.

PubMed

Diniz, J A P; Nunes, M R T; Travassos da Rosa, A P A; Cruz, A C R; de Souza, W; Medeiros, D B A; Chiang, J O; Vasconcelos, P F C

2006-12-01

Itacaiunas and Curionopolis viruses were isolated from Culicoides midges in Parauapebas municipality, Pará state, Brazil, in 1984 and 1985, respectively. Itacaiunas virus infected newborn mice and mosquito cells (C6/36), but did not replicate in some mammalian cell lineages; while Curionopolis virus infected only mice. Neither virus showed a serological relationship with any of the 195 known arboviruses circulating in Brazil, nor against 38 other rhabdoviruses isolated worldwide. Both virus particles are bullet-shaped and similar in morphology to that observed for other members of the family Rhabdoviridae. Partial nucleotide sequencing of the N protein showed that those two viruses constitute a separate clade in the family Rhabdoviridae, which we propose to be a new genus, designated Bracorhabdovirus.

CLAST: CUDA implemented large-scale alignment search tool.

PubMed

Yano, Masahiro; Mori, Hiroshi; Akiyama, Yutaka; Yamada, Takuji; Kurokawa, Ken

2014-12-11

Metagenomics is a powerful methodology to study microbial communities, but it is highly dependent on nucleotide sequence similarity searching against sequence databases. Metagenomic analyses with next-generation sequencing technologies produce enormous numbers of reads from microbial communities, and many reads are derived from microbes whose genomes have not yet been sequenced, limiting the usefulness of existing sequence similarity search tools. Therefore, there is a clear need for a sequence similarity search tool that can rapidly detect weak similarity in large datasets. We developed a tool, which we named CLAST (CUDA implemented large-scale alignment search tool), that enables analyses of millions of reads and thousands of reference genome sequences, and runs on NVIDIA Fermi architecture graphics processing units. CLAST has four main advantages over existing alignment tools. First, CLAST was capable of identifying sequence similarities ~80.8 times faster than BLAST and 9.6 times faster than BLAT. Second, CLAST executes global alignment as the default (local alignment is also an option), enabling CLAST to assign reads to taxonomic and functional groups based on evolutionarily distant nucleotide sequences with high accuracy. Third, CLAST does not need a preprocessed sequence database like Burrows-Wheeler Transform-based tools, and this enables CLAST to incorporate large, frequently updated sequence databases. Fourth, CLAST requires <2 GB of main memory, making it possible to run CLAST on a standard desktop computer or server node. CLAST achieved very high speed (similar to the Burrows-Wheeler Transform-based Bowtie 2 for long reads) and sensitivity (equal to BLAST, BLAT, and FR-HIT) without the need for extensive database preprocessing or a specialized computing platform. Our results demonstrate that CLAST has the potential to be one of the most powerful and realistic approaches to analyze the massive amount of sequence data from next-generation sequencing technologies.

Normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1997-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1997-06-10

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion.

PubMed

Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris

2005-12-01

Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

Tziminema unachi n. gen., n. sp. (Nematoda: Strongylidae: Strongylinae) parasite of Baird's tapir Tapirus bairdii from Mexico.

PubMed

Güiris-Andrade, D M; Oceguera-Figueroa, A; Osorio-Sarabia, D; Pérez-Escobar, M E; Nieto-López, M G; Rojas-Hernández, N M; García-Prieto, L

2017-11-20

A new genus and species of nematode, Tziminema unachi n. gen., n. sp. is described from the caecum and colon of Baird's tapir Tapirus bairdii (Gill, 1865), found dead in the Reserva de la Biósfera El Triunfo, Chiapas State, in the Neotropical realm of Mexico. Tziminema n. gen. differs from the other nine genera included in the Strongylinae by two main characteristics: having 7-9 posteriorly directed tooth-like structures at the anterior end of the buccal capsule, and the external surface of the buccal capsule being heavily striated. Phylogenetic analyses of the DNA sequences of the mitochondrial cytochrome c oxidase and nuclear DNA, including a partial sequence of the internal transcribed spacer 1, 5.8S and a partial sequence of the internal transcribed spacer 2 of the new taxon, confirmed its inclusion in Strongylinae and its rank as a new genus.

A double-labeling procedure for sequence analysis of picomole amounts of nonradioactive RNA fragments.

PubMed Central

Gupta, R C; Randerath, E; Randerath, K

1976-01-01

A double-labeling procedure for sequence analysis of nonradioactive polyribonucleotides is detailed, which is based on controlled endonucleolytic degradation of 3'-terminally (3H)-labeled oligonucleotide-(3') dialcohols and 5"-terminal analysis of the partial (3H)-labeled fragments following their separation according to chain length by polyethyleneimine- (PEI-)cellulose TLC and detection by fluorography. Undesired nonradioactive partial digestion products are eliminated by periodate oxidation. The 5'-termini are assayed by enzymic incorporation of (32p)-label into the isolated fragments, enzymic release of (32p)-labeled nucleoside-(5') monophosphates, two-dimensional PEI-cellulose chromatography, and autoradiography. Using this procedure, as little as 0.1 - 0.3 A260 unit of tRNA is needed to sequence all fragments in complete ribonuclease T1 and A digests, whereas radioactive derivative methods previously described by us1-4 required 4 - 6 A260 units. Images PMID:826884

Initial Detection and Molecular Characterization of Namaycush Herpesvirus (Salmonid Herpesvirus 5) in Lake Trout.

PubMed

Glenney, Gavin W; Barbash, Patricia A; Coll, John A

2016-03-01

A novel herpesvirus was found by molecular methods in samples of Lake Trout Salvelinus namaycush from Lake Erie, Pennsylvania, and Lake Ontario, Keuka Lake, and Lake Otsego, New York. Based on PCR amplification and partial sequencing of polymerase, terminase, and glycoprotein genes, a number of isolates were identified as a novel virus, which we have named Namaycush herpesvirus (NamHV) salmonid herpesvirus 5 (SalHV5). Phylogenetic analyses of three NamHV genes indicated strong clustering with other members of the genus Salmonivirus, placing these isolates into family Alloherpesviridae. The NamHV isolates were identical in the three partially sequenced genes; however, they varied from other salmonid herpesviruses in nucleotide sequence identity. In all three of the genes sequenced, NamHV shared the highest sequence identity with Atlantic Salmon papillomatosis virus (ASPV; SalHV4) isolated from Atlantic Salmon Salmo salar in northern Europe, including northwestern Russia. These results lead one to believe that NamHV and ASPV have a common ancestor that may have made a relatively recent host jump from Atlantic Salmon to Lake Trout or vice versa. Partial nucleotide sequence comparisons between NamHV and ASPV for the polymerase and glycoprotein genes differ by >5% and >10%, respectively. Additional nucleotide sequence comparisons between NamHV and epizootic epitheliotropic disease virus (EEDV/SalHV3) in the terminase, glycoprotein, and polymerase genes differ by >5%, >20%, and >10%, respectively. Thus, NamHV and EEDV may be occupying discrete ecological niches in Lake Trout. Even though NamHV shared the highest genetic identity with ASPV, each of these viruses has a separate host species, which also implies speciation. Additionally, NamHV has been detected over the last 4 years in four separate water bodies across two states, which suggests that NamHV is a distinct, naturally replicating lineage. This, in combination with a divergence in nucleotide sequence from EEDV, indicates that NamHV is a new species in the genus Salmonivirus. Received April 20, 2015; accepted October 11, 2015.

An improved model for whole genome phylogenetic analysis by Fourier transform.

PubMed

Yin, Changchuan; Yau, Stephen S-T

2015-10-07

DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

SIMAP—the database of all-against-all protein sequence similarities and annotations with new interfaces and increased coverage

PubMed Central

Arnold, Roland; Goldenberg, Florian; Mewes, Hans-Werner; Rattei, Thomas

2014-01-01

The Similarity Matrix of Proteins (SIMAP, http://mips.gsf.de/simap/) database has been designed to massively accelerate computationally expensive protein sequence analysis tasks in bioinformatics. It provides pre-calculated sequence similarities interconnecting the entire known protein sequence universe, complemented by pre-calculated protein features and domains, similarity clusters and functional annotations. SIMAP covers all major public protein databases as well as many consistently re-annotated metagenomes from different repositories. As of September 2013, SIMAP contains >163 million proteins corresponding to ∼70 million non-redundant sequences. SIMAP uses the sensitive FASTA search heuristics, the Smith–Waterman alignment algorithm, the InterPro database of protein domain models and the BLAST2GO functional annotation algorithm. SIMAP assists biologists by facilitating the interactive exploration of the protein sequence universe. Web-Service and DAS interfaces allow connecting SIMAP with any other bioinformatic tool and resource. All-against-all protein sequence similarity matrices of project-specific protein collections are generated on request. Recent improvements allow SIMAP to cover the rapidly growing sequenced protein sequence universe. New Web-Service interfaces enhance the connectivity of SIMAP. Novel tools for interactive extraction of protein similarity networks have been added. Open access to SIMAP is provided through the web portal; the portal also contains instructions and links for software access and flat file downloads. PMID:24165881

Evaluation of next generation mtGenome sequencing using the Ion Torrent Personal Genome Machine (PGM)☆

PubMed Central

Parson, Walther; Strobl, Christina; Huber, Gabriela; Zimmermann, Bettina; Gomes, Sibylle M.; Souto, Luis; Fendt, Liane; Delport, Rhena; Langit, Reina; Wootton, Sharon; Lagacé, Robert; Irwin, Jodi

2013-01-01

Insights into the human mitochondrial phylogeny have been primarily achieved by sequencing full mitochondrial genomes (mtGenomes). In forensic genetics (partial) mtGenome information can be used to assign haplotypes to their phylogenetic backgrounds, which may, in turn, have characteristic geographic distributions that would offer useful information in a forensic case. In addition and perhaps even more relevant in the forensic context, haplogroup-specific patterns of mutations form the basis for quality control of mtDNA sequences. The current method for establishing (partial) mtDNA haplotypes is Sanger-type sequencing (STS), which is laborious, time-consuming, and expensive. With the emergence of Next Generation Sequencing (NGS) technologies, the body of available mtDNA data can potentially be extended much more quickly and cost-efficiently. Customized chemistries, laboratory workflows and data analysis packages could support the community and increase the utility of mtDNA analysis in forensics. We have evaluated the performance of mtGenome sequencing using the Personal Genome Machine (PGM) and compared the resulting haplotypes directly with conventional Sanger-type sequencing. A total of 64 mtGenomes (>1 million bases) were established that yielded high concordance with the corresponding STS haplotypes (<0.02% differences). About two-thirds of the differences were observed in or around homopolymeric sequence stretches. In addition, the sequence alignment algorithm employed to align NGS reads played a significant role in the analysis of the data and the resulting mtDNA haplotypes. Further development of alignment software would be desirable to facilitate the application of NGS in mtDNA forensic genetics. PMID:23948325

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov.

PubMed Central

Doroghazi, J. R.; Ju, K.-S.; Metcalf, W. W.

2014-01-01

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with five other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these other species, including Streptomyces almquistii NRRL B-1685T, Streptomyces flocculus NRRL B-2465T, Streptomyces gibsonii NRRL B-1335T and Streptomyces rangoonensis NRRL B-12378T are quite similar. This cluster is of particular taxonomic interest because Streptomyces albus is the type species of the genus Streptomyces. The related strains were subjected to multilocus sequence analysis (MLSA) utilizing partial sequences of the housekeeping genes atpD, gyrB, recA, rpoB and trpB and confirmation of previously reported phenotypic characteristics. The five strains formed a coherent cluster supported by a 100 % bootstrap value in phylogenetic trees generated from sequence alignments prepared by concatenating the sequences of the housekeeping genes, and identical tree topology was observed using various different tree-making algorithms. Moreover, all but one strain, S. flocculus NRRL B-2465T, exhibited identical sequences for all of the five housekeeping gene loci sequenced, but NRRL B-2465T still exhibited an MLSA evolutionary distance of 0.005 from the other strains, a value that is lower than the 0.007 MLSA evolutionary distance threshold proposed for species-level relatedness. These data support a proposal to reclassify S. almquistii, S. flocculus, S. gibsonii and S. rangoonensis as later heterotypic synonyms of S. albus with NRRL B-1811T as the type strain. The MLSA sequence database also demonstrated utility for quickly and conclusively confirming that numerous strains within the ARS Culture Collection had been previously misidentified as subspecies of S. albus and that Streptomyces albus subsp. pathocidicus should be redescribed as a novel species, Streptomyces pathocidini sp. nov., with the type strain NRRL B-24287T. PMID:24277863

Characterization of perch rhabdovirus (PRV) in farmed grayling Thymallus thymallus.

PubMed

Gadd, Tuija; Viljamaa-Dirks, Satu; Holopainen, Riikka; Koski, Perttu; Jakava-Viljanen, Miia

2013-10-11

Two Finnish fish farms experienced elevated mortality rates in farmed grayling Thymallus thymallus fry during the summer months, most typically in July. The mortalities occurred during several years and were connected with a few neurological disorders and peritonitis. Virological investigation detected an infection with an unknown rhabdovirus. Based on the entire glycoprotein (G) and partial RNA polymerase (L) gene sequences, the virus was classified as a perch rhabdovirus (PRV). Pairwise comparisons of the G and L gene regions of grayling isolates revealed that all isolates were very closely related, with 99 to 100% nucleotide identity, which suggests the same origin of infection. Phylogenetic analysis demonstrated that they were closely related to the strain isolated from perch Perca fluviatilis and sea trout Salmo trutta trutta caught from the Baltic Sea. The entire G gene sequences revealed that all Finnish grayling isolates, and both the perch and sea trout isolates, were most closely related to a PRV isolated in France in 2004. According to the partial L gene sequences, all of the Finnish grayling isolates were most closely related to the Danish isolate DK5533 from pike. The genetic analysis of entire G gene and partial L gene sequences showed that the Finnish brown trout isolate ka907_87 shared only approximately 67 and 78% identity, respectively, with our grayling isolates. The grayling isolates were also analysed by an immunofluorescence antibody test. This is the first report of a PRV causing disease in grayling in Finland.

Molecular characterization of Echinococcus granulosus isolates from Bulgarian human cystic echinococcosis patients.

PubMed

Marinova, Irina; Spiliotis, Markus; Wang, Junhua; Muhtarov, Marin; Chaligiannis, Ilias; Sotiraki, Smaro; Rainova, Iskra; Gottstein, Bruno; Boubaker, Ghalia

2017-03-01

Although cystic echinococcosis (CE) is highly endemic in Bulgaria, there is still scarce information about species and/or genotypes of the Echinococcus granulosus complex that infect humans. Our study tackled the genetic diversity of E. granulosus complex in a cohort of 30 Bulgarian CE patients. Ten animal E. granulosus isolates from neighboring Greece were additionally included. Specimens were comparatively analyzed for partial sequences of five mitochondrial (mt) (cox I, nad I, rrnS, rrnL, and atp6) and three nuclear (nc) genes (act II, hbx 2, and ef-1α) using a PCR-sequencing approach. All 30 Bulgarian isolates were identified as E. granulosus sensu stricto (s.s.) and were showing identical sequences for each of the three examined partial nc gene markers. Based upon concatenated sequences from partial mtDNA markers, we detected 10 haplotypes: 6 haplotypes (H1-H6) clustering with E. granulosus s.s. (G1) and 4 haplotypes (H9-H13) grouping with E. granulosus s.s. (G3), with H1 and H10 being the most frequent in Bulgarian patients. The haplotypes H1, H4, and H11 were also present in Greek hydatid cyst samples of animal origin. In conclusion, E. granulosus s.s. (G1 and G3 genotypes) is the only causative agent found so far to cause human CE in Bulgaria. However, further studies including larger sample sizes and other additional geographic regions in Bulgaria will have to be performed to confirm our results.

Biologically inspired EM image alignment and neural reconstruction.

PubMed

Knowles-Barley, Seymour; Butcher, Nancy J; Meinertzhagen, Ian A; Armstrong, J Douglas

2011-08-15

Three-dimensional reconstruction of consecutive serial-section transmission electron microscopy (ssTEM) images of neural tissue currently requires many hours of manual tracing and annotation. Several computational techniques have already been applied to ssTEM images to facilitate 3D reconstruction and ease this burden. Here, we present an alternative computational approach for ssTEM image analysis. We have used biologically inspired receptive fields as a basis for a ridge detection algorithm to identify cell membranes, synaptic contacts and mitochondria. Detected line segments are used to improve alignment between consecutive images and we have joined small segments of membrane into cell surfaces using a dynamic programming algorithm similar to the Needleman-Wunsch and Smith-Waterman DNA sequence alignment procedures. A shortest path-based approach has been used to close edges and achieve image segmentation. Partial reconstructions were automatically generated and used as a basis for semi-automatic reconstruction of neural tissue. The accuracy of partial reconstructions was evaluated and 96% of membrane could be identified at the cost of 13% false positive detections. An open-source reference implementation is available in the Supplementary information. seymour.kb@ed.ac.uk; douglas.armstrong@ed.ac.uk Supplementary data are available at Bioinformatics online.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ion, A.; Telvi, L.; Galacteros, F.

We describe a pedigree presenting X-linked severe mental retardation associated with multiple congenital abnormalities and 46,XY gonadal dysgenesis, leading in one family member to female gender assignment. Female carriers are unaffected. The dysmorphic features are similar to those described in the {alpha}-thalassemia and mental retardation (ATR-X) syndrome, although there is no clinical evidence of {alpha}-thalassemia in this family. In addition, the family had other clinical features not previously observed in the ATR-X syndrome, including partial optic-nerve atrophy and partial ocular albinism. Mutations in a putative DNA helicase, termed XH2, have been reported to give rise to the ATR-X syndrome. Wemore » screened the YCH2 gene for mutations in affected members of the family and identified a 4-bp deletion at an intron/exon boundary that removes an invariant 3{prime} splice-acceptor site. The mutation cosegregates with the syndrome. The genomic deletion causes missplicing of the pre-mRNA, which results in the loss of 8 bp of coding sequence, thereby generating a frameshift and a downstream premature stop codon. Our finding increases the range of clinical features associated with mutations in the XH2 gene. 17 refs., 4 figs., 2 tabs.« less

The effect of letter string length and report condition on letter recognition accuracy.

PubMed

Raghunandan, Avesh; Karmazinaite, Berta; Rossow, Andrea S

Letter sequence recognition accuracy has been postulated to be limited primarily by low-level visual factors. The influence of high level factors such as visual memory (load and decay) has been largely overlooked. This study provides insight into the role of these factors by investigating the interaction between letter sequence recognition accuracy, letter string length and report condition. Letter sequence recognition accuracy for trigrams and pentagrams were measured in 10 adult subjects for two report conditions. In the complete report condition subjects reported all 3 or all 5 letters comprising trigrams and pentagrams, respectively. In the partial report condition, subjects reported only a single letter in the trigram or pentagram. Letters were presented for 100ms and rendered in high contrast, using black lowercase Courier font that subtended 0.4° at the fixation distance of 0.57m. Letter sequence recognition accuracy was consistently higher for trigrams compared to pentagrams especially for letter positions away from fixation. While partial report increased recognition accuracy in both string length conditions, the effect was larger for pentagrams, and most evident for the final letter positions within trigrams and pentagrams. The effect of partial report on recognition accuracy for the final letter positions increased as eccentricity increased away from fixation, and was independent of the inner/outer position of a letter. Higher-level visual memory functions (memory load and decay) play a role in letter sequence recognition accuracy. There is also suggestion of additional delays imposed on memory encoding by crowded letter elements. Copyright © 2016 Spanish General Council of Optometry. Published by Elsevier España, S.L.U. All rights reserved.

Draft genome sequences of 1 MSSA and 7 MRSA ST5 isolates obtained from California

USDA-ARS?s Scientific Manuscript database

Staphylococcus aureus is a commensal of humans that can cause a spectrum of diseases. An isolate’s capacity to cause disease is partially attributed to the acquisition of novel mobile genetic elements. This report provides the draft genome sequence of one methicillin susceptible and seven methicilli...

Thermal and acid tolerant beta-xylosidases, genes encoding, related organisms, and methods

DOEpatents

Thompson, David N [Idaho Falls, ID; Thompson, Vicki S [Idaho Falls, ID; Schaller, Kastli D [Ammon, ID; Apel, William A [Jackson, WY; Lacey, Jeffrey A [Idaho Falls, ID; Reed, David W [Idaho Falls, ID

2011-04-12

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose and/or xylobiose using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

Genetic variation and biological activity of isolates of lymantria dispar multiple nucleopolyhedrovirus from north america, europe, and asia

USDA-ARS?s Scientific Manuscript database

Little is known about genetic variation of Lymantria dispar multiple nucleopolyhedrovirus (LdMNPV; Baculoviridae: Alphabaculovirus) at the nucleotide sequence level. To obtain a more comprehensive view of genetic diversity among isolates of LdMNPV, partial sequences of the lef-8 gene were generated...

Distribution, genetic diversity and recombination analysis of Citrus tristeza virus of India

USDA-ARS?s Scientific Manuscript database

Citrus tristeza virus (CTV) isolates representing all the citrus growing geographical zones of India were analyzed for sequence of the 5'ORF1a fragments of the partial LProI domain and for the coat protein (CP) gene. The sequences were compared with previously reported Indian and CTV genotypes from...

Hepatitis E virus genotype 3 diversity: phylogenetic analysis and presence of subtype 3b in wild boar in Europe.

PubMed

Vina-Rodriguez, Ariel; Schlosser, Josephine; Becher, Dietmar; Kaden, Volker; Groschup, Martin H; Eiden, Martin

2015-05-22

An increasing number of indigenous cases of hepatitis E caused by genotype 3 viruses (HEV-3) have been diagnosed all around the word, particularly in industrialized countries. Hepatitis E is a zoonotic disease and accumulating evidence indicates that domestic pigs and wild boars are the main reservoirs of HEV-3. A detailed analysis of HEV-3 subtypes could help to determine the interplay of human activity, the role of animals as reservoirs and cross species transmission. Although complete genome sequences are most appropriate for HEV subtype determination, in most cases only partial genomic sequences are available. We therefore carried out a subtype classification analysis, which uses regions from all three open reading frames of the genome. Using this approach, more than 1000 published HEV-3 isolates were subtyped. Newly recovered HEV partial sequences from hunted German wild boars were also included in this study. These sequences were assigned to genotype 3 and clustered within subtype 3a, 3i and, unexpectedly, one of them within the subtype 3b, a first non-human report of this subtype in Europe.

Direct identification of non-polio enteroviruses in residual paralysis cases by analysis of VP1 sequences.

PubMed

Rahimi, Pooneh; Tabatabaie, H; Gouya, Mohammad M; Mahmudi, M; Musavi, T; Rad, K Samimi; Azad, T Mokhtari; Nategh, R

2009-06-01

The 66 serotypes of human enteroviruses (EVs) are classified into four species A-D, based on phylogenetic relationships in multiple genome regions. Partial VP(1) amplification and sequence analysis are reliable methods for identifying non-polio enterovirus serotypes, especially in negative cell culture specimens from patients with residual paralysis. In Iran during the years 2000-2002, there were 29 residual paralysis cases with negative cell (RD, HEp(2) and L(20)B) culture results. The genomic RNA was extracted from stool specimens from cases of residual paralysis and detected by amplification of the 5'-nontranslated region using RT-PCR with Pan-EV primers. Partial VP(1) amplification by semi-nested RT-PCR (snRT-PCR) and sequence analysis were done. Specimens from the 29 culture-negative cases contained echoviruses of six different serotypes. The global eradication of wild polioviruses is near and study of non-polio enteroviruses, which can cause poliomyelitis, is increasingly important to understand their pathogenesis. The VP(1) sequences, derived from the snRT-PCR products, allowed rapid molecular analysis of these non-polio strains.

Subtracting the sequence bias from partially digested MNase-seq data reveals a general contribution of TFIIS to nucleosome positioning.

PubMed

Gutiérrez, Gabriel; Millán-Zambrano, Gonzalo; Medina, Daniel A; Jordán-Pla, Antonio; Pérez-Ortín, José E; Peñate, Xenia; Chávez, Sebastián

2017-12-07

TFIIS stimulates RNA cleavage by RNA polymerase II and promotes the resolution of backtracking events. TFIIS acts in the chromatin context, but its contribution to the chromatin landscape has not yet been investigated. Co-transcriptional chromatin alterations include subtle changes in nucleosome positioning, like those expected to be elicited by TFIIS, which are elusive to detect. The most popular method to map nucleosomes involves intensive chromatin digestion by micrococcal nuclease (MNase). Maps based on these exhaustively digested samples miss any MNase-sensitive nucleosomes caused by transcription. In contrast, partial digestion approaches preserve such nucleosomes, but introduce noise due to MNase sequence preferences. A systematic way of correcting this bias for massively parallel sequencing experiments is still missing. To investigate the contribution of TFIIS to the chromatin landscape, we developed a refined nucleosome-mapping method in Saccharomyces cerevisiae. Based on partial MNase digestion and a sequence-bias correction derived from naked DNA cleavage, the refined method efficiently mapped nucleosomes in promoter regions rich in MNase-sensitive structures. The naked DNA correction was also important for mapping gene body nucleosomes, particularly in those genes whose core promoters contain a canonical TATA element. With this improved method, we analyzed the global nucleosomal changes caused by lack of TFIIS. We detected a general increase in nucleosomal fuzziness and more restricted changes in nucleosome occupancy, which concentrated in some gene categories. The TATA-containing genes were preferentially associated with decreased occupancy in gene bodies, whereas the TATA-like genes did so with increased fuzziness. The detected chromatin alterations correlated with functional defects in nascent transcription, as revealed by genomic run-on experiments. The combination of partial MNase digestion and naked DNA correction of the sequence bias is a precise nucleosomal mapping method that does not exclude MNase-sensitive nucleosomes. This method is useful for detecting subtle alterations in nucleosome positioning produced by lack of TFIIS. Their analysis revealed that TFIIS generally contributed to nucleosome positioning in both gene promoters and bodies. The independent effect of lack of TFIIS on nucleosome occupancy and fuzziness supports the existence of alternative chromatin dynamics during transcription elongation.

Complete genome sequences of two divergent isolates of strawberry crinkle virus coinfecting a single strawberry plant.

PubMed

Koloniuk, Igor; Fránová, Jana; Sarkisova, Tatiana; Přibylová, Jaroslava

2018-05-04

Strawberry crinkle disease is one of the major diseases that threatens strawberry production. Although the biological properties of the agent, strawberry crinkle virus (SCV), have been thoroughly investigated, its complete genome sequence has never been published. Existing RT-PCR-based detection relies on a partial sequence of the L protein gene, presumably the least expressed viral gene. Here, we present complete sequences of two divergent SCV isolates co-infecting a single plant, Fragaria x ananassa cv. Čačanská raná.

Phylogenetic analysis of Sicilian goats reveals a new mtDNA lineage.

PubMed

Sardina, M T; Ballester, M; Marmi, J; Finocchiaro, R; van Kaam, J B C H M; Portolano, B; Folch, J M

2006-08-01

The mitochondrial hypervariable region 1 (HVR1) sequence of 67 goats belonging to the Girgentana, Maltese and Derivata di Siria breeds was partially sequenced in order to present the first phylogenetic characterization of Sicilian goat breeds. These sequences were compared with published sequences of Indian and Pakistani domestic goats and wild goats. Mitochondrial lineage A was observed in most of the Sicilian goats. However, three Girgentana haplotypes were highly divergent from the Capra hircus clade, indicating that a new mtDNA lineage in domestic goats was found.

Structure, organization and expression of common carp (Cyprinus carpio L.) SLP-76 gene.

PubMed

Huang, Rong; Sun, Xiao-Feng; Hu, Wei; Wang, Ya-Ping; Guo, Qiong-Lin

2008-05-01

SLP-76 is an important member of the SLP-76 family of adapters, and it plays a key role in TCR signaling and T cell function. Partial cDNA sequence of SLP-76 of common carp (Cyprinus carpio L.) was isolated from thymus cDNA library by the method of suppression subtractive hybridization (SSH). Subsequently, the full length cDNA of carp SLP-76 was obtained by means of 3' RACE and 5' RACE, respectively. The full length cDNA of carp SLP-76 was 2007 bp, consisting of a 5'-terminal untranslated region (UTR) of 285 bp, a 3'-terminal UTR of 240 bp, and an open reading frame of 1482 bp. Sequence comparison showed that the deduced amino acid sequence of carp SLP-76 had an overall similarity of 34-73% to that of other species homologues, and it was composed of an NH2-terminal domain, a central proline-rich domain, and a C-terminal SH2 domain. Amino acid sequence analysis indicated the existence of a Gads binding site R-X-X-K, a 10-aa-long sequence which binds to the SH3 domain of LCK in vitro, and three conserved tyrosine-containing sequence in the NH2-terminal domain. Then we used PCR to obtain a genomic DNA which covers the entire coding region of carp SLP-76. In the 9.2k-long genomic sequence, twenty one exons and twenty introns were identified. RT-PCR results showed that carp SLP-76 was expressed predominantly in hematopoietic tissues, and was upregulated in thymus tissue of four-month carp compared to one-year old carp. RT-PCR and virtual northern hybridization results showed that carp SLP-76 was also upregulated in thymus tissue of GH transgenic carp at the age of four-months. These results suggest that the expression level of SLP-76 gene may be related to thymocyte development in teleosts.

Prevalence and genetic characterization of eimeriid coccidia from feces of black-necked cranes, Grus nigricollis.

PubMed

Liang, Yu; Zhao, ZiJiao; Hu, JunJie; Esch, Gerald W; Peng, MingChun; Liu, Qiong; Chen, JinQing

2018-03-01

Disseminated visceral coccidiosis (DVC) is a widely distributed intestinal and extraintestinal disease of cranes caused by eimeriid coccidia and has lethal pathogenicity to several crane species. Here, feces of 164 black-necked cranes collected in Dashanbao Black-necked Crane National Nature Reserve, China, were examined to determine the prevalence of coccidial oocysts. Of the 164 fecal samples, 76 (46.3%) were positive for oocysts of Eimeria, including E. gruis in 59 (35.9%), E. reichenowi in 52 (31.7%), and E. bosquei in 47 (28.7%) by microscopic observation. Sixty-eight (89.5%) of these positive samples included two or more morphologically identifiable species of Eimeria. The nearly full length 18S rRNA gene (18S rRNA; about 1.8 kb) and partial mitochondrial cytochrome c oxidase I gene (COX1; about 1.3 kb) from oocysts of each morphologically distinct species of Eimeria were amplified, sequenced, and analyzed. BLAST searches using these new 18S rRNA sequences for E. gruis, E. reichenowi, or E. bosquei showed the most similar sequences were those of E. gruis (98.7-99.7% identity), E. reichenowi (97.9-100% identity), or E. gruis (98.6-99.6% identity) isolated from different species of Grus. BLAST searches using the new COX1 sequences for the three species of Eimeria showed that no nucleotide sequences of Eimeria and Isospora coccidia in GenBank have more than 83.0% identity with these species. Identities among the new COX1 sequences were 91.8% for E. gruis and E. reichenowi, 94.5% for E. gruis and E. bosquei, and 91.3% for E. reichenowi and E. bosquei. Phylogenetic analysis based on 18S rRNA or COX1 sequences indicated that Eimeria spp. in black-necked cranes were clustered together with other previously identified Eimeria species from different cranes.

Clarification of the Concept of Ganoderma orbiforme with High Morphological Plasticity

PubMed Central

Wang, Dong-Mei; Wu, Sheng-Hua; Yao, Yi-Jian

2014-01-01

Ganoderma has been considered a very difficult genus among the polypores to classify and is currently in a state of taxonomic chaos. In a study of Ganoderma collections including numerous type specimens, we found that six species namely G. cupreum, G. densizonatum, G. limushanense, G. mastoporum, G. orbiforme, G. subtornatum, and records of G. fornicatum from Mainland China and Taiwan are very similar to one another in basidiocarp texture, pilear cuticle structure, context color, pore color and basidiospore characteristics. Further, we sequenced the nrDNA ITS region (ITS1 and ITS2) and partial mtDNA SSU region of the studied materials, and performed phylogenetic analyses based on these sequence data. The nrDNA ITS sequence analysis results show that the eight nrDNA ITS sequences derived from this study have single-nucleotide polymorphisms in ITS1 and/or ITS2 at inter- and intra-individual levels. In the nrDNA ITS phylogenetic trees, all the sequences from this study are grouped together with those of G. cupreum and G. mastoporum retrieved from GenBank to form a distinct clade. The mtDNA SSU sequence analysis results reveal that the five mtDNA SSU sequences derived from this study are clustered together with those of G. cupreum retrieved from GenBank and also form a distinct clade in the mtDNA SSU phylogenetic trees. Based on morphological and molecular data, we conclude that the studied taxa are conspecific. Among the names assigned to this species, G. fornicatum given to Asian collections has nomenclatural priority over the others. However, the type of G. fornicatum from Brazil is probably lost and a modern description based on the type lacks. The identification of the Asian collections to G. fornicatum therefore cannot be confirmed. To the best of our knowledge, G. orbiforme is the earliest valid name for use. PMID:24875218

First insight into the viral community of the cnidarian model metaorganism Aiptasia using RNA-Seq data

PubMed Central

Brüwer, Jan D.

2018-01-01

Current research posits that all multicellular organisms live in symbioses with associated microorganisms and form so-called metaorganisms or holobionts. Cnidarian metaorganisms are of specific interest given that stony corals provide the foundation of the globally threatened coral reef ecosystems. To gain first insight into viruses associated with the coral model system Aiptasia (sensu Exaiptasia pallida), we analyzed an existing RNA-Seq dataset of aposymbiotic, partially populated, and fully symbiotic Aiptasia CC7 anemones with Symbiodinium. Our approach included the selective removal of anemone host and algal endosymbiont sequences and subsequent microbial sequence annotation. Of a total of 297 million raw sequence reads, 8.6 million (∼3%) remained after host and endosymbiont sequence removal. Of these, 3,293 sequences could be assigned as of viral origin. Taxonomic annotation of these sequences suggests that Aiptasia is associated with a diverse viral community, comprising 116 viral taxa covering 40 families. The viral assemblage was dominated by viruses from the families Herpesviridae (12.00%), Partitiviridae (9.93%), and Picornaviridae (9.87%). Despite an overall stable viral assemblage, we found that some viral taxa exhibited significant changes in their relative abundance when Aiptasia engaged in a symbiotic relationship with Symbiodinium. Elucidation of viral taxa consistently present across all conditions revealed a core virome of 15 viral taxa from 11 viral families, encompassing many viruses previously reported as members of coral viromes. Despite the non-random selection of viral genetic material due to the nature of the sequencing data analyzed, our study provides a first insight into the viral community associated with Aiptasia. Similarities of the Aiptasia viral community with those of corals corroborate the application of Aiptasia as a model system to study coral holobionts. Further, the change in abundance of certain viral taxa across different symbiotic states suggests a role of viruses in the algal endosymbiosis, but the functional significance of this remains to be determined. PMID:29507840

A Deep-Coverage Tomato BAC Library and Prospects Toward Development of an STC Framework for Genome Sequencing

PubMed Central

Budiman, Muhammad A.; Mao, Long; Wood, Todd C.; Wing, Rod A.

2000-01-01

Recently a new strategy using BAC end sequences as sequence-tagged connectors (STCs) was proposed for whole-genome sequencing projects. In this study, we present the construction and detailed characterization of a 15.0 haploid genome equivalent BAC library for the cultivated tomato, Lycopersicon esculentum cv. Heinz 1706. The library contains 129,024 clones with an average insert size of 117.5 kb and a chloroplast content of 1.11%. BAC end sequences from 1490 ends were generated and analyzed as a preliminary evaluation for using this library to develop an STC framework to sequence the tomato genome. A total of 1205 BAC end sequences (80.9%) were obtained, with an average length of 360 high-quality bases, and were searched against the GenBank database. Using a cutoff expectation value of <10−6, and combining the results from BLASTN, BLASTX, and TBLASTX searches, 24.3% of the BAC end sequences were similar to known sequences, of which almost half (48.7%) share sequence similarities to retrotransposons and 7% to known genes. Some of the transposable element sequences were the first reported in tomato, such as sequences similar to maize transposon Activator (Ac) ORF and tobacco pararetrovirus-like sequences. Interestingly, there were no BAC end sequences similar to the highly repeated TGRI and TGRII elements. However, the majority (70.3%) of STCs did not share significant sequence similarities to any sequences in GenBank at either the DNA or predicted protein levels, indicating that a large portion of the tomato genome is still unknown. Our data demonstrate that this BAC library is suitable for developing an STC database to sequence the tomato genome. The advantages of developing an STC framework for whole-genome sequencing of tomato are discussed. [The BAC end sequences described in this paper have been deposited in the GenBank data library under accession nos. AQ367111–AQ368361.] PMID:10645957

Quality assessment of protein model-structures based on structural and functional similarities.

PubMed

Konopka, Bogumil M; Nebel, Jean-Christophe; Kotulska, Malgorzata

2012-09-21

Experimental determination of protein 3D structures is expensive, time consuming and sometimes impossible. A gap between number of protein structures deposited in the World Wide Protein Data Bank and the number of sequenced proteins constantly broadens. Computational modeling is deemed to be one of the ways to deal with the problem. Although protein 3D structure prediction is a difficult task, many tools are available. These tools can model it from a sequence or partial structural information, e.g. contact maps. Consequently, biologists have the ability to generate automatically a putative 3D structure model of any protein. However, the main issue becomes evaluation of the model quality, which is one of the most important challenges of structural biology. GOBA--Gene Ontology-Based Assessment is a novel Protein Model Quality Assessment Program. It estimates the compatibility between a model-structure and its expected function. GOBA is based on the assumption that a high quality model is expected to be structurally similar to proteins functionally similar to the prediction target. Whereas DALI is used to measure structure similarity, protein functional similarity is quantified using standardized and hierarchical description of proteins provided by Gene Ontology combined with Wang's algorithm for calculating semantic similarity. Two approaches are proposed to express the quality of protein model-structures. One is a single model quality assessment method, the other is its modification, which provides a relative measure of model quality. Exhaustive evaluation is performed on data sets of model-structures submitted to the CASP8 and CASP9 contests. The validation shows that the method is able to discriminate between good and bad model-structures. The best of tested GOBA scores achieved 0.74 and 0.8 as a mean Pearson correlation to the observed quality of models in our CASP8 and CASP9-based validation sets. GOBA also obtained the best result for two targets of CASP8, and one of CASP9, compared to the contest participants. Consequently, GOBA offers a novel single model quality assessment program that addresses the practical needs of biologists. In conjunction with other Model Quality Assessment Programs (MQAPs), it would prove useful for the evaluation of single protein models.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

The Effects of Within-Sequence Acoustic Similarity on the Short-Term Retention of Consonants and Words

ERIC Educational Resources Information Center

Marcer, D.; And Others

1977-01-01

Compares the rates of forgetting of five-item sequences of acoustically similar and dissimilar consonants and words in the absence of proactive and retroactive interference in order to test whether within sequence similarity rather than stimulus length would have a greater influence on retention. (Author/RK)